Powered by Deep Web Technologies
Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Superconductivity for Electric Systems Annual Peer Review Arlington, VA July 25-27, 2006Superconductivity for Electric Systems Annual Peer Review Arlington, VA July 25-27, 2006 Understanding and Pushing the Limits  

E-Print Network [OSTI]

Superconductivity for Electric Systems Annual Peer Review Arlington, VA July 25-27, 2006Superconductivity for Electric Systems Annual Peer Review Arlington, VA July 25-27, 2006 Understanding and Pushing pinning " #12;Superconductivity for Electric Systems Annual Peer Review Arlington, VA July 25-27, 2006

2

12th International Conference on Nuclear Engineering Arlington, VA, April 25-29, 2004  

E-Print Network [OSTI]

that the nuclear reactor sector has acquired over the years. Keywords: Irradiation, beam targets, high-power proton1 12th International Conference on Nuclear Engineering Arlington, VA, April 25-29, 2004 ICONE12 Laboratory, UPTON NY 11973, USA 2 Princeton University, Princeton, NJ, USA 3 KEK, Tsukuba, Japan simos

McDonald, Kirk

3

U.S. Department of Energy Hydrogen and Fuel Cells Program 2012 Annual Merit Review and Peer Evaluation Report: May 14-18, 2012, Arlington, VA  

SciTech Connect (OSTI)

This document summarizes the comments provided by peer reviewers on hydrogen and fuel cell projects presented at the fiscal year (FY) 2012 U.S. Department of Energy (DOE) Hydrogen and Fuel Cells Program and Vehicle Technologies Program Annual Merit Review and Peer Evaluation Meeting (AMR), held May 14-18, 2012, in Arlington, VA.

Not Available

2012-09-01T23:59:59.000Z

4

ILASS Americas 17th Annual Conference on Liquid Atomization and Spray Systems, Arlington, VA, May 2004 Optimal Disturbance Structure and Development on a Sheared Interface  

E-Print Network [OSTI]

ILASS Americas 17th Annual Conference on Liquid Atomization and Spray Systems, Arlington, VA, May, viscosity and mean velocity all change. In the immediate vicinity of the interface, boundary layer flow thickness), density ratio r = 0.02 and viscosity ratio m = 0.025. The OD of this two-phase flow show some

Yecko, Philip

5

Arlington, Virginia: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Virginia: Energy Resources Virginia: Energy Resources (Redirected from Arlington, VA) Jump to: navigation, search Equivalent URI DBpedia Coordinates 38.8903896°, -77.0841446° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":38.8903896,"lon":-77.0841446,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

6

ANNOUNCEMENT: ZIP Code Information.  

Science Journals Connector (OSTI)

THE U. S. Post Office Department has announced that the use of ZIP Codes will be mandatory on all domestic addresses for subscriptions and other mailings by 1 January 1967. Accordingly, the American Institute of Physics has established a procedure for obtaining the necessary information. You are requested to follow this procedure exactly.First, do not submit a change of address request consisting merely of the addition of your ZIP Code. Second, if your address changes in any other way, do include the ZIP Code of the new address. Third, and most important, be sure to furnish your ZIP Code in accordance with instructions included with all renewal invoices and renewal orders which have been sent out by the AIP.Failure to conform to this procedure may result in delays.

1965-09-27T23:59:59.000Z

7

E-Print Network 3.0 - arlington arlington texas Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

, Texas 76019-0198 T 817.272.2584 F ... Source: Corley, Bill - Department of Industrial and Manufacturing Systems Engineering, University of Texas at Arlington...

8

E-Print Network 3.0 - arlington texas usa Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Applications Robert Magnusson (UT Arlington, ... Source: Corley, Bill - Department of Industrial and Manufacturing Systems Engineering, University of Texas at Arlington...

9

Arlington County - Green Building Incentive Program | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Arlington County - Green Building Incentive Program Arlington County - Green Building Incentive Program Arlington County - Green Building Incentive Program < Back Eligibility Commercial Construction Installer/Contractor Multi-Family Residential Residential Savings Category Heating & Cooling Home Weatherization Construction Commercial Weatherization Commercial Heating & Cooling Design & Remodeling Bioenergy Solar Lighting Windows, Doors, & Skylights Heating Buying & Making Electricity Water Water Heating Wind Program Info State Virginia Program Type Green Building Incentive Provider Arlington County In October 1999, the County Board of Arlington adopted a Pilot Green Building Incentive Program using the standards established by the U. S. Green Building Council's Leadership in Energy and Environmental Design

10

DOE Electricity Advisory Committee Meeting Arlington, Virginia  

Broader source: Energy.gov (indexed) [DOE]

DOE Electricity Advisory Committee Meeting DOE Electricity Advisory Committee Meeting Arlington, Virginia October 29, 2010 Minutes EAC Members in Attendance Richard Cowart, Chair Regulatory Assistance Project The Honorable Lauren Azar, Vice Chair Wisconsin Public Utilities Commission Guido Bartels, IBM Rick Bowen, Alcoa Frederick Butler Salmon Ventures Ltd. Ralph Cavanagh Natural Resources Defense Council Lisa Crutchfield National Grid USA The Honorable Robert Curry New York State Public Service Commission José Delgado Roger Duncan Robert Gramlich American Wind Energy Association Michael Heyeck American Electric Power Joseph Kelliher NextEra Energy, Inc. Edward Krapels Anbaric Holdings Barry Lawson National Rural Electric Cooperative Association

11

Microsoft PowerPoint - [4] HVDC Technology Workshop Arlington April 2013 RevC [Compatibility Mode]  

Broader source: Energy.gov (indexed) [DOE]

Neil Kirby Neil Kirby Panel Session : State of HVDC Technologies US DOE Grid Tech Applications for High-Voltage Direct Current Transmission Technologies GRID Neil Kirby Arlington, VA April 22 nd , 2013 Agenda * HVDC Technologies * World View * Key Projects * Development Work P 2 HVDC Transmission Back to Back - Asynchronous interconnection of adjacent networks - DC Circuit is short - within the same building/station - 2 Converters in 1 Station Point to Point - Long Distance Transmission by Overhead Line or Insulated Submarine or Underground Cable or a combination of these - DC Circuit Distance according to application - DC Circuit Distance according to application - Two Converter Stations Multi-terminal - 3 or more HVDC Converter Stations on a common DC conductor - Limited installations worldwide (2 systems in service)

12

Proceedings of the American Control Conference Arlington, VA June 25-27, 2001  

E-Print Network [OSTI]

system certain desirable properties such as complete dynamic separation between side-slip and yaw rate was then tested on an experimental vehicle system. 1. Introduction The independent use of either front steering, rear steering, and differential torque steering to control the yaw rate of a vehicle is a well

Brennan, Sean

13

Proceedings of the AmericanControlConference Arlington, VA June 25-27, 2001  

E-Print Network [OSTI]

of the response curve. This is typically achieved by matching drive and sense resonant frequencies (Fig. 2c is extremely narrow. For example, a 1% fluctuation in frequency matching between drive and sense modes Variable Gain Amplifier Figure 1: Illustration of the proposed micromachined gy- roscope with control

Tang, William C

14

Proceedings of the American Control Conference Arlington, VA June 25-27, 2001  

E-Print Network [OSTI]

robustness and performance of the overall system. In particular, under normal boiler oper- ating conditions and 50 psi). The 900# header receives steam from three utility-type boilers burning refinery gas, three CO- type boilers burning coker off gas and refinery gas, and two once-through steam generators (OTSG

Marquez, Horacio J.

15

Arlington, Texas: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Texas: Energy Resources Texas: Energy Resources (Redirected from Arlington, TX) Jump to: navigation, search Equivalent URI DBpedia Coordinates 32.735687°, -97.1080656° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":32.735687,"lon":-97.1080656,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

16

VA Energy Management Action Plan  

Broader source: Energy.gov (indexed) [DOE]

VA Energy Management VA Energy Management Action Plan Ken Demers Chief, VA National Energy Business Center Purpose Cited Deficiencies Within VA's Previous Energy Program... *No comprehensive Department-wide policy *Lack of coordinated acquisition and investment strategies throughout the Administrations and Staff Offices *No uniform measurement and verification of energy usage *Unverifiable reporting mechanism *Lack of capturing "lessons learned" and best practices from previous experiences Potential Annual Savings ENERGY COST ($000) CONSUMPTION (Billion Btu) Baseline - FY 2005: $397,577 Baseline - FY 2005: 29,094 Savings Savings SOURCE OF SAVINGS FY 2007 FY 2008 Future TOTAL

17

University of Texas at Arlington Tuition Rebate Form Applicant Information  

E-Print Network [OSTI]

University of Texas at Arlington Tuition Rebate Form Applicant Information Name: Date: Last First M.I. MyMav ID#: High School Graduation Date: AN UNDERGRADUATE STUDENT MAY BE ELIGIBLE FOR A TUITION REBATE HAVE ANSWERED "YES" TO ANY QUESTIONS ABOVE, YOU ARE NOT ELIGIBLE FOR THE TUITION REBATE ACCORDING

Huang, Haiying

18

The University of Texas at Arlington EMERGENCY PROCEDURES  

E-Print Network [OSTI]

The University of Texas at Arlington EMERGENCY PROCEDURES QUICK REFERENCE GUIDE Provided By: UTA-272-3003 1 The procedures contained in this "Quick Reference Guide" are suggested for general emergency procedures developed to assist the university community in complying with safety and environmental

Texas at Arlington, University of

19

University of Texas at Arlington TEACH Grant Facts  

E-Print Network [OSTI]

University of Texas at Arlington TEACH Grant Facts The TEACH Grant Program was authorized by the U.S. Congress effective for the 2008-2009 award year. It is a non-need based program that provides grants the TEACH Grant was awarded. Students may be awarded up to the following amounts annually: Graduates 9

Huang, Haiying

20

VA's Performance Contracting Program Overview | Department of...  

Broader source: Energy.gov (indexed) [DOE]

VA's Performance Contracting Program Overview VA's Performance Contracting Program Overview Presentation-given at the Fall 2012 Federal Utility Partnership Working Group (FUPWG)...

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Category:Richmond, VA | Open Energy Information  

Open Energy Info (EERE)

VA VA Jump to: navigation, search Go Back to PV Economics By Location Media in category "Richmond, VA" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Richmond VA Virginia Electric & Power Co.png SVFullServiceRestauran... 64 KB SVQuickServiceRestaurant Richmond VA Virginia Electric & Power Co.png SVQuickServiceRestaura... 64 KB SVHospital Richmond VA Virginia Electric & Power Co.png SVHospital Richmond VA... 66 KB SVLargeHotel Richmond VA Virginia Electric & Power Co.png SVLargeHotel Richmond ... 62 KB SVLargeOffice Richmond VA Virginia Electric & Power Co.png SVLargeOffice Richmond... 69 KB SVMediumOffice Richmond VA Virginia Electric & Power Co.png SVMediumOffice Richmon... 64 KB SVMidriseApartment Richmond VA Virginia Electric & Power Co.png

22

Property:Zip | Open Energy Information  

Open Energy Info (EERE)

This is a property of type String. This is a property of type String. Pages using the property "Zip" Showing 25 pages using this property. (previous 25) (next 25) 1 10Charge Inc + 75001 + 12 Voltz Limited + LA8 9NH + 1366 Technologies + 02421 + 1Soltech Inc + 75081 + 1st Light Energy, Inc. + 953650 + 1st Mile + 2800 + 2 21 Century Solar Inc + 75042 + 21-Century Silicon, Inc. + 75081-1881 + 21st century Green Solutions LLC + 48439 + 25 x 25 America s Energy Future + 21093 + 2OC + BA1 7AB + 2degrees + OX2 7HT + 2e Carbon Access + 10280 + 3 3 Phases Energy Services LLC + CA 94129 + 3C Holding AG + 61118 + 3Degrees + 94111 + 3G Energi + TD5 7BH + 3GSolar + 97774 + 3M + 55144-1000 + 3P Energy GmbH + 19061 + 3S Industries AG Formerly 3S Swiss Solar Systems AG + CH-3006 + 3TIER + 98121 +

23

Verification Checklist Home Address: City: State: Zip:  

Broader source: Energy.gov (indexed) [DOE]

Indoor airPLUS Version 1 (Rev. 01) Verification Checklist Home Address: City: State: Zip: Section Requirements (Refer to full Indoor airPLUS Construction Specifications for details) Must Correct Builder Verified Rater Verified N/A Note: The Rev. 01 checklist has been modified to reflect only the additional Indoor airPLUS requirements and their corresponding section numbers that must be met after completing the ENERGY STAR checklists. ENERGY STAR remains a prerequisite for Indoor airPLUS certification. ENERGY STAR V3 Checklists Thermal Enclosure System Rater Checklist completed. o o Water Management System Builder Checklist completed. o o HVAC System Quality Installation Contractor Checklist completed. o o HVAC System Quality Installation Rater Checklist completed. o o

24

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

25

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Engineering and Computer Science on ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

26

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of the Arts on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

27

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

28

E-Print Network 3.0 - arlington virginia usa Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Are All Mavericks. The UT ... Source: Texas at Arlington, University of - Department of Industrial and Manufacturing Systems Engineering Collection: Engineering 3 3 IC4N 2011rd...

