National Library of Energy BETA

Sample records for asia eastern asia

  1. Accounting for Co-benefits in Asia's Transportation Sector: Methods...

    Open Energy Info (EERE)

    modeling tools User Interface: Spreadsheet Website: www.iges.or.jpencpactivity20101108.html UN Region: Eastern Asia Accounting for Co-benefits in Asia's Transportation...

  2. Search Asia Advanced Search

    E-Print Network [OSTI]

    .html (1 of 2)9/4/2007 12:59:34 PM Search #12;Asia Times No material from Asia Times Online may:// (2 of 2)9/4/2007 12:59:34 PM #12;

  3. South Asia Regional Initiative for Energy Cooperation and Development...

    Open Energy Info (EERE)

    www.usaid.govourwork Country Afghanistan, Pakistan, Bhutan, India, Sri Lanka, Bangladesh, Nepal, Maldives Southern Asia, Southern Asia, Southern Asia, Southern Asia,...

  4. Energy and Security in Northeast Asia: Proposals for Nuclear Cooperation

    E-Print Network [OSTI]

    Kaneko, Kumao; Suzuki, Atsuyuki; Choi, Jor-Shan; Fei, Edward


    Asia, examine the energy- security connection in Asia withon the long-term security of energy supply, which mustin East Asia's security, nuclear energy, and environment. It

  5. SIGGRAPH Asia 2008 Course notes

    E-Print Network [OSTI]

    Gutierrez, Diego

    SIGGRAPH Asia 2008 Scattering Course notes Diego Gutierrez Universidad de Zaragoza Henrik § 1 #12;1 About the Lecturers Diego Gutierrez University of Zaragoza diegog Diego Gutierrez is an Associate Professor at the University of Zaragoza, in Spain, where he

  6. Spirits of Capitalism: Explaining Industrial Variation in South Asia

    E-Print Network [OSTI]

    Naseemullah, Adnan


    1966). “Indian Automotive Industry: Opportunities andin Pakistan’s Automotive Industry. ” Journal of Asia Pacificin Pakistan’s Automotive Industry”, Journal of Asia Pacific

  7. Energy, Transportation Ministers from Asia-Pacific Nations Pledge...

    Office of Environmental Management (EM)

    Transportation Ministers from Asia-Pacific Nations Pledge Cooperation on Cleaner, More Energy-Efficient Transportation Energy, Transportation Ministers from Asia-Pacific Nations...

  8. Territorial and Maritime Boundary Disputes in Asia

    E-Print Network [OSTI]

    Fravel, M. Taylor

    Territorial disputes involve a state’s national sovereignty and territorial integrity-its core interests. Historically, they have been the most common issue over which states collide and go to war. Since 1945, Asia has ...

  9. Energy and Security in Northeast Asia

    E-Print Network [OSTI]

    May, Michael; Johnson, Celeste; Fei, Edward; Suzuki, Tatsujiro


    plants as a form of energy security in the absence of suffi-can be drawn. The energy security situation and outlook areregional cooperation on energy and security issues in Asia.


    E-Print Network [OSTI]

    REVIEW ARTICLE 100 NPG ASIA MATERIALS | VOL 3 | NOVEMBER 2011 | or find materials for which the dielectric permittivity and the magnetic permeability µ were both negative. He deduced that one striking outcome would be that the refractive index of the material would

  11. East Asia Institute September 12, 2012 Taiwan Today

    E-Print Network [OSTI]

    Dodla, Ramana

    East Asia Institute September 12, 2012 Taiwan, and staff on Taiwan. On Wednesday, September 12, 2012, the East Asia Institute "Taiwan Today". The Taipei Economic and Cultural Office in Houston made

  12. Policy Paper 24: Energy and Security in Northeast Asia

    E-Print Network [OSTI]

    May, Michael; Johnson, Celeste; Fei, Edward; Suzuki, Tatsujiro


    regional cooperation on energy and security issues in Asia.Energy and Security in Northeast Asia An IGCC studyplants as a form of energy security in the absence of suffi-

  13. Agreements --Asia 51 52 Atlas of International Freshwater Agreements

    E-Print Network [OSTI]

    Wolf, Aaron

    Agreements -- Asia 51 ASIA #12;52 Atlas of International Freshwater Agreements Amur River. Photo credit: Mikhail A. Yatskov. Amur* Total area: 2,085,900 km2 Area of Basin in Country Countries km2 and the Upper Amur River #12;Agreements -- Asia 53 An Nahr Al Kabir Total area: 1,300 km2 Area of Basin

  14. INTERNATIONAL DIRECTORY OF Southeast Asia Librarians

    E-Print Network [OSTI]

    California at Berkeley, University of

    Information Services/Library R. G. Menzies Building #2 The Australian National University Canberra ACT 0200 and Indonesian National Library of Australia Tieke Atikah (Mrs.) Manager, Regional Office Asia National Library Collection Development National Library of Australia Parkes Place, Canberra ACT 2600, Australia Tel: 61 2

  15. Southeast Asia Research Centre Rolando G. TALAMPAS

    E-Print Network [OSTI]

    Po, Lai-Man

    Southeast Asia Research Centre Rolando G. TALAMPAS Asian Center University of the Philippines William Henry Scott, was the real freeman (timagua or timawa) in classical Philippine society because he in classic Philippine society," Philippine Studies Vol. 30 (Third Quarter 1982), p. 373. The same essay has

  16. Aerosol Characterization Data from the Asian Pacific Regional Aerosol Characterization Project (ACE-Asia)

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    The Aerosol Characterization Experiments (ACE) were designed to increase understanding of how atmospheric aerosol particles affect the Earth's climate system. These experiments integrated in-situ measurements, satellite observations, and models to reduce the uncertainty in calculations of the climate forcing due to aerosol particles and improve the ability of models to predict the influences of aerosols on the Earth's radiation balance. ACE-Asia was the fourth in a series of experiments organized by the International Global Atmospheric Chemistry (IGAC) Program (A Core Project of the International Geosphere Biosphere Program). The Intensive Field Phase for ACE-Asia took place during the spring of 2001 (mid-March through early May) off the coast of China, Japan and Korea. ACE-Asia pursued three specific objectives: 1) Determine the physical, chemical, and radiative properties of the major aerosol types in the Eastern Asia and Northwest Pacific region and investigate the relationships among these properties. 2) Quantify the physical and chemical processes controlling the evolution of the major aerosol types and in particular their physical, chemical, and radiative properties. 3) Develop procedures to extrapolate aerosol properties and processes from local to regional and global scales, and assess the regional direct and indirect radiative forcing by aerosols in the Eastern Asia and Northwest Pacific region [Edited and shortened version of summary at]. The Ace-Asia collection contains 174 datasets.

  17. Assistance Focus: Asia/Pacific Region (Brochure)

    SciTech Connect (OSTI)

    Not Available


    The Clean Energy Solutions Center Ask an Expert service connects governments seeking policy information and advice with one of more than 30 global policy experts who can provide reliable and unbiased quick-response advice and information. The service is available at no cost to government agency representatives from any country and the technical institutes assisting them. This publication presents summaries of assistance provided to governments in the Asia/Pacific region, including the benefits of that assistance.

  18. The Role of Asia in Mitigating Climate Change: Results from the Asia Modeling Exercise

    SciTech Connect (OSTI)

    Calvin, Katherine V.; Clarke, Leon E.; Krey, Volker; Blanford, Geoffrey J.; Jiang, Kejun; Kainuma, M.; Kriegler, Elmar; Luderer, Gunnar; Shukla, Priyadarshi R.


    In 2010, Asia accounted for 60% of global population, 39% of Gross World Product, 44% of global energy consumption and nearly half of the world’s energy system CO2 emissions. Thus, Asia is an important region to consider in any discussion of climate change or climate change mitigation. This paper explores the role of Asia in mitigating climate change, by comparing the results of 23 energy-economy and integrated assessment models. We focus our analysis on seven key areas: base year data, future energy use and emissions absent climate policy, the effect of urban and rural development on future energy use and emissions, the role of technology in emissions mitigation, regional emissions mitigation, and national climate policies

  19. Energy and Security in Northeast Asia: Proposals for Nuclear Cooperation

    E-Print Network [OSTI]

    Kaneko, Kumao; Suzuki, Atsuyuki; Choi, Jor-Shan; Fei, Edward


    Henry S. Rowen, "Nuclear Energy and Nuclear Proliferation -Northeast Asian nuclear energy cooperation advanced byAsia). 2 Cooperation on nuclear energy would have a direct

  20. Spirits of Capitalism: Explaining Industrial Variation in South Asia

    E-Print Network [OSTI]

    Naseemullah, Adnan


    multinationals like Walmart and the Gap have establishedestates in South Asia to Walmart and JC Penney, but alsomultinational buyers (Walmart, JC Penney, Ralph Lauren, etc)

  1. Security Policies in East Asia: Four Essays

    E-Print Network [OSTI]

    Lee, Chae-Jin


    of South Korea Young C. Kim 66 List of Contributors 79 Cover Painting by Dong Shouping (1904 - ) iii Preface In the spring semester of 1981 the Center for East Asian Studies at the University of Kansas sponsored a "Colloquium on Asian Security... Perceptions of Asian Security Akira Iriye After a hiatus following the war in Vietnam, the question of Asian security seems once again to be agitating the governments of America and Asia. Does the increasing naval presence of the Soviet Union in the region...

  2. TEP Asia Ltd | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing CapacityVectren)Model forTechnologies95Symerton,E CTEP Asia Ltd Jump to:

  3. Pioneer Asia Wind Turbines | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LIST OFAMERICA'SHeavyAgency (IRENA)Options JumpOpenEIEnergyPerpetual EnergyAsia Wind

  4. GE Hydro Asia Co Ltd formerly Kvaerner Power Equipment Co Ltd...

    Open Energy Info (EERE)

    Hydro Asia Co Ltd formerly Kvaerner Power Equipment Co Ltd Kvaerner Hangfa Jump to: navigation, search Name: GE Hydro Asia Co Ltd (formerly Kvaerner Power Equipment Co., Ltd...

  5. Policy Paper 35: Energy and Security in Northeast Asia: Fueling Security

    E-Print Network [OSTI]

    Calder, Kent; Fesharaki, Fereidun; Shirk, Susan L.; Stankiewicz, Michael


    Deese (editors). Energy and Security. 3. Fereidun Fesharaki,Energy and Security in Northeast Asia: Fueling Security Anrising energy demand. Energy and Security in Northeast Asia

  6. The human causes of deforestation in southeast Asia

    SciTech Connect (OSTI)

    Kummer, D.M.; Turner, B.L. II )


    The recurrent pattern of deforestation in southeast Asia is that of large scale logging for exports followed by agricultural expansion. The apparent difference between global and regional or local causes of land use, such as in SE Asia, has become a central theme in the emerging global change agenda. This article illustrates the significance of regional variation for understanding one example of land cover change, tropical deforestation, focusing on the Philippines, and using mathematical modeling. The commonalities of this case with other in SE Asia are discussed. 43 refs., 2 figs., 5 tabs.

  7. International prospects for clean coal technologies (Focus on Asia)

    SciTech Connect (OSTI)

    Gallaspy, D.T. [Southern Energy, Inc., Atlanta, GA (United States)


    The purpose of this paper is to propose Asia as a focus market for commercialization of CCT`s; describe the principles for successful penetration of CCT`s in the international market; and summarize prospects for CCT`s in Asia and other international markets. The paper outlines the following: Southern Company`s clean coal commitment; acquisition of Consolidated Electric Power Asia (CEPA); the prospects for CCT`s internationally; requirements for CCT`s widespread commercialization; CEPA`s application of CCT`s; and gas turbine power plants as a perfect example of a commercialization driver.

  8. Public Health in East and Southeast Asia: Challenges and Opportunities in the Twenty-First Century

    E-Print Network [OSTI]

    Detels, Roger; Sullivan, Sheena G.; Tan, Chorh Chuan


    curriculum. Imbalance and Maldistribution Another criticalnations of Asia is maldistribution, such as imbalances in

  9. The air quality and health impacts of aviation in Asia

    E-Print Network [OSTI]

    Lee, In Hwan, S.M. Massachusetts Institute of Technology


    Aviation in Asia is growing more rapidly than other regions around the world. Adverse health impacts of aviation are linked to an increase in the concentration of particulate matter smaller than 2.5 [mu]m in diameter ...

  10. Energy Scenarios for East Asia: 2005-2025

    E-Print Network [OSTI]

    Paltsev, Sergey

    We describe several scenarios for economic development and energy use in East Asia based on the MIT Emissions Prediction and Policy Analysis (EPPA) model, a computable general equilibrium model of the world economy. Historic ...

  11. e-Commerce fulfillment models for luxury brands in Asia

    E-Print Network [OSTI]

    Thomson, Benjamin R


    Asia-Pacific countries have experienced a rapid rise in Internet usage in recent history. China, in particular, has seen 40% of its population (or 500M people) connect to the Internet in the past 10 years, and continues ...

  12. Secondary residential demand trends in contemporary Japan and North Asia

    E-Print Network [OSTI]

    Lam, Michael M


    This research paper attempts to address the opportunity and challenges for Vacation Residential Development in North Asia, with specific geographic focus on Japan first through an analysis of national and regional consumption, ...

  13. On-Road Emissions in Asia Measured by Remote Sensing.

    E-Print Network [OSTI]

    Denver, University of

    On-Road Emissions in Asia Measured by Remote Sensing. · Donald H. Stedman, Gary A. Bishop on-road advantage · Large on-road emissions cause poor air quality. · Remote sensing measures on

  14. U.S.-Asia Pacific Comprehensive Energy Partnership | Department...

    Broader source: (indexed) [DOE]

    underway in APEC and ASEAN to bring concrete, impactful progress in addressing energy poverty and energy access issues in the region" through the new U.S.-Asia Pacific...

  15. South Asia Water Resources Workshop: An effort to promote water quality data sharing in South Asia

    SciTech Connect (OSTI)



    To promote cooperation in South Asia on environmental research, an international working group comprised of participants from Bangladesh, India, Nepal, Pakistan, Sri Lanka, and the US convened at the Soaltee Hotel in Kathmandu, Nepal, September 12 to 14, 1999. The workshop was sponsored in part by the Cooperative Monitoring Center (CMC) at Sandia National Laboratories in Albuquerque, New Mexico, through funding provided by the Department of Energy (DOE) Office of Nonproliferation and National Security. The CMC promotes collaborations among scientists and researchers in regions throughout the world as a means of achieving common regional security objectives. In the long term, the workshop organizers and participants are interested in the significance of regional information sharing as a means to build confidence and reduce conflict. The intermediate interests of the group focus on activities that might eventually foster regional management of some aspects of water resources utilization. The immediate purpose of the workshop was to begin the implementation phase of a project to collect and share water quality information at a number of river and coastal estuary locations throughout the region. The workshop participants achieved four objectives: (1) gaining a better understanding of the partner organizations involved; (2) garnering the support of existing regional organizations promoting environmental cooperation in South Asia; (3) identifying sites within the region at which data is to be collected; and (4) instituting a data and information collection and sharing process.

  16. Microsoft Research Asia JapanTaiwan Academic Forum May 17, 2010 at National Taiwan University, Taipei, Taiwan

    E-Print Network [OSTI]

    Ouhyoung, Ming

    Microsoft Research Asia JapanTaiwan Academic Forum May 17, 2010 at National Taiwan University, Taipei, Taiwan · Objectives To strengthen regional academic exchange in Asia Pacific region, in partnership with National Taiwan University, Microsoft Research Asia

  17. Tall buildings in Asia : a critique on the high-rise building in Colombo, Shri Lanka

    E-Print Network [OSTI]

    Pieris, Anoma D. (Anoma Darshani)


    The recent generation of tall buildings in Asia have been appropriated from the West with little adaptation. With no understanding of the forces that have generated this building form, Asia embraces the high-rise as an ...

  18. Policy Paper 37: Energy and Security in Northeast Asia: Proposals for Nuclear Cooperation

    E-Print Network [OSTI]

    Kaneko, Kumao; Suzuki, Atsuyuki; Choi, Jor-Shan; Fei, Edward


    Policy Papers 35-37, Energy and Security in Northeast Asia,regional and global energy and security politics. In PolicyPolicy Paper 24, Energy and Security in Northeast Asia). 2

  19. Policy Paper 36: Energy and Security in Northeast Asia: Supply and Demand, Conflict and

    E-Print Network [OSTI]

    Fesharaki, Fereidun; Banaszak, Sarah; WU, Kang; Valencia, Mark J.; Dorian, James P.


    Energy and Security in Northeast Asia: Supply and Demand,Policy Papers 35- 37, Energy and Security in Northeast Asia,on Northeast Asian energy and security held in Seoul, Korea.

  20. Restoration of Cenozoic deformation in Asia and the size of Greater India

    E-Print Network [OSTI]

    Torsvik, Trond Helge

    Restoration of Cenozoic deformation in Asia and the size of Greater India Douwe J. J. van 2011. [1] A long standing problem in the geological evolution of the India Asia collision zone is how and where convergence between India and Asia was accommodated since collision. Proposed collision ages vary

  1. 2011 Asia Value Advisors. All rights reserved Launching Your Social Business

    E-Print Network [OSTI]

    create social value / impact ? ¨ How do I launch a social business ? #12;© 2011 Asia Value Advisors. All Impact Creation #12;© 2011 Asia Value Advisors. All rights reserved Social Issues (Systematic Approach me ? ¨ How do I create social value / impact ? ¨ How do I launch a social business ? #12;© 2011 Asia

  2. Tropical timber import export Africa Asia volume Congo India Nigeria Papua New Guinea & the Solomon Islands

    E-Print Network [OSTI]

    Tropical timber import export Africa Asia volume Congo India Nigeria Papua New Guinea & the Solomon/14/2008 12:55:54 PM] #12;Tropical timber import export Africa Asia volume Congo India Nigeria Volume ('000 m3 import export Africa Asia volume Congo India Nigeria Papua New Guinea Reports (commissioned

  3. Copyright 2000 FT Asia Intelligence Wire All rights reserved

    E-Print Network [OSTI]

    Copyright 2000 FT Asia Intelligence Wire All rights reserved Copyright 2000 The Hindu THE HINDU May 10, 2000 LENGTH: 1384 words HEADLINE: The Hindu-Editorial: Development and goal-setting - I BYLINE: NIRUPAM BAJPAI & JEFFREY D. SACHS BODY: WHILE PRESENTING the Union Budget for 2000-01, the Finance

  4. The Importance of Asia Economic and Geopolitical Considerations

    E-Print Network [OSTI]

    Riley, Shawn J.

    million · #1 China: 1,368 million · #2 India: 1,268 million · #4 Indonesia: 255 million · #6 Pakistan: 189: 7.5% · China: 7.3% · Egypt: 6.8% · Malaysia: 5.8% · Pakistan: 5.4% · Indonesia 5.0% · Source Sea #12;Territorial Disputes: South Asia · China-India dispute · Large areas under dispute · Pakistan

  5. The Asia Pacific LNG trade: Status and technology development

    SciTech Connect (OSTI)

    Hovdestad, W.R.


    The Asia Pacific Region is experiencing a period of sustained economic expansion. Economic growth has led to an increasing demand for energy that has spurred a rapid expansion of baseload liquefied natural gas (LNG) facilities in this region. This is illustrated by the fact that seven of the ten baseload facilities in existence provide LNG for markets in the Asia Pacific region. With the three exceptions having been initially commissioned in 1972 and earlier, it is fair to observed that most advances in LNG technology have been developed and applied for this market. The paper presents the current status and identified future trends for the Asia Pacific LNG trade. Technology development in terms of application to onstream production, processing and transportation facilities, including LNG tankers, is presented. The potential of future advances to applied technology and operational practices to improve the cost-effectiveness of new and existing facilities is discussed. Current design data and methods as actually used are examined in terms of identifying where fundamental research and basic physical data are insufficient for optimization purposes. These findings are then summarized and presented in terms of the likely evolution of future and existing LNG projects in the Asia Pacific region.

  6. Proceedings of the 26th Pacific Asia Conference on

    E-Print Network [OSTI]

    Proceedings of the 26th Pacific Asia Conference on Language, Information and Computation (PACLIC 26 Conference on Language, Information and Computation (PACLIC 26), we would like to extend our warm welcome gratitude to our invited speakers. This international conference is organized by the Faculty of Computer

  7. Global Biofuel Production and Food Security: Implications for Asia Pacific

    E-Print Network [OSTI]

    Global Biofuel Production and Food Security: Implications for Asia Pacific 56th AARES Annual Conference Fremantle, Western Australia 7-10 February 2012 William T. Coyle #12;Global Biofuel Production and Food Security: Making the Connection --Past analysis and the evidence about biofuels and spiking

  8. Design Editorial A Quick View From Pacific Asia

    E-Print Network [OSTI]

    Papalambros, Panos

    particularly from China and India is testimony to the increased activity of researchers from Asia abandoned in Europe. While the energy, enthusiasm and fresh thinking of young researchers as you would find areas where Japan is considered an innovator. Now there seems to be a renewed awareness that uni

  9. Europe and western Asia: genetics and population history

    E-Print Network [OSTI]

    18 Europe and western Asia: genetics and population history Mark G. Thomas, Toomas Kivisild, Lounes Chikhi, and Joachim Burger This chapter examines the genetic history of Europe during the past 20 have been used extensively to address three major questions on the demographic history of Europe: (1

  10. Energy and Security in Northeast Asia: Supply and Demand, Conflict and

    E-Print Network [OSTI]

    Fesharaki, Fereidun; Banaszak, Sarah; WU, Kang; Valencia, Mark J.; Dorian, James P.


    in Northeast Asia Energy security is a vague and changingand military dimensions of energy security is provided byan important element of energy security. Lack of importing,

  11. Policy Paper 37: Energy and Security in Northeast Asia: Proposals for Nuclear Cooperation

    E-Print Network [OSTI]

    Kaneko, Kumao; Suzuki, Atsuyuki; Choi, Jor-Shan; Fei, Edward


    The bilateral nuclear and security agreement between theThe bilateral nuclear and security agreement between thein East Asia's security, nuclear energy, and environment. It

  12. Ice, Snow and Water: impacts of climate change on California and Himalayan Asia

    E-Print Network [OSTI]

    Fenner, R. A.


    in Asia. Progress Climate science and technology has enabledClimate Change Think Globally, Assess Regionally, Act Locally”, Issues in Science and Technology

  13. South Asia transboundary water quality monitoring workshop summary report.

    SciTech Connect (OSTI)

    Betsill, Jeffrey David; Littlefield, Adriane C.; Luetters, Frederick O.; Rajen, Gaurav


    The Cooperative Monitoring Center (CMC) promotes collaborations among scientists and researchers in several regions as a means of achieving common regional security objectives. To promote cooperation in South Asia on environmental research, an international working group made up of participants from Bangladesh, India, Nepal, Pakistan, and the United States convened in Kathmandu, Nepal, from February 17-23,2002. The workshop was held to further develop the South Asia Transboundary Water Quality Monitoring (SATWQM) project. The project is sponsored in part by the CMC located at Sandia National Laboratories in Albuquerque, New Mexico through funding provided by the US. Department of State, Regional Environmental Affairs Office, American Embassy, Kathmandu, Nepal, and the National Nuclear Security Administration's (NNSA) Office of Nonproliferation and National Security. This report summarizes the SATWQM project, the workshop objectives, process and results. The long-term interests of the participants are to develop systems for sharing regional environmental information as a means of building confidence and improving relations among South Asian countries. The more immediate interests of the group are focused on activities that foster regional sharing of water quality data in the Ganges and Indus River basins. Issues of concern to the SATWQM network participants include studying the impacts from untreated sewage and industrial effluents, agricultural run-off, salinity increases in fresh waters, the siltation and shifting of river channels, and the environmental degradation of critical habitats such as wetlands, protected forests, and endangered aquatic species conservation areas. The workshop focused on five objectives: (1) a deepened understanding of the partner organizations involved; (2) garnering the support of additional regional and national government and non-government organizations in South Asia involved in river water quality monitoring; (3) identification of sites within the region at which water quality data are to be collected; (4) instituting a data and information collection and sharing process; and, (5) training of partners in the use of water quality monitoring equipment.

  14. Asia-Pacific focus of coming LNG trade boom

    SciTech Connect (OSTI)

    Not Available


    This paper reports that the Asia-Pacific region remains the centerpiece of a booming world trade in liquefied natural gas. Biggest growth in LNG demand is expected from some of the region's strongest economies such as Japan, South Korea, and Taiwan, Key LNG exporters such as Brunei, Malaysia, and Indonesia are scrambling to implement projects to meet that expected demand growth. Uncertainties cloud the outlook for Far East LNG trade, Australia, for one, is more cautious in pressing expansion of its LNG export capacity as more competing LNG expansions spring up around the world, notably in the Middle East and Africa.

  15. New Zealand Asia-Pacific energy series country report

    SciTech Connect (OSTI)

    Yamaguchi, N.D.; Keevill, H.D.


    This report on New Zealand is one of a series of country studies intended to provide a continuous, long-term source of energy sector analysis for the Asia-Pacific region. This report addresses significant changes occurring due to the reform, deregulation, and privatization of the economy in general and the energy sector in particular; provides the reader with an overview of the economic and political situation; petroleum and gas issues are highlighted, particularly the implications of foreign trade in oil and gas; provides the latest available statistics and insights to energy policy that are not generally available elsewhere.

  16. Asia/Pacific refineries spark growth in conversion capacity

    SciTech Connect (OSTI)

    Rhodes, A.K.


    Led by refiners in the Asia/Pacific region, worldwide capacity for conversion processes, such as fluid catalytic cracking, hydrocracking, and coking, increased at a faster pace this year than did crude oil distillation capacity. Crude capacity showed only a small gain of 0.4% to 74.5 million b/d according to the Journal`s most recent survey of refining capacity. This article summarizes data from the survey on the largest refiners, capacities, conversion processes, fuel processes, processing comparison, and refinery size.

  17. LEDSGP/about/Asia LEDS Partnership | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas: EnergyKulpsville, Pennsylvania:LEDSGP/about < LEDSGP(RedirectedAsia LEDS

  18. PetroAsia Energy Ltd | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland:NPIProtectio ProgramInformationMissouri:PartnershipPetroAsia Energy Ltd Jump

  19. Renewable Energy Asia Group Ltd REA | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LIST OFAMERICA'SHeavyAgency (IRENA)OptionsEquivalent URIGum Pvt LtdReivaxLtd JumpAsia

  20. Sustainable Development Strategy for Central Asia | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop Inc JumpHeter BatterySolarfinMarketMember CorpSunvie SASandBuildingCentral Asia

  1. AAB Asia Alliance Base International | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EAand Dalton JumpProgram |RecentSulfonate as aEnergy1 Jump to:1AAB Asia

  2. Southern Asia future plans feature long-distance lines

    SciTech Connect (OSTI)

    Not Available


    This paper reports that although pipe line mileage working, planned and under study has dipped slightly from 47,346 km (29,420 mi) to 44,853 km (27,871 mi), Southern Asia continues to hold a strong position for future projects with some of the most interesting programs in the international market. Two dramatic, long-distance natural gas transmission, gathering and lateral networks continue to hold the future pipe line construction spotlight in Southern Asia. The Association of South East Asian Nations (ASEAN) continues to study a 7,830 km (4,865 mi) gas transmission system. With an estimated cost of $10 billion, the system includes some 6,276 km (3,900 mi) of transmission lines, with 1,094 km (680 mi) offshore. Group members include Brunei, Indonesia, Malaysia, the Philippines, Singapore and Thailand. The second project, the Trans-Asian Pipeline System, involves 3,380 km (2,100 mi) of transmission lines from the Iran's Bandar Abbas gas field across Pakistan to a terminal at Calcutta, India.

  3. Impacts of global warming on climate change over East Asia as simulated by 15 GCMs

    SciTech Connect (OSTI)

    Zong-ci Zhao; Xiaodong Li


    About 15 GCMs (GFDL1, GISS, LLNL, MPI, OSU, UKMOL, UKMOH, GCMs90-92, GFDL2, NCAR, OPYC, LSG, HADL, GCMs95) obtained from the IPCC WG 1 1990, 1992 and 1995 reports have been chosen to examine the impacts of global warming, on the climate chance over East Asia. Although the models scenarios of the human activities were different for the different GCMs, the climate change over East Asia (70E-140E, 15N-60N) for tile doubled CO{sub 2} as simulated by about 15 GCMs have been analysed. The Simulations shown that the temperature might increased by about 0.5 - 1.5 C over East Asia, especially in winter and northwestern parts of East Asia. The precipitation might increase in northwestern and northeastern parts of East Asia and decrease in the central part of East Asia. The evaluations and assessments of the GCMs over East Asia have indicated that the GCMs have the abilities to simulate the climate change over East Asia, especially for the temperature and the winter season. There are some uncertainties for the simulations to compare with the observations, especially for tile precipitation and tile summer season.

  4. The Indian Ocean Experiment: Widespread Air Pollution from South and Southeast Asia

    E-Print Network [OSTI]

    Dickerson, Russell R.

