Powered by Deep Web Technologies
Note: This page contains sample records for the topic "auburn hills mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Auburn Hills, Michigan: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Auburn Hills, Michigan: Energy Resources Auburn Hills, Michigan: Energy Resources (Redirected from Auburn Hills, MI) Jump to: navigation, search Equivalent URI DBpedia Coordinates 42.6875323°, -83.2341028° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.6875323,"lon":-83.2341028,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Modular and Manufactured Houses Offer Homeowners the Building America and ENERGY STAR(R) Advantage: Genesis Homes -- Auburn Hills, Michigan  

SciTech Connect

Genesis Homes is headquartered in Auburn, Michigan, and has 11 factories throughout the nation. They build modular and manufactured homes with quality design, construction practice, and building materials that qualify for the Energy Star label.



Auburn University | Open Energy Information  

Open Energy Info (EERE)

University Place Auburn, Alabama Zip 36849 Product Largest university in Alabama, enrolling approximately 23,000 students in 230 undergraduate, graduate, and professional programs....


DOE Solar Decathlon: Auburn University: Enjoying Campus Life  

NLE Websites -- All DOE Office Websites (Extended Search)

Auburn University's solar-powered house on the National Mall at Solar Decathlon 2002. Auburn University's solar-powered house on the National Mall at Solar Decathlon 2002. Enlarge image The Auburn house is loosely based on a traditional southern design called the dogtrot, which incorporates a central porch that divides the house into two halves. (Credit: Warren Gretz/U.S. Department of Energy Solar Decathlon) Who: Auburn University What: Solar house Where: Auburn University Auburn, AL 36849 Map This House Public tours: Not available Solar Decathlon 2002 Auburn University: Enjoying Campus Life The solar-powered house built by Auburn University for the U.S. Department of Energy Solar Decathlon 2002 returned to campus after placing third in the competition. It currently resides on the university's Agricultural Campus, where it has been landscaped and is used as office space and for


Auburn University | Princeton Plasma Physics Lab  

NLE Websites -- All DOE Office Websites (Extended Search)

Auburn University Auburn University Auburn University Professors J. Hanson and G. Hartwell Plasma equilibrium reconstruction relies on many pin-point magnetic field measurements (~ 100) during the plasma discharge and rather detailed analysis. A widely used analysis code to perform these reconstructions is the VMEC MHD equilibrium code, developed for the 2-D magnetic field configuration of the tokamak device. One complication to the magnetic field measurements within the plasma is compensating for induced currents, eddy curents, in the metal vacuum vessel and magnet coil frame support. The equilibrium reconstruction is further complicated when dealing with 3-D magnetic topologies associated with stellerators and torusatrons. To adapt the standard VMEC code to the coil frame and vacuum vessel of the


Auburn Hills, Michigan: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

23°, -83.2341028° 23°, -83.2341028° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.6875323,"lon":-83.2341028,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Auburn, Illinois: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Auburn, Illinois: Energy Resources Auburn, Illinois: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 39.5917197°, -89.7464874° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.5917197,"lon":-89.7464874,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


City of Auburn, Indiana (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Auburn, Indiana (Utility Company) Auburn, Indiana (Utility Company) Jump to: navigation, search Name City of Auburn Place Auburn, Indiana Utility Id 994 Utility Location Yes Ownership M NERC Location RFC NERC RFC Yes Activity Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] SGIC[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. City of Auburn, IN Smart Grid Project was awarded $2,075,080 Recovery Act Funding with a total project value of $4,150,160. Utility Rate Schedules Grid-background.png Private Outdoor Lighting- 100 watt sodium vapor lamp Lighting Private Outdoor Lighting- 175 watt mercury vapor lamp Lighting Private Outdoor Lighting- 250 watt mercury vapor lamp Lighting


City of Auburn, Indiana (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Indiana (Utility Company) Indiana (Utility Company) (Redirected from City of Auburn, IN) Jump to: navigation, search Name City of Auburn Place Auburn, Indiana Utility Id 994 Utility Location Yes Ownership M NERC Location RFC NERC RFC Yes Activity Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] SGIC[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. City of Auburn, IN Smart Grid Project was awarded $2,075,080 Recovery Act Funding with a total project value of $4,150,160. Utility Rate Schedules Grid-background.png Private Outdoor Lighting- 100 watt sodium vapor lamp Lighting Private Outdoor Lighting- 175 watt mercury vapor lamp Lighting


Auburn-Washburn Wind Project | Open Energy Information  

Open Energy Info (EERE)

Auburn-Washburn Wind Project Auburn-Washburn Wind Project Jump to: navigation, search Name Auburn-Washburn Wind Project Facility Auburn-Washburn Sector Wind energy Facility Type Community Wind Location KS Number of Units 1 Wind Turbine Manufacturer SkyStream Wind for Schools Portal Turbine ID 105237 References Wind Powering America[1] Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"TERRAIN","zoom":6,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"500px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[]}


City of Auburn, IN Smart Grid Project | Open Energy Information  

Open Energy Info (EERE)

Smart Grid Project Smart Grid Project Jump to: navigation, search Project Lead City of Auburn, IN Country United States Headquarters Location Auburn, Indiana Recovery Act Funding $2,075,080.00 Total Project Value $4,150,160.00 Coverage Area Coverage Map: City of Auburn, IN Smart Grid Project Coordinates 41.3669942°, -85.0588575° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[]}


Auburn low-temperature geothermal well. Volume 6. Final report  

DOE Green Energy (OSTI)

The Auburn well was drilled to explore for low temperature geothermal resources in central New York State. The Auburn site was selected based on: its proximity to the Cayuga County anomaly (30/sup 0/C/km), its favorable local geological conditions and the potential to provide hot water and space heating to two educational facilities. The well was drilled to a total depth of 5250 feet and into the Pre-Cambrian Basement. The well was extensively logged, flow and stress tested, hydraulically stimulated, and pump (pressure transient analysis) tested. The low-temperature geothermal potential was assessed in terms of: geological environment; hydrological conditions; reservoir characteristics; and recoverable hydrothermal reserves. The average geothermal gradient was measured to be as high as 26.7/sup 0/C/km with a bottom-hole temperature of 126/sup 0/ +- 1/sup 0/F. The proved volumetric resources were estimated to be 3.0 x 10/sup 6/ stock tank barrels (STB) with a maximum initial deliverability of approx.11,600 STB/D and a continuous deliverability of approx.3400 STB/D. The proved hydrothermal reserves were estimated to be 21.58 x 10/sup 10/ Btu based on a volumetric component (4.13 x 10/sup 10/ Btu), and a reinjection component (17.45 x 10/sup 10/ Btu). The conclusion was made that the Auburn low-temperature reservoir could be utilized to provide hot water and space heating to the Auburn School District.

Lynch, R.S.; Castor, T.P.



NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

2012 48 months Aaron Yocum Auburn Hills, MI Validation of Material Models for Automotive Carbon-Fiber Composite Structures via Physical and.... The project is the validation of...


DOE/EA-1624: Environmental Assessment for Auburn Landfill Gas Electric Generators and Anaerobic Digester Energy Facilities (December 2008)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Auburn Landfill Gas Electric Generators and Auburn Landfill Gas Electric Generators and Anaerobic Digester Energy Facilities Auburn, New York Final Environmental Assessment DOE/EA-1624 Prepared for: U.S. Department of Energy National Energy Technology Laboratory January 2009 INTENTIONALLY LEFT BLANK AUBURN LANDFILL GAS ELECTRIC GENERATORS AND ANAEROBIC DIGESTER ELECTRIC FACILITIES FINAL EA DOE/EA-1624 i Table of Contents 1.0 INTRODUCTION .......................................................................................................................................... 1 1.1 BACKGROUND............................................................................................................................................... 2 1.2 PURPOSE AND NEED ...................................................................................................................................... 4


Auburn Board of Public Works | Open Energy Information  

Open Energy Info (EERE)

Works Works Jump to: navigation, search Name Auburn Board of Public Works Place Nebraska Utility Id 993 Utility Location Yes Ownership M NERC Location MRO NERC SPP Yes Operates Generating Plant Yes Activity Generation Yes Activity Transmission Yes Activity Buying Transmission Yes Activity Distribution Yes Activity Bundled Services Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Demand Service Commercial General Service Single Phase Commercial General Service Three Phase Commercial Irrigation General Service Commercial Large Power Service Commercial Outdoor Lighting Service Lighting



E-Print Network (OSTI)

C.F. , 1980, "Aquifer Thermal Energy - Parameter Study" (infrom the Auburn University Thermal Energy Storage , LBL No.studies in aquifer thermal energy , Presented at the ~~~~~~~

Tsang, Chin Fu



Service/Product Provider  

NLE Websites -- All DOE Office Websites (Extended Search)

Johnson Controls, Inc. Ford Motor Company 2875 High Meadow Cir. 550 Town Center Dr., Ste 200 Auburn Hills, MI 48326-2773 Dearborn, MI 48126 Business: Building Automation, Facility...



E-Print Network (OSTI)

LBL-9459. experimental Thermal energy storage in confinedAUBURN UNIVERSITY THERMAL ENERGY STORAGE PROGRM1 Christineseries of aquifer thermal energy storage field experiments.

Doughty, Christine



Auburn Hot Spring Pool & Spa Low Temperature Geothermal Facility | Open  

Open Energy Info (EERE)

Hot Spring Pool & Spa Low Temperature Geothermal Facility Hot Spring Pool & Spa Low Temperature Geothermal Facility Jump to: navigation, search Name Auburn Hot Spring Pool & Spa Low Temperature Geothermal Facility Facility Auburn Hot Spring Sector Geothermal energy Type Pool and Spa Location Auburn, Wyoming Coordinates 42.7921493°, -111.0032647° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[]}


Geochemical equilibrium modeling of the Auburn Thermal Energy Storage Field Test  

DOE Green Energy (OSTI)

The objective of the study was to investigate some alternate reservoir damage mechanisms that may have contributed to the loss of well injectivity experienced at the Mobile field site. Specifically, this includes mineral precipitation and/or alteration resulting from: 1) increased temperatures and temperature gradients, 2) presence of oxygen, 3) fluid-fluid incompatibility (mixing of two different aquifer waters), and 4) fluid-rock imcompatibility (introducing foreign groundwaters into storage aquifer sedimentary matrix). The primary investigatory tool used in the study is an Electric Power Research Institute computer program (EQUILIB), which is based on equilibrium chemical thermodynamics. The computer code was utilized to simulate changes in mineralogy and groundwater chemistries due to the interaction of the sediment material and two differing aquifer waters at temperatures of 55/sup 0/C, 100/sup 0/C, and 150/sup 0/C. Conclusions are primarily based on the 55/sup 0/C results since this was the maximum operating temperature for the Auburn experiment.

Stottlemyre, J.A.; Smith, R.P.; Erikson, R.L.


Note: This page contains sample records for the topic "auburn hills mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Rochester Hills, Michigan: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Hills, Michigan: Energy Resources Hills, Michigan: Energy Resources (Redirected from Rochester Hills, MI) Jump to: navigation, search Equivalent URI DBpedia Coordinates 42.6583661°, -83.1499322° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.6583661,"lon":-83.1499322,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Sand Hills EA  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

- - Office Name and State goes here Environmental Assessment Sand Hills Wind Energy Facility Albany County, Wyoming May 2011 High Desert District Rawlins Field Office The BLM's multiple-use mission is to sustain the health and productivity of the public lands for the use and enjoyment of present and future generations. The Bureau accomplishes this by managing such activities as outdoor recreation, livestock grazing, mineral development, and energy production, and by conserving natural, historical, cultural, and other resources on public lands. BLM/WY/PL-11/035+1430 WY-030-EA09-314 Contents Chapter Page Acronyms and Abbreviations .................................................................................................. ix


Spittal Hill Wind Farm | Open Energy Information  

Open Energy Info (EERE)

| Sign Up Search Page Edit with form History Facebook icon Twitter icon Spittal Hill Wind Farm Jump to: navigation, search Name Spittal Hill Wind Farm Place United Kingdom...


Black Hills Corporation | Open Energy Information  

Open Energy Info (EERE)

Black Hills Corporation Jump to: navigation, search Name Black Hills Corporation Place Rapid City, South Dakota Zip 57709 Product Diversified energy and communications company....


Sunny Hill Energy | Open Energy Information  

Open Energy Info (EERE)

Sunny Hill Energy Jump to: navigation, search Name Sunny Hill Energy Place San Jose, California Zip 95113 Sector Solar Product California-based solar financing and business support...


Guardian Industries | Open Energy Information  

Open Energy Info (EERE)

Industries Industries Jump to: navigation, search Name Guardian Industries Place Auburn Hills, MI Website http://www.guardian.com/ References Results of NREL Testing (Glass Magazine)[1] Guardian News Archive[2] Information About Partnership with NREL Partnership with NREL Yes Partnership Type Other Relationship Partnering Center within NREL Transportation Technologies and Systems Partnership Year 2002 LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! Guardian Industries is a company located in Auburn Hills, MI. References ↑ "Results of NREL Testing (Glass Magazine)" ↑ "Guardian News Archive" Retrieved from "http://en.openei.org/w/index.php?title=Guardian_Industries&oldid=381719" Categories: Clean Energy Organizations


Glacier Hills | Open Energy Information  

Open Energy Info (EERE)

Glacier Hills Glacier Hills Jump to: navigation, search Name Glacier Hills Facility Glacier Hills Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner We Energies Developer We Energies Energy Purchaser We Energies Location Between Portage and Randolph above Highway 33 WI Coordinates 43.572059°, -89.111309° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.572059,"lon":-89.111309,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Cedro Hill | Open Energy Information  

Open Energy Info (EERE)

Cedro Hill Cedro Hill Jump to: navigation, search Name Cedro Hill Facility Cedro Hill Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Edison Mission Energy Developer DKRW Wind LLC Location Located in Bruni TX Coordinates 27.56341162°, -98.91720772° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":27.56341162,"lon":-98.91720772,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Mustang Hills | Open Energy Information  

Open Energy Info (EERE)

Hills Hills Jump to: navigation, search Name Mustang Hills Facility Mustang Hills (Alta VI) Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Terra-Gen Power Developer Terra-Gen Power Energy Purchaser Southern California Edison Co Location Tehachapi Pass CA Coordinates 35.01917213°, -118.3031845° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.01917213,"lon":-118.3031845,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Bull Hill | Open Energy Information  

Open Energy Info (EERE)

Hill Hill Jump to: navigation, search Name Bull Hill Facility Bull Hill Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner First Wind Developer First Wind Energy Purchaser NSTAR Location Hancock County ME Coordinates 44.723076°, -68.170852° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":44.723076,"lon":-68.170852,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Record Hill | Open Energy Information  

Open Energy Info (EERE)

Record Hill Record Hill Jump to: navigation, search Name Record Hill Facility Record Hill Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Wagner Wind Energy - Independence Wind LLC Developer Wagner Wind Energy - Independence Wind LLC Location Roxbury ME Coordinates 44.66175478°, -70.63453674° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":44.66175478,"lon":-70.63453674,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


PP-118 Hill County Electric Cooperative Inc | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

18 Hill County Electric Cooperative Inc PP-118 Hill County Electric Cooperative Inc Presidential permit authorizing Hill County Electric Cooperative Inc to construct, operate, and...


Laurel Hill | Open Energy Information  

Open Energy Info (EERE)

Laurel Hill Laurel Hill Facility Laurel Hill Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Duke Energy Developer Duke Enegy Energy Purchaser Delaware Municipal Electric Corp Location Lycoming County PA Coordinates 41.5245155°, -77.04111099° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.5245155,"lon":-77.04111099,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Trinity Hills | Open Energy Information  

Open Energy Info (EERE)

Trinity Hills Trinity Hills Facility Trinity Hills Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner BP Wind Energy Developer BP Wind Energy Energy Purchaser Merchant Location Archer and Yound Counties TX Coordinates 33.401504°, -98.7115027° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":33.401504,"lon":-98.7115027,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Sandy Hill Case Study Packet 2004  

Science Conference Proceedings (OSTI)

Sandy Hill Case Study Packet 2004. The Baldrige Case Study Packet is composed of documents used to train Baldrige ...



Smoky Hill and River Valleys  

E-Print Network (OSTI)

.............................................................................3 - 13 Wind Energy and the Meridian Way Wind Farm County. This location is the site of a new wind farm development by Westar Energy, Horizon Wind EnergySmoky Hill and Republican River Valleys Water, Wind, and Economic Development 2008 Field Conference

Peterson, Blake R.


Union Hill-Novelty Hill, Washington: Energy Resources | Open Energy  

Open Energy Info (EERE)

Novelty Hill, Washington: Energy Resources Novelty Hill, Washington: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 47.6798082°, -122.016938° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.6798082,"lon":-122.016938,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Long Hill Energy Ltd | Open Energy Information  

Open Energy Info (EERE)

Hill Energy Ltd Hill Energy Ltd Jump to: navigation, search Name Long Hill Energy Ltd Place United Kingdom Sector Wind energy Product JV formed by Snowmountain Eneterprises Ltd and Wind Direct Ltd to develop single wind turbine installations. References Long Hill Energy Ltd[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Long Hill Energy Ltd is a company located in United Kingdom . References ↑ "Long Hill Energy Ltd" Retrieved from "http://en.openei.org/w/index.php?title=Long_Hill_Energy_Ltd&oldid=348446" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties


Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...


US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.

Note: This page contains sample records for the topic "auburn hills mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.


Black Hills Energy (Electric) - Residential Energy Efficiency...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

unit Freezer: 30unit Dishwasher: 30unit RefrigeratorFreezer Recycling: 50unit CFLLED Bulbs: In-store rebates Black Hills Energy (BHE) offers rebates for residential...


Black Hills Power- Residential Customer Rebate Program  

Energy.gov (U.S. Department of Energy (DOE))

Black Hills Power offers cash rebates to residential customers who purchase and install energy efficient equipment in their homes. Incentives exist for water heaters, demand control units, air...


NUFO Science Exhibition on Capitol Hill Draws Congressmen, Crowds  

NLE Websites -- All DOE Office Websites (Extended Search)

NUFO Science Exhibition on Capitol Hill Draws Congressmen, Crowds NUFO Science Exhibition on Capitol Hill Draws Congressmen, Crowds Print At the invitation of the House Science and...


Combine Hills Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Combine Hills Wind Farm Combine Hills Wind Farm Jump to: navigation, search Name Combine Hills Wind Farm Facility Combine Hills Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Babcock & Brown/Eurus Developer Eurus Energy Purchaser PacifiCorp Location Near Umapine OR Coordinates 45.94152°, -118.589137° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.94152,"lon":-118.589137,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Woodstock Hills Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Woodstock Hills Wind Farm Woodstock Hills Wind Farm Jump to: navigation, search Name Woodstock Hills Wind Farm Facility Woodstock Hills Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Juhl Wind and Edison Mission Group (owns majority) Developer Woodstock Windfarms Energy Purchaser Xcel Energy Location Pipestone County MN Coordinates 43.9948°, -96.3175° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.9948,"lon":-96.3175,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Bishop Hill I | Open Energy Information  

Open Energy Info (EERE)

Bishop Hill I Bishop Hill I Jump to: navigation, search Name Bishop Hill I Facility Bishop Hill I Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Ivenergy Developer Ivenergy Energy Purchaser Tennessee Valley Authority Location Altona IL Coordinates 41.15978766°, -90.10059357° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.15978766,"lon":-90.10059357,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Wilmont Hills Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Wilmont Hills Wind Farm Wilmont Hills Wind Farm Jump to: navigation, search Name Wilmont Hills Wind Farm Facility Wilmont Hills Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Northern Alternative Energy Developer Northern Alternative Energy Energy Purchaser Alliant Energy Location Nobles County MN Coordinates 43.761108°, -95.8276° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.761108,"lon":-95.8276,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Goodnoe Hills Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Goodnoe Hills Wind Farm Goodnoe Hills Wind Farm Jump to: navigation, search Name Goodnoe Hills Wind Farm Facility Goodnoe Hills Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner EnXco/Power Holdings Developer EnXco/Power Holdings Energy Purchaser PacifiCorp Location Goldendale Coordinates 45.784293°, -120.552475° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.784293,"lon":-120.552475,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Arbor Hills Biomass Facility | Open Energy Information  

Open Energy Info (EERE)

Hills Biomass Facility Hills Biomass Facility Jump to: navigation, search Name Arbor Hills Biomass Facility Facility Arbor Hills Sector Biomass Facility Type Landfill Gas Location Washtenaw County, Michigan Coordinates 42.3076493°, -83.8473015° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.3076493,"lon":-83.8473015,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Mendota Hills Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Hills Wind Farm Hills Wind Farm Jump to: navigation, search Name Mendota Hills Wind Farm Facility Mendota Hills Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner GE Energy Developer Navitas Energy Energy Purchaser Exelon Location Near Paw Paw IL Coordinates 41.738291°, -89.044032° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.738291,"lon":-89.044032,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Canadian Hills (Mitsubishi) | Open Energy Information  

Open Energy Info (EERE)

Hills (Mitsubishi) Hills (Mitsubishi) Jump to: navigation, search Name Canadian Hills (Mitsubishi) Facility Canadian Hills (Mitsubishi) Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Atlantic Power Corp Developer Apex Wind Energy Energy Purchaser Oklahoma Municipal Power Authority / SWEPCO Location Calumet OK Coordinates 35.69756036°, -98.20438385° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.69756036,"lon":-98.20438385,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Chandler Hills Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Chandler Hills Wind Farm Chandler Hills Wind Farm Jump to: navigation, search Name Chandler Hills Wind Farm Facility Chandler Hills Wind Farm Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Terra-Gen Power Energy Purchaser Great River Energy Location Chandler Murray County MN Coordinates 43.916988°, -95.953898° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.916988,"lon":-95.953898,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Crofton Hills Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Crofton Hills Wind Farm Crofton Hills Wind Farm Facility Crofton Hills Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Crofton Hills Wind Developer Juhl Wind Energy Purchaser NPPD Location South of Crofton NE Coordinates 42.700138°, -97.505236° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.700138,"lon":-97.505236,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Canadian Hills (Repower) | Open Energy Information  

Open Energy Info (EERE)

Canadian Hills (Repower) Canadian Hills (Repower) Jump to: navigation, search Name Canadian Hills (Repower) Facility Canadian Hills (Repower) Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Atlantic Power Corp Developer Apex Wind Energy Energy Purchaser Oklahoma Municipal Power Authority / SWEPCO Location Calumet OK Coordinates 35.66212553°, -98.12820911° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.66212553,"lon":-98.12820911,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Sibley Hills Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Hills Wind Farm Hills Wind Farm Jump to: navigation, search Name Sibley Hills Wind Farm Facility Sibley Hills Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Northern Alternative Energy Developer Northern Alternative Energy Energy Purchaser Alliant/IES Utilities Location Sibley IA Coordinates 43.4037°, -95.7417° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.4037,"lon":-95.7417,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Campbell Hill Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Campbell Hill Wind Farm Campbell Hill Wind Farm Jump to: navigation, search Name Campbell Hill Wind Farm Facility Campbell Hill Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Duke Energy Carolinas LLC Developer Duke Energy Carolinas LLC Energy Purchaser PacifiCorp Location Northeast of Casper WY Coordinates 42.998955°, -106.021366° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.998955,"lon":-106.021366,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


NPP Grassland: Beacon Hill, U.K.  

NLE Websites -- All DOE Office Websites (Extended Search)

Beacon Hill, U.K., 1972-1973 Beacon Hill, U.K., 1972-1973 [PHOTOGRAPH] Photograph: General view of study site in 1973 (click on the photo to view a series of images from this site). Data Citation Cite this data set as follows: Williamson, P., and J. Pitman. 1998. NPP Grassland: Beacon Hill, U.K., 1972-1973. Data set. Available on-line [http://www.daac.ornl.gov] from Oak Ridge National Laboratory Distributed Active Archive Center, Oak Ridge, Tennessee, U.S.A. Description Productivity of a chalk grassland was studied from 1972 to 1973 at Beacon Hill, West Sussex, U.K. Measurements of above-ground live biomass and total dead matter were made approximately bi-monthly. Above-ground net primary production was estimated by several methods, including peak live biomass, peak total live and dead, and accounting for turnover determined from


DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility

Note: This page contains sample records for the topic "auburn hills mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed


Bunker Hill Sediment Characterization Study  

SciTech Connect

The long history of mineral extraction in the Coeur dAlene Basin has left a legacy of heavy metal laden mine tailings that have accumulated along the Coeur dAlene River and its tributaries (U.S. Environmental Protection Agency, 2001; Barton, 2002). Silver, lead and zinc were the primary metals of economic interest in the area, but the ores contained other elements that have become environmental hazards including zinc, cadmium, lead, arsenic, nickel, and copper. The metals have contaminated the water and sediments of Lake Coeur dAlene, and continue to be transported downstream to Spokane Washington via the Spokane River. In 1983, the EPA listed the Bunker Hill Mining and Metallurgical Complex on the National Priorities List. Since that time, many of the most contaminated areas have been stabilized or isolated, however metal contaminants continue to migrate through the basin. Designation as a Superfund site causes significant problems for the economically depressed communities in the area. Identification of primary sources of contamination can help set priorities for cleanup and cleanup options, which can include source removal, water treatment or no action depending on knowledge about the mobility of contaminants relative to water flow. The mobility of contaminant mobility under natural or engineered conditions depends on multiple factors including the physical and chemical state (or speciation) of metals and the range of processes, some of which can be seasonal, that cause mobilization of metals. As a result, it is particularly important to understand metal speciation (National Research Council, 2005) and the link between speciation and the rates of metal migration and the impact of natural or engineered variations in flow, biological activity or water chemistry.

Neal A. Yancey; Debby F. Bruhn



Vehicle Technologies Office: Workplace Charging Challenge Partner: City of  

NLE Websites -- All DOE Office Websites (Extended Search)

Auburn Hills to someone by E-mail Auburn Hills to someone by E-mail Share Vehicle Technologies Office: Workplace Charging Challenge Partner: City of Auburn Hills on Facebook Tweet about Vehicle Technologies Office: Workplace Charging Challenge Partner: City of Auburn Hills on Twitter Bookmark Vehicle Technologies Office: Workplace Charging Challenge Partner: City of Auburn Hills on Google Bookmark Vehicle Technologies Office: Workplace Charging Challenge Partner: City of Auburn Hills on Delicious Rank Vehicle Technologies Office: Workplace Charging Challenge Partner: City of Auburn Hills on Digg Find More places to share Vehicle Technologies Office: Workplace Charging Challenge Partner: City of Auburn Hills on AddThis.com... Goals Research & Development Testing and Analysis Workplace Charging


Loess Hills and Southern Iowa Development and Conservation (Iowa) |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Loess Hills and Southern Iowa Development and Conservation (Iowa) Loess Hills and Southern Iowa Development and Conservation (Iowa) Loess Hills and Southern Iowa Development and Conservation (Iowa) < Back Eligibility Agricultural Commercial Construction Fuel Distributor General Public/Consumer Industrial Installer/Contractor Institutional Investor-Owned Utility Low-Income Residential Multi-Family Residential Municipal/Public Utility Nonprofit Residential Retail Supplier Rural Electric Cooperative Schools Systems Integrator Transportation Utility Savings Category Alternative Fuel Vehicles Hydrogen & Fuel Cells Buying & Making Electricity Water Home Weatherization Solar Wind Program Info State Iowa Program Type Environmental Regulations Provider Loess Hills Alliance The Loess Hills Development and Conservation Authority, the Loess Hills


Cedar Hills Wind Facility | Open Energy Information  

Open Energy Info (EERE)

Facility Facility Jump to: navigation, search Name Cedar Hills Wind Facility Facility Cedar Hills Wind Facility Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner MDU Utilities Developer MDU Utilities Energy Purchaser MDU Utilities Location Cedar Hills west of Rhame ND Coordinates 46.249235°, -103.756285° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":46.249235,"lon":-103.756285,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Barren Hills Geothermal Project | Open Energy Information  

Open Energy Info (EERE)

Hills Geothermal Project Hills Geothermal Project Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Development Project: Barren Hills Geothermal Project Project Location Information Coordinates 39.01°, -119.19° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.01,"lon":-119.19,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Steamboat Hills Geothermal Facility | Open Energy Information  

Open Energy Info (EERE)

Geothermal Facility Geothermal Facility Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Steamboat Hills Geothermal Facility General Information Name Steamboat Hills Geothermal Facility Facility Steamboat Hills Sector Geothermal energy Location Information Location Reno, Nevada Coordinates 39.5296329°, -119.8138027° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.5296329,"lon":-119.8138027,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Sou Hills Geothermal Project | Open Energy Information  

Open Energy Info (EERE)

Sou Hills Geothermal Project Sou Hills Geothermal Project Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Development Project: Sou Hills Geothermal Project Project Location Information Coordinates 40.143055555556°, -117.72638888889° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.143055555556,"lon":-117.72638888889,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Combine Hills II | Open Energy Information  

Open Energy Info (EERE)

Combine Hills II Combine Hills II Facility Combine Hills II Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Eurus Developer Eurus Energy Purchaser Clark County PUD Location Near Milton-Freewater OR Coordinates 45.946742°, -118.56828° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.946742,"lon":-118.56828,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Golden Hills Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Golden Hills Wind Farm Golden Hills Wind Farm Facility Golden Hills Wind Farm Sector Wind energy Facility Type Commercial Scale Wind Facility Status Proposed Owner BP Alternative Energy Developer BP Alternative Energy Location Near Wasco in Sherman County OR Coordinates 45.547633°, -120.761232° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.547633,"lon":-120.761232,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Red Hills Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Red Hills Wind Farm Red Hills Wind Farm Facility Red Hills Wind Farm Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Acciona Developer Acciona Energy Purchaser N/A Location North of Elk City OK Coordinates 35.531944°, -99.403889° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.531944,"lon":-99.403889,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}



NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)


Enforcement Letter, CH2M Hill- October 4, 2004  

Energy.gov (U.S. Department of Energy (DOE))

Issued to CH2M Hill related to at a Lapse in Dosimetry Accreditation at the Separations Process Research Unit


Deferredlrotation Grazing with Steers in the Kansas Flint Hills  

E-Print Network (OSTI)

Deferredlrotation Grazing with Steers in the Kansas Flint Hills CLENTON E. OWENSBY, ED F. SMITH, AND KLING L. ANDERSON Highlight: Deferred-rotation grazing of Kansas Flint Hills' range grazed by steers May was in the Flint Hills region of the True Prairie, 5 miles northwest of Manhattan, Kans. (described by Herbel

Owensby, Clenton E.


Nutritive Value of Tree Leaves m the Kansas Flint Hills  

E-Print Network (OSTI)

w . 11 `c7 Nutritive Value of Tree Leaves m the Kansas Flint Hills JR. FORWOOD AND C.E. OWENSBY Flint Hills, the tons of tree leaves that fall to the ground each autumn are largely ignored MANAGEMENT 38(l), January 1985 We have observed cattle grazing Flint Hills rangeland in the fall selecting

Owensby, Clenton E.


Shaokatan Hills Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Shaokatan Hills Wind Farm Shaokatan Hills Wind Farm Jump to: navigation, search Name Shaokatan Hills Wind Farm Facility Shaokatan Hills Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Edison Mission Group owns majority Developer Northern Alternative Energy Energy Purchaser Xcel Energy Location Hendricks in Lincoln County MN Coordinates 44.4039°, -96.432767° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":44.4039,"lon":-96.432767,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Rolling Hills (IA) | Open Energy Information  

Open Energy Info (EERE)

Rolling Hills (IA) Rolling Hills (IA) Jump to: navigation, search Name Rolling Hills (IA) Facility Rolling Hills (IA) Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner MidAmerican Energy Company Developer MidAmerican Energy Company Energy Purchaser MidAmerican Energy Company Location Massena IA Coordinates 41.230443°, -94.75459° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.230443,"lon":-94.75459,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Hill-climbing SMT processor resource distribution  

Science Conference Proceedings (OSTI)

The key to high performance in Simultaneous MultiThreaded (SMT) processors lies in optimizing the distribution of shared resources to active threads. Existing resource distribution techniques optimize performance only indirectly. They infer potential ... Keywords: Hill-climbing algorithm, SMT processor, limit study

Seungryul Choi; Donald Yeung



Black Hills Energy (Gas) - Residential New Construction Rebate Program |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Black Hills Energy (Gas) - Residential New Construction Rebate Black Hills Energy (Gas) - Residential New Construction Rebate Program Black Hills Energy (Gas) - Residential New Construction Rebate Program < Back Eligibility Construction Residential Savings Category Appliances & Electronics Heating & Cooling Home Weatherization Construction Commercial Weatherization Commercial Heating & Cooling Design & Remodeling Other Program Info State Iowa Program Type Utility Rebate Program Rebate Amount Builder Incentive: $800 - $2300 Provider Black Hills Energy Black Hills Energy offers new construction rebates for home builders in the eligible service area. Rebates between $800 and $5,000 are available for a range of efficiency measures incorporated into home construction. Qualifying homes must use natural gas and meet the minimum efficiency


DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP

Note: This page contains sample records for the topic "auburn hills mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4


Singaraya Hills Green Power Pvt Ltd | Open Energy Information  

Open Energy Info (EERE)

Singaraya Hills Green Power Pvt Ltd Singaraya Hills Green Power Pvt Ltd Jump to: navigation, search Name Singaraya Hills Green Power Pvt. Ltd. Place Vijayawada, Andhra Pradesh, India Zip 520 010 Sector Biomass Product Vijayawada based biomass project developers. References Singaraya Hills Green Power Pvt. Ltd.[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Singaraya Hills Green Power Pvt. Ltd. is a company located in Vijayawada, Andhra Pradesh, India . References ↑ "Singaraya Hills Green Power Pvt. Ltd." Retrieved from "http://en.openei.org/w/index.php?title=Singaraya_Hills_Green_Power_Pvt_Ltd&oldid=351110" Categories: Clean Energy Organizations Companies Organizations Stubs


Compound and Elemental Analysis At Fenton Hill Hdr Geothermal Area  

Open Energy Info (EERE)

Compound and Elemental Analysis At Fenton Hill Hdr Geothermal Area Compound and Elemental Analysis At Fenton Hill Hdr Geothermal Area (Brookins & Laughlin, 1983) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Compound and Elemental Analysis At Fenton Hill Hdr Geothermal Area (Brookins & Laughlin, 1983) Exploration Activity Details Location Fenton Hill Hdr Geothermal Area Exploration Technique Compound and Elemental Analysis Activity Date Usefulness not indicated DOE-funding Unknown Notes Fenton Hill HDR Site References D. G. Brookins, A. W. Laughlin (1983) Rb-Sr Geochronologic Investigation Of Precambrian Samples From Deep Geothermal Drill Holes, Fenton Hill, New Mexico Retrieved from "http://en.openei.org/w/index.php?title=Compound_and_Elemental_Analysis_At_Fenton_Hill_Hdr_Geothermal_Area_(Brookins_%26_Laughlin,_1983)&oldid=511281"


Hammars Hill Energy HHE Ltd | Open Energy Information  

Open Energy Info (EERE)

Hammars Hill Energy HHE Ltd Hammars Hill Energy HHE Ltd Jump to: navigation, search Name Hammars Hill Energy (HHE) Ltd Place Scotland, United Kingdom Sector Wind energy Product UK-based wind power project developer. References Hammars Hill Energy (HHE) Ltd[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Hammars Hill Energy (HHE) Ltd is a company located in Scotland, United Kingdom . References ↑ "Hammars Hill Energy (HHE) Ltd" Retrieved from "http://en.openei.org/w/index.php?title=Hammars_Hill_Energy_HHE_Ltd&oldid=346359" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...


