National Library of Energy BETA

Sample records for avaya ip office

  1. T-648: Avaya IP Office Manager TFTP Server Lets Remote Users Traverse the Directory

    Broader source: Energy.gov [DOE]

    The software does not properly validate user-supplied input. A remote user can supply a specially crafted request to view files on target system running the IP Office Manager software.

  2. Effective Project Management Office Processes and Technology Transfer: Implementation of an Avaya Voice Over Internet Protocol Telephony System in Mexico

    E-Print Network [OSTI]

    Perez, Mary Louise

    2012-08-31

    Management Institute, Inc. (PMI) to implement Information Technology (IT) projects and to transfer technology know how knowledge to its subsidiary in Mexico. To answer this question, an assessment of Cisco and Avaya VoIP telephony systems was completed...

  3. RESEARCH & INNOVATION OFFICE EASY ACCESS IP

    E-Print Network [OSTI]

    University of Technology, Sydney

    RESEARCH & INNOVATION OFFICE EASY ACCESS IP AN INTRODUCTION FOR INDUSTRY PARTNERS FEBRUARY 2014 #12 to provide industry with greater opportunity and incentive to develop products and services that will lead regardless of how successful the end product is You gain easy access to cutting edge science, technology

  4. Income Protection (IP) Insurance 

    E-Print Network [OSTI]

    Stokes, Kenneth; Barnaby, G. A. Art; Waller, Mark L.; Outlaw, Joe

    1999-06-09

    Kenneth Stokes, G.A. ?Art? Barnaby, Mark Waller and Joe Outlaw* The Income Protection (IP) program insures the producer against lost income from reductions in yield or price. This policy pays when the harvested and appraised production to count, multiplied...

  5. IP SwitchingIP Switching and Label Switchingand Label Switching

    E-Print Network [OSTI]

    Jain, Raj

    Raj Jain 1 IP SwitchingIP Switching and Label Switchingand Label Switching Raj Jain Professor Switching vs routing q IP Switching (Ipsilon) q Tag Switching (CISCO) q Multi-protocol label switching a tag. Exit router strips it off. H R R R H H HUntagged Packet Tagged packet #12;Raj Jain 9 Tag

  6. OFFICE,

    Office of Legacy Management (LM)

    OFFICE, . . . . . ..-... --.-... .-..I... ..-... bUmME. wArl&l ' rrsldu*. in the dw6lopmQt pmgrwh : Be ostiamts Uuat not man lf+ .b%'o,Qds. cik'e%ah of the...

  7. Project no. 004089 Instrument : IP

    E-Print Network [OSTI]

    Guichard, Francoise

    Project no. 004089 AMMA Instrument : IP D.2.1.A.e The impacts of contrasting atmospheric convective available potential energy (CAPE). This finding is consistent with observations that daytime

  8. Intellectual Property (IP) Service Providers for Acquisition...

    Energy Savers [EERE]

    Property (IP) Service Providers for Acquisition and Assistance Transactions WA05056IBMWATSONRESEARCHCENTERWaiverofDomesticand.pdf Need to Consider Intentional...

  9. Dynaically Responsive IP Window Coatings

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Pacific Northwest National Laboratory Dynamically Responsive IR Window Coatings 2014 Building Technologies Office Peer Review 2 Project Summary Timeline: Start date:...

  10. Structure of mouse IP-10, a chemokine

    SciTech Connect (OSTI)

    Jabeen, Talat; Leonard, Philip; Jamaluddin, Haryati; Acharya, K. Ravi, E-mail: bsskra@bath.ac.uk [Department of Biology and Biochemistry, University of Bath, Claverton Down, Bath BA2 7AY (United Kingdom)

    2008-06-01

    The structure of mouse IP-10 shows a novel tetrameric association. Interferon-?-inducible protein (IP-10) belongs to the CXC class of chemokines and plays a significant role in the pathophysiology of various immune and inflammatory responses. It is also a potent angiostatic factor with antifibrotic properties. The biological activities of IP-10 are exerted by interactions with the G-protein-coupled receptor CXCR3 expressed on Th1 lymphocytes. IP-10 thus forms an attractive target for structure-based rational drug design of anti-inflammatory molecules. The crystal structure of mouse IP-10 has been determined and reveals a novel tetrameric association. In the tetramer, two conventional CXC chemokine dimers are associated through their N-terminal regions to form a 12-stranded elongated ?-sheet of ?90 Å in length. This association differs significantly from the previously studied tetramers of human IP-10, platelet factor 4 and neutrophil-activating peptide-2. In addition, heparin- and receptor-binding residues were mapped on the surface of IP-10 tetramer. Two heparin-binding sites were observed on the surface and were present at the interface of each of the two ?-sheet dimers. The structure supports the formation of higher order oligomers of IP-10, as observed in recent in vivo studies with mouse IP-10, which will have functional relevance.

  11. Empirical Tests of Anonymous Voice Over IP Marc Liberatoreb,

    E-Print Network [OSTI]

    Wright , Matthew

    Proxy Proxy Contact Anonymous Voice over IP (aVoIP) Initiator Proxy Proxy Proxy The Onion Router (Tor for extending onion-routing style anonymity protocols for supporting anonymous VoIP (aVoIP) traffic show that aVoIP could be developed in an onion routing system with reasonable performance guarantees

  12. BASICS IP PC104 Security Policy

    E-Print Network [OSTI]

    BASICS IP PC104 Security Policy Version: 1.2 Vocality International Ltd. Revision Date: 1 June 2012 revision. #12;Vocality International Ltd. Document Version 1.1 BASICS IP PC104 Security Policy Page 2 of 21 ........................................................................................................................................ 9 5 Identification and Authentication Policy

  13. The Wireless IP Project Mikael Sternad

    E-Print Network [OSTI]

    The Wireless IP Project Mikael Sternad ¡ Signals and Systems, Uppsala University, PO Box 528,SE-751 20 Uppsala, Sweden. Abstract The optimization of resources in wireless packet data sys- tems year 2000 formed the Wireless IP project, which studies such issues. We perform research towards

  14. For IPS Office Use Only A / R: Eng Prof

    E-Print Network [OSTI]

    supporting documents have been received (for instance, transcripts and official test scores) 2. You have / Country: ______________________________ Postal Code: ____________________________________ Postal Code country code and city code in telephone) Fax number if dialed from the US

  15. On the development of Voice over IP 

    E-Print Network [OSTI]

    Yang, Xu

    2009-05-15

    problems in the Session Initiation Protocol (SIP) call setup process. To support product line development and enable product evolution in the quickly growing VoIP market, I have proposed a generic development framework for SIP application servers...

  16. IP routing lookup: hardware and software approach 

    E-Print Network [OSTI]

    Chakaravarthy, Ravikumar V.

    2005-08-29

    The work presented in this thesis is motivated by the dual goal of developing a scalable and efficient approach for IP lookup using both hardware and software approach. The work involved designing algorithms and techniques to increase the capacity...

  17. ITDS tech contacts ip-requests@sfu.ca

    E-Print Network [OSTI]

    Kavanagh, Karen L.

    Desktop printer? ITDS tech contacts ip-requests@sfu.ca for static IP address from NS ITDS tech functionality Y N HCS Printer? N MFD?Y Obtain second static IP from ip-requests@sfu.ca for scanning Y ITDS tech questions such as the following of their clients when they request to purchase a new printer: · Why do you

  18. LINEAR COLLIDER TEST FACILITY: TWISS PARAMETER ANALYSIS AT THE IP/POST-IP LOCATION OF THE ATF2 BEAM LINE *

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    LINEAR COLLIDER TEST FACILITY: TWISS PARAMETER ANALYSIS AT THE IP/POST-IP LOCATION OF THE ATF2 BEAM through to the IP, the Twiss parameters need to be measured at the IP or PIP. Up to now, these parameters to extract the Twiss parameters and the emittance thanks to the three coefficients of the fit

  19. Towards All-IP Wireless Networks: Architectures and Resource Management

    E-Print Network [OSTI]

    Boutaba, Raouf

    Towards All-IP Wireless Networks: Architectures and Resource Management Mechanism Majid Ghaderi-IP network integrating different wireless technologies using IP and its associated service models. The first to facilitate the integration of wireless LAN and 3G cellular networks towards a uniform architecture for all

  20. Multimedia Communications over IP Networks 4 -6 September 2000

    E-Print Network [OSTI]

    Abu-Rgheff, Mosa Ali

    Multimedia Communications over IP Networks 4 - 6 September 2000 Evolution of the Internet David@plymouth.ac.uk School of Computing #12;Multimedia Communications over IP Networks 4 - 6 September 2000 Evolution' applying at each level: #12;Multimedia Communications over IP Networks 4 - 6 September 2000 Evolution

  1. Detecting VoIP Floods Using the Hellinger Distance

    E-Print Network [OSTI]

    Wang, Haining

    Detecting VoIP Floods Using the Hellinger Distance Hemant Sengar, Student Member, IEEE, Haining running over the TCP/IP suite, it is susceptible to flooding attacks. If flooded, as a time. Because multiple protocols are involved in a VoIP service and most of them are susceptible to flooding

  2. Impact of wireless losses on the predictability of end-to-end flow characteristics in Mobile IP Networks 

    E-Print Network [OSTI]

    Bhoite, Sameer Prabhakarrao

    2005-02-17

    -1 IMPACT OF WIRELESS LOSSES ON THE PREDICTABILITY OF END-TO-END FLOW CHARACTERISTICS IN MOBILE IP NETWORKS A Thesis by SAMEER BHOITE Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements... for the degree of MASTER OF SCIENCE December 2004 Major Subject: Mechanical Engineering IMPACT OF WIRELESS LOSSES ON THE PREDICTABILITY OF END-TO-END FLOW CHARACTERISTICS IN MOBILE IP NETWORKS A Thesis by SAMEER BHOITE Submitted to Texas A&M University in partial...

  3. July 5 -August 2 (SICCEP and IP-CHINA) July 19 -August 16 (IP-CHINA and SICCEP)

    E-Print Network [OSTI]

    Herrmann, Samuel

    July 5 - August 2 (SICCEP and IP-CHINA) July 19 - August 16 (IP-CHINA and SICCEP) Summer School ................................................................................................. 11 #12;#12;SUMMER SCHOOL 2014 Page 4 SICCEP IP-CHINA-CHINA Introduction to Chinese LawIntroduction to Chinese Law, Institutions, and Politics, Institutions, and Politics Environment, Science, and Society

  4. IP address management : augmenting Sandia's capabilities through open source tools.

    SciTech Connect (OSTI)

    Nayar, R. Daniel

    2005-08-01

    Internet Protocol (IP) address management is an increasingly growing concern at Sandia National Laboratories (SNL) and the networking community as a whole. The current state of the available IP addresses indicates that they are nearly exhausted. Currently SNL doesn't have the justification to obtain more IP address space from Internet Assigned Numbers Authority (IANA). There must exist a local entity to manage and allocate IP assignments efficiently. Ongoing efforts at Sandia have been in the form of a multifunctional database application notably known as Network Information System (NWIS). NWIS is a database responsible for a multitude of network administrative services including IP address management. This study will explore the feasibility of augmenting NWIS's IP management capabilities utilizing open source tools. Modifications of existing capabilities to better allocate available IP address space are studied.

  5. Characterization, Monitoring, and Sensor Technology Integrated Program (CMST-IP). Technology summary

    SciTech Connect (OSTI)

    Not Available

    1994-04-01

    The Characterization, Monitoring, and Sensor Technology Integrated Program seeks to deliver needed technologies, timely and cost-effectively, to the Office of Waste Management (EM-30), the Office of Environmental Restoration (EM-40), and the Office of Facility Transition and Management (EM-60). The scope of characterizations monitoring, and sensor technology needs that are required by those organizations encompass: (1) initial location and characterization of wastes and waste environments - prior to treatment; (2) monitoring of waste retrieval, remediation and treatment processes; (3) characterization of the co-position of final waste treatment forms to evaluate the performance of waste treatments processes; and (4) site closure and compliance monitoring. Wherever possible, the CMST-IP fosters technology transfer and commercialization of technologies that it sponsors.

  6. Deployment summary: Fiscal years 1995-2000 [USDOE Office of International Programs

    SciTech Connect (OSTI)

    2000-07-01

    This publication summarizes the progress made by the Office of International Programs (IP) in deploying innovative technologies for the environmental remediation of the DOE complex and for sites of its international collaborators for fiscal years 1995 through 2000.

  7. Badge Office

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Badge Office Badge Office The central point where badges are issued to employees and official visitors. Contact Badge Office (505) 667-6901 Email Badge Office location As the...

  8. Lessons Learned in the Design and Use of IP1 / IP2 Flexible Packaging - 13621

    SciTech Connect (OSTI)

    Sanchez, Mike; Reeves, Wendall; Smart, Bill

    2013-07-01

    For many years in the USA, Low Level Radioactive Waste (LLW), contaminated soils and construction debris, have been transported, interim stored, and disposed of, using IP1 / IP2 metal containers. The performance of these containers has been more than adequate, with few safety occurrences. The containers are used under the regulatory oversight of the US Department of Transportation (DOT), 49 Code of Federal Regulations (CFR). In the late 90's the introduction of flexible packaging for the transport, storage, and disposal of low level contaminated soils and construction debris was introduced. The development of flexible packaging came out of a need for a more cost effective package, for the large volumes of waste generated by the decommissioning of many of the US Department of Energy (DOE) legacy sites across the US. Flexible packaging had to be designed to handle a wide array of waste streams, including soil, gravel, construction debris, and fine particulate dust migration. The design also had to meet all of the IP1 requirements under 49CFR 173.410, and be robust enough to pass the IP2 testing 49 CFR 173.465 required for many LLW shipments. Tens of thousands of flexible packages have been safely deployed and used across the US nuclear industry as well as for hazardous non-radioactive applications, with no recorded release of radioactive materials. To ensure that flexible packages are designed properly, the manufacturer must use lessons learned over the years, and the tests performed to provide evidence that these packages are suitable for transporting low level radioactive wastes. The design and testing of flexible packaging for LLW, VLLW and other hazardous waste streams must be as strict and stringent as the design and testing of metal containers. The design should take into consideration the materials being loaded into the package, and should incorporate the right materials, and manufacturing methods, to provide a quality, safe product. Flexible packaging can be shown to meet the criteria for safe and fit for purpose packaging, by meeting the US DOT regulations, and the IAEA Standards for IP-1 and IP-2 including leak tightness. (authors)

  9. Taming IP Packet Flooding Attacks Karthik Lakshminarayanan Daniel Adkins

    E-Print Network [OSTI]

    Perrig, Adrian

    Taming IP Packet Flooding Attacks Karthik Lakshminarayanan Daniel Adkins ¡ Adrian Perrig Ion hosts is denial- of-service (DoS) caused by IP packet floods. Hosts in the Internet are unable to stop ­ not the net- work ­ should be given control to respond to packet floods and overload. Ideally, hosts should

  10. Experimental Comparison of Handoff Performance of SIGMA and Mobile IP

    E-Print Network [OSTI]

    Atiquzzaman, Mohammed

    to be eight seconds which is significantly higher than the six milliseconds handoff latency of SIGMA. The restExperimental Comparison of Handoff Performance of SIGMA and Mobile IP Surendra Kumar Sivagurunathan;1 Experimental Comparison of Handoff Performance of SIGMA and Mobile IP Surendra Kumar Sivagurunathan, Justin

  11. The IPS Compiler: Optimizations, Variants and Concrete Efficiency

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    The IPS Compiler: Optimizations, Variants and Concrete Efficiency Yehuda Lindell Eli Oxman Benny, it is black-box in the underlying semi-honest protocol, and it has excellent asymptotic efficiency. In this paper, we study the IPS compiler from a number different angles. We present an efficiency improvement

  12. Hardware IP Protection during Evaluation Using Embedded Sequential Trojan

    E-Print Network [OSTI]

    Bhunia, Swarup

    encryption and vendor-specific toolsets, which may be unacceptable due to lack of flexibility to use in-house IPs from piracy and reverse- engineering include passive defenses like watermarking [1] as well. It creates the possibility of a design house illegally using an IP in an IC design or selling it to external

  13. Security Challenges in the IP-based Internet of Things

    E-Print Network [OSTI]

    Security Challenges in the IP-based Internet of Things Tobias Heer , Oscar Garcia-Morchon , Ren.garcia,sye.loong.keoh,sandeep.kumar}@philips.com Abstract. A direct interpretation of the term Internet of Things refers to the use of standard Internet of standard IP security protocols. Keywords: Security, Internet of Things, IETF 1 Introduction The Internet

  14. Population SAMC, ChIP-chip Data Analysis and Beyond 

    E-Print Network [OSTI]

    Wu, Mingqi

    2011-02-22

    This dissertation research consists of two topics, population stochastics approximation Monte Carlo (Pop-SAMC) for Baysian model selection problems and ChIP-chip data analysis. The following two paragraphs give a brief introduction to each...

  15. Universal IP multicast delivery Beichuan Zhang a,*, Wenjie Wang b

    E-Print Network [OSTI]

    Massey, Dan

    it is available, and automatically build unicast tunnels to connect IP Multicast ``islands'' to form an overall mechanisms we adopted to support end hosts behind Network Address Translation (NAT) gateways and firewalls. Ó

  16. Performance comparison of native ATM vs IP over ATM 

    E-Print Network [OSTI]

    Mohammed, Shajiuddin Asif

    1998-01-01

    engineers through its high bandwidth and multi traffic support. The robustness of the Internet Protocol (115 contributed to massive increase in Internet hosts globally. IP is a connectionless protocol as opposed to ATM, which is connection oriented...

  17. IP3 signalling regulates exogenous RNAi in Caenorhabditis elegans

    E-Print Network [OSTI]

    Nagy, Anikó I.; Vázquez-Manrique, Rafael P.; Lopez, Marie; Christov, Christo; Sequedo, María Dolores; Herzog, Mareike; Herlihy, Anna E; Bodak, Maxime; Gatsi, Roxani; Baylis, Howard A.

    2015-01-21

    -proteins acting downstream of GPCRs [34]. Thus signalling through a GPCR may be important to the alterations in RNAi sensitivity. Increased IP3 signalling causes RNAi resistance. To ascertain whether IP3 signalling is capable of modulating the RNAi... : cgcgttcaccactcgaccaccgaac and tttttatgggttttggtaggttttag) [7], a 1.19 kb promoter region of unc-47 (terminal sequences: gatcccggaacagtcg and ctgtaatgaaataaatgt) were amplified from genomic DNA and cloned upstream of the itr-1 cDNA using restriction enzyme splicing...

  18. Analysis of the mouse embryonic stem cell regulatory networks obtained by ChIP-chip and ChIP-PET

    E-Print Network [OSTI]

    Mathur, Divya

    Background: Genome-wide approaches have begun to reveal the transcriptional networks responsible for pluripotency in embryonic stem (ES) cells. Chromatin Immunoprecipitation (ChIP) followed either by hybridization to a ...

  19. Campus Sustainability Office Campus Planning Office

    E-Print Network [OSTI]

    Elzanowski, Marek

    Campus Sustainability Office (CSO) Campus Planning Office (CPO) Campus Sustainability Manager (Molly Bressers) Campus Sustainability Office and Campus Planning Office May 2015 Student Employee (Thea

  20. CMTA Office

    High Performance Buildings Database

    Prospect, KY When CMTA outgrew their old office space, the consultant engineering company decided to construct a new building. Not only does the structure provide offices for the firm, it also showcases progressive design elements and allows the firm to test new technologies and demonstrate their effectiveness to clients. The new CMTA office building is located in a live-work development on the outskirts of Louisville, KY. The location was selected to place the office close to where the employees live.

  1. President Office Vice President Office

    E-Print Network [OSTI]

    Wu, Yih-Min

    Affairs Division Computer Information Management Division Media Instruction and Production Center Division Campus Security Supplies Office Office of Research and Development Planning Section and Waste Control Division Radiation Protection Division Biological Pollution Control Division #12

  2. Efficiently Monitoring Bandwidth and Latency in IP Networks

    E-Print Network [OSTI]

    Chan, Chee Yong

    of the up-to-date band- width utilizations and path latencies is critical for numerous im- portant network the challenging problem of efficiently monitoring bandwidth utilization and path latencies in an IP data network of links or packet flows, and (b) path latencies for a given set of paths, while minimizing the overhead

  3. Efficiently Monitoring Bandwidth and Latency in IP Networks

    E-Print Network [OSTI]

    Garofalakis, Minos

    of the up­to­date band­ width utilizations and path latencies is critical for numerous im­ portant network the challenging problem of efficiently monitoring bandwidth utilization and path latencies in an IP data network of links or packet flows, and (b) path latencies for a given set of paths, while minimizing the overhead

  4. IP ROUTING ISSUES IN SATELLITE CONSTELLATION NETWORKS A. CLERGET,2

    E-Print Network [OSTI]

    Wood, Lloyd

    constellation networks; Internet Protocol (IP); routing; tunnelling; Multi-Protocol Label Switching (MPLS); Border Gateway Protocol (BGP); Quality of Service (QoS); multicast. 1 INTRODUCTION Satellite; in conjunction with its terrestrial gateway stations it forms an autonomous system (AS). Over the same period

  5. CIPT: Using Tuangou to Reduce IP Transit Costs Rade Stanojevic

    E-Print Network [OSTI]

    Gorinsky, Sergey

    transit links. In- tuitively, the less traffic of an ISP flows through those links, the lower the costCIPT: Using Tuangou to Reduce IP Transit Costs Rade Stanojevic Ignacio Castro Sergey Gorinsky prices per Mbps de- cline steadily, the overall transit costs of these ISPs remain high or even increase

  6. Quantitative Visualization of ChIP-chip Data by Using Linked...

    Office of Scientific and Technical Information (OSTI)

    Quantitative Visualization of ChIP-chip Data by Using Linked Views Citation Details In-Document Search Title: Quantitative Visualization of ChIP-chip Data by Using Linked Views...

  7. Mobility Modeling and Handoff Analysis for IP/MPLS-Based Cellular Networks

    E-Print Network [OSTI]

    Boutaba, Raouf

    that every Foreign Agent (FA) has the functionality of a FA and Gateway Foreign Agent (GFA). However by removing the need for IP-in- IP tunneling from the HA to the FA using Label Switched Paths (LSPs). However

  8. An approach for improving performance of aggregate voice-over-IP traffic 

    E-Print Network [OSTI]

    Al-Najjar, Camelia

    2006-10-30

    The emerging popularity and interest in Voice-over-IP (VoIP) has been accompanied by customer concerns about voice quality over these networks. The lack of an appropriate real-time capable infrastructure in packet networks ...