    1 The Indian Ocean Experiment: Widespread Air Pollution from South and Southeast Asia J. Lelieveld1-range transport of air pollution from South and Southeast Asia towards the Indian Ocean during the dry monsoon season in January-March 1999. Surprisingly high pollution levels were observed over the entire northern

  5. Inverting for emissions of carbon monoxide from Asia using aircraft observations over the western Pacific

    E-Print Network [OSTI]

    Palmer, Paul

    Inverting for emissions of carbon monoxide from Asia using aircraft observations over the western 2001), in combination with an optimal estimation inverse model, to improve emission estimates of carbon monoxide (CO) from Asia. A priori emissions and their errors are from a customized bottom-up Asian emission

  6. Greater India Basin hypothesis and a two-stage Cenozoic collision between India and Asia

    E-Print Network [OSTI]

    Torsvik, Trond Helge

    Greater India Basin hypothesis and a two-stage Cenozoic collision between India and Asia Douwe J. J and where India­Asia convergence was accommodated after collision at or be- fore 52 Ma remains a long and 25 Ma. Paleomagnetic data show that this extended continental and oceanic "Greater India" promontory

  7. Africa n visitatori Asia n visitatori America Latina n visitatori Marocco 81 India 367 Argentina 142

    E-Print Network [OSTI]

    Africa n° visitatori Asia n° visitatori America Latina n° visitatori Marocco 81 India 367 Venezuela 64 Ruanda 50 Armenia 94 Colombia 49 Senegal 50 Turchia 37 Cuba 46 22 PMA in Africa Algeria America Latina 196 Africa 194 Europa dell'Est 121 5 PMA in Asia più altre 32 nazioni 1

  8. APRU FELLOWS PROGRAM 2012 in partnership with NUS Asia Research Institute

    E-Print Network [OSTI]

    Wu, Yih-Min

    -cities rise around the Pacific Rim, natural hazards from earthquakes and tsunamis, pollution, cross, Singapore The Value of Water: Water, Values and Society in the Asia Pacific Region How do we value water and management around the Asia Pacific region? Oceans cover 70 per cent of the globe. The Pacific Ocean makes up

  9. Supermarket revolution in Asia and emerging development strategies to include small farmers

    E-Print Network [OSTI]

    Wang, Changlu

    , initially, procurement by modern retail was only from the spot wholesale markets, and few standards were on Markets in Asia, Michigan State University, East Lansing, MI 48824; c Harvard University, Cambridge, MA been significant and unique. Second, Asia's super- market revolution has exhibited unique pathways

  10. Regional summer precipitation events in Asia and their changes in the past decades

    E-Print Network [OSTI]

    Qian, Weihong

    Regional summer precipitation events in Asia and their changes in the past decades Cai Yao,1 Song; accepted 11 June 2008; published 4 September 2008. [1] A recently derived data set of daily precipitation is used to study the summer precipitation events over Asia and their changes in the decades of 1978

  11. Making the Best Use of What you Have Asia Intellectual Capital Alliances a te ectua Cap ta a ce

    E-Print Network [OSTI]

    BYOBBYOB ­ Making the Best Use of What you Have Asia Intellectual Capital Alliances a te ectua Cap ta a ce 24 October 2011 Copyright © 2011 Asia Intellectual Capital Alliance. All rights reserved. #12

  12. Lidar Measurements of the Vertical Distribution of Aerosol Optical and Physical Properties over Central Asia

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Chen, Boris B.; Sverdlik, Leonid G.; Imashev, Sanjar A.; Solomon, Paul A.; Lantz, Jeffrey; Schauer, James J.; Shafer, Martin M.; Artamonova, Maria S.; Carmichael, Gregory R.


    The vertical structure of aerosol optical and physical properties was measured by Lidar in Eastern Kyrgyzstan, Central Asia, from June 2008 to May 2009. Lidar measurements were supplemented with surface-based measurements of PM 2.5 and PM 10 mass and chemical composition in both size fractions. Dust transported into the region is common, being detected 33% of the time. The maximum frequency occurred in the spring of 2009. Dust transported to Central Asia comes from regional sources, for example, Taklimakan desert and Aral Sea basin, and from long-range transport, for example, deserts of Arabia, Northeast Africa, Iran, and Pakistan. Regionalmore »sources are characterized by pollution transport with maximum values of coarse particles within the planetary boundary layer, aerosol optical thickness, extinction coefficient, integral coefficient of aerosol backscatter, and minimum values of the Ångström exponent. Pollution associated with air masses transported over long distances has different characteristics during autumn, winter, and spring. During winter, dust emissions were low resulting in high values of the Ångström exponent (about 0.51) and the fine particle mass fraction (64%). Dust storms were more frequent during spring with an increase in coarse dust particles in comparison to winter. The aerosol vertical profiles can be used to lower uncertainty in estimating radiative forcing. « less

  13. Cooperative measures to mitigate Asia-Pacific maritime conflicts.

    SciTech Connect (OSTI)

    Chai, Wen-Chung


    The economies of East Asia are predominantly export based and, therefore, place special emphasis on the security of the sea lines of communication (SLOCs). Due to economic globalization, the United States shares these concerns. Cooperative measures by the concerned parties could reduce the potential for disruption by maritime conflicts. Primary threats against the SLOCs are disputes over the resources under the seas, disputes over some small island groups, disputes between particular parties (China-Taiwan and North-South Korea), or illegal activities like smuggling, piracy, or terrorism. This paper provides an overview on these threats, issue by issue, to identify common elements and needed cooperation. Cooperation on other topics such as search and rescue, fisheries protection, and oil spill response may help support improved relations to prevent maritime conflicts. Many technologies can help support maritime cooperation, including improved communications links, tracking and emergency beacon devices, and satellite imaging. Appropriate technical and political means are suggested for each threat to the SLOCs.

  14. Asia, North America lead way in growth of NGL, LPG trade

    SciTech Connect (OSTI)

    Otto, K.; Gist, R.; Whitley, C.; Haun, R.


    Recent analyses of world NGL trade indicate that important changes in LPG supply and demand are under way in Asia and North America. LPG markets in the 1990s reflect a rapidly shifting balance between East-of-Suez and West-of-Suez markets. This shift has increased concern about availability of future LPG supplies for Asia. The paper discusses world developments, East versus West of Suez, end uses and supplies in Asia, Canadian ethane, propane, butane, and natural gasoline, Mexican ethane, LPG, and natural gasoline, US ethane, propane, butanes, and iso-C{sub 4} and C{sub 5}.

  15. Towards SEA for the developing nations of Asia

    SciTech Connect (OSTI)

    Briffett, Clive; Obbard, Jeffrey Philip; Mackee, Jamie


    In the developing and transitional countries of Asia, environmental impact assessment (EIA) has been widely practiced as a planning tool that identifies the potential impacts associated with developments and determines their level of significance and the need for mitigating measures. Not withstanding its extensive use in many Asian countries, certain limitations are now being increasingly recognised with regard to achieving sustainable development within the planning process. It is also noted that the natural environment in Asia has continued to be severely degraded despite the adoption of EIA. This research project was undertaken at the National University of Singapore to review the status on the implementation of EIA procedures and to investigate the status and potential of strategic environmental assessment (SEA) in Asia. The research project generally investigated the existing physical attributes of six countries including Hong Kong and Singapore, Malaysia and the Philippines, Sri Lanka and Vietnam and discussed their prevailing environmental conditions. It more specifically reviewed policymaking and environmental planning, environmental legislation and the practice and procedures of environmental impact assessment. It also evaluated environmental assessment education and training activities. In some cases such as Hong Kong, an opportunity to analyse actual SEA practice was included. In other cases, the potential for possible take up of formal SEA was assessed. A comparative review assesses the degree to which EIA and SEA procedures have been utilized, considers how the use of SEA could overcome the deficiencies of the EIA project-based system and includes aspects of meeting sustainability criteria. Results show that the use and application of EIA is relatively strong across all countries with the possible exception of Singapore which relies more heavily on its planning and control system to address potential environmental impacts arising from development projects. Despite this, EIAs have been undertaken in every country due to aid and bank lending agencies requiring them and multinational companies and many local NGOs completing voluntary EIAs. Even though the mandatory introduction of EIA into some countries is fairly recent such as Hong Kong (1999) and Vietnam (1994), efforts to conduct such investigations may have started many years before. The country reviews highlight many common problems and adverse influences that give rise to inadequate EIA practice, and in some cases, recommendations for improvement are proposed. The potential for SEA is assessed on the basis of its present usage which is generally small except for Hong Kong and the environmental strategic decision-making that is being conducted in policy, plan and programme formulations. While the more comprehensive and well-refined westernized model of SEA is generally weakly implemented at present, there is evidence to suggest that Agenda 21, along with other international treaties such as the Biodiversity Charter and the Ramsar Convention, has motivated certain sustainability initiatives that are resulting in increased environmental considerations at a strategic level. In some cases, these may be reflected in National Plan policymaking or in the sector and area-based activities of various ministries and departments. It is concluded that SEA potential is generally strong in those countries with smaller centralized bureaucracies but that its successful implementation will be highly dependent on changing the mind-sets and motivations of top personnel at ministerial level.

  16. Developing an Asia-Pacific manufacturing footprint strategy in the medical device industry

    E-Print Network [OSTI]

    Dev, Nishanth K. (Nishanth Krishna)


    As medical device manufacturers operating in the Asia-Pacific region are planning for increased demand in the near future, they must evaluate their manufacturing footprint strategies to determine if they are getting the ...

  17. Policy Paper 36: Energy and Security in Northeast Asia: Supply and Demand, Conflict and

    E-Print Network [OSTI]

    Fesharaki, Fereidun; Banaszak, Sarah; WU, Kang; Valencia, Mark J.; Dorian, James P.


    Regional Strategies." Energy Policy. Vol.23, No.2, pp.167-Asia and the Pacific. Energy Policy Im- plications of thethe central objectives of energy policy, such as energy sav-

  18. Proceedings ofAsia-Pacific Microwave Conference 2007 Conformal Antennas on Liquid Crystalline Polymer

    E-Print Network [OSTI]

    Swaminathan, Madhavan

    Proceedings ofAsia-Pacific Microwave Conference 2007 Conformal Antennas on Liquid Crystalline Abstract- Recent developments in Liquid Crystalline Polymer (LCP) based processing technology showed, and low substrate isolation due to semi-conducting attributes. Recent developments in Liquid Crystalline

  19. Sustainable shelters for post disaster reconstruction : an integrated approach for reconstruction after the South Asia earthquake

    E-Print Network [OSTI]

    Ali, Zehra (Zehra Hyder)


    A year after the South Asia earthquake, over 60% of the survivors are still vulnerable due to the lack of adequate shelter, the absence of basic facilities for water and sanitation and livelihood restoration. The harsh ...

  20. The humanitarian relief supply chain : analysis of the 2004 South East Asia earthquake and Tsunami

    E-Print Network [OSTI]

    Russell, Timothy Edward


    Humanitarian relief supply chains are not well documented. This thesis describes humanitarian relief supply chains in general and those specifically utilized in the 2004 South East Asia Earthquake and Tsunami relief effort. ...

  1. Architecture in miniature : representation of space and form in illustrations and buildings in Timurid Central Asia

    E-Print Network [OSTI]

    Yazar, Hatice


    This study attempts to explore a number of questions about the use of an architectural language in Timurid and Safavid miniature paintings of 15th and 16th century Central Asia. Of these the most important are the following: ...

  2. Water balance investigations of groundwater depletion in Asia : information needs and uncertainty analysis

    E-Print Network [OSTI]

    Kiang, Julie E. (Julie Ega), 1971-


    Irrigated agriculture is an essential component of global food production. In many regions of the world, and Asia in particular, groundwater is a major source of irrigation water. Over-pumping of groundwater aquifers has ...

  3. Final Report of Summer Research 2007 Vietnam and Southeast Asia, June 6 – August 21

    E-Print Network [OSTI]

    Morris-Jung, Jason


    of Summer Research 2007 Vietnam and Southeast Asia, June 6 –in the upland areas of Vietnam. Then I travelled to Banff,Jung Page 2 En route to Vietnam, I also made a visit to the

  4. Sustainable development and comprehensive capital : The post-Soviet decline of Central Asia

    E-Print Network [OSTI]

    Sievers, Eric


    The general post-Soviet decline of the states of Central Asia (Kazakhstan, Kyrgyzstan, Tajikistan, Turkmenistan, and Uzbekistan) mirrors specific declines in the robustness of these states' stocks of financial, physical, ...

  5. Contribution of vegetation and peat fires to particulate air pollution in Southeast Asia

    E-Print Network [OSTI]

    Reddington, C L

    Smoke haze, caused by vegetation and peat fires in Southeast Asia, is of major concern because of its adverse impact on regional air quality. We apply two different methods (a chemical transport model and a Lagrangian ...

  6. Pakistan: Asia-Pacific energy series, country report

    SciTech Connect (OSTI)

    Gazdar, M.N.


    As part of our continuing assessment of Asia-Pacific energy markets, the Energy Program has embarked on a series of country studies that discuss in detail the structure of the energy sector in each major country in the region. The country studies also provide the reader with an overview of the economic and political situation in the various countries. We have particularly highlighted petroleum and gas issues in the country studies and have attempted to show the foreign trade implications of oil and gas trade. Finally, to the greatest extent possible, we have provided the latest available statistics -- often from unpublished and disparate sources that are unavailable to most readers. Staff members have traveled extensively in -- and at times have lived in -- the countries under review and have held discussions with senior policymakers in government and industry. Thus, these reports provide not only information but also the latest thinking on energy issues in the various countries. This report summarizes the energy and economic situation in Pakistan.

  7. Aussie LNG players target NE Asia in expansion bid

    SciTech Connect (OSTI)

    Not Available


    Australia's natural gas players, keen to increase their presence in world liquefied natural gas trade, see Asia as their major LNG market in the decades to come. That's despite the fact that two spot cargoes of Australian Northwest Shelf LNG were shipped to Europe during the last 12 months and more are likely in 1994. Opportunities for growth are foreseen within the confines of the existing Northwest Shelf gas project for the rest of the 1990s. But the main focus for potential new grassroots project developers and expansions of the existing LNG plant in Australia is the expected shortfall in contract volumes of LNG to Japan, South Korea, and Taiwan during 2000--2010. Traditionally the price of crude oil has been used as a basis for calculating LNG prices. This means the economics of any new 21st century supply arrangements are delicately poised because of the current low world oil prices, a trend the market believes is likely to continue. In a bid to lessen the effect of high initial capital outlays and still meet projected demand using LNG from new projects and expansion of the existing plant, Australia's gas producers are working toward greater cooperation with prospective Asian buyers.

  8. Indonesia: Asia-Pacific energy series, country report

    SciTech Connect (OSTI)

    Prawiraatmadja, W.; Yamaguchi, N.; Breazeale, K.; Basari, S.R.


    As part of our continuing assessment of Asia-Pacific energy markets, the Energy Program has embarked on a series of country studies that discuss in detail the structure of the energy sector in each major country in the region. To date, our reports to the US Department of Energy have covered Australia, China, Indonesia, Japan, Malaysia, the Philippines, Singapore, South Korea, Taiwan, and Thailand. The country studies also provide the reader with an overview of the economic and political situation in the various countries. We have particularly highlighted petroleum and gas issues in the country studies and have attempted to show the foreign trade implications of oil and gas trade. Finally, to the greatest extent possible, we have provided the latest available statistics -- often from unpublished and disparate sources that are unavailable to most readers. Staff members have traveled extensively in -- and at times have lived in -- the countries under review and have held discussions with senior policymakers in government and industry. Thus, these reports provide not only information but also the latest thinking on energy issues in the various countries. This report covers Indonesia. 37 refs., 36 figs., 64 tabs.

  9. Asia Times -Search Asia

    E-Print Network [OSTI]

    -tourism, now that its core business, hacking down what's left of the Java forests, has been taken away. But Jakarta is busy passing the buck by putting pressure on importing countries Sep 19, 2003 Letting Indonesia to the government for something by way of incentive to refocus to non- logging business activities, including eco

  10. Asia Times -Search Asia

    E-Print Network [OSTI]

    's forests 'breathe' (Jan 23, '03) Will the World Bank go green? (Jan 21, '03) Indonesia: More local power called the Earth's green lung plummeted from 162 million hectares in 1950 to only 98 million in 2000

  11. New Zealand: Asia-Pacific energy series, country report

    SciTech Connect (OSTI)

    Yamaguchi, N.D.; Keevill, H.D.


    The New Zealand energy sector has undergone significant changes in the past few years. Reform and deregulation came to New Zealand in large doses and at a rapid pace. Unlike Japan where deregulation was designed for a five-year phase-in period or even Australia where the government was fully geared up to handle deregulation, deregulation occurred in New Zealand almost with no phase-in period and very little planning. Under fast-paced Rogernomics,'' the energy sector was but one more element of the economy to be deregulated and/or privatized. While the New Zealand energy sector deregulation is generally believed to have been successful, there are still outstanding questions as to whether the original intent has been fully achieved. The fact that a competent energy bureaucracy was mostly lost in the process makes it even more difficult to find those with long enough institutional memories to untangle the agreements and understandings between the government and the private sector over the previous decade. As part of our continuing assessment of Asia-Pacific energy markets, the Resources Programs at the East-West Center has embarked on a series of country studies that discuss in detail the structure of the energy sector in each major country in the region. To date, our reports to the US Department of Energy, Assistant Secretary for International Affairs and Energy Emergencies, have covered Australia, China, India, Indonesia, Japan, Malaysia, New Zealand, Pakistan, the Philippines, Singapore, South Korea, Taiwan, and Thailand. The country studies also provide the reader with an overview of the economic and political situation in the various counties. We have particularly highlighted petroleum and gas issues in the country studies and have attempted to show the foreign trade implications of oil and gas trade. Finally, to the greatest extent possible, we have provided the latest available statistics.

  12. A Review of "Artistic and Cultural Exchanges Between Europe and Asia 1400-1900" by Michael North 

    E-Print Network [OSTI]

    Rao, Nagendra


    times, but it is only in the Middle Ages that European intel- lectuals and travelers noted, with considerable interest, the Asian art and culture, which resulted in close interaction between two cultures. Traditionally, European scholars had hegemonic... attitude towards Asia, wherein Asia was considered as less civilized when compared with European civilization, but recent studies have highlighted need for a different approach towards Asia. Consequently, the European discourse uses the concept...

  13. Globalized humanitarianism : U.S. imperial formation in Asia and the Pacific through the Indochinese refugee problem

    E-Print Network [OSTI]

    Sahara, Ayako


    Committee on Judiciary, Refugees from Indochina: HearingsCommittee on Judiciary, Refugee Problems in Southeast Asia,Committee on Judiciary, Refugee Crisis in Cambodia: Hearing

  14. Light rain events change over North America, Europe and Asia for 1973-2009

    SciTech Connect (OSTI)

    Qian, Yun; Gong, Daoyi; Leung, Lai-Yung R.


    Long-term daily precipitation data from NCDC are used to investigate the changes of light rain events from 1973-2009 over North America, Europe and Asia. Results reveal that the trend of light rain events presents a remarkably diverse feature in different regions, while an overall decrease trend can be found over the continents in northern hemisphere. In North America, most of stations show a decrease trend for light rain on the annual basis but a decrease trend can also be found for moderate and heavy rain. The opposite trends are observed over the stations in Europe and the trend of light rain is not significant when averaged for all the stations. In Asia, especially East Asia, the light rain days show an overwhelming decrease trend with high spatial coherency. Meanwhile the moderate and heavy rain events (> 10 mm/day) have increased, suggesting a remarkable shift of precipitation from light to heavy rain in East Asia. While both the warming at a global scale and increased atmospheric aerosols due to air pollution at a regional scale (e.g. East Asia) may have affected the light rain changes, it remains a challenging task to quantitatively detect and separate the cause of light rain changes in different regions. ?

  15. Third Asia-Pacific Conference on FRP in Structures (APFIS2012) The Third Asia-Pacific Conference on FRP in Structures (APFIS2012) was held from 2 to 4

    E-Print Network [OSTI]

    Third Asia-Pacific Conference on FRP in Structures (APFIS2012) The Third Asia-Pacific Conference on FRP in Structures (APFIS2012) was held from 2 to 4 February 2012 at the Hokkaido University Conference Hall, Sapporo, Japan. APFIS is one of the official conferences of the International Institute for FRP

  16. "SE Asia was rifted parts of the Early Paleozoic NW Australia Gondwana", GEOSEA'98 (Ninth Regional Congress on Geology, Mineral and Energy Resources of Sotheast Asia, Kuala Lumpur, Malaysia (with Bunopas,

    E-Print Network [OSTI]

    Banbara, Mutsunori

    Congress on Geology, Mineral and Energy Resources of Sotheast Asia, Kuala Lumpur, Malaysia (with Bunopas, S Thailand and East Asia" GEOSEA '98 (Ninth Regional Congress on Geology, Mineral and Energy Resources Otago, New Zealand: equivocal evidence for terrane association" Geological Society of New Zealand & New

  17. Regional Modeling of Dust Mass Balance and Radiative Forcing over East Asia using WRF-Chem

    SciTech Connect (OSTI)

    Chen, Siyu; Zhao, Chun; Qian, Yun; Leung, Lai-Yung R.; Huang, J.; Huang, Zhongwei; Bi, Jianrong; Zhang, Wu; Shi, Jinsen; Yang, Lei; Li, Deshuai; Li, Jinxin


    The Weather Research and Forecasting model with Chemistry (WRF-Chem) is used to investigate the seasonal and annual variations of mineral dust over East Asia during 2007-2011, with a focus on the dust mass balance and radiative forcing. A variety of measurements from in-stu and satellite observations have been used to evaluate simulation results. Generally, WRF-Chem reproduces not only the column variability but also the vertical profile and size distribution of mineral dust over and near the dust source regions of East Asia. We investigate the dust lifecycle and the factors that control the seasonal and spatial variations of dust mass balance and radiative forcing over the seven sub-regions of East Asia, i.e. source regions, the Tibetan Plateau, Northern China, Southern China, the ocean outflow region, and Korea-Japan regions. Results show that, over the source regions, transport and dry deposition are the two dominant sinks. Transport contributes to ~30% of the dust sink over the source regions. Dust results in a surface cooling of up to -14 and -10 W m-2, atmospheric warming of up to 20 and 15 W m-2, and TOA cooling of -5 and -8 W m-2 over the two major dust source regions of East Asia, respectively. Over the Tibetan Plateau, transport is the dominant source with a peak in summer. Over identified outflow regions, maximum dust mass loading in spring is contributed by the transport. Dry and wet depositions are the comparably dominant sinks, but wet deposition is larger than dry deposition over the Korea-Japan region, particularly in spring (70% versus 30%). The WRF-Chem simulations can generally capture the measured features of dust aerosols and its radaitve properties and dust mass balance over East Asia, which provides confidence for use in further investigation of dust impact on climate over East Asia.

  18. ---Home Yahoo! Help My Yahoo!

    E-Print Network [OSTI]

    - - -Home Yahoo! Help My Yahoo! Wednesday. If Japan becomes home to the world's first thermonuclear reactor, it would be the first time for Asia. But in a fusion reactor, energy is harnessed by forcing the nuclei of light atoms together, the same process

  19. India-Asia collision and the Cenozoic slowdown of the Indian plate: Implications for the forces driving

    E-Print Network [OSTI]

    Avouac, Jean-Philippe

    India-Asia collision and the Cenozoic slowdown of the Indian plate: Implications for the forces; revised 12 August 2009; accepted 25 September 2009; published 17 March 2010. [1] The plate motion of India changed dramatically between 50 and 35 Ma, with the rate of convergence between India and Asia dropping

  20. ISES-AP -3rd International Solar Energy Society Conference Asia Pacific Region (ISES-AP-08) Incorporating the 46th ANZSES Conference

    E-Print Network [OSTI]

    ISES-AP - 3rd International Solar Energy Society Conference ­ Asia Pacific Region (ISES-AP-08-AP - 3rd International Solar Energy Society Conference ­ Asia Pacific Region (ISES-AP-08) Incorporating ISES-AP - 3rd International Solar Energy Society Conference ­ Asia Pacific Region (ISES-AP-08

  1. Hillslope glacier coupling: The interplay of topography and glacial dynamics in High Asia

    E-Print Network [OSTI]

    Bookhagen, Bodo

    of hillslopes and glacial dynamics increases with topographic steepness and debris cover. The melt loweringHillslope glacier coupling: The interplay of topography and glacial dynamics in High Asia Dirk 9 March 2011; published 14 June 2011. [1] High Asian glacial landscapes have large variations

  2. Sensitivity of population smoke exposure to fire locations in Equatorial Asia

    E-Print Network [OSTI]

    Jacob, Daniel J.

    :// 1. Introduction Global palm oil production has more than doubled since 2000 in response to soaring demand (FAO, 2013). Indonesia and Malaysia together account for 86% of the world's production online 19 September 2014 Keywords: Equatorial Asia Adjoint Palm oil Fire Conservation Population

  3. Water governance: Critique, Theory and Evidence from Asia 1 Eduardo Araral

    E-Print Network [OSTI]

    Chaudhuri, Sanjay

    Water governance: Critique, Theory and Evidence from Asia 1 Eduardo Araral Lee Kuan Yew School of Water Policy of the Lee Kuan Yew School of Public Policy #12;Abstract Most scholars agree that improving water governance is the key to addressing water insecurity in developing countries. However, in the last

  4. First Asia-Pacific Solar Physics Meeting ASI Conference Series, 2011, Vol. 2, pp 175180

    E-Print Network [OSTI]

    Usoskin, Ilya G.

    First Asia-Pacific Solar Physics Meeting ASI Conference Series, 2011, Vol. 2, pp 175­180 Edited by Arnab Rai Choudhuri & Dipankar Banerjee Long-term variation of solar surface differential rotation L. Zhang1,2 , K. Mursula2 , I. Usoskin3 , H. Wang1 and Z. Du1 1 Key Laboratory of Solar Activity, National

  5. EU:France, UK,etc. East Asia: Japan, China,etc.

    E-Print Network [OSTI]

    : The advanced T-lean fusion fuel reactor US HIF Science Virtual National Lab.(LBNL, LLNL,PPPL) has been Heating Heated plasma image SNL-Z project #12;Fast Ignition opens a new rout to compact IF Reactor 1983EU:France, UK,etc. East Asia: Japan, China,etc. US: LLNL, SNL, U. Rochester Inertial Fusion Power

  6. DOI: 10.1002/asia.200800427 Chemical Modification of Proteins at Cysteine: Opportunities in Chemistry

    E-Print Network [OSTI]

    Davis, Ben G.

    ;Abstract: Chemical modification of proteins is a rapidly expanding area in chemical biology. SelectiveDOI: 10.1002/asia.200800427 Chemical Modification of Proteins at Cysteine: Opportunities and macromolecular func- tion. In other cases such chemical alterations have changed the protein function entirely

  7. Mixtures of pollution, dust, sea salt, and volcanic aerosol during ACE-Asia: Radiative properties

    E-Print Network [OSTI]

    was dominated by marine, polluted, volcanic, and dust aerosols. Average total light scattering coefficients (sspMixtures of pollution, dust, sea salt, and volcanic aerosol during ACE-Asia: Radiative properties). Aerosol hygroscopicity ranged from deliquescent with hysteresis (marine frequently and polluted variably


    E-Print Network [OSTI]

    Hack, Robert

    INTERNATIONAL INSTITUTE FOR GEO-INFORMATION SCIENCE AND EARTH OBSERVATION Tsunami ramp Asia 26 december 2004 Het onstaan van tsunamis Robert Hack (met dank aan van Mark van der Meijde en Colin Reeves cause for tsunami #12;Worldwide plate boundaries Source: USGS #12;Tectonic Setting Source: USGS Breuk

  9. Groundwater Resources Use and Management in the Amu Darya River Basin (Central Asia)

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    1 Groundwater Resources Use and Management in the Amu Darya River Basin (Central Asia) Shavkat) 1183-1193" DOI : 10.1007/s12665-009-0107-4 #12;2 Abstract This paper analyses groundwater resources use nations for sustaining their vital agricultural productions started to use groundwater during the recent

  10. Modelling of long-range transport of Southeast Asia biomass-burning aerosols to Taiwan and their radiative forcings over East Asia

    SciTech Connect (OSTI)

    Lin, Chuan-Yao; Zhao, Chun; Liu, Xiaohong; Lin, Neng-Huei; Chen, Wei-Nei


    Biomass burning is a major source of aerosols and air pollutants during the springtime in Southeast Asia. At Lulin mountain background station (elevation 2862 m) in Taiwan, the concentrations of carbon monoxide (CO), ozone (O3) and particulate matter particles with diameter less than 10 ?m (PM10), were measured around 150-250 ppb, 40-60 ppb, and 10-30?g/m3, respectively at spring time (February-April) during 2006 and 2009, which are about 2~3 times higher than those in other seasons. Observations and simulation results indicate that the higher concentrations during the spring time are clearly related to biomass burning plumes transported from the Indochina Peninsula of Southeast Asia. The spatial distribution of high aerosols optical depth (AOD) were identified by the satellite measurement and Aerosol Robotic Network (AERONET) ground observation, and could be reasonably captured by the WRF-Chem model during the study period of 15-18 March, 2008. AOD reached as high as 0.8-1.0 in Indochina ranging from 10 to 22°N and 95 to 107°E. Organic carbon (OC) is a major contributor of AOD over Indochina according to simulation results. The contributor of AOD from black carbon (BC) is minor when compared with OC over the Indochina. However, the direct absorption radiative forcing of BC in the atmosphere could reach 35-50 W m-2, which is about 8-10 times higher than that of OC. The belt shape of radiation reduction at surface from Indochina to Taiwan could be as high 20-40 W m-2 during the study period. The implication of the radiative forcing from biomass burning aerosols and their impact on the regional climate in East Asia is our major concern.

  11. Landmarks of the Persian Renaissance : monumental funerary architecture in Iran and Central Asia in the tenth and eleventh centuries

    E-Print Network [OSTI]

    Michailidis, Melanie


    This dissertation investigates the sudden proliferation of mausolea in Iran and Central Asia in the tenth and eleventh centuries and how their patrons, who were secular rulers of Iranian descent, drew on the pre-Islamic ...