St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...


Short-Rotation Crops for Bioenergy: Proceedings of IEA, Bioenergy, Task 17 Meeting in Auburn, Alabama, USA, September 6-9, 1999  

DOE Green Energy (OSTI)

These proceedings are the results of the third meeting of Task 17 (Short-Rotation Crops for Bioenergy) within the framework of International Energy Agency (IEA), Bioenergy. (Minutes from the meeting can be seen at page 91.) The meeting was held in Auburn, Alabama, USA, September 6--9, 1999. The meeting was held soon after President Clinton of the United States signed Executive Order No.13134: DEVELOPING AND PROMOTING BIOBASED PRODUCTS AND BIOENERGY on August 12, 1999. Executive orders in the US are official documents, through which the President of the US manages the operation of the Federal Government. This order outlines the administration's goal of tripling the use of biomass products and bioenergy in the US by the year 2010. During the time of this meeting, it was also known from sources in Europe that the European Union (EU) commission was working on draft instructions to its member countries on how to increase the use of renewable energy from six to twelve percent in Europe within 10 years. The objectives of Task 17 support the goals of member countries for bioenergy production and use. These objectives are as follows: to stimulate the full-scale implementation of energy crops in the participating countries; to strengthen the contacts and co-operation between participating countries, scientists, biomass producers, machine developers, entrepreneurs, and end users to select the most urgent research and development areas and suggest projects of co-operation; to inform Ex-Co- members; and to deliver proceedings from the meetings.

Wright, L.L.



Black Hills Power Inc | Open Energy Information  

Open Energy Info (EERE)

Jump to: navigation, search Jump to: navigation, search Name Black Hills Power Inc Place Rapid City, South Dakota Utility Id 19545 Utility Location Yes Ownership I NERC Location WECC NERC MRO Yes NERC WECC Yes Operates Generating Plant Yes Activity Generation Yes Activity Transmission Yes Activity Buying Transmission Yes Activity Distribution Yes Activity Wholesale Marketing Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] SGIC[3] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! Black Hills Power, Inc. Smart Grid Project was awarded $9.576 Recovery Act Funding with a total project value of $19,153,256. Utility Rate Schedules Grid-background.png GL (General Service Large) Commercial GS (General Service - Total Electric) Commercial


On convergence of the Flint Hills series  

E-Print Network (OSTI)

It is not known whether the Flint Hills series $\\sum_{n=1}^{\\infty} \\frac{1}{n^3\\cdot\\sin(n)^2}$ converges. We show that this question is closely related to the irrationality measure of $\\pi$, denoted $\\mu(\\pi)$. In particular, convergence of the Flint Hills series would imply $\\mu(\\pi) \\leq 2.5$ which is much stronger than the best currently known upper bound $\\mu(\\pi)\\leq 7.6063...$. This result easily generalizes to series of the form $\\sum_{n=1}^{\\infty} \\frac{1}{n^u\\cdot |\\sin(n)|^v}$ where $u,v>0$. We use the currently known bound for $\\mu(\\pi)$ to derive conditions on $u$ and $v$ that guarantee convergence of such series.

Alekseyev, Max A



Bishop Hill II | Open Energy Information  

Open Energy Info (EERE)

II II Jump to: navigation, search Name Bishop Hill II Facility Bishop Hill II Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner MidAmerican Energy Developer Ivenergy Energy Purchaser Ameren Illinois Location Cambridge IL Coordinates 41.24438513°, -90.09338379° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.24438513,"lon":-90.09338379,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Rolling Hills (WY) | Open Energy Information  

Open Energy Info (EERE)

WY) WY) Jump to: navigation, search Name Rolling Hills (WY) Facility Rolling Hills (WY) Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner EnXco Developer PacifiCorp Location Converse WY Coordinates 43.08080003°, -105.8497953° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.08080003,"lon":-105.8497953,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


EA-1581: Sand Hills Wind Project, Wyoming  

Energy.gov (U.S. Department of Energy (DOE))

The Bureau of Land Management, with DOEs Western Area Power Administration as a cooperating agency, is preparing this EA to evaluate the environmental impacts of a proposal to construct, operate, and maintain the Sand Hills Wind Energy Facility on private and federal lands in Albany County, Wyoming. If the proposed action is implemented, Western would interconnect the proposed facility to an existing transmission line.


DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either


DOE Settles Elk Hills Equity Claims | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Settles Elk Hills Equity Claims Settles Elk Hills Equity Claims DOE Settles Elk Hills Equity Claims April 22, 2011 - 4:58pm Addthis The Department of Energy announced today that it has settled a longstanding dispute over equity rights to the Naval Petroleum Reserve-1 (commonly referred to as "Elk Hills") located in Bakersfield, California. Under the agreement, Chevron U.S.A., Inc. has agreed to pay $108 million to the United States to resolve all outstanding equity claims. From World War II to 1998, the United States and Chevron (along with its predecessor Standard Oil of California) operated their respective interests in the Elk Hills oil field as a single unit. The Department sold its interest in Elk Hills in 1998. However, an agreement between Chevron and the Department allowed for equity interests in the field to be redetermined


Microsoft Word - SPP_Success_Story_Hill_AFB_FINAL.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

Hill Air Force Base Hill Air Force Base 1820 Midpark Road, Suite C, Knoxville, TN 37921 75 CES/CEEE, 7302 Wardleigh Road, Bldg 15, Hill AFB, UT 84056-5223 Business: Energy Services Company (ESCO) Business: United States Air Force Joseph T. Price Kent Nomura, Deputy, Maintenance Engineering Phone: (865) 330-7216 / Fax: (865) 330-7217 Phone: (801) 777-7268 / (801) 777-5946 Email: jprice@ameresco.com Email: kent.nomura@hill.af.mil Hill Air Force and Ameresco Landfill Gas Generator Energy Project is the First of its Kind for the Department of Defense and the State of Utah. Project Scope Hill Air Force Base and Ameresco teamed up to create a generating facility which is powered by landfill gasses. The landfill gas extracted from the Davis County Landfill is used to fuel two 1400kW generators. These produce


Black Hills Energy - Solar Power Program | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Black Hills Energy - Solar Power Program Black Hills Energy - Solar Power Program Black Hills Energy - Solar Power Program < Back Eligibility Commercial Fed. Government General Public/Consumer Industrial Local Government Nonprofit Residential Schools State Government Savings Category Solar Buying & Making Electricity Program Info Start Date 7/1/2006 State Colorado Program Type Performance-Based Incentive Rebate Amount Systems up to 10 kW: $0.1267/kWh (only for first 5 kW) Systems larger than 10 kW up to 100 kW: $0.16/kWh Provider Black Hills Energy Black Hills Energy has a performance-based incentive (PBI) for photovoltaic (PV) systems up to 100 kilowatts (kW) in capacity. In exchange for these incentives, Black Hills Energy earns the right to the renewable energy credits (RECs) associated with the PV-generated electricity for a period of


Independent Activity Report, CH2M Hill Plateau Remediation Company -  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Independent Activity Report, CH2M Hill Plateau Remediation Company Independent Activity Report, CH2M Hill Plateau Remediation Company - January 2011 Independent Activity Report, CH2M Hill Plateau Remediation Company - January 2011 January 2011 Review of the CH2M Hill Plateau Remediation Company Unreviewed Safety Question Procedure [ARPT-RL-2011-003] The U.S. Department of Energy Office of Independent Oversight, within the Office of Health, Safety and Security, during a site visit from January 10-14, 2011, presented the results of a technical review of the CH2M Hill Plateau Remediation Company (PRC) Unreviewed Safety Question (USQ) Procedure. Independent Activity Report, CH2M Hill Plateau Remediation Company - January 2011 More Documents & Publications CX-009415: Categorical Exclusion Determination Independent Activity Report, Richland Operations Office - January 2011


EA-1581: Sand Hills Wind Project, Wyoming | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

81: Sand Hills Wind Project, Wyoming 81: Sand Hills Wind Project, Wyoming EA-1581: Sand Hills Wind Project, Wyoming Location of the proposed Sand Hills Wind Project, near Laramie, Wyoming Location of the proposed Sand Hills Wind Project, near Laramie, Wyoming Summary The Bureau of Land Management, with DOE's Western Area Power Administration as a cooperating agency, is preparing this EA to evaluate the environmental impacts of a proposal to construct, operate, and maintain the Sand Hills Wind Energy Facility on private and federal lands in Albany County, Wyoming. If the proposed action is implemented, Western would interconnect the proposed facility to an existing transmission line. Public Comment Opportunities No public comment opportunities available at this time. List of Available Documents


DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated

Note: This page contains sample records for the topic "auburn hills mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...


DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical


WIND DATA REPORT Camden Hills Regional High School, ME  

E-Print Network (OSTI)

WIND DATA REPORT Camden Hills Regional High School, ME March 1st 2006 to May 31th 2006 Prepared.................................................................................................................... 10 Wind Speed Time Series........................................................................................................... 10 Wind Speed Distributions

Massachusetts at Amherst, University of


WIND DATA REPORT Camden Hills Regional High School, ME  

E-Print Network (OSTI)

WIND DATA REPORT Camden Hills Regional High School, ME December 1, 2006 ­ February 28, 2007...................................................................................................................... 7 Wind Speed Time Series............................................................................................................. 8 Wind Speed Distributions

Massachusetts at Amherst, University of


WIND DATA REPORT Camden Hills Regional High School, ME  

E-Print Network (OSTI)

WIND DATA REPORT Camden Hills Regional High School, ME June 1st 2006 to August 31th 2006 Prepared.................................................................................................................... 10 Wind Speed Time Series........................................................................................................... 10 Wind Speed Distributions

Massachusetts at Amherst, University of


WIND DATA REPORT Camden Hills Regional High School, ME  

E-Print Network (OSTI)

WIND DATA REPORT Camden Hills Regional High School, ME December 1st 2005 to February 28th 2006.................................................................................................................... 10 Wind Speed Time Series........................................................................................................... 10 Wind Speed Distributions

Massachusetts at Amherst, University of


WIND DATA REPORT Camden Hills Regional High School, ME  

E-Print Network (OSTI)

WIND DATA REPORT Camden Hills Regional High School, ME September 1st 2006 to November 30th 2006.................................................................................................................... 10 Wind Speed Time Series........................................................................................................... 10 Wind Speed Distributions

Massachusetts at Amherst, University of


Bunker Hill, Indiana: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

with form History Share this page on Facebook icon Twitter icon Bunker Hill, Indiana: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates...


Green Hill, Tennessee: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Login | Sign Up Search Page Edit with form History Facebook icon Twitter icon Green Hill, Tennessee: Energy Resources Jump to: navigation, search Equivalent URI DBpedia...


The Texas Hill Country and the looming water crisis.  

E-Print Network (OSTI)

??This report examines the cultural and economic growth of the Texas Hill Country resulting from the construction of the Highland Lake chain. It compares the (more)

Brah, Bryan Lewis



Injectivity Test At Fenton Hill Hdr Geothermal Area (Grigsby...  

Open Energy Info (EERE)

navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Injectivity Test At Fenton Hill Hdr Geothermal Area (Grigsby, Et Al., 1983) Exploration Activity Details...


Black Hills Energy (Gas)- Commercial Energy Efficiency Rebate Programs  

Energy.gov (U.S. Department of Energy (DOE))

Black Hills Energy offers commercial and industrial customers incentives to encourage energy efficiency in eligible businesses. Prescriptive rebates are available for furnace and boiler...


Black Hills Energy (Gas)- Commercial Energy Efficiency Program  

Energy.gov (U.S. Department of Energy (DOE))

Black Hills Energy offers multiple programs for Colorado commercial and industrial customers to save natural gas in eligible facilities. The commercial prescriptive rebate program provides...


Town of Chapel Hill - Worthwhile Investments Save Energy (WISE...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

to help subsidize energy efficiency improvements in Chapel Hill homes. Qualified homeowners can choose from a list of pre-qualified contractors who will conduct energy...


Modeling-Computer Simulations At Fenton Hill Hdr Geothermal Area...  

Open Energy Info (EERE)

navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Modeling-Computer Simulations At Fenton Hill Hdr Geothermal Area (Goff & Decker, 1983) Exploration...


Modeling-Computer Simulations At Fenton Hill Hdr Geothermal Area...  

Open Energy Info (EERE)

navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Modeling-Computer Simulations At Fenton Hill Hdr Geothermal Area (Heiken & Goff, 1983) Exploration...


Blue Hill Investment Partners LLC | Open Energy Information  

Open Energy Info (EERE)

Investment Partners LLC Jump to: navigation, search Name Blue Hill Investment Partners LLC Place Philadelphia, Pennsylvania Zip PA 19118 Sector Renewable Energy Product A...


Town of Chapel Hill - Land-Use Management Ordinance | Department...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Land-Use Management Ordinance Town of Chapel Hill - Land-Use Management Ordinance Eligibility Residential Savings For Solar Buying & Making Electricity Heating & Cooling Commercial...


Black Hills Energy (Gas) - Residential Energy Efficiency Program |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Black Hills Energy (Gas) - Residential Energy Efficiency Program Black Hills Energy (Gas) - Residential Energy Efficiency Program Black Hills Energy (Gas) - Residential Energy Efficiency Program < Back Eligibility Residential Savings Category Heating & Cooling Commercial Heating & Cooling Heating Home Weatherization Commercial Weatherization Sealing Your Home Ventilation Appliances & Electronics Water Heating Maximum Rebate All Incentives: $750/customer Ceiling/Wall/Foundation Insulation: $500 Infiltration Control/Caulking/Weather Stripping: $200 Duct Insulation: $150 Program Info State Colorado Program Type Utility Rebate Program Rebate Amount Qualified New Homes (Builders): Contact Black Hills Energy Evaluations: Free or reduced cost Storage Water Heater: $75 or $300 Tankless Water Heater: $300 Furnace/Boiler Maintenance: $30 or $100


Black Hills Energy (Gas) - Commercial Energy Efficiency Program |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Black Hills Energy (Gas) - Commercial Energy Efficiency Program Black Hills Energy (Gas) - Commercial Energy Efficiency Program Black Hills Energy (Gas) - Commercial Energy Efficiency Program < Back Eligibility Commercial Industrial Institutional Local Government Nonprofit Schools State Government Savings Category Heating & Cooling Commercial Heating & Cooling Heating Home Weatherization Commercial Weatherization Sealing Your Home Construction Design & Remodeling Other Appliances & Electronics Water Heating Windows, Doors, & Skylights Maximum Rebate General: Contact Black Hills Energy; Rebates over $10,000 must be pre-approved Ceiling/Wall Insulation: $10,000 Infiltration Control: $1,500 Energy Evaluations: $1500 Custom: 50% of incremental cost Program Info Start Date 7/1/2010 State Colorado Program Type Utility Rebate Program

Note: This page contains sample records for the topic "auburn hills mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Blue Hill Partners LLC | Open Energy Information  

Open Energy Info (EERE)

Logo: Blue Hill Partners LLC Name Blue Hill Partners LLC Address 40 W. Evergreen Ave. Place Philadelphia, Pennsylvania Zip 19118 Region Northeast - NY NJ CT PA Area Product Invests equity capital in venture-stage companies in the advanced industrial technology sector Phone number (215) 247-2400 Website http://www.bluehillpartners.co Coordinates 40.075493°, -75.208266° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.075493,"lon":-75.208266,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab



Town of Chapel Hill - Energy Conservation Requirements for Town Buildings |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Town of Chapel Hill - Energy Conservation Requirements for Town Town of Chapel Hill - Energy Conservation Requirements for Town Buildings Town of Chapel Hill - Energy Conservation Requirements for Town Buildings < Back Eligibility Construction Local Government Savings Category Heating & Cooling Home Weatherization Construction Commercial Weatherization Commercial Heating & Cooling Design & Remodeling Solar Lighting Windows, Doors, & Skylights Heating Water Heating Program Info State North Carolina Program Type Energy Standards for Public Buildings Provider Town of Chapel Hill The Town of Chapel Hill's energy-conservation ordinance requires that all town-owned buildings be designed to achieve a goal of achieving a Silver level certification as defined by the Green Building Council's Leadership in Energy and Environmental Design (LEED) program.


Accidental Gas Emission From Shallow Pressurized Aquifers At Alban Hills  

Open Energy Info (EERE)

Accidental Gas Emission From Shallow Pressurized Aquifers At Alban Hills Accidental Gas Emission From Shallow Pressurized Aquifers At Alban Hills Volcano (Rome, Italy)- Geochemical Evidence Of Magmatic Degassing? Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Journal Article: Accidental Gas Emission From Shallow Pressurized Aquifers At Alban Hills Volcano (Rome, Italy)- Geochemical Evidence Of Magmatic Degassing? Details Activities (0) Areas (0) Regions (0) Abstract: Recent studies suggested that Alban Hills (Rome) is a quiescent and not an extinct volcano, as it produced Holocene eruptions and several lahars until Roman times by water overflow from the Albano crater lake. Alban Hills are presently characterized by high PCO2 in groundwaters and by several cold gas emissions usually in sites where excavations removed the


McGuiness Hills Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

McGuiness Hills Geothermal Area McGuiness Hills Geothermal Area Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: McGuiness Hills Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (1) 9 Exploration Activities (0) 10 References Map: McGuiness Hills Geothermal Area McGuiness Hills Geothermal Area Location Map Area Overview Geothermal Area Profile Location: Nevada Exploration Region: Northern Basin and Range Geothermal Region GEA Development Phase: none"None" is not in the list of possible values (Phase I - Resource Procurement and Identification, Phase II - Resource Exploration and Confirmation, Phase III - Permitting and Initial Development, Phase IV - Resource Production and Power Plant Construction) for this property.


DOE - Office of Legacy Management -- ANC Gas Hills Site - 040  

NLE Websites -- All DOE Office Websites (Extended Search)

ANC Gas Hills Site - 040 ANC Gas Hills Site - 040 FUSRAP Considered Sites Site: ANC Gas Hills Site (040) Designated Name: Alternate Name: Location: Evaluation Year: Site Operations: Site Disposition: Radioactive Materials Handled: Primary Radioactive Materials Handled: Radiological Survey(s): Site Status: The ANC Gas Hills site is a Uranium Mill Tailings Remedial Action (UMTRA) Title II site located in Gas Hills, Wyoming. UMTRA Title II sites are privately owned and operated sites that were active when the Uranium Mill Tailings Radiation Control Act was passed in 1978. The majority of the milling conducted at these sites was for private sale, but a portion was sold to the U.S. Government. After the owner completes U.S. Nuclear Regulatory Commission license termination, the Department of Energy¿s


Rock Hill Utilities - Water Heater and Heat Pump Rebate Program |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Rock Hill Utilities - Water Heater and Heat Pump Rebate Program Rock Hill Utilities - Water Heater and Heat Pump Rebate Program Rock Hill Utilities - Water Heater and Heat Pump Rebate Program < Back Eligibility Residential Savings Category Heating & Cooling Commercial Heating & Cooling Heat Pumps Appliances & Electronics Water Heating Program Info State South Carolina Program Type Utility Rebate Program Rebate Amount Water Heater: up to $275 Heat Pump Replacement: $400 Provider Rock Hill Utilities Through the SmartChoice program, Rock Hill Utilities offers rebates for water heater and heat pump replacements. Information on financing for heat pumps can also be found on the web site listed above. If both the water heater and heat pump are purchased then the customer may qualify for the Great Rate program. The Great Rate program will add a 25% discount to a


DOE/EA-1967: Hills Creek-Lookout Point Transmission Line Rebuild...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DOEEA-1967: Hills Creek-Lookout Point Transmission Line Rebuild, Lane County, Oregon DOEEA-1967: Hills Creek-Lookout Point Transmission Line Rebuild, Lane County, Oregon Summary...


Joint Cross Well and Single Well Seismic Studies at Lost Hills, California  

E-Print Network (OSTI)

were con- ducted in a diatomite reservoir to monitor theWater Saturation in Diatomite using Wireline Logs, Losttechniques. Lost Hills Diatomite The reservoir at Lost Hills

Gritto, Roland; Daley, Thomas M.; Myer, Larry R.



Rolling Hills Electric Coop | Open Energy Information  

Open Energy Info (EERE)

Electric Coop Electric Coop Jump to: navigation, search Name Rolling Hills Electric Coop Place Kansas Utility Id 16267 Utility Location Yes Ownership C NERC Location SPP NERC SPP Yes RTO SPP Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Heat Pump Rider(single Phase) Residential Irrigation (I-10) Commercial Irrigation - Load Control (I-LC-10) Commercial Irrigation -Voluntary Load Management (I-VLM-10) Commercial Large Power (LP-10) Three phase for a demand of not less than 200 kW. Commercial Off Peak (OP-10), Three phase services >15kW Primary Power Service (PP-10) Commercial


DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP


Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)



RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state


Black Hills Energy (Gas) - Residential Energy Efficiency Rebate Programs |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Black Hills Energy (Gas) - Residential Energy Efficiency Rebate Black Hills Energy (Gas) - Residential Energy Efficiency Rebate Programs Black Hills Energy (Gas) - Residential Energy Efficiency Rebate Programs < Back Eligibility Residential Savings Category Heating & Cooling Commercial Heating & Cooling Heating Home Weatherization Commercial Weatherization Sealing Your Home Appliances & Electronics Design & Remodeling Windows, Doors, & Skylights Water Heating Maximum Rebate Insulation: $750 Weather-Stripping and Caulking: $200 Program Info State Iowa Program Type Utility Rebate Program Rebate Amount Energy Evaluation: Free Clothes Washers: $100 Dishwashers: $20 Replacement Furnaces: $250 - $400 Replacement Boilers: $150 or $400 Duct Repair/Sealing: $200 Duct Insulation (R-8): $150 Insulation/Weather-Stripping/Caulking: 70% of project cost


Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mkinen; Jorma Tarhio



Independent Oversight Review, Hanford Site CH2M Hill Plateau Remediation Company- November 2012  

Energy.gov (U.S. Department of Energy (DOE))

Review of the Hanford Site CH2M Hill Plateau Remediation Company Implementation Verification Review Processes


Mars Hill (2006) Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Mars Hill (2006) Wind Farm Mars Hill (2006) Wind Farm Jump to: navigation, search Name Mars Hill (2006) Wind Farm Facility Mars Hill (2006) Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner UPC Wind Partners Developer UPC Wind Partners Energy Purchaser Confidential Location Aroostook county ME Coordinates 46.551388°, -67.808333° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":46.551388,"lon":-67.808333,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Four Hills Nashua Landfill Biomass Facility | Open Energy Information  

Open Energy Info (EERE)

Four Hills Nashua Landfill Biomass Facility Four Hills Nashua Landfill Biomass Facility Jump to: navigation, search Name Four Hills Nashua Landfill Biomass Facility Facility Four Hills Nashua Landfill Sector Biomass Facility Type Landfill Gas Location Hillsborough County, New Hampshire Coordinates 42.8334794°, -71.6673352° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.8334794,"lon":-71.6673352,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Energy Innovation Hub Directors Visit the Hill | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Directors Visit the Hill Directors Visit the Hill Energy Innovation Hub Directors Visit the Hill April 24, 2013 - 5:39pm Addthis Rep. Chaka Fattah (D-PA) and Acting Secretary of Energy Daniel Poneman speak during an event on Capitol Hill featuring the directors of the five energy innovation hubs. | Energy Department video. Ben Dotson Ben Dotson Project Coordinator for Digital Reform, Office of Public Affairs What is an Energy Innovation Hub? Modeled after the strong scientific management characteristics of the Manhattan Project and AT&T Bell Laboratories, the Energy Innovation Hubs are integrated research centers that combine basic and applied research with engineering to accelerate scientific discovery that addresses critical energy issues. Yesterday, the directors of the Energy Department's Energy Innovation Hubs


CH2M HILL Plateau Remediation Company | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

CH2M HILL Plateau Remediation Company CH2M HILL Plateau Remediation Company CH2M HILL Plateau Remediation Company The Office of Hea1th, Safety and Security's Office of Enforcement and Oversight has evaluated the facts and circumstances of a series of radiological work deficiencies at the Plutonium Finishing Plant (PFP) and the 105 K-East Reactor Facility (105KE Reactor) by CH2M HILL Plateau Remediation Company (CHPRC). The radiological work deficiencies at PFP are documented in the April 29, 2011, Department of Energy Richland Operations Office (DOE-RL) Surveillance Report S-11-SED-CHP~C-PFP-002, Planning and Execution of Radiological Work. S-11-SED-CHPRC-PFP-002 documented four examples where inadequate hazard analysis resulted in airborne radioactivity that exceeded the limits of the controlling radiological work permit.

Note: This page contains sample records for the topic "auburn hills mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Flint Hills Rural E C A, Inc | Open Energy Information  

Open Energy Info (EERE)

Flint Hills Rural E C A, Inc Place Kansas Utility Id 6431 Utility Location Yes Ownership C NERC Location SPP Activity Distribution Yes References EIA Form EIA-861 Final Data File...


Coupled Model Simulation of Snowfall Events over the Black Hills  

Science Conference Proceedings (OSTI)

Numerical simulations of two snowfall events over the Black Hills of South Dakota are made to demonstrate the use and potential of a coupled atmospheric and land surface model. The Coupled AtmosphericHydrologic Model System was used to simulate ...

J. Wang; M. R. Hjelmfelt; W. J. Capehart; R. D. Farley



Fenton Hill Hdr Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Fenton Hill Hdr Geothermal Area Fenton Hill Hdr Geothermal Area (Redirected from Fenton Hill Hdr Area) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Fenton Hill Hdr Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (26) 10 References Area Overview Geothermal Area Profile Location: New Mexico Exploration Region: Rio Grande Rift GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content History and Infrastructure Operating Power Plants: 0 No geothermal plants listed.


Puente Hills Energy Recovery Biomass Facility | Open Energy Information  

Open Energy Info (EERE)

Puente Hills Energy Recovery Biomass Facility Puente Hills Energy Recovery Biomass Facility Jump to: navigation, search Name Puente Hills Energy Recovery Biomass Facility Facility Puente Hills Energy Recovery Sector Biomass Facility Type Landfill Gas Location Los Angeles County, California Coordinates 34.3871821°, -118.1122679° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":34.3871821,"lon":-118.1122679,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Edom Hills (repower) Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Edom Hills (repower) Wind Farm Edom Hills (repower) Wind Farm Jump to: navigation, search Name Edom Hills (repower) Wind Farm Facility Edom Hills (repower) Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner BP Alternative Energy Developer BP Alternative Energy Energy Purchaser Southern California Edison Co Location CA Coordinates 33.9095°, -116.734° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":33.9095,"lon":-116.734,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


City of Olive Hill, Kentucky (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Olive Hill, Kentucky (Utility Company) Olive Hill, Kentucky (Utility Company) Jump to: navigation, search Name Olive Hill City of Place Kentucky Utility Id 14103 Utility Location Yes Ownership M NERC Location RFC NERC RFC Yes Activity Buying Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Commercial Industrial Industrial Residential Average Rates Residential: $0.0920/kWh Commercial: $0.1090/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=City_of_Olive_Hill,_Kentucky_(Utility_Company)&oldid=410054


Golden Hills Solar Power Plant | Open Energy Information  

Open Energy Info (EERE)

Hills Solar Power Plant Hills Solar Power Plant Jump to: navigation, search Name Golden Hills Solar Power Plant Facility Golden Hills Solar Sector Solar Facility Type Photovoltaic Developer PowerWorks Location Alameda County, California Coordinates 37.6016892°, -121.7195459° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.6016892,"lon":-121.7195459,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Clean Cities: Triangle Clean Cities (Raleigh, Durham, Chapel Hill)  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

Triangle Clean Cities (Raleigh, Durham, Chapel Hill) Coalition Triangle Clean Cities (Raleigh, Durham, Chapel Hill) Coalition The Triangle Clean Cities (Raleigh, Durham, Chapel Hill) coalition works with vehicle fleets, fuel providers, community leaders, and other stakeholders to reduce petroleum use in transportation. Triangle Clean Cities (Raleigh, Durham, Chapel Hill) coalition Contact Information Lacey Jane Wolfe 919-558-2705 lacey@tjcog.org Coalition Website Clean Cities Coordinator Lacey Jane Wolfe Photo of Lacey Jane Wolfe Lacey Jane Wolfe began her work with Triangle Clean Cities Coalition in September 2009. She serves as the Energy and Environment Program Specialist at Triangle J Council of Governments. Her responsibilities include reporting for the Carolina Blue Skies and Green Jobs Initiative, directing the Turn Off Your Engine Campaign (idle reduction at public schools),


Energy Innovation Hub Directors Visit the Hill | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Energy Innovation Hub Directors Visit the Hill Energy Innovation Hub Directors Visit the Hill Energy Innovation Hub Directors Visit the Hill April 24, 2013 - 5:39pm Addthis Rep. Chaka Fattah (D-PA) and Acting Secretary of Energy Daniel Poneman speak during an event on Capitol Hill featuring the directors of the five energy innovation hubs. | Energy Department video. Ben Dotson Ben Dotson Project Coordinator for Digital Reform, Office of Public Affairs What is an Energy Innovation Hub? Modeled after the strong scientific management characteristics of the Manhattan Project and AT&T Bell Laboratories, the Energy Innovation Hubs are integrated research centers that combine basic and applied research with engineering to accelerate scientific discovery that addresses critical energy issues. Yesterday, the directors of the Energy Department's Energy Innovation Hubs


Case Study - Hill Air Force Base, Utah | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Hill Air Force Base, Utah Hill Air Force Base, Utah Case Study - Hill Air Force Base, Utah October 7, 2013 - 2:00pm Addthis Overview Energy savings performance contracting at Hill Air Force Base generated much interest during a recent training session on energy management that downlinked 12 Department of Defense sites. Energy systems in 940 buildings on the Base will be upgraded under an 18-year ESPC between the Government and the energy service company, CES/Way. Improvements are distributed over five task orders that will be completed in five years, with CES/Way providing $2.5 million in up-front costs for the first two task orders. Utah Power & Light will provide $8 million in rebates to help cover the contractor's initial investment, maintenance services, and interest costs.