  9. Security Through Obscurity: An Approach for Protecting Register Transfer Level Hardware IP

    E-Print Network [OSTI]

    Bhunia, Swarup

    Property (IP) cores. Recent trends of IP piracy and reverse-engineering are causing major revenue loss piracy, RTL obfuscation. I. INTRODUCTION Recent trends in IP-piracy and reverse-engineering efforts that is functionally equivalent to the original but is significantly more difficult to reverse engineer [11]. Software

  10. Assessment of VoIP Service Availability in the Current Internet

    E-Print Network [OSTI]

    Kaiser, Gail E.

    Assessment of VoIP Service Availability in the Current Internet Wenyu Jiang Department of Computer Science Columbia University Email: hgs@cs.columbia.edu Abstract-- We evaluate the availability of voice over IP (VoIP) service typically achieved in the current Internet. Service avail- ability is examined

  11. Building Technologies Office Overview

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Roland Risser Director, Building Technologies Office Building Technologies Office Energy Efficiency Starts Here. 2 Building Technologies Office Integrated Approach: Improving...

  12. Sustainability Performance Office | Department of Energy

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Sustainability Performance Office Sustainability Performance Office Sustainability Performance Office Sustainability Performance Office Sustainability Performance Office...

  13. http://physics.technion.ac.il/~ips/webIsrael Physical Society Prof. Cezar Bruma IPS_Join_to_2006_05_06.doc created 2006_04_30 printed: 5/7/2006

    E-Print Network [OSTI]

    Adler, Joan

    ) IPS signed an Agreement with the American Physical Society (APS) www.aps.org All IPS members advantage of our reciprocal arrangements with EPS, APS and IOP · Strengthen our ability to promote physicshttp://physics.technion.ac.il/~ips/webIsrael Physical Society Prof. Cezar Bruma IPS_Join_to_2006

  14. Building Technologies Office Overview

    SciTech Connect (OSTI)

    2013-04-01

    Building Technologies Office Overview Presentation for the 2013 Building Technologies Office's Program Peer Review

  15. Office of Chief Financial Officer

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2001-01-19

    This Order implements the provisions of the Chief Financial Officers Act of 1990 within the Department of Energy. Cancels SEN 34-91. Canceled by DOE O 520.1A.

  16. Fellows' Officers

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformation Current HABFES OctoberEvan Racah861May 2011AprilOfficers Fellows' Officers

  17. Minute of proceedings from the IP, Competition and Human Rights conference 

    E-Print Network [OSTI]

    Waelde, Charlotte

    Minute of proceedings from the IP, Competition and Human Rights conference, chaired by Waelde and Brown. The meeting was held in Edinburgh during 2004....

  18. Linear Collider Test Facility: Twiss Parameter Analysis at the IP/Post-IP Location of the ATF2 Beam Line

    SciTech Connect (OSTI)

    Bolzon, Benoit; /Annecy, LAPP; Jeremie, Andrea; /Annecy, LAPP; Bai, Sha; /Beijing, Inst. High Energy Phys.; Bambade, Philip; /KEK, Tsukuba; White, Glen; /SLAC

    2012-07-02

    At the first stage of the ATF2 beam tuning, vertical beam size is usually bigger than 3 {micro}m at the IP. Beam waist measurements using wire scanners and a laser wire are usually performed to check the initial matching of the beam through to the IP. These measurements are described in this paper for the optics currently used ({beta}{sub x} = 4cm and {beta}{sub y} = 1mm). Software implemented in the control room to automate these measurements with integrated analysis is also described. Measurements showed that {beta} functions and emittances were within errors of measurements when no rematching and coupling corrections were done. However, it was observed that the waist in the horizontal (X) and vertical (Y) plane was abnormally shifted and simulations were performed to try to understand these shifts. They also showed that multiknobs are needed in the current optics to correct simultaneously {alpha}{sub x}, {alpha}{sub y} and the horizontal dispersion (D{sub x}). Such multiknobs were found and their linearity and orthogonality were successfully checked using MAD optics code. The software for these multiknobs was implemented in the control room and waist scan measurements using the {alpha}{sub y} knob were successfully performed.

  19. Responsible University Officer Chief Information Officer

    E-Print Network [OSTI]

    Whitton, Mary C.

    Responsible University Officer Chief Information Officer Responsible Office Information Technology Services Information Security Liaison Policy Policy Statement Given the risks associated with information and Department Heads be aware of information security issues and of their responsibilities for mitigating

  20. Catalog of publications, Office of Science and Technology (Office of Water, Environmental Protection Agency), 1999 edition

    SciTech Connect (OSTI)

    1999-08-01

    This catalog focuses on the following: Introduction to the Office of Science and Technology (OST); Industrial Effluent Limitations and Guidelines (Listed alphabetically by Point Source); Water Quality Standards; Ambient Water Quality Criteria; Biological Quality Criteria; Nutrient Criteria; Equilibrium Partitioning Sediment Guidelines (Sediment Quality Criteria); Drinking Water Criteria; Drinking Water Health Advisories; Water Quality Modeling and Total Maximum Daily Loads Guidance; Analytical Laboratory Methods; Contaminated Sediments; Fish Tissue Quality; Municipal Sewage Sludge; Great Lakes Guidance; Beach Water Quality; Pollution Prevention-IP3 Reports; Videotapes; and Datafiles and Software.

  1. Office of Chief Financial Officer

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2001-11-27

    Page Change 1 to DOE O 520.1 modifies the responsibility statement to include NNSA Field CFO positions, modifies Heads of Field Elements responsibilities for consistency with the CFO responsibilities, and makes a minor change to reflect the establishment of the Office of Management, Budget and Evaluation. Cancels SEN 34-9.

  2. Stochastic TCO minimization for Video Transmission over IP Networks

    E-Print Network [OSTI]

    Goudarzi, Pejman

    2012-01-01

    From the viewpoint of service operators the Total Cost of Ownership (TCO) for developing a communication service comprises from two parts; CAPital EXpenditure (CAPEX) and OPerational EXpenditure (OPEX). These two types of costs are interrelated and affect any service provider's deployment strategy. In many traditional methods, selection of critical elements of a new service is performed in a heuristic manner aimed at reducing only the OPEX part of the TCO which is not necessarily optimal. Furthermore, exact cost modeling for such services is not always possible and contains some uncertainties. In the current work, after cost modeling of each video streaming element by capturing the effect of the model uncertainties, the TCO optimization problem for video streaming over IP networks is formulated as a stochastic optimization problem. The solution of the proposed optimization problem can cope with the cost modeling uncertainties and track the dynamism in the TCO and lead to a time-varying optimal solution. Numer...

  3. Taming IP Packet Flooding Attacks Karthik Lakshminarayanan Daniel Adkins y Adrian Perrig Ion Stoica

    E-Print Network [OSTI]

    Perrig, Adrian

    Taming IP Packet Flooding Attacks #3; Karthik Lakshminarayanan Daniel Adkins y Adrian Perrig Ion hosts is denial­ of­service (DoS) caused by IP packet floods. Hosts in the Internet are unable to stop -- not the net­ work -- should be given control to respond to packet floods and overload. Ideally, hosts should

  4. 9.IP.002.5.en.do Item 5: Obs

    E-Print Network [OSTI]

    Wauben, Wiel

    latter Vaisala stitute ng the sensor port. 9-IP/2 #12;AMOFSG/9-IP/2 - 2 - 2. SOLUTION AND EVALUATION 2 KNMI decide OR at civil ai International forward scatte used for visib ficant reductio r sensors hav forecasting a EOROLOG FORWARD (Present SU s in the meteo er sensors hav ts in the meas nsor firmwar es

  5. Hans Peter Schwefel Wireless Networks III, Fall 2005: MM1, IP Mobility Support

    E-Print Network [OSTI]

    Schwefel, Hans-Peter

    Page 1 Hans Peter Schwefel Wireless Networks III, Fall 2005: MM1, IP Mobility Support Wireless@kom.auc.dk http://www.kom.auc.dk/~hps http://www.kom.auc.dk/~tatiana · Mm1 IP Mobility Support (HPS) · Mm2 Wireless TCP (HPS) · Mm3 Wireless applications, SIP & IMS (HPS) · Mm4 Ad-hoc Networks I (TKM) · Mm5 Ad

  6. Econometric Feedback for Runtime Risk Management in VoIP Architectures

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Econometric Feedback for Runtime Risk Management in VoIP Architectures Oussema Dabbebi, R. Risk management provides new perspectives for addressing this issue. Risk models permit to reduce-configuration strategy for support- ing runtime risk management in VoIP architectures. This strategy aims

  7. BH-2 Mainframe Chassis 65-0200 IP-2 Iontophoresis Pump Module 65-0203

    E-Print Network [OSTI]

    BH-2 Mainframe Chassis 65-0200 IP-2 Iontophoresis Pump Module 65-0203 PPM-2 Pneumatic Pump Module Module ..............6 MS-2 Power Supply ..........................................6 IP-2 Pump Module ..............................................7-8 PPM-2 Pneumatic Pump Module ..........................9 Recommended Setup Procedure

  8. Low-Latency Mobile IP Hando for Infrastructure-Mode Wireless LANs

    E-Print Network [OSTI]

    Chiueh, Tzi-cker

    Low-Latency Mobile IP Hando#11; for Infrastructure-Mode Wireless LANs Srikant Sharma Ningning Zhu roaming through multiple wireless LAN segments. However, the peculiarities of commer- cially available 802.11b wireless LAN hardware prevent existing mobile IP implementations from achieving sub- second Mobile

  9. NLEL-MAAT at CLEF-IP Santiago Correa, Davide Buscaldi, Paolo Rosso.

    E-Print Network [OSTI]

    Rosso, Paolo

    NLEL-MAAT at CLEF-IP Santiago Correa, Davide Buscaldi, Paolo Rosso. NLE Lab, ELiRF Research Group, DSIC, Universidad Politécnica de Valencia, Spain. {scorrea, dbuscaldi, prosso}@dsic.upv.es http://users.dsic.upv.es/grupos/nle Abstract. This report presents the work carried out at NLE Lab for the IP@CLEF-2009 competition. We adapted

  10. Recovery from Shared Risk Link Group Failures using IP Fast Reroute

    E-Print Network [OSTI]

    Chao, Jonathan

    and randomly generated topologies. Index Terms--routing, failure recovery, shared risk link group (SRLG), fastRecovery from Shared Risk Link Group Failures using IP Fast Reroute Kang Xi, H. Jonathan Chao}@poly.edu, cguo01@students.poly.edu Abstract--Failure recovery in IP networks is critical to high- quality service

  11. Energy star compliant voice over internet protocol (VoIP) telecommunications network including energy star compliant VoIP devices

    DOE Patents [OSTI]

    Kouchri, Farrokh Mohammadzadeh

    2012-11-06

    A Voice over Internet Protocol (VoIP) communications system, a method of managing a communications network in such a system and a program product therefore. The system/network includes an ENERGY STAR (E-star) aware softswitch and E-star compliant communications devices at system endpoints. The E-star aware softswitch allows E-star compliant communications devices to enter and remain in power saving mode. The E-star aware softswitch spools messages and forwards only selected messages (e.g., calls) to the devices in power saving mode. When the E-star compliant communications devices exit power saving mode, the E-star aware softswitch forwards spooled messages.

  12. Responsible University Officer Chief Information Officer

    E-Print Network [OSTI]

    Whitton, Mary C.

    Responsible University Officer Chief Information Officer Responsible Office Information Technology at Chapel Hill that manages its own or subcontracts its information technology must: Establish and maintain Management Plan, contact the Information Security Office (ISO) at 919-445-9393 or security@unc.edu. Designate

  13. OFFICE of the CHIEF INFORMATION SECURITY OFFICER

    E-Print Network [OSTI]

    Matrajt, Graciela

    OFFICE of the CHIEF INFORMATION SECURITY OFFICER 2013 Information Security and Privacy Annual conversation,The Office of the Chief Information Security Officer (CISO) invites readers to email ciso@uw.edu by May 1st, 2014 with privacy-themed cap- tions for the cartoon on the right.Winning captions

  14. A PANCHROMATIC VIEW OF THE RESTLESS SN 2009ip REVEALS THE EXPLOSIVE EJECTION OF A MASSIVE STAR ENVELOPE

    E-Print Network [OSTI]

    Friedman, Andrew Samuel

    The double explosion of SN 2009ip in 2012 raises questions about our understanding of the late stages of massive star evolution. Here we present a comprehensive study of SN 2009ip during its remarkable rebrightenings. ...

  15. Director's Office

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformation Current HAB PacketDiesel pricesCenter at CornellDirector's Office Print

  16. Office Buildings

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYear Jan FebElements)Feet) Decade8 45YearYear

  17. Office of Communication - Speakers' Bureau

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Office of Communication Office of Communication home | Office of Communication staff | speakers' bureau | available materials | links | talk to Fermilab Speakers' Bureau The Office...

  18. Finance & Administration Controller's Office

    E-Print Network [OSTI]

    Weston, Ken

    Finance & Administration Controller's Office April 2014 Michael Williams Controller Controller ICOFA 61318 Revised: 4/4/2014 #12;Finance & Administration Controller's Office Accounting & Asset Coordinator Property Surplus Sales 81269 Revised: 4/4/2014 #12;Finance & Administration Controller's Office

  19. Architecture and Performance Models for Scalable IP Lookup Engines on FPGA*

    E-Print Network [OSTI]

    Hwang, Kai

    requirement of the IP lookup engine. In particular, a simple but realistic model of DDR3 memory is used designs achieve 5.6x ­ 70x the energy efficiency of TCAM, and have performance independent of the prefix

  20. U-107: Cisco NX-OS IP Packet Processing Flaw Lets Remote Users...

    Broader source: Energy.gov (indexed) [DOE]

    can cause denial of service conditions. PLATFORM: Nexus 1000v, 5000, and 7000 Series Switches ABSTRACT: A remote user can send a specially crafted IP packet to cause the target...

  1. 28 BIts&ChIps 17 november 2005 Energetiq Technology heeft een licht-

    E-Print Network [OSTI]

    Cambridge, University of

    28 · BIts&ChIps · 17 november 2005 Energetiq Technology heeft een licht- bron gelanceerd voor extreem ultravi- olet (EUV) metrologie. Deze Electrode- less Z-Pinch EUV-source, of EQ-10M, genereert EUV

  2. NLEL-MAAT at CLEF-IP Santiago Correa and Davide Buscaldi and Paolo Rosso

    E-Print Network [OSTI]

    Rosso, Paolo

    NLEL-MAAT at CLEF-IP Santiago Correa and Davide Buscaldi and Paolo Rosso NLE Lab, ELiRF Research Group, DSIC, Universidad Polit´ecnica de Valencia, Spain. {scorrea, dbuscaldi, prosso}@dsic.upv.es http://users.dsic.upv.es/grupos/nle Abstract. This report presents the work carried out at NLE Lab for the CLEF-IP 2009 competition. We adapted

  3. Chief Information Officer

    Broader source: Energy.gov [DOE]

    The Federal Energy Regulatory Commission is looking for an experienced senior level executive to serve as the Chief Information Officer (CIO). The Chief Information Officer (CIO) reports directly...

  4. Building Technologies Office Overview

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Roland Risser Director, Building Technologies Office Building Technologies Office Overview Our Homes and Buildings Use 40% of Our Nation's Energy and 75% of Electricity Energy Use...

  5. Building Technologies Office Overview

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Technologies Office Roland Risser Director, Building Technologies Office National Energy Consumption 40% 60% Reducing consumption or improving performance calls for cutting-edge...

  6. Advanced Manufacturing Office News

    SciTech Connect (OSTI)

    2013-08-08

    News stories about advanced manufacturing, events, and office accomplishments. Subscribe to receive updates.

  7. The Office of Independent Enterprise Assessments' Office of Enforcemen...

    Office of Environmental Management (EM)

    The Office of Independent Enterprise Assessments' Office of Enforcement convened the 2014 DOE Safety and Security Enforcement Workshop May 13 and 14, 2014 The Office of Independent...

  8. Office of Personnel Management (OPM) Billing System PIA, Office...

    Energy Savers [EERE]

    Personnel Management (OPM) Billing System PIA, Office of Health, Safety and Security Office of Personnel Management (OPM) Billing System PIA, Office of Health, Safety and Security...

  9. Rapid Recycling of Ca2+ Between IP3-Sensitive Stores and Lysosomes

    E-Print Network [OSTI]

    López Sanjurjo, Cristina I.; Tovey, Stephen C.; Taylor, Colin W.

    2014-10-22

    to the many receptors that stimulate phospholipase C (PLC), and then to mediate regener- ative propagation of the cytosolic Ca2+ signals [7]. The ER is unique among intracellular organelles in the extent to which it forms intimate associations with other... of lysosomal Ca2+ uptake exaggerates the Ca2+ signals evoked by Ca2+ release from distinct IP3-sensitive stores Stimulation of the endogenous muscarinic M3 receptors of HEK cells with carbachol (CCh) activates PLC. The IP3 produced then evokes Ca2+ release from...

  10. Office of Information Management

    Broader source: Energy.gov [DOE]

    The Office of Information Management provides a broad range of information technology services in support of the Associate Under Secretary for the Office of Environment, Health, Safety and Security (AU).

  11. Office Buildings: Consumption Tables

    U.S. Energy Information Administration (EIA) Indexed Site

    and Type of Office Building Total (trillion Btu) per Building (million Btu) per Square Foot (thousand Btu) Dollars per Million Btu All Office Buildings 1,089 1,475 90.5 16.32...

  12. Finance & Administration Controller's Office

    E-Print Network [OSTI]

    McQuade, D. Tyler

    Finance & Administration Controller's Office July 2014 Michael Williams Controller Controller Administrative Services 51111 Catherine Hebert Program Director ICOFA 61318 Revised: 7/28/2014 #12;Finance Surplus Property 81269 Revised: 7/28/2014 #12;Finance & Administration Controller's Office Disbursement

  13. Office Buildings - Full Report

    Gasoline and Diesel Fuel Update (EIA)

    PDF Office Buildings Although no one building type dominates the commercial buildings sector, office buildings are the most common and account for more than 800,000 buildings or 17...

  14. Student Services Conference Office

    E-Print Network [OSTI]

    Sussex, University of

    Student Services Conference Office Guidelines VAT Exemption for Eligible Bodies #12;Student ........................................................................................................2 Applying the rules to Conferences is intended for use by the University of Sussex Conference Office to determine if an Organisation using

  15. Assistant Director (Commissioned Officer)

    E-Print Network [OSTI]

    Matrajt, Graciela

    Manager Maintenance Sup. II Bldg & Grounds Sup. B Program Ops Specialist Maintenance & Construction Coord. Coordinator Parking Enforcement Officer 2 - FTE Budget Analyst Cashier .5 FTE Parking Operations Officer 8

  16. Finance & Administration Controller's Office

    E-Print Network [OSTI]

    Finance & Administration Controller's Office July 2015 Michael Williams Assistant VP & Controller Thornton Exec. Support Assistant Administrative Services 57950 Cherrylyn Mills-Brown Office Administrator Administrative Services 51112 Judd Enfinger Associate Controller Accounting Services 60998 Sandra Scanlan

  17. Office of the Chief Information Officer DOERM@hq.doe.gov Office...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Office of the Chief Information Officer DOERM@hq.doe.gov Office of IT Planning, Architecture and E-government Records Management Division (IM-23) Employee Separation:...

  18. Is the Internet ready for VoIP? Fouad A. Tobagi, Athina P. Markopoulou, Mansour J.Karam

    E-Print Network [OSTI]

    Markopoulou, Athina

    Is the Internet ready for VoIP? Fouad A. Tobagi, Athina P. Markopoulou, Mansour J.Karam Email communication over the Internet (VoIP). If the Internet were to become the universal network for all the packet loss and delay characteristics of today's Internet, in order to understand the effectiveness

  19. IP for Smart Objects Internet Protocol for Smart Objects (IPSO) Alliance

    E-Print Network [OSTI]

    Dunkels, Adam

    , smart cities, structural health management systems, smart grid and energy management, and transportationIP for Smart Objects Internet Protocol for Smart Objects (IPSO) Alliance White paper #1 Adam, Cisco Systems September 2008 Executive Summary The emerging application space for smart objects requires

  20. Automatic Information Discovery from the "Invisible Web" King-Ip Lin, Hui Chen

    E-Print Network [OSTI]

    Lin, King-Ip "David"

    Automatic Information Discovery from the "Invisible Web" King-Ip Lin, Hui Chen Division of Computer@memphis.edu Abstract A large amount of on-line information resides on the invisible web ­ web pages generated to find information on the invisible web. We describe our overall architecture and process: from obtaining

  1. The peculiar balmer decrement of SN 2009ip: Constraints on circumstellar geometry

    SciTech Connect (OSTI)

    Levesque, Emily M.; Stringfellow, Guy S.; Bally, John; Keeney, Brian A. [CASA, Department of Astrophysical and Planetary Sciences, University of Colorado 389-UCB, Boulder, CO 80309 (United States); Ginsburg, Adam G., E-mail: Emily.Levesque@colorado.edu [European Southern Observatory, ESO Headquarters, Karl-Schwarzschild-Strasse 2, D-95748 Garching bei München (Germany)

    2014-01-01

    We present optical and near-IR spectroscopic observations of the luminous blue variable SN 2009ip during its remarkable photometric evolution of 2012. The spectra sample three key points in the SN 2009ip light curve, corresponding to its initial brightening in August (2012-A) and its dramatic rebrightening in early October (2012-B). Based on line fluxes and velocities measured in our spectra, we find a surprisingly low I(H?)/I(H?) ratio (?1.3-1.4) in the 2012-B spectra. Such a ratio implies either a rare Case B recombination scenario where H?, but not H?, is optically thick, or an extremely high density for the circumstellar material of n{sub e} > 10{sup 13} cm{sup –3}. The H? line intensity yields a minimum radiating surface area of ?20,000 AU{sup 2} in H? at the peak of SN 2009ip's photometric evolution. Combined with the nature of this object's spectral evolution in 2012, a high circumstellar density and large radiating surface area imply the presence of a thin disk geometry around the central star (and, consequently, a possible binary companion), suggesting that the observed 2012-B rebrightening of SN 2009ip can be attributed to the illumination of the disk's inner rim by fast-moving ejecta produced by the underlying events of 2012-A.