  12. Logistical and transportation infrastructure in Asia : potential for growth and development to support increasing trade with Europe

    E-Print Network [OSTI]

    Deonás, Nikolaos, 1978-


    This thesis examines the implications of the rapid growth in demand for trade between Europe and Asia for the existing transportation network and logistical infrastructure. In general terms, technologies need to improve ...

  13. Testing models of ultra-fast India-Asia convergence : new paleomagnetic results from Ladakh, Western Himalaya

    E-Print Network [OSTI]

    Bailey, Elizabeth A


    Rapid India-Asia convergence has led to a major continental collision and formation of the Himalayas, the highest mountain range on Earth. Knowledge of the paleolatitude of the Kohistan-Ladakh Arc (KLA), an intermediate ...

  14. Part IV: Other International Arrangement of Interest Asia Pacific Economic Cooperation (APEC) Oceans and Fisheries Working Group

    E-Print Network [OSTI]

    and economic cooperation among economies around the Pacific Rim. APEC members account for over 90% of globalPart IV: Other International Arrangement of Interest 166 Asia Pacific Economic Cooperation (APEC

  15. Timurid central Asia and Mughal India : some correlations regarding urban design concepts and the typology of the Muslim house

    E-Print Network [OSTI]

    Sobti, Manu P


    This thesis commences with the basic premise that Timurid Central Asia (which included the regions of Khorasan and Transoxania), with its monumental achievements in Urban Planning and Civic Architecture, beginning with the ...

  16. Effects of mineral aerosols on the summertime climate of southwest Asia: Incorporating subgrid variability in a dust emission scheme

    E-Print Network [OSTI]

    Marcella, Marc Pace

    [1] Improvements in modeling mineral aerosols over southwest Asia are made to the dust scheme in a regional climate model by representing subgrid variability of both wind speed and surface roughness length. The new module ...

  17. Asia/Pacific ethylene capacity to more than double by 2000

    SciTech Connect (OSTI)


    The tremendous growth of Asia`s petrochemical industry is expected to continue into the next century. This rapid expansion has redirected many Asian nations` energy resources to the petrochemical industry, according to an advisory report by Ronald E. Hagen of the East-West Center, Honolulu. Petrochemical producers throughout the region are planning to build a number of new, world-scale ethylene plants, and expand and upgrade existing facilities. Feedstocks used to produce ethylene include: ethane, LPG, naphtha, kerosene, gas oil, and ethanol. Traditionally, usage of ethanol and kerosene in the region has been small, and gas oil usage is centered mainly in China. Information is listed and discussed for ethylene capacity through 2000 on a country-by-country basis, along with the feedstocks used by each plant.

  18. WRF-Chem Simulations of Aerosols and Anthropogenic Aerosol Radiative Forcing in East Asia

    SciTech Connect (OSTI)

    Gao, Yi; Zhao, Chun; Liu, Xiaohong; Zhang, Meigen; Leung, Lai-Yung R.


    This study aims to provide a first comprehensive evaluation of WRF-Chem for modeling aerosols and anthropogenic aerosol radiative forcing (RF) over East Asia. Several numerical experiments were conducted from November 2007 to December 2008. Comparison between model results and observations shows that the model can generally reproduce the observed spatial distributions of aerosol concentration, aerosol optical depth (AOD) and single scattering albedo (SSA) from measurements at different sites, including the relatively higher aerosol concentration and AOD over East China and the relatively lower AOD over Southeast Asia, Korean, and Japan. The model also depicts the seasonal variation and transport of pollutions over East Asia. Particulate matter of 10 um or less in the aerodynamic diameter (PM10), black carbon (BC), sulfate (SO42-), nitrate (NO3-) and ammonium (NH4+) concentrations are higher in spring than other seasons in Japan due to the pollutant transport from polluted area of East Asia. AOD is high over Southwest and Central China in winter, spring and autumn and over North China in summer while is low over South China in summer due to monsoon precipitation. SSA is lowest in winter and highest in summer. The model also captures the dust events at the Zhangye site in the semi-arid region of China. Anthropogenic aerosol RF is estimated to range from -5 to -20 W m-2 over land and -20 to -40 W m-2 over ocean at the top of atmosphere (TOA), 5 to 30 W m-2 in the atmosphere (ATM) and -15 to -40 W m-2 at the bottom (BOT). The warming effect of anthropogenic aerosol in ATM results from BC aerosol while the negative aerosol RF at TOA is caused by scattering aerosols such as SO4 2-, NO3 - and NH4+. Positive BC RF at TOA compensates 40~50% of the TOA cooling associated with anthropogenic aerosol.

  19. Poison control centers in developing countries and Asia's need for toxicology education

    SciTech Connect (OSTI)

    Makalinao, Irma R. . E-mail:; Awang, Rahmat


    Poison control centers (PCCs) in developing countries have been set up in response to the challenge of decreasing mortality and morbidity from poisoning. The services range from poison information to actual clinical treatment mostly of acute cases. Lately, PCCs have expanded from their traditional role to one that actively engages in community health studies, toxicovigilance along with treatment of chronic poisoning. Recognizing that types of poisoning and specific needs may vary from country to country, toxicology education that addresses these unique regional issues has become more necessary. Toxicology education, both formal and informal, exists in various stages of development in Asia. Clearly, there are gaps that need to be addressed especially in areas where there are no poison centers or where strengthening is necessary. Collaboration between PCCs in developing countries can help augment available resources including human, analytical and technical expertise. The critical mass of trained toxicologists will fill in the demand for clinical and regulatory specialists and educators as well. This paper highlights the experiences and resources available to the Philippine and Malaysian poison centers and the strengths generated by networking and collaboration. The role of Asia Pacific Association of Medical Toxicology (APAMT) as the Science NGO representative to the Intergovernmental Forum on Chemical Safety (IFCS) forum standing committee in promoting chemical safety at the regional level will be discussed. The 'Clearinghouse on the Sound Management of Chemicals', a platform for engaging multi-stakeholder and interdisciplinary partnerships, will be described as a possible model for capacity building to advance chemical safety through education and training not only in developing countries in Asia but globally as well.

  20. Science and Technology in Support of U.S. Policy in Central Asia

    SciTech Connect (OSTI)

    Knapp, R B


    The current war with Iraq, international interventions in Afghanistan, and the continuous and seemingly insolvable problems in the Middle East emphasize the importance of supporting stable, healthy countries throughout the Middle East and South and Central Asia. The political alliances and foreign aid promulgated by the Cold War have been seriously strained, creating a more uncertain and unstable international environment. We must stay engaged with this part of the world. New partnerships must be forged. Central Asia represents a mix of political systems - from totalitarian rule to nascent democracy; of economic resources from natural to human; and of cultures from ancient to modern - making it of strategic importance to U. S. national and economic security. The U.S. must remain committed and proactively engaged in the region to promote open and democratic societies attractive to outside investment and to prevent the proliferation of weapons of mass destruction and extremist groups. The U.S is admired for its science and technology and its flexibility in innovation and applying S&T to solve problems. The inherent value that S&T can contribute to advancing U.S. policy goals is the underlying assumption of this report. Science and technology and their applications have much to contribute to social, economic, and environmental sustainability and, therefore, provide a strong foundation for helping the U.S. to implement its policies abroad. The application of concepts such as competition and peer review, open sharing of scientific information through the use of the internet and other information technologies, and the development of international scientific collaborations and networks, can make major contributions to healthy and stable societies in Central Asia. U.S. scientific and technical know-how has much to contribute to U.S. policy goals and easing regional tensions. Science and technology truly can build bridges between nations and cultures while serving the societies in them.

  1. More arms, less stability: Nuclear, chemical, and missile proliferation in the Asia-Pacific. Final report

    SciTech Connect (OSTI)

    Mack, A.


    In the wake of the Gulf War, the Bush Administration has reaffirmed its determination to seek controls over weapons of mass destruction in the Third World, in particular nuclear, chemical, and biological weapons (CBW); and over ballistic missiles, one possible delivery system for nuclear and CBW systems. Attention over the past eight months has naturally focused on the Middle East, but the Asia-Pacific region contains a number of countries which are alleged to have CW and BW programs. One country, North Korea, is far closer to manufacturing nuclear weapons than Iraq was.

  2. India-Low Carbon Asia Research Network (LoCARNet) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas: Energy ResourcesOrder at 8, 13 (Vt. Water Res.:01 - 429Dialogue, AdvisoryinAsia

  3. Japan-Low Carbon Asia Research Network (LoCARNet) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar2-0057-EAInvervar Hydro Jump to: navigation,JumpIAEA EnergyOxyNortheast Asia

  4. Laos-Low Carbon Asia Research Network (LoCARNet) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource History ViewInformationWinds Jump to: navigation,LandsvirkjunCarbon Asia

  5. Malaysia-Low Carbon Asia Research Network (LoCARNet) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource HistoryScenarios Towards 2050EnermarGenerationMainsaInformation Carbon Asia

  6. Observed Increase of TTL Temperature and Water Vapor in Polluted Couds over Asia

    SciTech Connect (OSTI)

    Su, Hui; Jiang, Jonathan; Liu, Xiaohong; Penner, J.; Read, William G.; Massie, Steven T.; Schoeberl, Mark R.; Colarco, Peter; Livesey, Nathaniel J.; Santee, Michelle L.


    Aerosols can affect cloud particle size and lifetime, which impacts precipitation, radiation and climate. Previous studies1-4 suggested that reduced ice cloud particle size and fall speed due to the influence of aerosols may increase evaporation of ice crystals and/or cloud radiative heating in the tropical tropopause layer (TTL), leading to higher water vapor abundance in air entering the stratosphere. Observational substantiation of such processes is still lacking. Here, we analyze new observations from multiple NASA satellites to show the imprint of pollution influence on stratospheric water vapor. We focus our analysis on the highly-polluted South and East Asia region during boreal summer. We find that "polluted" ice clouds have smaller ice effective radius than "clean" clouds. In the TTL, the polluted clouds are associated with warmer temperature and higher specific humidity than the clean clouds. The water vapor difference between the polluted and clean clouds cannot be explained by other meteorological factors, such as updraft and detrainment strength. Therefore, the observed higher water vapor entry value into the stratosphere in the polluted clouds than in the clean clouds is likely a manifestation of aerosol pollution influence on stratospheric water vapor. Given the radiative and chemical importance of stratospheric water vapor, the increasing emission of aerosols over Asia may have profound impacts on stratospheric chemistry and global energy balance and water cycle.

  7. Masha Udensiva-Brenner: Can you tell us about Russia's role in the Eurasian gas market before and after the Central Asia-

    E-Print Network [OSTI]

    Qian, Ning

    become competitors harriman magazine | 11 iNtervieWS The CenTral asia-China PiPeline and russia's energy and after the Central Asia- China Pipeline? Holly Decker: When the Soviet Union collapsed, all gas pipelines transit fees for political and economic gains. Russia had tight control and tried to disrupt pipelines

  8. A version of this appeared in Economic & Political Weekly (1999) XXXIV(18) Natural Gas Imports by South Asia: Pipelines or Pipedreams?

    E-Print Network [OSTI]


    A version of this appeared in Economic & Political Weekly (1999) XXXIV(18) Natural Gas Imports by South Asia: Pipelines or Pipedreams? TransAsia Pipeline System (TAPS): A Shared Natural Gas Pipeline situations where there are eager purchasers of natural gas (India and Pakistan), willing suppliers of natural

  9. Sources of black carbon aerosols in South Asia and surrounding regions during the Integrated Campaign for Aerosols, Gases and Radiation Budget (ICARB)

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Kumar, R.; Barth, M. C.; Nair, V. S.; Pfister, G. G.; Suresh Babu, S.; Satheesh, S. K.; Moorthy, K. Krishna; Carmichael, G. R.; Lu, Z.; Streets, D. G.


    This study examines differences in the surface black carbon (BC) aerosol loading between the Bay of Bengal (BoB) and the Arabian Sea (AS) and identifies dominant sources of BC in South Asia and surrounding regions during March–May 2006 (Integrated Campaign for Aerosols, Gases and Radiation Budget, ICARB) period. A total of 13 BC tracers are introduced in the Weather Research and Forecasting Model coupled with Chemistry to address these objectives. The model reproduced the temporal and spatial variability of BC distribution observed over the AS and the BoB during the ICARB ship cruise and captured spatial variability at the inlandmore »sites. In general, the model underestimates the observed BC mass concentrations. However, the model–observation discrepancy in this study is smaller compared to previous studies. Model results show that ICARB measurements were fairly well representative of the AS and the BoB during the pre-monsoon season. Elevated BC mass concentrations in the BoB are due to 5 times stronger influence of anthropogenic emissions on the BoB compared to the AS. Biomass burning in Burma also affects the BoB much more strongly than the AS. Results show that anthropogenic and biomass burning emissions, respectively, accounted for 60 and 37% of the average ± standard deviation (representing spatial and temporal variability) BC mass concentration (1341 ± 2353 ng m-3) in South Asia. BC emissions from residential (61%) and industrial (23%) sectors are the major anthropogenic sources, except in the Himalayas where vehicular emissions dominate. We find that regional-scale transport of anthropogenic emissions contributes up to 25% of BC mass concentrations in western and eastern India, suggesting that surface BC mass concentrations cannot be linked directly to the local emissions in different regions of South Asia.« less

  10. Effects of Siberian forest fires on air quality in East Asia during May 2003 and its climate implication

    E-Print Network [OSTI]

    Park, Rokjin

    Effects of Siberian forest fires on air quality in East Asia during May 2003 and its climate model Biomass burning Forest fire aerosols Radiative forcing Tropospheric ozone a b s t r a c t In May 2003, intense forest fires occurred over Siberia, which were the largest fires in the past decade

  11. Top-down estimate of a large source of atmospheric carbon monoxide associated with fuel combustion in Asia

    E-Print Network [OSTI]

    Palmer, Paul

    Top-down estimate of a large source of atmospheric carbon monoxide associated with fuel combustion modeling methodology, we find that the source of carbon monoxide from fossil-fuel and biofuel combustion source of atmospheric carbon monoxide associated with fuel combustion in Asia, Geophys. Res. Lett., 29

  12. Impacts of a nuclear war in South Asia on soybean and maize production in the Midwest United States

    E-Print Network [OSTI]

    Robock, Alan

    Impacts of a nuclear war in South Asia on soybean and maize production in the Midwest United States and soybeans to cooler, drier, and darker conditions from war-related smoke. We combined observed climate had an important effect. 1 Introduction In the event of nuclear war, targets in cities and industrial

  13. Africa N. of visitors Asia N. of visitors Latin America N. of visitors Morocco 81 India 367 Argentina 142

    E-Print Network [OSTI]

    Africa N. of visitors Asia N. of visitors Latin America N. of visitors Morocco 81 India 367 Argentina 142 South Africa 69 Iran 201 Mexico 126 Nigeria 65 Pakistan 140 Brazil 120 Egypt in LDCs in Africa Algeria 50 Korea Rep. 34 Costa Rica 44 16 from rest of Africa Ghana 37

  14. ACM SIGGRAPH Asia 2012, Singapore, November 29 December 1, 2012 Elasticity-Inspired Deformers for Character Articulation

    E-Print Network [OSTI]

    Plotkin, Joshua B.

    ACM SIGGRAPH Asia 2012, Singapore, November 29 ­ December 1, 2012 Elasticity-Inspired Deformers-mail: Copyright ACM, (2012). This is the author's version of the work. It is posted here by permission of ACM for your personal use. Not for redistribution. The definitive version will be published

  15. Modeling the Summertime Climate of Southwest Asia: The Role of Land Surface Processes in Shaping the Climate of Semiarid Regions

    E-Print Network [OSTI]

    Marcella, Marc P.

    Presented is a study on the role of land surface processes in determining the summertime climate over the semiarid region of southwest Asia. In this region, a warm surface air temperature bias of 3.5°C is simulated in the ...

  16. DOI: 10.1002/asia.201200349 Dye-Sensitized TiO2 Nanotube Solar Cells: Rational Structural and Surface

    E-Print Network [OSTI]

    Lin, Zhiqun

    DOI: 10.1002/asia.201200349 Dye-Sensitized TiO2 Nanotube Solar Cells: Rational Structural and Surface Engineering on TiO2 Nanotubes Jun Wang[a] and Zhiqun Lin*[b] 2754 2012 Wiley-VCH Verlag GmbH & Co-defined structural parameters and enhanced electronic properties, highly ordered TiO2 nanotube arrays have been

  17. Software Analytics in Practice Dongmei Zhang, Shi Han, Yingnong Dang, Jian-Guang Lou, Haidong Zhang, Microsoft Research Asia,

    E-Print Network [OSTI]

    Xie, Tao

    Software Analytics in Practice Dongmei Zhang, Shi Han, Yingnong Dang, Jian-Guang Lou, Haidong Zhang, Microsoft Research Asia, China Tao Xie, University of Illinois at Urbana-Champaign, USA Abstract: Software analytics is to utilize data-driven approaches to enable software practitioners to perform data exploration

  18. Isoprene emissions over Asia 1979-2012 : impact of climate and land use changes

    SciTech Connect (OSTI)

    Stavrakou, T.; Muller, J. F.; Bauwens, M.; De Smedt, I.; Roozendael, Van M.; Guenther, Alex B.; Wild, M.; Xia, X.


    Due to the scarcity of observational constraints and the rapidly changing environment in East and Southeast Asia, isoprene emissions predicted by models are expected to bear substantial uncertainties. The aim of this study is to improve upon the existing bottom-up estimates, and investigate the temporal evolution of the fluxes in Asia over 1979-2012. To this purpose, we calculate the hourly emissions at 0.5% ×0.5% resolution using the MEGAN-MOHYCAN model driven by ECMWF ERA-Interim climatology. This study incorporates (i) changes in land use, including the rapid expansion of oil palms, (ii) meteorological variability according to ERA-Interim, (iii) long-term changes in solar radiation (dimming/brightening) constrained by surface network radiation measurements,and (iv) recent experimental evidence that South Asian tropical forests are much weaker isoprene emitters than previously assumed, and on the other hand, that oil palms hold a strong isoprene emission capacity. These effects lead to a significant lowering (factor of two) in the total isoprene fluxes over the studied domain, and to emission reductions reaching a factor of 3.5 in Southeast Asia. The bottom-up annual isoprene emissions for 2005 are estimated at 7.0, 4.8, 8.3, 2.9 Tg in China, India, Indonesia and Malaysia, respectively. Changes in temperature and solar radiation are the major drivers of the interannual variability and trend in the emissions. An annual positive flux trend of 0.2% and 0.52% is found in Asia and China, respectively, through the entire period, related to positive trend in temperature and solar radiation. The impact of oil palm expansion in Indonesia and Malaysia is to enhance the trends over that region, e.g. from 1.17% to 1.5% in 1979-2005 in Malaysia. A negative emission trend is derived in India (?0.4 %), owing to the negative trend in solar radiation data associated to the strong dimming effect likely due to increasing aerosol loadings. The bottom-up emissions are evaluated using top-down isoprene emission estimates derived from inverse modelling constrained by GOME-2/MetOp-A formaldehyde columns through 2007-2012. The satellite-based estimates appear to support our assumptions, and confirm the lower emission rate in tropical forests of Indonesia and Malaysia. Additional flux measurements are clearly needed to better characterize the spatial variability of emission factors. Finally, a decreasing trend in the top-down Chinese emissions inferred after 2007, is in line with the cooling episode recorded in China after that year, thus suggesting that the satellite HCHO columns are able to capture climate-induced changes in emissions.


    SciTech Connect (OSTI)

    Calvin, Katherine V.; Fawcett, Allen A.; Jiang, Kejun


    While the world has yet to adopt a single unified policy to limit climate change, many countries and regions have adopted energy and climate policies that have implications for global emissions. In this paper, we discuss a few key policies and how they are included in a set of 24 energy and integrated assessment models that participated in the Asia Modeling Exercise. We also compare results from these models for a small set of stylized scenarios to the pledges made as part of the Copenhagen Accord and the goals stated by the Major Economies Forum. We find that the targets outlined by the United States, the European Union, Japan, and Korea require significant policy action in most of the models analyzed. For most of the models in the study, however, the goals outlined by India are met without any climate policy. The stringency of climate policy required to meet China’s Copenhagen pledges varies across models and accounting methodologies.

  20. Southeast Asia applied geophysics workshop: Geoscientists without borders Lee M. Liberty*, Spencer H. Wood, Emily A. Hinz, and Dylan Mikesell, Boise State University, Fongsaward

    E-Print Network [OSTI]

    Barrash, Warren

    Southeast Asia applied geophysics workshop: Geoscientists without borders Lee M. Liberty*, Spencer of the SEG Foundation Geoscientists Without Borders program, we conducted a geophysics workshop in northern Thailand to train students and professionals in geophysical methods to address environmental

  1. CITATION Professor Desmond Ball, School of International, Political and Strategic Studies, Strategic and Defence Studies Centre, ANU College of Asia and the Pacific

    E-Print Network [OSTI]

    CITATION ­ Professor Desmond Ball, School of International, Political and Strategic Studies contributions to understanding nuclear strategy, Australian defence, signals intelligence, regional security politics, and. most recently, conflict in Southeast Asia, have all been motivated by an unflinching

  2. Source sector and region contributions to BC and PM2.5 in Central Asia

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Kulkarni, S.; Sobhani, N.; Miller-Schulze, J. P.; Shafer, M. M.; Schauer, J. J.; Solomon, P. A.; Saide, P. E.; Spak, S. N.; Cheng, Y. F.; Denier van der Gon, H. A. C.; et al


    Particulate matter (PM) mass concentrations, seasonal cycles, source sector, and source region contributions in Central Asia (CA) are analyzed for the period April 2008–July 2009 using the Sulfur Transport and dEposition Model (STEM) chemical transport model and modeled meteorology from the Weather Research and Forecasting (WRF) model. Predicted aerosol optical depth (AOD) values (annual mean value ~0.2) in CA vary seasonally, with lowest values in the winter. Surface PM2.5 concentrations (annual mean value ~10 ?g m-3) also exhibit a seasonal cycle, with peak values and largest variability in the spring/summer, and lowest values and variability in the winter (hourly valuesmore »from 2 to 90 ?g m-3). Surface concentrations of black carbon (BC) (mean value ~0.1 ?g m-3) show peak values in the winter. The simulated values are compared to surface measurements of AOD as well as PM2.5, PM10, BC, and organic carbon (OC) mass concentrations at two regional sites in Kyrgyzstan (Lidar Station Teplokluchenka (LST) and Bishkek). The predicted values of AOD and PM mass concentrations and their seasonal cycles are fairly well captured. The carbonaceous aerosols are underpredicted in winter, and analysis suggests that the winter heating emissions are underestimated in the current inventory. Dust, from sources within and outside CA, is a significant component of the PM mass and drives the seasonal cycles of PM and AOD. On an annual basis, the power and industrial sectors are found to be the most important contributors to the anthropogenic portion of PM2.5. Residential combustion and transportation are shown to be the most important sectors for BC. Biomass burning within and outside the region also contributes to elevated PM and BC concentrations. The analysis of the transport pathways and the variations in particulate matter mass and composition in CA demonstrates that this region is strategically located to characterize regional and intercontinental transport of pollutants. Aerosols at these sites are shown to reflect dust, biomass burning, and anthropogenic sources from Europe; South, East, and Central Asia; and Russia depending on the time period. Simulations for a reference 2030 emission scenario based on pollution abatement measures already committed to in current legislation show that PM2.5 and BC concentrations in the region increase, with BC growing more than PM2.5 on a relative basis. This suggests that both the health impacts and the climate warming associated with these particles may increase over the next decades unless additional control measures are taken. The importance of observations in CA to help characterize the changes that are rapidly taking place in the region are discussed.« less

  3. Source sector and region contributions to BC and PM??? in Central Asia

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Kulkarni, S.; Sobhani, N.; Miller-Schulze, J. P.; Shafer, M. M.; Schauer, J. J.; Solomon, P. A.; Saide, P. E.; Spak, S. N.; Cheng, Y. F.; Denier van der Gon, H. A. C.; et al


    Particulate matter (PM) mass concentrations, seasonal cycles, source sector, and source region contributions in Central Asia (CA) are analyzed for the period April 2008–July 2009 using the Sulfur Transport and dEposition Model (STEM) chemical transport model and modeled meteorology from the Weather Research and Forecasting (WRF) model. Predicted aerosol optical depth (AOD) values (annual mean value ~0.2) in CA vary seasonally, with lowest values in the winter. Surface PM??? concentrations (annual mean value ~10 ?g m?³) also exhibit a seasonal cycle, with peak values and largest variability in the spring/summer, and lowest values and variability in the winter (hourly valuesmore »from 2 to 90 ?g m?³). Surface concentrations of black carbon (BC) (mean value ~0.1 ?g m?³) show peak values in the winter. The simulated values are compared to surface measurements of AOD as well as PM???, PM??, BC, and organic carbon (OC) mass concentrations at two regional sites in Kyrgyzstan (Lidar Station Teplokluchenka (LST) and Bishkek). The predicted values of AOD and PM mass concentrations and their seasonal cycles are fairly well captured. The carbonaceous aerosols are underpredicted in winter, and analysis suggests that the winter heating emissions are underestimated in the current inventory. Dust, from sources within and outside CA, is a significant component of the PM mass and drives the seasonal cycles of PM and AOD. On an annual basis, the power and industrial sectors are found to be the most important contributors to the anthropogenic portion of PM???. Residential combustion and transportation are shown to be the most important sectors for BC. Biomass burning within and outside the region also contributes to elevated PM and BC concentrations. The analysis of the transport pathways and the variations in particulate matter mass and composition in CA demonstrates that this region is strategically located to characterize regional and intercontinental transport of pollutants. Aerosols at these sites are shown to reflect dust, biomass burning, and anthropogenic sources from Europe; South, East, and Central Asia; and Russia depending on the time period. Simulations for a reference 2030 emission scenario based on pollution abatement measures already committed to in current legislation show that PM??? and BC concentrations in the region increase, with BC growing more than PM??? on a relative basis. This suggests that both the health impacts and the climate warming associated with these particles may increase over the next decades unless additional control measures are taken. The importance of observations in CA to help characterize the changes that are rapidly taking place in the region are discussed.« less

  4. ---Home Yahoo! Help My Yahoo!

    E-Print Network [OSTI]

    - - -Home Yahoo! Help My Yahoo! Thursday to release energy. But in a fusion reactor, energy is harnessed by forcing the nuclei of light atoms #12;Rokkasho is already home to nuclear fuel cycle facilities run by Japan Nuclear Fuel

  5. Bride Abduction in Post-Soviet Central Asia: Marking a Shift Towards Patriarchy through Local Discourses of Shame and Tradition 

    E-Print Network [OSTI]

    Werner, Cynthia


    patriarchy in post-Soviet Central Asia. Discourses of shame are mobilized by local actors in support of the popular view that a woman should ‘stay’ after being abducted. Women can and do resist abductions, but they risk dealing with the burden of shame... of naming this practice requires careful consideration (Walley 2006). For example, the term ‘bride kidnapping’ is based on a verb that originated in reference to the illegal abduction of children for labour or ransom, and therefore contains subtle implica...

  6. The Silicon Detector (SiD) And Linear Collider Detector R&D in Asia And North America

    SciTech Connect (OSTI)

    Brau, J.E.; /Oregon U.; Breidenbach, M.; /SLAC; Fujii, Y.; /KEK, Tsukuba


    In Asia and North America research and development on a linear collider detector has followed complementary paths to that in Europe. Among the developments in the US has been the conception of a detector built around silicon tracking, which relies heavily on a pixel (CCD) vertex detector, and employs a silicon tungsten calorimeter. Since this detector is quite different from the TESLA detector, we describe it here, along with some of the sub-system specific R&D in these regions.

  7. Muslim oil and gas periphery; the future of hydrocarbons in Africa, southeast Asia and the Caspian. Master`s thesis

    SciTech Connect (OSTI)

    Crockett, B.D.


    This thesis is a study of the contemporary political, economic, and technical developments and future prospects of the Muslim hydrocarbon exporters of Africa, Southeast Asia, and the Caspian. The established Muslim oil and gas periphery of Africa and Southeast Asia has four members in the Organization of Petroleum Exporting Countries (OPEC) and is systemically increasing its production of natural gas. I analyze US government and corporate policies regarding the countries and the major dilemmas of the Muslim hydrocarbon periphery. The first chapter provides a selective overview of global energy source statistics; the policies, disposition and composition of the major hydrocarbon production and consumption players and communities; a selective background of OPEC and its impact on the globe; and a general portrait of how the Muslim periphery piece fits into the overall Muslim oil and gas puzzle. Chapter two analyzes the established Muslim oil and gas periphery of Africa and Southeast Asia asking the following questions: What are the major political, economic, and technical trends and dilemmas affecting these producer nations. And what are the United States` policies and relationships with these producers. Chapter three asks the same questions as chapter two, but with regard to the newly independent states of the Caspian Sea. I probe the regional petroleum exploration and transportation dilemmas in some detail.