29

City of Arlington, Minnesota (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Arlington Arlington Place Minnesota Utility Id 828 Utility Location Yes Ownership M NERC Location MRO NERC MRO Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Service (Within City) Commercial Residential Service (Within City) Residential Residential Service (Outside City) Residential Security Lighting (175 Watt Mercury) Lighting Security Lighting (200 Watt Mercury) Lighting Security Lighting (400 Watt Mercury) Lighting Average Rates Residential: $0.0763/kWh Commercial: $0.0760/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a"

30

Arlington Heights, Illinois: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Arlington Heights, Illinois: Energy Resources Arlington Heights, Illinois: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 42.0883603°, -87.9806265° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.0883603,"lon":-87.9806265,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

31

REGULATORY MECHANISMS OF SLC39A4 (ZIP4) AND SLC39A5 (ZIP5) IN THE ADAPTIVE RESPONSE TO ZINC AVAILABILITY  

E-Print Network [OSTI]

The aims of this research were to determine how Zip4 and Zip5 are regulated in response to zinc availability and how Zip4 impacts development. Loss of Zip4 resulted in embryonic lethality. Heterozygosity negatively affected eye, heart, and brain...

Weaver, Benjamin Patrick

2009-04-06T23:59:59.000Z

32

NEW IPA Received from the VA Processing IPAs with the VA  

E-Print Network [OSTI]

NEW IPA Received from the VA Processing IPAs with the VA NEW IPA Received from the VA data and contact PDRF OSR will inform DFA/Division Admin and PI that we received the IPA department for Letter of Rehire OSR will sign/return the IPA to the VA for processing DFA/DA responsibilities: OSR

Kay, Mark A.

33

Property:Incentive/Cont2Zip | Open Energy Information  

Open Energy Info (EERE)

Zip Zip Jump to: navigation, search Property Name Incentive/Cont2Zip Property Type String Pages using the property "Incentive/Cont2Zip" Showing 25 pages using this property. (previous 25) (next 25) A AEP (Central and North) - CitySmart Program (Texas) + 75494 + AEP (Central, North and SWEPCO) - Commercial Solutions Program (Texas) + 75494 + AEP SWEPCO - CitySmart Program (Texas) + 77002-4567 + AEP SWEPCO - Commercial Solutions Program (Texas) + 75494 + AEP SWEPCO - SCORE Program (Texas) + 75494 + AEP Texas - Commercial and Industrial Energy Efficiency Rebate Program (Texas) + 79602 + AEP Texas Central Company - CitySmart Program (Texas) + 77002-4567 + AEP Texas Central Company - Commercial Solutions Program (Texas) + 77002-4567 + AEP Texas Central Company - SCORE Program (Texas) + 77210-4567 +

34

Electrostatic zipping actuators and their applications to MEMS  

E-Print Network [OSTI]

Electrostatic actuation is the most common and well-developed method of generating motion on the micro scale. To overcome the challenge of providing both high force and large displacement, electrostatic zipping actuators ...

Li, Jian, Ph. D. Massachusetts Institute of Technology

2004-01-01T23:59:59.000Z

35

NAME: STUDENT NUMBER (PID): CITY, STATE ZIP: DAYTIME PHONE NUMBER  

E-Print Network [OSTI]

NAME: STUDENT NUMBER (PID): ADDRESS: CITY, STATE ZIP: DAYTIME PHONE NUMBER: CELL PHONE NUMBER of financial institution. 14 Cell Phone Expenses 15 Other ordinary and necessary living expenses. 16 TOTAL (add

36

Property:Incentive/Cont4Zip | Open Energy Information  

Open Energy Info (EERE)

Zip Zip Jump to: navigation, search Property Name Incentive/Cont4Zip Property Type String Pages using the property "Incentive/Cont4Zip" Showing 18 pages using this property. A AEP (Central and North) - CitySmart Program (Texas) + 79602 + AEP (Central and SWEPCO) - Coolsaver A/C Tune Up (Texas) + 78401 + AEP (Central, North and SWEPCO) - Commercial Solutions Program (Texas) + 79602 + B Blue Ridge Electric Cooperative - Heat Pump Loan Program (South Carolina) + 29671 + C ComEd, Nicor Gas, Peoples Gas & North Shore Gas - Bonus Rebate Program (Illinois) + 60642 + E Energy Efficiency Fund (Electric) - Commercial and Industrial Energy Efficiency Programs (Connecticut) + 06037 + Entergy Arkansas - Commercial and Industrial Energy Efficiency Programs (Arkansas) + 72205 +

37

Property:Incentive/ContZip | Open Energy Information  

Open Energy Info (EERE)

ContZip ContZip Jump to: navigation, search Property Name Incentive/ContZip Property Type String Pages using the property "Incentive/ContZip" Showing 25 pages using this property. (previous 25) (next 25) 3 30% Business Tax Credit for Solar (Vermont) + 05633 + A AEP (Central and North) - Residential Energy Efficiency Programs (Texas) + 78746 + AEP (SWEPCO) - Residential Energy Efficiency Programs (Texas) + 75604-5926 + AEP Ohio (Electric) - Residential Energy Efficiency Rebate Program (Ohio) + 43213 + AEP Ohio (Gas) - Residential Energy Efficiency Rebate Program (Ohio) + 43213 + AEP Ohio - Commercial Custom Project Rebate Program (Ohio) + 43213 + AEP Ohio - Commercial Energy Efficiency Rebate Program (Ohio) + 43213 + AEP Ohio - Commercial New Construction Energy Efficiency Rebate Program (Ohio) + 43219 +

38

LANL Fuel Cell Research 1HFCIT Program Kick-off Meeting, Arlington, VA, February 13-14, 2007  

E-Print Network [OSTI]

Laboratory Hydrogen, Fuel Cells and Infrastructure Technologies Radoslav Adzic Paolina Atanassova Cabot fuel cell (PEFC) cathode Other objectives: · Investigate new catalyst supports and electrode structures physicochemical characterization, electrochemical and fuel cell testing · Optimize catalysts, supports

39

OU Veterans Association (OU-VA) Student Handbook / Educational Benefits  

E-Print Network [OSTI]

OU Veterans Association (OU-VA) Student Handbook / Educational Benefits VA Educational Benefits://vabenefits.vba.va.gov/vonapp. Please note that OU-VA does require a copy of your application. In the event that you

Oklahoma, University of

40

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along  

E-Print Network [OSTI]

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along: Chakravarthi, R., & VanRullen, R. (2011). Bullet trains and steam engines: Exogenous attention zips

VanRullen, Rufin

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

Guide to VA Mental Health Services  

E-Print Network [OSTI]

Guide to VA Mental Health Services for Veterans and Families Keitha R Beamer, MSN: PMHCNS, BC; CARN-AP #12;The most complex and dangerous conflicts, the most harrowing operations, and the most deadly wars.va.gov/vetdata/index.asp #12;Guiding Principals · Focus on Recovery · Coordinated Care for the Whole Person · Mental Health

Hardy, Christopher R.

42

Early Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Calcasieu Parish Public Library Central Branch 301 W. Claude St. Lake Charles 70605 #12;STATE LIBRARYEarly Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP AL Dauphin Island Sea Laboratory. Walton 32548 FL Panama City Beach Public Library 125000 Hutchison Blvd Panama City Beach 32407 FL

43

Protein folding by zipping and assembly S. Banu Ozkan*  

E-Print Network [OSTI]

Protein folding by zipping and assembly S. Banu Ozkan* , G. Albert Wu* , John D. Chodera, CA, May 2, 2007 (received for review April 13, 2006) How do proteins fold so quickly? Some denatured proteins fold to their native structures in only microseconds, on average, implying that there is a folding

Southern California, University of

44

US SoAtl VA Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

SoAtl VA SoAtl VA Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US SoAtl VA Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 4,000 8,000 12,000 16,000 US SoAtl VA Site Consumption kilowatthours $0 $300 $600 $900 $1,200 $1,500 $1,800 US SoAtl VA Expenditures dollars ELECTRICITY ONLY average per household * Virginia households consume an average of 86 million Btu per year, about 4% less than the U.S. average. * Average electricity consumption and costs are higher for Virginia households than the national average, but similar to those in neighboring states where electricity is the most common heating fuel. * Virginia homes are typically newer and larger than homes in other parts of the country. CONSUMPTION BY END USE

45

US SoAtl VA Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

SoAtl VA SoAtl VA Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US SoAtl VA Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 4,000 8,000 12,000 16,000 US SoAtl VA Site Consumption kilowatthours $0 $300 $600 $900 $1,200 $1,500 $1,800 US SoAtl VA Expenditures dollars ELECTRICITY ONLY average per household * Virginia households consume an average of 86 million Btu per year, about 4% less than the U.S. average. * Average electricity consumption and costs are higher for Virginia households than the national average, but similar to those in neighboring states where electricity is the most common heating fuel. * Virginia homes are typically newer and larger than homes in other parts of the country. CONSUMPTION BY END USE

46

DOE - Office of Legacy Management -- Reynolds Metals Co - VA 04  

Office of Legacy Management (LM)

Reynolds Metals Co - VA 04 Reynolds Metals Co - VA 04 FUSRAP Considered Sites Site: REYNOLDS METALS CO. (VA.04 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Virginia-Carolina Chemical Corporation VA.04-1 Location: 818 Perry Street , Richmond , Virginia VA.04-1 Evaluation Year: 1985 VA.04-2 VA.04-3 Site Operations: Preparatory process development involving only gram quantities of uranium performed in the 1950s. VA.04-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited materials handled VA.04-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium VA.04-1 Radiological Survey(s): None Indicated VA.04-1 VA.04-4 Site Status: Eliminated from consideration under FUSRAP

47

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany based producer of solid biofuel for energy production and biomass CHP plant developer ABI Energy Consultancy Services ABI Energy Consultancy Services Chennai Tamil Nadu India Biomass ABI Energy provides pre feasibility assessments and detailed biomass assessment studies to organisations considering seeking CDM credits AE E Lentjes GmbH AE E Lentjes GmbH Ratingen Germany Biomass Process and turnkey plant engineering of fossil fuel biomass and waste to energy plants AES Corporation AES Corporation Arlington Virginia Biomass Carbon Gateway Solar Wind energy Virginia based company that generates and distributes

48

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance for Clean Energy New York Alliance for Clean Energy New York Washington Ave Albany New York Coalition dedicated to promoting clean energy energy efficiency a healthy environment and a strong economy for the Empire State http www aceny org Northeast NY NJ CT PA Area Center for Clean Air Policy CCAP Center for Clean Air Policy CCAP First Street NE Suite Washington District of Columbia http www ccap org Northeast NY NJ CT PA Area Coalition for Rainforest Nations CfRN Coalition for Rainforest Nations CfRN Lexington Avenue th Floor New York New York http www rainforestcoalition org eng Northeast NY NJ CT PA Area Conservation International Conservation International Crystal Drive Suite Arlington Virginia http www conservation org Pages default aspx Northeast NY NJ CT PA Area Energy Sector Management Assistance Program of the World Bank ESMAP

49

Energy Department Recognizes City of Roanoke, VA for Leadership...  