Black Hills Power, Inc. Smart Grid Project | Open Energy Information  

Open Energy Info (EERE)

Black Hills Power, Inc. Smart Grid Project Black Hills Power, Inc. Smart Grid Project Jump to: navigation, search Project Lead Black Hills Power, Inc. Country United States Headquarters Location Rapid City, South Dakota Additional Benefit Places North Dakota, Minnesota Recovery Act Funding $9.576,628 Total Project Value $19,153,256 Coverage Area Coverage Map: Black Hills Power, Inc. Smart Grid Project Coordinates 44.0805434°, -103.2310149° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[]}


Smoky Hills II Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Smoky Hills II Wind Farm Smoky Hills II Wind Farm Jump to: navigation, search Name Smoky Hills II Wind Farm Facility Smoky Hills II Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Enel North America Developer TradeWind Energy Location Lincoln County KS Coordinates 38.886777°, -98.178906° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":38.886777,"lon":-98.178906,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Settlers Hill Gas Recovery Biomass Facility | Open Energy Information  

Open Energy Info (EERE)

Settlers Hill Gas Recovery Biomass Facility Settlers Hill Gas Recovery Biomass Facility Jump to: navigation, search Name Settlers Hill Gas Recovery Biomass Facility Facility Settlers Hill Gas Recovery Sector Biomass Facility Type Landfill Gas Location Kane County, Illinois Coordinates 41.987884°, -88.4016041° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.987884,"lon":-88.4016041,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Whitewater Hill Wind Farm I | Open Energy Information  

Open Energy Info (EERE)

Whitewater Hill Wind Farm I Whitewater Hill Wind Farm I Jump to: navigation, search Name Whitewater Hill Wind Farm I Facility Whitewater Hill Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Developer Cannon Power Corp. Energy Purchaser L.A. Department of Water Resources Location San Gorgonio CA Coordinates 33.9095°, -116.734° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":33.9095,"lon":-116.734,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


MHK Technologies/Davidson Hill Venturi DHV Turbine | Open Energy  

Open Energy Info (EERE)

MHK Technologies/Davidson Hill Venturi DHV Turbine MHK Technologies/Davidson Hill Venturi DHV Turbine < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Davidson Hill Venturi DHV Turbine.jpg Technology Profile Primary Organization Tidal Energy Pty Ltd Project(s) where this technology is utilized *MHK Projects/QSEIF Grant Sea Testing *MHK Projects/Stradbroke Island *MHK Projects/Tidal Energy Project Portugal Technology Resource Click here Current/Tidal Technology Type Click here Cross Flow Turbine Technology Readiness Level Click here TRL 1-3: Discovery / Concept Definition / Early Stage Development & Design & Engineering Technology Description The Davidson Hill Venturi DHV Turbine is a horizontal axis turbine that utilizes a Venturi structure in front of the intake The device can be mounted on the seabed or can float slack moored in a tidal stream


Hot Dry Rock at Fenton Hill, USA  

DOE Green Energy (OSTI)

The Hot Dry Rock Geothermal Energy Project began in the early 1970's with the objective of developing a technology to make economically available the large ubiquitous thermal energy of the upper earth crust. The program, operated by the Los Alamos National Laboratory, has been funded by the Department of Energy (and its predecessors) and for a few years with participation by West Germany and Japan. An energy reservoir was accessed by drilling and hydraulically fracturing in the Precambrian basement rock at Fenton Hill, outside the Valles Caldera of north-central New Mexico. Water was circulated through the reservoir (Phase 1, 1978--1980) producing up to 5 MWt at 132/degree/C. A second (Phase 2) reservoir has been established with a deeper pair of holes and an initial flow test completed producing about 10 MWt at 190/degree/C. These accomplishments have been supported and paralleled by developments in drilling, well completion and instrumentation hardware. Acoustic or microseismic fracture mapping and geochemistry studies in addition to hydraulic and thermal data contribute to reservoir analyses. Studies of some of the estimated 430,000 quads of HDR resources in the United States have been made with special attention focused on sites most advantageous for early development. 17 refs., 3 figs., 1 tab.

Hendron, R.H.



Steamboat Hills exploratory slimhole: Drilling and testing  

DOE Green Energy (OSTI)

During July-September, 1993, Sandia National Laboratories, in cooperation with Far West Capital, drilled a 4000 feet exploratory slimhole (3.9 inch diameter) in the Steamboat Hills geothermal field near Reno, Nevada. This well was part of Sandia`s program to evaluate slimholes as a geothermal exploration tool. During and after drilling the authors performed four series of production and injection tests while taking downhole (pressure-temperature-spinner) and surface (wellhead pressure and temperature, flow rate) data. In addition to these measurements, the well`s data set includes: continuous core (with detailed log); borehole televiewer images of the wellbore`s upper 500 feet; daily drilling reports from Sandia and from drilling contractor personnel; daily drilling fluid record; numerous temperature logs; and comparative data from production and injection wells in the same field. This report contains: (1) a narrative account of the drilling and testing, (2) a description of equipment used, (3) a brief geologic description of the formation drilled, (4) a summary and preliminary interpretation of the data, and (5) recommendations for future work.

Finger, J.T.; Jacobson, F.D.; Hickox, C.E.; Eaton, R.R.



Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png


Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls


Consent Order, Kaiser-Hill Company, LLC - EA 98-03 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Consent Order, Kaiser-Hill Company, LLC - EA 98-03 Consent Order, Kaiser-Hill Company, LLC - EA 98-03 Consent Order, Kaiser-Hill Company, LLC - EA 98-03 April 14, 1998 Price-Anderson Enforcement Consent Order issued to Kaiser-Hill Company, LLC related to three Radiological Events at the Rocky Flats Environmental Technology Site, (EA 98-03) This letter refers to the Department of Energy's (DOE) evaluation of the facts and circumstances presented to DOE by Kaiser-Hill Company, L.L.C.'s(Kaiser-Hill) internal investigation reports of three events that occurred at the Rocky Flats EnvironmentalTechnology Site between January 1996 and January 1998. Consent Order, Kaiser-Hill Company, LLC - EA 98-03 More Documents & Publications Enforcement Letter, Kaiser-Hill Company, L.L.C. - July 20, 1998 Issued to Kaiser-Hill Company, LLC related to Failure to Perform Required

Note: This page contains sample records for the topic "auburn hills mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Consent Order, Kaiser-Hill Company, LLC - EA 98-03 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Kaiser-Hill Company, LLC - EA 98-03 Kaiser-Hill Company, LLC - EA 98-03 Consent Order, Kaiser-Hill Company, LLC - EA 98-03 April 14, 1998 Price-Anderson Enforcement Consent Order issued to Kaiser-Hill Company, LLC related to three Radiological Events at the Rocky Flats Environmental Technology Site, (EA 98-03) This letter refers to the Department of Energy's (DOE) evaluation of the facts and circumstances presented to DOE by Kaiser-Hill Company, L.L.C.'s(Kaiser-Hill) internal investigation reports of three events that occurred at the Rocky Flats EnvironmentalTechnology Site between January 1996 and January 1998. Consent Order, Kaiser-Hill Company, LLC - EA 98-03 More Documents & Publications Enforcement Letter, Kaiser-Hill Company, L.L.C. - July 20, 1998 Issued to Kaiser-Hill Company, LLC related to Failure to Perform Required


Quantum theory of rotational isomerism and Hill equation  

SciTech Connect

The process of rotational isomerism of linear triatomic molecules is described by the potential with two different-depth minima and one barrier between them. The corresponding quantum-mechanical equation is represented in the form that is a special case of the Hill equation. It is shown that the Hill-Schroedinger equation has a Klein's quadratic group symmetry which, in its turn, contains three invariant subgroups. The presence of these subgroups makes it possible to create a picture of energy spectrum which depends on a parameter and has many merging and branch points. The parameter-dependent energy spectrum of the Hill-Schroedinger equation, like Mathieu-characteristics, contains branch points from the left and from the right of the demarcation line. However, compared to the Mathieu-characteristics, in the Hill-Schroedinger equation spectrum the 'right' points are moved away even further for some distance that is the bigger, the bigger is the less deep well. The asymptotic wave functions of the Hill-Schroedinger equation for the energy values near the potential minimum contain two isolated sharp peaks indicating a possibility of the presence of two stable isomers. At high energy values near the potential maximum, the height of two peaks decreases, and between them there appear chaotic oscillations. This form of the wave functions corresponds to the process of isomerization.

Ugulava, A.; Toklikishvili, Z.; Chkhaidze, S.; Abramishvili, R. [I. Javakhishvili Tbilisi State University, 3, I. Chavchavadze Avenue, 0179 Tbilisi (Georgia); Chotorlishvili, L. [Institut fuer Physik, Martin-Luther Universitat Halle-Wittenberg, Heinrich-Damerow-Str. 4, 06120 Halle (Germany)



Water quality in the vicinity of Fenton Hill, 1987 and 1988. [Fenton Hill site  

DOE Green Energy (OSTI)

Water-quality data have been collected since 1974 from established surface- and ground-water stations at, and in the vicinity of, Fenton Hill (site of the Laboratory's Hot Dry Rock Geothermal Project). The site is located on the southwest edge of the Valles Caldera in the Jemez Mountains. To determine the chemical quality of water, data were collected in 1987 and 1988 from 13 surface-water stations and 19 ground-water stations. The classification of the water quality is made on the basis of predominated ions and total dissolved solids. There are four classifications of surface water (sodium and chloride, calcium and bicarbonate, calcium and sulfate, and sodium and bicarbonate) and three classifications of ground water (sodium and chloride, calcium and bicarbonate, and sodium and bicarbonate). Variations in the chemical quality of the surface and ground water in 1987 and 1988 are apparent when data are compared with each other and with previous analyses. These variations are not considered significant, as they are in the range of normal seasonal changes. Cumulative production since 1976 from the supply well at Fenton Hill has been about 63 {times} 10{sup 6} gal, with a decline in the water level of the well of about 14 ft, or about 1.4 ft/yr. The aquifer penetrated by the well is still capable of reliable supply to the site for a number of years, based on past production. The quality of water from the well has deteriorated slightly; however, the water quality is in compliance with drinking water standards. The effects of discharge from the storage ponds into an adjacent canyon have been monitored by trace metal analyses of vegetation and soil. The study indicates minimal effects, which will be undetectable in a few years if there are no further releases of effluents into the canyon. 19 refs., 6 figs., 3 tabs.

Purtymun, W.D.; Ferenbaugh, R.W.; Maes, M.N.; Williams, M.C.



,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


Compound and Elemental Analysis At Fenton Hill Hdr Geothermal Area  

Open Energy Info (EERE)

Fenton Hill Hdr Fenton Hill Hdr Area (Laughlin, Et Al., 1983) Exploration Activity Details Location Fenton Hill Hdr Area Exploration Technique Compound and Elemental Analysis Activity Date Usefulness useful DOE-funding Unknown Notes Thin sections were prepared of the different lithologies from each core. Standard petrographic techniques were used to identify constituent minerals and to obtain modal analyses. The number of points counted varied from about 500 to several thousand, depending upon the grain size of the rock. Whole-rock chemical analysis was performed by John Husler, University of New Mexico, using a variety of techniques (Laughlin and Eddy, 1977). The precision for SiO2 is + 1% relative; for the other oxides it is + 2% relative. Accuracy was monitored by using USGS standard rock samples. Where


Three principal results from recent Fenton Hill flow testing  

DOE Green Energy (OSTI)

Results of recent flow testing at Fenton Hill, New Mexico, have been examined in light of their applicability to the development of commercial-scale hot dry rock (HDR) reservoirs at other sites. These test results, obtained during the cumulative 11 months of reservoir flow testing between 1992 and 1995, show that there was no significant production temperature drawdown during this time and that the reservoir flow became more dispersed as flow testing proceeded. Based on these test results together with previous HDR research at Fenton Hill and elsewhere, it is concluded that a three-well geometry, with one centrally located injection well and two production wells -- one at each end of the pressure-stimulated reservoir region -- would provide a much more productive system for future HDR development than the two-well system tested at Fenton Hill.

Brown, D. [Los Alamos National Lab., NM (United States); DuTeaux, R. [Stanford Univ., CA (United States)



Laguna Hills, California: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Laguna Hills, California: Energy Resources Laguna Hills, California: Energy Resources (Redirected from Laguna Hills, CA) Jump to: navigation, search Equivalent URI DBpedia Coordinates 33.599767°, -117.710878° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":33.599767,"lon":-117.710878,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


El Centro/Superstition Hills Geothermal Project | Open Energy Information  

Open Energy Info (EERE)

Centro/Superstition Hills Geothermal Project Centro/Superstition Hills Geothermal Project Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Development Project: El Centro/Superstition Hills Geothermal Project Project Location Information Coordinates 33.020833333333°, -115.81305555556° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":33.020833333333,"lon":-115.81305555556,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


McGinness Hills Geothermal Project | Open Energy Information  

Open Energy Info (EERE)

McGinness Hills Geothermal Project McGinness Hills Geothermal Project Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Development Project: McGinness Hills Geothermal Project Project Location Information Coordinates 39.493055555556°, -117.06638888889° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.493055555556,"lon":-117.06638888889,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Fenton Hill Hdr Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Fenton Hill Hdr Geothermal Area Fenton Hill Hdr Geothermal Area Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Fenton Hill Hdr Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (26) 10 References Area Overview Geothermal Area Profile Location: New Mexico Exploration Region: Rio Grande Rift GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content History and Infrastructure Operating Power Plants: 0 No geothermal plants listed. Add a new Operating Power Plant


Southern Minnesota Hills Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Southern Minnesota Hills Wind Farm Southern Minnesota Hills Wind Farm Facility Southern Minnesota Hills Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Northern Alternative Energy Developer Northern Alternative Energy Energy Purchaser Southern Minnesota Municipal Power Agency Location Fairmont MN Coordinates 43.571537°, -94.449473° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.571537,"lon":-94.449473,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Compound and Elemental Analysis At Fenton Hill Hdr Geothermal Area  

Open Energy Info (EERE)

Grigsby, Et Al., 1983) Grigsby, Et Al., 1983) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Compound and Elemental Analysis At Fenton Hill Hdr Geothermal Area (Grigsby, Et Al., 1983) Exploration Activity Details Location Fenton Hill Hdr Geothermal Area Exploration Technique Compound and Elemental Analysis Activity Date Usefulness not indicated DOE-funding Unknown References C. O. Grigsby, J. W. Tester, P. E. Trujillo, D. A. Counce, J. Abbott, C. E. Holley, L. A. Blatz (1983) Rock-Water Interactions In Hot Dry Rock Geothermal Systems- Field Investigations Of In Situ Geochemical Behavior Retrieved from "http://en.openei.org/w/index.php?title=Compound_and_Elemental_Analysis_At_Fenton_Hill_Hdr_Geothermal_Area_(Grigsby,_Et_Al.,_1983)&oldid=511285


City of Hill City, Kansas (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Hill City Hill City Place Kansas Utility Id 8599 Utility Location Yes Ownership M NERC Location SPP NERC SPP Yes Operates Generating Plant Yes Activity Generation Yes Activity Distribution Yes Activity Buying Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Service Commercial Residential Service Residential Average Rates Residential: $0.1260/kWh Commercial: $0.1190/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=City_of_Hill_City,_Kansas_(Utility_Company)&oldid=409730


Black Hills Energy (Electric) - Commercial Energy Efficiency Program |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Black Hills Energy (Electric) - Commercial Energy Efficiency Black Hills Energy (Electric) - Commercial Energy Efficiency Program Black Hills Energy (Electric) - Commercial Energy Efficiency Program < Back Eligibility Commercial Industrial Institutional Local Government Nonprofit Schools State Government Savings Category Heating & Cooling Commercial Heating & Cooling Cooling Home Weatherization Construction Commercial Weatherization Design & Remodeling Other Heat Pumps Appliances & Electronics Commercial Lighting Lighting Manufacturing Maximum Rebate All Incentives: 50% of equipment and labor cost Custom: 50% of the incremental cost Program Info Start Date 7/1/2010 Expiration Date 12/31/2013 State Colorado Program Type Utility Rebate Program Rebate Amount T8/T5 Fluorescent Fixtures: $4-$18/system High-Bay Fluorescent Fixtures: $40-$125/fixture


City of Rock Hill, South Carolina (Utility Company) | Open Energy  

Open Energy Info (EERE)

Rock Hill, South Carolina (Utility Company) Rock Hill, South Carolina (Utility Company) Jump to: navigation, search Name City of Rock Hill Place South Carolina Utility Id 16195 Utility Location Yes Ownership M NERC Location SERC Activity Bundled Services Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png 175 Watt HPS lighting Lighting Economic Development Rate (Schedule EDR -1) Commercial Economic Development Rate (Schedule EDR -2) Industrial Flood Lighting Rate 1000 Watt HPS Lighting Flood Lighting Rate 400 Watt HPS Lighting General Service/ Non Demand (Schedule GS) Commercial General Service/Demand (Schedule GD) Industrial


Economic Development Benefits of the Mars Hill Wind Farm, Wind Powering America Rural Economic Development, Case Study (Fact Sheet)  

DOE Green Energy (OSTI)

This case study summarizes the economic development benefits of the Mars Hill Wind Farm to the community of Mars Hill, Maine. The Mars Hill Wind Farm is New England's first utility-scale wind farm.

Not Available



Black Hills Energy (Electric) - Residential Energy Efficiency Program |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Electric) - Residential Energy Efficiency Electric) - Residential Energy Efficiency Program Black Hills Energy (Electric) - Residential Energy Efficiency Program < Back Eligibility Construction Residential Savings Category Home Weatherization Commercial Weatherization Heating & Cooling Commercial Heating & Cooling Cooling Construction Design & Remodeling Appliances & Electronics Sealing Your Home Ventilation Heat Pumps Commercial Lighting Lighting Water Heating Maximum Rebate Attic Insulation: $500 Wall Insulation: $500 Air Sealing: $300 Program Info Start Date 7/1/2010 Expiration Date 12/31/2013 State Colorado Program Type Utility Rebate Program Rebate Amount Energy Star New Home: Contact Black Hills Energy Air-Source Heat Pump Split System: $400 Central A/C: $500-$700 Ground Source Heat Pumps: $1,200


Analysis of Subsidence Data for the Big Hill Site, Texas  

Science Conference Proceedings (OSTI)

The elevation change data measured at the Big Hill SPR site over the last 10 years has been studied and a model utilized to project elevation changes into the future. The subsidence rate at Big Hill is low in comparison with other Strategic Petroleum Reserve sites and has decreased with time due to the maintenance of higher operating pressures and the normal decrease in creep closure rate of caverns with time. However, the subsidence at the site is projected to continue. A model was developed to project subsidence values 20 years into the future; no subsidence related issues are apparent from these projections.

Bauer, Stephen J.



Scientific progress on the Fenton Hill HDR project since 1983  

DOE Green Energy (OSTI)

The modern HDR concept originated at the Los Alamos National Laboratory and was first demonstrated at Fenton Hill, NM. Experience gained during the development of the deeper HDR reservoir at Fenton Hill clearly showed that HDR reservoirs are formed by opening pre-existing, but sealed, multiply connected joint sets. Subsequent flow testing indicated that sustained operation of HDR systems under steady state conditions is feasible. The most significant remaining HDR issues are related to economics and locational flexibility. Additional field test sites are needed to advance the understanding of HDR technology so that the vast potential of this resource can be economically realized around the world.

Brown, D.W.; Duchane, D.V.


Note: This page contains sample records for the topic "auburn hills mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


TransForum v5n2 -University of Waterloo Students Win First-Year...  

NLE Websites -- All DOE Office Websites (Extended Search)

in Auburn Hills, Michigan. General Motors (GM), the U.S. Department of Energy (DOE), and Argonne sponsored the event, which challenged 17 universities from across North...


DOE Selects CH2M Hill Plateau Remediation Company for Plateau...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

CH2M Hill Plateau Remediation Company for Plateau Remediation Contract at its Hanford Site DOE Selects CH2M Hill Plateau Remediation Company for Plateau Remediation Contract at its...


Enforcement Letter, CH2M Hill Mound, Inc - December 22, 2004...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Letter, CH2M Hill Mound, Inc - December 22, 2004 December 22, 2004 Issued to CH2M Hill Mound, Inc. related to a Radioactive Contamination Event during Remediation Activities at...


Town of Chapel Hill- Worthwhile Investments Save Energy (WISE) Homes and Buildings Program  

Energy.gov (U.S. Department of Energy (DOE))

Chapel Hill is using money made available to it from the American Recovery and Reinvestment Act of 2009 to help subsidize energy efficiency improvements in Chapel Hill homes. Qualified homeowners...


Evaluation of Eastern Redcedar Infestations in theNorthern Kansas Flint Hills  

E-Print Network (OSTI)

Evaluation of Eastern Redcedar Infestations in theNorthern Kansas Flint Hills CLENTON E. OWENSBY than on loamy upland. The study area was in the True Prairie of northeast Kansas Flint Hills near Man

Owensby, Clenton E.


Reseeding "Go-Back" Land in The Flint Hills of Kansas'  

E-Print Network (OSTI)

224 Reseeding "Go-Back" Land in The Flint Hills of Kansas' CLENTON E. OWENSBY AND KLING L. ANDERSON in the Kansas Flint Hills, once cultivated, is now being allowed to "go-back" to grassland. Such areas have

Owensby, Clenton E.


Federal Energy Management Program: Case Study - Hill Air Force Base, Utah  

NLE Websites -- All DOE Office Websites (Extended Search)

Case Study - Hill Case Study - Hill Air Force Base, Utah to someone by E-mail Share Federal Energy Management Program: Case Study - Hill Air Force Base, Utah on Facebook Tweet about Federal Energy Management Program: Case Study - Hill Air Force Base, Utah on Twitter Bookmark Federal Energy Management Program: Case Study - Hill Air Force Base, Utah on Google Bookmark Federal Energy Management Program: Case Study - Hill Air Force Base, Utah on Delicious Rank Federal Energy Management Program: Case Study - Hill Air Force Base, Utah on Digg Find More places to share Federal Energy Management Program: Case Study - Hill Air Force Base, Utah on AddThis.com... Energy Savings Performance Contracts Assistance & Contacts Resources Laws & Regulations Energy Service Companies Awarded Projects


Special Report Order, Issued to CH2M Hill Hanford Group, Inc.- October 22, 2001  

Energy.gov (U.S. Department of Energy (DOE))

Issued to CH2M Hill Hanford Group, Inc., related to Multiple Nuclear Safety Issues at the Hanford Site


Yield ResponsZs to Time of Burning in the Kansas Flint Hills1  

E-Print Network (OSTI)

Yield ResponsZs to Time of Burning in the Kansas Flint Hills1 CLENTON E. OWENSBY and KLING L Agricultural Experiment Station, Manhattan. Grazing managem,ent in the Kansas Flint Hills has tradition- ally, about 58 inches annually in central Louisiana and about 32 inches in the Flint Hills. Mc

Owensby, Clenton E.


Particle Size Changes in Rumens of Cattle Grazing Kansas Flint Hills Range  

E-Print Network (OSTI)

Particle Size Changes in Rumens of Cattle Grazing Kansas Flint Hills Range J.R. FORWOOD, C.E. OWENSBY, AND G. TOWNE Abstract A ruminally fistulated Hereford steer and heifer grazing Kansas Flint Hills particle size changes in rumens of cattle grazing native Kansas Flint Hills range forage. Materials

Owensby, Clenton E.


Intensive-Early Stocking and Season-Long Stocking of Kansas Flint Hills Range  

E-Print Network (OSTI)

Intensive-Early Stocking and Season-Long Stocking of Kansas Flint Hills Range ED F. SMITH AND CLENTON E. OWENSBY Highlight: Native Flint Hills bluestem range was stocked at twice the normal rate, 1 gains during the latter half of the growing season on Kansas Flint Hills range are barely one-half those

Owensby, Clenton E.


Stocking rate effects on intensive-early stocked Flint Hills bluestem range  

E-Print Network (OSTI)

Stocking rate effects on intensive-early stocked Flint Hills bluestem range CLENTON E. OWENSBY, ROBERT COCHRAN, AND ED F. SMITH Stocking rate effects on intensive-early stocked Kansas Flint Hills range- lands is limited to the first 2 1/ 2 months of the growing season in the Kansas Flint Hills. Grazing

Owensby, Clenton E.


Lithium in Jack Hills zircons: Evidence for extensive weathering of Earth's earliest crust Takayuki Ushikubo a,  

E-Print Network (OSTI)

Lithium in Jack Hills zircons: Evidence for extensive weathering of Earth's earliest crust Takayuki Hills lithium weathering continental crust Hadean In situ Li analyses of 4348 to 3362 Ma detrital of REEs. The Jack Hills zircons also have fractionated lithium isotope ratios (7 Li=-19 to+13) about five

Mcdonough, William F.


Effects of Range Burning on Kansas Flint Hills Soil  

E-Print Network (OSTI)

Effects of Range Burning on Kansas Flint Hills Soil CLENTON E. OWENSBY AND JOHN BRUCE WYRILL, III Highlight: Two tallgrass prairie areas burned annually for 20 (grazed) nnd 48 (un. grazed) years ar-spring burned ungrared plots were generally higher in soil pH, organic ma~fer, and K than late-spring burned

Owensby, Clenton E.


Dutch Hill/Cohocton Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Dutch Hill/Cohocton Wind Farm Dutch Hill/Cohocton Wind Farm Jump to: navigation, search Name Dutch Hill/Cohocton Wind Farm Facility Dutch Hill/Cohocton Wind Farm Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner First Wind Developer First Wind Energy Purchaser Market Location Steuben County NY Coordinates 42.52342°, -77.500303° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.52342,"lon":-77.500303,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Loess Hills Wind Energy Center | Open Energy Information  

Open Energy Info (EERE)

Loess Hills Wind Energy Center Loess Hills Wind Energy Center Jump to: navigation, search Name Loess Hills Wind Energy Center Facility Loess Hills Wind Energy Center Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Wind Capital Group/John Deere Capital Developer Wind Capital Group/John Deere Capital Energy Purchaser Missouri Joint Municipal Electric Utility Commission Location Rock Port MO Coordinates 40.410864°, -95.514861° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.410864,"lon":-95.514861,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Moulton Chandler Hills Wind Farm Phase II | Open Energy Information  

Open Energy Info (EERE)

Moulton Chandler Hills Wind Farm Phase II Moulton Chandler Hills Wind Farm Phase II Jump to: navigation, search Name Moulton Chandler Hills Wind Farm Phase II Facility Moulton Chandler Hills Wind Farm Phase II Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Great River Energy Developer EnXco Energy Purchaser Great River Energy Location Near Chandler MN Coordinates 43.9189°, -95.9557° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.9189,"lon":-95.9557,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Whitewater Hill Wind Farm II | Open Energy Information  

Open Energy Info (EERE)

Whitewater Hill Wind Farm II Whitewater Hill Wind Farm II Jump to: navigation, search Name Whitewater Hill Wind Farm II Facility Whitewater Hill Sector Wind energy Facility Type Community Wind Facility Status In Service Owner Cannon Power Corp. Developer Cannon Power Corp. Energy Purchaser Los Angeles Department of Water Resources/SDG&E Location San Gorgonio CA Coordinates 33.9095°, -116.734° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":33.9095,"lon":-116.734,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.


Consent Order, CH2M Hill Hanford Group, Inc. - EA-2000-09 | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

M Hill Hanford Group, Inc. - EA-2000-09 M Hill Hanford Group, Inc. - EA-2000-09 Consent Order, CH2M Hill Hanford Group, Inc. - EA-2000-09 July 25, 2000 Price-Anderson Enforcement Consent Order issued to CH2M Hill Hanford Group, Inc., related to Quality Problems at the Hanford Site Tank Farms, (EA-2000-09) This letter refers to the Department of Energy's (DOE) evaluation of an internal investigation conducted by CH2M Hill Group, Inc. (CHG) in February 2000. The investigation examined the facts and circumstances surrounding quality problems with the procurement of safety class piping for the W-314 Project at the Tank Farm Waste Remediation System. Consent Order, CH2M Hill Hanford Group, Inc. - EA-2000-09 More Documents & Publications Consent Order, Fluor Federal Services - EA-2000-10 Special Report Order, CH2M Hill Hanford Group, Inc. - October 22, 2001

Note: This page contains sample records for the topic "auburn hills mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Homa Hills, Wyoming: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Homa Hills, Wyoming: Energy Resources Homa Hills, Wyoming: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 42.9799661°, -106.3608619° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.9799661,"lon":-106.3608619,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Fountain Hills, Arizona: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Fountain Hills, Arizona: Energy Resources Fountain Hills, Arizona: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 33.60535°, -111.741113° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":33.60535,"lon":-111.741113,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Waite Hill, Ohio: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Waite Hill, Ohio: Energy Resources Waite Hill, Ohio: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 41.6186592°, -81.3840001° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.6186592,"lon":-81.3840001,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Vine Hill, California: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Hill, California: Energy Resources Hill, California: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 38.0085326°, -122.0960753° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":38.0085326,"lon":-122.0960753,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Gold Hill, Oregon: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Hill, Oregon: Energy Resources Hill, Oregon: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 42.4317894°, -123.0506035° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.4317894,"lon":-123.0506035,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Tara Hills, California: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Hills, California: Energy Resources Hills, California: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 37.9935337°, -122.3163591° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.9935337,"lon":-122.3163591,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Hidden Hills, California: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Hidden Hills, California: Energy Resources Hidden Hills, California: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 34.1602832°, -118.6523096° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":34.1602832,"lon":-118.6523096,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


North College Hill, Ohio: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

College Hill, Ohio: Energy Resources College Hill, Ohio: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 39.2183911°, -84.5507778° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.2183911,"lon":-84.5507778,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Farmington Hills, Michigan: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Farmington Hills, Michigan: Energy Resources Farmington Hills, Michigan: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 42.4853125°, -83.3771553° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.4853125,"lon":-83.3771553,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Barrington Hills, Illinois: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Hills, Illinois: Energy Resources Hills, Illinois: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 42.13375°, -88.211186° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.13375,"lon":-88.211186,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Bunker Hill Village, Texas: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Bunker Hill Village, Texas: Energy Resources Bunker Hill Village, Texas: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 29.7674508°, -95.5299427° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":29.7674508,"lon":-95.5299427,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Fruit Hill, Ohio: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Fruit Hill, Ohio: Energy Resources Fruit Hill, Ohio: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 39.0756169°, -84.3643835° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.0756169,"lon":-84.3643835,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Nichols Hills, Oklahoma: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Nichols Hills, Oklahoma: Energy Resources Nichols Hills, Oklahoma: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 35.5508903°, -97.5489293° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.5508903,"lon":-97.5489293,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Black Hills Power Inc (Wyoming) | Open Energy Information  

Open Energy Info (EERE)

Wyoming) Wyoming) Jump to: navigation, search Name Black Hills Power Inc Place Wyoming Utility Id 19545 References Energy Information Administration.[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates Residential: $0.0867/kWh Commercial: $0.0948/kWh Industrial: $0.0627/kWh The following table contains monthly sales and revenue data for Black Hills Power Inc (Wyoming). Month RES REV (THOUSAND $) RES SALES (MWH) RES CONS COM REV (THOUSAND $) COM SALES (MWH) COM CONS IND_REV (THOUSAND $) IND SALES (MWH) IND CONS OTH REV (THOUSAND $) OTH SALES (MWH) OTH CONS TOT REV (THOUSAND $) TOT SALES (MWH) TOT CONS


Turpin Hills, Ohio: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Turpin Hills, Ohio: Energy Resources Turpin Hills, Ohio: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 39.1100606°, -84.3799397° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.1100606,"lon":-84.3799397,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Raleigh Hills, Oregon: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Raleigh Hills, Oregon: Energy Resources Raleigh Hills, Oregon: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 45.4806734°, -122.7620422° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.4806734,"lon":-122.7620422,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Country Club Hills, Illinois: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Club Hills, Illinois: Energy Resources Club Hills, Illinois: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 41.5680898°, -87.7203257° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.5680898,"lon":-87.7203257,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


The Village of Indian Hill, Ohio: Energy Resources | Open Energy  

Open Energy Info (EERE)

Indian Hill, Ohio: Energy Resources Indian Hill, Ohio: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 39.180136°, -84.347958° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.180136,"lon":-84.347958,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Kirtland Hills, Ohio: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Kirtland Hills, Ohio: Energy Resources Kirtland Hills, Ohio: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 41.6239365°, -81.3070506° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.6239365,"lon":-81.3070506,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Wesley Hills, New York: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Wesley Hills, New York: Energy Resources Wesley Hills, New York: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 41.1592618°, -74.0698645° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.1592618,"lon":-74.0698645,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "auburn hills mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Agoura Hills, California: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Agoura Hills, California: Energy Resources Agoura Hills, California: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 34.1363945°, -118.7745348° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":34.1363945,"lon":-118.7745348,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Mars Hill (2007) Wind Farm | Open Energy Information  

Open Energy Info (EERE)

7) Wind Farm 7) Wind Farm Jump to: navigation, search Name Mars Hill (2007) Wind Farm Facility Mars Hill (2007) Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner UPC Wind Partners Developer UPC Wind Partners Energy Purchaser Confidential Location Aroostook county ME Coordinates 46.551388°, -67.808333° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":46.551388,"lon":-67.808333,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Cedar Hills, Utah: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Hills, Utah: Energy Resources Hills, Utah: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 40.4141174°, -111.7585414° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.4141174,"lon":-111.7585414,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


South San Jose Hills, California: Energy Resources | Open Energy  

Open Energy Info (EERE)

Jose Hills, California: Energy Resources Jose Hills, California: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 34.0127894°, -117.9047845° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":34.0127894,"lon":-117.9047845,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Willoughby Hills, Ohio: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Willoughby Hills, Ohio: Energy Resources Willoughby Hills, Ohio: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 41.5983823°, -81.4184471° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.5983823,"lon":-81.4184471,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Signal Hill, California: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Signal Hill, California: Energy Resources Signal Hill, California: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 33.8044614°, -118.1678456° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":33.8044614,"lon":-118.1678456,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Moreland Hills, Ohio: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Moreland Hills, Ohio: Energy Resources Moreland Hills, Ohio: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 41.4478312°, -81.4276153° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.4478312,"lon":-81.4276153,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Inglewood-Finn Hill, Washington: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Inglewood-Finn Hill, Washington: Energy Resources Inglewood-Finn Hill, Washington: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 47.7141386°, -122.2402528° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.7141386,"lon":-122.2402528,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


View Park-Windsor Hills, California: Energy Resources | Open Energy  

Open Energy Info (EERE)

Park-Windsor Hills, California: Energy Resources Park-Windsor Hills, California: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 33.9929545°, -118.3491169° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":33.9929545,"lon":-118.3491169,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Lea Hill, Washington: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Hill, Washington: Energy Resources Hill, Washington: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 47.3262117°, -122.1815078° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.3262117,"lon":-122.1815078,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Pleasant Hill, California: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Hill, California: Energy Resources Hill, California: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 37.9479786°, -122.0607963° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.9479786,"lon":-122.0607963,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Clyde Hill, Washington: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Hill, Washington: Energy Resources Hill, Washington: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 47.6317656°, -122.2179015° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.6317656,"lon":-122.2179015,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Cimarron Hills, Colorado: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Cimarron Hills, Colorado: Energy Resources Cimarron Hills, Colorado: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 38.8586057°, -104.6988617° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":38.8586057,"lon":-104.6988617,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Shorewood Hills, Wisconsin: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Shorewood Hills, Wisconsin: Energy Resources Shorewood Hills, Wisconsin: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 43.0774958°, -89.4456756° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.0774958,"lon":-89.4456756,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Rocky Hill, Connecticut: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Hill, Connecticut: Energy Resources Hill, Connecticut: Energy Resources Jump to: navigation, search This article is a stub. You can help OpenEI by expanding it. Equivalent URI DBpedia Coordinates 41.6648216°, -72.6392587° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.6648216,"lon":-72.6392587,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Crest Hill, Illinois: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Crest Hill, Illinois: Energy Resources Crest Hill, Illinois: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 41.554753°, -88.0986709° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.554753,"lon":-88.0986709,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Beverly Hills, California: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Beverly Hills, California: Energy Resources Beverly Hills, California: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 34.0736204°, -118.4003563° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":34.0736204,"lon":-118.4003563,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Society Hill, New Jersey: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Hill, New Jersey: Energy Resources Hill, New Jersey: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 40.5339927°, -74.4579304° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.5339927,"lon":-74.4579304,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Druid Hills, Georgia: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Druid Hills, Georgia: Energy Resources Druid Hills, Georgia: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 33.7803832°, -84.3360359° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":33.7803832,"lon":-84.3360359,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Chapel Hill, North Carolina: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Chapel Hill, North Carolina: Energy Resources Chapel Hill, North Carolina: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 35.9131996°, -79.0558445° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.9131996,"lon":-79.0558445,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "auburn hills mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Marshfield Hills, Massachusetts: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Marshfield Hills, Massachusetts: Energy Resources Marshfield Hills, Massachusetts: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 42.1459351°, -70.7397626° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.1459351,"lon":-70.7397626,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Mint Hill, North Carolina: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Mint Hill, North Carolina: Energy Resources Mint Hill, North Carolina: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 35.1795892°, -80.6472904° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.1795892,"lon":-80.6472904,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


McGraw-Hill dictionary of science and engineering  

Science Conference Proceedings (OSTI)

This dictionary contains over 35,000 terms representing more than 100 fields of science and engineering. It was derived from the comprehensive McGraw-Hill Dictionary of Scientific and Technical terms (Third Edition, 1984). Since it is much smaller and less than half the price of the comprehensive reference, it is suitable for personal collections of students, teachers, writers, and general readers. It provides definitions not available in standard dictionaries.