  8. Cooperative Mmonitoring Center Occasional Paper/5: Propspects of Conventional Arms Control in South Asia

    SciTech Connect (OSTI)

    Gupta, Amit; Kamal, Nazir


    The intensely adversarial relationship between India and Pakistan is marked by military rivalry, mutual distrust, and suspicion. The most dividing disagreement has been over the Kashmir region. An inability to discuss the Kashmir issue has prevented discussion on other important issues. Since there is little prospect of detente, at least in the near-term, the question is whether this rivalry can be contained by other means, such as arms control approaches. Conventional arms control has been applied flexibly and successfully in some regions to reduce threat-perceptions and achieve reassuring military stability. Some lessons from other international models might be applied to the India/Pakistan context. This paper discusses the status of conventional arms control in South Asia, the dominant Indian and Pakistani perceptions about arms control, the benefits that could be derived from arms control, as well as the problems and prospects of arms control. It also discusses existing conventional arms control agreements at the regional and global levels as well as the potential role of cooperative monitoring technology.

  9. Volatility basis-set approach simulation of organic aerosol formation in East Asia: implications for anthropogenic-biogenic interaction and controllable amounts

    SciTech Connect (OSTI)

    Matsui, H.; Koike, Makoto; Kondo, Yutaka; Takami, A.; Fast, Jerome D.; Kanaya, Y.; Takigawa, M.


    Organic aerosol (OA) simulations using the volatility basis-set approach were made for East Asia and its outflow region. Model simulations were evaluated through comparisons with OA measured by aerosol mass spectrometers in and around Tokyo (at Komaba and Kisai in summer 2003 and 2004) and over the outflow region in East Asia (at Fukue and Hedo in spring 2009). The simulations with aging processes of organic vapors reasonably well reproduced mass concentrations, temporal variations, and formation efficiency of observed OA at all sites. As OA mass was severely underestimated in the simulations without the aging processes, the oxidations of organic vapors are essential for reasonable OA simulations over East Asia. By considering the aging processes, simulated OA concentrations considerably increased from 0.24 to 1.28 µg m-3 in the boundary layer over the whole of East Asia. OA formed from the interaction of anthropogenic and biogenic sources was also enhanced by the aging processes. The fraction of controllable OA was estimated to be 87 % of total OA over the whole of East Asia, showing that most of the OA in our simulations formed anthropogenically (controllable). A large portion of biogenic secondary OA (78 % of biogenic secondary OA) formed through the influence of anthropogenic sources. The high fraction of controllable OA in our simulations is likely because anthropogenic emissions are dominant over East Asia and OA formation is enhanced by anthropogenic sources and their aging processes. Both the amounts (from 0.18 to 1.12 µg m-3) and the fraction (from 75 % to 87 %) of controllable OA were increased by aging processes of organic vapors over East Asia.

  10. Model analysis of the anthropogenic aerosol effect on clouds over East Asia

    SciTech Connect (OSTI)

    Gao, Yi; Zhang, Meigen; Liu, Xiaohong; Zhao, Chun


    A coupled meteorology and aerosol/chemistry model WRF-Chem (Weather Research and Forecast model coupled with Chemistry) was used to conduct a pair of simulations with present-day (PD) and preindustrial (PI) emissions over East Asia to examine the aerosol indirect effect on clouds. As a result of an increase in aerosols in January, the cloud droplet number increased by 650 cm{sup -3} over the ocean and East China, 400 cm{sup -3} over Central and Southwest China, and less than 200 cm{sup -3} over North China. The cloud liquid water path (LWP) increased by 40-60 g m{sup -2} over the ocean and Southeast China and 30 g m{sup -2} over Central China; the LWP increased less than 5 g m{sup -2} or decreased by 5 g m{sup -2} over North China. The effective radius (Re) decreased by more than 4 {mu}m over Southwest, Central, and Southeast China and 2 {mu}m over North China. In July, variations in cloud properties were more uniform; the cloud droplet number increased by approximately 250-400 cm{sup -3}, the LWP increased by approximately 30-50 g m{sup -2}, and Re decreased by approximately 3 {mu}m over most regions of China. In response to cloud property changes from PI to PD, shortwave (SW) cloud radiative forcing strengthened by 30 W m{sup -2} over the ocean and 10 W m{sup -2} over Southeast China, and it weakened slightly by approximately 2-10 W m{sup -2} over Central and Southwest China in January. In July, SW cloud radiative forcing strengthened by 15 W m{sup -2} over Southeast and North China and weakened by 10 W m{sup -2} over Central China. The different responses of SW cloud radiative forcing in different regions was related to cloud feedbacks and natural variability.

  11. Creating an Evergreen Agriculture in Africa: for Food Security...

    Open Energy Info (EERE)

    Central Asia, Eastern Asia, Southern Asia, South-Eastern Asia, Western Asia, Eastern Europe, Northern Europe, Southern Europe, Western Europe, Australia and New Zealand,...

  12. Micro-level Practices to Adapt to Climate Change for African...

    Open Energy Info (EERE)

    Central Asia, Eastern Asia, Southern Asia, South-Eastern Asia, Western Asia, Eastern Europe, Northern Europe, Southern Europe, Western Europe, Australia and New Zealand,...

  13. Locating Climate Insecurity: Where Are the Most Vulnerable Places...

    Open Energy Info (EERE)

    Central Asia, Eastern Asia, Southern Asia, South-Eastern Asia, Western Asia, Eastern Europe, Northern Europe, Southern Europe, Western Europe, Australia and New Zealand,...

  14. Forestry-based Carbon Sequestration Projects in Africa: Potential...

    Open Energy Info (EERE)

    Central Asia, Eastern Asia, Southern Asia, South-Eastern Asia, Western Asia, Eastern Europe, Northern Europe, Southern Europe, Western Europe, Australia and New Zealand,...

  15. Guide to Clean Development Mechanism Projects Related to Municipal...

    Open Energy Info (EERE)

    Central Asia, Eastern Asia, Southern Asia, South-Eastern Asia, Western Asia, Eastern Europe, Northern Europe, Southern Europe, Western Europe, Australia and New Zealand,...

  16. Making Development Climate Resilient: A World Bank Strategy for...

    Open Energy Info (EERE)

    Central Asia, Eastern Asia, Southern Asia, South-Eastern Asia, Western Asia, Eastern Europe, Northern Europe, Southern Europe, Western Europe, Australia and New Zealand,...

  17. CMC Participation in the Regional Centre for Strategic Studies (RCSS) Workshop: Defense, Technology and Cooperative Security in South Asia

    SciTech Connect (OSTI)

    Biringer, K.L.; Olsen, J.


    As an ongoing part of the collaborative efforts between the Cooperative Monitoring Center (CMC) at Sandia National Laboratories, the United States Arms Control and Disarmament Agency (ACDA), and U.S. Department of Energy (DOE), staff from the CMC served as faculty in conducting a workshop in Shanghai, China. Sponsor of the workshop was the Regional Centre for Strategic Studies (RCSS) based in Colombo, Sri Lanka. The workshop included participants from throughout South Asia and China. The CMC presented four sessions related to the role of monitoring technologies in promoting regional security and building confidence among nations. Participation in these workshops supports U.S. efforts to further regional cooperation and promote arms control, nonproliferation and other cooperative securily measures and supplements efforts funded by DOE and ACDA over the past four years. The RCSS Shanghai meeting permitted a continued CMC involvement in regionally conducted training for anew generation of leaders in government, the military, and academia throughout South Asia and China. Nuclear issues are clearly a dominant South Asian concern since the nuclear tests of May 1998. However, there remains a strong interest in identifying opportunities for increased trade and reduced tensions in other areas. The RCSS and other regional organizations are enthusiastic about continued CMC involvement in future regional courses.

  18. Cooperative Monitoring Center Occasional Paper/12: ENTNEA: A Concept for Enhancing Nuclear Transparency for Confidence Building in Northeast Asia

    SciTech Connect (OSTI)

    Nam, Man-Kwon; Shin, Sung-Tack


    Nuclear energy continues to be a strong and growing component of economic development in Northeast Asia. A broad range of nuclear energy systems already exists across the region and vigorous growth is projected. Associated with these capabilities and plans are various concerns about operational safety, environmental protection, and accumulation of spent fuel and other nuclear materials. We consider cooperative measures that might address these concerns. The confidence building measures suggested here center on the sharing of information to lessen concerns about nuclear activities or to solve technical problems. These activities are encompassed by an Enhanced Nuclear Transparency in Northeast Asia (ENTNEA) concept that would be composed of near-term, information-sharing activities and an eventual regional institution. The near-term activities would address specific concerns and build a tradition of cooperation; examples include radiation measurements for public safety and emergency response, demonstration of safe operations at facilities and in transportation, and material security in the back end of the fuel cycle. Linkages to existing efforts and organizations would be sought to maximize the benefits of cooperation. In the longer term, the new cooperative tradition might evolve into an ENTNEA institution. In institutional form, ENTNEA could combine the near-term activities and new cooperative activities, which might require an institutional basis, for the mutual benefit and security of regional parties.

  19. Uncorrected)Ch.5)in)))Earthquake)Hazard,)Risk,)and)Disasters,)Ed)M.)Wyss,)Elsevier)2014)ISBN: 978-0-12-Aggravated)Earthquake)Risk)in)South)Asia:))

    E-Print Network [OSTI]

    Bilham, Roger

    Uncorrected)Ch.5)in)))Earthquake)Hazard,)Risk,)and)Disasters,)Ed)M.)Wyss,)Elsevier)2014)ISBN: 978-0-12- 394848-9) 1) Aggravated)Earthquake)Risk)in)South)Asia:)) ))))))))))))))))))))))))))Engineering.4) million) people) to) earthquake) deaths) in) the) past) 12) years,) and) more) than) 2) million) in) the

  20. On-Road Emissions in Asia Measured by Remote Sensing. Donald H. Stedman and Gary A. Bishop,University of Denver, Department of Chemistry and

    E-Print Network [OSTI]

    Denver, University of

    On-Road Emissions in Asia Measured by Remote Sensing. Donald H. Stedman and Gary A. Bishop Analysis, Tiburon, California 94920 ABSTRACT On-road emissions are precisely the emissions which sensing measures mass emissions of CO, HC, NO and smoke per kg (or per L) of fuel burned. On

  1. Professional Travel in Pakistan Pakistan is located in the South Asia and is bordered by China to the north, Afghanistan and Iran on the

    E-Print Network [OSTI]

    Chen, Deming

    1 Professional Travel in Pakistan Pakistan is located in the South Asia and is bordered by China important aspect of life in Pakistan and about 97% of Pakistanis are Muslim. The people of Pakistan shake hands with other females right away. Pakistani women may not interact with strangers. · Pakistan

  2. Utilizing Large Integrated Data Sets for Regional Seismic Research in Asia Aaron A. Velasco, Julio Aguilar-Chang, Hans E. Hartse

    E-Print Network [OSTI]

    Utilizing Large Integrated Data Sets for Regional Seismic Research in Asia Aaron A. Velasco, Julio open source data. · To utilize these data effectively for regional seismic research, a mechanism must Amplitude Corrections (MDAC) parameters for regional seismic stations were developed utilizing amplitude

  3. Copyright 1999, Society of Petroleum Engineers Inc. This paper was prepared for presentation at the 1999 SPE Asia Pacific Oil and Gas

    E-Print Network [OSTI]

    Schechter, David S.

    Copyright 1999, Society of Petroleum Engineers Inc. This paper was prepared for presentation at the 1999 SPE Asia Pacific Oil and Gas Conference and Exhibition held in Jakarta, Indonesia, 20­22 April 1999. This paper was selected for presentation by an SPE Program Committee following review

  4. Copyright 2012 by Hyopil Shin, Munhyong Kim, Hayeon Jang, and Andrew Cattle 26th Pacific Asia Conference on Language,Information and Computation pages 181190

    E-Print Network [OSTI]

    Copyright 2012 by Hyopil Shin, Munhyong Kim, Hayeon Jang, and Andrew Cattle 26th Pacific Asia Corpus in Korean Hyopil Shin, Munhyong Kim, Yu-Mi Jo, Hayeon Jang, and Andrew Cattle a Department and conclusions. 181 Copyright 2012 by Hyophil Shin, Munhyong Kim, Yu-Mi Jo, Hayeon Jang, and Adrew Cattle 26 th

  5. Conference Paper for Electricity Industry in Transition: Issues and Prospects for Asia, Bangkok, Thailand, Jan. 14-16, 2004. 2003 Dennis Ray and Frank Wayno

    E-Print Network [OSTI]

    Conference Paper for Electricity Industry in Transition: Issues and Prospects for Asia, Bangkok and Education in a Transitioning Electric Power Industry Dennis Ray Executive Director Power Systems Engineering University Abstract The electric supply industry is in transition from its traditional

  6. 2010-2011 Princeton Graduate Students with Academic Interests in South Asia Shahana Chattaraj, PHD, Woodrow Wilson School, Urban Policy

    E-Print Network [OSTI]

    Rowley, Clarence W.

    2010-2011 Princeton Graduate Students with Academic Interests in South Asia Shahana Chattaraj, PHD, Woodrow Wilson School, Urban Policy Barret F Bradstreet, Phd, WWS, Security Studies, Indian military strategy Diane L Coffey, Phd, WWS, Population coffey

  7. Develop. Growth Differ. (2006) 48, 559573 doi: 10.1111/j.1440-169x.2006.00893.x Blackwell Publishing Asia

    E-Print Network [OSTI]


    of California Davis, Davis, California 95616, USA In this study, we report on the presence of efflux transporter Publishing Asia Increase in multidrug transport activity is associated with oocyte maturation in sea stars of California Davis, Bodega Bay, California 94923, USA, 2 Hopkins Marine Station, Stanford University, Pacific

  8. Multi-Institutional Phase II Clinical Study of Concurrent Chemoradiotherapy for Locally Advanced Cervical Cancer in East and Southeast Asia

    SciTech Connect (OSTI)

    Kato, Shingo; Ohno, Tatsuya; Thephamongkhol, Kullathorn; Chansilpa, Yaowalak


    Purpose: To evaluate the toxicity and efficacy of concurrent chemoradiotherapy using weekly cisplatin for patients with locally advanced cervical cancer in East and Southeast Asia, a multi-institutional Phase II clinical study was conducted among eight Asian countries. Methods and Materials: Between April 2003 and March 2006, 120 patients (60 with bulky Stage IIB and 60 with Stage IIIB) with previously untreated squamous cell carcinoma of the cervix were enrolled in the present study. Radiotherapy consisted of pelvic external beam radiotherapy (total dose, 50 Gy) and either high-dose-rate or low-dose-rate intracavitary brachytherapy according to institutional practice. The planned Point A dose was 24-28 Gy in four fractions for high-dose-rate-intracavitary brachytherapy and 40-45 Gy in one to two fractions for low-dose-rate-intracavitary brachytherapy. Five cycles of weekly cisplatin (40 mg/m{sup 2}) were administered during the radiotherapy course. Results: All patients were eligible for the study. The median follow-up was 27.3 months. Of the 120 patients, 100 (83%) received four or five cycles of chemotherapy. Acute Grade 3 leukopenia was observed in 21% of the patients, and Grade 3 gastrointestinal toxicity was observed in 6%. No patient failed to complete the radiotherapy course because of toxicity. The 2-year local control and overall survival rate for all patients was 87.1% and 79.6%, respectively. The 2-year major late rectal and bladder complication rate was 2.5% and 0%, respectively. Conclusion: The results have suggested that concurrent chemoradiotherapy using weekly cisplatin is feasible and effective for patients with locally advanced cervical cancer in East and Southeast Asia.

  9. Radiative and thermodynamic responses to aerosol extinction profiles during the pre-monsoon month over South Asia

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Feng, Y.; Kotamarthi, V. R.; Coulter, R.; Zhao, C.; Cadeddu, M.


    Aerosol radiative effects and thermodynamic responses over South Asia are examined with a version of the Weather Research and Forecasting model coupled with Chemistry (WRF-Chem) for March 2012. Model results of Aerosol Optical Depth (AOD) and extinction profiles are analyzed and compared to satellite retrievals and two ground-based lidars located in the northern India. The WRF-Chem model is found to underestimate the AOD during the simulated pre-monsoon month and about 83 % of the model low-bias is due to aerosol extinctions below ~2 km. Doubling the calculated aerosol extinctions below 850 hPa generates much better agreement with the observed AODmore »and extinction profiles averaged over South Asia. To separate the effect of absorption and scattering properties, two runs were conducted: in one run (Case I), the calculated scattering and absorption coefficients were increased proportionally, while in the second run (Case II) only the calculated aerosol scattering coefficient was increased. With the same AOD and extinction profiles, the two runs produce significantly different radiative effects over land and oceans. On the regional mean basis, Case I generates 48 % more heating in the atmosphere and 21 % more dimming at the surface than Case II. Case I also produces stronger cooling responses over the land from the longwave radiation adjustment and boundary layer mixing. These rapid adjustments offset the stronger radiative heating in Case I and lead to an overall lower-troposphere cooling up to -0.7 K day?1, which is smaller than that in Case II. Over the ocean, direct radiative effects dominate the heating rate changes in the lower atmosphere lacking such surface and lower atmosphere adjustments due to fixed sea surface temperature, and the strongest atmospheric warming is obtained in Case I. Consequently, atmospheric dynamics (boundary layer heights and meridional circulation) and thermodynamic processes (water vapor and cloudiness) are shown to respond differently between Case I and Case II underlying the importance of determining the exact portion of scattering or absorbing aerosols that lead to the underestimation of aerosol optical depth in the model. In addition, the model results suggest that both direct radiative effect and rapid thermodynamic responses need to be quantified for understanding aerosol radiative impacts.« less

  10. Radiative and thermodynamic responses to aerosol extinction profiles during the pre-monsoon month over South Asia

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Feng, Y.; Kotamarthi, V. R.; Coulter, R.; Zhao, C.; Cadeddu, M.


    Aerosol radiative effects and thermodynamic responses over South Asia are examined with a version of the Weather Research and Forecasting model coupled with Chemistry (WRF-Chem) for March 2012. Model results of Aerosol Optical Depth (AOD) and extinction profiles are analyzed and compared to satellite retrievals and two ground-based lidars located in the northern India. The WRF-Chem model is found to underestimate the AOD during the simulated pre-monsoon month and about 83 % of the model low-bias is due to aerosol extinctions below ~2 km. Doubling the calculated aerosol extinctions below 850 hPa generates much better agreement with the observed AODmore »and extinction profiles averaged over South Asia. To separate the effect of absorption and scattering properties, two runs were conducted: in one run (Case I), the calculated scattering and absorption coefficients were increased proportionally, while in the second run (Case II) only the calculated aerosol scattering coefficient was increased. With the same AOD and extinction profiles, the two runs produce significantly different radiative effects over land and oceans. On the regional mean basis, Case I generates 48 % more heating in the atmosphere and 21 % more dimming at the surface than Case II. Case I also produces stronger cooling responses over the land from the longwave radiation adjustment and boundary layer mixing. These rapid adjustments offset the stronger radiative heating in Case I and lead to an overall lower-troposphere cooling up to -0.7 K day?1, which is smaller than that in Case II. Over the ocean, direct radiative effects dominate the heating rate changes in the lower atmosphere lacking such surface and lower atmosphere adjustments due to fixed sea surface temperature, and the strongest atmospheric warming is obtained in Case I. Consequently, atmospheric dynamics (boundary layer heights and meridional circulation) and thermodynamic processes (water vapor and cloudiness) are shown to respond differently between Case I and Case II underlying the importance of determining the exact portion of scattering or absorbing aerosols that lead to the underestimation of aerosol optical depth in the model. In addition, the model results suggest that both direct radiative effect and rapid thermodynamic responses need to be quantified for understanding aerosol radiative impacts.« less

  11. Temperature dependence, spatial scale, and tree species diversity in eastern Asia and North America

    E-Print Network [OSTI]

    Brown, James H.

    that determine the latitudinal gradient of species diversity, but the underlying mechanisms remain poorly understood. The recently proposed metabolic theory of ecology (MTE) aims to explain ecological patterns and body size on the metabolism of organisms. Here we use 2 comparable databases of tree distributions

  12. Energy and Environmental Issues in Eastern Europe and Central Asia: An Annotated Guide to Information Resources

    SciTech Connect (OSTI)

    Gant, K.S.


    Energy and environmental problems undermine the potential for sustained economic development and contribute to political and economic instability in the strategically important region surrounding the Caspian and Black Seas. Many organizations supporting efforts to resolve problems in this region have found that consensus building--a prerequisite for action--is a difficult process. Reaching agreement on priorities for investment, technical collaboration, and policy incentives depends upon informed decision-making by governments and local stakeholders. And while vast quantities of data and numerous analyses and reports are more accessible than ever, wading through the many potential sources in search of timely and relevant data is a formidable task. To facilitate more successful data searches and retrieval, this document provides annotated references to over 200 specific information sources, and over twenty primary search engines and data retrieval services, that provide relevant and timely information related to the environment, energy, and economic development around the Caspian and Black Seas. This document is an advance copy of the content that Oak Ridge National Laboratory (ORNL) plans to transfer to the web in HTML format to facilitate interactive search and retrieval of information using standard web-browser software.

  13. Energy Outlook in Eastern Europe and Central Asia Region | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, AlabamaETEC GmbH JumpEllenville, NewLtd EILEnergy DatadataCentre Jump

  14. Source Contribution Analysis of Surface Particulate Polycyclic Aromatic Hydrocarbon Concentrations in Northeastern Asia by Source-receptor Relationships

    SciTech Connect (OSTI)

    Inomata, Yayoi; Kajino, Mizuo; Sato, Keiichi; Ohara, Toshimasa; Kurokawa, Jun-Ichi; Ueda, Hiromasa; Tang, Ning; Hayakawa, Kazuichi; Ohizumi, Tsuyoshi; Akimoto, Hajime


    We analyzed the sourceereceptor relationships for particulate polycyclic aromatic hydrocarbon (PAH) concentrations in northeastern Asia using an aerosol chemical transport model. The model successfully simulated the observed concentrations. In Beijing (China) benzo[a]pyren (BaP) concentrations are due to emissions from its own domain. In Noto, Oki and Tsushima (Japan), transboundary transport from northern China (>40°N, 40-60%) and central China (30-40°N, 10-40%) largely influences BaP concentrations from winter to spring, whereas the relative contribution from central China is dominant (90%) in Hedo. In the summer, the contribution from Japanese domestic sources increases (40-80%) at the 4 sites. Contributions from Japan and Russia are additional source of BaP over the northwestern Pacific Ocean in summer. The contribution rates for the concentrations from each domain are different among PAH species depending on their particulate phase oxidation rates. Reaction with O3 on particulate surfaces may be an important component of the PAH oxidation processes.

  15. Source sector and region contributions to BC and PM2.5 in Central Asia

    SciTech Connect (OSTI)

    Kulkarni, S.; Sobhani, N.; Miller-Schulze, J. P.; Shafer, M. M.; Schauer, J. J.; Solomon, P. A.; Saide, P. E.; Spak, S. N.; Cheng, Y. F.; Denier van der Gon, H. A. C.; Lu, Z.; Streets, D. G.; Janssens-Maenhout, G.; Wiedinmyer, C.; Lantz, J.; Artamonova, M.; Chen, B.; Imashev, S.; Sverdlik, L.; Deminter, J. T.; Adhikary, B.; D'Allura, A.; Wei, C.; Carmichael, G. R.


    Particulate matter (PM) mass concentrations, seasonal cycles, source sector, and source region contributions in Central Asia (CA) are analyzed for the period April 2008–July 2009 using the Sulfur Transport and dEposition Model (STEM) chemical transport model and modeled meteorology from the Weather Research and Forecasting (WRF) model. Predicted aerosol optical depth (AOD) values (annual mean value ~0.2) in CA vary seasonally, with lowest values in the winter. Surface PM2.5 concentrations (annual mean value ~10 ?g m-3) also exhibit a seasonal cycle, with peak values and largest variability in the spring/summer, and lowest values and variability in the winter (hourly values from 2 to 90 ?g m-3). Surface concentrations of black carbon (BC) (mean value ~0.1 ?g m-3) show peak values in the winter. The simulated values are compared to surface measurements of AOD as well as PM2.5, PM10, BC, and organic carbon (OC) mass concentrations at two regional sites in Kyrgyzstan (Lidar Station Teplokluchenka (LST) and Bishkek). The predicted values of AOD and PM mass concentrations and their seasonal cycles are fairly well captured. The carbonaceous aerosols are underpredicted in winter, and analysis suggests that the winter heating emissions are underestimated in the current inventory. Dust, from sources within and outside CA, is a significant component of the PM mass and drives the seasonal cycles of PM and AOD. On an annual basis, the power and industrial sectors are found to be the most important contributors to the anthropogenic portion of PM2.5. Residential combustion and transportation are shown to be the most important sectors for BC. Biomass burning within and outside the region also contributes to elevated PM and BC concentrations. The analysis of the transport pathways and the variations in particulate matter mass and composition in CA demonstrates that this region is strategically located to characterize regional and intercontinental transport of pollutants. Aerosols at these sites are shown to reflect dust, biomass burning, and anthropogenic sources from Europe; South, East, and Central Asia; and Russia depending on the time period. Simulations for a reference 2030 emission scenario based on pollution abatement measures already committed to in current legislation show that PM2.5 and BC concentrations in the region increase, with BC growing more than PM2.5 on a relative basis. This suggests that both the health impacts and the climate warming associated with these particles may increase over the next decades unless additional control measures are taken. The importance of observations in CA to help characterize the changes that are rapidly taking place in the region are discussed.

  16. Search Asia Advanced Search

    E-Print Network [OSTI]

    , but this remains some way off from dismantling the entire system that allow Indonesian timber to reach this country

  17. Asia/ITS

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming963 1.969 1.979Coal4 Arizona - NaturalYear Jan FebProved

  18. Asia | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop IncIowaWisconsin: EnergyYork Jump|Line SitingOil andAshtabula - Otter

  19. An extended abstract of this paper is published in the proceedings of the 3rd International Workshop on Security in Cloud Computing--SCC@AsiaCCS 2015. This is the full version.

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    Workshop on Security in Cloud Computing--SCC@AsiaCCS 2015. This is the full version. Entangled Encodings Entangled cloud storage (Aspnes et al., ESORICS 2004) enables a set of clients to "entangle" their files into a single clew to be stored by a (potentially malicious) cloud provider. The entan- glement makes

  20. Variability of North Pacific Sea Ice and East AsiaNorth Pacific Winter Climate State Key Laboratory of Numerical Modeling for Atmospheric Sciences and Geophysical Fluid Dynamics, Institute of Atmospheric

    E-Print Network [OSTI]

    , accompanied by a weakening of the east Asian jet stream and trough. The associated anomalous southeasterlies by a strengthening of the east Asia jet stream and trough. The associated anomalous northerlies intensify the east. The intensified EAWM also strengthens the local Hadley cell, which in turn strengthens the east Asian jet stream

  1. Key to Juniperus of Europe, Canary Islands, Azores, Asia Minor and Africa rev. 16 Jun 2011 1a. All leaves acicular (subulate), jointed at the base, in whorls of 3; cones borne axillary

    E-Print Network [OSTI]

    Adams, Robert P.

    Key to Juniperus of Europe, Canary Islands, Azores, Asia Minor and Africa rev. 16 Jun 2011 1a. All as wide as midrib, mature seed cones about as long as leaves, endemic to Madeira Island...........................J. maderensis 7a.2 Stomatal bands wider than midrib, mature seed cones longer that leaves, endemic to the Canary

  2. A survey of nuclear-related agreements and possibilities for nuclear cooperation in South Asia: Cooperative Monitoring Center Occasional Paper/15

    SciTech Connect (OSTI)



    Several existing nuclear-related agreements already require India and Pakistan, as members, to share information. The agreements are bilateral, regional, and international. Greater nuclear transparency between India and Pakistan could be promoted by first understanding the information flows required by existing agreements. This understanding is an essential step for developing projects that can incrementally advance the sensitivity of the information being shared. This paper provides a survey of existing nuclear-related agreements involving India and Pakistan, and suggests future confidence-building projects using the frameworks provided by these agreements. The Bilateral Agreement on the Prohibition of Attack against Nuclear Reactors and Nuclear Facilities is discussed as a basis for creating further agreements on restricting the use and deployment of nuclear weapons. The author suggests options for enhancing the value of the list of nuclear facilities exchanged annually as a part of this agreement. The International Atomic Energy Agency's regional cooperation agreement among countries in the Asia-Pacific region is an opportunity for greater subregional nuclear cooperation in South Asia. Linking the regional agreement with South Asian environmental cooperation and marine pollution protection efforts could provide a framework for projects involving Indian and Pakistani coastal nuclear facilities. Programs of the Food and Agriculture Organization of the United Nations that use nuclear techniques to increase food and crop production and optimize water management in arid areas also provide similar opportunities for nuclear cooperation. Other frameworks for nuclear cooperation originate from international conventions related to nuclear safety, transportation of nuclear wastes, worker protection against ionizing radiation, and the nondeployment of nuclear weapons in certain areas. The information shared by existing frameworks includes: laws and regulations (including internal inspection procedures that enforce compliance); lists of nuclear facilities; emergency response procedures and available resources; information related to the transportation of nuclear wastes (particularly via shipping); understanding and notification of accidental releases; and radionuclide release data from select coastal facilities. Incremental increases in the sensitivity of the information being shared could strengthen norms for Indian and Pakistani nuclear transparency. This paper suggests seven technology-based Indian and Pakistani nuclear transparency projects for consideration. Existing nuclear-related agreements provide an information-sharing framework within which the projects could occur. Eventually, as confidence increases and new agreements are negotiated, future projects could begin to deal with the accounting of fissile materials and nuclear weapons disposition and control.

  3. Regional Radiological Security Partnership in Southeast Asia – Increasing the Sustainability of Security Systems at the Site-Level by Using a Model Facility Approach

    SciTech Connect (OSTI)

    Chamberlain, Travis L.; Dickerson, Sarah; Ravenhill, Scott D.; Murray, Allan; Morris, Frederic A.; Herdes, Gregory A.