Energy Savers [EERE]

Department Recognizes City of Roanoke, VA for Leadership in Better Buildings Challenge Energy Department Recognizes City of Roanoke, VA for Leadership in Better Buildings Challenge...

50

Photo of the Week: Power Up! Twenty Steps to Zip a Zipper | Department...  

Office of Environmental Management (EM)

Power Up Twenty Steps to Zip a Zipper Photo of the Week: Power Up Twenty Steps to Zip a Zipper April 4, 2014 - 10:30am Addthis On Feb. 18, 2014, Argonne hosted its 19th annual...

51

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Organization Organization Address Place Zip Notes Website Region Organization Organization Address Place Zip Notes Website Region Adirondack North Country Association Adirondack North Country Association Main Street Suite Saranac Lake New York http www adirondack org Northeast NY NJ CT PA Area African Renewable Energy Alliance AREA African Renewable Energy Alliance AREA Online http area network ning com xg source msg mes network Alliance for Sustainable Colorado Alliance for Sustainable Colorado Wynkoop Street Denver Colorado Mission of is to catalyze the shift to a truly sustainable world by fostering collaboration among nonprofits businesses governments and academia http www sustainablecolorado org Rockies Area American Clean Skies Foundation American Clean Skies Foundation st Street NE Suite Washington District of Columbia http www cleanskies

52

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institution Name Institution Name Address Place Zip Notes Website Region Institution Name Institution Name Address Place Zip Notes Website Region ARCH Venture Partners Texas ARCH Venture Partners Texas Bridgepoint Parkway Bldg Suite Austin Texas http www archventure com Texas Area ARCH Venture Partners Washington ARCH Venture Partners Washington Second Avenue Suite Seattle Washington http www archventure com Pacific Northwest Area African Wind Energy Association South Africa African Wind Energy Association South Africa South Africa http www afriwea org en south africa htm Alternative Energy Institute Alternative Energy Institute russell long blvd Canyon Texas http www windenergy org Texas Area Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org

53

DOE - Office of Legacy Management -- Norfolk Naval Station - VA 05  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Norfolk Naval Station - VA 05 Norfolk Naval Station - VA 05 FUSRAP Considered Sites Site: NORFOLK NAVAL STATION (VA.05) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Norfolk , Virginia VA.05-1 Evaluation Year: 1993 VA.05-1 Site Operations: Demonstration of extinguishing a uranium fire at the Fire Fighters School for AEC contractors. VA.05-3 VA.05-2 Site Disposition: Eliminated - Potential for contamination considered remote based on the limited quantity of materials handled VA.05-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium VA.05-2 Radiological Survey(s): Yes - Health and Safety Monitoring during operations only VA.05-2 Site Status: Eliminated from consideration under FUSRAP

54

DOE - Office of Legacy Management -- Mobil Oil Corp - VA 01  

Office of Legacy Management (LM)

Mobil Oil Corp - VA 01 Mobil Oil Corp - VA 01 FUSRAP Considered Sites Site: Mobil Oil Corp. (VA.01 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: Virginia-Carolina Chemical Corporation VA.01-1 Location: 818 Perry Street , Richmond , Virginia VA.01-1 Evaluation Year: Circa 1987 VA.01-2 VA.01-3 Site Operations: Research/Development to recover Uranium as a byproduct of phosphate production; preparatory process for pilot plant scale operation at Nichols, Florida. VA.01-1 Site Disposition: Eliminated - Potential for residual radioactive contamination from small quantities of material used at the site is considered remote VA.01-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium VA.01-1

55

Electric Utility Company Assigned to a Zip Code? | OpenEI Community  

Open Energy Info (EERE)

Electric Utility Company Assigned to a Zip Code? Electric Utility Company Assigned to a Zip Code? Home I have found an error in the utility company assigned to a zip code. I am not sure if the "assigned" utility company covers part of the zip code in question or not. How do I report an error like this for correction? Thanks. Submitted by Conroyt on 23 May, 2013 - 09:01 1 answer Points: 0 Thanks for submitting this. The Utilities Gateway (http://en.openei.org/wiki/Gateway:Utilities) uses the developer.nrel.gov service for zip-code lookups (http://developer.nrel.gov/doc/api/utility_rates/v3). This in turn uses Google for geocoding, and finds the centroid of the geographic region in question. This means that the result is based on the center of a zip code region, which may have no data. This question is timed well as we are

56

Nuclear Energy Research Advisory Committee Meeting March 30-31, 1999, Marriott Crystal City, Arlington, Virginia  

Broader source: Energy.gov (indexed) [DOE]

March 30-31, 1999, Marriott Crystal City, Arlington, Virginia March 30-31, 1999, Marriott Crystal City, Arlington, Virginia NERAC members present: John Ahearne Robert Long Thomas Boulette Sekazi Mtingwa Thomas Cochran Richard Reba Joseph Comfort Joy Rempe Jose Luis Cortez Miguel Rios Maureen S. Crandall C. Paul Robinson (Tuesday only) Allen Croff Allen Sessoms (Wednesday only) James Duderstadt (Chair) Daniel C. Sullivan Marvin Fertel (Wednesday only) John Taylor Dale Klein Charles E. Till Linda Knight Neil Todreas NERAC members absent: Beverly Hartline Warren Miller J. Bennett Johnston Robert Socolow William Kastenberg Bruce Tarter Also present: Norton Haberman, Senior Technical Advisor, Office of Nuclear Energy, Science, and Technology (NE), DOE John Herczeg, Lead Nuclear Engineer, Office of Technology, DOE William Magwood, Director, Office of Nuclear Energy, Science, and Technology (NE), DOE

57

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear memory  

E-Print Network [OSTI]

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear-pseudosubstrate inhibitory peptide (ZIP) remains in the brain after infusion. Here, we demon- strate that foreground context the brain by 24 h after infusion. These data contribute to a growing body of lit- erature that demonstrates

Helmstetter, Fred J.

58

Hacia dnde va el teatro en Cali!  

E-Print Network [OSTI]

, damas alturistas del arte caleo, lagartos de coctel y, lo mejor, muchsima gente joven. La verdad es que el foro debi llamarse Hacia dnde va el TEC? pues el colocar en la mesa central a Enrique Buenaventura sita como centro de atencin sus... posiciones y reclamas. De otra parte un foro de esta naturaleza en la ciudad de Cali es un foro al TEC, causa y efecto de los logros y dificultades del teatro local. As que el foro se enfoc hacia la "Crisis del TEC," hecho cultural sin precedentes en la...

Cajamarca Castro, Orlando

1990-10-01T23:59:59.000Z

59

Do we get actual vendor name while we searched with zip code...  

Open Energy Info (EERE)

Co has utility id 14006 located in Ohio". But I had also check the zip code in google earth, It falling in other state "Rincorn, PR". Please let me know? Submitted by SUTHARI on...

60

THE DEPLOYMENT OF ZIP NON-EQUILIBRIUM PHONON DETECTORS IN CDMS II  

E-Print Network [OSTI]

operating these Si and Ge Z-sensitive Ionization and Phonon (ZIP) detectors at the Stanford Underground Facility are reported. 1 Surface electron events The Cryogenic Dark Matter Search (CDMS) 1 utilizes

California at Berkeley, University of

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

WEC-Sim Wave Energy Converter Simulator - WEC-Sim-v1-0.zip -...  

Open Energy Info (EERE)

Sim-v1-0.zip Download WEC-Sim-v1-0.zip URL: http:en.openei.orgdatasetsdataset76407f83-43ed-4bac-a0aa-e2b6cacb70b9resource42b3c07c-2f71-47ed-b95b-c2f479d9aa99download...

62

Identification of bZIP interaction partners of viral proteins HBZ, MEQ, BZLF1, and K-bZIP using coiled-coil arrays  

E-Print Network [OSTI]

Basic-region leucine-zipper transcription factors (bZIPs) contain a segment rich in basic amino acids that can bind DNA, followed by a leucine zipper that can interact with other leucine zippers to form coiled-coil homo- ...

Reinke, Aaron Wade

63

Communication and Collaboration Keep San Francisco VA Medical Center  

Broader source: Energy.gov (indexed) [DOE]

Communication and Collaboration Keep San Francisco VA Medical Communication and Collaboration Keep San Francisco VA Medical Center Project on Track Communication and Collaboration Keep San Francisco VA Medical Center Project on Track October 7, 2013 - 1:56pm Addthis San Francisco VA Medical Center The San Francisco VA Medical Center is saving more than $500,000 and almost 3 million kWh every year through a retrofit financed by FEMP's Super ESPC Program. Overview The Veterans Affairs Medical Center in San Francisco is saving almost 3 million kilowatt-hours of electricity, more than 70,000 therms of natural gas, and more than $500,000 annually. The energy savings are enough to power 400 homes and supply natural gas to more than 100 homes each year in California. These savings were realized by taking advantage of Super Energy

64

Looking for a way to find utilites per zip code (a list?) | OpenEI  

Open Energy Info (EERE)

Looking for a way to find utilites per zip code (a list?) Looking for a way to find utilites per zip code (a list?) Home I am trying to map out utilities in the USA by ZIP codes. The EPA sent me to OpenEI (this is a nice validation of our group), or Energy Star. Does anyone know of a data set linking zip codes to utilities? I am trying to map something similar to what DSRIE.gov does with utilities and incentives. Thank you head of time. Submitted by Caniemeyer on 1 July, 2013 - 13:55 1 answer Points: 0 Hello- Yes, there is indeed a dataset that lists utilities by zip-code. It can be found on OpenEI here: http://en.openei.org/datasets/node/899. Be sure to view both the investor owned and non-investor owned lists. Since it was sourced from licensed Ventyx data, this is the most recent publicly available data we can provide. Please let me know if you have any questions

65

Pipeline Annual Data - 1996 Gas Distribution Annuals Data (Zip) | Data.gov  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Distribution Annuals Data (Zip) Distribution Annuals Data (Zip) Energy Data Apps Maps Challenges Resources Blogs Let's Talk Energy Beta You are here Data.gov » Communities » Energy » Data Pipeline Annual Data - 1996 Gas Distribution Annuals Data (Zip) Dataset Summary Description Pipeline operators (for gas distribution, gas transmission, and hazardous liquid pipelines) are required to submit an annual report to the Pipeline and Hazardous Materials Safety Administration's Office of Pipeline Safety. The report includes information about the operator, a description of their system (main, services), leaks eliminated/repaired during the year, excavation damage, excess flow valves, and other information. Beginning in 2010, the form also includes information regarding integrity management programs.

66

Pipeline Annual Data - 1997 Gas Distribution Annuals Data (Zip) | Data.gov  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

7 Gas Distribution Annuals Data (Zip) 7 Gas Distribution Annuals Data (Zip) Energy Data Apps Maps Challenges Resources Blogs Let's Talk Energy Beta You are here Data.gov » Communities » Energy » Data Pipeline Annual Data - 1997 Gas Distribution Annuals Data (Zip) Dataset Summary Description Pipeline operators (for gas distribution, gas transmission, and hazardous liquid pipelines) are required to submit an annual report to the Pipeline and Hazardous Materials Safety Administration's Office of Pipeline Safety. The report includes information about the operator, a description of their system (main, services), leaks eliminated/repaired during the year, excavation damage, excess flow valves, and other information. Beginning in 2010, the form also includes information regarding integrity management programs.