  2. CPS-IP: Cyber Physical Systems Interconnection Protocol Department of Computer

    E-Print Network [OSTI]

    He, Tian

    heterogeneity of CPS systems at three different levels: function interoperability, policy regulation of the devices used in cyber physical system have very limited memory, computing capability and energy, whichCPS-IP: Cyber Physical Systems Interconnection Protocol Shan Lin Department of Computer Science

  3. SIP-based VoIP Traffic Behavior Profiling and Its Applications

    E-Print Network [OSTI]

    Zhang, Zhi-Li

    calls over the Internet, or any other IP network, using the packet switched network as a transmission maximize network efficiency, stream- line the network architecture, reduce capital and operational Hun such powerful infrastructures also make them a liability. Risks include Denial of Service (DoS), Ser- vice Theft

  4. Automatic Information Discovery from the "Invisible Web" King-Ip Lin, Hui Chen

    E-Print Network [OSTI]

    Lin, King-Ip "David"

    that is untouched by the traditional search engines. Known as the "invisible web" or "deep web", it representsAutomatic Information Discovery from the "Invisible Web" King-Ip Lin, Hui Chen Division of Computer@memphis.edu Abstract A large amount of on-line information resides on the invisible web ­ web pages generated

  5. Host-IP Clustering Technique for Deep Web Characterization Denis Shestakov

    E-Print Network [OSTI]

    Hammerton, James

    Host-IP Clustering Technique for Deep Web Characterization Denis Shestakov Department of Media databases. This part of the Web, known as the deep Web, is to date relatively unexplored and even major are aimed at more accurate estimation of main parameters of the deep Web by sampling one national web domain

  6. Translation of a Patent Certificate Translated by AFD China IP Our Ref. No.:080801507-E

    E-Print Network [OSTI]

    Peleg, Shmuel

    #12;Translation of a Patent Certificate Translated by AFD China IP Our Ref. No.:080801507-E Certificate No. 1156871 Certificate of Invention Patent Title: Method and System for Producing a Video Synopsis Inventors: Shmuel Peleg; Alexander Rav-Acha Patent No.: ZL 2006 8 0048754.8 Date of Filing

  7. IP Traffic Grooming over WDM Optical Networks Jing Fang and Arun K. Somani

    E-Print Network [OSTI]

    originating from hosts that are IP endpoints. This growth is being fueled by various applications capacity at the end systems. The advent of new services with increasing intelligence and the corresponding WDM to send ATM cells over SONET devices that are connect

  8. SoftBridge: An Architecture for Building IP-based Bridges over the Digital Divide

    E-Print Network [OSTI]

    Blake, Edwin

    SoftBridge: An Architecture for Building IP-based Bridges over the Digital Divide John Lewis, Bill outline the architecture and the requirements that the SoftBridge has to fulfill. An ap- proach and some), about 4 million land lines exist in South Africa and only 20% of South Africans have cellphones. Even

  9. Cost and Reliability Considerations in Designing the Next-Generation IP over WDM Backbone Networks

    E-Print Network [OSTI]

    Greenberg, Albert

    Cost and Reliability Considerations in Designing the Next-Generation IP over WDM Backbone Networks of the cost and reliability considerations involved in designing the next-generation backbone network. Our cost of the network. Hence, a fundamental redesign of the backbone network which avoids such redundant

  10. Large-Scale Quality Analysis of Published ChIP-seq Data

    E-Print Network [OSTI]

    Kundaje, Anshul

    ChIP-seq has become the primary method for identifying in vivo protein–DNA interactions on a genome-wide scale, with nearly 800 publications involving the technique appearing in PubMed as of December 2012. Individually and ...

  11. Reflectivity retrieval in a networked radar environment: Demonstration from the CASA IP1

    E-Print Network [OSTI]

    Jayasumana, Anura P.

    using data from the first Integration Project (IP1) radar network in Oklahoma. Electromagnetic waves, the lowest coverage altitude gets higher with range due to earth curvature [1]. A networked radar environment is capable of high spatial coverage and temporal resolution. The Engineering Research Center for CASA

  12. Performance optimization of mobile WiMAX netwoks for VoIP streams

    E-Print Network [OSTI]

    Gomez-Castellanos, Javier

    -I, 09340 - Mexico City milo@xanum.uam.mx Abstract-- Supporting as many VoIP (Voice over Internet Protocol. Department of Telecommunications UNAM, Mexico City {lortiz, victor, javierg}@fi-b.unam.mx R. Santos School of Telematics UCOL, Colima, Mexico aquinor@ucol.mx M. Lopez-Guerrero Department of Electrical Engineering UAM

  13. University of Oklahoma [INTELLECTUAL PROPERTY POLICY] The University of Oklahoma |IP Policy 1

    E-Print Network [OSTI]

    Oklahoma, University of

    University of Oklahoma [INTELLECTUAL PROPERTY POLICY] The University of Oklahoma |IP Policy 1 INTELLECTUAL PROPERTY POLICY 3.27.1 PREAMBLE (A) The people of the State of Oklahoma may reasonably expect from their creative works, trademarks, discoveries, and inventions. #12;University of Oklahoma

  14. A Key Establishment IP-Core for Ubiquitous Computing Markus Volkmer and Sebastian Wallner

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    A Key Establishment IP-Core for Ubiquitous Computing Markus Volkmer and Sebastian Wallner Hamburg in the ubiquitous and pervasive comput- ing setting is secure key exchange. The restrictions moti- vate-core in ¢¡¤£¦¥¨§ -CMOS technology are evaluated. 1. Introduction In ubiquitous and pervasive computing scenarios, key

  15. OFFICE of the CHIEF INFORMATION SECURITY OFFICER

    E-Print Network [OSTI]

    Matrajt, Graciela

    security and privacy. Services are designed to help UW units understand risks by analyzing and forecasting Chief Information Security Officer In reflecting back on all our hard work during 2012, I would like of Contents Asset-Based Risk Management

  16. Office Of Nuclear Energy

    Broader source: Energy.gov (indexed) [DOE]

    Office Of Nuclear Energy Sensors and Instrumentation Annual Review Meeting Enhanced Micro-Pocket Fission Detector (MPFD) for High Temperature Reactors Troy Unruh Idaho National...

  17. Office of Physical Protection

    Broader source: Energy.gov [DOE]

    The Office of Physical Protection is comprised of a team of security specialists engaged in providing Headquarters-wide physical protection.

  18. Government Printing Office Requirements

    Broader source: Energy.gov [DOE]

    This section describes the Government Printing Office (GPO) requirements for all print materials, whether printed electronically or on paper. This includes requirements for printing and copying for...

  19. Site Office Manager, Princeton

    Broader source: Energy.gov [DOE]

    A successful candidate in this position will serve as the Princeton Site Office (PSO) Manager by providing overall executive leadership to the PSO.

  20. Vehicle Technologies Office: News

    Broader source: Energy.gov [DOE]

    EERE intends to issue, on behalf of its Fuel Cell Technologies Office, a Funding Opportunity Announcement (FOA) entitled "Fuel Cell Technologies Incubator: Innovations in Fuel Cell and Hydrogen...

  1. Building Technologies Office

    Broader source: Energy.gov (indexed) [DOE]

    Technologies Office Richard Karney, P.E. May 8, 2014 40% 60% National Energy Consumption Reducing consumption or improving performance calls for cutting-edge...

  2. Solar Energy Technologies Office

    Office of Energy Efficiency and Renewable Energy (EERE)

    In 2011, the Energy Department's Solar Energy Technologies Office (SETO) became the SunShot Initiative, a collaborative national effort that aggressively drives innovation to make solar energy...

  3. Sustainability Performance Office | Department of Energy

    Office of Environmental Management (EM)

    Performance Office Sustainability Performance Office The U.S. Department of Energy (DOE) Sustainability Performance Office (SPO) oversees departmental sustainability...

  4. PONDER - A Real time software backend for pulsar and IPS observations at the Ooty Radio Telescope

    E-Print Network [OSTI]

    Naidu, Arun; Manoharan, P K; Krishnakumar, M A

    2015-01-01

    This paper describes a new real-time versatile backend, the Pulsar Ooty Radio Telescope New Digital Efficient Receiver (PONDER), which has been designed to operate along with the legacy analog system of the Ooty Radio Telescope (ORT). PONDER makes use of the current state of the art computing hardware, a Graphical Processing Unit (GPU) and sufficiently large disk storage to support high time resolution real-time data of pulsar observations, obtained by coherent dedispersion over a bandpass of 16 MHz. Four different modes for pulsar observations are implemented in PONDER to provide standard reduced data products, such as time-stamped integrated profiles and dedispersed time series, allowing faster avenues to scientific results for a variety of pulsar studies. Additionally, PONDER also supports general modes of interplanetary scintillation (IPS) measurements and very long baseline interferometry data recording. The IPS mode yields a single polarisation correlated time series of solar wind scintillation over a b...

  5. UC Sustainability Office Report

    E-Print Network [OSTI]

    Hickman, Mark

    UC Sustainability Office Report Introduction Welcome to the third annual UC Sustainability Office infrastructure, UC is now trending in a positive direction against some sustainability indicators. Electricity products and membership of the UC Sustainability Community is growing. There are concerns around the amount

  6. FRASER POLLUTION ABATEMENT OFFICE

    E-Print Network [OSTI]

    #12;-. FRASER POLLUTION ABATEMENT OFFICE 1992-93 Progress Report By MaggieM. Paquet MAIAPublishingLtd. 302 E. 6th Street NorthVancouver,BC V7L 1P6 For FraserPollutionAbatementOffice EnvironmentCanada 224W objectives of FRAP is to clean up pollution in the Fraser River Basin. This objective depends on pollution

  7. FRASER POLLUTION ABATEMENT OFFICE

    E-Print Network [OSTI]

    #12;FRASER POLLUTION ABATEMENT OFFICE PROGRESS REPORT 1994-95 Prepared By Maggie M. Paquet MAIA Publishing Ltd. Vancouver, BC For Technology and Pollution Prevention Section Fraser River Action Plan Environment Canada, FPAO Progress Report 1994-1995 ACKNOWLEDGEMENTS The Fraser Pollution Abatement Office

  8. Europaisches Patent Office

    E-Print Network [OSTI]

    Vertes, Akos

    (19) (12) Europaisches Patentamt European Patent Office Office europeen des brevets 11111~11111111111111111"11111111111111111"11""1111111111II~,,~1111 (11) EP 2 356 668 81 EUROPEAN PATENT SPECIFICATION (86) International application number: PCT/US2009/065891 (45) Date of publication and mention of the grant of the patent: 17.07.2013 Bulletin

  9. KALELE ROAD Parking Office

    E-Print Network [OSTI]

    FREEWAY H1 KALELE ROAD Parking Office on ground floor Bike Rack Locations Bike Lockers BICYCLE RACK Hale Kahawai Environmental Protection Services Federal Credit Union Energy House & Safety Office Bus Shelter Bus Shelter Art Building Sustainability Courtyard Kuykendall Hall Campus Center Jakuan Tea

  10. Appointment of Contracting Officers and Contracting Officer Representatives

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2004-04-21

    The Order established procedures governing the selection, appointment and termination of Department of Energy contracting officers and contracting officer representatives. Supersedes DOE O 541.1A.

  11. The Office of Independent Enterprise Assessments' Office of Enforcemen...

    Broader source: Energy.gov (indexed) [DOE]

    Steve Simonson, Director of the Office of Enforcement, addresses the 2014 DOE Safety and Security Enforcement Workshop attendees. Steve Simonson, Director of the Office of...

  12. Three-Dimensional (3-D) Reconstructions of EISCAT IPS Velocity Data in the Declining Phase of Solar Cycle 23

    E-Print Network [OSTI]

    2010-01-01

    scintillation observations of the solar wind. Geophys. Res.IPS observations of the solar wind. Proc. SPIE 6689, 668911-scale structure of the fast solar wind. J. Geophys. Res.

  13. CSP 541: Internet Technologies W.R. Stevens, TCP/IP Illustrated, Volume 1, Addison-Wesley, ISBN 0201633469

    E-Print Network [OSTI]

    Heller, Barbara

    CSP 541: Internet Technologies Texts W.R. Stevens, TCP/IP Illustrated, Volume 1, Addison March 2006 (html, css checks) CSP 541: Internet Technologies - CS Dept, Illinois Institut... 1 of 1 #12;

  14. T-629: Avaya WinPDM Multiple Buffer Overflow Vulnerabilities | Department

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURINGEnergyPlan | Department ofSUPPLEMENTSwitzerland| Department of| Department

  15. Workforce Management Office (WFMO) Functional Statements WORKFORCE MANAGEMENT OFFICE

    E-Print Network [OSTI]

    May 2014 Workforce Management Office (WFMO) ­ Functional Statements WORKFORCE MANAGEMENT OFFICE The Workforce Management Office (WFMO) is the servicing Human Resource Organization for NOAA and is the principal contact point with the Department of Commerce (DOC) Office of Human Resources Management. WFMO

  16. Supervisory Program Analysis Officer

    Broader source: Energy.gov [DOE]

    A successful candidate in this position will be responsible for the program analysis and evaluation of all activities which fall within the purview of the Office. The incumbent directs a moderate...

  17. Office of Information Security

    Broader source: Energy.gov [DOE]

    The Office of Information Security is responsible for implementation of the Classified Matter Protection and Control Program (CMPC), the Operations Security Program (OPSEC) and the Facility Clearance Program and the Survey Program for Headquarters

  18. Oak Ridge Office

    Office of Environmental Management (EM)

    - Mr. Steve Dixon, Chairman Oak Ridge Site Specific Advisory Board Post Office Box 200 1 Oak Ridge, Tennessee 3 783 0 Dear Mr. Dixon: RESPONSE TO RECOMMENDATION ON PROVIDING...

  19. Office of Security Policy

    Broader source: Energy.gov [DOE]

    The Office of Security Policy is the central source within the Department of Energy for the development and analysis of safeguards and security policies and standards affecting facilities, nuclear materials, personnel, and classified information.

  20. Portsmouth Paducah Project Office

    Broader source: Energy.gov [DOE]

    The U.S. Department of Energy (DOE) established the Portsmouth/Paducah Project Office (PPPO) on October 1, 2003, to provide focused leadership to the Environmental Management missions at the...

  1. User Liaison Office

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Office Space User space is available in the ARC, reserve space here. arc-thumb.jpg Click to see Virtual Tour 12000 Jefferson Avenue, Newport News, VA 23606 Phone: (757) 269-7255...

  2. Oak Ridge Office

    Office of Environmental Management (EM)

    PO. Box 2001 Oak Ridge, Tennessee 37831 July 21, 2010 Mr. Ron Murphree, Chair Oak Ridge Site Specific Advisory Board Post Office Box 200 1 Oak Ridge, Tennessee 3783 1 Dear Mr....

  3. Manager, Golden Field Office

    Broader source: Energy.gov [DOE]

    This position is located in the Office of Energy Efficiency and Renewable Energy (EERE). The mission of EERE is to create and sustain American leadership in the global transition to a clean energy...

  4. Director, Office of Research

    Broader source: Energy.gov [DOE]

    Within the Department of Energy, the Office of Fossil Energy (FE) plays a key role in helping the United States meet its continually growing need for secure, reasonably priced and environmentally...

  5. DEPARTMENT OF I Office

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    SLAC Site Office Enter APS report date here Linac Coherent Light Source-II, Menlo Park, California (EA No. DOEEA-1904) 115,000 The proposed Linac Coherent Light Source...

  6. Office of Nuclear Safety

    Broader source: Energy.gov [DOE]

    The Office of Nuclear Safety establishes nuclear safety requirements and expectations for the Department to ensure protection of workers and the public from the hazards associated with nuclear operations with all Department operations.

  7. Office of Fossil Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURINGEnergy Bills and ReduceNovemberDOE's PrioritiesOctober 2013CommentsOfficeOffice

  8. Office of Personnel Management

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested Parties -DepartmentAvailableHighOffice of Indian Energy PolicyOffice0

  9. Chief Technology Officer Opportunity Profile

    E-Print Network [OSTI]

    Mazzotti, Frank

    Chief Technology Officer Opportunity Profile #12;CHIEF TECHNOLOGY OFFICER Date: 01/23/2015 Prepared for the position and to give a deeper understanding of the role of Chief Technology Officer. We have also included: POSITION ANNOUNCEMENT TAB V: THE REGION TAB I: POSITION ANNOUNCEMENT #12;Chief Technology Officer

  10. Clues to the nature of SN 2009ip from photometric and spectroscopic evolution to late times

    SciTech Connect (OSTI)

    Graham, M. L. [Astronomy Department, University of California, Berkeley, CA 94720 (United States); Sand, D. J. [Physics Department, Texas Tech University, Lubbock, TX 79409 (United States); Valenti, S.; Howell, D. A.; Parrent, J. [Las Cumbres Observatory Global Telescope Network, Goleta, CA 93117 (United States); Halford, M.; Zaritsky, D. [Astronomy Department, University of Arizona, Tucson, AZ 85721 (United States); Bianco, F. [Department of Physics, New York University, 4 Washington Place, New York, NY 10003 (United States); Rest, A. [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Dilday, B., E-mail: melissagraham@berkeley.edu [North Idaho College, 1000 W. Garden Avenue, Coeur d'Alene, ID 83814 (United States)

    2014-06-01

    We present time series photometric and spectroscopic data for the transient SN 2009ip from the start of its outburst in 2012 September until 2013 November. These data were collected primarily with the new robotic capabilities of the Las Cumbres Observatory Global Telescope Network, a specialized facility for time domain astrophysics, and includes supporting high-resolution spectroscopy from the Southern Astrophysical Research Telescope, Kitt Peak National Observatory, and Gemini Observatory. Based on our nightly photometric monitoring, we interpret the strength and timing of fluctuations in the light curve as interactions between fast-moving ejecta and an inhomogeneous circumstellar material (CSM) produced by past eruptions of this massive luminous blue variable (LBV) star. Our time series of spectroscopy in 2012 reveals that, as the continuum and narrow H? flux from CSM interactions declines, the broad component of H? persists with supernova (SN)-like velocities that are not typically seen in LBVs or SN impostor events. At late times, we find that SN 2009ip continues to decline slowly, at ? 0.01 mag day{sup –1}, with small fluctuations in slope similar to Type IIn supernovae (SNe IIn) or SN impostors but no further LBV-like activity. The late-time spectrum features broad calcium lines similar to both late-time SNe and SN impostors. In general, we find that the photometric and spectroscopic evolution of SN 2009ip is more similar to SNe IIn than either continued eruptions of an LBV star or SN impostors but we cannot rule out a nonterminal explosion. In this context, we discuss the implications for episodic mass loss during the late stages of massive star evolution.

  11. Implementation of load sharing in TCP/IP distributed systems by election technique 

    E-Print Network [OSTI]

    Muppidi, Sridhar Reddy

    1991-01-01

    asynchronous Mesh Complete Arbitary 8(n log n) 8(n log n) 8(a log n) 8(n log n + m) 8(n log n) 8(n) 8(n) 8(a log n+ m) 13 Only recently have algorithms been designed for networks with faulty channels. Goldreich and Shrira [14] study election...IMPLEMENTATION OF LOAD SHARING IN TCP/IP DISTRIBUTED SYSTEMS BY ELECTION TECHNIQUE A Thesis by SRIDHAR REDDY MUPPIDI Submitted to the Oflice of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree...

  12. Fusion rules and vortices in $p_x+ip_y$ superconductors

    E-Print Network [OSTI]

    Michael Stone; Suk Bum Chung

    2005-11-30

    The "half-quantum" vortices ($\\sigma$) and quasiparticles ($\\psi$) in a two-dimensional $p_x+ip_y$ superconductor obey the Ising-like fusion rules $\\psi\\times \\psi=1$, $\\sigma\\times \\psi=\\sigma$, and $\\sigma\\times \\sigma= 1+\\psi$. We explain how the physical fusion of vortex-antivortex pairs allows us to use these rules to read out the information encoded in the topologically protected space of degenerate ground states. We comment on the potential applicability of this fact to quantum computation. Modified 11/30/05 to reflect manuscript as accepted for publication. Includes corrected last section.

  13. Assistance Transactions Headquarters IP Counsel, GC-62, John Lucas, 202-586-2939

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirley Ann Jackson About UsEnergy Marketing Corp. |Storage, Oversight Assessment ofAssessment of(IP)

  14. Office Buildings - Types of Office Buildings

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)Decade Year-0 Year-1 Year-2 Year-3 Year-4Barrels)(Dollars2.PDF Office

  15. Badging, Badge Office

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.Theory of raregovAboutRecovery ActTools toBadging, Badge Office Badging, Badge Office

  16. Fermilab | Directorate | Offices

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverse (Journal Article) | SciTech ConnectTimothyOffices Office of Integrated

  17. Office Buildings - Full Report

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYear Jan FebElements)Feet) Decade8PDF Office

  18. Office of Heath, Safety and Security Now Two New Offices

    Office of Energy Efficiency and Renewable Energy (EERE)

    To serve you better, DOE has structured the former HSS into to new organizations: the Office Independent Enterprise Assessment (IEA); and Office of Environment, Health, Safety and Security (EHSS).

  19. UMass Office of Information Technologies Office of Information Technologies

    E-Print Network [OSTI]

    Mountziaris, T. J.

    UMass Office of Information Technologies Office of Information Technologies A218 Lederle GRC University of Massachusetts Amherst http://www.oit.umass.edu/ The Instructor's Guide to Information Security 1. Student Information at UMass Amherst What is FERPA anyway

  20. Appointment of Contracting Officers and Contracting Officer Representatives

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    1996-04-30

    To establish procedures governing the selection, appointment, and termination of contracting officers and for the appointment of contracting officer representatives. Cancels DOE Order 4200.4A. Canceled by DOE O 541.1A.

  1. p{sub x}+ip{sub y} Superfluid from s-Wave Interactions of Fermionic Cold Atoms

    SciTech Connect (OSTI)

    Zhang Chuanwei; Tewari, Sumanta; Lutchyn, Roman M.; Das Sarma, S.

    2008-10-17

    Two-dimensional (p{sub x}+ip{sub y}) superfluids or superconductors offer a playground for studying intriguing physics such as quantum teleportation, non-Abelian statistics, and topological quantum computation. Creating such a superfluid in cold fermionic atom optical traps using p-wave Feshbach resonance is turning out to be challenging. Here we propose a method to create a p{sub x}+ip{sub y} superfluid directly from an s-wave interaction making use of a topological Berry phase, which can be artificially generated. We discuss ways to detect the spontaneous Hall mass current, which acts as a diagnostic for the chiral p-wave superfluid.

  2. Vehicle Technologies Office: Events | Department of Energy

    Office of Environmental Management (EM)

    Vehicle Technologies Office: Events Vehicle Technologies Office: Events The Vehicle Technologies Office holds a number of events to advance research, development and deployment of...

  3. Nevada Field Office | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Us Our Operations Management and Budget Office of Civil Rights Workforce Statistics Nevada Field Office Nevada Field Office FY15 Semi Annual Report FY14 Year End...

  4. Sandia Field Office | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Us Our Operations Management and Budget Office of Civil Rights Workforce Statistics Sandia Field Office Sandia Field Office FY15 Semi Annual Report FY14 Year End...