    In 2004, Australia, through the Australian Nuclear Science and Technology Organisation (ANSTO), created the Regional Security of Radioactive Sources (RSRS) project and partnered with the U.S. Department of Energy’s Global Threat Reduction Initiative (GTRI) and the International Atomic Energy Agency (IAEA) to form the Southeast Asian Regional Radiological Security Partnership (RRSP). The intent of the RRSP is to cooperate with countries in Southeast Asia to improve the security of their radioactive sources. This Southeast Asian Partnership supports objectives to improve the security of high risk radioactive sources by raising awareness of the need and developing national programs to protect and control such materials, improve the security of such materials, and recover and condition the materials no longer in use. The RRSP has utilized many tools to meet those objectives including: provision of physical protection upgrades, awareness training, physical protection training, regulatory development, locating and recovering orphan sources, and most recently - development of model security procedures at a model facility. This paper discusses the benefits of establishing a model facility, the methods employed by the RRSP, and three of the expected outcomes of the Model Facility approach. The first expected outcome is to increase compliance with source security guidance materials and national regulations by adding context to those materials, and illustrating their impact on a facility. Second, the effectiveness of each of the tools above is increased by making them part of an integrated system. Third, the methods used to develop the model procedures establishes a sustainable process that can ultimately be transferred to all facilities beyond the model. Overall, the RRSP has utilized the Model Facility approach as an important tool to increase the security of radioactive sources, and to position facilities and countries for the long term secure management of those sources.

  4. 2009 -Asia rld Reneuvable ffxx*rgy Smxlgr&$$ XSSS * Asia

    E-Print Network [OSTI]

    ethanol blended with gasoline as a vehicle fuel. These include: 1) the effects on the emissions of air on the use of l0% by volume blends of ethanol with gasoline (E10), the most commonly used blend globally and sustainability of ethanol in gasoline. Niven reviews data available on five environmental aspects of using

  5. Kidnapping Politics in East Asia

    E-Print Network [OSTI]

    Samuels, Richard J.

    Introduction: History is filled with political abductions, incidents in which individuals are kidnapped and held hostage by hostile groups or states to gain leverage or legitimacy for their cause.1 Such episodes have been ...

  6. Nuclear deterrence in South Asia

    SciTech Connect (OSTI)

    Hagerty, D.T.


    Did India and Pakistan nearly fight a nuclear war in 1990? In a provocative 1993 article, Seymour M. Hersh claims that they did. During a crisis with India over the rapidly escalating insurgency in Kashmir, Pakistan openly deployed its main armored tank units along the Indian border and, in secret, placed its nuclear-weapons arsenal on alert. As a result, the Bush Administration became convinced that the world was on the edge of a nuclear exchange between Pakistan and India. Universe of cases is admittedly small, but my argument is supported by recent research indicating that preemptive attacks of any kind have been historically rarer than conventionally believed. The nuclear era has seen two instances of preventive attacks against nuclear facilities-the 1981 Israeli bombing of Iraq`s Osirak nuclear facility and the allied coalition`s 1991 air war against Iraq-but both of these actions were taken without fear of nuclear reprisal. In situations where nuclear retaliation has been a possibility, no leader of nuclear weapon state has chosen to launch a preemptive first strike. 97 refs.

  7. Long-term Follow-up Results of a Multi-institutional Phase 2 Study of Concurrent Chemoradiation Therapy for Locally Advanced Cervical Cancer in East and Southeast Asia

    SciTech Connect (OSTI)

    Kato, Shingo; Ohno, Tatsuya; Thephamongkhol, Kullathorn; Chansilpa, Yaowalak; Cao, Jianping; Xu, Xiaoting; Devi, C. R. Beena; Swee, Tang Tieng; Calaguas, Miriam J.C.; Reyes, Rey H. de los; Cho, Chul-Koo; Dung, To Anh; Supriana, Nana; Erawati, Dyah; Mizuno, Hideyuki; Nakano, Takashi; Tsujii, Hirohiko


    Purpose: To report the long-term survival and toxicity of a multi-institutional phase 2 study of concurrent chemoradiation therapy (CCRT) for locally advanced cervical cancer in east and southeast Asia. Methods and Materials: Ten institutions from 8 Asian countries participated in the study. Between April 2003 and March 2006, 120 patients (60 with bulky stage IIB and 60 with stage IIIB) were treated with CCRT. Radiation therapy consisted of pelvic external beam radiation therapy and either high-dose-rate or low-dose-rate intracavitary brachytherapy. Five cycles of weekly cisplatin (40 mg/m{sup 2}) were administered during the course of radiation therapy. Treatment results were evaluated by the rates of local control, overall survival, and late toxicities. Results: Median follow-up was 63.7 months, and the follow-up rate at 5 years was 98%. The 5-year local control and overall survival rates for all patients were 76.8% and 55.1%, respectively. The 5-year rates of major late toxicities of the rectum and bladder were 7.9% and 0%, respectively. Conclusions: The long-term results have suggested that CCRT is safe and effective for patients with locally advanced cervical cancer in east and southeast Asia. However, further efforts are needed to improve overall survival.

  8. Application of an online-coupled regional climate model, WRF-CAM5, over East Asia for examination of ice nucleation schemes: Part I. Comprehensive model evaluation and trend analysis for 2006 and 2011

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Chen, Ying; Zhang, Yang; Fan, Jiwen; Leung, Lai -Yung; Zhang, Qiang; He, Kebin


    Online-coupled climate and chemistry models are necessary to realistically represent the interactions between climate variables and chemical species and accurately simulate aerosol direct and indirect effects on cloud, precipitation, and radiation. In this Part I of a two-part paper, simulations from the Weather Research and Forecasting model coupled with the physics package of Community Atmosphere Model (WRF-CAM5) are conducted with the default heterogeneous ice nucleation parameterization over East Asia for two full years: 2006 and 2011. A comprehensive model evaluation is performed using satellite and surface observations. The model shows an overall acceptable performance for major meteorological variables at themore »surface and in the boundary layer, as well as column variables (e.g., precipitation, cloud fraction, precipitating water vapor, downward longwave and shortwave radiation). Moderate to large biases exist for cloud condensation nuclei over oceanic areas, cloud variables (e.g., cloud droplet number concentration, cloud liquid and ice water paths, cloud optical depth, longwave and shortwave cloud forcing). These biases indicate a need to improve the model treatments for cloud processes, especially cloud droplets and ice nucleation, as well as to reduce uncertainty in the satellite retrievals. The model simulates well the column abundances of chemical species except for column SO2 but relatively poor for surface concentrations of several species such as CO, NO2, SO2, PM2.5, and PM10. Several reasons could contribute to the underestimation of major chemical species in East Asia including underestimations of anthropogenic emissions and natural dust emissions, uncertainties in the spatial and vertical distributions of the anthropogenic emissions, as well as biases in meteorological, radiative, and cloud predictions. Despite moderate to large biases in the chemical predictions, the model performance is generally consistent with or even better than that reported for East Asia with only a few exceptions. The model generally reproduces the observed seasonal variations and the difference between 2006 and 2011 for most variables or chemical species. Overall, these results demonstrate promising skills of WRF-CAM5 for long-term simulations at a regional scale and suggest several areas of potential improvements.« less

  9. Seasonal cycle of Precipitation over Major River Basins in South and Southeast Asia: A Review of the CMIP5 climate models data for present climate and future climate projections

    E-Print Network [OSTI]

    Hasson, Shabeh ul; Lucarini, Valerio; Böhner, Jürgen


    We review the skill of thirty coupled climate models participating in Coupled Model Intercomparison Project 5 in terms of reproducing properties of the seasonal cycle of precipitation over the major river basins of South and Southeast Asia (Indus, Ganges, Brahmaputra and Mekong) for historical period (1961-2000). We also present projected changes by these models by end of century (2061-2100) under extreme scenario RCP8.5. First, we assess their ability to reproduce observed timings of the monsoon onset and the rate of rapid fractional accumulation (RFA slope) - a measure of seasonality within active monsoon period. Secondly, we apply a threshold-independent seasonality index (SI) - a multiplicative measure of precipitation and extent of its concentration relative to the uniform distribution (relative entropy - RE). We apply SI distinctly for monsoonal precipitation regime (MPR), westerly precipitation regime (WPR) and annual precipitation regime. For present climate, neither any single model nor the multi-mod...

  10. Application of an online-coupled regional climate model, WRF-CAM5, over East Asia for examination of ice nucleation schemes. Part II. Sensitivity to heterogeneous ice nucleation parameterizations and dust emissions

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Zhang, Yang; Chen, Ying; Fan, Jiwen; Leung, Lai -Yung


    Aerosol particles can affect cloud microphysical properties by serving as ice nuclei (IN). Large uncertainties exist in the ice nucleation parameterizations (INPs) used in current climate models. In this Part II paper, to examine the sensitivity of the model predictions to different heterogeneous INPs, WRF-CAM5 simulation using the INP of Niemand et al. (N12) [1] is conducted over East Asia for two full years, 2006 and 2011, and compared with simulation using the INP of Meyers et al. (M92) [2], which is the original INP used in CAM5. M92 calculates the nucleated ice particle concentration as a function of icemore »supersaturation, while N12 represents the nucleated ice particle concentration as a function of temperature and the number concentrations and surface areas of dust particles. Compared to M92, the WRF-CAM5 simulation with N12 produces significantly higher nucleated ice crystal number concentrations (ICNCs) in the northern domain where dust sources are located, leading to significantly higher cloud ice number and mass concentrations and ice water path, but the opposite is true in the southern domain where temperatures and moistures play a more important role in ice formation. Overall, the simulation with N12 gives lower downward shortwave radiation but higher downward longwave radiation, cloud liquid water path, cloud droplet number concentrations, and cloud optical depth. The increase in cloud optical depth and the decrease in downward solar flux result in a stronger shortwave and longwave cloud forcing, and decreases temperature at 2-m and precipitation. Changes in temperature and radiation lower surface concentrations of OH, O?, SO?²?, and PM2.5, but increase surface concentrations of CO, NO?, and SO? over most of the domain. By acting as cloud condensation nuclei (CCN) and IN, dust particles have different impacts on cloud water and ice number concentrations, radiation, and temperature at 2-m and precipitation depending on whether the dominant role of dust is CCN or IN. These results indicate the importance of the heterogeneous ice nucleation treatments and dust emissions in accurately simulating regional climate and air quality.« less

  11. Workshop at SIGGRAPH Asia 2012 Program Handbook

    E-Print Network [OSTI]

    Thawonmas, Ruck

    -West line (green) Make a transfer at Buona Vista station to the Circle line (yellow) If travelling along the registration. Tea breaks 2 Tea breaks are provided each day for workshop attendees. The tea breaks will be held

  12. AFRICA ASIA SOUTH AMERICA Algeria Afghanistan Argentina

    E-Print Network [OSTI]

    Oxford, University of

    Peru Comoros China, Hong Kong SAR Suriname Congo, Dem. Rep. (Kinshasa) China, Macau SAR Uruguay Congo

  13. Philippines: Asia Pacific energy series: Country report

    SciTech Connect (OSTI)

    Hoffman, S.


    The purpose of this report is to present an overview of Philippines energy planning and policy and to analyze its energy resources and economic developments. Geography, population, geothermal reserves, coal, oil industry, electricity, and renewable energy are the major topics included in the report. A chapter is focused on national economy and energy policy. 40 tabs., 2 figs.

  14. Is chytridiomycosis an emerging disease in Asia?

    E-Print Network [OSTI]

    Brown, Rafe M.


    Museum of Natural Sciences, Raleigh, North Carolina, United States of America, 26Museo Nacional de Ciencias Naturales, Madrid, Spain Abstract The disease chytridiomycosis, caused by the fungus Batrachochytrium dendrobatidis (Bd), has caused dramatic... Museum of Natural Sciences, Raleigh, North Carolina, United States of America, 26Museo Nacional de Ciencias Naturales, Madrid, Spain Abstract The disease chytridiomycosis, caused by the fungus Batrachochytrium dendrobatidis (Bd), has caused dramatic...

  15. Sustainable and equitable urban environments in Asia

    E-Print Network [OSTI]

    Badshah, Akhtar


    This study identifies some of the factors and conditions that can encourage the development of sustainable and equitable urban environments. It argues that cities will continue to grow and that it is not productive to view ...

  16. HISTORY 228 Historicizing Popular Culture in Asia

    E-Print Network [OSTI]

    Sheridan, Jennifer

    production and reception. From this perspective, we can enter debates, such as those about post: 30% Mid-term short-paper (5 pages): 20 % Final Paper (10 pages) 30% As you see from the above texts, placed on Learn@UW or available for download through the libraries various search engines

  17. Asia Pacific oil and gas conference: Proceedings

    SciTech Connect (OSTI)



    This book is a compilation of conference proceedings on oil and gas development technologies for the Pacific Rim countries. It includes papers on horizontal drilling technologies, reservoir modeling, corrosion protection techniques, pipeline design and flow measurement, and well logging instrumentation. Other papers deal with resource management and reservoir engineering techniques and modeling. Reservoir engineering papers include enhanced recovery and well stimulation techniques as well as optimizing field depletion.

  18. East Asia's Energy Outlook and Challenges

    E-Print Network [OSTI]

    Goda, Keisuke

    Geothermal Use · New Financing renewable energy Sustainable Fossil Fuel Use · Clean Coal Technology · N Transport Others N-Energy 0 1000 2000 3000 4000 5000 6000 1990 2011 2035 Coal Oil Natura Gas Electricity.00 100.00 91.50 100.00 1.30 Dependence on imported coal 21.42 32.40 NA 0.00 95.70 NA 73.90 82.03 0

  19. Danionics Asia Ltd | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar2-0057-EA Jump to: navigation, searchDaimler Evonik JV JumpDanbio

  20. Asia/ITS | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:FinancingPetroleum Based Fuels Research atDepartment of EnergyOF THE MANAGEMENT OF

  1. Asia West LLC | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EAandAmminex A SOpenAshley, Ohio: Energy ResourcesInformationPowerWest

  2. Asia Wind Group Ltd | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EAandAmminex A SOpenAshley, Ohio: Energy

  3. International Minor in Engineering: Middle Eastern Studies Language: maximum of 12 semester hours # of sem hours

    E-Print Network [OSTI]

    Lee, Tonghun

    and Architecture 3 (NW) CWL 189/190 Literature of Asia and Africa I/II 3 (NW, H) 205 Islam and West Through

  4. CENOZOIC PLATE TECTONICS OF SE ASIA 11 Cenozoic plate tectonic reconstructions of SE Asia

    E-Print Network [OSTI]

    Royal Holloway, University of London

    for the Tertiary is proposed, based on the integration of new palaeomagnetic data from east Indonesia recording the development of sedi- mentary basins, and the distribution of petro-leum resources. Reconstructions palaeomagnetic data from east Indonesia (Ali & Hall 1995; Hall et al. 1995a, b) permit reconstructions


    E-Print Network [OSTI]

    Kim, Ho-Young

    using a process known as polymer electrospinning. By exposing a droplet of polymer solution to a strong

  6. Asia Silicon Qinghai Co Ltd aka Asia Si Material | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar Energy LLC Jump to: navigation,SummariesAshman Technologies Jump to:Silicon

  7. Anthropogenic emissions of highly reactive volatile organic compounds in eastern Texas

    E-Print Network [OSTI]

    Mickley, Loretta J.

    al 2003, Parrish et al 2012) and in an oil/gas field of northern Colorado (Gilman et al 2013 of VOCs, have been used to constrain AHRVOC emissions in East Asia (Fu et al 2007) and Nigeria (Marais et

  8. A synthesis of carbon in international trade

    E-Print Network [OSTI]

    Peters, G. P; Davis, S. J; Andrew, R.


    Russia South America Central America Eastern Europe West Asia Global Consumption Production (MtC) Exports (Russia South America Central America Eastern Europe West Asia Global Consumption Balance Production (MtC) Exports (Russia South America Central America Eastern Europe West Asia Global Consumption Balance Production (MtC) Exports (

  9. UNEP-Southeast Asia Climate Change Network | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al.,Turin, New York: EnergyU.S. EPA Region 10Information

  10. 2012 Symposium of Campus Asia Program Building Resiliency for Emergency

    E-Print Network [OSTI]

    Banbara, Mutsunori

    Professor Robert Rudolf Well-being at risk? Adaptation to Life and Labor Market Events in South Korea) Professor Guosheng Qu Vice President International Association of Risk Management Thoughts on Critical Professor Cuz Potter Democratic math? Citizen Participation and Risk Analysis Professor Kan Kimura

  11. South EaSt aSia TABLE OF CONTENTS

    E-Print Network [OSTI]

    resources both renewable and non-renewable, the concern for environmental degradation, national energy is enthusiastically getting on board. Even though many of the countries in the region enjoy a wealth of energy security and the world-wide need to "do more with less" have provided the motivation to adopt

  12. Spirits of Capitalism: Explaining Industrial Variation in South Asia

    E-Print Network [OSTI]

    Naseemullah, Adnan


    Delhi, Nov. 16 (medium). Foundry components manufacturer,April 25 ($8.2 billion). Foundry components manufacturer,Fiat), Memon Associate Foundry (Yamaha motorcycles), Dawood

  13. Policy Paper 09: Northeast Asia Cooperation Dialogue II Conference Papers

    E-Print Network [OSTI]

    Young-Koo, Cha; Kang, Choi; JI, Guoxing; Mack, Andrew; Pregenzer, Arian L.; Dobrovolski, Vassili


    legally stockpile separated plutonium (Pu) and highlyhidden stockpiles of already- produced plutonium. Moreover,stockpile in large quantities, but rather will import little more plutonium

  14. Policy Paper 24: Energy and Security in Northeast Asia

    E-Print Network [OSTI]

    May, Michael; Johnson, Celeste; Fei, Edward; Suzuki, Tatsujiro


    steps: • Existing plutonium stockpiles must be safeguardedprotect large plutonium stockpiles. Since the late 1960s,of Japa- nese plutonium stockpiles from reprocessing. Such

  15. Paratransit in Southeast Asia: A Market Response to Poor Roads?

    E-Print Network [OSTI]

    Cervero, Robert


    conventional) Buses (double decker) Minibus, Mikrolet BemoBuses (conventional) Buses (Double Decker) Vehicle Capacity*by conventional and double- decker buses, it scores low with

  16. Generational Politics: Narratives of Power in Central Asia's Visual Culture

    E-Print Network [OSTI]

    Khudonazar, Anaita


    Aleksei Chadov) and Alisa (Zhanna Friske). Day Watch [1972. Print. Vasil’eva Zhanna. “Balabanov Poshel “Voinoi. ”

  17. Asia-Pacific Integrated Model (AIM) | Open Energy Information

    Open Energy Info (EERE)

    (LEDS). Key Outputs Emissions estimates (CO2, SO2, NOx), total primary energy supply, electricity generation by fuel-type, sector-wise energy consumption, economic output...

  18. Climate regulation of fire emissions and deforestation in equatorial Asia

    E-Print Network [OSTI]


    on the anomaly optimization (see Materials and Methods) andabsolute optimization approach described in Materials and

  19. Spirits of Capitalism: Explaining Industrial Variation in South Asia

    E-Print Network [OSTI]

    Naseemullah, Adnan


    of Industrial Policy in Pakistan, 1947-1971. ” Workingand the Development of Pakistan, 1913-1948. ” Journal of2008). Crossed Swords: Pakistan, its Army and the Wars

  20. Promoting responsible FM & timber trade in South East Asia

    E-Print Network [OSTI]

    5 Import countries account for >55% from 04-07 Top 5 Export trade partners Account for >62% from 04-07 Malaysia U S Indonesia· ·Russia Thailand U S Japan China HK U K Korea #12;Theory of Change Land Manager

  1. Energy Secretary Announces $52 Million Request for Asia Pacific...

    Energy Savers [EERE]

    touring the University of New South Wales Centre of Excellence for Advanced Silicon Photovoltaics and Phototonics where he saw the latest technologies available in capturing and...

  2. Crossed swords : divided militaries and politics in East Asia

    E-Print Network [OSTI]

    Heginbotham, Eric


    (cont.) Domestic politics, then, frequently have a decisive impact on strategic planning and produces policies that the consideration of external threats alone would not suggest.

  3. Ecosystem services provided by palms in SE Asia

    E-Print Network [OSTI]

    Schierup, Mikkel Heide

    important in forest ecosystems and include some 600 species in SEA. Rural communities depend on palms provided by ecosystems and research into the value of these resources should: - Include rural communities of rural communities' harvest of palm products - Evaluate the potential of developing new palm products

  4. Spirits of Capitalism: Explaining Industrial Variation in South Asia

    E-Print Network [OSTI]

    Naseemullah, Adnan


    lean production” were better able to capture the gains from technology by decentralizing manufacturing

  5. Aerosol Optical Depths In South/South East Asia

    E-Print Network [OSTI]

    Frank, Thomas D.

    Delhi Gujarat Himachal Pradesh Jammu and Kashmir Kerala Madhya Pradesh Manipur Meghalaya Karnataka Jammu and Kashmir Kerala Madhya Pradesh Manipur Meghalaya Karnataka Nagaland Orissa Punjab Rajasthan Delhi Gujarat Himachal Pradesh Jammu and Kashmir Kerala Madhya Pradesh Manipur Meghalaya Karnataka

  6. Lucrative Opportunities in Asia Pacific to Help Global Bunker...

    Open Energy Info (EERE)

    Energy Concerns to Push Global Market to Grow at 8.1% CAGR from 2013 to 2019 Oil Shale Market is Estimated to Reach USD 7,400.70 Million by 2022 more Group members (32)...

  7. Explaining civil-military relations in Southeast Asia

    E-Print Network [OSTI]

    Kwok, Jia-Chuan


    Civil-military relations describe the interactions and balance of power between the civilians and the military in a nation state. Due to the organizational apparatus and capacity for forcible coercion that the military ...

  8. Observed Holiday Aerosol Reduction and Temperature Cooling over East Asia

    SciTech Connect (OSTI)

    Gong, Daoyi; Wang, Wenshan; Qian, Yun; Bai, Wenbing; Guo, Yuanxi; Mao, Rui


    The Spring Festival air pollution in China was investigated using the long-term observations from 2001-2012 over 323 stations. During the Spring Festival with nearly half of urban population leaving the cities for holidays, the particulate matter (PM10) concentration is about 24.5?gm-3 (23%) lower than normal days. Associated with the national-wide burning of firework, the PM10 concentration sharply increases to 123.8?gm-3 at Chinese New Year Day (increment of 35%). Similar to PM10, the SO2 and NO2 decrease from high values in normal days to a holiday minimum with reduction of 23.3% and 30.6%, respectively. The NO2 has no peak in New Year Day because of the different emission source. The night mean and minimum temperature co-vary with PM10. Both nighttime mean and minimum temperature decrease by about 2.1°C during the holidays. And in association with the pollution jump at New Year Day the night temperature simultaneously increase by about 0.89°C. The in-phase co-variations between PM10 and night temperature suggest an overall warming effect of holiday aerosol during winter in China.

  9. Spirits of Capitalism: Explaining Industrial Variation in South Asia

    E-Print Network [OSTI]

    Naseemullah, Adnan


    structures, class bases or strategies within the nationalist movement opposed to British rule, and 3) a low productivity, predominantly agrarian

  10. Issues, Value Cleavages, and Political Change in East Asia

    E-Print Network [OSTI]

    Lee, Aie-Rie


    and Markets around the Pacific Rim: Congruence Theory andGlobal Studies: Japan & Pacific Rim (Dubuque: McGraw Hill,Markets around the Pacific Rim. 20. In the Korean survey,

  11. Policies, Political-Economy, and Swidden in Southeast Asia

    E-Print Network [OSTI]


    J. C. (1976). The Moral Economy of the Peasant: Rebellionand the Political Economy of Ignorance. Agroforestryof Small-holder Oil Palm Economies of Sabah and Sarawak.

  12. 2005 Pearson Education South Asia Pte Ltd Applied Fluid Mechanics

    E-Print Network [OSTI]

    Leu, Tzong-Shyng "Jeremy"

    Sections 10.Minor Losses 11.Series Pipeline Systems 12.Parallel Pipeline Systems 13.Pump Selection is not circular. · An example is the shell-and-tube heat exchanger shown in Fig. 9.1, in which, for example, hot water from an industrial process may be flowing to the right inside the inner tube. #12;4 9. Velocity

  13. Japan in Asia's Space Race: Directions and Implications

    E-Print Network [OSTI]

    PEKKANEN, Saadia M.


    Cyberspace, and National Security,” Air Force Association,industrial policy with national security are not likely toin- terest of Japan’s national security. THE PLAYERS AND THE

  14. Energy and Security in Northeast Asia: Proposals for Nuclear Cooperation

    E-Print Network [OSTI]

    Kaneko, Kumao; Suzuki, Atsuyuki; Choi, Jor-Shan; Fei, Edward


    two gaseous diffusion plants (at Portsmouth and Paducah) andgaseous diffusion plants (GDPs; in Portsmouth, Ohio; Paducah,

  15. Policy Paper 24: Energy and Security in Northeast Asia

    E-Print Network [OSTI]

    May, Michael; Johnson, Celeste; Fei, Edward; Suzuki, Tatsujiro


    environmental concerns remain, existence of both facilities will be beneficial if they can pro- vide regional long-term spent fuel

  16. 2005 Pearson Education South Asia Pte Ltd Applied Fluid Mechanics

    E-Print Network [OSTI]

    Leu, Tzong-Shyng "Jeremy"

    , magnetic flowmeter, vortex flowmeter, and ultrasonic flowmeter. #12;3 15. Flow Measurement ©2005 Pearson Flowmeter 6. Vortex Flowmeter 7. Magnetic Flowmeter 8. Ultrasonic Flowmeters 9. Positive-Displacement Meters system. · Describe four types of variable-head meters: the venturi tube, the flow nozzle, the orifice

  17. Policy Paper 24: Energy and Security in Northeast Asia

    E-Print Network [OSTI]

    May, Michael; Johnson, Celeste; Fei, Edward; Suzuki, Tatsujiro


    nuclear waste, and plutonium disposition. The last would bemanagement and disposition of this plutonium will be a verystorage, or disposition of the plutonium. Later in a paper

  18. Policy Paper 09: Northeast Asia Cooperation Dialogue II Conference Papers

    E-Print Network [OSTI]

    Young-Koo, Cha; Kang, Choi; JI, Guoxing; Mack, Andrew; Pregenzer, Arian L.; Dobrovolski, Vassili


    and stopping reprocessing of any spent fuel. Evidence thatof reprocessing some its growing spent fuel stockpilespent reactor fuel which could be separated in the North’s reprocessing

  19. Policy Paper 24: Energy and Security in Northeast Asia

    E-Print Network [OSTI]

    May, Michael; Johnson, Celeste; Fei, Edward; Suzuki, Tatsujiro


    enrichment, spent nuclear fuel reprocessing, and pluto- niumreprocessing as compared to direct disposition of spent fuel.reprocessing facilities to recover plutonium in spent nuclear fuel.