67

Hydrogen Production and Dispensing Facility Opens at W. Va. Airport |  

Broader source: Energy.gov (indexed) [DOE]

Hydrogen Production and Dispensing Facility Opens at W. Va. Airport Hydrogen Production and Dispensing Facility Opens at W. Va. Airport Hydrogen Production and Dispensing Facility Opens at W. Va. Airport August 19, 2009 - 1:00pm Addthis Major General Allen Tackett of the National Guard's 130th Airlift Wing dispenses the first fill-up of hydrogen fuel from the Yeager facility. Major General Allen Tackett of the National Guard's 130th Airlift Wing dispenses the first fill-up of hydrogen fuel from the Yeager facility. Washington, D.C. -- A hydrogen production and dispensing station constructed and operated with support from the Office of Fossil Energy's National Energy Technology Laboratory (NETL) was officially opened Monday at the Yeager Airport in Charleston, W.Va. The facility is an example of how domestically produced fuels may be used to power a variety of vehicles

68

Leafy Biomass Gasifier for 15 kVA Diesel Genset  

Science Journals Connector (OSTI)

A 15 kVA diesel genset powered by a loose sugarcane leaves gasifier was successfully tested and long-term data ... 20-40 cm (water gage). The gasifier also produces char which is 2028% by ... . Tests conducted wi...

Anil K. Rajvanshi; Rajiv M. Jorapur

1993-01-01T23:59:59.000Z

69

Early Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Public Library Central Branch 301 W. Claude St. Lake Charles 70605 29. LA Iberia Parish Library 445 EEarly Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP 1. AL Dauphin. Mobile 36606 6. AL City of Bayou La Batre Public Library 12747 Padgett Switch Road Irvington 36544 7. FL

70

ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY  

E-Print Network [OSTI]

86 #12;87 ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY Amagansett 11930 11784 Brightwaters 11718 Kings Park 11754 Setauket 11733 Brookhaven 11719 Lake Grove 11755 Shelter River 11739 Port Jefferson Station 11776 NASSAU COUNTY Albertson 11507 Greenvale 11548 Old Westbury

Ohta, Shigemi

71

Nuclear Energy Research Advisory Committee Meeting April 15-16, 2002, Marriott Crystal City Hotel, Arlington, Virginia  

Broader source: Energy.gov (indexed) [DOE]

15-16, 2002, Marriott Crystal City Hotel, Arlington, Virginia 15-16, 2002, Marriott Crystal City Hotel, Arlington, Virginia NERAC members present: John Ahearne (Monday only) Robert Long Thomas Cochran Warren F. Miller, Jr. Joseph Comfort Benjamin F. Montoya Michael L. Corradini Sekazi Mtingwa Jose Luis Cortez Lura Powell Maureen S. Crandall Richard Reba (Tuesday only) Allen Croff Joy Rempe James Duderstadt (Chair) Daniel C. Sullivan (Monday morning only) Steve Fetter John Taylor Beverly Hartline Ashok Thadani (ad hoc; Monday only) Leslie Hartz Charles E. Till Andrew Klein Neil Todreas (Tuesday only) Dale Klein (Monday only) NERAC members absent: Marvin Fertel Allen Sessoms J. Bennett Johnston C. Bruce Tarter Linda C. Knight Joan Woodard Also present: Ralph Bennett, Director for Advanced Nuclear Energy, Idaho National Engineering and

72

DOE - Office of Legacy Management -- Naval Proving Ground - VA 0-01  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Proving Ground - VA 0-01 Proving Ground - VA 0-01 FUSRAP Considered Sites Site: NAVAL PROVING GROUND (VA.0-01 ) Eliminated from further consideration under FUSRAP - Referred to DOD Designated Name: Not Designated Alternate Name: None Location: Dahlgren , Virginia VA.0-01-1 Evaluation Year: 1987 VA.0-01-1 Site Operations: Site operations were not specified; this site was identified on the 1954 Accountable Station Lists. VA.0-01-1 VA.0-01-2 Site Disposition: Eliminated - Referred to DOD VA.0-01-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DOD VA.0-01-1 Also see Documents Related to NAVAL PROVING GROUND VA.0-01-1 - DOE Letter; Fiore to Schafer; Referral of DOD or Former

73

DOE - Office of Legacy Management -- Reactor Site - Fort Belvoir - VA 0-02  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Reactor Site - Fort Belvoir - VA Reactor Site - Fort Belvoir - VA 0-02 FUSRAP Considered Sites Site: REACTOR SITE - FORT BELVOIR (VA.0-02 ) Eliminated from further consideration under FUSRAP - Referred to DOD Designated Name: Not Designated Alternate Name: None Location: Fort Belvoir , Virginia VA.0-02-1 Evaluation Year: 1987 VA.0-02-1 Site Operations: No evidence of AEC involvement with reactor operations. AEC conducted health and safety inspections of this site. Probably a licensed operation. VA.0-02-1 Site Disposition: Eliminated - Referred to DOD VA.0-02-1 Radioactive Materials Handled: Reactor fuel Primary Radioactive Materials Handled: Reactor Fuel Radiological Survey(s): Health and safety inspections VA.0-02-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to DOD VA.0-02-1

74

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Company Oil and Gas Company Address Place Zip Website Company Oil and Gas Company Address Place Zip Website Abu Dhabi National Oil Company Abu Dhabi National Oil Company Abu http www adnoc ae default aspx Al Furat Petroleum Company Al Furat Petroleum Company Damascus Syria http www afpc sy com new history htm Dolphin Energy Dolphin Energy Abu Dhabi Trade Center Building Abu Dhabi United Arab Emirates http www dolphinenergy com Public default index htm ExxonMobil ExxonMobil Las Colinas Boulevard Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United Kingdom W1S LG http www gulfsands com s Home asp Kuwait Petroleum Corporation Kuwait Petroleum Corporation Safat Kuwait http www kpc com kw default aspx

75

State Oil and Gas Board State Oil and Gas Board Address Place Zip Website  

Open Energy Info (EERE)

State Oil and Gas Board Address Place Zip Website State Oil and Gas Board Address Place Zip Website Alabama Oil and Gas Board Alabama Oil and Gas Board Hackberry Lane Tuscaloosa Alabama http www gsa state al us ogb ogb html Alaska Division of Oil and Gas Alaska Division of Oil and Gas W th Ave Suite Anchorage Alaska http dog dnr alaska gov Alaska Oil and Gas Conservation Commission Alaska Oil and Gas Conservation Commission W th Ave Ste Anchorage Alaska http doa alaska gov ogc Arizona Oil and Gas Commission Arizona Oil and Gas Commission W Congress Street Suite Tucson Arizona http www azogcc az gov Arkansas Oil and Gas Commission Arkansas Oil and Gas Commission Natural Resources Dr Ste Little Rock Arkansas http www aogc state ar us JDesignerPro JDPArkansas AR Welcome html California Division of Oil Gas and Geothermal Resources California

76

Name Address Place Zip Sector Product Stock Symbol Year founded Number  

Open Energy Info (EERE)

Address Place Zip Sector Product Stock Symbol Year founded Number Address Place Zip Sector Product Stock Symbol Year founded Number of employees Number of employees Telephone number Website Coordinates Region ABS Alaskan Inc Van Horn Rd Fairbanks Alaska Gateway Solar Wind energy Marine and Hydrokinetic Solar PV Solar thermal Wind Hydro Small scale wind turbine up to kW and solar systems distributor http www absak com United States AER NY Kinetics LLC PO Box Entrance Avenue Ogdensburg Marine and Hydrokinetic United States AW Energy Lars Sonckin kaari Espoo FI Marine and Hydrokinetic http www aw energy com Finland AWS Ocean Energy formerly Oceanergia Redshank House Alness Point Business Park Alness Ross shire IV17 UP Marine and Hydrokinetic http www awsocean com United Kingdom Able Technologies Audubon Road Englewood Marine and Hydrokinetic http

77

Contract Connections @ ChallengeHER, Norfolk VA, October 14  

Broader source: Energy.gov [DOE]

The U.S. Small Business Administration (SBA), Women Impacting Public Policy (WIPP), and American Express OPEN have partnered to host this special FREE contracting event for women business owners. American Express OPEN will hold a Contract Connections session at the ChallengeHER Norfolk Event, on October 14th, 2014 at the Webb University Center, Norfolk, VA.

78

Polarized Muon Decay at Rest with V+A Interaction  

E-Print Network [OSTI]

In this paper, we analyze the polarized muon decay at rest (PMDaR) and elastic neutrino-electron scattering (ENES) admitting the non-standard V+A interaction in addition to standard V-A interaction. Considerations are made for Dirac massive muon neutrino and electron antineutrino. Moreover, muon neutrinos are transversely polarized. It means that the outgoing muon-neutrino beam is a mixture of the left- and right-chirality muon neutrinos and has a fixed direction of transverse spin polarization with respect to production plane. We show that the angle-energy distribution of muon neutrinos contains the interference terms between the standard V-A and exotic V+A couplings, which are proportional to the transverse components of muon neutrino spin polarization. They do not vanish in a limit of massless neutrino and include the relative phases to test the CP violation. In consequence, it allows to calculate a neutrino flux and an expected event number in the ENES (detection process) both for the standard model prediction and the case of neutrino left-right mixture.

W. Sobkw; S. Ciechanowicz; M. Misiaszek

2011-02-07T23:59:59.000Z

79

Health and Wellness @ U.Va. Department of Student Health  

E-Print Network [OSTI]

Health and Wellness @ U.Va. Department of Student Health Counseling and Psychological Services "Without health there is no happiness. An attention to health, then, should take the place of every other on Accreditation of Healthcare Organizations 2013 Parents Handbook p. 36-41 #12;Student Health Services · 12:30am-2

Acton, Scott

80

E-Print Network 3.0 - analyze va shenasai Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

is how an organism Summary: 12;87Analyzing the effect of wind on flight migration dataset (APM) between Va and Vg-Va using... . Furthermore, we focus on the analysis of air...

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

E-Print Network 3.0 - adenovirus va rna-derived Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

va rna-derived Search Powered by Explorit Topic List Advanced Search Sample search results for: adenovirus va rna-derived Page: << < 1 2 3 4 5 > >> 1 MINI REVIEW MODIFIED...

82

E-Print Network 3.0 - avalieye tarahi va Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

RESEARCH (PROGRAM... ) FUNDS NOT SALARIED BY VA 1. NAME: 2. DEGREE: 3. SSN: 4. VA TITLE: CONTRACT WOC INVESTIGATOR'S SIGNATURE... Table 8) Code (If code 99, enter name of...

83

E-Print Network 3.0 - annamria zskai va Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

RESEARCH (PROGRAM... ) FUNDS NOT SALARIED BY VA 1. NAME: 2. DEGREE: 3. SSN: 4. VA TITLE: CONTRACT WOC INVESTIGATOR'S SIGNATURE... Table 8) Code (If code 99, enter name of...