  5. Livermore Field Office | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Us Our Operations Management and Budget Office of Civil Rights Workforce Statistics Livermore Field Office Livermore Field Office FY15 Semi Annual Report FY14 Year...

  6. Pantex Field Office | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Us Our Operations Management and Budget Office of Civil Rights Workforce Statistics Pantex Field Office Pantex Field Office FY12 Semi Annual Report FY11 Year End...

  7. Contact the Sustainability Performance Office | Department of...

    Office of Environmental Management (EM)

    Performance Office Contact the Sustainability Performance Office The U.S. Department of Energy (DOE) Sustainability Performance Office (SPO) oversees departmental sustainability...

  8. Appointment of Contracting Officers and Contracting Officer's Representatives

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2000-10-27

    To establish procedures governing the selection, appointment, and termination of contracting officers and for the appointment of contracting officer's representatives. To ensure that only trained and qualified procurement and financial assistance professionals, within the scope of this Order, serve as contracting officers. Cancels DOE O 541.1. Canceled by DOE O 541.1B.

  9. PARKING MAP Sales Office

    E-Print Network [OSTI]

    California at Santa Cruz, University of

    PARKING MAP BayDr. Main Entrance Parking Sales Office Main Entrance Kiosk East Remote Lot for details DMV Parking Transit Stop Traffic Signal PARTIAL OR FULL LOT CLOSURE Crown Lot 111 Kresge Lot 147M--close-in parking for undergraduate students (lot-specific) EV--charging for electric vehicles MC

  10. PARKING MAP Sales Office

    E-Print Network [OSTI]

    California at Santa Cruz, University of

    PARKING MAP BayDr. Main Entrance Parking Sales Office Main Entrance Kiosk East Remote Lot Parking Transit Stop Traffic Signal PARTIAL OR FULL LOT CLOSURE Stevenson Lot 110 Crown Lot 111 Merrill student parking C--close-in parking for undergraduate students (lot-specific) EV--charging for electric

  11. Registered Student Organization Officer

    E-Print Network [OSTI]

    Raina, Ramesh

    website: gradorg.syr.edu #12;Important Information Registered Graduate Student Organization Handbook Fiscal Policy document provides additional fiscal guidelines and procedures ­ The Fiscal Policy can with Office of Student Activities If any of the required information changes, contact Internal VP

  12. Accommodation Office Housing Fair

    E-Print Network [OSTI]

    Bristol, University of

    Accommodation Office Housing Fair 11 am to 4 pm December 10th 2014 Wills Great Hall bristol accommodation, Waterlane Apartments, College Green & Fusion Towers offer a mix of studios and two bedroomed, with a range of flats and houses, and room sizes from 1 to 12. Our list of properties for academic year 2015

  13. Sustainable Office Lighting Options

    E-Print Network [OSTI]

    Massachusetts at Amherst, University of

    Sustainable Office Lighting Options Task Lighting: Task lighting is a localized method of lighting a workspace so that additional, unnecessary lighting is eliminated, decreasing energy usage and costs. Illumination levels in the targeted work areas are higher with task lighting than with the ambient levels

  14. Office of Document Reviews

    Broader source: Energy.gov [DOE]

    The Office of Document Reviews ensures that all documents prepared at DOE Headquarters are properly marked to identify the level and category of protected information they contain (if any) and to ensure that all documents the Department prepares or is required to review under applicable statutes for public release contain no information requiring protection under law, regulations and Executive orders.

  15. Chief Financial Officer Responsibilities

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2006-11-21

    The Order sets forth requirements for operating the Department of Energy in full compliance with the Chief Financial Officers Act of 1990 and sets standards for sound financial management policies and practices, effective internal controls, accurate and timely financial information, and well-qualified financial managers. Supersedes DOE O 520.1.

  16. Office of Quality Management

    Office of Energy Efficiency and Renewable Energy (EERE)

    The Office of Quality Management develops and interprets Government-wide policies and procedures and conducts training to ensure the accurate identification of information and documents that must be classified or controlled under statute or Executive order to protect the national security and controlled unclassified Official Use Only information for the effective operation of the Government.

  17. OFFICE FOR EMERGENCY MANAGEMENT

    Office of Legacy Management (LM)

    OFFICE FOR EMERGENCY MANAGEMENT 155OP STREETNW. WiSHINGTON. D.C. ' , iQns 25,19&L At-t :. I' .' at l530 P Btmat, IO&, XtwMn&m, 0. 6., at 9130 A.Jb Sa 1 llmbemupoftbaaomlttaal8f...

  18. Deputy Director, Advanced Manufacturing Office

    Broader source: Energy.gov [DOE]

    This position is located in the Advanced Manufacturing Office (AMO), within the Office of Energy Efficiency and Renewable Energy (EERE). EERE leads the U.S. Department of Energy's efforts to...

  19. Energy efficiency in office technology

    E-Print Network [OSTI]

    Dandridge, Cyane Bemiss

    1994-01-01

    This thesis, directed toward a wide variety of persons interested in energy efficiency issues with office technology, explores several issues relating to reducing energy use and improving energy efficiency of office ...

  20. Comments from Nebraska's Energy Office.

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    Web Site at >http:www.neo.ne.gov<. Feedback for Proposed Collection of Densified Biomass Fuel Data Nebraska Energy Office Page 2 Doris A. Jansky Nebraska Energy Office...

  1. Europaisches Patentamt European Patent Office

    E-Print Network [OSTI]

    Church, George M.

    Europaisches Patentamt European Patent Office Office europeen des brevets ® Publication number: o 303 459 A2 @ EUROPEAN PATENT APPLICATION ® Application number: 88307391.8 @ Int. C1.4: C 12 Q 1

  2. Office of Information Technology Accomplishments

    E-Print Network [OSTI]

    Yorke, James

    Office of Information Technology Accomplishments Fiscal Year 2007 #12;Office of Information'scentralinformationtechnologyserviceorganization,itismypleasuretosharewithyou theOfficeofInformationTechnology'spublication,"OITAccomplishmentsFiscalYear2007,"whichfeatures's goal is to take a quantum leap forward in the information technology environmentavailabletostudents

  3. CtIP tetramer assembly is required for DNA-end resection and repair

    E-Print Network [OSTI]

    Davies, Owen R.; Forment, Josep V.; Sun, Meidai; Belotserkovskaya, Rimma; Coates, Julia; Galanty, Yaron; Demir, Mukerrem; Morton, Christopher; Rzechorzek, Neil; Jackson, Stephen P.; Pellegrini, Luca

    2015-01-05

    of reservoir solution (200 mM lithium sulphate, 100 mM sodium acetate pH 3.6, 32% (v/v) PEG 400) and equilibrated for 7-10 days. Suitable crystals were incubated in cryoprotectant (20 mM Tris pH 8.0, 150 mM sodium chloride, 200 mM lithium sulphate, 100 m... protocol22. CtIP recombinant protein samples at 0.5-0.1 mg/ml were digested with 0.6 µg/µl proteinase K (NEB) at 60°C for 1 hour. For each digested protein sample, in addition to standard solutions containing 0-100 µM zinc acetate, 10 µl of supernatant...

  4. Abstract--Broadcast TV distribution over an IP network requires stringent QoS constraints, such as low latency and loss.

    E-Print Network [OSTI]

    Greenberg, Albert

    technique at the IP layer. Link-based FRR creates a pseudo-wire or tunnel in parallel to the IP adjacencies (links); and thus, single link failures are transparent to the Interior Gateway Protocol (IGP). Although to rebuild the multi-cast tree after a network failure. This process, when combined with the Internal Gateway

  5. Administration Office for Master Students

    E-Print Network [OSTI]

    Fischlin, Andreas

    Administration Office for Master Students in Environmental Sciences CHN H 50.4 CH - 8092 Zürich Tel to the Administration Office for Master Students at the beginning of the Master thesis Last name, first name and that the completed evaluation form is delivered to the student administration office within two weeks after

  6. UNIVERSITY OF YORK COMMUNICATIONS OFFICE

    E-Print Network [OSTI]

    Wirosoetisno, Djoko

    UNIVERSITY OF YORK COMMUNICATIONS OFFICE WEB OFFICE Web Strategy Date 4 February, 2003 Version 4, Press and PR Officer William Mackintosh, Web Manager #12;Web Strategy 4.4 ©University of York Page 2............................................................................................... 6 3.2 Objectives of the Web Strategy

  7. Site Office Contracting Officer E-mail address Ames Site Office...

    National Nuclear Security Administration (NNSA)

    York Jacquelyn.york@ch.doe.gov Brookhaven Site Office Evelyn Landini Jennifer Hartmann elandini@bnl.gov jhartmann@bnl.gov Idaho Site Office Paul Allen allenph@id.doe.gov...

  8. Some Implications of Low Power Wireless to IP Networking Kannan Srinivasan, Prabal Dutta, Arsalan Tavakoli, and Philip Levis

    E-Print Network [OSTI]

    Levis, Philip

    and cellphones. This trend towards smaller, lower power, and more numerous devices has led to new wirelessSome Implications of Low Power Wireless to IP Networking Kannan Srinivasan, Prabal Dutta, Arsalan Division, UC Berkeley, Berkeley, CA Abstract We examine and outline challenges in IPv6 routing over low-power

  9. Comparison of Energy Efficiency in PSTN and VoIP Florin Bota, Faheem Khuhawar, Marco Mellia, Michela Meo

    E-Print Network [OSTI]

    Comparison of Energy Efficiency in PSTN and VoIP Systems Florin Bota, Faheem Khuhawar, Marco Mellia.lastname@polito.it ABSTRACT The importance of deploying energy efficient networks has vastly increased due to the rapidly to existing networks that could prove to be energy efficient. In this paper, two telephone net- works namely

  10. On the Selection of Optimal Diverse AS-Paths for Inter-Domain IP/(G)MPLS Tunnel Provisioning

    E-Print Network [OSTI]

    Rougier, Jean-Louis

    On the Selection of Optimal Diverse AS-Paths for Inter-Domain IP/(G)MPLS Tunnel Provisioning of diverse AS paths can be computed, in order to proactively increase the success rate of tunnel set these services beyond domain boundaries, particularly for critical inter-AS VPNs, TV transport or voice gateways

  11. Semi-Markov modeling of dependability of VoIP network in the presence of resource degradation and security attacks

    E-Print Network [OSTI]

    Dharmaraja, S.

    of Technology, Delhi, India a r t i c l e i n f o Article history: Received 19 August 2010 Received in revised models. & 2011 Elsevier Ltd. All rights reserved. 1. Introduction Voice over Internet Protocol (VoIP), also known as Internet telephony, is the technology that enables people to use the Internet

  12. Project Management Coordination Office Organization Chart

    Office of Energy Efficiency and Renewable Energy (EERE)

    Project Management Coordination Office Organization Chart, U.S. Department of Energy's Office of Energy Efficiency and Renewable Energy.

  13. Welcome to The Office of Science

    ScienceCinema (OSTI)

    Brinkman, William

    2013-05-29

    The Director of the Department of Energy's Office of Science, Dr. William Brinkman, introduces the new Office of Science website.

  14. Categorical Exclusion Determinations: Office of Electricity Delivery...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Office of Electricity Delivery and Energy Reliability Categorical Exclusion Determinations: Office of Electricity Delivery and Energy Reliability Categorical Exclusion...

  15. Advanced Manufacturing Office (Formerly Industrial Technologies...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Manufacturing Office (Formerly Industrial Technologies Program) Advanced Manufacturing Office (Formerly Industrial Technologies Program) Presented at the NREL Hydrogen and Fuel...

  16. Office of the Director, NIH Director's Advisory

    E-Print Network [OSTI]

    Rau, Don C.

    Ethics Office (HNAT) Office of the Chief Information Officer (HNAV) Division of Resolution and Equity (2 Technology Policy and Review Office (2) Information Technology Acquisitions Services (4) Information of Communications and Outreach (3) Office of Research Information Systems (HNA36) Office of Policy for Extramural

  17. Office of Information Resources

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested Parties -DepartmentAvailableHighOffice of Indian Energy Policy andSubpart

  18. Office of Inspector General

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested Parties -DepartmentAvailableHighOffice of Indian Energy Policy

  19. Office of Indian Energy Policy and Programs Office of Energy...

    Energy Savers [EERE]

    Indian Energy Policy and Programs Office of Energy Efficiency and Renewable Energy Tribal Energy Program Commercial-Scale Renewable Energy Project Development and Finance Workshop...

  20. Office of the Chief Financial Officer Annual Report 2010

    E-Print Network [OSTI]

    Fernandez, Jeffrey

    2011-01-01

    of Energy Efficiency and Renewable Energy (EERE) and non-DOEEnergy Efficiency and Renewable Energy (EERE) While OfficeEnergy Efficiency and Renewable Energy Assistant Secretary

  1. Building-Grid Integration Research and Development Innovators Program (BIRD IP)

    Office of Energy Efficiency and Renewable Energy (EERE)

    The Building Technologies Office (BTO) within the Department of Energy (DOE) is seeking graduate students interested in exploring building-grid integration and development (R&D) technology concepts that can improve the operating efficiency of buildings and increase penetration of distributed renewable energy generation, leading to more efficient buildings and cleaner generation of electricity.

  2. August 1998Published for the Members of the IP Multicast Initiative. BROADCAST on page 6

    E-Print Network [OSTI]

    Touch, Joe

    and financial services, media and manufacturing, retail, energy, telecommunications, and more. Our services in the international business community, with offices in eight countries in North America, Asia, and Europe. Our-known aggregator of Internet audio sites, became America's best-ever initial publicoffering when its shares opened

  3. OFFICE: NEPA REVIEWS:

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i nAand DOEDepartmentNew2008Group, Inc. Order(National4, 2014INFORMATION OFFICER

  4. Education Office Housing

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.Theory ofDid you not find what you wereDisclaimersMailEconomicEducation Office

  5. Ames Site Office Jobs

    Office of Science (SC) Website

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorkingLosThe 26thI D- 6 0 4 2 rzNewsOffice of ScienceAdvancedU.S.

  6. Argonne Site Office Jobs

    Office of Science (SC) Website

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorkingLosThe 26thI D- 6 0 4 2 rzNewsOffice of

  7. In-Office Services:

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverseIMPACT EVALUATION PLAN FOR THE SITE-218 58ImprovingInaInstitute / TexasOffice

  8. Office Buildings - Energy Consumption

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYear Jan FebElements)Feet) Decade8

  9. Offices | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative Fuels Data Center HomeVehicle Replacement U.S.Job&Energy Department »Offices

  10. Ahb Compatible DDR Sdram Controller Ip Core for Arm Based Soc

    E-Print Network [OSTI]

    Shashikumar, Dr R; Nagendrakumar, M; Hemanthkumar, C S

    2010-01-01

    DDR SDRAM is similar in function to the regular SDRAM but doubles the bandwidth of the memory by transferring data on both edges of the clock cycles. DDR SDRAM most commonly used in various embedded application like networking, image or video processing, Laptops ete. Now a days many applications needs more and more cheap and fast memory. Especially in the field of signal processing, requires significant amount of memory. The most used type of dynamic memory for that purpose is DDR SDRAM. For FPGA design the IC manufacturers are providing commercial memory controller IP cores working only on their products. Main disadvantage is the lack of memory access optimization for random memory access patterns. The data path part of those controllers can be used free of charge. This work propose an architecture of a DDR SDRAM controller, which takes advantage of those available and well tested data paths and can be used for any FPGA device or ASIC design.(5). In most of the SOC design, DDR SDRAM is commonly used. ARM pro...

  11. Jefferson Lab Chief Operating Officer

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    COO Privacy and Security Notice Skip over navigation Search the JLab Site Chief Operating Officer Please upgrade your browser. This site's design is only visible in a graphical...

  12. Profiles in garbage: Office paper

    SciTech Connect (OSTI)

    Miller, C. [Environmental Industry Associations, Washington, DC (United States)

    1998-04-01

    The primary markets for recycled office paper are tissue mills, printing and writing paper, and paperboard packaging. Other uses include exports and newsprint. As recently as 1990, more than half of recovered office paper was exported, primarily to paper mills in Pacific Rim countries. This decade has seen an increase in the number of mills using deinked market pulp made from office paper. North American capacity to produce deinked market pulp skyrocketed in the first half of this decade. However, oversupply in the end markets for office paper led to financial problems and shutdown for several of these new mills.

  13. Vehicle Technologies Office: Propulsion Systems

    Broader source: Energy.gov [DOE]

    Vehicle Technologies Office research focuses much of its effort on improving vehicle fuel economy while meeting increasingly stringent emissions standards. Achieving these goals requires a...

  14. Office of Secure Transportation Activities

    Office of Environmental Management (EM)

    6th, 2012 WIPP Knoxville, TN OFFICE OF SECURE TRANSPORTATION Agency Integration Briefing Our Mission To provide safe and secure ground and air transportation of nuclear weapons,...

  15. Director, Information Technology Services Office

    Broader source: Energy.gov [DOE]

    The mission of the information Technologies Services Office is to provide effective corporate management leadership to proactively identify and manage business system efficiency improvements and to...

  16. Director, Office of Resource Management

    Broader source: Energy.gov [DOE]

    The Office of the Associate Under Secretary for Environment, Health, Safety, and Security (AU) provides corporate leadership and strategic approaches for protecting DOEs workers, the public, the...

  17. Office of Science User Facilities

    Broader source: Energy.gov [DOE]

    This presentation summarizes the information on the Office of Science User Facilities, which was given during the webinar on the DOE BRIDGE funding opportunity.

  18. February 2008 Office of Chief Financial Officer Department of Energy

    E-Print Network [OSTI]

    February 2008 Office of Chief Financial Officer Department of Energy FY 2009 Congressional Budget Department of Energy FY 2009 Congressional Budget Request Volume 4 DOE/CF-027 Volume 4 Science Printed with soy ink on recycled paper #12;#12;Department of Energy/ Science FY 2009 Congressional Budget Volume 4

  19. EXECUTIVE OFFICE OF THE PRESIDENT OFFICE OF MANAGEMENT AND BUDGET

    E-Print Network [OSTI]

    US Army Corps of Engineers

    and quality. VE contributes to the overall management objectives of streamlining operations, improving qualityEXECUTIVE OFFICE OF THE PRESIDENT OFFICE OF MANAGEMENT AND BUDGET WASHINGTON, D.C. 20503 December, improve performance, enhance quality, and foster the use of innovation. Agencies should maintain policies

  20. OFFICE OF GRADUATE AND PROFESSIONAL STUDIES Thesis Office

    E-Print Network [OSTI]

    OFFICE OF GRADUATE AND PROFESSIONAL STUDIES Thesis Office 612 Sterling Evans Library rev. 6/2013 thesis@tamu.edu 5000 TAMU Tel. 979.845.2225 Fax 979.862.3124 College Station, TX 77843-5000 Page 1 of 1 http://thesis.tamu.edu GUIDELINES FOR THE PREPARATION OF THE APPROVAL OF WRITTEN THESIS FORM

  1. Education Officers in PSOM Departments Education Officer Phone Email

    E-Print Network [OSTI]

    Sharp, Kim

    Education Officers in PSOM Departments Education Officer Phone Email Anesthesiology and Critical@upenn.edu Cell & Developmental Biology Neal A. Rubinstein, MD, PhD 898-4162 nrubinst@mail.med.upenn.edu Psychiatry Anthony Rostain, MD 746-7210 rostain@mail.med.upenn.edu Radiation Oncology Sydney Evans, VMD 898

  2. A panchromatic view of the restless SN 2009ip reveals the explosive ejection of a massive star envelope

    SciTech Connect (OSTI)

    Margutti, R.; Milisavljevic, D.; Soderberg, A. M.; Chornock, R.; Zauderer, B. A.; Sanders, N. E.; Berger, E. [Harvard-Smithsonian Center for Astrophysics, 60 Garden St., Cambridge, MA 02138 (United States); Murase, K. [Institute for Advanced Study, Princeton, NJ 08540 (United States); Guidorzi, C. [Department of Physics, University of Ferrara, via Saragat 1, I-44122 Ferrara (Italy); Kuin, P. [University College London, MSSL, Holmbury St. Mary, Dorking, Surrey RH5 6NT (United Kingdom); Fransson, C. [Department of Astronomy and the Oskar Klein Centre, Stockholm University, AlbaNova, SE-106 91 Stockholm (Sweden); Levesque, E. M. [CASA, Department of Astrophysical and Planetary Sciences, University of Colorado, 389-UCB, Boulder, CO 80309 (United States); Chandra, P.; Challis, P. [National Centre for Radio Astrophysics, Tata Institute of Fundamental Research, Pune University Campus, Ganeshkhind, Pune 411007 (India); Bianco, F. B. [Center for Cosmology and Particle Physics, New York University, 4 Washington Place, New York, NY 10003 (United States); Brown, P. J. [George P. and Cynthia Woods Mitchell Institute for Fundamental Physics and Astronomy, Texas A. and M. University, Department of Physics and Astronomy, 4242 TAMU, College Station, TX 77843 (United States); Chatzopoulos, E. [Department of Astronomy, University of Texas at Austin, Austin, TX 78712-1205 (United States); Cheung, C. C. [Space Science Division, Naval Research Laboratory, Washington, DC 20375-5352 (United States); Choi, C. [CEOU/Department of Physics and Astronomy, Seoul National University, Seoul 151-742 (Korea, Republic of); Chomiuk, L. [National Radio Astronomy Observatory, P.O. Box O, Socorro, NM 87801 (United States); and others

    2014-01-01

    The double explosion of SN 2009ip in 2012 raises questions about our understanding of the late stages of massive star evolution. Here we present a comprehensive study of SN 2009ip during its remarkable rebrightenings. High-cadence photometric and spectroscopic observations from the GeV to the radio band obtained from a variety of ground-based and space facilities (including the Very Large Array, Swift, Fermi, Hubble Space Telescope, and XMM) constrain SN 2009ip to be a low energy (E ? 10{sup 50} erg for an ejecta mass ?0.5 M {sub ?}) and asymmetric explosion in a complex medium shaped by multiple eruptions of the restless progenitor star. Most of the energy is radiated as a result of the shock breaking out through a dense shell of material located at ?5 × 10{sup 14} cm with M ? 0.1 M {sub ?}, ejected by the precursor outburst ?40 days before the major explosion. We interpret the NIR excess of emission as signature of material located further out, the origin of which has to be connected with documented mass-loss episodes in the previous years. Our modeling predicts bright neutrino emission associated with the shock break-out if the cosmic-ray energy is comparable to the radiated energy. We connect this phenomenology with the explosive ejection of the outer layers of the massive progenitor star, which later interacted with material deposited in the surroundings by previous eruptions. Future observations will reveal if the massive luminous progenitor star survived. Irrespective of whether the explosion was terminal, SN 2009ip brought to light the existence of new channels for sustained episodic mass loss, the physical origin of which has yet to be identified.