  20. Strengthening Public and Private Climate Finance in Asia - Indonesia | Open

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing CapacityVectren) JumpandStereoNewCreek FormationStratovolcanoOpen

  1. Greenhouse Gas Inventory Development in Asia | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New PagesSustainableGlynn County,Solar Jump to: navigation, searchInitiative Scenario

  2. File:NREL-asia-dir.pdf | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New Pages Recent Changes AllApschem.pdfgasp 03.pdfMmpa 2007.pdf

  3. File:NREL-asia-glo.pdf | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New Pages Recent Changes AllApschem.pdfgasp 03.pdfMmpa 2007.pdfglo.pdf Jump to: navigation,

  4. File:NREL-asia-tilt.pdf | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New Pages Recent Changes AllApschem.pdfgasp 03.pdfMmpa 2007.pdfglo.pdf Jump to:

  5. Solid International ASIA Pte Ltd | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing Capacity forSiliciumEnergy Inc Jump to:Solergy Power JumpSolicore Inc

  6. PNOC EnerAsia JV | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland:NPIProtectio Program | OpenWisconsin:NewOver CoreOxfordlocalPECOUSA IncPNOC

  7. Energy Secretary Announces $52 Million Request for Asia Pacific Partnership

    Broader source: (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy A plug-inPPLfor Innovative SolarSavings Performance Contracting (ESPC)on Clean

  8. Energy, Transportation Ministers from Asia-Pacific Nations Pledge

    Broader source: (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy A plug-inPPLfor Innovative SolarSavingsAugust 26, 2013

  9. Asia-Energy Efficiency Guide to Industry | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar Energy LLC Jump to: navigation,SummariesAshman Technologies Jump

  10. Aufwind Schmack Asia Holding GmbH | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar Energy LLC Jump to:Greece: Energy Resources JumpAudio-Magnetotellurics

  11. Malaysia-Lowering Emissions in Asia's Forests (LEAF) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop Inc Jump to: navigation, search Name:Power ElectronicsMakatecInformation

  12. REEEP South Asia Regional Secretariat | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop Inc Jump to:Newberg,Energy LLCALLETE IncScienceRoadmap/12-FD-hbScanWafer ASSouth

  13. Regional Climate Change Adaptation Platform for Asia | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop Inc Jump to:Newberg,Energy LLCALLETEREFURecent contentSW

  14. South Asia Energy Management Systems Inc SAEMS | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop Inc JumpHeter BatterySolarfin Jump to:SolkarSector ProgrammesREEEP EERESouthEnergy

  15. South Asia Regional Initiative for Energy Cooperation and Development

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop Inc JumpHeter BatterySolarfin Jump to:SolkarSector ProgrammesREEEP

  16. Sustainable Development Strategy for South Asia | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop Inc JumpHeter BatterySolarfinMarketMember CorpSunvie SASandBuildingCentral

  17. Thailand-Lowering Emissions in Asia's Forests (LEAF) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop Inc JumpHeter BatterySolarfinMarketMemberITerraPowerDevelopingInformation

  18. Vestas Asia Pacific A S | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop IncIowa (Utility Company) JumpGTZUtility RatesComercioElectric Coop

  19. Vietnam-Lowering Emissions in Asia's Forests (LEAF) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop IncIowa (Utility Company) JumpGTZUtilityInformation

  20. Responsible Asia Forest Trade (RAFT) Program | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-bRenewable Energy

  1. Strengthening Planning Capacity for Low Carbon Growth in Developing Asia

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS ReportEurope GmbHSoloPageBeforeCreek Wind FarmStratton Middle-

  2. United Nations Economic and Social Commission for Western Asia | Open

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EISTJThin Film SolarTown(LECBP)BioGenUnidym IncOpen EnergyEnergy

  3. Asia Carbon Emission Management India Pvt Ltd | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EAandAmminex A SOpenAshley, Ohio: Energy Resources JumpAshworths

  4. Asia Pacific Energy Research Centre-IEA Cooperation | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EAandAmminex A SOpenAshley, Ohio: Energy Resources

  5. Asia Pacific Partnership on Clean Development and Climate | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EAandAmminex A SOpenAshley, Ohio: Energy ResourcesInformation

  6. Asia Power Leibo Hydroelectricity Co Ltd | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EAandAmminex A SOpenAshley, Ohio: Energy ResourcesInformationPower Leibo

  7. Asia Sustainable and Alternative Energy Program | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EAandAmminex A SOpenAshley, Ohio: Energy ResourcesInformationPower

  8. Cambodia-Lowering Emissions in Asia's Forests (LEAF) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmentalBowerbank, Maine:Kansas:Information(Redirected fromCounty,County, Idaho:(RECP)

  9. Asia-Pacific Regional Climate Change Adaptation Assessment | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop IncIowaWisconsin: EnergyYork Jump|Line SitingOil andAshtabula -

  10. Credit Leona Securities Asia CLSA UK | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButtePower VenturesInformation EU-UNDP ClimatePublic Schools WindLeona

  11. Asia-Pacific Partnerships and Projects | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative Fuels Data Center HomeVehicle ReplacementStates


    E-Print Network [OSTI]

    Somayaji, Anil

    Abstract--This paper presents a high-level classification of current research in cloud computing security Terms--Cloud Computing, Security, Virtual Machines I. INTRODUCTION LOUD COMPUTING is now the foundation for security breaches. Many security researchers have studied various aspects of cloud computing security from

  13. What caused the cool summer over northern Central Asia, East Asia and central North America during 2009?

    E-Print Network [OSTI]

    Wang, Bin

    , together with the Rossby wave response to the subtropical heating generated by convective activities over, USA 3 Center for Advanced Information Science and Technology, University of Aizu, Japan 4 Atmosphere and Ocean Research Institute, University of Tokyo, Japan E-mail: Received 8 August

  14. Between “Europe” and “Africa”: Building the “New” Ukraine on the Shoulders of Migrant Women

    E-Print Network [OSTI]

    Solari, Cinzia


    in Transition: Eastern Europe and Russia After the CollapseProspects for Europeanness." Europe-Asia Studies Verdery,in Contemporary Eastern Europe." East European Politics and

  15. The Role of Circulation Features on Black Carbon Transport into...

    Office of Scientific and Technical Information (OSTI)

    significantly different AO modulation of BC transport over Northeast Asia and Eastern Europe. Nevertheless, we find that the overall climatological circulation patterns simulated...

  16. North America Europe Central &

    E-Print Network [OSTI]

    Johnson, Matthew

    1 North America Western Europe Central & Eastern Europe Latin America & Caribbean Middle East Europe Central & Eastern Europe Latin America & Caribbean Middle East & Central Asia Asia Pacific Africa Per capita consumption Population (100 millions) 0 5 10 15 20 25 30 35 North America Western Europe

  17. The distribution of thunderstorm and lightning parameters over the Eastern Hemisphere for 1972 

    E-Print Network [OSTI]

    Freeman, William Burns


    - cially over the oceans, North Africa, Arabia, the Mediterranean Sea, and Southeast China. These were areas of sparse data in the W. M. O. compilation but were covered in this investigation. The tentative, first estimate of the distribution of lightning... discharge on a yearly basis were located over South Africa, the Mediterranean Sea, Arabia, Southeast China, Southeast Asia, and Australia. The occurrence of lightning discharge was shown to follow Sun northward from January to the maximum poleward thrust...

  18. Vietnam-Strengthening Public and Private Climate Finance in Asia | Open

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al.,Turin, NewArkansas:Standards JumpUSA(EC-LEDS) | OpenEnergy

  19. Rice straw burning in Southeast Asia as a source of CO and COS to the atmosphere

    SciTech Connect (OSTI)

    Nguyen, B.C.; Mihalopoulos, N.; Putaud, J.P. [Centre des Faibles Radioactivites, Gif-sur-Yvette (France)


    This paper discusses the results of aerosol monitoring field tests conducted in four locations in Viet Nam during 1992 and 1993. Atmospheric samples were collected during the dry and wet seasons during the time when rice straw burning was taking place in the agricultural rangelands. The samples were analyzed for carbon monoxide, carbon dioxide, and carbonyl sulfide. Experimental methods and implications of the analytical results are described. 21 refs., 2 figs., 3 tabs.

  20. Sensitivity of population smoke exposure to fire locations in Equatorial Asia1 Patrick S. Kim1,*

    E-Print Network [OSTI]

    Mickley, Loretta J.

    , Fire, Conservation, Population-Exposure52 53 1. Introduction54 55 Global palm oil and Malaysia together account for 86% of the57 world's production and Indonesia plans to double its output for conversion to32 oil palm plantations, can lead to high smoke concentrations across this densely populated

  1. Public Health in East and Southeast Asia: Challenges and Opportunities in the Twenty-First Century

    E-Print Network [OSTI]

    Detels, Roger; Sullivan, Sheena G.; Tan, Chorh Chuan


    Sheena G. Sullivan, and Chorh Chuan Tan 2. Changes in SocialSheena G. Sullivan, and Chorh Chuan Tan Contributors Index 1G. Sullivan, and Chorh Chuan Tan The twentieth century was a

  2. Contemporary South Asia 13(3), (September 2004) 287306 Women, work and the imagination

    E-Print Network [OSTI]

    -based labour and hand-power, while fully consistent with capitalisation pro- cesses, tend to strengthen favoured by the state and non-governmental organisations as low-cost, low-risk interventions, their value

  3. Policy Paper 36: Energy and Security in Northeast Asia: Supply and Demand, Conflict and

    E-Print Network [OSTI]

    Fesharaki, Fereidun; Banaszak, Sarah; WU, Kang; Valencia, Mark J.; Dorian, James P.


    with coal the main energy supplier for the industry. Theboth potential energy suppliers--Russia and possibly

  4. "Global Cities" and "Globalization" in East Asia: Empirical Realities and Conceptual Questions

    E-Print Network [OSTI]

    Smith, David; Timberlake, Michael


    1997: An Empirical Analysis of Air Travel Links. ” Americantop four places in our analysis of air passenger flows in

  5. Asian Green City Index Assessing the environmental performance of Asia's major cities

    E-Print Network [OSTI]

    Napp, Nils

    wind farm in China 025 Land use and buildings New technology: The world's greenest skyscraper 019 Transport 019 Waste 020 Water 020 Sanitation 020 Air quality 021 Environmental governance 022 Managing the city as a `living organism' An interview with Nicholas You, urban environmental expert 004

  6. Power Rental Market to Receive Thrust from Asia-Pacific, to Rise...

    Open Energy Info (EERE)

    The report presents a detailed financial profile of some of the key vendors operating in the global market for power rental systems. These include Rental Power...

  7. Macroeconomic models of consumer demand for consumer packaged goods in Asia

    E-Print Network [OSTI]

    Mau, Jonathan


    CPGCo, a global manufacturer of consumer packaged goods, has had tremendous difficulty in producing accurate forecasts for its products in developing markets. The problem was especially apparent during the global economic ...

  8. Social Science Data Sharing & Management in Asia: Overview and Future Prospects

    E-Print Network [OSTI]

    Tsang, Daniel C


    speakers, HKU Prof. John Bacon-Shone gave a presentation onSurvey disappeared Source: Bacon-Shone, John. “ArchivingSession-II-1415-1440-John-Bacon-Shone.pdf Universities

  9. Velocity structure of the uppermost mantle beneath East Asia from Pn tomography and its dynamic implications

    E-Print Network [OSTI]

    Niu, Fenglin

    regions on Earth's surface due to the collision from the India plate and the suctions induced seismicity of the area, we conducted a Pn traveltime tomography to estimate the compressive wave speed. In each region, stable blocks tend to have high Pn velocity while the boundary regions, which show a high

  10. Policy Paper 37: Energy and Security in Northeast Asia: Proposals for Nuclear Cooperation

    E-Print Network [OSTI]

    Kaneko, Kumao; Suzuki, Atsuyuki; Choi, Jor-Shan; Fei, Edward


    the accumulation of stockpiles of plutonium. Japan, based ons increasing stockpile of separated plutonium. Korea, theplutonium in deployed weapons, in weapons marked for dismantling, in scrap at the nuclear weapons production complexes, and in stockpiles

  11. Carsharing and Station Cars in Asia: An Overview of Japan and Singapore

    E-Print Network [OSTI]

    Barth, Mathew; Shaheen, Susan; Fukuda, Tuenjai; Fukuda, Atsushi


    L . Novick. CarLink: A Smart Car- sharing System. Field TestAccessed July 2005. 25. Tan, C. Car Share Scheme Soon inK L : NTUC Income Car Co-op Mem­ bers May Have Use of Cars

  12. Quantifying Emissions of Greenhouse Gases from South Asia Through a Targeted Measurement

    E-Print Network [OSTI]

    of Philosophy in Climate Physics and Chemistry Abstract Methane (CH4), nitrous oxide (N2O) and sulfur in India and are used for measurement- based assessment of emissions. Several features are identified are investigated to better quantify some of the uncertainties associated with this chemical transport model

  13. Combating Terrorism in Central Asia: Explaining Differences in States' Responses to Terror

    E-Print Network [OSTI]

    Omelicheva, Mariya Y.


    This work examines differences in the level of violence of counterterrorism measures adopted by Central Asian states. Why do some Central Asian governments opt for wanton repression in the name of the struggle with terrorism, ...

  14. Policy Paper 35: Energy and Security in Northeast Asia: Fueling Security

    E-Print Network [OSTI]

    Calder, Kent; Fesharaki, Fereidun; Shirk, Susan L.; Stankiewicz, Michael


    stretching from energy-rich Sakhalin in the Northeast,Korea, while that from Sakhalin could be shipped by pipelinefor access to the Sakhalin Island or Spratly Island oil

  15. In Asia, there are two distinct types of chum salmon (Oncorhynchus

    E-Print Network [OSTI]

    - ing Kamchatka, the Sea of Okhotsk, the east coast of Sakhalin Island, and the Amur River. Later, and populations from Pri- morye, Sakhalin Island, and north- east Russia were the most distinct. Microsatellite

  16. Policy Paper 36: Energy and Security in Northeast Asia: Supply and Demand, Conflict and

    E-Print Network [OSTI]

    Fesharaki, Fereidun; Banaszak, Sarah; WU, Kang; Valencia, Mark J.; Dorian, James P.


    field in Indonesia and Sakhalin in Russia are likely to befield in Indonesia and Sakhalin, are almost certain to beas well as on and offshore Sakhalin is- land, in the Russian

  17. Local People, National Parks, and International Conservation Movements: Conflicts over Nature in Southeast Asia

    E-Print Network [OSTI]

    Rodriguez, Steven Martin


    Socity & Global Environmental Governance. Albany: SUNY,the rise of “global environmental governance” in the 1960sdevelopment of global environmental governance has largely

  18. Policy Paper 37: Energy and Security in Northeast Asia: Proposals for Nuclear Cooperation

    E-Print Network [OSTI]

    Kaneko, Kumao; Suzuki, Atsuyuki; Choi, Jor-Shan; Fei, Edward


    power reactors (22 boiling water reactors (BWRs), 22 PWRs,two advanced boiling water reactors (ABWRs) at Kashiwazaki-

  19. Proceedings of PACLIC 19, the 19th Asia-Pacific Conference on Language, Information and Computation.

    E-Print Network [OSTI]

    ' wai4ce4 `outside' c. nei4xiao1 `sell domestically' wai4xiao1 `export' d. zai4 huang2gong1 zhi1 nei4 `in the palace' zai4 huang2gong1 zhi1 wai4 `out of the palace'. e. yi4bai3 kong1chi3 yi3nei4 `within's tenure' *ren4wai4 b. *nei4guo2 wai4guo2 `foreign country' *nei4qi1 wai4qi1 `maternal relatives' nei4

  20. Public Health in East and Southeast Asia: Challenges and Opportunities in the Twenty-First Century

    E-Print Network [OSTI]

    Detels, Roger; Sullivan, Sheena G.; Tan, Chorh Chuan


    an outcome study of anorexia nervosa. Singapore Med J, 48,disorders, especially anorexia nervosa, were initially

  1. Drinking Water Quality and Child Health in South Asia: The Role of Secondary Contamination

    E-Print Network [OSTI]

    Ercumen, Ayse


    DPHE.  2001.  Arsenic  contamination  of  groundwater  in  for  microbial  contamination  of  well  water.   J.  al.  2011.  Fecal   contamination  of  shallow  tubewells  

  2. Do biomass burning aerosols intensify drought in equatorial Asia during El Niño?

    E-Print Network [OSTI]

    Tosca, M. G; Randerson, J. T; Zender, C. S; Flanner, M. G; Rasch, P. J


    A view from Sumatra, in: Forest Fires and Regional Haze inreleased from peat and forest fires in Indonesia duringto the 1997 Indonesian forest fire, Geophys. Res. Lett. ,

  3. Domestic Violence Lawmaking in Asia: Some Innovative Trends in Feminist Lawmaking

    E-Print Network [OSTI]

    de Silva de Alwis, Rangita


    Confer- ence in Islamabad, Pakistan (May 3, 2005). 31. SeeId. 103. Khurram Shahzad, Pakistan moves to outlaw domesticdomestic violence"). 173. Pakistan Act, supra note 65, § 2.

  4. Public Health in East and Southeast Asia: Challenges and Opportunities in the Twenty-First Century

    E-Print Network [OSTI]

    Detels, Roger; Sullivan, Sheena G.; Tan, Chorh Chuan


    Fuel or tobacco combustion Carbon monoxide (CO) RemodelingCarbon monoxide (CO) Reactions of NOx and other volatile organic compounds in the atmosphere ­ Ozone (O ) Fossil fuel combustion

  5. Ice, Snow and Water: impacts of climate change on California and Himalayan Asia

    E-Print Network [OSTI]

    Fenner, R. A.


    BRIEFING NOTE  Ice, Snow  and Water: impacts of climate of declining mountain snows and glacier retreat  in impacts of declining mountain snows on water availability in

  6. Cultures and Markets in Asia: Money, Exchange and Finance Summer 2015, Session B

    E-Print Network [OSTI]

    Post, David M.

    , changing gender roles, and rapid urbanization enable economic growth, produce new power relations:// sources/understanding-and-avoiding-plagiarism. Additional Notes 1. Cellphones

  7. Nuclear power programs in developing countries of the world: Southeast Asia

    SciTech Connect (OSTI)


    This article reviews the present and future status of the nuclear industry in the developing nations of China, North Korea, Thailand, Indonesia, and the Philippines. Each of the countries has a booming export-driven economy, which is turn requires considerable new generating capacity. The nuclear option is being considered as a provider of much of this additional capacity. China is committed to an extensive nuclear power program, and Indonesia has an ambitious plan to have seven to twelve reactors in service by the year 2015. North Korea will receive two LWRs to replace its current non-power nuclear units. The nuclear option is still under discussion in the Philippines and in Thailand.

  8. Emerging nuclear programs in Asia: The Phillipines, Thailand, Indonesia, and Pakistan

    SciTech Connect (OSTI)

    Williams, M.L.


    This article is a review of the potential for nuclear energy development in the developing nations of Pakistan, Indonesia, Thailand, and the Philippines. In each country, there is a substantial need for new generating capacity, and each is exploring the idea of having nuclear energy supply a meaningful portion of this new capacity. Of the four countries, only Pakistan is currently a nuclear operator, and one vintage CANDU plant in operation and the Chashma unit under construction. Thailand and Indonesia have ambitious plans to have 12 reactors in service by the year 2015.

  9. Local People, National Parks, and International Conservation Movements: Conflicts over Nature in Southeast Asia

    E-Print Network [OSTI]

    Rodriguez, Steven Martin


    Biology 13 (1999): 1247-50; Henning Borchers, Jurassicand History 5 (1999): 257-292. Borchers, Henning. Jurassic

  10. PACIFIC ECONOMIC BULLETIN Pacific Economic Bulletin Volume 22 Number 1 March 2007 Asia Pacific Press

    E-Print Network [OSTI]

    , Malaysia, and Russia, and claimed that1 · each year, US$23 billion of forest products are produced globally traded globally is of suspicious origin, and · if all exports associated with illegally harvested logs would enable the United States to increase its sawnwood, wood panel and roundwood exports by over US$460

  11. Impacts of a nuclear war in South Asia on rice production in Mainland China

    E-Print Network [OSTI]

    Robock, Alan

    of nuclear weapons by the superpowers would be so catastrophic that we avoided such a tragedy for the first four decades after the invention of nuclear weapons. The realization, based on research con- ducted-size (15 kt) nuclear weapons to at- tack the other's most populated urban areas. Based on the analysis

  12. Brief Profile On Tobacco Health Warnings in the South-East Asia Region

    E-Print Network [OSTI]

    World Health Organization


    package of tobacco products and any outside packaging and labellingpackage of tobacco products and any outside packaging and labellingpackage of tobacco products and any outside packaging and labelling

  13. An investigation of rainfall characteristics and patterns in the Mekong Delta of Southeast Asia 

    E-Print Network [OSTI]

    Klein, Frank J


    INDEX STATION PAIR TSN-5006 BIEN HQA-5022 MONTH BASE STATION 0 -1 +1 OTHER STATION *We 'kA'**'kite%'4'*****'k%%%**%%***ee%e * * 0 * 31 26 2 * 59 * * * * -1 * 6 68 8 * 82 * * * * +1 * 0 4 5 * 9 * * ee***eee 'ke...

  14. Africa n visitatori Asia n visitatori America Latina n visitatori Algeria 109 India 348 Brasile 131

    E-Print Network [OSTI]

    Brasile 131 Nigeria 86 Iran 150 Argentina 78 Egitto 66 Cina 137 Colombia 71 Sud Africa 63 Pakistan 85

  15. Spatial patterns of Holocene glacier advance and retreat in Central Asia Summer Rupper a,

    E-Print Network [OSTI]

    Roe, Gerard

    dated. This is true, for example, in the Pacific coast of the United States, South America, New Zealand February 2008 Available online 8 August 2009 Keywords: Climate Paleoclimate Glaciers Energy balance Monsoon

  16. Policy Paper 37: Energy and Security in Northeast Asia: Proposals for Nuclear Cooperation

    E-Print Network [OSTI]

    Kaneko, Kumao; Suzuki, Atsuyuki; Choi, Jor-Shan; Fei, Edward


    sodium leakage accident of the prototype fast breeder reactorsodium leak at Monju fast good operating safety reactorsodium leak in the secondary loop of the 280 MWe Monju fast breeder reactor (

  17. The logic of regionalism: a comparative study of regionalism in Europe and Asia 

    E-Print Network [OSTI]

    Kim, Mi-Kyung


    the balance between the state?s public power and the state?s market governability, consequently resulting in a political convergence toward a majoritarian political system based on individualism and delegative democracy. However, regionalism is realized...

  18. Final Report of Summer Research 2007 Vietnam and Southeast Asia, June 6 – August 21

    E-Print Network [OSTI]

    Morris-Jung, Jason


    Environmental Assessment of hydro-power development in QuangEnvironmental Assessment of hydro-power development on theand environmental impacts of hydro-power development on the

  19. Policy Paper 37: Energy and Security in Northeast Asia: Proposals for Nuclear Cooperation

    E-Print Network [OSTI]

    Kaneko, Kumao; Suzuki, Atsuyuki; Choi, Jor-Shan; Fei, Edward


    including the safety of nuclear energy production; theenergy production are lowered; and unfavorable public perception of reactor safety,energy production. It also provided proof of the transnational nature of nuclear safety.

  20. Meteorological controls on glacier mass balance in High Asia L.A. RASMUSSEN

    E-Print Network [OSTI]

    Rasmussen, L.A.

    influence on the rivers in the Aral Basin (Kaser and others, 2010). A related potential impact of glacier, hydropower and domestic consumption (Barnett and others, 2005). Delay of flow is caused by temporary

  1. Migration of seismicity and earthquake interactions monitored by GPS in SE Asia triple junction: Sulawesi, Indonesia

    E-Print Network [OSTI]

    McCaffrey, Robert

    : Sulawesi, Indonesia Christophe Vigny,1 Hugo Perfettini,1,2 Andrea Walpersdorf,1,2 Anne Lemoine1 Wim Simons] Global Positioning System (GPS) measurements made in Sulawesi, Indonesia, from 1992 to 1999 detected, fault, fluids, seismotectonics, earthquake, Indonesia Citation: Vigny, C., et al., Migration

  2. Migration of seismicity and earthquake interactions monitored by GPS in SE Asia triple junction: Sulawesi, Indonesia

    E-Print Network [OSTI]

    Vigny, Christophe

    : Sulawesi, Indonesia Christophe Vigny,1 Hugo Perfettini,1,2 Andrea Walpersdorf,1,2 Anne Lemoine,1 Wim Simons] Global Positioning System (GPS) measurements made in Sulawesi, Indonesia, from 1992 to 1999 detected, fault, fluids, seismotectonics, earthquake, Indonesia 1. Introduction [2] The Eurasian, Philippine Sea

  3. Policy Paper 35: Energy and Security in Northeast Asia: Fueling Security

    E-Print Network [OSTI]

    Calder, Kent; Fesharaki, Fereidun; Shirk, Susan L.; Stankiewicz, Michael


    and petroleum products to Japan, the largest amount Japan received from any Asian country other than Indonesia.

  4. E-Aggregation: The Present and Future of Online Financial Services in Asia-Pacific

    E-Print Network [OSTI]

    Fujii, Hiroshi


    Many financial institutions have built websites to inform and attract customers. Financial aggregation present an opportunity by which they can build stronger ...

  5. Variability of aerosol optical properties derived from in situ aircraft measurements during ACE-Asia

    E-Print Network [OSTI]

    Clarke, Antony

    , and Cameron S. McNaughton Department of Oceanography, University of Hawaii, Honolulu, Hawaii, USA Received 29 and artifacts are characterized using in-flight measurements of particle-free air and measurements dominant components, fine-mode pollution and coarse-mode mineral dust, were observed to vary independently

  6. Three-dimensional simulations of inorganic aerosol distributions in east Asia during spring 2001

    E-Print Network [OSTI]

    . The Asian outflow during March and April of 2001 is heavily polluted with high aerosol loadings. Under size and gas-aerosol distributions along air mass trajectories, a situation that is analyzed in detail, University of Hawaii, Honolulu, Hawaii, USA. Copyright 2004 by the American Geophysical Union. 0148


    E-Print Network [OSTI]

    in Endangered Species. For further information please contact: R. Juge Gregg, Washington, DC, rjgregg for ecosystem services provided by forests such as watershed protection, biodiversity and carbon storage. Forest NGOs and investment institutions. For further information, please contact: Kerstin Canby, kcanby

  8. Policy Paper 36: Energy and Security in Northeast Asia: Supply and Demand, Conflict and

    E-Print Network [OSTI]

    Fesharaki, Fereidun; Banaszak, Sarah; WU, Kang; Valencia, Mark J.; Dorian, James P.


    Kazuya, 1996. "Long-Term Energy Supply/Demand Outlook for19 Energy Supply Security and Infrastructure Issues inseek to project future energy supply and demand for Japan,

  9. Policy Paper 05: Regional Cooperation and Environmental Issues in Northeast Asia

    E-Print Network [OSTI]

    Hayes, Peter; Zarsky, Lyuba


    Energy issues, especially clean coal com- bustion (China,of air pollution, provision of clean coal technol- ogy,

  10. G?ru?a Medicine: A History of Snakebite and Religious Healing in South Asia

    E-Print Network [OSTI]

    Slouber, Michael


    Venkitangu, Thrissur, Kerala: Ullannoor Mana Trust.Ithihyamala: Fables of Kerala. New Delhi: Children’s BookA Study from Central Kerala. ” Indian J Pediatr. Lalou, M. (

  11. Public Health in East and Southeast Asia: Challenges and Opportunities in the Twenty-First Century

    E-Print Network [OSTI]

    Detels, Roger; Sullivan, Sheena G.; Tan, Chorh Chuan


    of dengue fever is achievable through mosquito control, useof the Aedes mosquito, vector for the dengue fever virus, toDengue fever is transmitted by the bite of an Aedes mosquito

  12. Spectral absorption of solar radiation by aerosols during ACE-Asia R. W. Bergstrom,1

    E-Print Network [OSTI]

    slightly with wavelength in the visible region. We interpret these results in light of the two absorbing by black carbon mixed with nonabsorbing pollution aerosols. For the 12 April case we attempt to estimate a relatively complicated aerosol mixture of both industrial pollution (including black carbon) and mineral dust

  13. Policy Paper 37: Energy and Security in Northeast Asia: Proposals for Nuclear Cooperation

    E-Print Network [OSTI]

    Kaneko, Kumao; Suzuki, Atsuyuki; Choi, Jor-Shan; Fei, Edward


    radioactive materials involved is listed below: Activity at time of dumping Location (Ci) Liquid Effluent

  14. Policy Paper 37: Energy and Security in Northeast Asia: Proposals for Nuclear Cooperation

    E-Print Network [OSTI]

    Kaneko, Kumao; Suzuki, Atsuyuki; Choi, Jor-Shan; Fei, Edward


    construction of floating nuclear power plants similar tonuclear-powered icebreakers. The floating power plants would

  15. International GSI-Asia Geosynthetics Conference Taichung, Taiwan, Nov. 16~18, 2010

    E-Print Network [OSTI]

    Zornberg, Jorge G.

    by the inclusion of nonwoven geotextiles under the fine-grained soil component of the cover. 1. INTRODUCTION), or a porous geosynthetic (e.g. a nonwoven geotextile). This phenomenon was initially observed in geotechnical geomaterials with relatively large pores (e.g. gravel, geotextiles) decreases faster than that of fine

  16. Pastoralist Mobility and Social Controls In Inner Asia: Experiments Using Agent-Based Modeling

    E-Print Network [OSTI]

    Rogers, J. Daniel


    of pastoralist social structure have the greatest impact onforms of social structure that had the greatest impact on

  17. Does Social Capital Lead to Support for Democracy in East Asia?

    E-Print Network [OSTI]

    Jou, Willy


    for democracy. Instead, what impact social capital exerts onfor examining the impact of social capital on democraticIn other words, does the impact of social capital depend on


    E-Print Network [OSTI]

    wood energy data, leading to best estimates of future consumption. It also tries to estimate. The work continues, particularly in much- needed efforts to strengthen the available wood energy data-use Conversion 22 3.7 Quotes 23 4. Selected Wood Energy Data 27 4.1 Energy Balances in RWEDP Member-countries 27

  19. Middlemen and marcher states in Central Asia and East/West Empire Synchrony

    E-Print Network [OSTI]


    Alexis Alvarez, Hiroko Inoue, Kirk Lawrence, Anders Carlson,Carlson, Ben Fierro and Kirk Lawrence 2006 “Upward sweeps ofAlvarez, Hiroko Inoue, Kirk Lawrence and Anders Carlson

  20. Policy Paper 37: Energy and Security in Northeast Asia: Proposals for Nuclear Cooperation

    E-Print Network [OSTI]

    Kaneko, Kumao; Suzuki, Atsuyuki; Choi, Jor-Shan; Fei, Edward


    security, nuclear energy, and environment. It also indicatesbased on its nuclear submarine technology Energy Environmentalternatives? Environment--Use of nuclear energy can lessen


    E-Print Network [OSTI]

    Di Pillo, Gianni

    .8273 ABSTRACT The paper describes the production planning model of the whole supply chain and the ICT Italian motorcycle firm. The management model is based on a master production plan with increasing details as a mean to ensure flexible dispatch and control of finished product, leaving the manufacturing of all

  2. Policy Paper 37: Energy and Security in Northeast Asia: Proposals for Nuclear Cooperation

    E-Print Network [OSTI]

    Kaneko, Kumao; Suzuki, Atsuyuki; Choi, Jor-Shan; Fei, Edward


    reactors (LWRs) using low-enriched uranium (LEU) as fuelenrichment plant for low-enriched uranium, and a subcritical

  3. The East Asia Regional Advisory Board The Fuqua School of Business

    E-Print Network [OSTI]

    Reif, John H.