84

V.A. HOSPITAL QUALITY MONITORS: 19881997 Mike West, Omar Aguilar & Viridiana Lourdes  

E-Print Network [OSTI]

V.A. HOSPITAL QUALITY MONITORS: 1988­1997 Mike West, Omar Aguilar & Viridiana Lourdes Institute, 1998 This report discusses reanalysis of VA hospital quality monitor data sets as described in West and Aguilar (1997) ``Studies of Quality Monitor Time Series: The V.A. Hospital System. In Fall 1998 the data

West, Mike

85

V.A. HOSPITAL QUALITY MONITORS: 1988-1997 Mike West, Omar Aguilar & Viridiana Lourdes  

E-Print Network [OSTI]

V.A. HOSPITAL QUALITY MONITORS: 1988-1997 Mike West, Omar Aguilar & Viridiana Lourdes Institute, 1998 This report discusses reanalysis of VA hospital quality monitor data sets as described in West and Aguilar 1997 Studies of Quality Monitor Time Series: The V.A. Hospital System. In Fall 1998 the data set

West, Mike

86

VA-4-B Wholesale Power Rate Schedule | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

4-B Wholesale Power Rate Schedule 4-B Wholesale Power Rate Schedule VA-4-B Wholesale Power Rate Schedule Area: Virginia Power System: Kerr-Philpott This rate schedule shall be available to public bodies and cooperatives (any one of whom is hereinafter called the Customer) in Virginia and North Carolina served through the transmission facilities of Virginia Electric and Power Company (hereinafter called the Company) and PJM Interconnection LLC (hereinafter called PJM). This rate schedule shall be applicable to the sale at wholesale of power and accompanying energy generated at the John H. Kerr and Philpott Projects (hereinafter called the Projects) and sold under appropriate contracts between the Government and the Customer. Document Available for Download VA-4-B Rate Schedule More Documents & Publications

87

Nuclear Energy Research Advisory Committee Meeting November 17-18, 1998, Hyatt Regency Crystal City, Arlington, Virginia  

Broader source: Energy.gov (indexed) [DOE]

1- 1- Minutes for the Nuclear Energy Research Advisory Committee Meeting November 17-18, 1998, Hyatt Regency Crystal City, Arlington, Virginia NERAC members present: John Ahearne (Tuesday only) Linda Knight Thomas Boulette Thomas Cochran Robert Long Joseph Comfort Warren Miller Jose Luis Cortez Sekazi Mtingwa Maureen S. Crandall (Tuesday only) Richard Reba Allen Croff Joy Rempe James Duderstadt (Chair) Robert Socolow (Tuesday only) Marvin Fertel Daniel C. Sullivan Beverly Hartline Bruce Tarter (Tuesday only) William Kastenberg Charles E. Till Dale Klein Neil Todreas NERAC members absent: J. Bennett Johnston Glenn Seaborg C. Paul Robinson Allen Sessoms Miguel Rios John Taylor Also present: Norton Haberman, Senior Technical Advisor, Office of Nuclear Energy, Science, and Technology, NE, DOE

88

Safety of Carotid Endarterectomy in a High-Risk Population: Lessons from the VA and Connecticut  

Science Journals Connector (OSTI)

Background The safety and efficacy of carotid endarterectomy (CEA) have been demonstrated in randomized trials, but these studies excluded patients thought to be at higher risk for poor outcomes. We sought to determine whether patients undergoing CEA in Veteran Affairs Hospitals (VA) were at higher risk and had different outcomes, compared with patients in nonfederal hospitals. Study Design Records of all CEA performed in the VA Connecticut Healthcare System between October 1997 and September 2002 were examined and compared with CEA performed in all nonfederal Connecticut hospitals (CT). Results There were 7,089 \\{CEAs\\} performed (VA, 140; CT, 6,949). VA patients had increased comorbidity scores and symptomatic presentation (39% versus 14%; p Connecticut. These results suggest not only that patients undergoing vascular surgery at the VA may form a higher-risk population compared with patients receiving care in non-VA hospitals, but that these high-risk patients can undergo CEA safely.

Jeffrey S. Weiss; Patricia Dumas; Charles Cha; Richard J. Gusberg; Alan Dardik

2006-01-01T23:59:59.000Z

89

Critical Materials Workshop Final Participant List  

Broader source: Energy.gov [DOE]

List of participants who attended the Critical Materials Workshop held on April 3, 2012 in Arlington, VA

90

High Temperature Membrane Working Group Meeting, May 14, 2007  

Broader source: Energy.gov [DOE]

This agenda provides information about the High Temperature Membrane Working Group Meeting on May 14, 2007 in Arlington, Va.

91

2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go to presentations and download.  

E-Print Network [OSTI]

Laboratory Geochemical Tools for Monitoring Geologic Carbon Sequestration, (David Cole, ORNL) Andre Duguid-surface carbon sequestration T.S. Ramakrishnan (Jim Johnson, speaker) Schlumberger Capacity and Injectivity2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go

Daniels, Jeffrey J.

92

Partners in Preparedness e American Red Cross in the National Capital Region  

E-Print Network [OSTI]

. Belvoir, VA 22060 (703) 805-2057 Loudoun County 604 South King Street, #006 Leesburg, VA 20175 (703) 777) 549-8300 Arlington County 4333 Arlington Boulevard Arlington, VA 22203 (703) 527-3010 Fairfax County 1050 West Perimeter Road Suite E1-23 Andrews Air Force Base, MD 20762 (240) 857-7315 Montgomery County

Acton, Scott

93

Brookhaven National Laboratory presentation 2007 Peer Review  

E-Print Network [OSTI]

Brookhaven National Laboratory presentation 2007 Peer Review August 7- 9, 2007, Arlington, VA Slide Laboratory, Upton, NY 11973 DOE Peer Review, Arlington VA, August 7-9 2007 #12;Brookhaven National Laboratory presentation 2007 Peer Review August 7- 9, 2007, Arlington, VA Slide 2 2 Outline Program objective

Homes, Christopher C.

94

Notice of Availability of the Record of Decision for the Arlington Wind Interconnection Project (DOE/EIS-0183) (1/14/05)  

Broader source: Energy.gov (indexed) [DOE]

86 86 Federal Register / Vol. 70, No. 16 / Wednesday, January 26, 2005 / Notices 8. Mr. Mohan Singh, Regional Business Director, North Atlantic Division. Brenda S. Bowen, Army Federal Register Liaison Office. [FR Doc. 05-1383 Filed 1-25-05; 8:45 am] BILLING CODE 3710-08-M DEPARTMENT OF ENERGY Bonneville Power Administration Arlington Wind Interconnection Project AGENCY: Bonneville Power Administration (BPA), Department of Energy (DOE). ACTION: Notice of availability of Record of Decision (ROD). SUMMARY: This notice announces the availability of the ROD to offer contract terms to interconnect up to 200 megawatts of wind generation from the Columbia Energy Partners' proposed Arlington Wind Project into the Federal Columbia River Transmission System. The wind project will be interconnected

95

Building Energy Management Open-Source Software Development (BEMOSS)  

Broader source: Energy.gov [DOE]

Lead Performer: Virginia Tech Advanced Research Institute - Alexandria, VA Project Partners: -- Arlington County, Virginia -- Danfoss Corporation - Baltimore, MD -- Virginia Tech Foundation - Blacksburg, VA

96

VA-2-B Wholesale Power Rate Schedule | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

2-B Wholesale Power Rate Schedule 2-B Wholesale Power Rate Schedule VA-2-B Wholesale Power Rate Schedule Area: Virginia Power System: Kerr-Philpott This rate schedule shall be available to public bodies and cooperatives (any one of whom is hereinafter called the Customer) in Virginia and North Carolina to whom power may be transmitted pursuant to contracts between the Government, Virginia Electric and Power Company (hereinafter called the Company), the Company's Transmission Operator, currently PJM Interconnection LLC (hereinafter called PJM), and the Customer. This rate schedule shall be applicable to the sale at wholesale of power and accompanying energy generated at the John H. Kerr and Philpott Projects and sold under appropriate contracts between the Government and the Customer. Document Available for Download

97

Microsoft Word - DM_VA-#121918-v2-SmartGrid_Comments_--_DOE.DOC  

Broader source: Energy.gov (indexed) [DOE]

COMMENTS OF VERIZON AND VERIZON WIRELESS COMMENTS OF VERIZON AND VERIZON WIRELESS Michael Glover Of Counsel Edward Shakin William H. Johnson VERIZON 1320 North Courthouse Road Ninth Floor Arlington, Virginia 22201 (703) 351-3060 John T. Scott, III William D. Wallace VERIZON WIRELESS 1300 I Street N.W. Suite 400 West Washington, DC 20005 July 12, 2010 TABLE OF CONTENTS Page -i- I. USE OF COMMERCIAL BROADBAND NETWORKS WOULD FACILITATE THE EFFICIENT AND EFFECTIVE IMPLEMENTATION OF SMART GRID TECHNOLOGY. ............................................................................................................... 2 II. RESPONSES TO SPECIFIC QUESTIONS RAISED IN THE REQUEST FOR INFORMATION................................................................................................................

98

W.Va. Mom Sees Benefits of Weatherization | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

W.Va. Mom Sees Benefits of Weatherization W.Va. Mom Sees Benefits of Weatherization W.Va. Mom Sees Benefits of Weatherization April 2, 2010 - 2:43pm Addthis Joshua DeLung Not only is Rachael McCarty working full-time and going to college, but also she's a full-time single mom of two small children. After moving to Bluefield, W.Va., from California a few years ago, Rachel bought her first home, a property that needed some work. "It's a very, very old house, and it didn't really have any insulation," she says. Last year, Rachael was approved for the weatherization assistance program from Community Action of South Eastern West Virginia. The agency installed a new furnace and insulation, along with a new hot water heater and weather stripping for the doors. She says the house was much easier to heat this

99

VaPa - nuorten varhennettu kuntoutus Lappeenrannassa; Backdated rehabilitation of youngsters in Lappeenranta.  

E-Print Network [OSTI]

??Kehittmishanke ksittelee Lappeenrannassa vuosina 2001-2003 toteutettua nuorten varhennettua kuntoutusta VaPa- hanketta. Kuntoutuskokeilun jrjestettiin Lappeenrannan sosiaali- ja terveysviraston ostopalveluna yhteis-voimin Lappeenrannan Kelan, tyvoimatoimiston ja toteuttajatahon Laptuote-stin (more)

Korja,Minna-Liisa

2006-01-01T23:59:59.000Z

100

DOE Zero Energy Ready Home Case Study: Promethean Homes, Charlottesville, VA  

Broader source: Energy.gov [DOE]

Case study of a DOE Zero Energy Ready home in Charlottesville, VA, that achieves a HERS 33 without PV. The 2,572-ft2 custom home with daylight basement, has 2x6 advanced framed walls filled with R...

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

The Shorthorn: Casey Crane Robert Arrowood, Carrizo Oil and Gas, Inc. representative, takes local homeowners' questions about on-campus natural gas drilling in an Arlington office complex Tuesday.  

E-Print Network [OSTI]

that plans to drill on university property. Carrizo Oil and Gas, Inc. recently signed a one-year leaseThe Shorthorn: Casey Crane Robert Arrowood, Carrizo Oil and Gas, Inc. representative, takes local homeowners' questions about on-campus natural gas drilling in an Arlington office complex Tuesday. Jenna

Chiao, Jung-Chih

102

1/10/14 Technologyuses micro-windmills to recharge cell phones -News Center -UT Arlington www.uta.edu/news/releases/2014/01/microwindmill-rao-chiao.php 1/4  

E-Print Network [OSTI]

1/10/14 Technologyuses micro-windmills to recharge cell phones - News Center - UT Arlington www power homes NEWS CENTER Technology uses micro-windmills to recharge cell phones Search News Center News of these tiny windmills. Hundreds of the windmills could be embedded in a sleeve for a cell phone. Wind, created

Chiao, Jung-Chih

103

Blue Ridge Renewable Energy LLC | Open Energy Information  

Open Energy Info (EERE)

Arlington, Virginia Zip: 22209 Product: Developer and operator of the Blue Ridge landfill energy project. References: Blue Ridge Renewable Energy LLC1 This article is a...

104

Matching between Reaction and Catalyst Conditions in Growing VA-SWNTs by ACCVD  

E-Print Network [OSTI]

Matching between Reaction and Catalyst Conditions in Growing VA-SWNTs by ACCVD Hisashi Sugime1 of the catalyst nanoparticles is a crucial issue. Co-Mo binary catalysts effectively grow SWNTs either from CO [1/3 for the former [1] and 1.6/1 for the latter [2]. The structure of catalyst nanoparticles should be determined

Maruyama, Shigeo

105

Energy Secretary Moniz's Remarks at Hampton University in Hampton, Va.-- As Prepared for Delivery  

Broader source: Energy.gov [DOE]

Today, Secretary of Energy Ernest Moniz traveled to Hampton Roads, Va. to highlight President Obamas State of the Union address at Hampton University, one of the nations top historically black universities and a leader in science, technology, engineering and math (STEM) education.