Parker, S.P.



Three dimensional simulation for Big Hill Strategic Petroleum Reserve (SPR).  

Science Conference Proceedings (OSTI)

3-D finite element analyses were performed to evaluate the structural integrity of caverns located at the Strategic Petroleum Reserve's Big Hill site. State-of-art analyses simulated the current site configuration and considered additional caverns. The addition of 5 caverns to account for a full site and a full dome containing 31 caverns were modeled. Operations including both normal and cavern workover pressures and cavern enlargement due to leaching were modeled to account for as many as 5 future oil drawdowns. Under the modeled conditions, caverns were placed very close to the edge of the salt dome. The web of salt separating the caverns and the web of salt between the caverns and edge of the salt dome were reduced due to leaching. The impacts on cavern stability, underground creep closure, surface subsidence and infrastructure, and well integrity were quantified. The analyses included recently derived damage criterion obtained from testing of Big Hill salt cores. The results show that from a structural view point, many additional caverns can be safely added to Big Hill.

Ehgartner, Brian L. (Sandia National Laboratories, Albuquerque, NM); Park, Byoung Yoon; Sobolik, Steven Ronald (Sandia National Laboratories, Albuquerque, NM); Lee, Moo Yul (Sandia National Laboratories, Albuquerque, NM)



Black Hills Power Inc (Montana) | Open Energy Information  

Open Energy Info (EERE)

Black Hills Power Inc Black Hills Power Inc Place Montana Utility Id 19545 References Energy Information Administration.[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates Residential: $0.0851/kWh Commercial: $0.0941/kWh Industrial: $0.0496/kWh The following table contains monthly sales and revenue data for Black Hills Power Inc (Montana). Month RES REV (THOUSAND $) RES SALES (MWH) RES CONS COM REV (THOUSAND $) COM SALES (MWH) COM CONS IND_REV (THOUSAND $) IND SALES (MWH) IND CONS OTH REV (THOUSAND $) OTH SALES (MWH) OTH CONS TOT REV (THOUSAND $) TOT SALES (MWH) TOT CONS 2009-03 0.727 9.649 13 1.313 12.983 20 129.126 2,874.645 1 131.166 2,897.277 34


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:


The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.



DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co


DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP


DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;


Injectivity Test At Fenton Hill Hdr Geothermal Area (Dash, Et Al., 1983) |  

Open Energy Info (EERE)

Injectivity Test At Fenton Hill Hdr Geothermal Area (Dash, Et Al., 1983) Injectivity Test At Fenton Hill Hdr Geothermal Area (Dash, Et Al., 1983) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Injectivity Test At Fenton Hill Hdr Geothermal Area (Dash, Et Al., 1983) Exploration Activity Details Location Fenton Hill Hdr Geothermal Area Exploration Technique Injectivity Test Activity Date Usefulness useful DOE-funding Unknown Notes Fenton Hill HDR site. References Z. V. Dash, H. D. Murphy, R. L. Aamodt, R. G. Aguilar, D. W. Brown, D. A. Counce, H. N. Fisher, C. O. Grigsby, H. Keppler, A. W. Laughlin, R. M. Potter, J. W. Tester, P. E. Trujillo Jr, G. Zyvoloski (1983) Hot Dry Rock Geothermal Reservoir Testing- 1978 To 1980 Retrieved from "http://en.openei.org/w/index.php?title=Injectivity_Test_At_Fenton_Hill_Hdr_Geothermal_Area_(Dash,_Et_Al.,_1983)&oldid=511316"


Observation Wells At Fenton Hill Hdr Geothermal Area (Dash, Et Al., 1983) |  

Open Energy Info (EERE)

Fenton Hill Hdr Geothermal Area (Dash, Et Al., 1983) Fenton Hill Hdr Geothermal Area (Dash, Et Al., 1983) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Observation Wells At Fenton Hill Hdr Geothermal Area (Dash, Et Al., 1983) Exploration Activity Details Location Fenton Hill Hdr Geothermal Area Exploration Technique Observation Wells Activity Date Usefulness useful DOE-funding Unknown Notes Fenton Hill HDR site. References Z. V. Dash, H. D. Murphy, R. L. Aamodt, R. G. Aguilar, D. W. Brown, D. A. Counce, H. N. Fisher, C. O. Grigsby, H. Keppler, A. W. Laughlin, R. M. Potter, J. W. Tester, P. E. Trujillo Jr, G. Zyvoloski (1983) Hot Dry Rock Geothermal Reservoir Testing- 1978 To 1980 Retrieved from "http://en.openei.org/w/index.php?title=Observation_Wells_At_Fenton_Hill_Hdr_Geothermal_Area_(Dash,_Et_Al.,_1983)&oldid=511330"


U.S. Department of Energy, Richland Operations Office And CH2M HILL Plateau  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

CH2M HILL CH2M HILL Plateau Remediation Company Partnering Charter For Partnering Performance Agreement U.S. Department of Energy, Richland Operations Office And CH2M HILL Plateau Remediation Company Partnering Charter For Partnering Performance Agreement The U.S. Department of Energy (DOE) Richland Operations Office (DOE-RL) and CH2M HILL Plateau Remediation Company (CHPRC) are committed to continuous improvement and will utilize principles of the DOE Environmental Management (DOE-EM) Partnering Policy to enhance teaming to further execute the Plateau Remediation Contract. U.S. Department of Energy, Richland Operations Office And CH2M HILL Plateau Remediation Company Partnering Charter For Partnering Performance Agreement More Documents & Publications CH2M HILL Plateau Remediation Company


Department of Justice: CH2M Hill Hanford Group Inc. Admits Criminal  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Department of Justice: CH2M Hill Hanford Group Inc. Admits Criminal Department of Justice: CH2M Hill Hanford Group Inc. Admits Criminal Conduct, Parent Company Agrees to Cooperate in Ongoing Investigation and Pay $18.5 Million to Resolve Civil and Criminal Allegations Department of Justice: CH2M Hill Hanford Group Inc. Admits Criminal Conduct, Parent Company Agrees to Cooperate in Ongoing Investigation and Pay $18.5 Million to Resolve Civil and Criminal Allegations March 7, 2013 - 12:00pm Addthis The Justice Department, in conjunction with the U.S. Attorney's Office for the Eastern District of Washington, announced today that Colorado-based CH2M Hill Hanford Group Inc. (CHG) and its parent company, CH2M Hill Companies Ltd. (CH2M Hill) have agreed that CHG committed federal criminal violations, defrauding the public by engaging in years of widespread time


DOE Selects CH2M Hill Plateau Remediation Company for Plateau Remediation  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

CH2M Hill Plateau Remediation Company for Plateau CH2M Hill Plateau Remediation Company for Plateau Remediation Contract at its Hanford Site DOE Selects CH2M Hill Plateau Remediation Company for Plateau Remediation Contract at its Hanford Site June 19, 2008 - 1:29pm Addthis WASHINGTON, DC - The U.S. Department of Energy (DOE) today announced that CH2M Hill Plateau Remediation Company has been selected as the plateau remediation contractor for DOE's Hanford Site in southeastern Washington State. The contract is a cost-plus award-fee contract valued at approximately $4.5 billion over ten years (a five-year base period with the option to extend it for another five years). CH2M Hill Plateau Remediation Company is a limited liability company formed by CH2M Hill Constructors, Inc. The team also includes AREVA Federal


Development Wells At Fenton Hill Hdr Geothermal Area (Dash, Et Al., 1983) |  

Open Energy Info (EERE)

Fenton Hill Hdr Geothermal Area (Dash, Et Al., 1983) Fenton Hill Hdr Geothermal Area (Dash, Et Al., 1983) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Development Wells At Fenton Hill Hdr Geothermal Area (Dash, Et Al., 1983) Exploration Activity Details Location Fenton Hill Hdr Geothermal Area Exploration Technique Development Wells Activity Date Usefulness useful DOE-funding Unknown Notes Fenton Hill HDR site. References Z. V. Dash, H. D. Murphy, R. L. Aamodt, R. G. Aguilar, D. W. Brown, D. A. Counce, H. N. Fisher, C. O. Grigsby, H. Keppler, A. W. Laughlin, R. M. Potter, J. W. Tester, P. E. Trujillo Jr, G. Zyvoloski (1983) Hot Dry Rock Geothermal Reservoir Testing- 1978 To 1980 Retrieved from "http://en.openei.org/w/index.php?title=Development_Wells_At_Fenton_Hill_Hdr_Geothermal_Area_(Dash,_Et_Al.,_1983)&oldid=511310"


The Sweet Grass Hills and Blackfeet Indians: Sacredness, Land, and Institutional Discrimination.  

E-Print Network (OSTI)

??The Sweet Grass Hills of north-central Montana are part of the four Tribes of the Blackfoot Confederacys traditional territory and play a vital role in (more)

Sheets, Cassie



Water Sampling At Fenton Hill Hdr Geothermal Area (Rao, Et Al...  

Open Energy Info (EERE)

Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water Sampling At Fenton Hill Hdr Geothermal Area (Rao, Et Al., 1996) Exploration Activity...


Black Hills Energy - On-Site Solar PV Rebate Program | Department...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

- On-Site Solar PV Rebate Program Black Hills Energy - On-Site Solar PV Rebate Program Eligibility Commercial Fed. Government General PublicConsumer Industrial Local Government...


DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:

Note: This page contains sample records for the topic "auburn hills mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on


REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units


Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper



The Application of Fuzzy Technique to Coal Gangue Hills Reliability Analysis  

Science Conference Proceedings (OSTI)

Gangue hill is a production in mining area which piles up by the disordered accumulation of coal waste. Because of its poor stability, landslide may easily arise when meet disadvantages and accordingly cause enormous destruction of geological hazard. ... Keywords: gangue hills, stability, fuzzy-random reliability, fuzzy point evaluation

Kun Yang; Zhichao Ma



Independent Oversight Review, Hanford Site CH2M Hill Plateau Remediation  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Site CH2M Hill Plateau Site CH2M Hill Plateau Remediation Company - November 2012 Independent Oversight Review, Hanford Site CH2M Hill Plateau Remediation Company - November 2012 November 2012 Review of the Hanford Site CH2M Hill Plateau Remediation Company Implementation Verification Review Processes This report documents the independent review of implementation verification review (IVR) processes at the Hanford Site CH2M Hill Plateau Remediation Company that were conducted by the Office of Enforcement and Oversight (Independent Oversight), which is within the U.S. Department of Energy (DOE) Office of Health, Safety and Security (HSS). The onsite review was performed by the HSS Office of Safety and Emergency Management Evaluations from August 13 to17, 2012. The objective of this assessment was to evaluate


Preliminary Notice of Violation, CH2M HILL Hanford Group, Inc. -  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

HILL Hanford Group, Inc. - HILL Hanford Group, Inc. - NEA-2008-02 Preliminary Notice of Violation, CH2M HILL Hanford Group, Inc. - NEA-2008-02 June 5, 2008 Preliminary Notice of Violation issued to CH2M Hill Hanford Group, Inc., related to a Radioactive Waste Spill at the Hanford Site Tank Farms This letter refers to the Department of Energy's (DOE) investigation into the facts and circumstances associated with the July 27, 2007, spill of radioactive waste in the vicinity of the S-102 retrieval pump discharge at the Hanford Tank Farm. The results of the onsite investigation were provided in an Investigation Report dated March 5, 2008. Press Release Preliminary Notice of Violation, CH2M HILL Hanford Group, Inc. - NEA-2008-02 More Documents & Publications Preliminary Notice of Violation, Bechtel National, Inc. - NEA-2008-04


Enforcement Letter, Kaiser-Hill Company, L.L.C. - June 19, 2002 |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

June 19, 2002 June 19, 2002 Enforcement Letter, Kaiser-Hill Company, L.L.C. - June 19, 2002 June 19, 2002 Enforcement Letter issued to Kaiser-Hill Company, LLC related to Unplanned Radioactive Material Uptakes at the Rocky Flats Environmental Technology Site This letter refers to the Department of Energy's evaluation of facts and circumstances concerning the October 2001 unplanned uptakes of radioactive material by two Radiological Control Technicians (RCT) in Building [ ]. These issues were reported into the Noncompliance Tracking System (NTS) by your staff (NTS-RFO--KHLL-[ ] 2002-0001) on February 11, 2002. Enforcement Letter, Kaiser-Hill Company, L.L.C. - June 19, 2002 More Documents & Publications Consent Order, Kaiser-Hill Company, LLC - EA 98-03 Enforcement Letter, Kaiser-Hill Company, L.L.C. - July 20, 1998


Turkey Hill Dairy: Where Energy is Not Left Flapping in the Wind |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Turkey Hill Dairy: Where Energy is Not Left Flapping in the Wind Turkey Hill Dairy: Where Energy is Not Left Flapping in the Wind Turkey Hill Dairy: Where Energy is Not Left Flapping in the Wind December 21, 2011 - 11:26am Addthis These two General Electric wind turbines, erected in January 2011 on the Frey Farm landfill adjacent to Turkey Hill Dairy's ice cream and sweet iced tea plant in Lancaster County, Penn., are expected to produce 7.5 million kWh of electricity annually. | Photo courtesy of Lancaster County Solid Waste Management Authority. These two General Electric wind turbines, erected in January 2011 on the Frey Farm landfill adjacent to Turkey Hill Dairy's ice cream and sweet iced tea plant in Lancaster County, Penn., are expected to produce 7.5 million kWh of electricity annually. | Photo courtesy of Lancaster County Solid


Town of Kill Devil Hills - Wind Energy Systems Ordinance | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Town of Kill Devil Hills - Wind Energy Systems Ordinance Town of Kill Devil Hills - Wind Energy Systems Ordinance Town of Kill Devil Hills - Wind Energy Systems Ordinance < Back Eligibility Agricultural Commercial Industrial Institutional Local Government Nonprofit Residential Schools Savings Category Wind Buying & Making Electricity Program Info State North Carolina Program Type Solar/Wind Permitting Standards Provider Kill Devil Hills Planning and Inspections In October 2007, the town of Kill Devil Hills adopted an ordinance to regulate the use of wind-energy systems. The ordinance directs any individual or organization wishing to install a wind-energy system to obtain a zoning permit from the town planning board. '''Size Requirements:''' Wind turbine towers are restricted to a height of 80 feet with a maximum rotor size of 23 feet in diameter. The combined


Enforcement Letter, CH2M Hill Hanford Group, Inc. - April 24, 2001 |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

CH2M Hill Hanford Group, Inc. - April 24, 2001 CH2M Hill Hanford Group, Inc. - April 24, 2001 Enforcement Letter, CH2M Hill Hanford Group, Inc. - April 24, 2001 April 24, 2001 Enforcement Letter issued to CH2M Hill Hanford Group, Inc., related to Nuclear Safety Management at the Hanford Site Tank Farms This letter refers to a recent investigation by the Department of Energy (DOE), regarding potential noncompliances with the requirements of 10 CFR 830, "Nuclear Safety Management," occurring at the Hanford Tank Farms. The investigation reviewed three issues that were reported into the Noncompliance Tracking System (NTS) by CH2M Hill Hanford Group, Inc. Two of the NTS reports involve the failure to perform the Technical Safety Requirement (TSR) for [ ] gas monitoring. The initial potential noncompliance occurred in January 2000, in which a Zip Cord was installed


Preliminary Notice of Violation, CH2M Hill Hanford Group, Inc. - EA-2003-06  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

CH2M Hill Hanford Group, Inc. - CH2M Hill Hanford Group, Inc. - EA-2003-06 Preliminary Notice of Violation, CH2M Hill Hanford Group, Inc. - EA-2003-06 August 29, 2003 Preliminary Notice of Violation issued to CH2M Hill Hanford Group, Inc., related to Quality Assurance Issues at the Hanford Site Tank Farms This letter refers to the Department of Energy's Office of Price-Anderson Enforcement (OE) investigation of the facts and circumstances concerning quality assurance issues affecting nuclear safety at the Hanford Tank Farms. These issues involve the inadvertent deenergization of annulus leak detectors, dilution tank overfills, and dome loading control, over the period August 2002 to November 2002. Preliminary Notice of Violation, CH2M Hill Hanford Group, Inc. - EA-2003-06 More Documents & Publications


Special Report Order, CH2M Hill Hanford Group, Inc. - October 22, 2001 |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

CH2M Hill Hanford Group, Inc. - October 22, CH2M Hill Hanford Group, Inc. - October 22, 2001 Special Report Order, CH2M Hill Hanford Group, Inc. - October 22, 2001 October 22, 2001 Special Report Order ssued to CH2M Hill Hanford Group, Inc., related to Multiple Nuclear Safety Issues at the Hanford Site On September 18, 2001, the Office of Price-Anderson Enforcement (OE) in coordination with the DOE Office of River Protection (ORP) conducted a review of the actions taken by CH2M Hill Hanford Group (CHG) in response to an Enforcement Letter dated April 24, 2001. This Enforcement Letter referenced three Noncompliance Tracking System (NTS) reports submitted by CHG which collectively suggested weaknesses in your nuclear safety operations related to (1) corrective action management, (2) worker training


Groundwater Sampling At Fenton Hill Hdr Geothermal Area (Grigsby, Et Al.,  

Open Energy Info (EERE)

Groundwater Sampling At Fenton Hill Hdr Geothermal Area (Grigsby, Et Al., Groundwater Sampling At Fenton Hill Hdr Geothermal Area (Grigsby, Et Al., 1983) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Groundwater Sampling At Fenton Hill Hdr Geothermal Area (Grigsby, Et Al., 1983) Exploration Activity Details Location Fenton Hill Hdr Geothermal Area Exploration Technique Groundwater Sampling Activity Date 1983 Usefulness not indicated DOE-funding Unknown References C. O. Grigsby, J. W. Tester, P. E. Trujillo, D. A. Counce, J. Abbott, C. E. Holley, L. A. Blatz (1983) Rock-Water Interactions In Hot Dry Rock Geothermal Systems- Field Investigations Of In Situ Geochemical Behavior Retrieved from "http://en.openei.org/w/index.php?title=Groundwater_Sampling_At_Fenton_Hill_Hdr_Geothermal_Area_(Grigsby,_Et_Al.,_1983)&oldid=689261"


Surface Gas Sampling At Fenton Hill Hdr Geothermal Area (Grigsby, Et Al.,  

Open Energy Info (EERE)

Surface Gas Sampling At Fenton Hill Hdr Geothermal Area (Grigsby, Et Al., Surface Gas Sampling At Fenton Hill Hdr Geothermal Area (Grigsby, Et Al., 1983) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Surface Gas Sampling At Fenton Hill Hdr Geothermal Area (Grigsby, Et Al., 1983) Exploration Activity Details Location Fenton Hill Hdr Geothermal Area Exploration Technique Surface Gas Sampling Activity Date Usefulness not indicated DOE-funding Unknown References C. O. Grigsby, J. W. Tester, P. E. Trujillo, D. A. Counce, J. Abbott, C. E. Holley, L. A. Blatz (1983) Rock-Water Interactions In Hot Dry Rock Geothermal Systems- Field Investigations Of In Situ Geochemical Behavior Retrieved from "http://en.openei.org/w/index.php?title=Surface_Gas_Sampling_At_Fenton_Hill_Hdr_Geothermal_Area_(Grigsby,_Et_Al.,_1983)&oldid=689258


Surface Gas Sampling At Fenton Hill Hdr Geothermal Area (Goff & Janik,  

Open Energy Info (EERE)

Surface Gas Sampling At Fenton Hill Hdr Geothermal Area (Goff & Janik, Surface Gas Sampling At Fenton Hill Hdr Geothermal Area (Goff & Janik, 2002) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Surface Gas Sampling At Fenton Hill Hdr Geothermal Area (Goff & Janik, 2002) Exploration Activity Details Location Fenton Hill Hdr Geothermal Area Exploration Technique Surface Gas Sampling Activity Date Usefulness not indicated DOE-funding Unknown Notes Gas samples from HDR well References Fraser Goff, Cathy J. Janik (2002) Gas Geochemistry Of The Valles Caldera Region, New Mexico And Comparisons With Gases At Yellowstone, Long Valley And Other Geothermal Systems Retrieved from "http://en.openei.org/w/index.php?title=Surface_Gas_Sampling_At_Fenton_Hill_Hdr_Geothermal_Area_(Goff_%26_Janik,_2002)&oldid=689255"


Isotopic Analysis- Fluid At Fenton Hill Hdr Geothermal Area (Goff, Et Al.,  

Open Energy Info (EERE)

Isotopic Analysis- Fluid At Fenton Hill Hdr Geothermal Area (Goff, Et Al., Isotopic Analysis- Fluid At Fenton Hill Hdr Geothermal Area (Goff, Et Al., 1981) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Isotopic Analysis- Fluid At Fenton Hill Hdr Geothermal Area (Goff, Et Al., 1981) Exploration Activity Details Location Fenton Hill Hdr Geothermal Area Exploration Technique Isotopic Analysis- Fluid Activity Date Usefulness not indicated DOE-funding Unknown References Fraser E. Goff, Charles O. Grigsby, Pat E. Trujillo Jr, Dale Counce, Andrea Kron (1981) Geology, Water Geochemistry And Geothermal Potential Of The Jemez Springs Area, Canon De San Diego, New Mexico Retrieved from "http://en.openei.org/w/index.php?title=Isotopic_Analysis-_Fluid_At_Fenton_Hill_Hdr_Geothermal_Area_(Goff,_Et_Al.,_1981)&oldid=692519


Injectivity Test At Fenton Hill Hdr Geothermal Area (Grigsby, Et Al., 1983)  

Open Energy Info (EERE)

Injectivity Test At Fenton Hill Hdr Geothermal Area (Grigsby, Et Al., 1983) Injectivity Test At Fenton Hill Hdr Geothermal Area (Grigsby, Et Al., 1983) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Injectivity Test At Fenton Hill Hdr Geothermal Area (Grigsby, Et Al., 1983) Exploration Activity Details Location Fenton Hill Hdr Geothermal Area Exploration Technique Injectivity Test Activity Date Usefulness not indicated DOE-funding Unknown References C. O. Grigsby, J. W. Tester, P. E. Trujillo, D. A. Counce, J. Abbott, C. E. Holley, L. A. Blatz (1983) Rock-Water Interactions In Hot Dry Rock Geothermal Systems- Field Investigations Of In Situ Geochemical Behavior Retrieved from "http://en.openei.org/w/index.php?title=Injectivity_Test_At_Fenton_Hill_Hdr_Geothermal_Area_(Grigsby,_Et_Al.,_1983)&oldid=511318


U.S. Department of Energy, Richland Operations Office And CH2M HILL Plateau  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

U.S. Department of Energy, Richland Operations Office And CH2M HILL U.S. Department of Energy, Richland Operations Office And CH2M HILL Plateau Remediation Company Partnering Charter For Partnering Performance Agreement U.S. Department of Energy, Richland Operations Office And CH2M HILL Plateau Remediation Company Partnering Charter For Partnering Performance Agreement The U.S. Department of Energy (DOE) Richland Operations Office (DOE-RL) and CH2M HILL Plateau Remediation Company (CHPRC) are committed to continuous improvement and will utilize principles of the DOE Environmental Management (DOE-EM) Partnering Policy to enhance teaming to further execute the Plateau Remediation Contract. U.S. Department of Energy, Richland Operations Office And CH2M HILL Plateau Remediation Company Partnering Charter For Partnering Performance Agreement


Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani


Note: This page contains sample records for the topic "auburn hills mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel



MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Effects of dormant-season herbage removal on Flint Hills LISA M. AUEN AND CLENTON E. OWENSBY  

E-Print Network (OSTI)

Effects of dormant-season herbage removal on Flint Hills rangeland LISA M. AUEN AND CLENTON E. OWENSBY Ab8trWt Intensive-early stocking in the Kansas Flint Hills has greatly increased livestock production efficiency.The potential grrziap of regrowth on intensive-early stocked Flint Hills pastures

Owensby, Clenton E.


El Centro/Superstition Hills Geothermal Project (2) | Open Energy  

Open Energy Info (EERE)

Project (2) Project (2) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Development Project: El Centro/Superstition Hills Geothermal Project (2) Project Location Information Coordinates 33.020833333333°, -115.81305555556° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":33.020833333333,"lon":-115.81305555556,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Massive hydraulic fracture of Fenton Hill HDR Well EE-3  

DOE Green Energy (OSTI)

Subsequent to a 5.6 million gallon massive hydraulic fracturing (MHF) experiment in Fenton Hill Hot Dry Rock (HDR) Well EE-2, a 2 million gallon MHF was planned for Well EE-3. Although hydraulic communication between wells EE-2 and EE-3 was not established during the initial MHF, a large reservoir was created around EE-2 which seemed to be in proximity with EE-3. The objective of this 2nd MHF was two-fold, to test the reservoir and seismic characteristics of the EE-3 openhole region from 11,390 to 11,770 ft and to drive fractures into the fractured region created earlier by the EE-2 MHF experiment. This paper discusses well repairs to prepare EE-3 for the MHF, the pumping operations, and injection parameters and briefly summarizes seismic results. 2 refs., 6 figs.

Dash, Z.V.; Dreesen, D.S.; Walter, F.; House, L.



Water quality in vicinity of Fenton Hill Site, 1974  

DOE Green Energy (OSTI)

The water quality at nine surface water stations, eight ground water stations, and the drilling operations at the Fenton Hill Site have been studied as a measure of the environmental impact of the Los Alamos Scientific Laboratory geothermal experimental studies in the Jemez Mountains. Surface water quality in the Jemez River drainage area is affected by the quality of the inflow from thermal and mineral springs. Ground water discharges from the Cenozoic Volcanics are similar in chemical quality. Water in the main zone of saturation penetrated by test hole GT-2 is highly mineralized, whereas water in the lower section of the hole, which is in granite, contains a higher concentration of uranium. (auth)

Purtymun, W.D.; Adams, W.H.; Owens, J.W.



Water quality in vicinity of Fenton Hill Site, 1975  

DOE Green Energy (OSTI)

Water quality at 9 surface water stations, 14 ground water stations, and drilling and testing operations at the Fenton Hill Site has been studied as a measure of the environmental impact on the Los Alamos Scientific Laboratory's geothermal site in the Jemez Mountains. Slight variations in the chemical quality of the water at individual stations were observed during the year. Predominant ions and total dissolved solids in the surface and ground water declined slightly in comparison to previous data. These variations in quality are not considered significant considering seasonal and annual stream flow variations. Surface water discharge records from three U.S. Geological Survey gaging stations on the Rio Guadalupe and Jemez River were analyzed to provide background data for the impact study. Direct correlations were determined between mean annual discharge at each of two stations in the upper reach of the drainage and at the station in the lower reach.

Purtymun, W.D.; Adams, W.H.; Stoker, A.K.; West, F.G.



Cookson Hills Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Elec Coop, Inc Elec Coop, Inc Jump to: navigation, search Name Cookson Hills Elec Coop, Inc Place Oklahoma Utility Id 4296 Utility Location Yes Ownership C NERC Location SPP NERC SPP Yes RTO SPP Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Agricultural Service, Rate 18 Industrial Commercial and Small Power - Single Phase, Rate 2 Commercial Commercial and Small Power - Three Phase, Rate 3 Commercial Farm and Home, Rate 1 Residential Irrigation Service - Single Phase, Rate 27 Industrial Irrigation Service - Three Phase, Rate 28 Industrial Security Light Lighting


Hill Airforce Base Geothermal Project | Open Energy Information  

Open Energy Info (EERE)

Airforce Base Geothermal Project Airforce Base Geothermal Project Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Development Project: Hill Airforce Base Geothermal Project Project Location Information Coordinates 41.238888888889°, -111.97277777778° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.238888888889,"lon":-111.97277777778,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Black Hills Electric Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Dakota Dakota Utility Id 1769 Utility Location Yes Ownership C NERC Location WECC NERC WECC Yes Activity Transmission Yes Activity Buying Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Electric Heat Rate Commercial General Commercial Irrigation Commercial Large Commercial Commercial Residential Residential Residential All-Electric Rate Residential Seasonal Commercial Small Commercial Three Phase Commercial Average Rates Residential: $0.0901/kWh Commercial: $0.0960/kWh The following table contains monthly sales and revenue data for Black Hills


City of Blue Hill, Nebraska (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Nebraska (Utility Company) Nebraska (Utility Company) Jump to: navigation, search Name City of Blue Hill Place Nebraska Utility Id 20848 Utility Location Yes Ownership M NERC Location MRO Operates Generating Plant Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Industrial Electric Service Industrial Industrial Electric Service(Primary Service) Industrial Non-Residential Electric Rate- Single Phase Commercial Non-Residential Electric Rate- Single Phase(Primary Metering) Commercial Non-Residential Electric Rate- Three Phase Commercial Non-Residential Electric Rate- Three Phase(Primary Metering) Commercial


Loess Hills Wind Energy LLC | Open Energy Information  

Open Energy Info (EERE)

LLC LLC Jump to: navigation, search Name Loess Hills Wind Energy LLC Address PO Box 198 Place Malvern, Iowa Zip 51551 Sector Wind energy Product ReDriven Wind Energy Systems Year founded 2009 Number of employees 1-10 Phone number 712.527.0412 Website http://www.loesshillswindenerg Coordinates 41.0052059°, -95.5827334° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.0052059,"lon":-95.5827334,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)



Auburn, Massachusetts: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

385°, -71.8356271° 385°, -71.8356271° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.1945385,"lon":-71.8356271,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Auburn, Kansas: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

14°, -95.8160968° 14°, -95.8160968° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":38.906114,"lon":-95.8160968,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Auburn, Alabama: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

098566°, -85.4807825° 098566°, -85.4807825° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":32.6098566,"lon":-85.4807825,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Auburn, Washington: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

073228°, -122.2284532° 073228°, -122.2284532° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.3073228,"lon":-122.2284532,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Auburn, Indiana: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

3669942°, -85.0588575° 3669942°, -85.0588575° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.3669942,"lon":-85.0588575,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)



Preliminary Notice of Violation, Kaiser-Hill Company, LLC - EA-2001-04 |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Preliminary Notice of Violation, Kaiser-Hill Company, LLC - Preliminary Notice of Violation, Kaiser-Hill Company, LLC - EA-2001-04 Preliminary Notice of Violation, Kaiser-Hill Company, LLC - EA-2001-04 July 17, 2001 Preliminary Notice of Violation issued to Kaiser-Hill Company, LLC, related to Nuclear Safety, Work Control, and Radiation Protection Deficiencies at the Rocky Flats Environmental Technology Site This letter refers to the Department of Energy's (DOE, Department) evaluation of the facts and circumstances concerning a number of events and programmatic failures affecting nuclear safety at the Department's Rocky Flats Environmental Technology Site. The DOE Office of Price-Anderson Enforcement, in coordination with the DOE Rocky Flats Field Office (RFFO), conducted an on-site investigation during April 3-5, 2001. The results of

Note: This page contains sample records for the topic "auburn hills mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Surface Gas Sampling At Fenton Hill Hdr Geothermal Area (Grigsby, Et Al.,  

Open Energy Info (EERE)

source source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Page Edit History Facebook icon Twitter icon » Surface Gas Sampling At Fenton Hill Hdr Geothermal Area (Grigsby, Et Al., 1983) (Redirected from Water-Gas Samples At Fenton Hill Hdr Geothermal Area (Grigsby, Et Al., 1983)) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Surface Gas Sampling At Fenton Hill Hdr Geothermal Area (Grigsby, Et Al., 1983) Exploration Activity Details Location Fenton Hill Hdr Geothermal Area Exploration Technique Surface Gas Sampling Activity Date Usefulness not indicated DOE-funding Unknown References C. O. Grigsby, J. W. Tester, P. E. Trujillo, D. A. Counce, J.