    Amina on the Advanced Coal Technology group of the U.S.-China Clean Energy Research Colloboration (CERC environmental engineering and clean coal development company with deep expertise and broad R&D activities), a bilaterally funded organization that facilitates U.S.-China cooperation to advance clean energy technologies

  4. Quantifying emissions of greenhouse gases from South Asia through a targeted measurement campaign

    E-Print Network [OSTI]

    Ganesan, Anita Lakshmi


    Methane (CH 4 ), nitrous oxide (N20) and sulfur hexafluoride (SF6) are powerful greenhouse gases with global budgets that are well-known but regional distributions that are not adequately constrained for the purposes of ...

  5. Achieving population-level immunity to rabies in free-roaming dogs in Africa and Asia

    E-Print Network [OSTI]

    Morters, Michelle K.; McKinley, Trevelyan J.; Horton, Daniel L.; Cleaveland, Sarah; Schoeman, Johan P.; Restif, Olivier; Whay, Helen R.; Goddard, Amelia; Fooks, Anthony R.; Damriyasa, I. Made; Wood, James L. N.


    categorical and measured by direct observation and questionnaire at the time of vaccination (gender, age class, pregnancy, lactation, sterilisation status [Bali only], intestinal parasites [Zenzele only]) or within 6 weeks of vaccination (body condition... . There was an approximately even ratio of male to female dogs in Zenzele, but the ratio was skewed towards males (approximately 75%) in Bali. Less than 2% of dogs were sterilised in Zenzele, but castration of juvenile male dogs by community members was common in Bali...

  6. Palaeoenvironment and ecology of the middle Cretaceous Grebenka ora of northeastern Asia

    E-Print Network [OSTI]

    Rees, Allister

    Received 10 November 2000; accepted 11 December 2001 Abstract The Grebenka flora, from the main exposure with biostratigraphic correlation of the plant-bearing non-marine beds with marine units of the Krivorechenskaya floodplain aggradation indicate that the 100-m-thick plant-bearing volcaniclastic floodplain succession

  7. G?ru?a Medicine: A History of Snakebite and Religious Healing in South Asia

    E-Print Network [OSTI]

    Slouber, Michael


    for Remov- ing Snake’s Poison. ” In Lucr?rile SimpozionuluiM.K. (2010). “Traditional Poison- healing System in Kerala:to be wholly about curing poison. I have seen a few versions

  8. The role of opacity and transparency in achieving strategic stability in South Asia.

    SciTech Connect (OSTI)

    Rajain, Arpit (New Delhi, India); Ashraf, Tariq Mahmud (Islamabad, Pakistan)


    According to international relations theory, deterrence can be used as a tool to achieve stability between potentially hostile nations. India and Pakistan's long history of periodic crises raises the question of how they can achieve deterrence stability. 'Transparency' describes the flow of information between parties and plays a key role in establishing a deterrence relationship. This paper studies the balance needed between opacity and transparency in nuclear topics for the maintenance of deterrence stability between India and Pakistan. States with nuclear weapons are postulated to implement transparency in four categories: potential, capability, intent, and resolve. The study applies these categories to the nuclear components of the ongoing India-Pakistan Composite Dialogue Working Group for Peace and Security including CBMs. To focus our efforts, we defined four scenarios to characterize representative strategic/military/political conditions. The scenarios are combinations of these two sets of opposite poles: competition - cooperation; extremism - moderation (to be understood primarily in a religious/nationalistic sense). We describe each scenario in terms of select focal areas (nuclear doctrine, nuclear command and control, nuclear stockpile, nuclear delivery/defensive systems, and conventional force posture). The scenarios help frame the realm of possibilities, and have been described in terms of expected conditions for the focal areas. We then use the conditions in each scenario to prescribe a range of information-sharing actions that the two countries could take to increase stability. We also highlight the information that should not be shared. These actions can be political (e.g., declarations), procedural (e.g., advance notice of certain military activities), or technologically based (e.g., seismic monitoring of the nuclear test moratorium).

  9. Impacts of different cumulus physics over south Asia region with case study tropical cyclone Viyaru

    E-Print Network [OSTI]

    Fahad, Abdullah Al


    Tropical Cyclone Viyaru, formerly known as Cyclonic Storm Mahasen was a rapidly intensifying, category 01B storm that made landfall in Chittagong, Bangladesh on the 16th of May, 2013. In this study, the sensitivity of numerical simulations of tropical cyclone to cumulus physics parametrization is carried out with a view to determine the best cumulus physics option for prediction of the cyclones track, timing, and central pressure evolution in the Bay of Bengal. For this purpose, the tropical cyclone Viyaru has been simulated by WRF ARW in a nested domain with NCEP Global Final Analysis(FNL) data as initial and boundary conditions. The model domain consists of one parent domain and one nested domain. The resolution of the parent domain is 36 km while the nested domain has a resolution of 12 km. Five numerical simulations have been done with the same micro-physics scheme (WSM3), planetary boundary layer scheme,NOAH land surface scheme but different Cumulus Parametrization scheme. Four cumulus Parametrization sc...

  10. Brief Profile On Tobacco Health Warnings in the South-East Asia Region

    E-Print Network [OSTI]

    World Health Organization


    Tobacco Use Disorder. 5. Bangladesh. 6. Bhutan. 7. India. 8.of People’s Republic of Bangladesh, Ministry of Health andof People’s Republic of Bangladesh, Ministry of Health and

  11. Drinking Water Quality and Child Health in South Asia: The Role of Secondary Contamination

    E-Print Network [OSTI]

    Ercumen, Ayse


    Clusters  Survey  Bangladesh  2009.  Key  Findings.  of  groundwater  in  Bangladesh.  Kinniburgh,  D.G.   and  effectiveness  in  Bangladesh.  Am.  J.  Trop.  Med.  Hyg.  

  12. The Earliest Bronze Age in Southwest Asia (3100-2700 BC) ... Henry Wright

    E-Print Network [OSTI]

    White, Douglas R.

    southeast to northwest across the Mesopotamia and the Zagros-Taurus front ranges in the heart of the Middle


    E-Print Network [OSTI]

    Evans, Jason

    (Taurus and Caucasus Ranges) and to the east (Zagros Plateau and Elburz Mountains). Topography along with respect to two hypotheses: (1) that elevated heating by the Zagros Plateau of Iran causes subsidence

  14. Domestic Violence Lawmaking in Asia: Some Innovative Trends in Feminist Lawmaking

    E-Print Network [OSTI]

    de Silva de Alwis, Rangita


    to criminalize all forms of violence against women." Seerec- ognition of all forms of violence against women as

  15. Do biomass burning aerosols intensify drought in equatorial Asia during El Niño?

    E-Print Network [OSTI]

    Tosca, M. G; Randerson, J. T; Zender, C. S; Flanner, M. G; Rasch, P. J


    fication of drought-induced biomass burning in Indonesiavariability in global biomass burning emissions from 1997 toChemistry and Physics Do biomass burning aerosols intensify

  16. The United States’ Grand Strategy in the Asia-Pacific Region

    E-Print Network [OSTI]

    MAHNKEN, Thomas G.


    Econom- ic Geography and National Security at the U.S. NavalPerry and former National Security Advisor Stephen Hadleyand attention to, national security will likely be limited

  17. Ganging up on Jolly Roger in Asia : International cooperation and maritime piracy

    E-Print Network [OSTI]

    He, Ruijie


    As non-traditional security threats such as terrorism and organized transnational crime gain greater prominence around the globe, the need for international cooperation against these non-state actors has consequently ...

  18. U.S. Support for Philippine Dictatorship: Threat to Peace and Security in Asia

    E-Print Network [OSTI]

    Schirmer, Daniel Boone


    Srhirmer representing The Philippines Information Tidier in.U.S. Support for Philippine Dictatorship: Threat to Peaceaf the fjjst year in the Philippines that also merit The

  19. Ice, Snow and Water: impacts of climate change on California and Himalayan Asia

    E-Print Network [OSTI]

    Fenner, R. A.


    of Climate Change on Water, Biodiversity and Livelihoods”Dallas 5. The United Nations World Water Development Report3 (2009) “Water in a Changing World” Unesco Publishing (

  20. 36 BOSTONIA Fall 2010 PHOTOGRAPH BY ASIA KEPKA to make the

    E-Print Network [OSTI]

    Spence, Harlan Ernest

    to optimize the conver- sion and allow it to turn coal, coke, and other carbon-based fuel into pipeline Ways to Get There Getting the Dirt Out A new and improved way to turn coal into clean fuel 1 BY ART-sided industrial building. In the shadow of Brayton, the largest coal burning plant in New England, it looks like

  1. Diversity of Low Chill Peaches (Prunus persica) from Asia, Brazil, Europe and the USA 

    E-Print Network [OSTI]

    Anderson, Natalie A.


    , Arithmetic Mean) method. A wide range of diversity was detected, from 0.33 coefficient of similarity amongst the Thai peaches to 0.97 between two Brazilian peaches. The most distant clusters were the low chill peaches from Thailand and Taiwan and the local...

  2. Race and the Violence of Love : : Family and Nation in U.S. Adoptions from Asia

    E-Print Network [OSTI]

    Myers, Kit


    Blogs to Enhance Critical Reflection and Community of Practice. ” Journal of Educational Technology &

  3. Between Trade and Legitimacy, Maritime and Continent: The Zheng Organization in Seventeenth-Century East Asia

    E-Print Network [OSTI]

    Hang, Xing


    it, the Qing maintained a garrison until the late nineteenthreach a greatly relieved garrison. 120 Liang’s decision tono response from the garrison, planned to storm Nanjing the

  4. DOI: 10.1002/asia.201000560 Supramolecular Synthons in Designing Low Molecular Mass Gelling Agents

    E-Print Network [OSTI]

    Raghavan, Srinivasa

    ) show moderate to good gela- tion abilities with various solvents, in- cluding commercial fuels on these data, in addition to the single-crystal structures of 5 gelator salts. Analysis of the FT-IR and 1 H of Science 2A & 2B Raja S. C. Mullick Road, Jadavpur, Kolkata-700032, West Bengal (India) Fax: (+91

  5. Asian-Pacific Economic Literature ANU College of Asia & the Pacific

    E-Print Network [OSTI]

    Share of bio-fuels in total road-fuel consumption, in energy terms Source: OECD (2008). Brazil conditions. Introduction Heavy dependence on energy is becoming an increasingly important issue worldwide. As a renewable and clean energy source, bio-fuels is the development and policy choice of many countries

  6. Origin and Distribution Yellow starthistle is native to Eurasia (Asia Minor, the Mid-

    E-Print Network [OSTI]

    Maxwell, Bruce D.

    of yellow starthistle throughout the West, attributed to extensive road building, expansion of ranch- ing of this publication, all known patches in Montana have been small enough to eradicate within one to two years (shaded dispersal by wind, exemplified by those on dandelion. By creating two seed types that differ in how and when

  7. Policy Paper 37: Energy and Security in Northeast Asia: Proposals for Nuclear Cooperation

    E-Print Network [OSTI]

    Kaneko, Kumao; Suzuki, Atsuyuki; Choi, Jor-Shan; Fei, Edward


    magnets for uranium enrichment by centrifuge to Pakistan;uranium (HEU), and the expanded use of new enrichment technologies (i.e. , centrifugecentrifuges, that reduce power consumption and production costs will be very influential to the future uranium

  8. Policy Paper 37: Energy and Security in Northeast Asia: Proposals for Nuclear Cooperation

    E-Print Network [OSTI]

    Kaneko, Kumao; Suzuki, Atsuyuki; Choi, Jor-Shan; Fei, Edward


    Laser Isotope Separation (AVLIS) and advanced centrifuges,of the U.S. GDPs and deploy AVLIS over the next two decades.and France also have on-going AVLIS development programs. In

  9. Overcoming shadows of the past : post-conflict interstate reconciliation in East Asia and Europe

    E-Print Network [OSTI]

    He, Yinan, 1970-


    This dissertation explores the origins of interstate reconciliation after traumatic conflicts, mainly through the comparative study of postwar Sino-Japanese and (West) German-Polish relations. While Germany and Poland have ...

  10. It takes more than a village : mobilization, networks, and the state in Central Asia

    E-Print Network [OSTI]

    Radnitz, Scott (Scott B.)


    This dissertation develops and demonstrates a theory to account for the outbreak of mass mobilization in authoritarian settings. Two conditions make the expansion of protest across community boundaries more likely: (1) low ...

  11. Multiparameter adjoint tomography of the crust and upper mantle beneath East Asia: 1. Model

    E-Print Network [OSTI]

    Niu, Fenglin

    Resource and Prospecting, and Unconventional Natural Gas Institute, China University of Petroleum, Beijing

  12. Policy Paper 37: Energy and Security in Northeast Asia: Proposals for Nuclear Cooperation

    E-Print Network [OSTI]

    Kaneko, Kumao; Suzuki, Atsuyuki; Choi, Jor-Shan; Fei, Edward


    Japan, and Russia. Spent fuel reprocessing would separateThis includes spent fuel reprocessing and recycling ofit is interested in spent-fuel reprocessing and recycling to

  13. Between Trade and Legitimacy, Maritime and Continent: The Zheng Organization in Seventeenth-Century East Asia

    E-Print Network [OSTI]

    Hang, Xing


    and artisan crafts to shipbuilding and services. Even themade excellent wood for shipbuilding, one of the few itemsclients for processed shipbuilding timber was the Xuyuan

  14. Local People, National Parks, and International Conservation Movements: Conflicts over Nature in Southeast Asia

    E-Print Network [OSTI]

    Rodriguez, Steven Martin


    tourism industry); special developments around parks, e.g.ecotourism industry in and around the park. Hashim had beenover the timber industry. National parks were created in all

  15. Thailand-NAMA Programme for the Construction Sector in Asia | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al., 2013) |Information 5th congressional

  16. India-NAMA Programme for the Construction Sector in Asia | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas: Energy ResourcesOrder at 8, 13 (Vt. Water Res.:01 - 429Dialogue,Information NAMA

  17. NAMA-Programme for the construction sector in Asia | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformationOliver,Minnesota:Energy

  18. Energy Security and Sustainable Development in Asia and the Pacific | Open

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar2-0057-EA Jump to:of theClimateElgin,WindMap: CleanEnergy Information

  19. Brunei-Low Carbon Asia Research Network (LoCARNet) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar Energy LLC JumpBiossence JumpJerseyEconomyBridgerNationalInformation

  20. Cambodia-Low Carbon Asia Research Network (LoCARNet) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar Energy LLC JumpBiossenceBrunswick,Calendar HomeGmbH Jump to:(EC-LEDS) |

  1. China-Low Carbon Asia Research Network (LoCARNet) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar Energy LLCLtd Jump to:ChangingCNE Jump to:New EnergyPFAN)Energyin

  2. China-NAMA Programme for the Construction Sector in Asia | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar Energy LLCLtd Jump to:ChangingCNE Jump to:New

  3. Accounting for Co-benefits in Asia's Transportation Sector: Methods and

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LIST OFAMERICA'SHeavyAgencyTendo NewYanbu,InformationAbakusLLCApplications | Open

  4. Low Carbon Green Growth Roadmap for Asia and the Pacific | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar2-0057-EAInvervarLeeds,

  5. Malaysia-NAMA Programme for the Construction Sector in Asia | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop Inc Jump to: navigation, search Name:Power

  6. Myanmar-Low Carbon Asia Research Network (LoCARNet) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop Inc Jump to: navigation,Mereg GmbHMontebalitoMtMxEnergy Electric,

  7. Papua New Guinea-Lowering Emissions in Asia's Forests (LEAF) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop Inc Jump to:Newberg,Energy LLC Jump to:3 of MasonPalcanOpenRural ElInformation

  8. GE Hydro Asia Co Ltd formerly Kvaerner Power Equipment Co Ltd Kvaerner

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar2-0057-EA Jump to:ofEnia SpAFlexStock Co Ltd JumpLatinoEngineeringHangfa |

  9. Laos-Lowering Emissions in Asia's Forests (LEAF) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar2-0057-EAInvervar HydroElectricColorado:EnergyLaor Batteries LtdLowering

  10. USAID-Energy Trends in Developing Asia: Priorities for a Low-Carbon Future

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop IncIowa (Utility Company) Jump to:TucsonLLCAdministration EIA|| Open Energy

  11. United Nations Economic and Social Commission for Asia and the Pacific |

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop IncIowa (Utility Company) JumpGTZ Climate OrientedUnionUnitedKingdom:AfricaOpen

  12. Regional Community Forestry Training Center for Asia and the Pacific | Open

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b <Refurbished Projects Wind Farm JumpWestern

  13. Singapore-Low Carbon Asia Research Network (LoCARNet) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS ReportEurope GmbH Jump to:Idaho-Utah | Open

  14. Thailand-Low Carbon Asia Research Network (LoCARNet) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EISTJ AutomationTexas/Wind Resources < Texas Jump

  15. UN Economic and Social Commission for Asia and the Pacific (ESCAP) | Open

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EISTJThin Film SolarTown(LECBP) | OpenTrackI/UAA Mat-SuEnergy

  16. UN Economic and Social Commission for Asia and the Pacific | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EISTJThin Film SolarTown(LECBP) | OpenTrackI/UAA

  17. Vietnam-Low Carbon Asia Research Network (LoCARNet) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EISTJThin FilmUnitedVairexVert Investment Group

  18. Vietnam-NAMA Programme for the Construction Sector in Asia | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EISTJThin FilmUnitedVairexVert Investment GroupInformation NAMA

  19. Asia Least-Cost Greenhouse Gas Abatement Study | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EAandAmminex A SOpenAshley, Ohio: Energy Resources JumpAshworthsLeast-Cost

  20. Implementation of the Clean Development Mechanism in Asia and the Pacific |

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource History View NewGuam:on Openei |source History View NewCalifornia:

  1. Indonesia-Low Carbon Asia Research Network (LoCARNet) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource History View NewGuam:on Openei |sourceAnd Central Mississippi

  2. Indonesia-NAMA Programme for the Construction Sector in Asia | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource History View NewGuam:on Openei |sourceAnd Central MississippiInformation NAMA

  3. AIT-UNEP Regional Resource Centre for Asia and the Pacific | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop IncIowa (UtilityMichigan)data bookresult9) JumpMultipleSpringsACHP2 Jump

  4. Before the House Foreign Affairs Subcommittee on Asia, the Pacific and the

    Broader source: (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i n c i p a l De p uBUS SERVICEon Energy andInvestigations | DepartmentGlobal

  5. Philippines-Low Carbon Asia Research Network (LoCARNet) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsourceII JumpQuarterly Smart GridNorthInformationPersu

  6. Philippines-NAMA Programme for the Construction Sector in Asia | Open

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsourceII JumpQuarterly Smart GridNorthInformationPersuPlan (LCP) Jump to:Energy

  7. The Asia Pacific Clean Energy Summit in Honolulu, Hawaii | Department of

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCEDInstallers/ContractorsPhotovoltaics »TanklessResearchEnergy2 DOEThe AnnualThePotential

  8. st rait st By Salim Osman Senior Writer

    E-Print Network [OSTI]

    Chaudhuri, Sanjay

    this approach. First, as the global economic and political gravity shif ts to the Asia-Pacif ic, Moscow Vladimir Putin and other leaders have realised the need to restructure Russia's solely energy-based economy stagnation there. The energy sector, however, is the low-hanging f ruit. The Russian Far East and the East

  9. John P. Lynch: Campus Citizen, Community Educator, Classics Professor

    E-Print Network [OSTI]

    Vanderscoff, Cameron; Lynch, John P.


    Africa; and Asia and Asia Minor. And the interplay between those cultures was what enriched architecture,

  10. Eastern Frequency Response Study

    SciTech Connect (OSTI)

    Miller, N.W.; Shao, M.; Pajic, S.; D'Aquila, R.


    This study was specifically designed to investigate the frequency response of the Eastern Interconnection that results from large loss-of-generation events of the type targeted by the North American Electric Reliability Corp. Standard BAL-003 Frequency Response and Frequency Bias Setting (NERC 2012a), under possible future system conditions with high levels of wind generation.

  11. FISHING PERMIT Eastern Shore Agricultural

    E-Print Network [OSTI]

    FISHING PERMIT Eastern Shore Agricultural Research and Extension Center If all fields are not filled out, you do NOT have permission to fish! Name: ____________________________________________ Fishing Permit is valid for ONE YEAR. In return for this privilege, I agree to: 1. ABSOLVE the Eastern


    E-Print Network [OSTI]

    Prybyla, Jan S.


    energy sources which are of interest to the fast-growing nations of EastEast Asian Siberia's potential contribution to Pacific and global needs "plus the saliency of potential energyenergy crisis of 1973-74, the 1970s have been good to the free enterprise, mixed, and otherwise comparatively pluralistic countries of East

  13. Copyright 2012 by Tomokazu Takehisa 26th Pacific Asia Conference on Language,Information and Computation pages 254263

    E-Print Network [OSTI]

    are unergatives and unaccusatives, respectively. (3) a. Torakku-ni soba-o hasir-are-ta truck-DAT side-ACC run-PASS-PST `The truck ran by my side on me.' b. Titioya-ni sofaa-de ner-are-ta father-DAT couch-LOC sleep-DV-PASS-PST `The president died on us.' (Kageyama, 1996 with minor changes) This paper attempts to shed some light

  14. The Transit-Oriented Global Centers for Competitiveness and Livability: State Strategies and Market Responses in Asia

    E-Print Network [OSTI]

    Murakami, Jin


    America 2050: Where High-Speed Rail Works Best. New York:August MHSRA: Midwest High Speed Rail Association. 2009. O’2009. California High-Speed Rail Authority. SOC Website.

  15. The Transit-Oriented Global Centers for Competitiveness and Livability: State Strategies and Market Responses in Asia

    E-Print Network [OSTI]

    Murakami, Jin


    August MHSRA: Midwest High Speed Rail Association. 2009. O’2009. California High-Speed Rail Authority. SOC Website.America 2050: Where High-Speed Rail Works Best. New York:

  16. Excerpt from East Is West and West Is East: Gender, Culture, and Interwar Encounters between Asia and America

    E-Print Network [OSTI]

    Kuo, Karen


    change the title from From Feudalism to Industrialization toas exploitative as facing Japanese feudalism. In using herfor the changes from feudalism to modernity, Ishimoto

  17. D.-K. Baik (Ed.): AsiaSim 2004, LNAI 3398, pp. 694703, 2005. Springer-Verlag Berlin Heidelberg 2005

    E-Print Network [OSTI]

    Taya, Minoru

    as the magneto- superelastic analysis of a FSMA helical spring subjected to magnetic forces generated by the hybrid magnet composed of a permanent and electro magnet are compared with the experimental results shape memory alloy (FSMA) devices. The commercial code ANSYS/ Emag for magnetic analysis is combined

  18. 40 EDUCATION ABOUT ASIA Volume 12, Number 1 Spring 2007 ISTORIANS HAVE PORTRAYED the period from 1450

    E-Print Network [OSTI]

    Elman, Benjamin

    , statistical records, histories, gazetteers, legal codes, and ency- clopedias that induced elites in India natives and Westerners in India. New knowledge was in turn ordered and classified according, for example, describes how the British regime staged science in India via museums, exhibitions

  19. Funding Proposal to the Konrad-Adenauer-Stiftung (KAS) (Regional Project Energy Security and Climate Change-Asia Pacific)

    E-Print Network [OSTI]

    Po, Lai-Man

    ; urban studies, climate law) Expertise (climate change negotiations and implications for energy policy Young School of Policy Studies, Georgia State University, USA (urban planning, vulnerability assessmentFunding Proposal to the Konrad-Adenauer-Stiftung (KAS) (Regional Project Energy Security

  20. Excerpt from East Is West and West Is East: Gender, Culture, and Interwar Encounters between Asia and America

    E-Print Network [OSTI]

    Kuo, Karen


    parts of Ishimoto’s autobiography. After the war, IshimotoIshimoto wrote her autobiography in English for Americans atIn contrast, Ishimoto’s autobiography would seem to refuse a

  1. Policy Paper 47: The Changing Order in Northeast Asia and the Prospects for U.S.-Japan-CHina-Korea Relations

    E-Print Network [OSTI]

    Scalapino, Robert A.


    which would go from Sakhalin to Hokkaido. The development ofin any such development, as the Sakhalin pipeline project so

  2. Policy Paper 33: Maritime Shipping in Northeast Asia: Law of the Seas, Sea Lanes, and Security

    E-Print Network [OSTI]

    Meyrick, Stephen; Valencia, Mark; Chia, Lin Sien; Weeks, Stanley B.; Lee, Seo-hang


    and the islands of Sakhalin, the three major islands --the Russian mainland and the island of Sakhalin, (2) the LaPerouse Strait: between Sakhalin and Hokkaido, (3) the

  3. Globalized humanitarianism : U.S. imperial formation in Asia and the Pacific through the Indochinese refugee problem

    E-Print Network [OSTI]

    Sahara, Ayako


    citizen left out in Sakhalin (saharin zainichi tyosen/citizens left out in Sakhalin” became known as an issue duewho was repatriated from Sakhalin. Since 1958, he and his

  4. ---Home Yahoo! Help My Yahoo!

    E-Print Network [OSTI]

    at Rokkasho, a Japanese fishing village, but EU sources believe they would back Cadarache if Tokyo stepped

  5. ---Home Yahoo! Help My Yahoo!

    E-Print Network [OSTI]

    with South Korea had preferred Rokkasho, a remote fishing village in northeastern Japan. The ITER project

  6. Emissions of black carbon, organic, and inorganic aerosols from biomass burning in North America and Asia in 2008

    E-Print Network [OSTI]

    Jimenez, Jose-Luis

    assessment of the impact of aerosols emitted from boreal forest fires on the Arctic climate necessitates. Geophys. Res., 116, D08204, doi:10.1029/2010JD015152. 1. Introduction [2] Boreal forest fires are one the largest sources of BC emitted from boreal forest fires [Lavoué et al., 2000; Stocks et al., 2002; Conard

  7. Investigating the sources and atmospheric processing of fine particles from Asia and the Northwestern United States measured during INTEX B

    E-Print Network [OSTI]


    fuel combustion or biogenic emissions (including biomasscombustion or biogenic (including biomass burn- ing) emissions.combustion, or biogenic sources, which includes biomass burning (acetonitrile) and secondary VOCs linked to biogenic emissions.

  8. The Transit-Oriented Global Centers for Competitiveness and Livability: State Strategies and Market Responses in Asia

    E-Print Network [OSTI]

    Murakami, Jin


    Project. ” Transportation 17: 1-28. GLA: Greater LondonTransportation Systems High-Speed Rail (HSR) Investments and Urban Regeneration Opportunities in London,

  9. The report on Component 1 -Landscape Ecology and Biodiversity under the Central Asia Regional Integrated Pest Management Project,

    E-Print Network [OSTI]

    Isaacs, Rufus

    as Coordinator of Program/ICARDA. Forum/Workshop/Seminars/Conference I made Power Point presentation based of National University of Tajikistan. Dushanbe December 19-20, 2008. I made Power Point presentation based Climate Change, 7-10 November 2008, Alexandria, Egypt. The Abstracts of oral presentations was published

  10. Investigating the sources and atmospheric processing of fine particles from Asia and the Northwestern United States measured during INTEX B

    E-Print Network [OSTI]


    C. A. , Sullivan, A. P. , Peltier, R. E. , Weber, R. J. ,8, 1835–1853, 2008 R. E. Peltier et al. : Sources andR. J. , Sullivan, A. P. , Peltier, R. E. , Atlas, E. L. , de

  11. From the ACM SIGGRAPH Asia 2012 conference proceedings. Practical Hessian-Based Error Control for Irradiance Caching

    E-Print Network [OSTI]

    Zwicker, Matthias

    for Irradiance Caching Jorge Schwarzhaupt UC San Diego Henrik Wann Jensen UC San Diego Wojciech Jarosz Disney Research Z¨urich Pure Split-Sphere RMSE: 0.0901 Reference Reference (Irradiance) Bounded Split-Sphere RMSE-Sphere (clamped to the gradient and 150px max spacing) for irradiance caching. It also performs significantly

  12. Cooperative Monitoring Center Occasional Paper/4: Missile Control in South Asia and the Role of Cooperative Monitoring Technology

    SciTech Connect (OSTI)

    Kamal, N.; Sawhney, P.


    The succession of nuclear tests by India and Pakistan in May 1998 has changed the nature of their missile rivalry, which is only one of numerous manifestations of their relationship as hardened adversaries, deeply sensitive to each other's existing and evolving defense capabilities. The political context surrounding this costly rivalry remains unmediated by arms control measures or by any nascent prospect of detente. As a parallel development, sensible voices in both countries will continue to talk of building mutual confidence through openness to avert accidents, misjudgments, and misinterpretations. To facilitate a future peace process, this paper offers possible suggestions for stabilization that could be applied to India's and Pakistan's missile situation. Appendices include descriptions of existing missile agreements that have contributed to better relations for other countries as well as a list of the cooperative monitoring technologies available to provide information useful in implementing subcontinent missile regimes.