106

Economic Impact of the ACESA of 2009 on the W.Va. Economy 1 Policy Brief  

E-Print Network [OSTI]

Economic Impact of the ACESA of 2009 on the W.Va. Economy 1 Policy Brief: Economic Impact.D. Bureau of Business and Economic Research College of Business and Economics West Virginia University May concern over the effects of the current recession. The ARRA was designed to spur economic activity

Mohaghegh, Shahab

107

arlington New Nuclear Power  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

1963 1963 Prepared for the U.S. Department of Energy under Contract DE-AC05-76RL01830 An Analysis of Statewide Adoption Rates of Building Energy Code by Local Jurisdictions KA Cort RS Butner December 2012 PNNL-21963 An Analysis of Statewide Adoption Rates of Building Energy Code by Local Jurisdictions KA Cort RS Butner December 2012 Prepared for: The U.S. Department of Energy Under Contract DE-AC05-76RL01830 Pacific Northwest National Laboratory Richland, Washington 99352 iii Summary The purpose of this study is to quantify the energy code adoption rate by local jurisdictions from a sample set of 21 states. Some of the states within this sample have statewide energy codes, while others do not. Using construction starts and weighting results by localities that have or have not adopted energy

108

DOE Spent Nuclear Fuel Information In Support of TSPA-VA  

SciTech Connect (OSTI)

RW has started the viability assessment (VA) effort to determine the feasibility of Yucca Mountain as the first geologic repository for spent nuclear fuel (SNF) and high-level waste. One component of the viability assessment will be a total system performance assessment (TSPA), based on the design concept and the scientific data and analysis available, describing the repository's probable behavior relative to the overall system performance standards. Thus, all the data collected from the Exploratory Studies Facility to-date have been incorporated into the latest TSPA model. In addition, the Repository Integration Program, an integrated probabilistic simulator, used in the TSPA has also been updated by Golder Associates Incorporated at December 1997. To ensure that the Department of Energy-owned (DOE-owned) SNF continues to be acceptable for disposal in the repository, it will be included in the TSPA-VA evaluation. A number of parameters are needed in the TSPA-VA models to predict the performance of the DOE-owned SNF materials placed into the potential repository. This report documents all of the basis and/or derivation for each of these parameters. A number of properties were not readily available at the time the TSPA-VA data was requested. Thus, expert judgement and opinion was utilized to determine a best property value. The performance of the DOE-owned SNF will be published as part of the TSPA-VA report. Each DOE site will be collecting better data as the DOE SNF program moves closer to repository license application. As required by the RW-0333P, the National Spent Nuclear Fuel Program will be assisting each site in qualifying the information used to support the performance assessment evaluations.

A. Brewer; D. Cresap; D. Fillmore; H. Loo; M. Ebner; R. McCormack

1998-09-01T23:59:59.000Z

109

bZIP67 Regulates the Omega-3 Fatty Acid Content of Arabidopsis Seed Oil by Activating FATTY ACID DESATURASE3  

Science Journals Connector (OSTI)

...for a broad variety of industrial applications (Lu et...used to assist in the assessment of overall differences...place bZIP67 near the center of gene regulatory networks...analysis and quantitative assessment of changes in neutral...feed, biofuel, and industrial applications. Curr...

Ana Mendes; Amélie A. Kelly; Harrie van Erp; Eve Shaw; Stephen J. Powers; Smita Kurup; Peter J. Eastmond

2013-08-30T23:59:59.000Z

110

UV-B-Responsive Association of the Arabidopsis bZIP Transcription Factor ELONGATED HYPOCOTYL5 with Target Genes, Including Its Own Promoter  

Science Journals Connector (OSTI)

...Instructions for Authors ( www.plantcell.org ) is: Roman Ulm ( roman.ulm@unige.ch ). [W] Online version contains Web-only data. [OPEN] Articles can be viewed online without a subscription. The bZIP transcription factor HY5 plays an important...

Melanie Binkert; László Kozma-Bognár; Kata Terecskei; Lieven De Veylder; Ferenc Nagy; Roman Ulm

2014-10-28T23:59:59.000Z

111

Microsoft Word - DM_VA-#126832-v3-Smart_Grid_Comments_--_DOE_--_Policy_and_Logistical_Challenges.DOC  

Broader source: Energy.gov (indexed) [DOE]

UNITED STATES DEPARTMENT OF ENERGY Office of Electricity Delivery and Energy Reliability In the matter of: Smart Grid RFI: Addressing Policy and Logistical Challenges to Smart Grid Implementation 75 FR 57006 COMMENTS OF VERIZON AND VERIZON WIRELESS Michael Glover Of Counsel Edward Shakin William H. Johnson VERIZON 1320 North Courthouse Road Ninth Floor Arlington, Virginia 22201 (703) 351-3060 John T. Scott, III William D. Wallace VERIZON WIRELESS 1300 I Street N.W. Suite 400 West Washington, DC 20005 November 1, 2010 As the Department of Energy (DOE) correctly notes, Smart Grid technology that "better integrates information, communication, and intelligent control technology [] into the nation's electrical system" holds "significant promise."

112

File:EIA-Appalach6-WV-VA-BOE.pdf | Open Energy Information  

Open Energy Info (EERE)

Appalach6-WV-VA-BOE.pdf Appalach6-WV-VA-BOE.pdf Jump to: navigation, search File File history File usage Appalachian Basin, Southern West Virginia and Southwestern Virginia By 2001 BOE Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 17.02 MB, MIME type: application/pdf) Description Appalachian Basin, Southern West Virginia and Southwestern Virginia By 2001 BOE Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States West Virginia, Virginia File history Click on a date/time to view the file as it appeared at that time.

113

Naval Station Norfolk, VA- Energy Conservation Program UESC Partnership Success Story  

Broader source: Energy.gov (indexed) [DOE]

Station Norfolk, VA Station Norfolk, VA Energy Conservation Program UESC Partnership Success Story 20 November 2008 2 Agenda Background Basis for Success Phase I Phase I Mod 01 Phase II Other / Future Program Aspects Why the Partnership Works 3 Background Minimal structured plan for NS Norfolk prior to 2006 Other MidLant Installations had aggressive ESPC programs in place The largest US Navy Installation in the World had only scratched the surface on all the opportunities for energy conservation Decision made to establish long term UESC partnership / program with VNG 4 NS Norfolk Basis for Success Focus on long term partnership with Utility to meet infrastructure needs and energy goals Gear project efforts to support core Mission of NS Norfolk Long term benefits more important than strict

114

File:EIA-Appalach6-WV-VA-GAS.pdf | Open Energy Information  

Open Energy Info (EERE)

Appalach6-WV-VA-GAS.pdf Appalach6-WV-VA-GAS.pdf Jump to: navigation, search File File history File usage Appalachian Basin, Southern West Virginia and Southwestern Virginia By 2001 Gas Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 18.09 MB, MIME type: application/pdf) Description Appalachian Basin, Southern West Virginia and Southwestern Virginia By 2001 Gas Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States West Virginia, Virginia File history Click on a date/time to view the file as it appeared at that time.

115

File:USDA-CE-Production-GIFmaps-VA.pdf | Open Energy Information  

Open Energy Info (EERE)

VA.pdf VA.pdf Jump to: navigation, search File File history File usage Virginia Ethanol Plant Locations Size of this preview: 776 × 600 pixels. Full resolution ‎(1,650 × 1,275 pixels, file size: 380 KB, MIME type: application/pdf) Description Virginia Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Virginia External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:22, 27 December 2010 Thumbnail for version as of 16:22, 27 December 2010 1,650 × 1,275 (380 KB) MapBot (Talk | contribs) Automated bot upload

116

Case Study - The Department of Veterans Affairs West Haven Campus, VA  

Broader source: Energy.gov (indexed) [DOE]

The Department of Veterans Affairs West Haven Campus, The Department of Veterans Affairs West Haven Campus, VA Connecticut Health Care System Case Study - The Department of Veterans Affairs West Haven Campus, VA Connecticut Health Care System October 7, 2013 - 1:59pm Addthis Overview The West Haven (Connecticut) Campus of the Veterans Affairs Connecticut Health Care System was the first Veteran's Hospital to award a shared energy savings (SES) contract (now known as energy savings performance contracts). The project involves replacement of the lighting system, installation of a cooling system, maintenance of the new chiller equipment, and several smaller efforts. Up-front costs are being provided through a $3.9 million investment by the contractor, EUA Cogenex, about $400,000 in rebates from the local utilities for gas and electric service (Southern

117

Does species diversity really drive speciation? Henrique M. Pereira, Va^nia M. Proenca and Luis Vicente  

E-Print Network [OSTI]

Does species diversity really drive speciation? Henrique M. Pereira, Va^nia M. Proenc¸a and Luis Vicente H. M. Pereira (hpereira@stanfordalumni.org), CEHIDRO, Dept Civil Engineering, Inst. Superior Te

Pereira, Henrique Miguel

118

Validation of KENO V.a with ENDF/B-V cross sections for {sup 233}U systems  

SciTech Connect (OSTI)

A multigroup Monte carlo code KENO V.a is maintained at the ORNL as part of the standardized cmoputer analysis for licensing evaluation (SCALE) system. Included in the SCALE system are the 238-and 44-energy group ENDF/B-V cross section libraries. The purpose of this work was to validate the ENDF/B-V and KENO V.a for uranium 233 systems.

Dunn, M.E.; Basoglu, B.; Bentley, C.L.; Haught, C.; Plaster, M.J.; Wilkinson, A.D.; Yamamoto, T.; Dodds, H.L. [Univ. of Tennessee, Knoxville, TN (United States)

1994-12-31T23:59:59.000Z

119

About the Data in Buildings Performance Database | Department...  

Broader source: Energy.gov (indexed) [DOE]

College* Arlington County, VA* Arvada, CO* Atlanta, GA* Beaverton, OR* Boston, MA* Camas School District, WA* Chicago, IL* Clark County, NV* Cleveland, OH* Columbia, MO*...

120

Breaking the Fuel Cell Cost Barrier | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Breaking the Fuel Cell Cost Barrier Breaking the Fuel Cell Cost Barrier Presentation at the AMFC Workshop, May 8, Arlington, VA amfc050811gottesfeldcellera.pdf More Documents &...

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

2014 Water Power Peer Review Report  

Broader source: Energy.gov [DOE]

The Water Power Peer Review Meeting was held February 24-28, 2014 in Arlington, VA. Principle investigators from the Energy Department National Laboratories, academic, and industry representatives...

122

Standard Method of Test for Integrated Heat Pumps  

Broader source: Energy.gov [DOE]

Lead Performer: Oak Ridge National Laboratory - Oak Ridge, TN Partners: -- ASHRAE - Atlanta, GA -- Air Conditioning, Heating, and Refrigeration Institute (AHRI) - Arlington, VA

123

OFFICE OF ACCOUTNING SERVICES  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Hawaii, American Samoa and Guam 135 IV Baltimore, San Francisco, Seattle 175 Chicago, Boston and International Cities 200 Alexandria & Arlington, VA, New York City, Washington DC...

124

Solid State NMR Studies and Local Structure of Voltage Fade Materials  

Broader source: Energy.gov (indexed) [DOE]

with the Voltage Fade Team Michael Slater, Jason Croy, Kevin Gallagher, Christopher Johnson, Yang Ren DOE Vehicle Technologies Program Annual Merit Review Arlington, VA May 13 -...

125

Industry Interactive Procurement System (IIPS)  

Broader source: Energy.gov [DOE]

Presentation on DOEs Industry Interactive Procurement System (IIPS) presented at the PEM fuel cell pre-solicitation meeting held May 26, 2005 in Arlington, VA.

126

Quality, Performance, and Emission Impacts of Biodiesel Blends  

Broader source: Energy.gov (indexed) [DOE]

Ken Proc, Matt Ratcliff, Matt Thornton, Aaron Williams Vehicle Technologies Program Merit Review Fuels Technologies May 19, 2009 Arlington, VA This presentation does not contain...

127

Application Content and Evaluation Criteria/Process  

Broader source: Energy.gov [DOE]

Presentation on Application Content and Evaluation Criteria/Process presented at the PEM fuel cell pre-solicitation meeting held May 26, 2005 in Arlington, VA.