Issued to Kaiser-Hill Company, LLC related to Failure to Perform Required  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Issued to Kaiser-Hill Company, LLC related to Failure to Perform Issued to Kaiser-Hill Company, LLC related to Failure to Perform Required Surveillances at the Rocky Flats Environmental Technology Site, August 2, 2000 Issued to Kaiser-Hill Company, LLC related to Failure to Perform Required Surveillances at the Rocky Flats Environmental Technology Site, August 2, 2000 This letter refers to the Department of Energy's (DOE) evaluation of potential noncompliances with the requirements of 10 CFR 830.120 (Quality Assurance Rule). The potential noncompliances involved inadequate implementation of work controls, specifically failure to perform required combustible gas surveillances. The failure to fully perform the required surveillances was identified by the contractor during a comprehensive Kaiser-Hill (KHLL) Implementation Validation Review


Preliminary Notice of Violation, CH2M Hill Hanford Group, Inc - EA-2005-01  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

CH2M Hill Hanford Group, Inc - CH2M Hill Hanford Group, Inc - EA-2005-01 Preliminary Notice of Violation, CH2M Hill Hanford Group, Inc - EA-2005-01 March 10, 2005 Preliminary Notice of Violation issued to CH2M Hill Hanford Group, Inc., related to Radiological and Operational Events at the Hanford Tank Farms This letter refers to the recent investigation by the Department of Energy's (DOE) Office of Price-Anderson Enforcement (OE) at the Hanford Tank Farms of four radiological and operational events occurring during 2003 and 2004. The events included (1) the June 2003 multiple personnel contamination event at the [ ]; (2) the November 2003 Technical Safety Requirement violation during a cross-site waste transfer; (3) the November 2003 valve positioning error during S-112 waste retrieval operations; and


Enforcement Letter, Kaiser-Hill Company - August 12, 2004 | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Kaiser-Hill Company - August 12, 2004 Kaiser-Hill Company - August 12, 2004 Enforcement Letter, Kaiser-Hill Company - August 12, 2004 August 12, 2004 Enforcement Letter issued to Kaiser-Hill Company, LLC related to a Water Treatment System Breach and Foam Fire at the Rocky Flats Environmental Technology Site The Office of Price-Anderson Enforcement (OE) has reviewed the details and circumstances regarding two recent site events: the Building 771 unauthorized breach of the Water Treatment System in December 2003; and the February 2004 Building 991 foam fire. Both of these events represent significant breakdowns in your safety programs. Additionally, the general failure to adequately recognize hazards and implement effective controls observed in association with the Building 991 foam fire was an underlying deficiency in the 2003 Building


A Modified Logarithmic Law for Neutrally Stratified Flow over Low-Sloped Hills  

Science Conference Proceedings (OSTI)

The study of the atmospheric boundary layer flow over two-dimensional low-sloped hills under a neutral atmosphere finds numerous applications in meteorology and engineering, such as the development of large-scale atmospheric models, the siting of ...

Cludio C. Pellegrini; Gustavo C. R. Bodstein



Restructuring the urban neighborhood : the dialogue between image and ideology in Phoenix Hill, Louisville, Kentucky  

E-Print Network (OSTI)

This thesis addresses the problems of restructuring the urban neighborhood as specifically applied to the Phoenix Hill community in Louisville, Kentucky. Theory and concepts are briefly presented as a basis for design ...

Isaacs, Mark Andrew



An Observational Analysis and Evaluation of Land Surface Model Accuracy in the Nebraska Sand Hills  

Science Conference Proceedings (OSTI)

In this study, the influence of subsurface water on the energy budget components of three locations with heterogeneous land surfaces in the Nebraska Sand Hills are examined through observations and use of the Noah land surface model (LSM). ...

David B. Radell; Clinton M. Rowe



Turkey Hill Dairy: Where Energy is Not Left Flapping in the Wind...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

erected in January 2011 on the Frey Farm landfill adjacent to Turkey Hill Dairy's ice cream and sweet iced tea plant in Lancaster County, Penn., are expected to produce 7.5...


CH2M Hill Hanford Group Inc (CHG) Information Resource Management (IRM) Strategic Plan  

SciTech Connect

The CH2M Hill Hanford Group, Inc., Information Resource Management Strategic Plan is the top-level planning document for applying information and information resource management to achieve the CHG mission for the management of the River Protection Project




Asymptotics of instability zones of the Hill operator with a two term potential  

E-Print Network (OSTI)

Let $\\gamma_n $ denote the length of the $n$-th zone of instability of the Hill operator $Ly= -y^{\\prime \\prime} - [4t\\alpha \\cos2x + 2 \\alpha^2 \\cos 4x ] y,$ where $\\alpha \

Plamen Djakov; Boris Mityagin



Focusing Mechanisms in the Texas Hill Country Flash FIOMS of 1978  

Science Conference Proceedings (OSTI)

During the early morning of 2 August 1978, a stationary thunderstorm complex drenched the Balcones Escarpment of Texas and unleashed flash floods in the Hill Country which killed 27 people and produced extensive damage. After the storm, an ...

F. Caracena; J. M. Fritsch



DOE Cites CH2M Hill Hanford for Violating Nuclear Safety Rules | Department  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

for Violating Nuclear Safety Rules for Violating Nuclear Safety Rules DOE Cites CH2M Hill Hanford for Violating Nuclear Safety Rules March 10, 2005 - 10:44am Addthis Hanford Tank Farm Contractor Faces Fine of more than $300,000 WASHINGTON, DC - The Department of Energy (DOE) today notified the CH2M Hill Hanford Group, Inc. (CH2M Hill) - that it will fine the company $316,250 for violations of the department's nuclear safety requirements. CH2M Hill is the department's contractor responsible for storage of highly radioactive and hazardous liquid waste at the Hanford Tank Farms near Richland, Wash. The Preliminary Notice of Violation (PNOV) issued today, cites four events that took place in 2003 and 2004. These events include the contamination of several workers while removing equipment from a valve pit


Surface Gas Sampling At Fenton Hill Hdr Geothermal Area (Goff & Janik,  

Open Energy Info (EERE)

source source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Page Edit History Facebook icon Twitter icon » Surface Gas Sampling At Fenton Hill Hdr Geothermal Area (Goff & Janik, 2002) (Redirected from Water-Gas Samples At Fenton Hill Hdr Geothermal Area (Goff & Janik, 2002)) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Surface Gas Sampling At Fenton Hill Hdr Geothermal Area (Goff & Janik, 2002) Exploration Activity Details Location Fenton Hill Hdr Geothermal Area Exploration Technique Surface Gas Sampling Activity Date Usefulness not indicated DOE-funding Unknown Notes Gas samples from HDR well References Fraser Goff, Cathy J. Janik (2002) Gas Geochemistry Of The Valles


Preliminary Notice of Violation, CH2M Hill Hanford Group, Inc. - EA-2003-06  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Inc. - Inc. - EA-2003-06 Preliminary Notice of Violation, CH2M Hill Hanford Group, Inc. - EA-2003-06 August 29, 2003 Preliminary Notice of Violation issued to CH2M Hill Hanford Group, Inc., related to Quality Assurance Issues at the Hanford Site Tank Farms This letter refers to the Department of Energy's Office of Price-Anderson Enforcement (OE) investigation of the facts and circumstances concerning quality assurance issues affecting nuclear safety at the Hanford Tank Farms. These issues involve the inadvertent deenergization of annulus leak detectors, dilution tank overfills, and dome loading control, over the period August 2002 to November 2002. Preliminary Notice of Violation, CH2M Hill Hanford Group, Inc. - EA-2003-06 More Documents & Publications Preliminary Notice of Violation, CH2M Hill Hanford Group, Inc. - EA-2006-06


Modeling-Computer Simulations At Fenton Hill Hdr Geothermal Area (Heiken &  

Open Energy Info (EERE)

Heiken & Heiken & Goff, 1983) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Modeling-Computer Simulations At Fenton Hill Hdr Geothermal Area (Heiken & Goff, 1983) Exploration Activity Details Location Fenton Hill Hdr Geothermal Area Exploration Technique Modeling-Computer Simulations Activity Date Usefulness not indicated DOE-funding Unknown Notes Development of a geologically-based model of the thermal and hydrothermal potential of the Fenton Hill HDR area. References Grant Heiken, Fraser Goff (1983) Hot Dry Rock Geothermal Energy In The Jemez Volcanic Field, New Mexico Retrieved from "http://en.openei.org/w/index.php?title=Modeling-Computer_Simulations_At_Fenton_Hill_Hdr_Geothermal_Area_(Heiken_%26_Goff,_1983)&oldid=511328


Black Hills/Colorado Electric Utility Co. Smart Grid Project | Open Energy  

Open Energy Info (EERE)

Hills/Colorado Electric Utility Co. Smart Grid Project Hills/Colorado Electric Utility Co. Smart Grid Project Jump to: navigation, search Project Lead Black Hills/Colorado Electric Utility Co. Country United States Headquarters Location Pueblo, Colorado Recovery Act Funding $6,142,854.00 Total Project Value $12,285,708.00 Coverage Area Coverage Map: Black Hills/Colorado Electric Utility Co. Smart Grid Project Coordinates 38.2544472°, -104.6091409° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[]}


Cuttings Analysis At Fenton Hill Hdr Geothermal Area (Laughlin, Et Al.,  

Open Energy Info (EERE)

Laughlin, Et Al., Laughlin, Et Al., 1983) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Cuttings Analysis At Fenton Hill Hdr Geothermal Area (Laughlin, Et Al., 1983) Exploration Activity Details Location Fenton Hill Hdr Geothermal Area Exploration Technique Cuttings Analysis Activity Date Usefulness useful DOE-funding Unknown Notes A few cores (see Table I), cuttings collected at 1.5- or 3-m intervals, and random samples from a "junk basket" run behind the drill bit provided material for characterizing the basement rocks. References A. W. Laughlin, A. C. Eddy, R. Laney, M. J. Aldrich Jr (1983) Geology Of The Fenton Hill, New Mexico, Hot Dry Rock Site Retrieved from "http://en.openei.org/w/index.php?title=Cuttings_Analysis_At_Fenton_Hill_Hdr_Geothermal_Area_(Laughlin,_Et_Al.,_1983)&oldid=511306"


Isotopic Analysis- Fluid At Fenton Hill Hdr Geothermal Area (Goff, Et Al.,  

Open Energy Info (EERE)

source source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Page Edit History Facebook icon Twitter icon » Isotopic Analysis- Fluid At Fenton Hill Hdr Geothermal Area (Goff, Et Al., 1981) (Redirected from Isotopic Analysis At Fenton Hill Hdr Geothermal Area (Goff, Et Al., 1981)) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Isotopic Analysis- Fluid At Fenton Hill Hdr Geothermal Area (Goff, Et Al., 1981) Exploration Activity Details Location Fenton Hill Hdr Geothermal Area Exploration Technique Isotopic Analysis- Fluid Activity Date Usefulness not indicated DOE-funding Unknown References Fraser E. Goff, Charles O. Grigsby, Pat E. Trujillo Jr, Dale Counce,


Preliminary Notice of Violation, Kaiser-Hill Company, LLC - EA-2000-05 |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Preliminary Notice of Violation, Kaiser-Hill Company, LLC - Preliminary Notice of Violation, Kaiser-Hill Company, LLC - EA-2000-05 Preliminary Notice of Violation, Kaiser-Hill Company, LLC - EA-2000-05 May 19, 2000 Preliminary Notice of Violation issued to Kaiser-Hill Company, LLC, related to an Unplanned, Radioactive Material Uptake at the Rocky Flats Environmental Technology Site, (EA-2000-05) This letter refers to the Department of Energy's (DOE) evaluation of the facts and circumstances concerning an event, which occurred on February 2, 1999, in Building 779 at the Rocky Flats Environmental Technology Site. During this event, which involved glovebox decontamination and decommissioning (D&D) activities, a worker received an unplanned, uncontrolled radiological uptake of [ ] radioactive material. As a result


Department of Energy Finalizes $102 Million Loan Guarantee to Record Hill  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Finalizes $102 Million Loan Guarantee to Finalizes $102 Million Loan Guarantee to Record Hill Wind, LLC for Maine Wind Project Department of Energy Finalizes $102 Million Loan Guarantee to Record Hill Wind, LLC for Maine Wind Project August 15, 2011 - 11:08am Addthis Project Expected to Fund Approximately 200 Jobs and Provide Improvements to Wind Turbine Performance Washington D.C. - U.S. Energy Secretary Steven Chu today announced the Department of Energy finalized a $102 million loan guarantee to Record Hill Wind, LLC. The loan guarantee, in conjunction with an investment by the Yale University Endowment, will support the Record Hill wind project, which consists of a 50.6 megawatt wind power plant, an eight mile transmission line and associated interconnection equipment near the town of Roxbury,

Note: This page contains sample records for the topic "auburn hills mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Preliminary Notice of Violation, Kaiser-Hill Company,LLC - EA-1999-06 |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

LLC - LLC - EA-1999-06 Preliminary Notice of Violation, Kaiser-Hill Company,LLC - EA-1999-06 August 18, 1999 Preliminary Notice of Violation issued to Kaiser-Hill Company, LLC, related to the Procurement of Waste Containers at the Rocky Flats Environmental Technology Site, August 18, 1999 This letter refers to the Department of Energy's (DOE) evaluation of a number of deficiencies related to the procurement, design control, work processes, and quality improvement aspects of nuclear waste containers and nuclear waste components during 1997 and 1998. Kaiser-Hill Company, L.L.C. (KHLL) procured many of these items for initial use at the Rocky Flats Environmental Technology Site and for eventual shipment to the Waste Isolation Pilot Plant (WIPP). Preliminary Notice of Violation, Kaiser-Hill Company,LLC - EA-1999-06


Petrography Analysis At Fenton Hill Hdr Geothermal Area (Laughlin, Et Al.,  

Open Energy Info (EERE)

Fenton Hill Hdr Geothermal Area (Laughlin, Et Al., Fenton Hill Hdr Geothermal Area (Laughlin, Et Al., 1983) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Petrography Analysis At Fenton Hill Hdr Geothermal Area (Laughlin, Et Al., 1983) Exploration Activity Details Location Fenton Hill Hdr Geothermal Area Exploration Technique Petrography Analysis Activity Date Usefulness useful DOE-funding Unknown Notes Thin sections were prepared of the different lithologies from each core. Standard petrographic techniques were used to identify constituent minerals and to obtain modal analyses. The number of points counted varied from about 500 to several thousand, depending upon the grain size of the rock. Whole-rock chemical analysis was performed by John Husler, University of New Mexico, using a variety of techniques (Laughlin and Eddy, 1977). The


Geothermal exploration program, Hill Air Force Base, Davis and Weber Counties, Utah  

DOE Green Energy (OSTI)

Results obtained from a program designed to locate a low- or moderate-temperature geothermal resource that might exist beneath Hill Air Force Base (AFB), Ogden, Utah are discussed. A phased exploration program was conducted at Hill AFB. Published geological, geochemical, and geophysical reports on the area were examined, regional exploration was conducted, and two thermal gradient holes were drilled. This program demonstrated that thermal waters are not present in the shallow subsurface at this site. (MHR)

Glenn, W.E.; Chapman, D.S.; Foley, D.; Capuano, R.M.; Cole, D.; Sibbett, B.; Ward, S.H.



Peer Review of the Hot Dry Rock Project at Fenton Hill, New Mexico  

Science Conference Proceedings (OSTI)

This report briefly describes the history of the hot dry rock experiment project conducted by the U.S. Department of Energy and Los Alamos National Laboratory at Fenton Hill, New Mexico, from about 1971 through 1995. The authors identify the primary lessons learned and techniques developed during the course of the Fenton Hill project, and summarize the extent to which these technologies have been transferred to the U.S. geothermal industry.




Barriers to faulting in the Basin-Range province: evidence from the Sou Hills transverse block  

Science Conference Proceedings (OSTI)

Transverse structural blocks may inhibit the propagation of fault ruptures in the Basin-Range province. The Sou Hills, between Dixie and Pleasant Valleys, is a block of uplifted Tertiary bedrock transverse to the NNE-SSW trend of the central Nevada seismic belt. Three lines of evidence indicate that offset due to normal faulting is much less in the Sou Hills compared to adjacent segments of the seismic belt. First, estimates of total late Cenozoic offsets of pre-extension basalts show that the total offset is less in the Sou Hills. Second, analyses of landforms that reflect rates of relative uplift show that Quaternary tectonic activity on range-bounding faults declines where faults join the Sou Hills. Third, measurements of late Quaternary fault scarps show that individual rupture segments in the Sou Hills are shorter in length and have smaller displacements compared to the nearly continuous ruptures of several meters offset found along the Tobin and Stillwater Ranges to the north and south. The Sou Hills rupture pattern is distinctive: ruptures are dispersed over a wide zone rather than being concentrated along well-defined range fronts. Normal faulting patterns produced by the 1915 Pleasant Valley, Nevada and the 1983 Borah Peak, Idaho earthquakes indicate that a discontinuous, spatially dispersed faulting style typifies ruptures which die out in transverse bedrock features. These historic analogues support a model for prehistoric faulting in which ruptures have repeatedly died out in the Sou Hills. Transverse blocks such as the Sou Hills appear to present barriers to propagating ruptures.

Fonseca, J.E.



Orebody Modelling for Exploration: The Western Mineralisation, Broken Hill, NSW  

Science Conference Proceedings (OSTI)

The Western Mineralisation in the Broken Hill deposit was studied to identify the zonation sequence of lithogeochemical haloes along and across the strike of the orebody. Samples used are from 77 drill holes and the samples were assayed for Pb, Zn, Fe, S, Cu, Ag, Cd, Sb, Bi and As. Variogram analyses were calculated for all the elements and kriging was used to construct the 3D block model. Analysis of cross sections along and across the strike of the orebody shows that Bi and Sb form broader halos around sulphide masses and this suggests that they are pathfinder elements for the Pb and Zn elements of this orebody. The threshold concentrations (minimum anomaly) of the 10 elements were determined using the concentration-area analysis. On east-west vertical cross sections, the values of linear productivity, variability gradient and zonality index were calculated for each element. Based on the maximum zonality index of each element, the sequence of geochemical zonation pattern was determined from top to bottom of the orebody. The result shows that S, Pb, Zn and Cd tend to concentrate in the upper part of the mineralisation whereas Ag, Cu, Bi and As have a tendency to concentrate in the lower part of the mineralised rocks. Also, an empirical product ratio index was developed based on the position of the elements in the zonation sequence. The methods and results of this research are applicable to exploration of similar Zn and Pb sulphide ore deposits.

Lotfolah Hamedani, Mohammad, E-mail: mlotfham@gmail.com; Plimer, Ian Rutherford [University of Adelaide, School of Earth and Environmental Sciences (Australia); Xu Chaoshui [University of Adelaide, School of Civil, Environmental and Mining Engineering (Australia)



Service/Product Provider  

NLE Websites -- All DOE Office Websites (Extended Search)

Johnson Controls, Inc. Ford Motor Company Johnson Controls, Inc. Ford Motor Company 2875 High Meadow Cir. 550 Town Center Dr., Ste 200 Auburn Hills, MI 48326-2773 Dearborn, MI 48126 Business: Building Automation, Facility Management Business: Automotive Manufacturing Kurt Carter, Account Executive, Corporate Clients Bill Allemon, Energy Program Manager Phone: 248-444-6124 Phone: 313-323-7910 Email: kurt.w.carter@jci.com Email: wallemon@ford.com Johnson Controls teams with Ford to save $3 million at Ford World Headquarters. Project Scope Johnson Controls developed ventilation and other energy and water savings improvements for Ford Motor Company's World Headquarters resulting in a projected ten-year utility savings exceeding $3 million. Project Summary A key element of the project is Demand Control Ventilation (DCV). By installing DCV, Johnson Controls


Boundary layer eddies at the Goodnoe Hills site  

DOE Green Energy (OSTI)

Data from nine instrumented meteorological towers at the MOD-2 wind turbine site at Goodnoe Hills in Washington State were analyzed to evaluate high-frequency perturbations, which were observed in the lower boundary-layer flow. Horizontal winds and temperature measurements for a period of 8 min, undisturbed by turbine operation, were available for this study. The data are in 1-s values from June 27, 1985. Throughout the study, departures from the mean for the period and for each sensor were used on area maps and on line-time and tower-time cross sections. Conventional streamline and isotach analyses were employed; they show highly organized flow fields with embedded perturbations traversing the site. Most of the flow fields have a well-developed vortical structure that reaches from the surface through the top level of the highest tower. These structures consist of a system of clockwise and counter-clockwise circulations. The wave length is about 500 to 600 m. Their wave speed is slightly greater than the mean wind speed and their movement is in the general direction of the mean flow. The results of the study show two main reasons why wind conditions and turbine power output in a wind farm may vary in a remarkable and abrupt fashion in space and time under certain circumstances: (1) The boundary-layer flow contains highly organized coherent perturbations with a typical size of 300 {times} 300 M{sup 2}. (2) The transition zones between the perturbations moving through a wind farm are associated with very definitive changes in the wind field that are on the order of meters and seconds. 2 refs., 11 figs.

Aspliden, C.I.; Wendell, L.L.; Clem, K.S.; Gower, G.L.



Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.



Black Hills as a green area sink for atmospheric pollutants: first annual report  

SciTech Connect

A study of small particle pollution in the Black Hills area of western South Dakota has been initiated. The sampling was conducted over thirteen hills and surrounding plains stations for a period of twelve months using a Gardner small particle counter. The concentrations of both Aitken and near-CCN particles were obtained and supplemented by meteorological observations. The results of the analysis of these data indicate that the Black Hills area is a significant reservoir of clean air and that the observed low particle concentrations are the result of a) the natural decrease in concentration with elevation, b) the reduction in count due to frequent precipitation events over the Black Hills; and c) the true green area effect due to the particle removal mechanisms of vegetation. Several tests were developed to assess the magnitude of the green area effect. After corrections were applied for elevation changes, precipitation scavenging, and local pollution sources, the present analysis suggests the presence of significant particulate filtering by the heavy vegetation covering of the Black Hills. Additional data are needed to increase our understanding of the green area effect, but present indications are that a reduction in particulate concentration by as much as a factor of two (relative to plains concentrations) may be taking place as a result of these filtering processes.

Davis, B.L.; Blair, D.N.; Johnson, L.R.; Haggard, S.J.



Isotopic Analysis- Fluid At Fenton Hill Hdr Geothermal Area (Rao, Et Al.,  

Open Energy Info (EERE)

source source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Page Edit History Facebook icon Twitter icon » Isotopic Analysis- Fluid At Fenton Hill Hdr Geothermal Area (Rao, Et Al., 1996) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Isotopic Analysis- Fluid At Fenton Hill Hdr Geothermal Area (Rao, Et Al., 1996) Exploration Activity Details Location Fenton Hill Hdr Geothermal Area Exploration Technique Isotopic Analysis- Fluid Activity Date Usefulness useful DOE-funding Unknown References U. Fehn, R. T. D. Teng, Usha Rao, Fraser E. Goff (1996) Sources Of Chloride In Hydrothermal Fluids From The Valles Caldera, New Mexico- A 36Cl Study Retrieved from


Microsoft Word - CX - Olallie Yellow Lake Sea Lea Hill.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Olallie, Yellow Lake, Sea Lea Hill Wireless Communication Projects Olallie, Yellow Lake, Sea Lea Hill Wireless Communication Projects Budget Information: Work Order #254675, Task 01; WO#255947, Task 01; WO#258439, Task 01 Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021): B1.7 Acquisition, installation, operation, and removal of communication systems... B1.19 Siting, construction, and operation of microwave and radio communication towers and associated facilities... Location: All three projects will be located in King County, Washington Olallie Township 25 North, Range 5 East, Section 35 Yellow Lake Township 24 North, Range 6 East, Section 11 Sea Lea Hill Township 21 North, Range 5 East, Section 4 Proposed by: Bonneville Power Administration (BPA) Description of the Proposed Action: BPA proposes to attach wireless communication


Enforcement Letter, Kaiser-Hill Company, L.L.C. - July 21, 1998 |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1, 1998 1, 1998 Enforcement Letter, Kaiser-Hill Company, L.L.C. - July 21, 1998 This letter refers to the Department of Energy's (DOE) evaluation of potential noncompliances with the requirements of 10 CFR 830.120 (Quality Assurance Rule). The potential noncompliances involved inadequate implementation of work controls, specifically failure of workers to perform required surveillance of the Fire Protection System. The failure to fully perform the required surveillance was identified by Safe Sites of Colorado (SSOC) on June 2, 1997, and reported to DOE in the subject Noncompliance Tracking System report on June 26, 1997. Enforcement Letter, Kaiser-Hill Company, L.L.C. - July 21, 1998 More Documents & Publications Enforcement Letter, Kaiser-Hill Company, L.L.C. - July 20, 1998


A Touch of Green for Des Moines' Sherman Hill | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

A Touch of Green for Des Moines' Sherman Hill A Touch of Green for Des Moines' Sherman Hill A Touch of Green for Des Moines' Sherman Hill November 3, 2011 - 4:47pm Addthis This 1930s grocery store is currently under renovation by the Green & Main initiative. When complete in Spring 2012, the previously abandoned building will be LEED Platinum certified and feature a green roof and 54 original windows retrofitted to achieve high energy efficiency standards. | Photo courtesy of Green & Main. This 1930s grocery store is currently under renovation by the Green & Main initiative. When complete in Spring 2012, the previously abandoned building will be LEED Platinum certified and feature a green roof and 54 original windows retrofitted to achieve high energy efficiency standards. | Photo courtesy of Green & Main.


Modeling-Computer Simulations At Fenton Hill Hdr Geothermal Area (Goff &  

Open Energy Info (EERE)

Decker, 1983) Decker, 1983) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Modeling-Computer Simulations At Fenton Hill Hdr Geothermal Area (Goff & Decker, 1983) Exploration Activity Details Location Fenton Hill Hdr Geothermal Area Exploration Technique Modeling-Computer Simulations Activity Date Usefulness useful DOE-funding Unknown Notes Review and identification of 24 potential sites for EGS development across the U.S., as well as modeling of the representative geologic systems in which promising EGS sites occur. References Fraser Goff, Edward R. Decker (1983) Candidate Sites For Future Hot Dry Rock Development In The United States Retrieved from "http://en.openei.org/w/index.php?title=Modeling-Computer_Simulations_At_Fenton_Hill_Hdr_Geothermal_Area_(Goff_%26_Decker,_1983)&oldid=511326"


Enforcement Letter, CH2M Hill Hanford Group, Inc. - April 24, 2001 |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Inc. - April 24, 2001 Inc. - April 24, 2001 Enforcement Letter, CH2M Hill Hanford Group, Inc. - April 24, 2001 April 24, 2001 Enforcement Letter issued to CH2M Hill Hanford Group, Inc., related to Nuclear Safety Management at the Hanford Site Tank Farms This letter refers to a recent investigation by the Department of Energy (DOE), regarding potential noncompliances with the requirements of 10 CFR 830, "Nuclear Safety Management," occurring at the Hanford Tank Farms. The investigation reviewed three issues that were reported into the Noncompliance Tracking System (NTS) by CH2M Hill Hanford Group, Inc. Two of the NTS reports involve the failure to perform the Technical Safety Requirement (TSR) for [ ] gas monitoring. The initial potential noncompliance occurred in January 2000, in which a Zip Cord was installed


Water quality impacts from mining in the Black Hills, South Dakota, USA  

Science Conference Proceedings (OSTI)

The focus of this research was to determine if abandoned mines constitute a major environmental hazard in the Black Hills. Many abandoned gold mines in the Black Hills contribute acid and heavy metals to streams. In some areas of sulfide mineralization local impacts are severe, but in most areas the impacts are small because most ore deposits consist of small quartz veins with few sulfides. Pegmatite mines appear to have negligible effects on water due to the insoluble nature of pegmatite minerals. Uranium mines in the southern Black Hills contribute some radioactivity to surface water, but he impact is limited because of the dry climate and lack of runoff in that area. 26 refs.

Rahn, P.H.; Davis, A.D.; Webb, C.J. [South Dakota School of Mines and Technology, Rapid City, SD (United States)] [South Dakota School of Mines and Technology, Rapid City, SD (United States); Nichols, A.D. [Versar, Inc., Eden Prairie, MN (United States)] [Versar, Inc., Eden Prairie, MN (United States)



Strategic Petroleum Reserve (SPR) geological site characterization report, Big Hill Salt Dome  

Science Conference Proceedings (OSTI)

Geological and geophysical analyses of the Big Hill Salt Dome were performed to determine the suitability of this site for use in the Strategic Petroleum Reserve (SPR). Development of 140 million barrels (MMB) of storage capacity in the Big Hill Salt Dome is planned as part of the SPR expansion to achieve 750 MMB of storage capacity. Objectives of the study were to: (1) Acquire, evaluate, and interpret existing data pertinent to geological characterization of the Big Hill Dome; (2) Characterize the surface and near-surface geology and hydrology; (3) Characterize the geology and hydrology of the overlying cap rock; (4) Define the geometry and geology of the dome; (5) Determine the feasibility of locating and constructing 14 10-MMB storage caverns in the south portion of the dome; and (6) Assess the effects of natural hazards on the SPR site. Recommendations are included. (DMC)

Hart, R.J.; Ortiz, T.S.; Magorian, T.R.