  3. SiFi: Exploiting VoIP Silence for WiFi Energy Savings in Smart Phones

    E-Print Network [OSTI]

    Zhou, Gang

    ), to its sleep or Power Save Mode (PSM), which consumes little power (36mW). Applications like VoIP do not perform well under PSM mode however, due to their real-time nature, so the energy footprint is quite high WiFi to the Power Save Mode (PSM) which consumes 20 fold less energy (36mW in Sprint HTC Hero

  4. IP ADDRESS HOSTNAME MACHINE TYPE 129.252.130.106 canopus.cse.sc.edu # SUN Ultra10

    E-Print Network [OSTI]

    Bakos, Jason D.

    IP ADDRESS HOSTNAME MACHINE TYPE 129.252.130.106 canopus.cse.sc.edu # SUN Ultra10 129.252.130.107 deneb.cse.sc.edu # SUN Ultra10 129.252.130.108 glensh.cse.sc.edu # SUN Ultra10 129.252.130.111 menkar.cse.sc.edu # SUN Ultra10 129.252.130.112 nunki.cse.sc.edu # SUN Ultra10 129.252.130.113 pollux.cse.sc.edu # SUN

  5. Exact solution of the p+ip Hamiltonian revisited: duality relations in the hole-pair picture

    E-Print Network [OSTI]

    Jon Links; Ian Marquette; Amir Moghaddam

    2015-04-02

    We study the exact Bethe Ansatz solution of the p+ip Hamiltonian in a form whereby quantum numbers of states refer to hole-pairs, rather than particle-pairs used in previous studies. We find an asymmetry between these approaches. For the attractive system states in the strong pairing regime take the form of a quasi-condensate involving two distinct hole-pair creation operators. An analogous feature is not observed in the particle-pair picture.

  6. Effects of verbenone and brevicomin on within-tree populations of Dendroctonus frontalis and Ips avulsus (Coleoptera: Scolytidae) 

    E-Print Network [OSTI]

    Watterson, Gary Phillip

    1979-01-01

    EFFECTS OF VERBENONE AND BREVICOMIN ON WITHIN-TREE POPULATIONS OF DENDROCTONUS FRONTALIS AND IPS AVULSUS (COLEOPTERA: SCOLYTIDAE) A Thesis by GARY PHILLIP WATTERSON Submitted to the Graduate College of Texas A8M University in partial... by GARY PHILLIP WATTERSON Approved as to style and content by: Chairman of o ee Head of Department ember Member I , Mem er December, 1979 ABSTRACT Effects of Verbenone and Brevi comi n on Within-Tree Populations of Dendroctonus frontalis and ~I...

  7. UNLV OFFICE OF INFORMATION TECHNOLOGY PASSWORD POLICY

    E-Print Network [OSTI]

    Walker, Lawrence R.

    UNLV OFFICE OF INFORMATION TECHNOLOGY PASSWORD POLICY RESPONSIBLE ADMINISTRATOR: VICE PROVOST FOR INFORMATION TECHNOLOGY RESPONSIBLE OFFICE(S): OFFICE OF THE VICE PROVOST FOR INFORMAnON TECHNOLOGY ORIGINALLY to the Office of Information Technology's Policies and Procedures web page at http

  8. J. Douglas Streit, Information Security Officer Office of Computing and Communications Services

    E-Print Network [OSTI]

    J. Douglas Streit, Information Security Officer Office of Computing and Communications Services Last updated February 6, 2012 Old Dominion University Information Technology Security Program #12;J. Douglas Streit, Information Security Officer Office of Computing and Communications Services Last updated

  9. Science Highlights | U.S. DOE Office of Science (SC)

    Office of Science (SC) Website

    Agency - Energy (ARPA-E) Office of Environmental Management (EM) Office of Energy Efficiency and Renewable Energy (EERE) Office of Fossil Energy (FE) Office of Nuclear Energy...

  10. 2014 Annual Planning Summary for the Richland Operations Office...

    Energy Savers [EERE]

    Richland Operations Office and the Office of River Protection 2014 Annual Planning Summary for the Richland Operations Office and the Office of River Protection The ongoing and...

  11. OFFICE OF SUSTAINABILITY Community Forum

    E-Print Network [OSTI]

    van den Berg, Jur

    Travel Natural Gas Transportation Electricity Without reductions 2007 2025 2050 Emissions (MTCO2e immediate steps to reduce greenhouse gas emissions · Create Sustainability Office and oversight committees RENEWABLES GROUNDS FOOD WASTE COMMUNICATION #12;OFFICE OF SUSTAINABILITY Open house meetings 3 Targeted

  12. Administration Office for Master Students

    E-Print Network [OSTI]

    Fischlin, Andreas

    of the thesis to the Administration Office for Master Students. With the agreement of the main supervisorAdministration Office for Master Students in Environmental Sciences CHN H 50.4 CH - 8092 Zürich Tel. +41-44-632 58 90 env_master@usys.ethz.ch Master Thesis Evaluation Form has to be sent

  13. Julia Maddock Senior Press Officer

    E-Print Network [OSTI]

    Julia Maddock Senior Press Officer #12;Corporate Planning and Communication Directorate Staff 31 Relations : Peter Barratt Press Officers : Gill Ormrod (until end December) Julia Maddock Natalie Bealing;Channel Activities · Media Relations Press Releases (Database + AlphaGalileo/Eurekalert/AAAS) Journalist

  14. Richland Operations Office technology summary

    SciTech Connect (OSTI)

    Not Available

    1994-05-01

    This document has been prepared by the Department of Energy`s Environmental Management Office of Technology Development to highlight its research, development, demonstration, testing, and evaluation activities funded through the Richland Operations Office. Technologies and processes described have the potential to enhance cleanup and waste management efforts.

  15. OKLAHOMA STATE UNIVERSITY BURSAR'S OFFICE

    E-Print Network [OSTI]

    Veiga, Pedro Manuel Barbosa

    OKLAHOMA STATE UNIVERSITY BURSAR'S OFFICE RESTRICTED TITLE IV FUND PAYMENT Valid through July 31st, return form to: Oklahoma State University Office of the Bursar 113 Student Union Building Stillwater, Oklahoma 74078 Your authorization may be rescinded at any time by sending a written cancellation request

  16. OKLAHOMA STATE UNIVERSITY BURSAR'S OFFICE

    E-Print Network [OSTI]

    Veiga, Pedro Manuel Barbosa

    OKLAHOMA STATE UNIVERSITY BURSAR'S OFFICE RESTRICTED PLUS LOAN PAYMENT Valid through July 31st, return form to: Oklahoma State University Office of the Bursar 113 Student Union Building Stillwater, Oklahoma 74078 Your authorization may be rescinded at any time by sending a written cancellation request

  17. Hiring Employers Report Coordinated by the SJSU Career Center

    E-Print Network [OSTI]

    Su, Xiao

    Materials Avaya, Inc. Burr Pilger Mayer Dell Ericsson Genentech, Inc. Salesforce.com Tesla Motors Synaptics

  18. SN 2009ip: CONSTRAINTS ON THE PROGENITOR MASS-LOSS RATE

    SciTech Connect (OSTI)

    Ofek, E. O.; Lin, L.; Goegues, E.; Kouveliotou, C.; Kasliwal, M. M.; Cao, Y.

    2013-05-01

    Some supernovae (SNe) show evidence for mass-loss events taking place prior to their explosions. Measuring their pre-outburst mass-loss rates provides essential information regarding the mechanisms that are responsible for these events. Here we present XMM-Newton and Swift X-ray observations taken after the latest, and presumably the final, outburst of SN 2009ip. We use these observations as well as new near-infrared and visible-light spectra and published radio and visible-light observations to put six independent order-of-magnitude constraints on the mass-loss rate of the SN progenitor prior to the explosion. Our methods utilize the X-ray luminosity, the bound-free absorption, the H{alpha} luminosity, the SN rise time, free-free absorption, and the bolometric luminosity of the outburst detected prior to the explosion. Assuming spherical mass loss with a wind-density profile, we estimate that the effective mass-loss rate from the progenitor was between 10{sup -3} and 10{sup -2} M{sub Sun} yr{sup -1}, over a few years prior to the explosion, with a velocity of {approx}10{sup 3} km s{sup -1}. This mass-loss rate corresponds to a total circumstellar matter (CSM) mass of {approx}0.04 M{sub Sun }, within 6 Multiplication-Sign 10{sup 15} cm of the SN. We note that the mass-loss rate estimate based on the H{alpha} luminosity is higher by an order of magnitude. This can be explained if the narrow-line H{alpha} component is generated at radii larger than the shock radius, or if the CSM has an aspherical geometry. We discuss simple geometries which are consistent with our results.

  19. THE UNIVERSITY OF UTAH OFFICE OF SUSTAINABILITY

    E-Print Network [OSTI]

    Feschotte, Cedric

    THE UNIVERSITY OF UTAH OFFICE OF SUSTAINABILITY THE UNIVERSITY OF UTAH OFFICE OF SUSTAINABILITY THE UNIVERSITY OF UTAH OFFICE OF SUSTAINABILITY GREENERGREENERGREENERGREENERGREENERGREENERGREENERGREENERGREENERGREENERGREENERGREENERFall 2010 - Spring 2011 GREENERGREENERGREENERGREENERGREENERGREENER Working for a Sustainable Campus

  20. Office of Technology Transfer Material Transfer Agreements

    E-Print Network [OSTI]

    Tullos, Desiree

    Office of Technology Transfer · Material Transfer Agreements · Confidentiality Agreements · Copyright / Patent Licensing The Office of Technology Transfer facilitates the transfer of innovations out of the university for public benefit TOOLS #12;Office of Technology Transfer Facilitating transfer of innovations

  1. 4-H Club Officer Handbook - Reporter 

    E-Print Network [OSTI]

    Howard, Jeff W.

    2006-08-09

    This section from the 4-H Club Officer Handbook features the multi-faceted role of the Reporter/Public Relations Officer. Tips on covering the news and dealing with your local media are essential to the officer's success ...

  2. Office of the Chief Information Officer | Department of Energy

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformationJesseworkSURVEY UNIVERSEHowScientific andComplexOffice ofOffice|Office

  3. Office of the Chief Human Capital Officer | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative Fuels Data CenterFinancialInvesting inServices » NEPANewsOffice ofOffice ofOffice of

  4. The Energy Department's Geothermal Technologies Office Releases...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    The Energy Department's Geothermal Technologies Office Releases 2013 Annual Report The Energy Department's Geothermal Technologies Office Releases 2013 Annual Report February 7,...

  5. Geothermal Technologies Office 2015 Peer Review

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    | US DOE Geothermal Office eere.energy.gov Geothermal Technologies Office 2015 Peer Review Sustainability of Shear-Induced Permeability for EGS Reservoirs - A Laboratory...

  6. Daniel Lee Cloyd named Counterintelligence Office

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    FBI officer accepts LANL counterintelligence post November 10, 2010 Daniel Lee Cloyd named Counterintelligence Office leader LOS ALAMOS, New Mexico, November 10, 2010-Daniel Lee...

  7. Vehicle Technologies Office: 2014 Electric Drive Technologies...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Vehicle Technologies Office: 2014 Electric Drive Technologies Annual Progress Report Vehicle Technologies Office: 2014 Electric Drive Technologies Annual Progress Report The...

  8. Innovative Office Lighting System with Integrated Spectrally...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    an innovative LED office lighting system solution that integrates light delivery, optics, and controls for energy efficiency and occupant health and well-being. The office...

  9. Vehicle Technologies Office: AVTA - Evaluating National Parks...

    Energy Savers [EERE]

    Office: AVTA - Evaluating National Parks and Forest Service Fleets for Plug-in Electric Vehicles Vehicle Technologies Office: AVTA - Evaluating National Parks and Forest...

  10. Vehicle Technologies Office Merit Review 2014: Understanding...

    Energy Savers [EERE]

    Vehicle Technologies Office Merit Review 2014: Understanding Protective Film Formation on Magnesium Alloys in Automotive Applications Vehicle Technologies Office Merit Review 2014:...

  11. Native American Finance Officers Association Conference | Department...

    Office of Environmental Management (EM)

    Native American Finance Officers Association Conference Native American Finance Officers Association Conference March 5, 2012 - 5:50pm Addthis This event will take place on March...

  12. DOL: Office of the Ombudsman for EEOICPA

    Broader source: Energy.gov [DOE]

    The Office of the Ombudsman for the Energy Employees Occupational Illness Compensation Program is an independent office within the Department of Labor that provides assistance and information to...

  13. Independent Oversight Review, Savannah River Operations Office...

    Office of Environmental Management (EM)

    Savannah River Operations Office - July 2013 Independent Oversight Review, Savannah River Operations Office - July 2013 July 2013 Review of the Employee Concerns Program at the...

  14. Quality New Mexico recognizes Community Programs Office

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Quality New Mexico recognizes Community Programs Office March 6, 2012 LOS ALAMOS, New Mexico, March 6, 2012-Los Alamos National Laboratory's Community Programs Office received...

  15. ORISE Resources: Medical Office Preparedness Planner

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    partnership with CDC yields Medical Office Preparedness Planner for Primary Care Providers The Medical Office Preparedness Planner is a tool for primary care providers (PCPs) and...

  16. Project Management Coordination Office Organization Chart | Department...

    Office of Environmental Management (EM)

    Office Organization Chart, U.S. Department of Energy's Office of Energy Efficiency and Renewable Energy. pmeorgchart101013.pdf More Documents & Publications Management Reform...

  17. Office of Security Assessments | Department of Energy

    Energy Savers [EERE]

    Security Assessments Office of Security Assessments MISSION The Office of Security Assessments is responsible for the independent evaluation of the effectiveness of safeguards and...

  18. Office of Indian Energy Policy and Programs Office of Energy...

    Office of Environmental Management (EM)

    DOE Office of Indian Energy Director-Chris Deschene 9:30-10:30 a.m. Introductions and Logistics - Sherry Stout -NREL 10:30-10:45 a.m. Summary of Tribal Leader Forum - Sarai...

  19. Office of the Chief Financial Officer | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative Fuelsof EnergyApril 2014DepartmentCouncilOffice of the Chief Financial Officer

  20. Sustainability Office University of Canterbury

    E-Print Network [OSTI]

    Hickman, Mark

    2014-2022 Sustainability Office University of Canterbury 11/6/2014 University of Canterbury Cycle ............................................................................................. 6 Encouragement of Sustainable Transport: 75th Percentile................................. 8 Encouragement of Sustainable Transport: General Campus Population..... 10 Summary

  1. Director, Office of Laboratory Policy

    Broader source: Energy.gov [DOE]

    The Office of Science is the single largest supporter of basic research in the physical sciences in the United States, providing more than 40 percent of total funding for this vital area of...

  2. DB-Netz AG Offices

    High Performance Buildings Database

    Hamm, Germany The new office building for DB Netz AG was designed by the collaborative team of Architrav Architects and the Buildings Physics and Technical Building Services group of the University of Karlsruhe. The team developed an energy efficient building concept for the 64,304 sqft office building, located in Hamm, Germany. The design concept of the building is dominated by architectural solutions for ventilation, cooling and lighting. Use of HVAC and electric lighting is minimized as much as possible.

  3. Filter!Demonstration Microwave!Office

    E-Print Network [OSTI]

    Filter!Demonstration in Microwave!Office muse #12;Objectives · Demonstrate!project!setup!in!Microwave

  4. Office of Classroom Management 2011 Annual Report

    E-Print Network [OSTI]

    Ciocan-Fontanine, Ionut

    Office of Classroom Management 2011 Annual Report Office of Classroom Management · Academic Support Director, Office of Classroom Management Charts/graphs Table of Contents 1 2 3 4 5 6 7 8 9 10 11 12 13 14 Office of Classroom Management 2011 Annual Report #12;1 2011 OCM Annual Report OCM's functions Scheduling

  5. UNLV OFFICE OF INFORMATION TECHNOLOGY RESPONSIBLE ADMINISTRATOR

    E-Print Network [OSTI]

    Walker, Lawrence R.

    UNLV OFFICE OF INFORMATION TECHNOLOGY RESPONSIBLE ADMINISTRATOR: RESPONSIBLE OFFICE(S): ORIGINALLY IsSUED: APPROVALS: VICE PROVOST FOR'INFORMATION TECHNOLOGY -.·..-; - OFFICE OF THE VICE PR~OST FOR INFORMATION TECHNOLOGY COMPUTER MANAGEMENT POLICY ApPROVED BY: j1/1q/;~ ~I Date REVISION DATE: NA STATEMENT

  6. OFFICE OF INFORMATION TECHNOLOGY COMPUTER SECURITY POLICY

    E-Print Network [OSTI]

    Walker, Lawrence R.

    OFFICE OF INFORMATION TECHNOLOGY COMPUTER SECURITY POLICY RESPONsmLE ADMINISTRATOR: RESPONsmLE OFFICE(S): ORIGINALLY ISSUED: ApPROVALS: VICE PROVOST FOR INFORMATION TECHNOLOGY OFFICE OF THE VICE PROVOST FOR INFORMATION TECHNOLOGY ApPROVED BY: ~ Date ~ts-tl2- Date li/rO/I?... I I Date REVISION DATE

  7. Office of Executive Resources Office of the Chief Human Capital Officer

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURINGEnergy Bills and ReduceNovemberDOE's PrioritiesOctober 2013CommentsOfficeOffice of

  8. A closer look at the fluctuations in the brightness of SN 2009IP during its late 2012 eruption

    SciTech Connect (OSTI)

    Martin, J. C. [Barber Observatory, University of Illinois Springfield, Springfield, IL 62704 (United States); Hambsch, F.-J. [Remote Observatory, Atacama Desert, Chile Vereniging Voor Sterrenkunde (VVS), Oude Bleken 12, B-2400 Mol (Belgium); Margutti, R.; Soderberg, A. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02318 (United States); Tan, T. G. [Perth Exoplanet Survey Telescope, Perth (Australia); Curtis, I., E-mail: jmart5@uis.edu [Adelaide (Australia)

    2015-01-01

    The supernova (SN) impostor SN 2009ip has re-brightened several times since its initial discovery in 2009 August. During its last outburst in late 2012 September, it reached a peak brightness of m{sub v} ?13.5 (M{sub v} brighter than ?18), causing some to speculate that it had undergone a terminal core-collapse SN. Relatively high-cadence multi-wavelength photometry of the post-peak decline revealed bumps in brightness infrequently observed in other SNe IIn. These bumps occurred synchronously in all ultraviolet (UV) and optical bands with amplitudes of 0.1–0.4 mag at intervals of 10–30 days. Episodic continuum brightening and dimming in the UV and optical with these characteristics is not easily explained within the context of models that have been proposed for the late September 2012 outburst of SN 2009ip. We also present evidence that the post-peak fluctuations in brightness occur at regular intervals and raise more questions about their origin.

  9. Fermilab | Directorate | Program Planning Office

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverse (Journal Article) | SciTech ConnectTimothyOffices Office ofProgram

  10. ATF2 ULTRA-LOW IP BETAS PROPOSAL R. Tomas, H. Braun, J.P. Delahaye, E. Marn, D. Schulte, F. Zimmermann, CERN

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    ATF2 ULTRA-LOW IP BETAS PROPOSAL R. Tom´as, H. Braun, J.P. Delahaye, E. Mar´n, D. Schulte, F at these ultra-low IP betas. INTRODUCTION ATF2 is a test facility with the aim of testing the FFS design that has Design 0.1 1.0 19000 ATF2 ultra-low Proposed 0.025 1.0 76000 CLIC 3TeV Design 0.09 3.5 63000 ILC Design 0

  11. Office Ergonomics: Setting Up Your Workstation Office of Environmental Health & Safety: www.ehs.utoronto.ca, ehs.office@utoronto.ca, 416.978.4467

    E-Print Network [OSTI]

    Chan, Hue Sun

    Office Ergonomics: Setting Up Your Workstation Office of Environmental Health & Safety: www. Turn the page #12;Office Ergonomics: Setting Up Your Workstation Office of Environmental Health Ddddddddddddddddd Office Ergonomics: Dos & Don'ts Do take the Online Office Ergonomics course which provides more

  12. Partnering Policy for the Office of Environmental Management...

    Office of Environmental Management (EM)

    Policy for the Office of Environmental Management Partnering Policy for the Office of Environmental Management Partnering Policy for the Office of Environmental Management More...

  13. Fuel Cell Technologies Office Newsletter: May 2015 | Department...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Fuel Cell Technologies Office Newsletter: May 2015 Fuel Cell Technologies Office Newsletter: May 2015 The May 2015 issue of the Fuel Cell Technologies Office (FCTO) newsletter...

  14. NA GC - Office of General Counsel | National Nuclear Security...

    National Nuclear Security Administration (NNSA)

    Blog Home About Us Our Operations Management and Budget Office of Civil Rights Workforce Statistics NA GC - Office of General Counsel NA GC - Office of General Counsel...

  15. Savannah River Field Office | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Us Our Operations Management and Budget Office of Civil Rights Workforce Statistics Savannah River Field Office Savannah River Field Office FY15 Semi Annual Report...

  16. NA 1 - Immediate Office of the Administrator | National Nuclear...

    National Nuclear Security Administration (NNSA)

    Us Our Operations Management and Budget Office of Civil Rights Workforce Statistics NA 1 - Immediate Office of the Administrator NA 1 - Immediate Office of the...

  17. Kansas City Field Office | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Us Our Operations Management and Budget Office of Civil Rights Workforce Statistics Kansas City Field Office Kansas City Field Office FY15 Semi Annual Report FY14...

  18. Los Alamos Field Office | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Us Our Operations Management and Budget Office of Civil Rights Workforce Statistics Los Alamos Field Office Los Alamos Field Office FY15 Semi Annual Report FY14 Year...

  19. 2013 Annual Planning Summary for the Office of River Protection...

    Energy Savers [EERE]

    River Protection and Richland Operations Office 2013 Annual Planning Summary for the Office of River Protection and Richland Operations Office The ongoing and projected...

  20. 2015 Building Technologies Office Program Peer Review Report...

    Office of Environmental Management (EM)

    Building Technologies Office Program Peer Review Report 2015 Building Technologies Office Program Peer Review Report The 2015 Building Technologies Office Program Peer Review...

  1. 2014 Building Technologies Office Program Peer Review Report...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    4 Building Technologies Office Program Peer Review Report 2014 Building Technologies Office Program Peer Review Report The 2014 Building Technologies Office Program Peer Review...

  2. Office of Energy Efficiency and Renewable Energy's Integrated...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Office of Energy Efficiency and Renewable Energy's Integrated Resource and Information System DOEIG-0905 April 2014 U.S. Department of Energy Office of Inspector General Office of...