128

¿A dónde se va la energía?  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

¿A dónde se va la energía? ¿A dónde se va la energía? Sólo aproximadamente el 14% -26% de la energía del combustible que usted pone en su tanque se usa para mover su coche o operar accesorios útiles, como el aire acondicionado. El resto de la energía es perdida en ineficiencias del motor, de la líínea de conducción y al estar a ralentí. Por lo tanto, el potencial para mejorar la eficiencia del combustible con tecnologías avanzadas es enorme. Combinadas Ciudad Carretera Conducir en Ciudad Los requerimientos de energía mostrados en el diagrama se calcularon conduciendo por la ciudad en el modo para-avanzar usando el procedimiento de la EPA FTP-75 Test. Perdidas de Motor En vehículos propulsados por gasolina, gran parte de la energía del combustible se pierde en el motor, primordialmente al calentarse. Pequeñas

129

Effect of flow rate of ethanol on growth dynamics of VA-SWNT -Transition from no-flow CVD to normal ACCVD  

E-Print Network [OSTI]

Effect of flow rate of ethanol on growth dynamics of VA-SWNT - Transition from no-flow CVD a growth model [2]. In this study, the flow rate of ethanol during the CVD was controlled precisely. Figure 1 shows the growth curve of VA-SWNT film for various ethanol flow rates. In the figure, "No

Maruyama, Shigeo

130

Comparing Extinction Rates: Past, Present, and Future Va^nia Proenc-a and Henrique Miguel Pereira, Faculdade de Cie^ncias da Universidade de Lisboa, Lisboa, Portugal  

E-Print Network [OSTI]

Comparing Extinction Rates: Past, Present, and Future Va^nia Proenc-a and Henrique Miguel Pereira et al., 2005; Pereira et al., 2010a). This is very worrying because species extinction

Pereira, Henrique Miguel

131

Reliable Power Inc | Open Energy Information  

Open Energy Info (EERE)

Power Inc Power Inc Jump to: navigation, search Name Reliable Power Inc Place Arlington, Virginia Zip VA 22201 Product US-based fuel cell manufacturer. Coordinates 43.337585°, -89.379449° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.337585,"lon":-89.379449,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

132

Millennium Institute | Open Energy Information  

Open Energy Info (EERE)

Name Millennium Institute Name Millennium Institute Address 2111 Wilson Blvd. Suite 700 Place Arlington, VA Zip 22201 Region Northeast - NY NJ CT PA Area Phone number (703) 351 5081 Website http://www.millenniuminstitute Coordinates 38.891701°, -77.084673° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":38.891701,"lon":-77.084673,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

133

Single-cycle terahertz pulses with >0.2 V/A field amplitudes via coherent transition radiation  

SciTech Connect (OSTI)

We demonstrate terahertz pulses with field amplitudes exceeding 0.2 V/A generated by coherent transition radiation. Femtosecond, relativistic electron bunches generated at the Linac Coherent Light Source are passed through a beryllium foil, and the emitted radiation is characterized as a function of the bunch duration and charge. Broadband pulses centered at a frequency of 10 THz with energies of 140 {mu}J are measured. These far-below-bandgap pulses drive a nonlinear optical response in a silicon photodiode, with which we perform nonlinear autocorrelations that yield information regarding the terahertz temporal profile. Simulations of the spatiotemporal profile agree well with experimental results.

Daranciang, Dan [Department of Chemistry, Stanford University, Stanford, California 94305 (United States); PULSE Institute for Ultrafast Energy Science, SLAC National Accelerator Laboratory, Menlo Park, California 94025 (United States); Goodfellow, John [Department of Materials Science and Engineering, Stanford University, Stanford, California 94305 (United States); Stanford Institute for Materials and Energy Science, SLAC National Accelerator Laboratory, Menlo Park, California 94025 (United States); Fuchs, Matthias; Ghimire, Shambhu [PULSE Institute for Ultrafast Energy Science, SLAC National Accelerator Laboratory, Menlo Park, California 94025 (United States); Wen, Haidan [Advanced Photon Source, Argonne National Laboratory, Argonne, Illinois 60439 (United States); Reis, David A. [PULSE Institute for Ultrafast Energy Science, SLAC National Accelerator Laboratory, Menlo Park, California 94025 (United States); Stanford Institute for Materials and Energy Science, SLAC National Accelerator Laboratory, Menlo Park, California 94025 (United States); Department of Applied Physics, Stanford University, Stanford, California 94305 (United States); Loos, Henrik; Fisher, Alan S. [Linac Coherent Light Source, SLAC National Accelerator Laboratory, Menlo Park, California 94025 (United States); Lindenberg, Aaron M. [PULSE Institute for Ultrafast Energy Science, SLAC National Accelerator Laboratory, Menlo Park, California 94025 (United States); Department of Materials Science and Engineering, Stanford University, Stanford, California 94305 (United States); Stanford Institute for Materials and Energy Science, SLAC National Accelerator Laboratory, Menlo Park, California 94025 (United States)

2011-10-03T23:59:59.000Z

134

PLAYER REGISTRATION City State Zip  

E-Print Network [OSTI]

a $100 tax deductible/tax credit donation to Michigan State University. Staff, student and spouse fees are reduced and will not include a tax credit. The balance of the fee covers green fees, cart, lunch ________________________________________________ Name Daytime phone Golfers are registered on a first-come, first-served basis. CREDIT CARD USERS

135

Orange County Zip Codes Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

Irvine Anaheim Hills 92807 92603 Irvine Anaheim Hills 92808 92604 Irvine Anaheim Hills 92809 92605 Huntington Beach PO Box Only Anaheim Hills 92817 92606 Irvine Atwood 92870 92607 Laguna Beach Duplicate; PO 92609 Lake Forest PO Box Only Brea 92821 92610 El Toro Brea 92822 PO Box Only 92610 Foothill Ranch Brea

de Lijser, Peter

136

Orange County Zip Codes By Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

only 92607 Laguna Niguel Duplicate; PO Box only Brea 92823 92609 Lake Forest PO Box only Buena Park Valley 92728 Duplicate; PO Box only 92629 Dana Point Fullerton 92831 92630 Lake Forest Fullerton 92832 92637 Laguna Hills duplicate Fullerton 92833 92637 Laguna Woods duplicate Fullerton 92834 PO Box only

de Lijser, Peter

137

Search for V+A current in top quark decay in p anti-p collisions at s**(1/2) = 1.96-TeV  

SciTech Connect (OSTI)

The authors report an upper limit on the fraction of V + A current, f{sub V+A}, in top quark decays, using approximately 700 pb{sup -1} of p{bar p} collisions at {radical}s = 1.96 TeV acquired by the upgraded Collider Detector at Fermilab. For the decay t {yields} wb {yields} {ell}vb (where {ell} = e or {mu}), the invariant mass of the charged lepton and the bottom quark jet is sensitive to the polarization of the W boson. They determine f{sub V+A} = -0.06 {+-} 0.25 given a top quark mass of 175 GeV/c{sup 2}. They set an upper limit on f{sub V+A} of 0.29 at the 95% confidence level, which represents an improvement by a factor of two on the previous best direct limit.

Abulencia, A.; Adelman, J.; Affolder, T.; Akimoto, T.; Albrow, M.G.; Ambrose, D.; Amerio, S.; Amidei, D.; Anastassov, A.; Anikeev, K.; Annovi, A.; /Taiwan, Inst. Phys.

2006-08-01T23:59:59.000Z

138

Estimating VaR and ES of the spot price of oil using futures-varying centiles  

Science Journals Connector (OSTI)

This paper illustrates the power of modern statistical modelling in estimating measures of market risk, here applied to the Brent and WTI spot price of oil. Both Value-at-Risk (VaR) and Expected Shortfall (ES) are cast in terms of conditional centiles based upon semi-parametric regression models. Using the GAMLSS statistical framework, we stress the important aspects of selecting a highly flexible parametric distribution (skewed Student's t-distribution) and of modelling both skewness and kurtosis as non-parametric functions of the price of oil futures. Furthermore, an empirical application characterises the relationship between spot oil prices and oil futures - exploiting the futures market to explain the dynamics of the physical market. Our results suggest that NYMEX WTI has heavier tails compared with the ICE Brent. Contrary to the common platitude of the industry, we argue that 'somebody knows something' in the oil business.

Giacomo Scandroglio; Andrea Gori; Emiliano Vaccaro; Vlasios Voudouris

2013-01-01T23:59:59.000Z

139

Validation of KENO V.a with ENDF/B-V cross sections for {sup 233}U systems  

SciTech Connect (OSTI)

The multigroup Monte Carlo code KENO V.a and the 238- and 44-energy-group ENDF/B-V cross-section libraries were validated for {sup 233}U systems. Fifty-one critical experiments involving {sup 233}UO{sub 2}(NO{sub 3}){sub 2}, {sup 233}UO{sub 2}F{sub 2}, or {sup 233}U metal were selected for the validation. The H/{sup 233}U ratios for the experiments range from 0 to 1986. Each experiment was modeled with KENO V.a, and the effective multiplication factor k{sub eff} was calculated for each system using the 44- and 238-group ENDF/B-V, the 27- and 218-group ENDF/B-IV, and the 16-group Hansen-Roach cross-section libraries. The mean calculated k{sub eff} for all experiments using the 44- and 238-group libraries is 1.0090 {+-} 0.0021 and 1.0064 {+-} 0.0020, respectively. For comparison, the mean calculated k{sub eff} using the 27-, 218-, and 16-group libraries is 1.0142 {+-} 0.0038, 1.0125 {+-} 0.0038, and 0.9991 {+-} 0.0019, respectively. In general, an improvement exists in the agreement between the calculated k{sub eff}`s and the experimental results (i.e., k{sub eff} = 1.0) obtained with the newer ENDF/B-V libraries relative to ENDF/B-IV. This study is pertinent to {sup 233}U storage outside of the reactor.

Dunn, M.E.; Basoglu, B.; Bentley, C.L.; Plaster, M.J.; Wilkinson, A.D.; Dodds, H.L. [Univ. of Tennessee, Knoxville, TN (United States). Nuclear Engineering Dept.; Haught, C. [Martin Marietta Energy Systems, Piketon, OH (United States); Yamamoto, T. [Japan Atomic Energy Research Inst., Tokai (Japan)

1995-08-01T23:59:59.000Z

140

A LOW COST MULTI-BAND/MULTI-MODE RADIO FOR PUBLIC SAFETY S.M. Hasan (Virginia Tech, Blacksburg, VA, U.S.A., hasan@vt.edu); P. Balister  

E-Print Network [OSTI]

A LOW COST MULTI-BAND/MULTI-MODE RADIO FOR PUBLIC SAFETY S.M. Hasan (Virginia Tech, Blacksburg, VA, U.S.A., hasan@vt.edu); P. Balister (Virginia Tech, Blacksburg, VA, U.S.A., balister@vt.edu); K. Lee

Ellingson, Steven W.

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

Camenen, B., and Larson, M. 2007. A Total Load Formula for the Nearshore. Proceedings Coastal Sediments '07 Conference, ASCE Press, Reston, VA, 56-67.  

E-Print Network [OSTI]

Sediments '07 Conference, ASCE Press, Reston, VA, 56-67. A TOTAL LOAD FORMULA FOR THE NEARSHORE Benoit.larson@tvr.lth.se Abstract: A total load sediment transport formula based on recent studies on the bed load and suspended qualify and quantify the current-related and wave-related sediment transport. It appeared

US Army Corps of Engineers

142

Virginia Seafood Agricultural Research and Extension Center102SKingSt.,Hampton,VA23669757-727-4861www.arec.vaes.vt.edu/virginia-seafood Physical Resources  

E-Print Network [OSTI]

Virginia Seafood Agricultural Research and Extension Center102SKingSt.,Hampton,VA23669·757-727-4861·www.arec.vaes.vt.edu/virginia-seafood Physical Resources Land and Facilities Description Land Specialist, Muscle food safety and quality Safety and quality of seafood, beef, poultry, and pork products

Virginia Tech

143

Virginia Seafood Agricultural Research and Extension Center102SKingSt.,Hampton,VA23669757/727-4861www.arec.vaes.vt.edu/virginia-seafood Physical Resources  

E-Print Network [OSTI]

Virginia Seafood Agricultural Research and Extension Center102SKingSt.,Hampton,VA23669·757/727-4861·www.arec.vaes.vt.edu/virginia-seafood Physical Resources Land and Facilities Description Land and quality Safety and quality of seafood, beef, poultry, and pork products. HACCP and bilingual training

Liskiewicz, Maciej

144

Microsoft Word - ARPA-E_RareEarth_Workshop_Overview_v6  

Broader source: Energy.gov (indexed) [DOE]

ARPA-E WORKSHOP ARPA-E WORKSHOP Rare Earth and Critical Materials December 6, 2010 in Arlington, VA Background ...................................................................................................................................................................................... 2 Breakout Sessions and Participant Preparation .............................................................................................................. 8 Agenda ................................................................................................................................................................................................ 9 Contact Information ................................................................................................................................................................... 10

145

Breaking the Fuel Cell Cost Barrier  

Broader source: Energy.gov (indexed) [DOE]

the Fuel Cell Cost Barrier AMFC Workshop May 8 th , 2011, Arlington, VA Shimshon Gottesfeld, CTO The Fuel Cell Cost Challenge 2 CellEra's goal - achieve price parity with...