Isotopic Analysis- Fluid At Fenton Hill Hdr Geothermal Area (Goff & Janik,  

Open Energy Info (EERE)

source source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Page Edit History Facebook icon Twitter icon » Isotopic Analysis- Fluid At Fenton Hill Hdr Geothermal Area (Goff & Janik, 2002) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Isotopic Analysis- Fluid At Fenton Hill Hdr Geothermal Area (Goff & Janik, 2002) Exploration Activity Details Location Fenton Hill Hdr Geothermal Area Exploration Technique Isotopic Analysis- Fluid Activity Date Usefulness not indicated DOE-funding Unknown Notes Gas samples from HDR well References Fraser Goff, Cathy J. Janik (2002) Gas Geochemistry Of The Valles Caldera Region, New Mexico And Comparisons With Gases At Yellowstone, Long


Geothermal Literature Review At Fenton Hill Hdr Geothermal Area (Goff &  

Open Energy Info (EERE)

Goff & Goff & Decker, 1983) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Geothermal Literature Review At Fenton Hill Hdr Geothermal Area (Goff & Decker, 1983) Exploration Activity Details Location Fenton Hill Hdr Geothermal Area Exploration Technique Geothermal Literature Review Activity Date Usefulness useful DOE-funding Unknown Notes Review and identification of 24 potential sites for EGS development across the U.S., as well as modeling of the representative geologic systems in which promising EGS sites occur. References Fraser Goff, Edward R. Decker (1983) Candidate Sites For Future Hot Dry Rock Development In The United States Retrieved from "http://en.openei.org/w/index.php?title=Geothermal_Literature_Review_At_Fenton_Hill_Hdr_Geothermal_Area_(Goff_%26_Decker,_1983)&oldid=511314"

Note: This page contains sample records for the topic "auburn hills mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Enforcement Letter, CH2M Hill Hanford Group Inc, - September 6, 2007 |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Group Inc, - September 6, Group Inc, - September 6, 2007 Enforcement Letter, CH2M Hill Hanford Group Inc, - September 6, 2007 September 6, 2007 Enforcement Letter issued to CH2M Hill Hanford Group, Inc., related to Quality Improvement Deficiencies at the Hanford Tank Farms The Department of Energy (DOE) held an Enforcement Conference on August 29, 2006, with CH2M Hill Hanford Group (CHG) to discuss potential violations of nuclear safety requirements described in our Investigation Summary Report dated July 26, 2006. At that time, DOE elected to defer a decision on a potential quality improvement violation related to recurring radiological events and deficiencies in the identification and control of radiological hazards at the Tank Farms. This decision was based upon the fact that CHG senior management had initiated radiological work


Independent Oversight Review, Richland Operations Office and CH2M Hill  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

and CH2M and CH2M Hill Plateau Remediation Company and Mission Support Alliance - April 2012 Independent Oversight Review, Richland Operations Office and CH2M Hill Plateau Remediation Company and Mission Support Alliance - April 2012 April 2012 Review of Richland Operations Office and CH2M Hill Plateau Remediation Company and Mission Support Alliance Conduct of Operations The purpose of this independent oversight review by the U.S. Department of Energy (DOE) Office of Enforcement and Oversight, within the Office of Health, Safety and Security (HSS), was to observe and shadow1 a DOE Richland Operations Office (DOE-RL) assessment of its contractors at the Hanford Site. The HSS reviewer observed the implementation and effectiveness of the DOE-RL assessment of two of the contractors (CHPRC and


Enforcement Letter, Kaiser-Hill Company, L.L.C. - July 20, 1998 |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

0, 1998 0, 1998 Enforcement Letter, Kaiser-Hill Company, L.L.C. - July 20, 1998 July 20, 1998 Issued to Kaiser-Hill Company, LLC related to Recurring Weaknesses in Implementing Quality Assurance Rule Requirements at the Rocky Flats Environmental Technology Site This letter refers to the Department of Energy's (DOE) evaluation of noncompliances reported in four Noncompliance Tracking System (NTS) entries, identified in the subject line above. The four NTS reports were submitted between September 24, 1997, and March 3, 1998. The reports identified potential noncompliances with requirements of 10 CFR 830.120 (Quality Assurance Rule) and 10 CFR 835 (Radiation Protection Rule). Enforcement Letter, Kaiser-Hill Company, L.L.C. - July 20, 1998 More Documents & Publications


Up-Hill ET in (NH3)5Ru(III)-Modified Ferrocytochrome c  

NLE Websites -- All DOE Office Websites (Extended Search)

Up-Hill Electron Transfer in Pentaammineruthenium(III)-Modified Up-Hill Electron Transfer in Pentaammineruthenium(III)-Modified Ferrocytochrome c: Rates, Thermodynamics, and the Mediating Role of the Ruthenium Moiety Ji Sun, James F. Wishart, and Stephan S. Isied Inorg. Chem. 34, 3998-4000 (1995) Abstract: At moderate to high ionic strengths (>0.1 M), Co(oxalate)33- oxidizes native cytochrome c very slowly, however it undergoes a rapid reaction with pendant ruthenium complexes covalently attached to the surface of the protein. Under these conditions, the rate of the thermodynamically unfavorable (up-hill) FeII-to-RuIII electron transfer process in pentaammineruthenium-modified horse-heart cytochrome c can be revealed using sufficiently high Co(oxalate) 33- concentrations. Rate measurements performed over a wide range of CoIII concentrations confirm the proposed


Geology Of The Fenton Hill, New Mexico, Hot Dry Rock Site | Open Energy  

Open Energy Info (EERE)

source source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Page Edit History Facebook icon Twitter icon » Geology Of The Fenton Hill, New Mexico, Hot Dry Rock Site Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Journal Article: Geology Of The Fenton Hill, New Mexico, Hot Dry Rock Site Details Activities (4) Areas (1) Regions (0) Abstract: The Phase I prototype hot dry rock (HDR) geothermal system was developed in Precambrian basement rocks at Fenton Hill, New Mexico. Core and cuttings samples from the four deep wells indicate that the reservoir of this Phase I HDR system lies within a homogeneous biotite granodiorite body of very low permeability. Natural fractures, although present, are


Independent Oversight Review, Richland Operations Office and CH2M Hill  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Richland Operations Office and CH2M Richland Operations Office and CH2M Hill Plateau Remediation Company and Mission Support Alliance - April 2012 Independent Oversight Review, Richland Operations Office and CH2M Hill Plateau Remediation Company and Mission Support Alliance - April 2012 April 2012 Review of Richland Operations Office and CH2M Hill Plateau Remediation Company and Mission Support Alliance Conduct of Operations The purpose of this independent oversight review by the U.S. Department of Energy (DOE) Office of Enforcement and Oversight, within the Office of Health, Safety and Security (HSS), was to observe and shadow1 a DOE Richland Operations Office (DOE-RL) assessment of its contractors at the Hanford Site. The HSS reviewer observed the implementation and effectiveness of the DOE-RL assessment of two of the contractors (CHPRC and


Flow Test At Fenton Hill Hdr Geothermal Area (Grigsby, Et Al., 1983) | Open  

Open Energy Info (EERE)

Grigsby, Et Al., 1983) Grigsby, Et Al., 1983) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Flow Test At Fenton Hill Hdr Geothermal Area (Grigsby, Et Al., 1983) Exploration Activity Details Location Fenton Hill Hdr Geothermal Area Exploration Technique Flow Test Activity Date Usefulness not indicated DOE-funding Unknown References C. O. Grigsby, J. W. Tester, P. E. Trujillo, D. A. Counce, J. Abbott, C. E. Holley, L. A. Blatz (1983) Rock-Water Interactions In Hot Dry Rock Geothermal Systems- Field Investigations Of In Situ Geochemical Behavior Retrieved from "http://en.openei.org/w/index.php?title=Flow_Test_At_Fenton_Hill_Hdr_Geothermal_Area_(Grigsby,_Et_Al.,_1983)&oldid=511312" Category: Exploration Activities What links here Related changes


Ameresco and Hill Air Force Base: SPP Success Story | ENERGY STAR Buildings  

NLE Websites -- All DOE Office Websites (Extended Search)

Hill Air Force Base: SPP Success Story Hill Air Force Base: SPP Success Story Secondary menu About us Press room Contact Us Portfolio Manager Login Facility owners and managers Existing buildings Commercial new construction Industrial energy management Small business Service providers Service and product providers Verify applications for ENERGY STAR certification Design commercial buildings Energy efficiency program administrators Commercial and industrial program sponsors Associations State and local governments Federal agencies Tools and resources Training In This Section Campaigns Commercial building design Communications resources Energy management guidance Financial resources Portfolio Manager Products and purchasing Recognition Research and reports Service and product provider (SPP) resources Success stories


The method of Hill determinants in PT-symmetric quantum mechanics  

E-Print Network (OSTI)

Hill-determinant method is described and shown applicable within the so called PT-symmetric quantum mechanics. We demonstrate that in a way paralleling its traditional Hermitian applications and proofs the method guarantees the necessary asymptotic decrease of wave functions as resulting from a fine-tuned mutual cancellation of their asymptotically growing exponential components. Technically, the rigorous proof is needed/offered that in a quasi-variational spirit the method allows us to work, in its numerical implementations, with a sequence of truncated forms of the rigorous Hill-determinant power series for the normalizable bound states.

Miloslav Znojil



Environmental analysis of the Fenton Hill Hot Dry Rock Geothermal Test Site  

DOE Green Energy (OSTI)

Techniques for the extraction of geothermal energy from hot dry rock within the earth's crust were tested at the first experimental system at Fenton Hill and proved successful. Because new concepts were being tried and new uses of the natural resources were being made, environmental effects were a major concern. Therefore, at all phases of development and operation, the area was monitored for physical, biological, and social factors. The results were significant because after several extended operations, there were no adverse environmental effects, and no detrimental social impacts were detected. Although these results are specific for Fenton Hill, they are applicable to future systems at other locations.

Kaufman, E.L.; Siciliano, C.L.B. (comps.)



Solar heating and hot water system installed at Cherry Hill, New Jersey. [Hotels  

DOE Green Energy (OSTI)

The solar heating and hot water system installed in existing buildings at the Cherry Hill Inn in Cherry Hill, New Jersey is described in detail. The system went into operation November 8, 1978 and is expected to furnish 31.5% of the overall heating load and 29.8% of the hot water load. The collectors are General Electric Company liquid evacuated tube type. The storage system is an above ground insulated steel water tank with a capacity of 7,500 gallons.

Not Available



In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma



OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown



NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk


Consent Order between Department of Energy and Kaiser-Hill Company, LLC, EA 98-03, April 14, 1998  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1998 1998 Mr. Robert Card [ ] Kaiser-Hill Company, L.L.C. Rocky Flats Environmental Technology Site P.O. Box 464 Golden, CO 80402-0464 EA 98-03 Subject: Consent Order Incorporating Agreement between U.S. Department of Energy and Kaiser-Hill Company, L.L.C. This letter refers to the Department of Energy's (DOE) evaluation of the facts and circumstances presented to DOE by Kaiser-Hill Company, L.L.C.'s (Kaiser-Hill) internal investigation reports of three events that occurred at the Rocky Flats Environmental Technology Site between January 1996 and January 1998. These events involved (1) an unplanned [radioactive material] uptake by two workers during a CERCLA Tank Remediation Project conducted by Rocky Mountain Remediation Service (RMRS), a sub-contractor to Kaiser-Hill; (2) seventeen workers


Painted Hills B&C Wind Farm I | Open Energy Information  

Open Energy Info (EERE)

Painted Hills B&C Wind Farm I Painted Hills B&C Wind Farm I Jump to: navigation, search Name Painted Hills B&C Wind Farm I Facility Painted Hills B&C Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Developer Zond Systems Energy Purchaser Southern California Edison Co Location San Gorgonio CA Coordinates 33.9095°, -116.734° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":33.9095,"lon":-116.734,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Painted Hills B&C Wind Farm II | Open Energy Information  

Open Energy Info (EERE)

Painted Hills B&C Wind Farm II Painted Hills B&C Wind Farm II Jump to: navigation, search Name Painted Hills B&C Wind Farm II Facility Painted Hills B&C Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Developer Zond Systems Energy Purchaser Southern California Edison Co Location San Gorgonio CA Coordinates 33.9095°, -116.734° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":33.9095,"lon":-116.734,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Fertilizing and Burning Flint Hills Bluestem CLENTON E. OWENSBY AND ED F. SMITH  

E-Print Network (OSTI)

Fertilizing and Burning Flint Hills Bluestem CLENTON E. OWENSBY AND ED F. SMITH Abstract Burned of nitrogen applied more than 80 lb N/acre did. Maintenance of good quality range was favored by burning and 0 and 40 lb N/acre compared to not burning and the same fertilizer rates. Eighty lb N/acre produced poor

Owensby, Clenton E.


DOE/EA-1967: Hills Creek-Lookout Point Transmission Line Rebuild, Lane County, Oregon  

Energy.gov (U.S. Department of Energy (DOE))

Bonneville Power Administration is preparing an EA to assess potential environmental impacts of the proposed rebuild of its 26-mile 115 kilovolt (kV) wood-pole Hills Creek-Lookout Point transmission line, which is generally located between Lowell and Oakridge, in Lane County, Oregon.


Analysis of fracturing pressures in the South Belridge and Lost Hills Fields  

Science Conference Proceedings (OSTI)

A presentation is made of both theories and rules of thumb believed applicable to everyday fracturing situations in the Lost Hills and South Belridge fields. Pressure analysis is featured with emphasis on bottom hole fracturing pressure calculation and interpretation. Suggestions for the application of findings are offered in hopes of increasing the efficiency of current frac completion and treating methods. 3 refs.

Swanson, G.S.; Meeken, R.B.


Note: This page contains sample records for the topic "auburn hills mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


CH2M Hill Hanford Group Inc (CHG) Information Resource Management (IRM) Strategic Plan  

SciTech Connect

The CH2M HILL Hanford Group, Inc. (CHG), Information Resource Management Strategic Plan is the top-level planning document for applying information and information resource management to achieve the CHG mission for the management of the River Protection Project waste tank farm.




Numerical Simulation of the 910 June 1972 Black Hills Storm Using CSU RAMS  

Science Conference Proceedings (OSTI)

Strong easterly flow of low-level moist air over the eastern slopes of the Black Hills on 910 June 1972 generated a storm system that produced a flash flood, devastating the area. Based on observations from this storm event, and also from the ...

U. S. Nair; Mark R. Hjelmfelt; Roger A. Pielke Sr.



Lithium isotopic systematics of granites and pegmatites from the Black Hills, South Dakota  

E-Print Network (OSTI)

isotope geochemistry by documenting the Li isotopic variations in different geological reservoirsLithium isotopic systematics of granites and pegmatites from the Black Hills, South Dakota Fang. Geochemistry Laboratory, Department of Geology, University of Maryland, College Park, MD 20742, U.S.A. 2

Rudnick, Roberta L.


Bottom Currents near a Small Hill on the Maderia Abyssal Plain  

Science Conference Proceedings (OSTI)

Near-bottom currents at depths in exceeds of 5000 m have been measured in the Great Meteor East study area (near 3130?N, 25W) over a 3 year period. The sites selected were on top of a small abyssal hill, on its flank, and on the abyssal plain ...

Peter M. Saunders



Geology and alteration of the Baltazor Hot Springs and Painted Hills Thermal Areas, Humboldt County, Nevada  

DOE Green Energy (OSTI)

The Baltazor Hot Springs KGRA and nearby Painted Hills thermal area are situated in Humboldt County, northwestern Nevada along the northwestern margin of the Basin and Range province. The oldest rocks exposed in the Baltazor area are eugeosynclinal metasedimentary and subordinate metavolcanic rocks of Permian to Triassic age intruded by Cretaceous diorite and quartz diorite. These are overlain by a thick volcanic and volcaniclastic sequence of Miocene through Pliocene age. Pre-Tertiary rocks are not exposed in the Painted Hills. Principal structures in the Baltazor area are intersecting high-angle normal faults which trend northerly and northwesterly. Quaternary landslides are dominant in the Painted Hills, although northerly- and northwesterly-trending high-angle faults are also present. Hydrothermal alteration and mineralization at Baltazor and in the Painted Hills are of several different styles and ages. Copper-bearing quartz veins in pre-Tertiary rocks antedate Cenozoic volcanism and sedimentation. The heat source for thermal phenomena and alteration in both areas is probably deep fault-controlled fluid circulation coupled with an abnormally high regional thermal gradient. (MHR)

Hulen, J.B.



VBA-0033 - In the Matter of Kaiser-Hill Company, L.L.C. | Department...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

L.L.C. On August 26 and 27, 1999, Kaiser-Hill Company, L.L.C. (K-H) and EG&G Rocky Flats, Inc. (EG&G) respectively filed Notices of Appeal from an Initial Agency Decision...



NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....


miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA


InertiaGravity Wave and Neutral Eady Wave Trains Forced by Directionally Sheared Flow over Isolated Hills  

Science Conference Proceedings (OSTI)

Analytical solutions are obtained to the linearized equations describing a particular class of directionally sheared flow over isolated hills or ridges. The flows are characterized by constant buoyancy frequency and vertical wind shear, though ...

Glenn Shutts



DOE Cites CH2M Hill Hanford Group, Inc. for Price-Anderson Violations |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Group, Inc. for Price-Anderson Group, Inc. for Price-Anderson Violations DOE Cites CH2M Hill Hanford Group, Inc. for Price-Anderson Violations June 5, 2008 - 12:51pm Addthis WASHINGTON, DC - The Department of Energy (DOE) today issued a Preliminary Notice of Violation (PNOV) to CH2M Hill Hanford Group, Inc. (CHG) for nuclear safety violations. CHG is the tank operations contractor for the tank farms located at DOE's Hanford Site in southeastern Washington State. The PNOV cites a series of violations that occurred on July 27, 2007, when waste being pumped out of tank S-102 spilled in the vicinity of the tank's retrieval pump. During waste transfer operations, a supply line became over-pressurized with tank waste, causing a rupture in the dilution water supply line and resulted in a spill of approximately 85 gallons of


Enforcement Letter, Kaiser-Hill Company, L.L.C - September 11, 2000 |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

C - September 11, 2000 C - September 11, 2000 Enforcement Letter, Kaiser-Hill Company, L.L.C - September 11, 2000 September 11, 2000 Issued to Kaiser-Hill Company, LLC related to Noncompliances with Design and Procurement Requirements at the Rocky Flats Environmental Technology Site This letter refers to an evaluation by the Department of Energy (DOE) of noncompliance report number NTS-RFO--KHLL-SITEWIDE-2000-0005, which describes noncompliances with the design and procurement requirements of 10 CFR 830.120 (Quality Assurance Rule). 10 CFR 830.120(c)(2)(iii) requires that procured items and services shall meet established requirements and perform as required; 10 CFR 830.120(c)(2)(ii) requires that design work including changes, shall incorporate applicable requirements and design


Preliminary Notice of Violation, CH2M Hill Hanford Group, Inc - March 10,  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Inc - Inc - March 10, 2005 Preliminary Notice of Violation, CH2M Hill Hanford Group, Inc - March 10, 2005 March 10, 2005 Preliminary Notice of Violation issued to CH2M Hill Hanford Group, Inc., related to Radiological and Operational Events at the Hanford Tank Farms This letter refers to the recent investigation by the Department of Energy's (DOE) Office of Price-Anderson Enforcement (OE) at the Hanford Tank Farms of four radiological and operational events occurring during 2003 and 2004. The events included (1) the June 2003 multiple personnel contamination event at the [ ]; (2) the November 2003 Technical Safety Requirement violation during a cross-site waste transfer; (3) the November 2003 valve positioning error during S-112 waste retrieval operations; and


Preliminary Notice of Violation, CH2M Hill Hanford Group, Inc - EA-2005-01  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Inc - Inc - EA-2005-01 Preliminary Notice of Violation, CH2M Hill Hanford Group, Inc - EA-2005-01 March 10, 2005 Preliminary Notice of Violation issued to CH2M Hill Hanford Group, Inc., related to Radiological and Operational Events at the Hanford Tank Farms This letter refers to the recent investigation by the Department of Energy's (DOE) Office of Price-Anderson Enforcement (OE) at the Hanford Tank Farms of four radiological and operational events occurring during 2003 and 2004. The events included (1) the June 2003 multiple personnel contamination event at the [ ]; (2) the November 2003 Technical Safety Requirement violation during a cross-site waste transfer; (3) the November 2003 valve positioning error during S-112 waste retrieval operations; and (4) the July 2004 extremity exposure during hermocouple removal activities.


Preliminary Notice of Violation, Kaiser-Hill Company, LLC - EA-96-04 |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

96-04 96-04 Preliminary Notice of Violation, Kaiser-Hill Company, LLC - EA-96-04 October 7, 1996 Preliminary Notice of Violation issued to Kaiser-Hill Company, LLC related to Radiological and Work Control Deficiencies associated with Two Radiological Release Events at the Rocky Flats Environmental Technology Site, (EA-96-04) This letter refers to the Department of Energy's (DOE) evaluation of the circumstances surrounding a number of radiological and work control deficiencies associated with two incidents: one in [a building] on March 4, 1996, and the other in [a different building] on April 18, 1996. The evaluation also considered a substantial number of other recent failures to adhere to your established worker radiological protection program requirements. On June 5-7, 1996, the DOE Office of Enforcement and


Technical safety appraisal of the Naval Petroleum Reserve No. 1, Elk Hills, California  

Science Conference Proceedings (OSTI)

The existing Elk Hills facilities for fluid production consist of tank settings, gas and oil/water gathering pipelines, gas plants, compressor facilities, lease automatic custody transfer units which meter the crude oil going to sales, and natural gas sales meters and pipelines, water injection and source wells, and gas injection pipelines and wells. The principal safety concerns presented by operations at Elk Hills are fire, occupational safety and industrial hygiene considerations. Transportation and motor vehicle accidents are also of great concern because of the large amount of miles driven on more than 900 miles of roads. Typical operations involve hazardous materials and processing equipment such as vessels, compressors, boilers, piping and valves. The aging facilities, specifically the 35R Gas Plant (constructed in 1952) and many of the pipelines, introduce an additional element of hazard to the operations.

Not Available



Enforcement Letter, Kaiser-Hill Company - August 12, 2004 | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Company - August 12, 2004 Company - August 12, 2004 Enforcement Letter, Kaiser-Hill Company - August 12, 2004 August 12, 2004 Enforcement Letter issued to Kaiser-Hill Company, LLC related to a Water Treatment System Breach and Foam Fire at the Rocky Flats Environmental Technology Site The Office of Price-Anderson Enforcement (OE) has reviewed the details and circumstances regarding two recent site events: the Building 771 unauthorized breach of the Water Treatment System in December 2003; and the February 2004 Building 991 foam fire. Both of these events represent significant breakdowns in your safety programs. Additionally, the general failure to adequately recognize hazards and implement effective controls observed in association with the Building 991 foam fire was an underlying deficiency in the 2003 Building


Preliminary Notice of Violation, CH2M Hill Hanford Group, Inc. - EA-2006-06  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Inc. - Inc. - EA-2006-06 Preliminary Notice of Violation, CH2M Hill Hanford Group, Inc. - EA-2006-06 November 16, 2006 Preliminary Notice of Violation issued to CH2M Hill Hanford Group, Inc., related to Radiological Contamination Events at the Hanford Site Tank Farms This letter refers to the recent investigation at the Hanford Tank Farms by the Department of Energy's (DOE) Office of Enforcement, now within the Office of Health, Safety and Security. The investigation involved (1) the September 2005 Tank C-202 Mobile Retrieval System (MRS) multi-personnel contamination event, (2) the March 2006 ER-311 catch tank camera removal radiological event, and (3) additional radiological contamination events that occurred between 2003-2006 as they relate to quality improvement


Preliminary Notice of Violation, Kaiser-Hill Company, LLC - EA-2000-01 |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

2000-01 2000-01 Preliminary Notice of Violation, Kaiser-Hill Company, LLC - EA-2000-01 January 24, 2000 Preliminary Notice of Violation issued to Kaiser-Hill Company, LLC, related to Recurring Procurement Quality Problems at the Rocky Flats Environmental Technology Site, January 24, 2000 (EA-2000-01) This letter refers to the Department of Energy's (DOE) evaluation of recurring procurement quality problems identified to you in Preliminary Notice of Violation (PNOV) EA-1999-06 and the effectiveness of corrective actions you identified in your response to the PNOV. Our letter of August 18, 1999, transmitting PNOV EA-1999-06 stated that DOE would defer enforcement action on additional similar violations contingent upon your taking corrective actions that effectively prevent recurrence of the


MEMORANDUM TO: File FROM: David R. Hill RE: Meeting Concerning Potential Test Procedures and Energy Conservation  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MEMORANDUM MEMORANDUM TO: File FROM: David R. Hill RE: Meeting Concerning Potential Test Procedures and Energy Conservation Standards for Set-Top Boxes and Network Equipment DATE: March 14, 2012 In compliance with the Department of Energy's guidance on ex parte communications (74 Fed. Reg. 52795 (Oct. 14, 2009)), this memorandum provides a summary of a March 7, 2012, meeting with DOE officials concerning potential test procedures and energy conservation standards for set-top boxes and network equipment. Meeting attendees: John Cymbalski (DOE - EE) Jeremy Dommu (DOE - EE) Ashley Armstrong (DOE - EE) Dan Cohen (DOE - GC) Celia Sher (DOE - GC) Cecilia Martaus (AT&T) Mike Pfau (AT&T) Jeff Dygert (AT&T) David Hill (Sidley Austin) The AT&T representatives discussed a number of concerns with DOE's potential promulgation

Note: This page contains sample records for the topic "auburn hills mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE Cites CH2M Hill Hanford Group for Price-Anderson Violations |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Group for Price-Anderson Violations Group for Price-Anderson Violations DOE Cites CH2M Hill Hanford Group for Price-Anderson Violations November 17, 2006 - 9:25am Addthis WASHINGTON, DC - The Department of Energy (DOE) today notified CH2M Hill Hanford Group (CHG) that it will fine the company $82,500 for violations of the Department's nuclear safety requirements. CHG is the prime contractor responsible for managing the storage and retrieval of highly radioactive and hazardous waste at the DOE Hanford Tank Farm site. The Preliminary Notice of Violation (PNOV) issued today cited a series of violations associated with two separate events involving the radioactive contamination of multiple CHG employees. The first event occurred on September 21, 2005, during disassembly and removal of auxiliary equipment


Sale of the Elk Hills Naval Petroleum Reserve | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Services » Petroleum Reserves » Naval Reserves » Sale of the Elk Services » Petroleum Reserves » Naval Reserves » Sale of the Elk Hills Naval Petroleum Reserve Sale of the Elk Hills Naval Petroleum Reserve Energy Secretary Federico Pena (left) and Occidental Petroleum's David Hentschel sign the historic transfer agreement with Patricia Godley, DOE's Assistant Secretary for Fossil Energy, who orchestrated the sale, looking on. Energy Secretary Federico Pena (left) and Occidental Petroleum's David Hentschel sign the historic transfer agreement with Patricia Godley, DOE's Assistant Secretary for Fossil Energy, who orchestrated the sale, looking on. On February 5, 1998, the Department of Energy and Occidental Petroleum Corporation concluded the largest divestiture of federal property in the history of the U.S. government.


Microearthquakes induced during hydraulic fracturing at the Fenton Hill HDR site: the 1982 experiments  

DOE Green Energy (OSTI)

The on-site real-time processing of microearthquake signals that occur during massive hydraulic fracturing provides a notion of the location and growth of the fracture system being created. This enables quick decisions to be made in regard to the ongoing operations. The analytical results and impact of the hypocenter mapping during the 1982 fracturing experiments in the Fenton Hill Phase II Hot Dry Rock geothermal reservoir are reported.

Keppler, H.; Pearson, C.F.; Potter, R.M.; Albright, J.N.



Water Balance of a Stock-Watering Pond in the Flint Hills of Kansas J. L. Duesterhaus,1  

E-Print Network (OSTI)

Water Balance of a Stock-Watering Pond in the Flint Hills of Kansas J. L. Duesterhaus,1 J. M. Ham,2 in the Flint Hills region of east-central Kansas from June 2005 to October 2006. The 0.35-ha pond supplied´n de las colinas de Flint en la regio´n central del este de Kansas a partir de junio del 2005 hasta

Owensby, Clenton E.


Geothermal exploration assessment and interpretation, Klamath Basin, Oregon: Swan Lake and Klamath Hills area  

DOE Green Energy (OSTI)

A synthesis and preliminary interpretation of predominantly geophysical information relating to the Klamath Basin geothermal resource is presented. The Swan Lake Valley area, northeast of Klamath Falls, and the Klamath Hills area, south of Klamath Falls, are discussed in detail. Available geophysical data, including gravity, magnetic, electrical resistivity, microearthquake, roving dipole resistivity, audio-magnetotelluric (AMT) and magnetotelluric (MT) data sets, are examined and reinterpreted for these areas. One- and two-dimensional modeling techniques are applied, and general agreement among overlapping data sets is achieved. The MT method appears well suited to this type of exploration, although interpretation is difficult in the complex geology. Roving dipole and AMT are useful in reconnaissance, while gravity and magnetics help in defining structure. For the Swan Lake Valley the data suggest buried electrically conductive zones beneath Meadow Lake Valley and Swan Lake, connected by a conductive layer at 1 kilometer depth. In the Klamath Hills area, the data suggest a conductive zone centered near the northwestern tip of Stukel Mountain, associated with a concealed northeast-trending cross-fault. Another conductive zone appears near some producing hot wells at the southwestern edge of the Klamath Hills. These conductive zones may represent geothermal reservoirs. Follow-up work is recommended for each target area.

Stark, M.; Goldstein, N.; Wollenberg, H.; Strisower, B.; Hege, H.; Wilt, M.



Geothermal resource exploration assessment and data interpretation, Klamath Basin, Oregon: Swan Lake and Klamath Hills area  

DOE Green Energy (OSTI)

A synthesis and preliminary interpretation of predominantly geophysical information relating to the Klamath Basin geothermal resource is presented. The Swan Lake Valley area, northeast of Klamath Falls, and the Klamath Hills area, south of Klamath Falls, are discussed in detail. Available geophysical data, including gravity, magnetic, electrical resistivity, microseismic, roving dipole resistivity, audio-magnetotelluric (AMT) and magnetotelluric (MT) data sets, are examined and reinterpreted for these areas. One- and two-dimensional modeling techniques are applied, and general agreement among overlapping data sets is achieved. The MT method appears well suited to this type of exploration, although interpretation is difficult in the complex geology. Roving dipole and AMT are useful in reconnaissance, while gravity and magnetics help in defining structure. For the Swan Lake Valley the data suggest buried electrically conductive zones beneath Meadow Lake Valley and Swan Lake, connected by a conductive layer at 1 kilometer depth. In the Klamath Hills area, the data suggest a conductive zone centered near the northwestern tip of Stukel Mountain, associated with a concealed northeast-trending cross-fault. Another conductive zone appears near some producing hot wells at the southwestern edge of the Klamath Hills. These conductive zones may represent geothermal reservoirs. Specific types of follow-up work are recommended for each target area.

Stark, M.; Goldstein, N.; Wollenberg, H.; Strisower, B.; Hege, M.



Solid Oxide Fuel Cell Diesel Auxiliary Power Unit Demonstration - DOE Hydrogen and Fuel Cells Program FY 2012 Annual Progress Report  

NLE Websites -- All DOE Office Websites (Extended Search)

9 9 FY 2012 Annual Progress Report DOE Hydrogen and Fuel Cells Program Dan Hennessy (Primary Contact), Jim Banna Delphi Automotive Systems, LLC 300 University Drive m/c 480-300-385 Auburn Hills, MI 48326 Phone: (248) 732-0656 Email: daniel.t.hennessy@delphi.com DOE Managers HQ: Dimitrios Papageorgopoulos Phone: (202) 586-5463 Email: Dimitrios.Papageorgopoulos@ee.doe.gov GO: David Peterson Phone: (720) 356-1747 Email: David.Peterson@go.doe.gov Contract Number: DE-EE0000478 Subcontractors: * Electricore, Inc., Valencia, CA * PACCAR, Inc., Bellevue, WA * TDA Research, Inc., Wheat Ridge, CO Project Start Date: August 1, 2009 Project End Date: April 30, 2013 Objectives


miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li



Mineralogical and geochemical characterisation of phosphogypsum waste material and its potential for use as backfill at WMC Fertilizers' Mine site, Phosphate Hill, N-W Queensland.  

E-Print Network (OSTI)

??The WMC Fertilizers operation at Phosphate Hill, north-west Queensland, began production of ammonium phosphate fertilizer in late 1999. In the production process, Cambrian marine phosphorites (more)

Dippel, Susan Katherine



Study of Reservoir Heterogencities and Structural Features Affecting Production in the Shallow Oil Zone, Eastern Elk Hills Area, California  

Science Conference Proceedings (OSTI)

Late Neogene (Plio-Pleistocene) shallow marine strata of the western Bakersfield Arch and Elk Hills produce hydrocarbons from several different reservoirs. This project focuses on the shallow marine deposits of the Gusher and Calitroleum reservoirs in the Lower Shallow Oil Zone (LSOZ). In the eastern part of the study area on the Bakersfield Arch at North and South Coles Levee field and in two wells in easternmost Elk Hills, the LSOZ reservoirs produce dry (predominantly methane) gas. In structurally higher locations in western Elk Hills, the LSOZ produces oil and associated gas. Gas analyses show that gas from the eastern LSOZ is bacterial and formed in place in the reservoirs, whereas gas associated with oil in the western part of the study area is thermogenic and migrated into the sands from deeper in the basin. Regional mapping shows that the gas-bearing LSOZ sands in the Coles Levee and easternmost Elk Hills area are sourced from the Sierra Nevada to the east whereas the oil-bearing sands in western Elk Hills appear to be sourced from the west. The eastern Elk Hills area occupied the basin depocenter, farthest from either source area. As a result, it collected mainly low-permeability offshore shale deposits. This sand-poor depocenter provides an effective barrier to the updip migration of gases from east to west. The role of small, listric normal faults as migration barriers is more ambiguous. Because our gas analyses show that the gas in the eastern LSOZ reservoirs is bacterial, it likely formed in-place near the reservoirs and did not have to migrate far. Therefore, the gas could have been generated after faulting and accumulated within the fault blocks as localized pools. However, bacterial gas is present in both the eastern AND western parts of Elk Hills in the Dry Gas Zone (DGZ) near the top of the stratigraphic section even though the measured fault displacement is greatest in this zone. Bacterial gas is not present in the west in the deeper LSOZ which has less measured fault displacement. The main difference between the DGZ and the LSOZ appears to be the presence of a sandpoor area in the LSOZ in eastern Elk Hills. The lack of permeable migration pathways in this area would not allow eastern bacterial gas to migrate farther updip into western Elk Hills. A similar sand-poor area does not appear to exist in the DGZ but future research may be necessary to verify this.

Janice Gillespie



Application of turbidite facies of the Stevens Oil Zone for reservoir management, Elk Hills Field, California  

SciTech Connect

A detailed depositional model for the uppermost sand reservoirs of the Stevens Oil Zone, Elk Hills Field, California, contains three facies: turbidite channel-fill sand bodies, overbank Sandstone and mudstone, and pelagic and hemipelagic siliceous shale. Sand bodies are the primary producing facies and consist of layered, graded sandstone with good permeability. The presence of incipient anticlines with subsea relief in the late Miocene resulted in deposition of lenticular and sinuous sand Was within structurally created channels. Relief of these structural channels was low when the earliest sand bodies were deposited, leading to a wide channel complex bounded by broad overbank deposits of moderate to low permeability. As deposition proceeded, increased structural relief constrained the channels, resulting in narrower sand body width and relatively abrupt channel terminations against very low permeability siliceous shale. With post-Miocene uplift and differential compaction, stratigraphic mounding of sand bodies helped create structural domes such as the 24Z reservoir. Stratigraphic traps including the 26R reservoir were also created. Such traps vary in seal quality from very effective to leaky, depending on the lateral transition from sand bodies to siliceous shale. Application of the Elk Hills turbidity model (1) provides a framework for monitoring production performance in the 24Z and Northwest Stevens waterflood projects; and for tracking gas migration into and out of the 26R reservoir, (2) helps b identify undeveloped locations in the 26R reservoir ideally suited for horizontal wells, (3) has led to the identification of two new production trends in the 29R area, and (4) makes possible the development of exploration plays in western Elk Hills.