  3. California Employment Growth and Office, Industrial, and Retail Markets, 1990

    E-Print Network [OSTI]

    Kroll, Cynthia; Tamura, Dina

    1990-01-01

    Office, Industrial, and Retail Markets, 1990 HE Californiastate's major office and retail markets. Services employmentstate's major office and retail markets." Like manufacturing

  4. US Department of Energy Office of Energy Efficiency and Renewable...

    Open Energy Info (EERE)

    US Department of Energy Office of Energy Efficiency and Renewable Energy (DOE EERE) Jump to: navigation, search Logo: Office of Energy Efficiency and Renewable Energy Name: Office...

  5. TO: Procurement Directors/Contracting Officers FROM: Director

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    0 DATE: May 30, 2014 TO: Procurement DirectorsContracting Officers FROM: Director Contract and Financial Assistance Policy Division Office of Policy Office of Procurement and...

  6. TO: Procurement Directors/Contracting Officers FROM: Director

    Broader source: Energy.gov (indexed) [DOE]

    4 DATE: July 7, 2014 TO: Procurement DirectorsContracting Officers FROM: Director Contract and Financial Assistance Policy Division Office of Policy Office of Procurement and...

  7. Department of Energy Office of Science Transportation Overview...

    Office of Environmental Management (EM)

    Energy Office of Science Transportation Overview Department of Energy Office of Science Transportation Overview Overview of the Office of Science for Transportation. Department of...

  8. DOE Fuel Cell Technologies Office: 2013 Fuel Cell Seminar and...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Office: 2013 Fuel Cell Seminar and Energy Exposition DOE Fuel Cell Technologies Office: 2013 Fuel Cell Seminar and Energy Exposition Overview of DOE's Fuel Cell Technologies Office...

  9. About the Sustainability Performance Office | Department of Energy

    Energy Savers [EERE]

    the Sustainability Performance Office About the Sustainability Performance Office The U.S. Department of Energy (DOE) Sustainability Performance Office (SPO) oversees departmental...

  10. Chicago Office NEPA Tracking Number U. S. DEPARTMENT OF ENERGY

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    CH F 560-ACQ (1105) Previous editions are obsolete. Chicago Office NEPA Tracking Number U. S. DEPARTMENT OF ENERGY OFFICE OF SCIENCE -- CHICAGO OFFICE NATIONAL ENVIRONMENTAL...

  11. Independent Oversight Review of the NNSA Production Office Readiness...

    Energy Savers [EERE]

    Independent Oversight Review of the NNSA Production Office Readiness Review Program February 2014 Office of Safety and Emergency Management Evaluations Office of Enforcement and...

  12. Occupational Health Manager PIA, Carlsbad Field Office | Department...

    Energy Savers [EERE]

    Occupational Health Manager PIA, Carlsbad Field Office Occupational Health Manager PIA, Carlsbad Field Office Occupational Health Manager PIA, Carlsbad Field Office PDF icon...

  13. Information Security Office Risk Management

    E-Print Network [OSTI]

    Alpay, S. Pamir

    Information Security Office Risk Management Exception Template #12;Risk Management Exception or Approved) 6/01/2013 CISO Jason Pufahl, CISO Approved 6/01/2013 RMAC Risk Management Advisory Council Reviewed #12;Risk Management Exception Template 2 | P a g e Please check one of the following: Requester

  14. Office: ITO PE/Project

    E-Print Network [OSTI]

    Mills, Kevin

    Mgr.: Mills/Swinson PAD No.: Smart Spaces Moving Through Smart Spaces "city-wide appliances" "in1 DARPA Office: ITO PE/Project: Pgm No.: Pgm Mgr.: Mills/Swinson PAD No.: Smart Spaces Personal Information Projection · Develop techniques for projecting personal information from cyberspace into smart

  15. OFFICE OF SUPPLIER DIVERSITY DEVELOPMENT

    E-Print Network [OSTI]

    Pittendrigh, Barry

    OFFICE OF SUPPLIER DIVERSITY DEVELOPMENT STRATEGIC PLAN JESSE MOORE, MANAGER August, 2005 Mission Statement Provide leadership and develop relationships that will result in Purdue's campus' supplier base is a recognized national leader in developing a diverse supplier base. All staff involved with purchasing

  16. ACCELERATING VERY FAST GAS IN THE SUPERNOVA IMPOSTOR SN 2009ip WITH JETS FROM A STELLAR COMPANION

    SciTech Connect (OSTI)

    Tsebrenko, Danny; Soker, Noam E-mail: soker@physics.technion.ac.il

    2013-11-10

    Using hydrodynamic numerical simulations we show that high-velocity ejecta with v ? 10{sup 4} km s{sup –1} in the outbursts of the supernova impostor SN 2009ip and similar luminous blue variable (LBV) stars can be explained by the interaction of fast jets, having v {sub jet} ? 2000-3000 km s{sup –1}, with a circumbinary shell (extended envelope). The density profile in the shell is very steep such that the shock wave, that is excited by the jets' interaction with the shell, accelerates to high velocities as it propagates outward. The amount of very fast ejecta is small, but sufficient to account for some absorption lines. Such an extended envelope can be formed from the binary interaction and/or the unstable phase of the LBV primary star. The jets themselves are launched by the more compact secondary star near periastron passages.

  17. Director, Salt Waste Processing Facility Project Office

    Broader source: Energy.gov [DOE]

    This position is located within The Department of Energy (DOE) Savannah River (SR) Operations Office, Salt Waste Processing Facility Project Office (SWPFPO). SR is located in Aiken, South Carolina....

  18. DOE Office of Indian Energy Overview Brochure

    Office of Energy Efficiency and Renewable Energy (EERE)

    The U.S. Department of Energy (DOE) Office of Indian Energy Stengthening Tribal Communities, Sustaining Future Generations is an overview brochure with information on the Office of Indian Energy's education and capacity building, technical assistance, and resources for tribes.

  19. New Mexico State University Controller's Office

    E-Print Network [OSTI]

    Johnson, Eric E.

    New Mexico State University Controller's Office MOU Remote Document Submission - Version B CO by the Remote Office or are of no value are destroyed according to New Mexico Administrative Codes (NMAC

  20. 4-H Club Officer Handbook - Parliamentarian 

    E-Print Network [OSTI]

    Howard, Jeff W.

    2006-08-09

    This section from the 4-H Club Officer Handbook features the multi-faceted role of the Parliamentarian. It covers the officer's duties, including how to keep order at club meetings through making and amending motions. ...

  1. 4-H Club Officer Handbook - Secretary 

    E-Print Network [OSTI]

    Howard, Jeff W.

    2006-08-09

    This section from the 4-H Club Officer Handbook features the multi-faceted role of the Secretary. It covers the officer's duties, including how to get organized for the start of your 4-H Club year. Other highlights include ...

  2. Finance and Enterprises Office February 2014

    E-Print Network [OSTI]

    Tam, Vincent W. L.

    Finance and Enterprises Office February 2014 Office Management Student matters Insurance HKU SPACE Planning & Management Associate Director of Finance ----------------------------------- Antony Hui Associate Director of Finance ----------------------------------- Edmund Li Assistant Director of Finance

  3. Division, NN-43, Office of Arms Control

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    as a Presiding Officer, and will not be re- sponsible to or subject to the super- vision or direction of any officer or em- ployee engaged in the performance of an...

  4. The University of Vermont Office of Admissions

    E-Print Network [OSTI]

    Bermingham, Laura Hill

    1 The University of Vermont Office of Admissions DISCOVERING UVM: Strong Voices, Open Minds are optional modes of transportation to Burlington, Vermont: Airlines Continental Airlines www Bushey University of Vermont, Office of Admissions 194 South Prospect St., Burlington, Vermont 05401

  5. Energy use in office buildings

    SciTech Connect (OSTI)

    None

    1980-10-01

    This is the report on Task IB, Familiarization with Additional Data Collection Plans of Annual Survey of BOMA Member and Non-Member Buildings in 20 Cities, of the Energy Use in Office Buildings project. The purpose of the work was to monitor and understand the efforts of the Building Owners and Managers Association International (BOMA) in gathering an energy-use-oriented data base. In order to obtain an improved data base encompassing a broad spectrum of office space and with information suitable for energy analysis in greater detail than is currently available, BOMA undertook a major data-collection effort. Based on a consideration of geographic area, climate, population, and availability of data, BOMA selected twenty cities for data collection. BOMA listed all of the major office space - buildings in excess of 40,000 square feet - in each of the cities. Tax-assessment records, local maps, Chamber of Commerce data, recent industrial-development programs, results of related studies, and local-realtor input were used in an effort to assemble a comprehensive office-building inventory. In order to verify the accuracy and completeness of the building lists, BOMA assembled an Ad-Hoc Review Committee in each city to review the assembled inventory of space. A questionnaire on office-building energy use and building characteristics was developed. In each city BOMA assembled a data collection team operating under the supervision of its regional affiliate to gather the data. For each city a random sample of buildings was selected, and data were gathered. Responses for over 1000 buildings were obtained.

  6. A two-step route to planar perovskite cells exhibiting reduced hysteresis Alexander H. Ip, Li Na Quan, Michael M. Adachi, Jeffrey J. McDowell, Jixian Xu, Dong Ha Kim, and Edward H.

    E-Print Network [OSTI]

    Sargent, Edward H. "Ted"

    A two-step route to planar perovskite cells exhibiting reduced hysteresis Alexander H. Ip, Li Na-efficiency planar perovskite solar cells Appl. Phys. Lett. 104, 253508 (2014); 10.1063/1.4885367 Dominating to IP: 142.150.235.171 On: Mon, 08 Jun 2015 18:21:31 #12;A two-step route to planar perovskite cells

  7. Mathematics Business Office - Department of Mathematics, Purdue ...

    E-Print Network [OSTI]

    $author.value

    Mathematics Business Office. Welcome to new faculty · Moving Procedures · Forms · Travel; Research. Pre-Award Center · Vice President for Research ...

  8. Advanced Manufacturing Office Overview | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Office Overview mwrfworkshopjuly2012.pdf More Documents & Publications Microwave and Radio Frequency Workshop Manufacturing Demonstration Facility Workshop...

  9. Hudson Valley Clean Energy Office and Warehouse

    High Performance Buildings Database

    Rhinebeck, NY Hudson Valley Clean Energy's new head office and warehouse building in Rhinebeck, New York, achieved proven net-zero energy status on July 2, 2008, upon completing its first full year of operation. The building consists of a lobby, meeting room, two offices, cubicles for eight office workers, an attic space for five additional office workers, ground- and mezzanine-level parts and material storage, and indoor parking for three contractor trucks.

  10. Office of Classification | Department of Energy

    Office of Environmental Management (EM)

    Classification Officers, HQ Classification Representatives, Secret Original Classifiers, Top Secret Derivative Classifiers, HQ Derivative Classifiers and HQ UCNI Reviewing...

  11. Vehicle Technologies Office: Maximizing Alternative Fuel Vehicle...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Maximizing Alternative Fuel Vehicle Efficiency Vehicle Technologies Office: Maximizing Alternative Fuel Vehicle Efficiency Besides their energy security and environmental benefits,...

  12. Office of Environmental Protection, Sustainability Support &...

    Energy Savers [EERE]

    Environmental Protection, Sustainability Support & Corporate Safety Analysis Office of Environmental Protection, Sustainability Support & Corporate Safety Analysis Mission The...

  13. Office of Research Opportunity | The Ames Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Research Opportunity The Office of Research Opportunities (ORO) is responsible for identifying and disseminating Funding Opportunity Announcements, coordinating complex or...

  14. University of Minnesota Office of Classroom Management

    E-Print Network [OSTI]

    Thomas, David D.

    University of Minnesota Office of Classroom Management "Low End" Asynchronous Videostreaming Pilot Office of Classroom Management "Low End" Asynchronous Videostreaming Pilot Project Evaluation Contents and testing of "low end" asynchronous video streaming as a Phase III in The Office of Classroom Management

  15. Office of the President University Policy

    E-Print Network [OSTI]

    Fernandez, Eduardo

    supervisor, the Office of the Inspector General or the Office of the General Counsel. Suspected fraud, waste complaint form on the Office of Inspector General's website - http://www.fau.edu/admin/oig/complaint.php. IV these activities and/or make them easier to detect and prevent; and provide for the reporting and investigation

  16. Table of Contents 3 Officers and Administration

    E-Print Network [OSTI]

    He, Chuan

    #12;Table of Contents 3 Officers and Administration 7 The Field and the School 15 Educational Agencies 176 SSA Calendar 178 Index #12;School of Social Service Administration 3 Officers and Administration Officers of the University Andrew M. Alper, Chairman of the Board of Trustees Robert J. Zimmer

  17. Abstract--Broadcast TV distribution over an IP network requires stringent QoS constraints, such as low latency and loss.

    E-Print Network [OSTI]

    Yuksel, Murat

    -wire or tunnel in parallel to the IP adjacencies (links) along the forwarding path used by the PIM tree. For each such tunnel both a primary and backup path are defined. The backup path is Layer-1-disjoint from the physical are transparent to the Interior Gateway Protocol (IGP). Although one may choose the back-up path's IGP link

  18. 978-1-4244-5489-1/10/ $26.00 2010 IEEE Abstract--Broadcast TV distribution over an IP network

    E-Print Network [OSTI]

    Yuksel, Murat

    ) is a proven failure restoration technique. Link-based FRR creates a pseudo-wire or tunnel in parallel to the IP adjacencies (links); and thus, single link failures are transparent to the Interior Gateway combined with the Internal Gateway Protocol (IGP) reconfiguration process (which may take several seconds

  19. Msc. Project in Ecology and Evolution or Climate Sciences Paleoecology Group, IPS and OCCR, Dr. Paul Henne and Prof. Willy Tinner

    E-Print Network [OSTI]

    Bern, Universität

    Msc. Project in Ecology and Evolution or Climate Sciences Paleoecology Group, IPS and OCCR, Dr. Paul Henne and Prof. Willy Tinner Applying paleoecological data to improve simulations of tree regeneration in Swiss forests Paleoecology and ecological modeling are powerful tools for studying climate

  20. Office of Marine and Aviation Operations NOAA's Office of Marine and Aviation Operations

    E-Print Network [OSTI]

    Office of Marine and Aviation Operations NOAA's Office of Marine and Aviation Operations (OMAO) 101 2015 #12;Office of Marine and Aviation Operations For future questions and information on OMAO://www.legislative.noaa.gov/. #12;Office of Marine and Aviation Operations Director, OMAO and the NOAA Corps Rear Admiral David A

  1. Standards Panel: 1. Stephen Diamond, General Manager, Industry Standards Office and Global Standards Officer, EMC

    E-Print Network [OSTI]

    Standards Panel: 1. Stephen Diamond, General Manager, Industry Standards Office and Global was President of the IEEE Computer Society. Steve is General Manager of the Industry Standards Office at EMC Standards Officer, EMC Corporation, Office of the CTO Steve Diamond has 30 years of management, marketing

  2. Office of the Chief Information Officer | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative Fuelsof EnergyApril 2014DepartmentCouncilOffice of the Chief Financial

  3. Vehicle Technologies Office Merit Review 2014: Vehicle & Systems...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Vehicle Technologies Office Merit Review 2014: Vehicle & Systems Simulation & Testing Vehicle Technologies Office Merit Review 2014: Vehicle & Systems Simulation & Testing...

  4. Advanced Manufacturing Office, U.S. Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    materials Advanced Manufacturing Office Advanced Manufacturing Office Battery and Supercapacitors: A technology capable of transforming many industries including vehicles systems...

  5. Chicago Operations Office: Technology summary

    SciTech Connect (OSTI)

    Not Available

    1994-12-01

    This document has been prepared by the Department of Energy`s (DOE) Environmental Management (EM) Office of Technology Development (OTD) to highlight its research, development, demonstration, testing, and evaluation (RDDT and E) activities funded through the Chicago Operations Office. Technologies and processes described have the potential to enhance DOE`s cleanup and waste management efforts, as well as improve US Industry`s competitiveness in global environmental markets. The information has been assembled from recently produced OTD documents which highlight technology development activities within each of the OTD program elements. OTD technologies addresses three specific problem areas: (1) groundwater and soils cleanup; (2) waste retrieval and processing; and (3) pollution prevention. These problems are not unique to DOE, but are associated with other Federal agency and industry sites as well. Thus, technical solutions developed within OTD programs will benefit DOE, and should have direct applications in outside markets.

  6. Office of Executive Resources Office of the Chief Human Capital Officer

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURINGEnergy Bills and ReduceNovemberDOE's PrioritiesOctober 2013 NewsOctober Office of

  7. Office of Executive Resources Office of the Chief Human Capital Officer

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURINGEnergy Bills and ReduceNovemberDOE's PrioritiesOctober 2013 NewsOctober Office of

  8. Office of Executive Resources Office of the Chief Human Capital Officer

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURINGEnergy Bills and ReduceNovemberDOE's PrioritiesOctober 2013CommentsOffice of

  9. Office of Executive Resources Office of the Chief Human Capital Officer

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURINGEnergy Bills and ReduceNovemberDOE's PrioritiesOctober 2013CommentsOffice

  10. Office of the Chief Human Capital Officer | Department of Energy

    Broader source: All U.S. Department of Energy (DOE) Office Webpages

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.Theory of rare Kaonforsupernovae model (JournalHearingsHuman Capital Officer Search

  11. Office of the Chief Information Officer | Department of Energy

    Broader source: All U.S. Department of Energy (DOE) Office Webpages

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.Theory of rare Kaonforsupernovae model (JournalHearingsHuman Capital Officer

  12. Office of the Chief Financial Officer Organization Chart | Department of

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirley Ann JacksonDepartment ofOffice|in the subsurfaceSecurityMissionEnergy Efficiency

  13. OFFICE,

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth DakotaRobbins and700 GJO-2003-411-TAC GJO-PIN~$ ., .,. ' e' , U .S

  14. Carlsbad Area Office strategic plan

    SciTech Connect (OSTI)

    NONE

    1995-10-01

    This edition of the Carlsbad Area Office Strategic Plan captures the U.S. Department of Energy`s new focus, and supercedes the edition issued previously in 1995. This revision reflects a revised strategy designed to demonstrate compliance with environmental regulations earlier than the previous course of action; and a focus on the selected combination of scientific investigations, engineered alternatives, and waste acceptance criteria for supporting the compliance applications. An overview of operations and historical aspects of the Waste Isolation Pilot Plant near Carlsbad, New Mexico is presented.

  15. Budget Office | The Ames Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room News PublicationsAudits &Bradbury Science Museum -Brooklin Gore About--BuckleBudget Office

  16. Ombuds Office Location & Hours

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformationJesseworkSURVEY UNIVERSEHowScientificOmbuds Office Location & Hours Ombuds

  17. DOE Loan Programs Office Update

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy A plug-in electric vehicle10nominate anDepartment ofTraining|Loan Programs Office

  18. Evaluation of Energy Concepts for Office Buildings 

    E-Print Network [OSTI]

    Fisch, M.; Norbert, M.; Plesser, S.

    2005-01-01

    synonym for innovative office buildings in Germany over the last 10 years. Since almost no reliable results of measurement and verification have been made public on the performance of these buildings – often very prominent company headquarters... buildings and analysed existing data on energy consumption suggest that glassed office buildings do not generally have a significantly higher energy consumption than regular office buildings. Introduction Over the last 10 years, some research...

  19. Ergonomic Evaluation for Office Workers Name: Date

    E-Print Network [OSTI]

    Slatton, Clint

    Ergonomic Evaluation for Office Workers Name: Date: Department: Campus Box #: Telephone Number: Fax Number: Building: Room Number: Email Address: Supervisor: Evaluation Date/Time: Symptoms : Respond

  20. Vehicle Technologies Office: Financial Opportunities - Active...

    Office of Environmental Management (EM)

    in the table below. Technology Solicitation Title Open Date Close Date Hydrogen and Fuel Cells Hydrogen and Fuel Cell Technologies Research, Development, and Demonstrations Office...

  1. Vehicle Technologies Office: Advanced Vehicle Testing Activity...

    Energy Savers [EERE]

    (AVTA) Data and Results The Vehicle Technologies Office (VTO) supports work to develop test procedures and carry out testing on a wide range of advanced vehicles and technologies...

  2. Office of Energy Efficiency and Renewable Energy

    Office of Environmental Management (EM)

    energy.govdiversity The Parker Ranch installation in Hawaii Office of Small and Disadvantaged Business Utilization (OSDBU) USWCC ASBCC Energy Connect Network - March 7, 2013...

  3. FBI officer accepts LANL counterintelligence post

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    LANL counterintelligence FBI officer accepts LANL counterintelligence post Cloyd has most recently served as assistant director of the Counterintelligence Division of the Federal...

  4. Quality New Mexico recognizes Community Programs Office

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    CPO receives Pion recognition Quality New Mexico recognizes Community Programs Office LANL has received 14 Pion and Roadrunner recognitions from Quality New Mexico since 1997....

  5. Categorical Exclusion Determinations: Office of Energy Efficiency...

    Energy Savers [EERE]

    Energy Efficiency and Renewable Energy Categorical Exclusion Determinations: Office of Energy Efficiency and Renewable Energy Categorical Exclusion Determinations issued by Energy...

  6. Vehicle Technologies Office: 2011 Advanced Power Electronics...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Power Electronics and Electric Motors R&D Annual Progress Report Vehicle Technologies Office: 2011 Advanced Power Electronics and Electric Motors R&D Annual Progress Report The...

  7. Vehicle Technologies Office: 2012 Advanced Power Electronics...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    2 Advanced Power Electronics and Electric Motors R&D Annual Progress Report Vehicle Technologies Office: 2012 Advanced Power Electronics and Electric Motors R&D Annual Progress...

  8. Vehicle Technologies Office: 2010 Advanced Power Electronics...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Power Electronics and Electric Motors R&D Annual Progress Report Vehicle Technologies Office: 2010 Advanced Power Electronics and Electric Motors R&D Annual Progress Report The...

  9. Vehicle Technologies Office | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Read more The U.S. Department of Energy's Vehicle Technologies Office supports research, development (R&D), and deployment of efficient and sustainable highway transportation...

  10. New Mexico State University Controller's Office

    E-Print Network [OSTI]

    Johnson, Eric E.

    New Mexico State University Controller's Office MOU Remote Document Submission - Version A CO according to New Mexico Administrative Codes (NMAC) and NMSU Records Management and Retention (NMSU RMR

  11. Office of Legacy Management ? Post Competition Accountability...

    Office of Environmental Management (EM)

    Organization Proposal 2012 This report serves as an official record of the quarterly cost, personnel, and performance information for the Office of Legacy Management to satisfy...