  13. The Transit-Oriented Global Centers for Competitiveness and Livability: State Strategies and Market Responses in Asia

    E-Print Network [OSTI]

    Murakami, Jin


    Residential (SR): Orchard MRT Station as an “Urban LivingResidential (SR): Orchard MRT Station as an “Urban Living

  14. Kindly supported by the Research School of Asia and the Pacific (

    E-Print Network [OSTI]

    scale structures Isabella Rosso 9.30 ­ 10:30 ENERGY and ADAPTATION Chair: Bob Webb Rooftop solar energy and governance with the focus on the voluntary carbon emissions trading scheme in China. Hao Zhang 11:00 ­ 12 Informal settlements and climate change issues in urban India. Sohail Ahmad Cultural Politics of Climate

  15. Seismic structure and ultra-low velocity zones at the base of the Earth's mantle beneath Southeast Asia

    E-Print Network [OSTI]

    Wen, Lianxing

    Seismic structure and ultra-low velocity zones at the base of the Earth's mantle beneath Southeast t We constrain seismic structure and ultra-low velocity zones near the Earth's core-mantle boundary that the strong scatterers represent ultra-low velocity zones (ULVZs). We suggest that the seismic structure

  16. Spatial distribution and size evolution of particles in Asian outflow: Significance of primary and secondary aerosols during ACE-Asia

    E-Print Network [OSTI]

    Clarke, Antony

    in the presence of pollution and mineral dust aerosol surface areas as high as 1200 mm2 cmÀ3 . Concentrations­13 nm % 5000 cmÀ3 ) in postfrontal air masses associated with offshore flow during cloud-free conditions Composition and Structure: Pollution--urban and regional (0305); 0368 Atmospheric Composition and Structure

  17. Relationships Between Emission Sources and Airmass Characteristics in East Asia1 during the TRACE-P Period2

    E-Print Network [OSTI]

    Stanier, Charlie

    . Department of Ecological Engineering, Toyohashi University of Technology, Toyohashi, Japan5 2. Center, such as ethane/CO and23 ethane/propane, by the backward trajectory could well reproduce the emission ratio and their ratio along the trajectory. From25 this analysis, the propane/ethane ratio and propane/acetylene ratio

  18. The Asialink Essays 2010 Volume 2 Published by Asialink, Sidney Myer Asia Centre

    E-Print Network [OSTI]

    of the impact of bilateral and regional trade agreements. In March, officials from eight Pacific Rim countries met in Melbourne to begin talks on a Trans-Pacific trade agreement.This follows the signing into foreign markets. With the recent completion of the first round of talks on a Trans-Pacific free trade

  19. An ancient origin for the enigmatic Flat-Headed Frogs (Bombinatoridae: Barbourula) from the islands of Southeast Asia.

    E-Print Network [OSTI]

    Brown, Rafe M.


    published data (e.g., [18,19]). All primer details are provided in Table 1. The PCR conditions used were standard and the thermal cycle profile was as follows: 94uC (3 min; 35 cycles of 94uC (30 s), 50uC [for mt genes] or 55uC [for nuc genes] (30 s), 72uC (1... AAAAAGCTTCAAACTGGGATTAGATACCCCACTAT [96] 16SH mt 39 r GCTAGACCATKATGCAAAAGGTA [97] 12SM mt 59 R GGCAAGTCGTAACATGGTAAG [98] 16SA mt 39 r ATGTTTTTGGTAAACAGGCG [99] 16SC mt 59 R GTRGGCCTAAAAGCAGCCAC [98] 16SD mt 39 r CTCCGGTCTGAACTCAGATCACGTAG [98] CXCR4-G nuc 59 R AGCAACAGTGGAARAANGC...

  20. An Ancient Origin for the Enigmatic Flat-Headed Frogs (Bombinatoridae: Barbourula) from the Islands of Southeast Asia

    E-Print Network [OSTI]

    Blackburn, David C.; Bickford, David P.; Diesmos, Arvin C.; Iskandar, Djoko T; Brown, Rafe M.


    published data (e.g., [18,19]). All primer details are provided in Table 1. The PCR conditions used were standard and the thermal cycle profile was as follows: 94uC (3 min; 35 cycles of 94uC (30 s), 50uC [for mt genes] or 55uC [for nuc genes] (30 s), 72uC (1... AAAAAGCTTCAAACTGGGATTAGATACCCCACTAT [96] 16SH mt 39 r GCTAGACCATKATGCAAAAGGTA [97] 12SM mt 59 R GGCAAGTCGTAACATGGTAAG [98] 16SA mt 39 r ATGTTTTTGGTAAACAGGCG [99] 16SC mt 59 R GTRGGCCTAAAAGCAGCCAC [98] 16SD mt 39 r CTCCGGTCTGAACTCAGATCACGTAG [98] CXCR4-G nuc 59 R AGCAACAGTGGAARAANGC...

  1. A GCM investigation of dust aerosol impact on the regional climate of North Africa and South/East Asia

    E-Print Network [OSTI]

    Gu, Y; Xue, Y; de Sales, F; Liou, KN


    Chem suggested that whether aero- sols enhance or suppresssemi-arid region. Dust aero- sols also appear in Australiaresults that the dust aero- sol effects on precipitation

  2. Central Asia IPM CRSP 2008-09 Annual Report 1 Ecologically-Based Participatory and Collaborative Research and

    E-Print Network [OSTI]

    Isaacs, Rufus

    trials (Table 1). Table 1. List of selected nectar plant species for establishing nectar strips management. Activity 1.1. Introduction of successful local nectar plants into existing vegetable farming systems in collaboration with local farmers and NGOs. Ten species of nectar plants were introduced

  3. Part II: Bilateral Consultative Arrangements Asia Memorandum of Understanding Between the American Institute in Taiwan and the Taipei

    E-Print Network [OSTI]

    the American Institute in Taiwan and the Taipei Economic and Cultural Representative Office in the United establishing U.S.-Taiwan cooperation in fisheries and aquaculture is the Memorandum of Understanding (MOU) Between the American Institute in Taiwan (AIT) and the Taipei Economic and Cultural Representative Office

  4. 9.00 -9.30 Registration CHAIR Professor Andrew MacIntyre, Dean, ANU College of Asia and Pacific &

    E-Print Network [OSTI]

    Botea, Adi

    Tea 15.00 - 16.30 Carbon sequestration in the landscape CHAIR Professor Quentin Grafton 15.00 ­ 15 Study 7: Biochar ANU researchers, Australia (TBC) 15.30 - 15.45 Case Study 8: Soil carbon Associate

  5. Globalized humanitarianism : U.S. imperial formation in Asia and the Pacific through the Indochinese refugee problem

    E-Print Network [OSTI]

    Sahara, Ayako


    Vietnam (15),” National Security Adviser: PresidentialVietnam (22),” National Security Adviser: PresidentialVietnam (13),” National Security Adviser: Presidential

  6. Space-based formaldehyde measurements as constraints on volatile organic compound emissions in east and south Asia and implications

    E-Print Network [OSTI]

    Palmer, Paul

    Space-based formaldehyde measurements as constraints on volatile organic compound emissions in east a continuous 6-year record (1996­2001) of GOME satellite measurements of formaldehyde (HCHO) columns over east (2007), Space-based formaldehyde measurements as constraints on volatile organic compound emissions

  7. ---Home Yahoo! Help My Yahoo!

    E-Print Network [OSTI]

    of Toyota Motor Corp., said he supports Japan's nuclear energy policy. "All possible energy options should at Cadarache in France. A final decision on the location is expected in December. Okuda, also chairman be ready and nuclear energy is the most suitable at present," he said. Japan has been cooperating

  8. A review of "Old Worlds: Egypt, Southwest Asia, India, and Russia in Early Modern English Writing." by John Michael Archer 

    E-Print Network [OSTI]

    Galina Yermolenko


    I examined the population trends of northern fur seals (Callorhinus ursinus) using an age-specific metapopulation model that allowed migration between rookeries. Mortality and birth rates were modified to simulate future ...

  9. Research Brief 2014/01 Experimental Forecasts of Seasonal Forecasts of Tropical Cyclone Landfall in East Asia

    E-Print Network [OSTI]

    Po, Lai-Man

    is similar to what has been observed in El Nino years (e.g. Chan 2000; Huang and Chan 2013). This is consistent with most global model results that suggest this year being likely an El Nino year (e.g. Fig. 4

  10. Research Brief 2014/02 Experimental Forecasts of Seasonal Forecasts of Tropical Cyclone Landfall in East Asia

    E-Print Network [OSTI]

    Po, Lai-Man

    southeastward as compared to the climatology. Such a difference is similar to what has been observed in El Nino that suggest this year being likely an El Nino year (e.g. Fig. 5). The numbers of TCs predicted and actually associated with El Niño and La Niña events. J. Climate, 13, 2960-2972. Chan, J. C. L. and M. Xu, 2009

  11. Experimental Forecasts of Seasonal Forecasts of Tropical Cyclone Landfall in East Asia (Updated version with Jun-Dec forecasts)

    E-Print Network [OSTI]

    Po, Lai-Man

    southeastward as compared to the climatology. Such a difference is similar to what has been observed in El Nino that suggest this year being likely an El Nino year (e.g. Fig. 5). The numbers of TCs predicted and actually associated with El Niño and La Niña events. J. Climate, 13, 2960-2972. Chan, J. C. L. and M. Xu, 2009

  12. A Comparative Context for U.S. Housing Policy: Housing Markets and the Financial Crisis in Europe, Asia, and Beyond

    E-Print Network [OSTI]

    Bardhan, Ashok; Edelstein, Robert; Kroll, Cynthia A


    A. Kroll, Editors. Global Housing Markets: Crises, Policies,2011. Carter, Tom. "The Canadian Housing Market: No Bubble?No Meltdown?" Global Housing Markets: Crises, Policies, and

  13. The onset of IndiaAsia continental collision: Early, steep subduction required by the timing of UHP metamorphism

    E-Print Network [OSTI]

    on a paleomagnetically determined slowdown of India's plate velocity, and as being at ca. 51 Ma based on the termination of the convergence rate and the termination of marine carbonate deposition. The Indian UHP rocks must have traveled MBT MCT STDS IYSZ Partial melt GHZ

  14. ---Home Yahoo! Help My Yahoo!

    E-Print Network [OSTI]

    November 2, 17:04 PM Japan, EU, others to discuss nuclear fusion reactor next week Japan, the European where they will build the world's first prototype nuclear fusion reactor, Japan's science ministry said are together working on the International Thermonuclear Experimental Reactor project will meet next Tuesday

  15. Africa N. of visitors Asia N. of visitors Latin America N. of visitors Algeria 109 India 348 Brazil 131

    E-Print Network [OSTI]

    India 348 Brazil 131 Nigeria 86 Iran 150 Argentina 78 Egypt 66 China 137 Colombia 71 South Africa 63 - CONDENSED MATTER PHYSICS (CMSP) ! 2 - MATHEMATICS (Math)! 1 - High Energy Physics (HECAP) ! 1 - Physics

  16. WORLD HEALTH ORGANIZATION SEA/EH/504 Regional Office for South-East Asia 21 April 1997

    E-Print Network [OSTI]

    California at Berkeley, University of

    , including identification of patients by the National Institute of Preventive and Social Medicine (NIPSOM jointly with NIPSOM, Rajshahi University and the Dhaka Community Hospital. The present report focuses as formulate an appropriate method/technique to evaluate arsenic problems in Bangladesh. (2) To develop risk

  17. Endohelminths from six rare species of turtles (Bataguridae) from Southeast Asia confiscated by international authorities in Hong Kong, China 

    E-Print Network [OSTI]

    Murray, Rebecca Ann


    is distributed from the Nicabar Islands, Bangladesh, and Assam, south through Burma, Thailand, Kampuchea, Vietnam, and Malaya, east in Indonesia to Sulawesi and Amboina. It is also located in the Philippines and Celebes. It inhabits lowland water bodies... vulnerable species (Hilton-Taylor, 2000). Cyclemys dentata The Asian leaf turtle is one of two members of the genus Cyclemys. It is distributed from northern India, southward through Burma, Thailand, Kampuchea, Vietnam, and Malaya, to Sumatra, Java...

  18. An intercomparison of lidar-derived aerosol optical properties with airborne measurements near Tokyo during ACE-Asia

    E-Print Network [OSTI]

    Clarke, Antony

    and 6 km over Sagami Bay southwest of Tokyo. The C-130 observation package included a tracking Sun extinction coefficients (sa $ 0.03 kmÀ1 ) derived from the airborne tracking Sun photometer, in situ optical

  19. A global aerosol model forecast for the ACE-Asia field experiment Mian Chin,1,2

    E-Print Network [OSTI]

    Chin, Mian

    layer. We attribute this ``missing'' dust source to desertification regions in the Inner Mongolia forecasting. After incorporating the desertification sources, the model is able to reproduce the observed

  20. Simulation of the Summer Monsoon Rainfall over East Asia using the NCEP GFS Cumulus Parameterization at Different Horizontal Resolutions

    SciTech Connect (OSTI)

    Lim, Kyo-Sun; Hong, Song You; Yoon, Jin-Ho; Han, Jongil


    The most recent version of Simplified Arakawa-Schubert (SAS) cumulus scheme in National Center for Environmental Prediction (NCEP) Global Forecast System (GFS) (GFS SAS) has been implemented into the Weather and Research Forecasting (WRF) model with a modification of triggering condition and convective mass flux to become depending on model’s horizontal grid spacing. East Asian Summer Monsoon of 2006 from June to August is selected to evaluate the performance of the modified GFS SAS scheme. Simulated monsoon rainfall with the modified GFS SAS scheme shows better agreement with observation compared to the original GFS SAS scheme. The original GFS SAS scheme simulates the similar ratio of subgrid-scale precipitation, which is calculated from a cumulus scheme, against total precipitation regardless of model’s horizontal grid spacing. This is counter-intuitive because the portion of resolved clouds in a grid box should be increased as the model grid spacing decreases. This counter-intuitive behavior of the original GFS SAS scheme is alleviated by the modified GFS SAS scheme. Further, three different cumulus schemes (Grell and Freitas, Kain and Fritsch, and Betts-Miller-Janjic) are chosen to investigate the role of a horizontal resolution on simulated monsoon rainfall. The performance of high-resolution modeling is not always enhanced as the spatial resolution becomes higher. Even though improvement of probability density function of rain rate and long wave fluxes by the higher-resolution simulation is robust regardless of a choice of cumulus parameterization scheme, the overall skill score of surface rainfall is not monotonically increasing with spatial resolution.

  1. Contrasting the management of livestock manures in Europe with that practised in Asia: what lessons can be learnt?2

    E-Print Network [OSTI]

    Boyer, Edmond

    , they are rarely popular unless a financial return is implied such as in biogas schemes.20 Keywords : European

  2. A Comparative Context for U.S. Housing Policy: Housing Markets and the Financial Crisis in Europe, Asia, and Beyond

    E-Print Network [OSTI]

    Bardhan, Ashok; Edelstein, Robert; Kroll, Cynthia A


    term. Recourse loan: The lender can go after some or all ofof capital sources for lenders. About two-thirds of U.S.of capital sources for lenders. Some institutional and

  3. Cooperative Monitoring Center Occasional Paper/6: Pakistani Perceptions and Prospects of Reducing the Nuclear Danger in South Asia

    SciTech Connect (OSTI)

    Kamal, N.


    The Indian and Pakistani nuclear tests in May 1998 triggered a full-blown nuclear debate. For the first time, hard-liners, moderates, and pacifists engaged in an extensive public discussion that helped to make the people of Pakistan more sensitive to the dangers of nuclear competition. Pakistan's concerns about its conventional military inferiority, both in the present and future, and the belief that nuclear capability would deter India from exerting its superior military strength, constituted the bedrock of its perception on the nuclear issue. Ofilcial Pakistani statements, both immediately after the nuclear tests and later, have advocated restraint on the issue of nuclearization, indicating cognizance of the importance of avoiding a regional nuclear arms competition, both for security and economic reasons. This paper suggests a variety of nonweaponization and nondeployment options that would serve the security interests of India and Pakistan. Besides preventing a hair-trigger situation, these options could reduce the financial and logistical burden of ensuring the safety and security of nuclear weapons as well as lower strategic threat-perceptions.

  4. Plains and Eastern Clean Line Transmission Line: Comment from...

    Office of Environmental Management (EM)

    from Block Plains and Eastern Clean Line: Arkansas and Oklahoma Plains and Eastern Clean Line Transmission Line: Comment from Block Plains and Eastern Clean Line: Arkansas and...

  5. Topic A Awardee: Eastern Interconnection Planning Collaborative...

    Energy Savers [EERE]

    policy makers Consumer and environmental interests Transmission Planning Authorities Market participants generating, transmitting or consuming electricity within the Eastern...

  6. Eastern Renewable Generation Integration Study (Presentation)

    SciTech Connect (OSTI)

    Bloom, A.


    This presentation provides a high-level overview of the Eastern Renewable Generation Integration Study process, scenarios, tools, and goals.

  7. INV . January 2009 EASTERN HEMISPHERE

    E-Print Network [OSTI]

    /6500/1998 1:6,500,000 The Mediterranean basin (bc) - C.I.A. G/5672/M4 C55/13000/2004 1:13,000,000 Geodynamic (bc) - C.I.A. G/5700/4300/1994 1:4,300,000 Europe (bc) - C.I.A. G/5700/4500/1997 non-circ 1:4,500 copies) (bc) - National Geographic Society 5671/G1/-/1986 - Eastern hemisphere narcotics - C.I.A. G/5671

  8. Eastern Renewable Generation Integration Study (Fact Sheet)

    SciTech Connect (OSTI)

    Not Available


    This one-page, two-sided fact sheet provides an overview of the Eastern Renewable Generation and Integration Study process.

  9. Plains and Eastern Clean Line

    Broader source: (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i nAandSummary Areas ofEnergy OnPeter B.EnergyInPilgrim6,and Eastern

  10. Internal and External Ethnic Assessments in Eastern Europe

    E-Print Network [OSTI]

    Ahmed, Patricia; Feliciano, Cynthia; Emigh, Rebecca Jean


    in The Gypsies of Eastern Europe, edited by David Crowe andin The Gypsies of Eastern Europe, edited by David Crowe andin The Gypsies of Eastern Europe, edited by David Crowe and

  11. Transmission Constraints and Congestion in the Western and Eastern...

    Office of Environmental Management (EM)

    Congestion in the Western and Eastern Interconnections, 2009-2012 (January 2014) Transmission Constraints and Congestion in the Western and Eastern Interconnections, 2009-2012...

  12. Plains and Eastern Clean Line Transmission Line: Comment from...

    Energy Savers [EERE]

    Plains and Eastern Clean Line Transmission Line: Comment from Marshall Hughes Plains and Eastern Clean Line Transmission Line: Comment from Marshall Hughes Comment submitted on...

  13. Advance Funding and Development Agreement: Plains & Eastern Clean...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Advance Funding and Development Agreement: Plains & Eastern Clean Line Transmission Project (September 20, 2012) Advance Funding and Development Agreement: Plains & Eastern Clean...

  14. 90E 120 150E 180 150W 120 90 60 30W 0 30E 60 DSDP Legs 196 ( ), ODP Legs 100210 ( ), IODP Expeditions 301352 ( )

    E-Print Network [OSTI]


  15. Sectoral trends in global energy use and greenhouse gas emissions

    E-Print Network [OSTI]


    Primary Energy (EJ) Centrally Planned Asia Middle East andPrimary Energy (EJ) Centrally Planned Asia Middle East andPrimary Energy (EJ) Centrally Planned Asia Middle East and

  16. Evolution of Middle Eastern Social Structures: a new model

    E-Print Network [OSTI]

    White, Douglas R.

    Evolution of Middle Eastern Social Structures: a new model Abstract The desert is small relative: evolution, endogamy, population, raiding, Bedouin,] #12;2 Evolution of Middle Eastern Social Structures

  17. Numerical Modeling of Eastern Connecticut's Visual Resources1

    E-Print Network [OSTI]

    Numerical Modeling of Eastern Connecticut's Visual Resources1 Daniel L. Civco 2/ l Submitted Conservation, The University of Connecticut, Storrs, Connecticut. / Abstract: A numerical model capable of accurately predicting the preference for landscape photographs of selected points in eastern Connecticut

  18. Eastern Renewable Generation Integration Study: Initial Results (Poster)

    SciTech Connect (OSTI)

    Bloom, A.; Townsend, A.; Hummon, M.; Weekley, A.; Clark, K.; King, J.


    This poster presents an overview of the Eastern Renewable Generation Integration Study, which aims to answer critical questions about the future of the Eastern Interconnection under high levels of solar and wind generation penetration.

  19. Copyright 2012 by Qingliang Miao, Shu Zhang, Bo Zhang, and Hao Yu 26th Pacific Asia Conference on Language,Information and Computation pages 99107

    E-Print Network [OSTI]

    "green tea", "soy", "fish oil" and "tumor diseases". Mining and drawing a full picture " HepG 2 " "It suggests that green tea c ould prevent Hum an hepatom a c ell HepG 2." Figure 1: Example, affect malignant melanoma>), (green tea, prevent, human hepatoma cell HepG2>). In order

  20. The relationships between biomass burning, land-cover/use change, and the distribution of carbonaceous aerosols in mainland Southeast Asia: A review and synthesis

    E-Print Network [OSTI]

    Shi, Tao

    1 The relationships between biomass burning, land-cover/use change, and the distribution. 793, The Ohio State University March 3, 2007 Biomass burning is a major source of black carbon directly and indirectly. Uncertainty regarding the contribution of biomass burning to the concentration

  1. A Trap At The Escape From The Trap? Demographic-Structural Factors of Political Instability in Modern Africa and West Asia

    E-Print Network [OSTI]


    Williams G. I. H. 2006. Liberia: The Heart of Darkness.In Albania, Egypt, Liberia, South Korea, and Syria,the year of civil war start Liberia occupied the first place

  2. Presented and Published by the IEEE ASIA PACIFIC MICROWAVE CONFERENCE in 2004 Biranchinath Sahu, Student Member, IEEE, and Gabriel A. Rincn-Mora, Senior Member, IEEE

    E-Print Network [OSTI]

    Rincon-Mora, Gabriel A.

    . Consequently, energy-efficient linear RF power amplifiers (PAs) are key components in mobile, battery Design Laboratory School of Electrical and Computer Engineering Georgia Institute of Technology, Atlanta power amplifiers (PAs) are critical for achieving longer battery life in state-of-the-art radio

  3. A Framework for Analysis of the Uncertainty of Socioeconomic Growth and Climate Change on the Risk of Water Stress: a Case Study in Asia

    E-Print Network [OSTI]

    Fant, C.

    The sustainability of future water resources is of paramount importance and is affected by many factors, including population, wealth and climate. Inherent in how these factors change in the future is the uncertainty of ...

  4. ISES-AP -3rd International Solar Energy Society Conference Asia Pacific Region (ISES-AP-08) Incorporating the 46th ANZSES Conference

    E-Print Network [OSTI] ABSTRACT Industrial growth of microalgae in open ponds can be strongly limited by evaporation compensatory addition of new feedstock water and the eventual recycling of the culture medium. We find in the protocol can be a small fraction of the microalgae energy yield as crude oil. This protocol should prove

  5. Column closure studies of lower tropospheric aerosol and water vapor during ACE-Asia using airborne Sun photometer and airborne in situ

    E-Print Network [OSTI]

    Sun photometer and airborne in situ and ship-based lidar measurements B. Schmid,1 D. A. Hegg,2 J. Wang (closure) between solar beam attenuation by aerosols and water vapor measured by airborne Sun photometry agreement with airborne Sun photometry in the marine boundary layer but is considerably lower in layers

  6. Key to Juniperus of Central Asia (from Turkmenistan/Iran through the former Soviet rev. 2/2011 Union, Pakistan and the Western Himalayas, including Nepal)

    E-Print Network [OSTI]

    Adams, Robert P.

    /2011 Union, Pakistan and the Western Himalayas, including Nepal) 1a. All leaves acicular (subulate, jointed

  7. Copyright 2012 by Akira Ohtani and Maria del Pilar Valverde Ibanez 26th Pacific Asia Conference on Language,Information and Computation pages 272279

    E-Print Network [OSTI]

    been hard for me.' (Inoue, 2004:76) c. Type III Senzai-wa detergent-TOP yu-ni warm water-in toke on transformational generative grammar that sentence (3)1 below shares syntactic properties with the tough sentences listed in (1b) and (2b). (3) Gakusei-ni-wa student-for-TOP kono this zisyo-ga dictionary-NOM tukai

  8. A review of "Travels in Africa Persia, and Asia the Great" by Sir Thomas Herbert, edited and with an introduction by John Anthony Butler 

    E-Print Network [OSTI]

    Aune, M. G.


    Nicky Hallett, The Senses in Religious Communities, 1600-1800: Early Modern “Convents of Pleasure.” Review by elena levy-navarro .................. 206 S u s a n n e Wo o d s , M i l t o n a n d t h e Po e t i c s o f F r e e d o m . Review... the Ancient s : The Fir s t Ita l ian Mythography. Review by catherine gimelli martin ........................................... 264 David Cast, ed. The Ashgate Research Companion to Giorgio Vasari. Review by maureen pelta, moore college of art and design...

  9. Is cost competitiveness a prerequisite for growth? : application of the theory of comparative advantage in understanding developing countries' export growth in Asia

    E-Print Network [OSTI]

    Tsubouchi, Minami


    The theory of comparative advantage argues that countries benefit from trade even without cost competitiveness and that what matters is the difference between efficiencies at which a country can produce different goods and ...

  10. Electronics Delivered To The Brain By Injection -June 09, 2015 Asian Scientist Magazine | Science, Technology and Medicine News Updates From Asia -

    E-Print Network [OSTI]

    Xie, Xiaoliang Sunney

    ultra- flexible mesh electronics which can be directly injected into the brains of mice. Once there that they could be used as minimally invasive detection or stimulation devices. Developing flexible electronics than traditional flexible electronics--could be applied to living tissue and other soft materials

  11. Aerosol optical properties measured on board the Ronald H. Brown during ACE-Asia as a function of aerosol chemical composition and

    E-Print Network [OSTI]

    chemical composition; number size distribution; and light scattering, hemispheric backscattering, pollution, volcanic, and dust sources. Presented here as a function of air mass source region are the mass: Pollution--urban and regional (0305); 0365 Atmospheric Composition and Structure: Troposphere

  12. supplement to Washington Magazine for readers throughout Asia Ye's National Water Prize 2 Kenji Yoshinari 3 Scholarship Conference in Beijing 4

    E-Print Network [OSTI]

    and the recently formed Consortium for Clean Coal Utilization (CCCU). Kristina M. Johnson, undersecretary of energy of accelerating findings that will help meet worldwide needs for energy and a clean environment. "This global; and Gary S. Calabrese, vice president of science and technology for Corning Inc., gave the afternoon

  13. Free Trade Agreements in the World Trade Organization: The Experience of East Asia and the Japan-Mexico Economic Partnership Agreement

    E-Print Network [OSTI]

    Turinov, Anna


    at 4. 51. Id. at 4-5. FREE TRADE AGREEMENTS IN THE WTO miesFREE TRADE AGREEMENTS IN THE WORLD TRADE ORGANIZATION: THEAsia's Arrival into Free Trade 3.2. Systemic

  14. Copyright 2000, Society of Petroleum Engineers Inc. This paper was prepared for presentation at the SPE Asia Pacific Oil and Gas Conference and

    E-Print Network [OSTI]

    Schechter, David S.

    is applied to a reservoir. This issue was investigated by performing water imbibition followed by CO2 gravity of different parameters such as permeability, initial water saturation, and injection schemes. We found that the efficiencies of the CO2 gravity drainage decrease as the rock permeability decreases and the initial water

  15. An Asia-Pacific Perspective Social and environmental safeguards are essential for the success of REDD+. This was a key message from the Copenhagen

    E-Print Network [OSTI]

    for the Endorsement of Forest Certification (PEFC). Governments in the South have also explored forest certification

  16. Sedimentary records of metal deposition in Japanese alpine lakes for the last 250 years: Recent enrichment of airborne Sb and In in East Asia

    E-Print Network [OSTI]

    Short, Daniel

    . Antimony is used in automobile brake pads, batteries, ceramics, glass, plastics, and flame retardants concentrations (Gebel, 1997), and In compounds are potentially pulmonary toxins, carcinogens, and teratogens

  17. Singapore Journal of Tropical Geography 27 (2006) 13 2006 Department of Geography, National University of Singapore and Blackwell Publishing Asia Pty Ltd

    E-Print Network [OSTI]

    Roy Chowdhury, Rinku


    Singapore Journal of Tropical Geography 27 (2006) 1­3 © 2006 Department of Geography, National of Geography and Regional Studies, University of Miami, Miami, Florida, USA Correspondence: Douglas O. Fuller ( This Special Issue of the Singapore Journal of Tropical Geography derives from

  18. The relevance of contemporary bronze casting in Ubon, Thailand for understanding the archaeological record of the Bronze Age in Peninsular Southeast Asia 

    E-Print Network [OSTI]

    Everly, Daniel Eugene


    A direct historical approach is used in this thesis to document the lost wax casting technique as currently practiced by indigenous metallurgists in northeastern Thailand. The smiths observed at Ban Pba Ao, Ubon Ratchathani ...

  19. In "Observation, Theory, and Modeling of Atmospheric Variability", edited by Zhu et al., World Scientific Series on Meteorology of East Asia, Vol. 3, World Scientific Publishing

    E-Print Network [OSTI]

    Bretherton, Chris

    of required research on this subject. 1. Introduction Potential global warming caused by increasing greenhouse reduce or amplify a global warming projection. Figure 1. Schematic illustration of the solar and infrared discrepancy in the magnitude of the simulated global warming in different models. In response to a doubling

  20. Cancer Prevention in Eastern North Carolina Task 3: Final Report

    E-Print Network [OSTI]

    Gopalakrishnan, K.

    1 Cancer Prevention in Eastern North Carolina Task 3: Final Report A Cancer Profile of Eastern, MPA Interim Manager, NC Comprehensive Cancer Program North Carolina Department of Health and Human University Greenville, NC 27834 Contract # 02776-12 #12;2 Project Title: Cancer Prevention in Eastern North