Reid, S.A.; Thompson, T.W. (Bechtel Petroleum Operations, Inc., Tupman, CA (United States)); McJannet, G.S. (Dept. of Energy, Tupman, CA (United States))



Microsoft Word - Roosevelt-HW-Hill_Landfill-G0335-I0019-CX.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1, 2009 1, 2009 REPLY TO ATTN OF: KEC-4 SUBJECT: Environmental Clearance Memorandum James Hall Customer Service Engineer - TPC-TPP-4 Proposed Action: H.W. Hill / Roosevelt Landfill Gas Generation Expansion Project (#I0019 and #G0335) Budget Information: Work Order # 244620, Task # 03 Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021): B1.7: "Acquisition, installation, operation, and removal of communication systems..." B4.6: "Additions or modifications to electric power transmission facilities that would not affect the environment beyond the previously developed facility area..." Location: Klickitat County, Washington Proposed by: Klickitat County Public Utility District No.1 (KPUD) and Bonneville Power


Well completion and operations for MHF of Fenton Hill HDR Well EE-2  

DOE Green Energy (OSTI)

Previous attempts to connect Fenton Hill Hot Dry Rock Geothermal Site Wells EE-2 and EE-3 by pumping 150 thousand to 1.3 million gallons of water had not achieved a detectable hydraulic fracture connection. Therefore, preparations were made to conduct, in December 1983, a 4 to 6 million gallon, 50 BPM water injection in EE-2. The objective was to enlarge the previously created reservoir in EE-2 using massive hydraulic facturing (MHF). The planning, preparations, operations and results of the MHF are presented here. 4 refs., 7 figs.

Dreesen, D.S.; Nicholson, R.W.



Data Review of the Hot Dry Rock Project at Fenton Hill, New Mexico  

DOE Green Energy (OSTI)

This report reviews the data collected during the hot dry rock experimental project conducted by the US Department of Energy and Los Alamos National Laboratory at Fenton Hill, New Mexico from about 1971 through 1995. Five main categories of data were reviewed: (1) geologic data; (2) flow test data; (3) reservoir modeling data; (4) chemical tracer data; and (5) seismic data. The review determines the important data sets from the project, determines where and how these data are stored, and evaluates whether further analyses of the data might be likely to yield additional information valuable to the geothermal industry or to the further development of enhanced geothermal systems.

GeothermEx, Inc.



Environmental studies conducted at the Fenton Hill Hot Dry Rock geothermal development site  

DOE Green Energy (OSTI)

An environmental investigation of Hot Dry Rock (HDR) geothermal development was conducted at Fenton Hill, New Mexico, during 1976-1979. Activities at the Fenton Hill Site included an evaluation of baseline data for biotic and abiotic ecosystem components. Identification of contaminants produced by HDR processes that had the potential for reaching the surrounding environment is also discussed. Three dominant vegetative communities were identified in the vicinity of the site. These included grass-forb, aspen, and mixed conifer communities. The grass-forb area was identified as having the highest number of species encountered, with Phleum pratense and Dactylis glomerata being the dominant grass species. Frequency of occurrence and mean coverage values are also given for other species in the three main vegetative complexes. Live trapping of small mammals was conducted to determine species composition, densities, population, and diversity estimates for this component of the ecosystem. The data indicate that Peromyscus maniculatus was the dominant species across all trapping sites during the study. Comparisons of relative density of small mammals among the various trapping sites show the grass-forb vegetative community to have had the highest overall density. Comparisons of small mammal diversity for the three main vegetative complexes indicate that the aspen habitat had the highest diversity and the grass-forb habitat had the lowest. Analyses of waste waters from the closed circulation loop indicate that several trace contaminants (e.g., arsenic, cadmium, fluoride, boron, and lithium) were present at concentrations greater than those reported for surface waters of the region.

Miera, F.R. Jr.; Langhorst, G.; McEllin, S.; Montoya, C.



Radon in Soil Gas Above Bedrock Fracture Sets at the Shepleys Hill Superfund Site  

Science Conference Proceedings (OSTI)

The Idaho National Laboratory (INL) recently provided technical support for ongoing environmental remediation activities at the Shepleys Hill remediation site near Devens, MA (Figure 1). The technical support was requested as follow-on work to an initial screening level radiation survey conducted in 2008. The purpose of the original study was to assess the efficacy of the INL-developed Backpack Sodium Iodide System (BaSIS) for detecting elevated areas of natural radioactivity due to the decay of radon-222 gases emanating from the underlying fracture sets. Although the results from the initial study were mixed, the BaSIS radiation surveys did confirm that exposed bedrock outcrops have higher natural radioactivity than the surficial soils, thus a high potential for detecting elevated levels of radon and/or radon daughter products. (INL 2009) The short count times associated with the BaSIS measurements limited the ability of the system to respond to elevated levels of radioactivity from a subsurface source, in this instance radon gas emanating from fracture sets. Thus, it was postulated that a different methodology be employed to directly detect the radon in the soil gases. The CR-39 particle track detectors were investigated through an extensive literature and technology search. The relatively long deployment or detection time of several days, as well as the sensitivity of the measurement and robustness of the detectors made the CR-39 technology promising for deployment at the Shepleys Hill site.

J.R. Giles; T.L. McLing; M.V. Carpenter; C.J. Smith; W. Brandon



Water quality in the vicinity of Fenton Hill. Progress report 1981 and 1982  

DOE Green Energy (OSTI)

As part of a continuing program of environmental studies, water quality data have been collected from established surface and ground water stations and from ponds and pond discharges at Fenton Hill Site located in the Jemez Mountains. Most of these stations were established in 1973, and water quality data have been collected since that time. There have been slight variations in the chemical quality of water from the surface and ground water locations; however, these variations are within normal seasonal fluctuations. The discharge from ponds at Fenton Hill infiltrates into canyon alluvium within 400 m of the site. Monitoring surface and spring discharge downgradient from the ponds failed to detect any effects resulting from water released from the ponds. Total dissolved solids and calcium have increased in water from well FH-1, which furnishes the water supply for the site. This increase is caused by the decreasing water level in the well resulting in yield from beds with a slightly different quality than has been found in previous years.

Purtymun, W.D.; Ferenbaugh, R.W.; Becker, N.M.; Adams, W.H.; Maes, M.N.



Geological structures from televiewer logs of GT-2, Fenton Hill, New Mexico: Part 1, Feature extraction  

DOE Green Energy (OSTI)

Patterns in reflected sonic intensity recognized during examination of televiewer logs of basement gneiss at the Hot Dry Rock Site, Fenton Hill, New Mexico, are due to geological fractures and foliations and to incipient breakouts. These features are obscured by artifacts caused by wellbore ellipticity, tool off-centering, and tool oscillations. An interactive method, developed for extraction of the structural features (fractures and foliations), uses human perception as a pattern detector and a chi-square test of harmonic form as a pattern discriminator. From imagery of GT-2, 733 structures were recovered. The acceptance rate of the discriminator was 54%. Despite these positive results, the general conclusion of this study is that intensity-mode imagery from Fenton Hill is not directly invertible for geological information because of the complexity of the televiewer imaging process. Developing a forward model of the intensity-imaging process, or converting to caliper-mode imagery, or doing both, will be necessary for high-fidelity feature extraction from televiewer data.

Burns, K.L.



Bald eagle habitat suitability on Melton Hill Reservoir and the Clinch River  

Science Conference Proceedings (OSTI)

The area around Melton Hill Reservoir and sections of the Clinch River along the Oak Ridge Reservation (ORR) provide suitable habitat for bald eagles for both breeding and wintering activities. Primary limitations on habitat suitability appear to be human activity in aquatic habitats and along shoreline areas, and human development along shoreline areas. ORR provides the majority of the suitable habitat because shoreline development is very limited. Four eagle management strategies discussed for ORR include planning development away from high-quality habitats, allowing forest stands near water to mature, conducting timber stand improvement to foster growth and development in pines and hardwoods, and using introductions to foster the development of a breeding population. The primary objective of this project was to make a qualitative assessment of bald eagle habitat suitability along Melton Hill Reservoir and the Clinch River and in adjacent areas on the ORR, including the proposed Advanced Neutron Source site. This survey`s aim was to provide ORR managers with an indication of whether suitable habitat exists and, if so, where it occurs on ORR. This information should provide the basis for incorporating eagle management into the overall ORR land management plan.

Buehler, D.A. [Univ., of Knoxville, TN (United States)



1995 verification flow testing of the HDR reservoir at Fenton Hill, New Mexico  

Science Conference Proceedings (OSTI)

Recent flow testing of the Fenton Hill HDR reservoir has demonstrated that engineered geothermal systems can be shut-in for extended periods of d= with apparently no adverse effects. However, when this particular reservoir at Venton Hill was shut-in for 2 years in a pressurized condition, natural convection within the open-jointed reservoir region appears to have leveled out the preexisting temperature gradient so that the gradient has now approached a condition more typical of liquid-dominated hydrothermal reservoirs which air invariably almost isothermal due to natural convection. As a result of the sudden flow impedance reduction that led to an almost 50% increase in Production flow new the end of the Second Phase of the LTFR in May 1993, we were uncertain as to the state of the reservoir after being shut-in for 2 years. The flow performance observed during the current testing was found to be intermediate between that at-the end of the Second Phase of the LTFT and that following, the subsequent sudden flow increase, implying that whatever caused the sudden reduction in impedance in the first place is probably somehow associated with the cooldown of the reservoir near the injection interval, since temperature recovery at the surfaces of the surrounding open joints is the most obvious phenomenon expected to occur over time within the reservoir.

Brown, D.


Note: This page contains sample records for the topic "auburn hills mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Seven Mile Hill I & II Wind Farm | Open Energy Information  

Open Energy Info (EERE)

I & II Wind Farm I & II Wind Farm Jump to: navigation, search Name Seven Mile Hill I & II Wind Farm Facility Seven Mile Hill I & II Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner PacifiCorp Developer PacifiCorp Energy Purchaser PacifiCorp Location Between Hanna and Medicine Bow WY Coordinates 41.939079°, -106.372225° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.939079,"lon":-106.372225,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


HILL: The High-Intensity Laser Laboratory Core Team's Reply to Questions from the NNSA Experimental Facilities Panel  

SciTech Connect

Question 1 - The type of physics regimes that HILL can access for weapons studies is quite interesting. The question that arises for the proposal team is what priority does this type of experimental data have versus data that can be obtained with NIF, and Z. How does HILL rank in priority compared to MARIE 1.0 in terms of the experimental data it will provide? We reiterate that isochoric heating experiments to be conducted with HILL are complementary to the high energy density physics experiments at NIF and Z and uniquely access states of matter that neither other facility can access. It is our belief that HILL will enable several important questions, e.g., as related to mix morphology, radiation transfer from corrugated surfaces, and equations of state, to be run to ground through carefully diagnosed, 'unit-physics' experiments. Such experiments will substantially improve confidence in our computer models and provide a rigorous science basis for certification. Question 2 - A secondary question relates to the interests of LLNL and SNL in the physics that HILL can address. This should be spelled out clearly. I would like to see the other labs be part of the discussion regarding how important this capability would be if built. Both sister Labs have a keen interest in the physics enabled by high-intensity, high-energy lasers, as evinced by the Z Petawatt and NIF ARC upgrades to their signature facilities. LANL scientists have teamed with scientists from both Laboratories in high-intensity laser 'first experiments' envisioned for HILL and we fully intend to continue these profitable discussions going forward. In the preparation of the HILL proposal, feedback was solicited from the broader HEDP and weapons science communities. The consensus view was that HILL filled a critical gap and that there was a need for a facility like HILL to address outstanding questions in weapons science. It was recognized that co-location of HILL with a facility such as MaRIE 1.0, Z, NIF, or Omega may offer additional advantages and we would expect these to be explored and evaluated during the CD process. Question 3 - A laser/optics experts group should review this proposal to ensure the level of R&D is reasonable to provide a sufficient chance of success (>50%). In the preparation of the HILL proposal, we sent our proposal and cost estimates to laser designers/scientists across the complex. Though risks were identified with our design, the prevailing view of those we engaged was that the risks were appropriately represented by the TRL levels assigned and that the enabling R&D planned in our proposal was adequate for risk mitigation. Question 4 - More data and peer review is needed from its sister facilities around the world. It is our specific intent to conduct both scientific and technical workshops with the user community if the High Intensity Science field is further encouraged as part of the NNSA Roadmap. Question 5 - Does HILL have to be co-located with MARIE 1.0? Is that feasible from the point of view of TA-53 real estate? Multiple siting options were considered for HILL, including co-location with MaRIE 1.0 (the most cost-effective and flexible option), as well as in a separate, stand-alone building and in a retro-fitted existing building. The cost estimate included these contingencies and candidate locations for HILL in TA-53 were identified. There is actually significant space at TA-53 on the hill in the northeast end of the mesa. Question 6 - What would be the impact on the weapons program if this facility were NOT built? An inability to elucidate aspects of weapons science in the dense plasma regime and validate computer models for same. This will lead to reduced confidence in the computer tools used for certification. Question 7 - Will HILL allow some of the x-ray vulnerability studies proposed by SPARC? If so what does Sandia's vulnerability group think of this method versus SPARC. It is possible that some of the scope envisioned for SPARC could be achieved on HILL, although likely that the energy produced at HILL not bei

Albright, B J [Los Alamos National Laboratory



Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)



Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)




E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.


A petrophysics and reservoir performance-based reservoir characterization of Womack Hill (Upper Smackover) Field (Alabama)  

E-Print Network (OSTI)

Womack Hill is one of the 57 Smackover fields throughout the Gulf Coast region. Since its discovery in 1970, Womack Hill Field has produced 30 million STB from the Upper Smackover sequence of carbonate reservoirs. Since production reached its peak in 1977, oil and gas rates have declined substantially. During the last ten years, the production decline has accelerated despite an increase in the water injection rate. This production decline along with the increase in the operating costs has caused a considerable drop in profitability of the field. The field currently produces 640 STB/D of oil and 330 MSCF/D of gas, along with 6,700 STB/D of water, which implies a water cut of over 90 percent. In order to optimize the reservoir management strategies for Womack Hill Field, we need to develop an integrated reservoir study. This thesis addresses the creation of an integrated reservoir study and specifically provides a detailed reservoir description that represents the high level of heterogeneity that exists within this field. Such levels of heterogeneity are characteristic of carbonate reservoirs. This research should serve as a guide for future work in reservoir simulation and can be used to evaluate various scenarios for additional development as well as to optimize the operating practices in the field. We used a non-parametric regression algorithm (ACE) to develop correlations between the core and well log data. These correlations allow us to estimate reservoir permeability at the "flow unit" scale. We note that our efforts to reach an overall correlation were unsuccessful. We generated distributions of porosity and permeability throughout the reservoir area using statistically derived estimates of porosity and permeability. The resulting reservoir description indicates a clear contrast in reservoir permeability between the western and eastern areas - and in particular, significant variability in the reservoir. We do note that we observed an essentially homogenous porosity distribution. We provided analysis of the production and injection data using various techniques (history plots, EUR plots, and decline type curve analysis) and we note this effort yielded a remaining recoverable oil of 1.9 MMSTB (under the current operating conditions). This analysis suggests a moderate flow separation between the western and eastern areas and raised some questions regarding the suitability of the hydraulic "jet pumps" (the water rate increased coincidentally with the installation of the jet pumps).

Avila Urbaneja, Juan Carlos



Mitigation action plan sale of Naval Petroleum Reserve No. 1 (Elk Hills) Kern County, California  

Science Conference Proceedings (OSTI)

Naval Petroleum Reserve No. 1 (NPR-1, also called {open_quotes}Elk Hills{close_quotes}), a Federally-owned oil and gas production field in Kern County, California, was created by an Executive Order issued by President Taft on September 2, 1912. He signed another Executive Order on December 13, 1912, to establish Naval Petroleum Reserve No. 2 (NPR-2), located immediately south of NPR-1 and containing portions of the town of Taft, California. NPR-1 was not developed until the 1973-74 oil embargo demonstrated the nation`s vulnerability to oil supply interruptions. Following the embargo, Congress passed the Naval Petroleum Reserves Production Act of 1976 which directed that the reserve be explored and developed to its fall economic potential at the {open_quotes}maximum efficient rate{close_quotes} (MER) of production. Since Elk Hills began full production in 1976, it has functioned as a commercial operation, with total revenues to the Federal government through FY 1996 of $16.4 billion, compared to total exploration, development and production costs of $3.1 billion. In February 1996, Title 34 of the National Defense Authorization Act for Fiscal Year 1996 (P.L. 104-106), referred to as the Elk Hills Sales Statute, directed the Secretary of Energy to sell NPR-1 by February 10, 1998.The Secretary was also directed to study options for enhancing the value of the other Naval Petroleum and Oil Shale Reserve properties such as NPR-2, located adjacent to NPR-1 in Kern County- Naval Petroleum Reserve No. 3 (NPR-3) located in Natrona County, Wyoming; Naval Oil Shale Reserves No. 1 and No. 3 (NOSR-1 and NOSR-3) located in Garfield County, Colorado; and Naval Oil Shale Reserve No. 2 (NOSR-2) located in Uintah and Carbon Counties, Utah. The purpose of these actions was to remove the Federal government from the inherently non-Federal function of operating commercial oil fields while making sure that the public would obtain the maximum value from the reserves.




Smart infrastructure for carbon foot print analysis of Electric Vehicles V Suresh, G Hill, Prof P T Blythe  

E-Print Network (OSTI)

Smart infrastructure for carbon foot print analysis of Electric Vehicles V Suresh, G Hill, Prof P of electric vehicles through on-road testing, user led trials and the analysis of the data collected from, trip profile, auxiliary loads and driving styles to determine how the battery discharges and recharges

Newcastle upon Tyne, University of



Science Conference Proceedings (OSTI)

A two year wind resource assessment was conducted to determine the feasibility of developing a community scale wind generation system for the Upper Skagit Indian Tribe?s Bow Hill land base, and the project researched residential wind resource technologies to determine the feasibility of contributing renewable wind resource to the mix of energy options for our single and multi-family residential units.




Microsoft Word - CX-HillsCreek-LookoutPointWoodPolesFY12_WEB.docx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

REPLY TO ATTN OF: KEP-Alvey SUBJECT: Environmental Clearance Memorandum Chad Hamel Project Manager - TEP-TPP-1 Proposed Action: Hills Creek-Lookout Point No. 1 wood pole replacements PP&A Project No.: 2315 (WO# 297311) Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021): B1.3 Routine maintenance Location: Lane County, Oregon Proposed by: Bonneville Power Administration (BPA), Alvey District Description of the Proposed Action: BPA proposes to replace four deteriorating wood pole structures and associated structural/electrical components (e.g. cross arms, insulators, guy anchors) along the subject transmission line. The poles are located on private residential and US Forest Service land. Landowners will be notified prior to replacement activities. Replacement will be in-


Television interference measurements near the MOD-2 WT array at Goodnoe Hills, Washington  

DOE Green Energy (OSTI)

Electromagnetic interference to television reception caused by the MOD-2 wind turbine (WT) array at Goodnoe Hills, Washington, was studied by means of detailed measurements at a number of test sites in the vicinity of the WT array. The commercial television signals available in the area were used as the radio frequency sources during the measurements. The dynamic measurements indicated that varying amounts of TVI were produced at all sites and on some or all of the available TV channels; with the directional antenna in use, most of the backward region interference produced video distortion that was judged to be acceptable; at one test location about 1-1/2 miles from the WT array site, forward region interference was observed; when the blades of the WTs rotate in synchronism, they tend to increase the amplitude of the interference pulses, thereby producing more TVI effects; and when the blades do not rotate in synchronism, each WT produces interference effects individually.

Sengupta, D L; Senior, T B.A.; Ferris, J E



Start-up operations at the Fenton Hill HDR Pilot Plant  

DOE Green Energy (OSTI)

With the completion of the surface test facilities at Fenton Hill, the Hot Dry Rock (HDR) Geothermal Energy Program at Los Alamos is moving steadily into the next stage of development. Start-up operations of the surface facilities have begun in preparation for testing the Phase II reservoir and the initial steady-state phase of operations. A test program has been developed that will entail a number of operational strategies to characterize the thermal performance of the reservoir. The surface facilities have been designed to assure high reliability while providing the flexibility and control to support the different operating modes. This paper presents a review of the system design and provides a discussion of the preliminary results of plant operations and equipment performance.

Ponden, R.F.



Geological structures from televiewer logs of GT-2, Fenton Hill, New Mexico: Part 2, Rectification  

DOE Green Energy (OSTI)

Televiewer logs from drill hole GT-2 at the Fenton Hill, New Mexico, Hot Dry Rock Site, have been rectified by conversion of structural traces on the scanner imagery to geographic location and orientation. The rectification method was direct inversion that consisted of mapping from the image to the wellbore, inverting the trace on the wellbore for principal points, and rotating from wellbore to geographic coordinates. From the test imagery of GT-2, 733 structures (fractures and foliations) were measured, compared with 42 structures from recovered core. The 733 new measurements listed in this report are a unique and unrepeatable collection of structural information from the Precambrian basement of northern New Mexico. This direct inversion method is accurate where the magnetic field vector is constant and the tool is centered and aligned in a circular wellbore. In other cases this method yields only approximate results.

Burns, K.L.



Water quality in the vicinity of Fenton Hill: Progress report, 1983 and 1984  

DOE Green Energy (OSTI)

Water quality data have been collected since 1974 from established surface and groundwater stations at and in the vicinity of Fenton Hill (Hot Dry Rock Geothermal Demonstration Site) located in the Jemez Mountains. This is part of a continued program of environmental studies. There has been a slight variation in chemical quality of water from the surface and groundwater stations; however, these variations are within normal seasonal fluctuations. Water supply at the site is pumped from the aquifer in the Abiquiu Tuff. Cumulative production from 1976 through 1984 has been 41.5 x 10/sup 6/ gal. The water level in the supply well declined from 365 ft in 1976 to 379 ft in 1984.

Purtymun, W.D.; Ferenbaugh, R.W.; Becker, N.M.; Williams, M.C.; Maes, M.



Case Study Walnut Hill United Methodist Church - Dallas, Texas, Chiller Replacement Analysis  

E-Print Network (OSTI)

In March of 1992 Walnut Hill United Methodist Church in Dallas, Tx. decided that their existing thermal storage and electric reciprocating chiller system were both in need of replacement. After analyzing several options, they chose to install 150 tons of gas-fired double-effect absorption chillers. This case study will show the original HVAC operation cost analysis and compare it to the present day operation costs and it will describe how unexpected changes occurred that caused the initial analysis to be questioned. Finally, this case study will show how today's operational costs are lower than originally projected. This presentation is not about the reasons the church chose this particular system, but about the analysis itself and its accuracy.

Phillips, J.



Start-Up Operations at the Fenton Hill HDR Pilot Plant  

DOE Green Energy (OSTI)

With the completion of the surface test facilities at Fenton Hill, the Hot Dry Rock (HDR) Geothermal Energy Program at Los Alamos is moving steadily into the next stage of development. Start-up operations of the surface facilities have begun in preparation for testing the Phase II reservoir and the initial steady-state phase of operations. A test program has been developed that will entail a number of operational strategies to characterize the thermal performance of the reservoir. The surface facilities have been designed to assure high reliability while providing the flexibility and control to support the different operating modes. This paper presents a review of the system design and provides a discussion of the preliminary results of plant operations and equipment performance.

Ponden, Raymond F.



Crosshole EM for oil field characterization and EOR monitoring: Field examples from Lost Hills, California  

SciTech Connect

A steamflood recently initiated by Mobil Development and Production U.S. at the Lost Hills No 3 oil field in California is notable for its shallow depth and the application of electromagnetic (EM) geophysical techniques to monitor the subsurface steam flow. Steam was injected into three stacked eastward-dipping unconsolidated oil sands at depths from 60 to 120 m; the plume is expected to develop as an ellipsoid aligned with the regional northwest-southeast strike. Because of the shallow depth of the sands and the high viscosity of the heavy oil, it is important to track the steam in the unconsolidated sediments for both economic and safety reasons. Crosshole and surface-to-borehole electromagnetic imaging were applied for reservoir characterization and steamflood monitoring. The crosshole EM data were collected to map the interwell distribution of the high-resistivity oil sands and to track the injected steam and hot water. Measurements were made in two fiberglass-cased observation wells straddling the steam injector on a northeast-southwest profile. Field data were collected before the steam drive, to map the distribution of the oil sands, and then 6 and 10 months after steam was injected, to monitor the expansion of the steam chest. Resistivity images derived from the collected data clearly delineated the distribution and dipping structure of the target oil sands. Difference images from data collected before and during steamflooding indicate that the steam chest has developed only in the middle and lower oil sands, and it has preferentially migrated westward in the middle oil sand and eastward in the deeper sand. Surface-to-borehole field data sets at Lost Hills were responsive to the large-scale subsurface structure but insufficiently sensitive to model steam chest development in the middle and lower oil sands. As the steam chest develops further, these data will be of more use for process monitoring.

Wilt, M.; Schenkel, C.; Wratcher, M.; Lambert, I.; Torres-Verdin, C.; Tseng H.W.



Auburn, New Hampshire: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

New Hampshire: Energy Resources New Hampshire: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 43.0045288°, -71.348398° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.0045288,"lon":-71.348398,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload


MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.


Note: This page contains sample records for the topic "auburn hills mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)


Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab



Conserving the rural landscape of the texas hill country: a place identity-based approach  

E-Print Network (OSTI)

Landscape change induced by population growth and urban development is impacting the ecosystem goods and services provided by open space, which is essential to supporting many urban and rural populations. Conserving open space cannot be attained without obtaining public support especially in a state like Texas where most open space is privately owned. This dissertation was aimed at exploring the role of place identity as an intrinsic incentive for landowner involvement in conserving open space threatened by landscape change. Four objectives addressed in this research include: 1) defining place identity and identifying its underlying dimensions; 2) developing and refining a place-identity scale; 3) developing and testing a conceptual framework to explain the relationships among commitment, place identity, behavior/behavioral intention to manifest place identity, and perception of landscape change; and 4) drawing implications for open space conservation. Identity theory and identity control theory were applied to conceptualize place identity and develope structural models for hypothesis testing. Place identity was defined as comprising meanings that individuals ascribe to a place through their interaction with that place and become defining elements of their self-identity. Both qualitative and quantitative methods were used in this research. Results from semi-structured interviews with a convenience sample of landowners in the Texas Hill Country were used to develop the place-identity scale. Survey data from randomly selected Hill Country landowners were used in confirmatory factor analysis, mean and covariance structure analysis, and invariance testing based on the covariance structure to test and refine measures, to compare differences between landowner groups, and to test hypotheses. Findings suggested that identity theory and identity control theory provided valuable insight to place identity in the face of change. Results also supported a model of place identity comprised of cognitive and affective dimensions, and identified variations among individuals in their affective place-identity. Moreover, findings indicated that both dimensions exhibited different effects on identity-related behavior/behavioral intention under the influence of landscape change. Implications were provided for engaging landowners in open space conservation. This dissertation addresses several research gaps, and also raises questions important in understanding and applying place identity to promoting conservation.

Lai, Po-Hsin



Green area effect and other aerosol scavenging processes in the Black Hills of South Dakota: final report  

SciTech Connect

Bi-weekly air sampling for particulates in the Black Hills has revealed several important scavenging mechanisms. A Gardner condensation nucleus counter was used to determine these particulate counts at fourteen stations. Analysis of the data has indicated that the forested Black Hills are a source of clean air when compared to the surrounding plains due mainly to greater precipitation and in-cloud scavenging events, an elevation variation, and the filtering effects of vegetation (green area sink effect). Little or no scavenging was indicated by certain meteorological variables when considered separately. The green area sink effect was substantiated after performing several tests on the data with a cleanup of as much as 50% evidenced.

Haggard, S.J.



Enforcement Letter, September 6, 2007, CH2M Hill Hanford Group Potential Violations of Nuclear Safety Requirements  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

6, 2007 6, 2007 Mr. John Fulton Chief Executive Officer CH2M Hill Hanford Group, Inc. 2440 Stevens Drive Richland, Washington 99352 Dear Mr. Fulton: The Department of Energy (DOE) held an Enforcement Conference on August 29, 2006, with CH2M Hill Hanford Group (CHG) to discuss potential violations of nuclear safety requirements described in our Investigation Summary Report dated July 26, 2006. At that time, DOE elected to defer a decision on a potential quality improvement violation related to recurring radiological events and deficiencies in the identification and control of radiological hazards at the Tank Farms. This decision was based upon the fact that CHG senior management had initiated radiological work improvements but insufficient data was available to assess their effectiveness. On July 12, 2007, Office of Enforcement


Review of the Hanford Site CH2M Hill Plateau Remediation Company Implementation Verification Review Processes, November 2012  

NLE Websites -- All DOE Office Websites (Extended Search)

Independent Oversight Review Independent Oversight Review of the Hanford Site CH2M Hill Plateau Remediation Company Implementation Verification Review Processes November 2012 Office of Safety and Emergency Management Evaluations Office of Enforcement and Oversight Office of Health, Safety and Security U.S. Department of Energy Table of Contents 1.0 Purpose ................................................................................................................................................... 1 2.0 Background ............................................................................................................................................ 1 3.0 Scope...................................................................................................................................................... 2


TVA Melton Hill Dam Sustainable Recreation Area: Analysis of Field Data from Renewable and Energy Efficiency Technologies  

Science Conference Proceedings (OSTI)

This report describes the culmination of activities, analyses, and results from EPRI's evaluation of TVA's Sustainable Recreation Area at Melton Hill Dam in East Tennessee. The recreation area includes renewable energy generation, energy and water efficiency, and other environmentally-driven enhancements throughout the area's visitor and campground facilities.EPRI has collected time-series data from a specific subset of technologies to evaluate energy and related performance ...



Detailed analysis of the wake and free-flow characteristics at the Goodnoe Hills MOD-2 site  

DOE Green Energy (OSTI)

Wind data collected at nine meteorological towers at the Goodnoe Hills MOD-2 wind turbine site were analyzed to characterize the wind flow over the site both in the absence and presence of wind turbine wakes. Although previous studies have examined the wake and free-flow characteristics at the site, data collected in 1985 from nine towers permitted a much more detailed and accurate analysis than was previously possible. 13 refs., 25 figs., 7 tabs.

Elliott, D.L.; Barnard, J.C.



Review of the Hanford Site CH2M Hill Plateau Remediation Company Implementation Verification Review Processes, November 2012  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Independent Oversight Review Independent Oversight Review of the Hanford Site CH2M Hill Plateau Remediation Company Implementation Verification Review Processes November 2012 Office of Safety and Emergency Management Evaluations Office of Enforcement and Oversight Office of Health, Safety and Security U.S. Department of Energy Table of Contents 1.0 Purpose ................................................................................................................................................... 1 2.0 Background ............................................................................................................................................ 1 3.0 Scope...................................................................................................................................................... 2


Use of slim holes for reservoir evaluation at the Steamboat Hills Geothermal Field, Nevada, USA  

SciTech Connect

Three slim holes were drilled at the Steamboat Hills Geothermal Field in northwestern Nevada about 15 km south of Reno. The slim holes were drilled to investigate the geologic conditions, thermal regime and productive characteristics of the geothermal system. They were completed through a geologic sequence consisting of alluvium cemented by geothermal fluids, volcaniclastic materials, and granodiorite. Numerous fractures, mostly sealed, were encountered throughout the drilled depth; however, several open fractures in the granodiorite, dipping between 65 and 90{degree}, had apertures up to 13 mm in width. The depths of the slim holes vary from 262 to 277 m with open-hole diameters of 76 mm. Pressure and temperature logs gave bottom-hole temperatures ranging from 163 to 166{degree} C. During injection testing, downhole pressures were measured using capillary tubing with a surface quartz transducer while temperatures were measured with a Kuster temperature tool located below the capillary tubing pressure chamber. No pressure increase was measured at reservoir depths in any of the three slim holes while injecting 11 kg/s of 29{degree}C water indicating a very high permeability in the geothermal reservoir. These injection test results suggested that productive geothermal fluids could be found at depths sufficient for well pumping equipment and at temperatures needed for electrical power production using binary-type conversion technology.

Combs, Jim; Goranson, Colin



Interface modeling to predict well casing damage for big hill strategic petroleum reserve.  

SciTech Connect

Oil leaks were found in well casings of Caverns 105 and 109 at the Big Hill Strategic Petroleum Reserve site. According to the field observations, two instances of casing damage occurred at the depth of the interface between the caprock and top of salt. This damage could be caused by interface movement induced by cavern volume closure due to salt creep. A three dimensional finite element model, which allows each cavern to be configured individually, was constructed to investigate shear and vertical displacements across each interface. The model contains interfaces between each lithology and a shear zone to examine the interface behavior in a realistic manner. This analysis results indicate that the casings of Caverns 105 and 109 failed by shear stress that exceeded shear strength due to the horizontal movement of the top of salt relative to the caprock, and tensile stress due to the downward movement of the top of salt from the caprock, respectively. The casings of Caverns 101, 110, 111 and 114, located at the far ends of the field, are predicted to be failed by shear stress in the near future. The casings of inmost Caverns 107 and 108 are predicted to be failed by tensile stress in the near future.