  12. Vehicle Technologies Office Merit Review 2015: Transportation...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Transportation Energy Data Book, Vehicle Technologies Market Report, and VT Fact of the Week Vehicle Technologies Office Merit Review 2015: Transportation Energy Data Book, Vehicle...

  13. Vehicle Technologies Office Merit Review 2014: Transportation...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Transportation Energy Data Book, Vehicle Technologies Market Report, and VT Fact of the Week Vehicle Technologies Office Merit Review 2014: Transportation Energy Data Book, Vehicle...

  14. Vehicle Technologies Office: AVTA - Evaluating Military Bases...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Military Bases and Fleet Readiness for Electric Vehicles Vehicle Technologies Office: AVTA - Evaluating Military Bases and Fleet Readiness for Electric Vehicles The Vehicle...

  15. Jefferson Lab Chief Operating Officer - Stockroom

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Stockroom Privacy and Security Notice Skip over navigation search Chief Operating Officer Please upgrade your browser. This site's design is only visible in a graphical browser...

  16. Office of Communication - Talk to Fermilab

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Home | Office of Communication Staff | Speakers' Bureau | Available Materials Links | Talk to Fermilab | Internal Communication Forum Internal Communication Forum Name: Email:...

  17. Bioenergy Technologies Office Program Management Review

    Broader source: Energy.gov [DOE]

    The Bioenergy Technologies Office will be hosting its biennial Program Management Peer Review on June 25, 2015 at the Walter E. Washington Convention Center.

  18. WIND AND WATER POWER TECHNOLOGIES OFFICE

    Broader source: Energy.gov (indexed) [DOE]

    AND WATER POWER TECHNOLOGIES OFFICE August 20, 2014 2 2013 Wind Technologies Market Report Purpose, Scope, and Data: * Publicly available annual report summarizing key trends in...

  19. Sustainability Performance Office | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    Argonne National Laboratory's Mira Supercomputer The U.S. Department of Energy (DOE) Sustainability Performance Office (SPO) oversees departmental sustainability efforts...

  20. Vehicle Technologies Office: 2014 Advanced Combustion Engine...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    2014 Advanced Combustion Engine Annual Progress Report Vehicle Technologies Office: 2014 Advanced Combustion Engine Annual Progress Report The Advanced Combustion Engine research...

  1. Vehicle Technologies Office: 2014 Advanced Combustion Engine...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Advanced Combustion Engine Annual Progress Report Vehicle Technologies Office: 2014 Advanced Combustion Engine Annual Progress Report The Advanced Combustion Engine research and...

  2. Geothermal Technologies Office Annual Report 2012

    SciTech Connect (OSTI)

    none,

    2012-12-31

    This annual report for the U.S. Department of Energy’s Geothermal Technologies Office highlights program areas, special projects, and accomplishments in 2012.

  3. Christopher Smith Principal Deputy Assistant Secretary Office...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Principal Deputy Assistant Secretary Office of Fossil Energy U.S. Department of Energy Before the Committee on Oversight and Government Reform Subcommittee on Energy Policy, Health...

  4. Secretarial Office: National Nuclear Security Administration

    Office of Environmental Management (EM)

    )Report Number: NA--LASO-LANL-WASTEMGT-2014-0006 After 2003 Redesign Secretarial Office: National Nuclear Security Administration LabSiteOrg: Los Alamos National Laboratory...

  5. Cooperation with the Office of Inspector General

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2001-03-21

    To establish Department of Energy (DOE) policy for cooperating with the Office of Inspector General (OIG). Cancels DOE 2320.1C

  6. Office of Environmental Management MAJOR CONTRACTS SUMMARY

    Office of Environmental Management (EM)

    Contract Period Total Value Contract Description Contract Type Carlsbad Field Office Nuclear Waste Partnership, LLC DE-EM0001971 Base Period 10112 - 93017 1.4B Waste...

  7. Fuel Cell Technologies Office Information Resources | Department...

    Energy Savers [EERE]

    Information Resources Fuel Cell Technologies Office Information Resources Learn about hydrogen and fuel cells, find publications and technical information, view and download...

  8. Vehicle Technologies Office: Power Electronics | Department of...

    Broader source: Energy.gov (indexed) [DOE]

    Office (VTO) is supporting research to lower the cost and improve the performance of power electronics. Vehicle power electronics primarily process and control the flow of...

  9. Vehicle Technologies Office: 2013 Advanced Power Electronics...

    Broader source: Energy.gov (indexed) [DOE]

    Technologies Office (VTO) provides support and guidance for many cutting-edge automotive technologies now under development. Research is focused on developing revolutionary...

  10. Alternate Watch Office | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Alternate Watch Office | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the...

  11. Independent Activity Report, Richland Operations Office - August...

    Office of Environmental Management (EM)

    Activity Report, Richland Operations Office - August 2011 August 2011 Hanford Sludge Treatment Project HIAR-RL-2011-08-25 This Independent Activity Report documents an...

  12. Independent Activity Report, Richland Operations Office - June...

    Office of Environmental Management (EM)

    Independent Activity Report, Richland Operations Office - June 2011 June 2011 Hanford Sludge Treatment Project Review HIAR-RL-2011-06-17 This Independent Activity Report...

  13. Business Requirements Global Office Knowledge Repository (GOKR)

    E-Print Network [OSTI]

    Riabov, Vladimir V.

    .................................................................................................4 3.3.2 Logistics................................................................................................10 5.1 GLOBAL OFFICE ACCOUNT MAINTENANCE.................................................................................11 5.2 EQUIPMENT SUPPLIER ACCOUNT MAINTENANCE

  14. Office of Nuclear Facility Safety Programs

    Broader source: Energy.gov [DOE]

    The Office of Nuclear Facility Safety Programs establishes nuclear safety requirements related to safety management programs that are essential to the safety of DOE nuclear facilities.

  15. Bioenergy Technologies Office (BETO) Announces Renewable Carbon...

    Energy Savers [EERE]

    Office of Energy Efficiency and Renewable Energy (EERE) is to develop and transform biomass resources into commercially viable, high-performance biofuels, bioproducts, and...

  16. Office of Worker Safety and Health Policy

    Office of Energy Efficiency and Renewable Energy (EERE)

    The Office of Worker Safety and Health Policy establishes Departmental expectations for worker safety and health through the development of rules, directives and guidance.

  17. Geothermal Technologies Office 2015 Peer Review

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Well Lithium Carbonate Cooling Water Evaporative Chiller Membrane Silicate Precipitation Nano- Filtration 4 | US DOE Geothermal Office eere.energy.gov 1) Rigorous...

  18. Growing America's Energy Future: Bioenergy Technologies Office...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    made possible by 50 million in cost-shared DOE funding. Bioenergy Successes 2014 BIOENERGY TECHNOLOGIES OFFICE Completed Feedstock Logistics Projects Demonstrate...

  19. Vehicle Technologies Office: 2009 Advanced Power Electronics...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    More Documents & Publications Thermal Performance and Reliability of Bonded Interfaces Vehicle Technologies Office Merit Review 2014: Performance and Reliability of Bonded...

  20. March 2014 Office of Chief Financial Officer DOE/CF-0102

    E-Print Network [OSTI]

    March 2014 Office of Chief Financial Officer DOE/CF-0102 Budget Highlights Department of Energy FY Budget Highlights Printed with soy ink on recycled paper Department of Energy FY 2015 Congressional............................................................................................................................................20 Science and Energy Science

  1. February 2010 Office of Chief Financial Officer DOE/CF-0046

    E-Print Network [OSTI]

    February 2010 Office of Chief Financial Officer DOE/CF-0046 Budget Highlights Department of Energy/CF-0046 Budget Highlights Printed with soy ink on recycled paper Department of Energy FY 2011 ............................................................................................................................................15 Advanced Research Projects Agency - Energy

  2. 4-H Club Officer Handbook - 4-H Health and Safety Officer 

    E-Print Network [OSTI]

    Howard, Jeff W.

    2006-08-09

    This section from the 4-H Club Officer Handbook features the multi-faceted role of the Health and Safety Officer. In addition to a list of the duties, highlights offer ideas for staging health activities at meetings and ...

  3. Office of Institutional Research and Planning | Page i Office of Institutional Research and Planning

    E-Print Network [OSTI]

    Farritor, Shane

    #12;Office of Institutional Research and Planning | Page i Office of Institutional Research and Planning What We Do The Office of Institutional Research and Planning (IRP) supports academic, administrative and physical planning for the institution, and researches and reports information about

  4. Office of the University Faculty Ombuds OFFICE OF THE UNIVERSITY FACULTY OMBUDS

    E-Print Network [OSTI]

    Texas at Austin, University of

    /Directors, Deans, Provost Office, Office of Institutional Equity, Legal Affairs, and other Administrative Officials, and fair administration Offices operations are based upon Code of Ethics and Standards of Practice/procedures that appear problematic n Inform University officials about significant trends, patterns of complaints

  5. 4-H Club Health/Safety Officer Handbook 1 Health/Safety Officer

    E-Print Network [OSTI]

    4-H Club Health/Safety Officer Handbook 1 4-H Club Health/Safety Officer Handbook Family & Consumer Sciences website: http://fcs.tamu.edu (click on Health and Safety) Texas 4-H website: http://texas4-h Health/Safety Officer Handbook2 This handbook was created by the following Texas A&M AgriLife Extension

  6. University of California, Davis Office of the University Registrar

    E-Print Network [OSTI]

    Ishida, Yuko

    University of California, Davis Office of the University Registrar Petition for Credit by Examination One Shields Avenue, 12 Mrak Hall, Davis, CA 95616-8692 | Office: 530-752-3639 | Fax: 530 at the Cashier's Office or bill your account at the Office of the University Registrar. · The Office

  7. Low-Resolution STELab IPS 3D Reconstructions of the Whole Heliosphere Interval and Comparison with in-Ecliptic Solar Wind Measurements from STEREO and Wind Instrumentation

    E-Print Network [OSTI]

    Bisi, M. M.; Jackson, B. V.; Buffington, A.; Clover, J. M.; Hick, P. P.; Tokumaru, M.

    2009-01-01

    structure of the fast solar wind. J. Geophys. Res. 112,observations of the solar wind. Proc. SPIE 6689, 668911-1.W.A. , Maagoe, S. : 1972, Solar wind velocity from ips

  8. Reprogramming peripheral blood mononuclear cells using an efficient feeder-free, non-integration method to generate iPS cells and the effect of immunophenotype and epigenetic state on HSPC fate 

    E-Print Network [OSTI]

    Liu, Jing

    2014-11-28

    Background and objectives In 2006 Shinya Yamanaka successfully reprogrammed mouse fibroblasts back to an embryonic stem cell-like state (called induced pluripotent cells, iPS cells) using retrovirus to introduce four ...

  9. http://dx.doi.org/10.1090/conm/426/08187 Licensed to Penn St Univ, University Park. Prepared on Sun Dec 29 17:35:46 EST 2013 for download from IP 128.118.88.48.

    E-Print Network [OSTI]

    Bressan, Alberto

    on Sun Dec 29 17:35:46 EST 2013 for download from IP 128.118.88.48. License or copyright restrictions may(t,O+),z(t))dt. ~ Licensed to Penn St Univ, University Park. Prepared on Sun Dec 29 17:35:46 EST 2013 for download from IP://www.ams.org/publications/ebooks/terms #12;~ Licensed to Penn St Univ, University Park. Prepared on Sun Dec 29 17:35:46 EST 2013 for download

  10. OFFICE OF INFORMATION TECHNOLOGY COMPUTER SECURITY POLICY

    E-Print Network [OSTI]

    Hemmers, Oliver

    OFFICE OF INFORMATION TECHNOLOGY COMPUTER SECURITY POLICY RESPONsmLE ADMINISTRATOR: RESPONsm Manual, Chapter 14: Data and Information Security, Section 4, Information Security Plans ­ Physical%20-%20DATA%20AND%20INFORMATION%20SECURITY.pdf. CONTACTS Refer to the Office of Information Technology

  11. TECHNOLOGY LICENSE APPLICATION Office of Technology Transfer

    E-Print Network [OSTI]

    Page 1 TECHNOLOGY LICENSE APPLICATION Office of Technology Transfer UT-Battelle, LLC (UT. One of the functions of UT-BATTELLE's Office of Technology Transfer is to negotiate license agreements for such intellectual property with companies for commercial applications of ORNL-developed technologies. Such licenses

  12. NOAA Office of Program Planning and Integration

    E-Print Network [OSTI]

    : · continuing to foster strategic management process among NOAA Line and Staff Offices, Goal Teams, Programs's Strategic Vision by Developing and evolving of NOAA's Strategic Plan Managing designated programs accordingNOAA Office of Program Planning and Integration STRATEGIC PLAN FY 2005 ­ FY 2010 U.S. Department

  13. Boston College Office of Student Services

    E-Print Network [OSTI]

    Huang, Jianyu

    .sec.state.ma.us/pre/precom/comidx.htm). Prepaid mailer addressed to you to be used by the Secretary of Commonwealth's Office. Transcript: Please.sec.state.ma.us/pre/precom/comidx.htm). Prepaid mailer addressed to you to be used by the Secretary of Commonwealth's Office

  14. Ed Synakowski Associate Director, Office of Science

    E-Print Network [OSTI]

    Ed Synakowski Associate Director, Office of Science Fusion Energy Sciences The charge for advice on strategic planning Presented to FESAC April 9, 2014 http://science.energy.gov/fes #12;The Office of Science, and pulse lengths; · Discovery Plasma Science ­ the study of laboratory plasmas and the high energy density

  15. Biology Advising Office Building 44, Room 135

    E-Print Network [OSTI]

    Clayton, Dale H.

    Biology Advising Office Building 44, Room 135 Mailing Address: Biology Advising Office, University of Utah, 257 South 1400 East, Salt Lake City, Utah 84112-0840 http://www.biology.utah.edu/undergraduate/advising.php Email: advising@biology.utah.edu Phone: (801) 581-6244 Fax: (801) 581-8571 Denise M. Brenis, Director

  16. FINANCE DEPARTMENT Office Hours Fall 2014

    E-Print Network [OSTI]

    Gallo, Linda C.

    FINANCE DEPARTMENT Office Hours Fall 2014 NAME OFFICE HOURS COURSE # COURSE TITLE DAY TIME ROOM-1515 and by appointment FIN 323.8 FIN 323.9 FIN 323.11 FIN 326.1 Fundamentals of Finance Fundamentals of Finance Fundamentals of Finance Financial Institution Mgt TTH TTH TH TTH 0930-1045 1100-1215 1600-1840 1230-1345 GMCS

  17. Patent Issued Additional Office Actions Received

    E-Print Network [OSTI]

    Cui, Yan

    Patent Issued Additional Office Actions Received 3-12 mo. Respond to Office Action Patent attorney The patent examiner provides notification of which claims in the application have been rejected or accepted determines there are multiple inventions in 1 application. Patent Application Published 6 mo. Non

  18. NOAA Office of Education Promoting Environmental Literacy

    E-Print Network [OSTI]

    NOAA Office of Education Promoting Environmental Literacy Science On a Sphere, Orlando Science-cutting priority of promoting environmental literacy. The Office of Education directly implements and manages Center Photo: Orlando Science Center Education Strategic Plan, 2009-2029 Photo: NOAA EPP Ph.D graduate

  19. Pennsylvania Department of Environmental Protection's Cambria Office

    High Performance Buildings Database

    Ebensburg, PA The Pennsylvania Department of Environmental Protection's second green office building, Cambria, has more green features and a higher level of environmental awareness than PA DEP's first building--the South Central Regional Office Building. This 36,000 ft2 facility, designed for approximately 125 occupants, has collected data and documented many facets of its green design initiatives.

  20. Office of Classroom Management A quick reference

    E-Print Network [OSTI]

    Thomas, David D.

    Office of Classroom Management A quick reference for how to navigate your classroom's technology of the camera. #12;Office of Classroom Management 1. Press any button other than the "system off" button 2. When and resources www.classroom.umn.edu Classroom Support Hotline: 612-625-1086 ·Controlsforthe

  1. The University of Vermont Office of Admissions

    E-Print Network [OSTI]

    Bermingham, Laura Hill

    1 The University of Vermont Office of Admissions DISCOVERING UVM: Strong Voices, Open Minds voices, Open minds" program at the University of Vermont. He/She will be a guest of the University of Vermont's Office of Admissions from the time he/she arrives on campus on Sunday until the conclusion

  2. The University of Vermont Office of Admissions

    E-Print Network [OSTI]

    Bermingham, Laura Hill

    1 The University of Vermont Office of Admissions Imagine UVM PARENTAL CONSENT FORM AND MEDICAL my permission to attend the Fall 2014 Visitation, "Imagine UVM" program at the University of Vermont. They will be a guest of the University of Vermont's Office of Admissions from the time they arrive on campus

  3. UNIVERSITY OF CONNECTICUT Office of Undergraduate Admissions

    E-Print Network [OSTI]

    Alpay, S. Pamir

    UNIVERSITY OF CONNECTICUT Office of Undergraduate Admissions Special Program in Dental Medicine. The University of Connecticut does not require that you sign such a waiver as a condition for admission or award of Connecticut Office of Undergraduate Admissions 2131 Hillside Road, Unit-3088 Storrs, CT 06269-3088 Please

  4. UNIVERSITY OF CONNECTICUT Office of Undergraduate Admissions

    E-Print Network [OSTI]

    Alpay, S. Pamir

    UNIVERSITY OF CONNECTICUT Office of Undergraduate Admissions Special Program in Law Recommendation persons making such recommendations on her or his behalf. The University of Connecticut does not require of recommendation along with the completed form to: Special Program in Law University of Connecticut Office

  5. UNIVERSITY OF CONNECTICUT Office of Undergraduate Admissions

    E-Print Network [OSTI]

    Alpay, S. Pamir

    UNIVERSITY OF CONNECTICUT Office of Undergraduate Admissions Special Program in Medicine. The University of Connecticut does not require that you sign such a waiver as a condition for admission or award of Connecticut Office of Undergraduate Admissions 2131 Hillside Road, Unit-3088 Storrs, CT 06269-3088 Please

  6. Geothermal Technologies Office 2012 Peer Review Report

    SciTech Connect (OSTI)

    none,

    2013-04-01

    On May 7-10, 2012, the U.S. Department of Energy, Office of Energy Efficiency and Renewable Energy, Geothermal Technologies Office conducted its annual program peer review in Westminster, CO. In accordance with the EERE Peer Review Guide, the review provides an independent, expert evaluation of the strategic goals and direction of the office and is a forum for feedback and recommendations on future office planning. The purpose of the review was to evaluate DOE-funded projects for their contribution to the mission and goals of the office and to assess progress made against stated objectives. Project scoring results, expert reviewer comments, and key findings and recommendations are included in this report.

  7. Office of Legacy Management's Strategic Plan 2016-2025 | Department...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Office of Legacy Management's Strategic Plan 2016-2025 Office of Legacy Management's Strategic Plan 2016-2025 Office of Legacy Management's Strategic Plan 2016-2025 More Documents...

  8. Computer Account Request Form ETSU Office of Information Technology

    E-Print Network [OSTI]

    Karsai, Istvan

    Computer Account Request Form ETSU Office of Information Technology 424 Roy S. Nicks Hall, Box 70728 Johnson City, Tennessee 37614 (423) 439-4648 · oithelp@etsu.edu This section for use by the Office _____________________________ ETSU Phone Number _____________________________ Department / Office

  9. Office of Energy Efficiency and Renewable Energy FY 2014 Budget...

    Office of Environmental Management (EM)

    Office of Energy Efficiency and Renewable Energy FY 2014 Budget Rollout Office of Energy Efficiency and Renewable Energy FY 2014 Budget Rollout U.S. Department of Energy's Office...

  10. ip_11.indd

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorkingLosThe 26th AnnualHistoryM aterials S cience a nd

  11. INTRODUCTION TO THE TECHNOLOGY TRANSFER OFFICE The Technology Transfer Office directly contributes to the three-pronged mission of Dartmouth

    E-Print Network [OSTI]

    INTRODUCTION TO THE TECHNOLOGY TRANSFER OFFICE 1. Mission The Technology Transfer Office directly. The Technology Transfer Office contributes to the research mission of the College by commercializing inventions sources, and ensuring compliance with Government technology transfer regulations. The teaching mission

  12. Office of Information Technology -Strategic Plan FY 2015 2020 1 of 12 Office of Information Technology (OIT)

    E-Print Network [OSTI]

    Barrash, Warren

    Office of Information Technology - Strategic Plan FY 2015 ­ 2020 1 of 12 Office of Information Technology (OIT) Strategic Plan FY 2015 ­ 2020 Office of Information Technology - Vision, Mission, Pillars, and Values Vision

  13. CRAD, Emergency Management - Office of River Protection K Basin...

    Energy Savers [EERE]

    CRAD, Emergency Management - Office of River Protection K Basin Sludge Waste System CRAD, Emergency Management - Office of River Protection K Basin Sludge Waste System May 2004 A...

  14. Independent Activity Report, Office of River Protection Waste...

    Broader source: Energy.gov (indexed) [DOE]

    and Introduction of New Office of Safety and Emergency Management Evaluations Site Lead for the Office of River Protection Waste Treatment Plant and Tank Farms...

  15. Office of Enterprse Assessments Review of the West Valley Demonstratio...

    Broader source: Energy.gov (indexed) [DOE]

    Deputy Director, Office of Enterprise Assessments Thomas R. Staker, Director, Office of Environment, Safety and Health Assessments Quality Review Board William A. Eckroade Thomas...

  16. Office of Enterprise Assessments Review of the Waste Isolation...

    Office of Environmental Management (EM)

    Review of the Waste Isolation Pilot Plant Conduct of Maintenance Recovery Plan December 2014 Office of Nuclear Safety and Environmental Assessments Office of Environment, Safety...

  17. Vehicle Technologies Office - AVTA: All Electric USPS Long Life...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    USPS Long Life Vehicle Conversions Vehicle Technologies Office - AVTA: All Electric USPS Long Life Vehicle Conversions The Vehicle Technologies Office's Advanced Vehicle Testing...

  18. Reorganization Status of the Office of Energy Efficiency and...

    Office of Environmental Management (EM)

    Reorganization Status of the Office of Energy Efficiency and Renewable Energy: Panel Observations Reorganization Status of the Office of Energy Efficiency and Renewable Energy:...

  19. Independent Activity Report, Los Alamos Site Office- December 2010

    Broader source: Energy.gov [DOE]

    Los Alamos Site Office, Office of Quality Assurance Assessment of the Chemistry and Metallurgy Research Building Replacement Project Quality Assurance Plan

  20. Hawaii Department of Land and Natural Resources Office of Conservation...

    Open Energy Info (EERE)

    Resources Office of Conservation and Coastal Lands Jump to: navigation, search Name: Hawaii Department of Land and Natural Resources Office of Conservation and Coastal Lands From...