Ehgartner, Brian L.; Park, Byoung Yoon



ICFT: An initial closed-loop flow test of the Fenton Hill Phase II HDR reservoir  

DOE Green Energy (OSTI)

A 30-day closed-loop circulation test of the Phase II Hot Dry Rock reservoir at Fenton Hill, New Mexico, was conducted to determine the thermal, hydraulic, chemical, and seismic characteristics of the reservoir in preparation for a long-term energy-extraction test. The Phase II heat-extraction loop was successfully tested with the injection of 37,000 m/sup 3/ of cold water and production of 23,300 m/sup 3/ of hot water. Up to 10 MW/sub t/ was extracted when the production flow rate reached 0.0139 m/sup 3//s at 192/degree/C. By the end of the test, the water-loss rate had decreased to 26% and a significant portion of the injected water was recovered; 66% during the test and an additional 20% during subsequent venting. Analysis of thermal, hydraulic, geochemical, tracer, and seismic data suggests the fractured volume of the reservoir was growing throughout the test. 19 refs., 64 figs., 19 tabs.

Dash, Z.V. (ed.); Aguilar, R.G.; Dennis, B.R.; Dreesen, D.S.; Fehler, M.C.; Hendron, R.H.; House, L.S.; Ito, H.; Kelkar, S.M.; Malzahn, M.V.



Water quality in the vicinity of Fenton Hill, 1985 and 1986: Progress report  

DOE Green Energy (OSTI)

Water quality data have been collected since 1974 from established surface and groundwater stations at and in the vicinity of Fenton Hill (Hot Dry Rock Geothermal Demonstration Site) located in the Jemez Mountains. This is part of a continuing program of environmental studies. Data on chemical quality of water were determined for samples collected from 13 surface water and 19 groundwater stations in 1985 and 1986. There were slight variations in the chemical quality of the ground and surface water in 1985 and 1986 as compared with previous analyses; however, these variations are within normal seasonal fluctuations. Chemical uptake in soil, roots, and foliage is monitored in the canyon, which receives intermittent effluent release of water from tests in the geothermal circulation loop and occasional fluids from drilling operations. The chemical concentrations found in soil, roots, and vegetation as the result of effluent release have shown a decrease in concentration down-canyon and also have decreased in concentration with time since the larger releases that took place in the late 1970s and early 1980s. 18 refs., 7 figs., 9 tabs.

Purtymun, W.D.; Ferenbaugh, R.W.; Williams, M.C.; Maes, M.N.



Observations of wake characteristics at the Goodnoe Hills MOD-2 array  

DOE Green Energy (OSTI)

The array of three MOD-2 wind turbines and two meteorological towers at Goodnoe Hills, Washington, provides an opportunity to evaluate turbine and wake interactions in a real environment. The triangular arrangement of the three turbines provides opportunities to study the effect of wakes on the performance of a downwind turbine at three different distances: 5, 7, and 10 rotor diameters (D), where 1 D is 300 ft. The information obtained from this test configuration is critical to future wind farm activities and is a key objective of the MOD-2 test program. This report describes the analysis of data measured at the turbines and towers from August 29 to November 12, 1982. The data are 2-min averages of 1-s values. Background flow characteristics were also examined to determine if flow variations across the site could mask wake measurements. For this analysis, one year's data gathered at the meteorological towers were analyzed. The results show some differences between characteristics measured at the towers, but these differences were not great enough to consider in evaluating wakes at the towers.

Buck, J.W.; Renne, D.S.



Summary of Degas II performance at the US Strategic Petroleum Reserve Big Hill site.  

Science Conference Proceedings (OSTI)

Crude oil stored at the US Strategic Petroleum Reserve (SPR) requires mitigation procedures to maintain oil vapor pressure within program delivery standards. Crude oil degasification is one effective method for lowering crude oil vapor pressure, and was implemented at the Big Hill SPR site from 2004-2006. Performance monitoring during and after degasification revealed a range of outcomes for caverns that had similar inventory and geometry. This report analyzed data from SPR degasification and developed a simple degas mixing (SDM) model to assist in the analysis. Cavern-scale oil mixing during degassing and existing oil heterogeneity in the caverns were identified as likely causes for the range of behaviors seen. Apparent cavern mixing patterns ranged from near complete mixing to near plug flow, with more mixing leading to less efficient degassing due to degassed oil re-entering the plant before 100% of the cavern oil volume was processed. The report suggests that the new cavern bubble point and vapor pressure regain rate after degassing be based on direct in-cavern measurements after degassing as opposed to using the plant outlet stream properties as a starting point, which understates starting bubble point and overstates vapor pressure regain. Several means to estimate the cavern bubble point after degas in the absence of direct measurement are presented and discussed.

Rudeen, David K. (GRAM, Inc., Albuquerque, NM); Lord, David L.



Secretary Bodman Makes "Energizing America for Energy Security" Tour Stops  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Makes "Energizing America for Energy Security" Makes "Energizing America for Energy Security" Tour Stops to Launch New Solar Facility Secretary Bodman Makes "Energizing America for Energy Security" Tour Stops to Launch New Solar Facility July 14, 2005 - 2:10pm Addthis AUBURN HILLS, MICH - Secretary of Energy Samuel W. Bodman toured the world's largest amorphous silicon thin-fill solar manufacturing plant in Auburn Hills, Mich., today, and joined United Solar Ovonic leaders in breaking ground on a new facility that will increase production and create 200 new jobs. "I congratulate Uni-Solar on this groundbreaking that will bring 200 new jobs to the Auburn Hills area," Secretary Bodman said. "This new facility will help provide consumers and contractors with another option to reduce


Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A



Geophysical investigations of the Baltazor Hot Springs known geothermal resource area and the Painted Hills thermal area, Humboldt County, Nevada  

DOE Green Energy (OSTI)

Geophysical investigations of the Baltazor Hot Springs KGRA and the Painted Hills thermal area, Humboldt Co., Nevada are described. The study includes a gravity survey of 284 stations covering 750 sq km, numerical modeling and interpretation of five detailed gravity profiles, numerical modeling and inerpretation of 21.8 line-km of dipole-dipole electrical resistivity data along four profiles, and a qualitative inerpretation of 38 line-km of self-potential data along eight profiles. The primary purpose of the investigation is to try to determine the nature of the geologic controls of the thermal anomalies at the two areas.

Edquist, R.K.



A CO{sub 2}-based analysis of a light-oil steamflood at NPR-1, Elk Hills, CA  

SciTech Connect

A steamdrive pilot was run on a light-oil reservoir at the Naval Petroleum Reserve No 1 (NPR1) in the Elk Hills oil field, Kern County, CA. The goal of this work was to establish a correlation between a documented growth in CO{sub 2} concentrations found in producing wells in the pilot area to the light-oil steamflood (LOSF); then to use a thermodynamic analysis of the expended energy to come up with an energy efficiency of the steamdrive.

Shotts, D.R.; Senum, G.I.



Notice of Availability of the Record of Decision for the Goodnoe Hills and White Creek Wind Energy Projects, Business Plan EIS (DOE/EIS-0183) (October 2005)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

13 Federal Register 13 Federal Register / Vol. 70, No. 226 / Friday, November 25, 2005 / Notices DEPARTMENT OF ENERGY Bonneville Power Administration Goodnoe Hills and White Creek Wind Energy Projects, October 2005 AGENCY: Bonneville Power Administration (BPA), Department of Energy (DOE). ACTION: Notice of availability of Record of Decision (ROD). SUMMARY: BPA has decided to offer contract terms for interconnection of the Goodnoe Hills and White Creek Wind Energy Projects into the Federal Columbia River Transmission System (FCRTS) at the Rock Creek substation in Klickitat County, Washington. The Large Generation Interconnection Agreement (LGIA) provides for interconnection of the Wind Projects with the FCRTS, the operation of Goodnoe Hills and White Creek Wind Energy Projects in the BPA Control Area

Note: This page contains sample records for the topic "auburn hills mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester



T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab



LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance


PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos



Characteristics of the C Shale and D Shale reservoirs, Monterey Formation, Elk Hills Field, Kern County, California  

Science Conference Proceedings (OSTI)

The upper Miocene C Shale and D Shale reservoirs of the Elk Hills Shale Member of the Monterey Formation have cumulative oil and gas production much higher than the originally estimated recovery. These San Joaquin basin reservoirs are the lowest of the Stevens producing zones at Elk Hills and currently produce from a 2800-acre area on the 31 S anticline. The C Shale contains lower slope and basin plain deposits of very fine grained, thinly bedded, graded turbidites, pelagic and hemipelagic claystone, and slump deposits. Although all units are oil-bearing, only the lower parts of the graded turbidity intervals have sufficient horizontal permeability to produce oil. The D Shale consists of chart, claystone, carbonates and slump deposits, also originating in a lower slope to basin plain setting. All D Shale rock types contain oil, but the upper chart interval is the most productive. The chart has high matrix porosity, and due to a complex horizontal and vertical microfracture system, produces at a highly effective rate. Core samples indicate more oil-in-place is present in the thin, graded C Shale beds and in the porous D Shale chart than is identifiable from conventional electric logs. High gas recovery rates are attributed mostly to this larger volume of associated oil. Gas also enters the reservoirs from the adjacent 26R reservoir through a leaky normal fault. Significant gas volumes also may desorb from immature organic material common in the rock matrix.

Reid, S.A.; McIntyre, J.L. (Bechtel Petroleum Operations, Inc., Tupman, CA (United States)); McJannet, G.S. (Dept. of Energy, Tupman, CA (United States))



Televiewer measurement of in-situ stress direction at the Fenton Hill Hot Dry Rock Site, New Mexico  

DOE Green Energy (OSTI)

The in situ stresses at Fenton Hill has been determined in drill hole EE-3A by observations of wellbore breakouts on imagery obtained with a televiewer logging tool. Wellbore shape, tool offcentering, and tool misalignment cause geometric distortions which have been treated by comparing imagery from two logging runs made six months apart. The comparison establishes that wellbore degradation in drill hole EE-3A is due to breakouts, which grow larger with time. The azimuth of the axis of minimum horizontal principal stress is estimated to be 110.7 +//minus/ 10.3 deg E of true N at a depth of 11,500 ft, increasing with depth at a rate of 1 deg per 50 ft. This method of measuring the orientation of horizontal principal axes is considerably more accurate than previous methods tried at Fenton Hill. The results agree generally with other stress indicators. The results support the concept that direction of reservoir growth during hydraulic stimulation favours the intermediate axis over other principal axes of stress. 11 figs., 1 tab.

Burns, K.L.



Constitutive models for the Etchegoin Sands, Belridge Diatomite, and overburden formations at the Lost Hills oil field, California  

SciTech Connect

This report documents the development of constitutive material models for the overburden formations, reservoir formations, and underlying strata at the Lost Hills oil field located about 45 miles northwest of Bakersfield in Kern County, California. Triaxial rock mechanics tests were performed on specimens prepared from cores recovered from the Lost Hills field, and included measurements of axial and radial stresses and strains under different load paths. The tested intervals comprise diatomaceous sands of the Etchegoin Formation and several diatomite types of the Belridge Diatomite Member of the Monterey Formation, including cycles both above and below the diagenetic phase boundary between opal-A and opal-CT. The laboratory data are used to drive constitutive parameters for the Extended Sandler-Rubin (ESR) cap model that is implemented in Sandia's structural mechanics finite element code JAS3D. Available data in the literature are also used to derive ESR shear failure parameters for overburden formations. The material models are being used in large-scale three-dimensional geomechanical simulations of the reservoir behavior during primary and secondary recovery.




Record of Decision for the Fourmile Hill Geothermal Development Project Power Purchase and Transmission Service Agreements (DOE/EIS-0266) (11/20/00)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

BONNEVILLE POWER ADMINISTRATION BONNEVILLE POWER ADMINISTRATION Fourmile Hill Geothermal Development Project Power Purchase and Transmission Service Agreements Administrator's Record of Decision Summary The Bonneville Power Administration (BPA) has decided to execute Transmission Services Agreements (TSAs) and Power Purchase Agreements (PPAs) with Calpine Siskiyou Geothermal Partners, L.P. (Calpine) to acquire output from the Fourmile Hill Geothermal Development Project (Project). Initially, BPA will execute one or more PPAs in order to acquire up to the entire Project output. TSAs will be executed before the Project becomes operational. The United States Forest Service (Forest Service) and the Bureau of Land Management (BLM) were the joint lead Federal agencies in the preparation of


Bruce hiLL is aN amiabLe feLLow, taLKing aBout the intricate  

E-Print Network (OSTI)

of physics students from western Kentucky university who ended up writing the software that controls ages. "i had been keeping in touch with ed Kintzel, a professor at western Ken- tucky university who had done on the software in their Kentucky classroom while the device itself remained in hill's lab. the work on ages


Mycorrhizal Species Dominate the Soil-Fungal Community in Estonian Oil Shale-Ash Hills Charles Cowden, Sam Willis, and Richard Shefferson  

E-Print Network (OSTI)

Mycorrhizal Species Dominate the Soil-Fungal Community in Estonian Oil Shale-Ash Hills Charles 30602 Introduction Estonia relies on vast reserves of oil shale to produce electricity. The mining and burning of oil shale is extremely inefficient and produces large quantities of tailings and ash (Vallner

Shefferson, Richard P.


Nanoscale Imaging of Airborne Particles Mike Bogan Stanford PULSE Institute, SLAC National Accelerator Laboratory, 2575 Sand Hill Road,  

NLE Websites -- All DOE Office Websites (Extended Search)

Diagnostics with an X-ray Laser? Lessons from the First Diagnostics with an X-ray Laser? Lessons from the First Nanoscale Imaging of Airborne Particles Mike Bogan Stanford PULSE Institute, SLAC National Accelerator Laboratory, 2575 Sand Hill Road, Menlo Park, CA 94025, USA What does airborne particulate matter look like? How do we develop quantitative descriptors for particles of complex morphology? These challenges were highlighted in the NIST workshop report "Aerosol Metrology Needs for Climate Science" (Dec, 2011). Sure, we can capture aerosol particles on surfaces - removing them from their airborne state - and probe them with high resolution optical and chemical imaging tools, but what information do we lose about the airborne particles? How can we follow dynamics? In this talk we will explore these very basic questions and their importance to combustion


Measurement of airborne fission products in Chapel Hill, NC, USA from the Fukushima Dai-ichi reactor accident  

E-Print Network (OSTI)

We present measurements of airborne fission products in Chapel Hill, NC, USA, from 62 days following the March 11, 2011, accident at the Fukushima Dai-ichi nuclear power plant. Airborne particle samples were collected daily in air filters and radio-assayed with two high-purity germanium (HPGe) detectors. The fission products I-131 and Cs-137 were measured with maximum activities of 4.2 +/- 0.6 mBq/m^3 and 0.42 +/- 0.07 mBq/m^3 respectively. Additional activity from I-131, I-132, Cs-134, Cs-136, Cs-137 and Te-132 were measured in the same air filters using a low-background HPGe detector at the Kimballton Underground Research Facility (KURF).

S. MacMullin; G. K. Giovanetti; M. P. Green; R. Henning; R. Holmes; K. Vorren; J. F. Wilkerson



Measurement of Airborne Fission Products in Chapel Hill, NC, USA from the Kukushima Dai-ichi Reactor Accident  

SciTech Connect

We present measurement results of airborne fission products in Chapel Hill, NC, USA, from 62 d following the March 11, 2011, accident at the Fukushima Dai-ichi nuclear power plant. Airborne particle samples were collected daily in air filters and radio-assayed with two high-purity germanium (HPGe) detectors. The fission products 131I and 137Cs were measured with maximum activity concentrations of 4.2 0.6 mBq/m3 and 0.42 0.07 mBq/m3 respectively. Additional activity from 131,132I, 134,136,137Cs and 132Te were measured in the same air filters using a low-background HPGe detector at the Kimballton Underground Research Facility (KURF).

MacMullin, S. [Univ, of North Carolina & Triangle Universities Nucl. Lab - Durham, NC; Giovanetti, G. K. [Univ, of North Carolina & Triangle Universities Nucl. Lab - Durham, NC; Green, M. P. [Univ, of North Carolina & Triangle Universities Nucl. Lab - Durham, NC; Henning, R. [Univ, of North Carolina & Triangle Universities Nucl. Lab - Durham, NC; Holmes, R. [Univ. North Carolina-Chapel & Univ. of Illinois-Urbana; Vorren, K. [University of North Carolina / Triangle Universities Nuclear Lababoratory, Durham; Wilkerson, J. F. [UNC/Triangle Univ. Nucl. Lab, Durham, NC/ORNL



Pre-test estimates of temperature decline for the LANL Fenton Hill Long-Term Flow Test  

DOE Green Energy (OSTI)

Pre-test predications for the Long-Term Flow Test (LTFT) of the experimental Hot Dry Rock (HDR) reservoir at Fenton Hill were made using two models. Both models are dependent on estimates of the ``effective`` reservoir volume accessed by the fluid and the mean fracture spacing (MFS) of major joints for fluid flow. The effective reservoir volume was estimated using a variety of techniques, and the range of values for the MFS was set through experience in modeling the thermal cooldown of other experimental HDR reservoirs. The two pre-test predictions for cooldown to 210{degrees}C (a value taken to compare the models) from initial temperature of 240{degrees}C are 6.1 and 10.7 years. Assuming that a minimum of 10{degrees}C is required to provide an unequivocal indication of thermal cooldown, both models predict that the reservoir will not exhibit observable cooldown for at least two years.

Robinson, B.A. [Los Alamos National Lab., NM (United States); Kruger, P. [Stanford Univ., CA (United States). Stanford Geothermal Program



Anomalous zones in Gulf Coast Salt domes with special reference to Big Hill, TX, and Weeks Island, LA  

Science Conference Proceedings (OSTI)

Anomalous features in Gulf Coast Salt domes exhibit deviations from normally pure salt and vary widely in form from one dome to the next, ranging considerably in length and width. They have affected both conventional and solution mining in several ways. Gas outbursts, insolubles, and potash (especially carnallite) have led to the breakage of tubing in a number of caverns, and caused irregular shapes of many caverns through preferential leaching. Such anomalous features essentially have limited the lateral extent of conventional mining at several salt mines, and led to accidents and even the closing of several other mines. Such anomalous features, are often aligned in anomalous zones, and appear to be related to diapiric processes of salt dome development. Evidence indicates that anomalous zones are found between salt spines, where the differential salt intrusion accumulates other materials: Anhydrite bands which are relatively strong, and other, weaker impurities. Shear zones and fault displacement detected at Big Hill and Weeks Island domes have not yet had any known adverse impacts on SPR oil storage, but new caverns at these sites conceivably may encounter some potentially adverse conditions. Seismic reflection profiles at Big Hill dome have shown numerous fractures and faults in the caprock, and verified the earlier recognition of a major shear zone transecting the entire salt stock and forming a graben in the overlying caprock. Casing that is placed in such zones can be at risk. Knowledge of these zones should create awareness of possible effects rather than preclude the future emplacement of caverns. To the extent possible, major anomalous zones and salt stock boundaries should be avoided. Shear zones along overhangs may be particularly hazardous, and otherwise unknown valleys in the top of salt may occur along shear zones. These zones often can be mapped geophysically, especially with high-resolution seismic techniques.

Neal, J.T. [Sandia National Labs., Albuquerque, NM (United States); Magorian, T.R. [Magorian (Thomas R.), Amherst, NY (United States); Thoms, R.L. [AGM, Inc., College Station, TX (United States); Autin, W.J.; McCulloh, R.P. [Louisiana Geological Survey, Baton Rouge, LA (United States); Denzler, S.; Byrne, K.O. [Acres International Corp., Amherst, NY (United States)



Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.



Task 5: TVA sediment-disturbing activities within the Watts Bar Reservoir and Melton Hill Reservoir areas of the Clinch River  

DOE Green Energy (OSTI)

The objectives of Task 5 of the Interagency Agreement No. DE-AI05-91OR22007 were to review: (1) the extent of dredging, construction, and other sediment-disturbing activities conducted by the Tennessee Valley Authority (TVA) in potentially contaminated areas of Watts Bar Reservoir, and (2) the disposition of the materials from these activities. This memorandum is the final report for Task 5. This memorandum describes major activities in the Watts Bar Reservoir and Melton Hill Reservoir areas of the Clinch River that possibly resulted in significant disturbance of potentially contaminated sediments. TVA records from the construction of Watts Bar Dam, Kingston Fossil Plant, and Melton Hill Dam were reviewed to facilitate qualitative description of the effect of these activities in disturbing potentially contaminated sediments. The critical period for these activities in disturbing contaminated sediments was during or after 1956 when the peak releases of radioactive contaminants occurred from the Oak Ridge Reservation.




Improved Oil Recovery from Upper Jurassic Smackover Carbonates through the Application of Advanced Technologies at Womack Hill Oil Field, Choctaw and Clarke Counties, Eastern Gulf Costal Plain  

SciTech Connect

Pruet Production Co. and the Center for Sedimentary Basin Studies at the University of Alabama, in cooperation with Texas A&M University, Mississippi State University, University of Mississippi, and Wayne Stafford and Associates proposed a three-phase, focused, comprehensive, integrated and multidisciplinary study of Upper Jurassic Smackover carbonates (Class II Reservoir), involving reservoir characterization and 3-D modeling (Phase I) and a field demonstration project (Phases II and III) at Womack Hill Field Unit, Choctaw and Clarke Counties, Alabama, eastern Gulf Coastal Plain. Phase I of the project has been completed. The principal objectives of the project are: increasing the productivity and profitability of the Womack Hill Field Unit, thereby extending the economic life of this Class II Reservoir and transferring effectively and in a timely manner the knowledge gained and technology developed from this project to producers who are operating other domestic fields with Class II Reservoirs. The major tasks of the project included reservoir characterization, recovery technology analysis, recovery technology evaluation, and the decision to implement a demonstration project. Reservoir characterization consisted of geoscientific reservoir characterization, petrophysical and engineering property characterization, microbial characterization, and integration of the characterization data. Recovery technology analysis included 3-D geologic modeling, reservoir simulation, and microbial core experiments. Recovery technology evaluation consisted of acquiring and evaluating new high quality 2-D seismic data, evaluating the existing pressure maintenance project in the Womack Hill Field Unit, and evaluating the concept of an immobilized enzyme technology project for the Womack Hill Field Unit. The decision to implement a demonstration project essentially resulted in the decision on whether to conduct an infill drilling project in Womack Hill Field. Reservoir performance, multiwell productivity analysis, and reservoir simulation studies indicate that water injection continues to provide stable support to maintain production from wells in the western unitized area of the field and that the strong water drive present in the eastern area of the field is adequate to sustain production from this part of the field. Although the results from the microbial characterization and microbial core experiments are very promising, it is recommended that an immobilized enzyme technology project not be implemented in the Womack Hill Field Unit until live (freshly taken and properly preserved) cores from the Smackover reservoir in the field are acquired to confirm the microbial core experiments to date. From 3-D geologic modeling, reservoir performance analysis, and reservoir simulation, four areas in the Womack Hill Field were identified as prospective infill drilling sites to recover undrained oil from the field. It was determined that the two areas in the unit area probably can be effectively drained by perforating higher zones in the Smackover reservoir in currently producing wells. The two areas in the eastern (non-unitized) part of the field require the drilling of new wells. The successful drilling and testing of a well in 2003 by J. R. Pounds, Inc. has proven the oil potential of the easternmost site in the non-unitized part of the field. Pruet Production Co. acquired new 2-D seismic data to evaluate the oil potential of the westernmost site. Because of the effects of a fault shadow from the major fault bounding the southern border of the Womack Hill Field, it is difficult to evaluate conclusively this potential drill site. Pruet Production Co. has decided not to drill this new well at this time and to further evaluate the new 2-D seismic profiles after these data have been processed using a pre-stack migration technique. Pruet Production Co. has elected not to continue into Phase II of this project because they are not prepared to make a proposal to the other mineral interest owners regarding the drilling of new wells as part of an infil

Ernest A. Mancini



Improved Oil Recovery from Upper Jurassic Smackover Carbonates through the Application of Advanced Technologies at Womack Hill Oil Field, Choctaw and Clarke Counties, Eastern Gulf Coastal Plain  

Science Conference Proceedings (OSTI)

Pruet Production Co. and the Center for Sedimentary Basin Studies at the University of Alabama, in cooperation with Texas A&M University, Mississippi State University, University of Mississippi, and Wayne Stafford and Associates proposed a three-phase, focused, comprehensive, integrated and multidisciplinary study of Upper Jurassic Smackover carbonates (Class II Reservoir), involving reservoir characterization and 3-D modeling (Phase I) and a field demonstration project (Phases II and III) at Womack Hill Field Unit, Choctaw and Clarke Counties, Alabama, eastern Gulf Coastal Plain. Phase I of the project has been completed. The principal objectives of the project are: increasing the productivity and profitability of the Womack Hill Field Unit, thereby extending the economic life of this Class II Reservoir and transferring effectively and in a timely manner the knowledge gained and technology developed from this project to producers who are operating other domestic fields with Class II Reservoirs. The major tasks of the project included reservoir characterization, recovery technology analysis, recovery technology evaluation, and the decision to implement a demonstration project. Reservoir characterization consisted of geoscientific reservoir characterization, petrophysical and engineering property characterization, microbial characterization, and integration of the characterization data. Recovery technology analysis included 3-D geologic modeling, reservoir simulation, and microbial core experiments. Recovery technology evaluation consisted of acquiring and evaluating new high quality 2-D seismic data, evaluating the existing pressure maintenance project in the Womack Hill Field Unit, and evaluating the concept of an immobilized enzyme technology project for the Womack Hill Field Unit. The decision to implement a demonstration project essentially resulted in the decision on whether to conduct an infill drilling project in Womack Hill Field. Reservoir performance, multiwell productivity analysis, and reservoir simulation studies indicate that water injection continues to provide stable support to maintain production from wells in the western unitized area of the field and that the strong water drive present in the eastern area of the field is adequate to sustain production from this part of the field. Although the results from the microbial characterization and microbial core experiments are very promising, it is recommended that an immobilized enzyme technology project not be implemented in the Womack Hill Field Unit until live (freshly taken and properly preserved) cores from the Smackover reservoir in the field are acquired to confirm the microbial core experiments to date. From 3-D geologic modeling, reservoir performance analysis, and reservoir simulation, four areas in the Womack Hill Field were identified as prospective infill drilling sites to recover undrained oil from the field. It was determined that the two areas in the unit area probably can be effectively drained by perforating higher zones in the Smackover reservoir in currently producing wells. The two areas in the eastern (non-unitized) part of the field require the drilling of new wells. The successful drilling and testing of a well in 2003 by J. R. Pounds, Inc. has proven the oil potential of the easternmost site in the non-unitized part of the field. Pruet Production Co. acquired new 2-D seismic data to evaluate the oil potential of the westernmost site. Because of the effects of a fault shadow from the major fault bounding the southern border of the Womack Hill Field, it is difficult to evaluate conclusively this potential drill site. Pruet Production Co. has decided not to drill this new well at this time and to further evaluate the new 2-D seismic profiles after these data have been processed using a pre-stack migration technique. Pruet Production Co. has elected not to continue into Phase II of this project because they are not prepared to make a proposal to the other mineral interest owners regarding the drilling of new wells as part of an infil

Ernest A. Mancini



What can SimbolX do for gammaray binaries? B. Cerutti, G. Dubus, G. Henri, A. B. Hill and A. Szostek  

E-Print Network (OSTI)

constrain the existing 1 A recent soft gamma­ray repeater/anomalous X­ray pulsar like burst was observedWhat can Simbol­X do for gamma­ray binaries? B. Cerutti, G. Dubus, G. Henri, A. B. Hill and A Grenoble, France Abstract. Gamma­ray binaries have been uncovered as a new class of Galactic objects

Recanati, Catherine

Note: This page contains sample records for the topic "auburn hills mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


A Comparison of Two Solar-Powered LED Street and Area Lighting Systems: Demonstration Results from Melton Hill Dam and Habitat for Humanity of Greater Chattanooga, Tennessee  

Science Conference Proceedings (OSTI)

Solar-powered lighting systems have developed to the point that they can now be considered as a viable option in replacing traditional grid-connected lighting in many areas. Two sites, Melton Hill dam near Lenoir City, Tennessee, and Habitat for Humanity in Chattanooga served as a unique testing opportunity to investigate the feasibility of LED solar-powered lighting as a replacement for traditional lighting technologies in off-grid applications. In this case study, each site is analyzed individually, but .



Review of Richland Operations Office and CH2M Hill Plateau Remediation Company and Mission Support Alliance Conduct of Operations, April 2012  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Oversight Review of Oversight Review of Richland Operations Office and CH2M HILL Plateau Remediation Company and Mission Support Alliance Conduct of Operations April 2012 Office of Safety and Emergency Management Evaluations Office of Enforcement and Oversight Office of Health, Safety and Security U.S. Department of Energy i Table of Contents 1.0 Purpose ................................................................................................................................................... 1 2.0 Background ............................................................................................................................................ 1 3.0 Scope ...................................................................................................................................................... 2


Review of Richland Operations Office and CH2M Hill Plateau Remediation Company and Mission Support Alliance Conduct of Operations, April 2012  

NLE Websites -- All DOE Office Websites (Extended Search)

Independent Oversight Review of Independent Oversight Review of Richland Operations Office and CH2M HILL Plateau Remediation Company and Mission Support Alliance Conduct of Operations April 2012 Office of Safety and Emergency Management Evaluations Office of Enforcement and Oversight Office of Health, Safety and Security U.S. Department of Energy i Table of Contents 1.0 Purpose ................................................................................................................................................... 1 2.0 Background ............................................................................................................................................ 1 3.0 Scope ...................................................................................................................................................... 2


Characterization of injection wells in a fractured reservoir using PTS logs, Steamboat Hills Geothermal Field, Nevada, USA  

DOE Green Energy (OSTI)

The Steamboat Hills Geothermal Field in northwestern Nevada, about 15 km south of Reno, is a shallow (150m to 825m) moderate temperature (155 C to 168 C) liquid-dominated geothermal reservoir situated in highly-fractured granodiorite. Three injection wells were drilled and completed in granodiorite to dispose of spent geothermal fluids from the Steamboat II and III power plants (a 30 MW air-cooled binary-type facility). Injection wells were targeted to depths below 300m to inject spent fluids below producing fractures. First, quasi-static downhole pressure-temperature-spinner (PTS) logs were obtained. Then, the three wells were injection-tested using fluids between 80 C and 106 C at rates from 70 kg/s to 200 kg/s. PTS logs were run both up and down the wells during these injection tests. These PTS surveys have delineated the subsurface fracture zones which will accept fluid. The relative injectivity of the wells was also established. Shut-in interzonal flow within the wells was identified and characterized.

Goranson, Colin; Combs, Jim



Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available



Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



Anomalous earth stress measurements during a six-year sequence of pumping tests at Fenton Hill, New Mexico  

DOE Green Energy (OSTI)

Since 1982, the Los Alamos National Laboratory has been conducting fracturing and flow-through tests on a deep region of jointed Precambrian rock underlying the western flank of the Valles Caldera, in the Jemez Mountains of north-central New Mexico. These experiments have been conducted as part of the Laboratory's Hot Dry Rock (HDR) Geothermal Energy Project, at our Fenton Hill Test Facility, 30 km west of Los Alamos. During this time, the overall project goal has been to experimentally study (and model) the development and performance of a commercial-sized HDR reservoir -- created hydraulically by multiply-fracturing a very large region of hot crystalline rock. One of the primary objectives of this extensive series of fracturing tests has been to study how hard ''competent'' rock dilates and shears during the continuing injection of water under pressure. In association with these tests, a number of seemingly anomalous results have been observed which, if taken separately, would have been fairly easy to ignore or explain anyway. However, in concert, these disparate results have started to form a picture of rock deformation which is quite different from our previously accepted concepts of hydraulic fracturing, and the interpretation of the resulting stress measurements. Key to this better understanding is the realization that almost all bodies of deep crystalline rock are already flawed by one or more sets of joints or planes of weakness, and that it is the interaction between these joints and the existing stress field determines the nature of the pressure-induced deformation. 16 refs., 8 figs., 2 tabs.

Brown, D.W.



Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-



Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan



Summary report on water quality, sediment and water chemistry data for water and sediment samples collected from source areas to Melton Hill and Watts Bar reservoirs  

Science Conference Proceedings (OSTI)

Contamination of surface water and sediments in the Clinch River and Watts Bar Reservoir (CR/WBR) system as a result of past and present activities by the US Department of Energy (DOE) on the Oak Ridge Reservation (ORR) and also activities by non-ORR facilities are being studied by the Clinch River Environmental Restoration Program (CR-ERP). Previous studies have documented the presence of heavy metals, organics, and radionuclides in the sediments of reservoirs in the vicinity. In support of the CR-ERP, during the summer of 1991, TVA collected and evaluated water and sediment samples from swimming areas and municipal water intakes on Watts Bar Reservoir, Melton Hill Reservoir (which is considered part of the Clinch River and Watts Bar Reservoir System), and Norris Reservoir, which was considered a source of less-contaminated reference or background data. Results of this study indicated that the levels of contamination in the samples from the Watts Bar and Melton Hill Reservoir sites did not pose a threat to human health. Despite the numerous studies, until the current work documented by this report, relatively few sediment or water samples had been collected by the CR-ERP in the immediate vicinity of contaminant point sources. This work focused on water and sediment samples taken from points immediately downstream from suspected effluent point sources