  1. Vehicle Technologies Office: 2013 Propulsion Materials R&D Annual...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Vehicle Technologies Office: 2013 Propulsion Materials R&D Annual Progress Report Vehicle Technologies Office: 2013 Propulsion Materials R&D Annual Progress Report This report...

  2. Vehicle Technologies Office: 2008 Propulsion Materials R&D Annual...

    Broader source: Energy.gov (indexed) [DOE]

    2008propulsionmaterials.pdf More Documents & Publications Vehicle Technologies Office: 2010 Propulsion Materials R&D Annual Progress Report Vehicle Technologies Office: 2013...

  3. Vehicle Technologies Office Recognizes Leaders in Advanced Vehicle...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Vehicle Technologies Office Recognizes Leaders in Advanced Vehicle Research, Development and Deployment Vehicle Technologies Office Recognizes Leaders in Advanced Vehicle Research,...

  4. RECORD of Categorical Exclusion (CX) determination: Office of...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Office of Electricity delivery and Energy Reliability (OE): EA-296-B Rainbow Energy Marketing Corporation RECORD of Categorical Exclusion (CX) determination: Office of...

  5. Bioenergy Technologies Office: Association of Fish and Wildlife...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Office: Association of Fish and Wildlife Agencies Agricultural Conservation Committee Meeting Bioenergy Technologies Office: Association of Fish and Wildlife Agencies Agricultural...

  6. DOE's Office of Science Awards 95 Million Hours of Supercomputing...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    DOE's Office of Science Awards 95 Million Hours of Supercomputing Time to Advance Research in Science, Academia and Industry DOE's Office of Science Awards 95 Million Hours of...

  7. MEMORANDUM FROM: THOMAS E. BROWN, DIRECTOR OFFICE OF CONTRACT...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    ,2008 MEMORANDUM FROM: THOMAS E. BROWN, DIRECTOR OFFICE OF CONTRACT MANAGEMENT OFFICE OF PROCUREMENT AND ASSISTANCE MANAGEMENT SUBJECT: Contract Change Order Administration of...

  8. Office of Energy Efficiency and Renewable Energy Fiscal Year...

    Energy Savers [EERE]

    Office of Energy Efficiency and Renewable Energy Fiscal Year 2014 Budget Rollout - Energy Saving Homes, Buildings, and Manufacturing Office of Energy Efficiency and Renewable...

  9. Office of Energy Efficiency and Renewable Energy FY 2015 Budget...

    Office of Environmental Management (EM)

    Budget Office of Energy Efficiency and Renewable Energy FY 2015 Budget Request Office of Energy Efficiency and Renewable Energy FY 2015 Budget Request U.S. Department of...

  10. DOE Announces Webinars on the Office of Energy Efficiency and...

    Office of Environmental Management (EM)

    the Office of Energy Efficiency and Renewable Energy's FY2016 Budget Request, and More DOE Announces Webinars on the Office of Energy Efficiency and Renewable Energy's FY2016...

  11. Reorganization of the Office of Energy Efficiency and Renewable...

    Office of Environmental Management (EM)

    Reorganization of the Office of Energy Efficiency and Renewable Energy: Preliminary Observations Reorganization of the Office of Energy Efficiency and Renewable Energy: Preliminary...

  12. Sustainable Transportation (Fact Sheet), Office of Energy Efficiency...

    Office of Environmental Management (EM)

    Sustainable Transportation (Fact Sheet), Office of Energy Efficiency and Renewable Energy, U.S. Department of Energy (DOE) Sustainable Transportation (Fact Sheet), Office of Energy...

  13. DOE Announces Rescheduled Webinar on the Office of Energy Efficiency...

    Broader source: Energy.gov (indexed) [DOE]

    FY2016 Budget Request Webinar Sponsor: Office of Energy Efficiency and Renewable Energy The Energy Department's Office of Energy Efficiency and Renewable Energy has...

  14. About the Bioenergy Technologies Office: Growing America's Energy...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    You are here Home About the Bioenergy Technologies Office: Growing America's Energy Future About the Bioenergy Technologies Office: Growing America's Energy Future The U.S....

  15. CRAD, Engineering - Office of River Protection K Basin Sludge...

    Energy Savers [EERE]

    CRAD, Engineering - Office of River Protection K Basin Sludge Waste System CRAD, Engineering - Office of River Protection K Basin Sludge Waste System May 2004 A section of Appendix...

  16. Office of Energy Efficiency and Renewable Energy Fiscal Year...

    Energy Savers [EERE]

    Sustainable Transportation Office of Energy Efficiency and Renewable Energy Fiscal Year 2014 Budget Rollout - Sustainable Transportation Office of Energy Efficiency and Renewable...

  17. Office of Energy Efficiency and Renewable Energy Fiscal Year...

    Energy Savers [EERE]

    Renewable Electricity Generation Office of Energy Efficiency and Renewable Energy Fiscal Year 2014 Budget Rollout - Renewable Electricity Generation Office of Energy Efficiency and...

  18. Vehicle Technologies Office: Materials for Hybrid and Electric...

    Office of Environmental Management (EM)

    Hybrid and Electric Drive Systems Vehicle Technologies Office: Materials for Hybrid and Electric Drive Systems The Vehicle Technologies Office (VTO) is working to lower the cost...

  19. Vehicle Technologies Office - AVTA: Hybrid-Electric Tractor Vehicles...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Tractor Vehicles Vehicle Technologies Office - AVTA: Hybrid-Electric Tractor Vehicles The Vehicle Technologies Office's Advanced Vehicle Testing Activity carries out testing on a...

  20. Vehicle Technologies Office - AVTA: Hybrid-Electric Delivery...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Delivery Vehicles Vehicle Technologies Office - AVTA: Hybrid-Electric Delivery Vehicles The Vehicle Technologies Office's Advanced Vehicle Testing Activity carries out testing on a...

  1. DOE Issues Request for Information for Richland Operations Office...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Office Richland Acquisitions - Post Fiscal Year 2018 Contract(s) Acquisition Planning DOE Issues Request for Information for Richland Operations Office Richland...

  2. Fuel Cell Technologies Office Multi-Year Research, Development...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Fuel Cell Technologies Office Multi-Year Research, Development, and Demonstration Plan Fuel Cell Technologies Office Multi-Year Research, Development, and Demonstration Plan The...

  3. 2015 Peer Review Agenda for the Geothermal Technologies Office...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    2015 Peer Review Agenda for the Geothermal Technologies Office 2015 Peer Review Agenda for the Geothermal Technologies Office Dr. Brian Anderson,chemical engineering professor at...

  4. Office of the Assistant General Counsel for Technology Transfer...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Technology Transfer & Intellectual Property Office of the Assistant General Counsel for Technology Transfer & Intellectual Property The Office of the Assistant General Counsel for...

  5. Record of Categorical Exclusion (CS) Determination, Office of...

    Broader source: Energy.gov (indexed) [DOE]

    Office of Electricity Delivery and Energy Reliability (OE): EA-363 Noble Americas Gas & Power Corporation Record of Categorical Exclusion (CS) Determination, Office of...

  6. Office of Energy Efficiency and Renewable Energy Launches New...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Office of Energy Efficiency and Renewable Energy Launches New Blog and Revamped Website Office of Energy Efficiency and Renewable Energy Launches New Blog and Revamped Website...

  7. Office of Energy Efficiency and Renewable Energy Overview Appropriatio...

    Energy Savers [EERE]

    Office of Energy Efficiency and Renewable Energy Overview Appropriation Summary by Program for FY 2011 Congressional Budget Office of Energy Efficiency and Renewable Energy...

  8. DOE Jobs Online (Hiring Manager), Office of Human Capitol Management...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Jobs Online (Hiring Manager), Office of Human Capitol Management Innovation and Solutions DOE Jobs Online (Hiring Manager), Office of Human Capitol Management Innovation and...

  9. Office of Enterprise Assessments Review of the Sandia National...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Sandia National LaboratoriesNew Mexico 2014 Site-Level Emergency Management Exercise April 2015 Office of Emergency Management Assessments Office of Environment, Safety and Health...

  10. Office of International Education International Student, Scholar, and Immigration Services

    E-Print Network [OSTI]

    Arnold, Jonathan

    Office of International Education International Student, Scholar, and Immigration Services 1324 of International Education after checking in. For the purpose of the Office of International Education, insurance

  11. Office of Health and Safety | Department of Energy

    Office of Environmental Management (EM)

    Health and Safety Office of Health and Safety Mission The Office of Health and Safety establishes worker safety and health requirements and expectations for the Department to...

  12. Final Report Implementing Office of Management and Budget Information...

    Energy Savers [EERE]

    Final Report Implementing Office of Management and Budget Information Dissemination Quality Guidelines (67 Fed Reg 62446) Final Report Implementing Office of Management and Budget...

  13. Frequently Asked Questions about the Office of Energy Efficiency...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Frequently Asked Questions about the Office of Energy Efficiency and Renewable Energy Frequently Asked Questions about the Office of Energy Efficiency and Renewable Energy Below...

  14. Office of Electricity Delivery and Energy Reliability Cyber Security...

    Energy Savers [EERE]

    Office of Electricity Delivery and Energy Reliability Cyber Security Project Selections Office of Electricity Delivery and Energy Reliability Cyber Security Project Selections On...

  15. Independent Oversight Review, Portsmouth/Paducah Project Office...

    Energy Savers [EERE]

    Independent Oversight Review, PortsmouthPaducah Project Office - May 2012 Independent Oversight Review, PortsmouthPaducah Project Office - May 2012 May 2012 Review of the...

  16. Energy Efficiency Upgrades Help Retired Military Officers Save...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Efficiency Upgrades Help Retired Military Officers Save Money Energy Efficiency Upgrades Help Retired Military Officers Save Money May 7, 2013 - 12:50pm Addthis A retirement...

  17. DOE Office of Science Publishes Update of Landmark Plan: "Facilities...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Office of Science Publishes Update of Landmark Plan: "Facilities for the Future of Science: A Twenty-Year Outlook" DOE Office of Science Publishes Update of Landmark Plan:...

  18. Letter to Congress RE: Office of Civilian Radioactive Waste Management...

    Office of Environmental Management (EM)

    to Congress RE: Office of Civilian Radioactive Waste Management's Annual Financial Report Letter to Congress RE: Office of Civilian Radioactive Waste Management's Annual Financial...

  19. Bioenergy Technologies Office: Association of Fish and Wildlife...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Bioenergy Technologies Office: Association of Fish and Wildlife Agencies Agricultural Conservation Committee Meeting Bioenergy Technologies Office: Association of Fish and Wildlife...

  20. Office of the Assistant General Counsel for International and...

    Energy Savers [EERE]

    International and National Security Programs Office of the Assistant General Counsel for International and National Security Programs The Office of the Assistant General Counsel...

  1. Vehicle Technologies Office Merit Review 2014: Vehicle & Systems...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    and Testing R&D Annual Progress Report Vehicle Technologies Office Merit Review 2014: Wireless Charging Vehicle Technologies Office Merit Review 2015: Overview of the DOEVTO...

  2. Office of Policy and International Affairs Before the Senate...

    Office of Environmental Management (EM)

    Office of Policy and International Affairs Before the Senate Environment an Public Works Committee Office of Policy and International Affairs Before the Senate Environment an...

  3. Acquisition and Project Management Office volunteers get up-close...

    National Nuclear Security Administration (NNSA)

    Our Jobs Our Jobs Working at NNSA Blog Home NNSA Blog Acquisition and Project Management Office volunteers get ... Acquisition and Project Management Office volunteers get...

  4. Environmental Management Los Alamos Field Office Corrective Action...

    Energy Savers [EERE]

    Field Office Corrective Action Plan - Radiological Release Phase II Environmental Management Los Alamos Field Office Corrective Action Plan - Radiological Release Phase II On...

  5. SEAB Endorsement of Office of Science Working Group | Department...

    Energy Savers [EERE]

    SEAB Endorsement of Office of Science Working Group SEAB Endorsement of Office of Science Working Group This memorandum from SEAB presents the recommendation from the Task Force on...

  6. EERE Project Management Center Database PIA, The Office of Energy...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Project Management Center Database PIA, The Office of Energy Efficiency and Renewable Energy (EERE) EERE Project Management Center Database PIA, The Office of Energy Efficiency...

  7. Vehicle Technologies Office: 2012 Advanced Combustion R&D Annual...

    Energy Savers [EERE]

    Vehicle Technologies Office: 2012 Advanced Combustion R&D Annual Progress Report Vehicle Technologies Office: 2012 Advanced Combustion R&D Annual Progress Report Annual report on...

  8. Fuel Cell Technologies Office Multi-Year Research, Development...

    Office of Environmental Management (EM)

    Technologies Office Multi-Year Research, Development, and Demonstration Plan Fuel Cell Technologies Office Multi-Year Research, Development, and Demonstration Plan The Fuel Cell...

  9. Fuel Cell Technologies Office Launches National Laboratory Tech...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Technologies Office Launches National Laboratory Tech-to-Market Activities Fuel Cell Technologies Office Launches National Laboratory Tech-to-Market Activities November 3, 2014 -...

  10. Office of Electricity Delivery & Energy Reliability FY 2012 Budget...

    Energy Savers [EERE]

    Office of Electricity Delivery & Energy Reliability FY 2012 Budget Request Presentation Office of Electricity Delivery & Energy Reliability FY 2012 Budget Request Presentation...

  11. Office of Electricity Delivery And Energy Reliability To Hold...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Office of Electricity Delivery And Energy Reliability To Hold Technical Conference On The Design Of Future Electric Transmission Office of Electricity Delivery And Energy...

  12. Secretary of Energy Announces New Office of Electricity Delivery...

    Energy Savers [EERE]

    Announces New Office of Electricity Delivery & Energy Reliability Secretary of Energy Announces New Office of Electricity Delivery & Energy Reliability June 9, 2005 - 1:45pm...

  13. Fiscal Year 2015 Vehicle Technologies Office Incubator Funding...

    Broader source: Energy.gov (indexed) [DOE]

    Documents & Publications Vehicle Technologies Office Merit Review 2015: High Energy Lithium-Sulfur Cathodes Vehicle Technologies Office Merit Review 2015: Fundamental Studies of...

  14. Northeast Home Heating Oil Reserve System Heating Oil, PIA Office...

    Broader source: Energy.gov (indexed) [DOE]

    Northeast Home Heating Oil Reserve System Heating Oil, PIA Office of Fossil Energy Headquaters Northeast Home Heating Oil Reserve System Heating Oil, PIA Office of Fossil Energy...

  15. The Geothermal Technologies Office Invests $18 Million for Innovative...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    The Geothermal Technologies Office Invests 18 Million for Innovative Projects The Geothermal Technologies Office Invests 18 Million for Innovative Projects The McGuiness Hills...

  16. Vehicle Technologies Office AVTA: Light Duty Alternative Fuel...

    Energy Savers [EERE]

    Office AVTA: Light Duty Alternative Fuel and Advanced Vehicle Data Vehicle Technologies Office AVTA: Light Duty Alternative Fuel and Advanced Vehicle Data The Vehicle Technologies...

  17. Office of the Assistant General Counsel for Procurement and Financial...

    Energy Savers [EERE]

    Procurement and Financial Assistance Office of the Assistant General Counsel for Procurement and Financial Assistance The Office of the Assistant General Counsel for Procurement...

  18. Vehicle Technologies Office: U.S. DRIVE 2014 Technical Accomplishments...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Vehicle Technologies Office: U.S. DRIVE 2014 Technical Accomplishments Report Vehicle Technologies Office: U.S. DRIVE 2014 Technical Accomplishments Report The U.S. DRIVE 2014...

  19. Office of Environment, Safety and Health Evaluations Appraisal...

    Energy Savers [EERE]

    Office of Environment, Safety and Health Evaluations Appraisal Process Guide, July 29, 2009 Office of Environment, Safety and Health Evaluations Appraisal Process Guide, July 29,...

  20. Office of Health, Safety and Security Report to the Secretary...

    Energy Savers [EERE]

    Office of Health, Safety and Security Report to the Secretary of Energy - February 2011 Office of Health, Safety and Security Report to the Secretary of Energy - February 2011...

  1. Vehicle Technologies Office Merit Review 2014: Refuel Colorado...

    Energy Savers [EERE]

    Refuel Colorado Presentation given by Colorado Energy Office at 2014 DOE Hydrogen and Fuel Cells Program and Vehicle Technologies Office Annual Merit Review and Peer Evaluation...

  2. Grand Junction Office Founder Honored at the Philip C. Leahy...

    Office of Environmental Management (EM)

    Grand Junction Office Founder Honored at the Philip C. Leahy Memorial Park Dedication and Open House Grand Junction Office Founder Honored at the Philip C. Leahy Memorial Park...

  3. Office of Enterprise Assessments | Department of Energy

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformationJesseworkSURVEY UNIVERSEHowScientific andComplex Oak125Office ofOfficeOffice

  4. January 2011 Monthly News Roundup | U.S. DOE Office of Science...

    Office of Science (SC) Website

    a question of efficiency, which essentially boils down to cost," Veeraraghavan said. "IP networks have to be operated at low utilization for the performance requirements of all...

  5. Office of the Registrar 433 Bolivar Street

    E-Print Network [OSTI]

    Office of the Registrar 433 Bolivar Street New Orleans, LA 70112 (504) 568-4829 Fax (504) 568 Professions Dentistry Graduate Studies Medicine Nursing Public Health 6. Dates of Attendance from

  6. TO: Procurement Directors/Contracting Officers FROM: ...

    Office of Environmental Management (EM)

    without taking steps to independently verify them. DOE Contracting Officers (COs) are reminded that DOE Order 481.1C, Work for Others (Non-DOE Funded Work) assigns...

  7. Registrar's Office San Francisco State University

    E-Print Network [OSTI]

    Ovchinnikov, Sergei

    Registrar's Office San Francisco State University 1600 Holloway Avenue San Francisco, CA 94132 are issued after receipt of payment. Each copy is $8.00. Make checks payable to: SAN FRANCISCO STATE

  8. Back Cover Front Cover Office of Continuing

    E-Print Network [OSTI]

    Goodman, Robert M.

    Back Cover Front Cover Office of Continuing Professional Education 2012­2013 Professional Landscape of Golf Course Irrigation Systems (p. 13) · Basics of Turf Management (p. 21) · Turfgrass Establishment (p

  9. Advanced Manufacturing Office: Smart Manufacturing Industry Day...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    14 The U.S. Department of Energy's (DOE's) Advanced Manufacturing Office (AMO) held a Smart Manufacturing Industry Day on February 25, 2015, at the Georgia Tech Hotel and...

  10. Office for Aboriginal Peoples ABORIGINAL STRATEGIC PLAN

    E-Print Network [OSTI]

    Kavanagh, Karen L.

    Office for Aboriginal Peoples ABORIGINAL STRATEGIC PLAN 2013-2018 #12;TABLE OF CONTENTS Statement .............................................................................. 3 The Ten Pillars of the Aboriginal Strategic Plan ............................................ 4 The Aboriginal Strategic Plan: Goals, Action Items, Timelines, and Leads

  11. Chief Marketing Officer Health Promotion Specialist

    E-Print Network [OSTI]

    Dennett, Daniel

    · Chief Marketing Officer · Health Promotion Specialist · Director of Communications · Account/Manager · Communication Specialist · Marketing Director · Senior Account Manager · Project Manager · Research Assistant of Public Relations · International Marketing Manager · Product Manager · Clinical Trial Manager Genentech

  12. National Nuclear Secutffy Admlnlsbrrtlon NEVADA SITE OFFICE

    Energy Savers [EERE]

    Nuclear Secutffy Admlnlsbrrtlon NEVADA SITE OFFICE CONTRACT MANAGEMENT PLAN for CONTRACT NO. DE-AC52-06NA25946 with NATIONAL SECURITY TECHNOLOGIES, LLC Jose Stephen A. e l l ; l...

  13. Savage Arms Sales Office 118 Mountain Road

    E-Print Network [OSTI]

    New Hampshire, University of

    Savage Arms Sales Office 118 Mountain Road Suffield, Ct. 06078 Phone: (413) 642-4121 Fax: (860) 668 to change.) California orders will also need the Dealers CFD# Sales Tax must be added for orders shipping

  14. Office of Headquarters Personnel Security Operations

    Broader source: Energy.gov [DOE]

    The Office of Headquarters Personnel Security manages and implements safeguards and security access authorization functions for DOE Headquarters and manages the Personal Identity Verification (PIV) process for Headquarters as mandated by Homeland Security Presidential Directive Number 12 (HSPD-12).

  15. 2013 Geothermal Technologies Office Annual Report

    SciTech Connect (OSTI)

    none,

    2014-02-01

    For the Geothermal Technologies Office (GTO), 2013 was a year of major achievements and repositioning to introduce major initiatives. Read all about our progress and successes this year, and as we look ahead, our new opportunities and initiatives.

  16. 4-H Club Officer Handbook - Council Delegate 

    E-Print Network [OSTI]

    Howard, Jeff W.

    2006-08-09

    This section from the 4-H Club Officer Handbook features the multi-faceted role of the Council Delegate. It explains the purpose of the County 4-H Council and outlines the delegate's various duties.

  17. 4-H Club Officer Handbook - Club Committees 

    E-Print Network [OSTI]

    Howard, Jeff W.

    2006-08-09

    This section from the 4-H Club Officer Handbook features key areas of responsibilities for members serving on the different club committees. Topics cover functions of club committees and important committee tips. The section ...

  18. 4-H Club Officer Handbook-President 

    E-Print Network [OSTI]

    Howard, Jeff W.

    2006-08-09

    This section from the 4-H Club Officer Handbook features the multi-faceted role of the President. It covers the leader's duties as well as preparing for and conducting a meeting. Tips include how to use the gavel properly. ...

  19. Workforce Management Office WORKFORCE AND SUCCESSION PLANNING

    E-Print Network [OSTI]

    2012 Workforce Management Office NOAA 1/1/2012 WORKFORCE AND SUCCESSION PLANNING Toolkit to Identify and Address Strategic Talent Gaps #12;Workforce & Succession Planning Toolkit NOAA Workforce .......................................................................................................3 Workforce Planning

  20. U.S. GOVERNMENT PRINTING OFFICE WASHINGTON

    E-Print Network [OSTI]

    Heller, Don

    U.S. GOVERNMENT PRINTING OFFICE WASHINGTON : For sale by the Superintendent of Documents, U­1800 Fax: (202) 512­2250 Mail: Stop SSOP, Washington, DC 20402­0001 90-136 PDF 2004 H.R. 3039