146

International Association of Latino Public Administration Executives...  

Broader source: Energy.gov (indexed) [DOE]

Forum August 27, 2013 7:30PM EDT to August 29, 2013 8:45PM EDT Holiday Inn Key Bridge, Arlington, VA Leading the President's Commitment to Diversity and Inclusion:...

147

Workshops and Public Meetings Related to Water-Energy | Department...  

Energy Savers [EERE]

Workshops and Public Meetings Related to Water-Energy Workshops and Public Meetings Related to Water-Energy Waste-to-Energy Roapmapping Workshop in Arlington, VA - November 5, 2014...

148

Climate Leadership Conference | Department of Energy  

Office of Environmental Management (EM)

City 1250 S Hayes St. Arlington, VA 22202 Hosted and organized by the Association of Climate Change Officers (ACCO), Center for Climate and Energy Solutions (C2ES), and the...

149

GEORGE LEA FOUNDER'S SCHOLARSHIP PUBLIC LANDS FOUNDATION  

E-Print Network [OSTI]

1 GEORGE LEA FOUNDER'S SCHOLARSHIP PUBLIC LANDS FOUNDATION P.O. Box 7226 Arlington, VA 22207 Scholarship Application Form This scholarship is being offered by the Public Lands Foundation, a national non

150

Catalysis Working Group Kick-Off Meeting Agenda  

Office of Environmental Management (EM)

1 Catalysis Working Group 2012 Hydrogen and Fuel Cells Program Annual Merit Review and Peer Evaluation Meeting Arlington, VA - May 14, 2012 Catalysis Working Group Kick-off Meeting...

151

POSTGRADUATE MONTEREY, CALIFORNIA  

E-Print Network [OSTI]

(WISE), two deep water moorings were placed in the northeastern portion of the South China Sea deep, Arlington, VA 22202-4302, and to the Office of Management and Budget, Paperwork Reduction Project (0704

152

Waste-to-Energy Workshop | Department of Energy  

Office of Environmental Management (EM)

Waste-to-Energy Workshop Waste-to-Energy Workshop November 5, 2014 9:00AM EST to November 6, 2014 12:00PM EST DoubleTree Hotel Crystal City 300 Army Navy Drive Arlington, VA 22202...

153

Big Data Projects on Solar Tech Evolution and Diffusion  

Broader source: Energy.gov [DOE]

This is the meeting agenda from the Big Data Projects on Solar Technology Evolution and Diffusion kickoff meeting, held on July 15, 2013 in Arlington, VA and facilitated by the SunShot Initiative.

154

Waste-to-Energy Roadmapping Workshop Agenda  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Waste-to-Energy Workshop Agenda November 5-6, 2014 DoubleTree Hotel Crystal City Arlington, VA 22202 Day 1: Wednesday, November 5, 2014 Time Activity 7:30 am Registration and...

155

Henderson Hall's Education and Career Fair | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Hall's Education and Career Fair September 25, 2014 2:00PM to 5:00PM EDT Location: Smith Gym, Henderson Hall, Arlington, VA POC: Donna Friend Website: http:www.mccshh.com...

156

Anion Exchange Membranes for Fuel Cells | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Anion Exchange Membranes for Fuel Cells Anion Exchange Membranes for Fuel Cells Presentation at the AMFC Workshop, May 8-9, 2011, Arlington, VA amfc110811herring.pdf More...

157

Register Now for AMO's Workshop on Composite Manufacturing  

Broader source: Energy.gov [DOE]

The U.S. Department of Energy's Advanced Manufacturing Office will host a workshop on Fiber Reinforced Polymer Composite Manufacturing on January 13, 2014 at the Hilton Crystal City in Arlington, VA.

158

ZERH Training: Harrisonburg, VA  

Broader source: Energy.gov [DOE]

This 3.5-hour training provides builders with a comprehensive review of zero energy-ready home construction including the business case, detailed specifications, and opportunities to be recognized...

159

Advanced Battery Manufacturing (VA)  

SciTech Connect (OSTI)

LiFeBATT has concentrated its recent testing and evaluation on the safety of its batteries. There appears to be a good margin of safety with respect to overheating of the cells and the cases being utilized for the batteries are specifically designed to dissipate any heat built up during charging. This aspect of LiFeBATTs products will be even more fully investigated, and assuming ongoing positive results, it will become a major component of marketing efforts for the batteries. LiFeBATT has continued to receive prismatic 20 Amp hour cells from Taiwan. Further testing continues to indicate significant advantages over the previously available 15 Ah cells. Battery packs are being assembled with battery management systems in the Danville facility. Comprehensive tests are underway at Sandia National Laboratory to provide further documentation of the advantages of these 20 Ah cells. The company is pursuing its work with Hybrid Vehicles of Danville to critically evaluate the 20 Ah cells in a hybrid, armored vehicle being developed for military and security applications. Results have been even more encouraging than they were initially. LiFeBATT is expanding its work with several OEM customers to build a worldwide distribution network. These customers include a major automotive consulting group in the U.K., an Australian maker of luxury off-road campers, and a number of makers of E-bikes and scooters. LiFeBATT continues to explore the possibility of working with nations that are woefully short of infrastructure. Negotiations are underway with Siemens to jointly develop a system for using photovoltaic generation and battery storage to supply electricity to communities that are not currently served adequately. The IDA has continued to monitor the progress of LiFeBATTs work to ensure that all funds are being expended wisely and that matching funds will be generated as promised. The company has also remained current on all obligations for repayment of an IDA loan and lease payments for space to the IDA. A commercial venture is being formed to utilize the LiFeBATT product for consumer use in enabling photovoltaic powered boat lifts. Field tests of the system have proven to be very effective and commercially promising. This venture is expected to result in significant sales within the next six months.

Stratton, Jeremy

2012-09-30T23:59:59.000Z

160

Arlington, Kansas: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

66808°, -98.1786739° 66808°, -98.1786739° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.8966808,"lon":-98.1786739,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

Arlington, Virginia: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

903896°, -77.0841446° 903896°, -77.0841446° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":38.8903896,"lon":-77.0841446,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

162

The University of Texas at Arlington Administration  

E-Print Network [OSTI]

of Education Rachel Croson, Ph.D., Dean, College of Business Pamela Jansma, Ph.D., Dean, College of Science Poster, Ph.D., Dean, School of Nursing Rebeccal Bichel, M.L.I.S., Dean, Library Beth S. Wright, Ph

Texas at Arlington, University of

163

UT Arlington 1895 Society Membership Roster  

E-Print Network [OSTI]

Shah (Patel) Thomas W. and Linda Simmons John Staniland Phillip and Janet Stephenson John Tapp David;Daniel W. and Linda Armstrong Mr. and Mrs. Vincent Ashwill Duncan and Sylvaine Aust Sunil Avadhanam John Ball Ray Barber Corlyce Barth Steven S. Barton Susan and Phillip Baxley Anonymous Jonathan Beard

Huang, Haiying

164

UT Arlington Rankin Society Membership Roster  

E-Print Network [OSTI]

Fairchild Aaron L. Farmer Shelly Frank William Frey David H. Gaines Robert Gamble Paul Geisel Randy and Beth Gideon Michael Gingrich John and Judy Goolsby Danny Griffin Mary Groner Sue Harl Ralph and Susan Hawkins. Wesson John and Darlene Wier Dale* and Cindy Will Stephen D. Willey Gretchen N. Williams David F. Wolf

Huang, Haiying

165

LBNL-4183E-rev1 N NA AT TU UR RA AL L G GA AS S V VA AR RI  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

4183E-rev1 4183E-rev1 N NA AT TU UR RA AL L G GA AS S V VA AR RI IA AB BI IL LI IT TY Y I IN N C CA AL LI IF FO OR RN NI IA A: : E EN NV VI IR RO ON NM ME EN NT TA AL L I IM MP PA AC CT TS S A AN ND D D DE EV VI IC CE E P PE ER RF FO OR RM MA AN NC CE E E EX XP PE ER RI IM ME EN NT TA AL L E EV VA AL LU UA AT TI IO ON N O OF F I IN NS ST TA AL LL LE ED D C CO OO OK KI IN NG G E EX XH HA AU US ST T F FA AN N P PE ER RF FO OR RM MA AN NC CE E Brett C. Singer, William W. Delp and Michael G. Apte Indoor Environment Department Atmospheric Sciences Department Environmental Energy Technologies Division July 2011 (Revised February 2012) Disclaimer 1 This document was prepared as an account of work sponsored by the United States Government. While this document is believed to contain correct information, neither the United States Government nor any agency thereof, nor The Regents of the University of California, nor any of

166

ZipZone Technologies | Open Energy Information  

Open Energy Info (EERE)

a complete line of renewable energy products from its online store.1 Products include solar photovoltaic (PV) panels, wind generators, inverters, batteries and energy related...

167

NETL Researcher Honored with 2013 Federal Laboratory Award Morgantown, W.Va. - Dr. Stephen E. Zitney of the National Energy Technology  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Researcher Honored with 2013 Federal Laboratory Award Researcher Honored with 2013 Federal Laboratory Award Morgantown, W.Va. - Dr. Stephen E. Zitney of the National Energy Technology Laboratory (NETL) has been awarded a Mid-Atlantic region Federal Laboratory Consortium (FLC) award for Excellence in Technology Transfer for his work on the 3D Virtual Energy Plant Simulator and Immersive Training System. The 3D Virtual Energy Plant Simulator and Immersive Training System (ITS) deployed at NETL's Advanced Virtual Energy Simulation Training and Research (AVESTAR ® ) Center delivers the first virtual energy plant for training, research, and development. NETL and its training partners are using the system to deliver realistic, cost-effective, and low-risk workforce training to the energy industries. Virtual reality-based training

168

ADVANCED COMPOSITE MATERIALS TECHNOLOGY FOR ROTORCRAFT Andrew Makeev*, University of Texas at Arlington, Arlington, Texas, USA  

E-Print Network [OSTI]

ADVANCED COMPOSITE MATERIALS TECHNOLOGY FOR ROTORCRAFT Andrew Makeev*, University of Texas, Patz Materials & Technologies, Benicia, CA, USA Abstract Composite materials are increasingly used. In polymer-matrix composite structures, matrix-dominated failures impose severe limitations on structural

Texas at Arlington, University of

169

President Obama Lauds Virginia Energy Company | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Lauds Virginia Energy Company Lauds Virginia Energy Company President Obama Lauds Virginia Energy Company March 10, 2010 - 1:25pm Addthis President Barack Obama speaks at OPOWER in Arlington, Va. | Photo courtesy of OPOWER President Barack Obama speaks at OPOWER in Arlington, Va. | Photo courtesy of OPOWER Joshua DeLung President Barack Obama visited OPOWER, an Arlington, Va., energy company to praise the work going on there. "The work you do here, as we just heard, is making homes more energy efficient, it's saving people money, it's generating jobs and it's putting America on the path to a clean energy future," Obama said. OPOWER implements an energy-efficiency program with utilities, delivering energy savings by motivating customers to take action. Consumers are empowered with tools that leverage cutting-edge behavioral science, data

170

Characterization of the environmental fate of Bacillus thuringiensis var. kaurstaki (Btk) after pest eradication efforts in Seattle, WA and Fairfax county, VA  

SciTech Connect (OSTI)

Understanding the fate of biological agents in the environment will be critical to recovery and restoration efforts after a biological attack. Los Alamos National Laboratory (LANL) is conducting experiments in the Seattle, WA and Fairfax County, VA areas to study agent fate in urban environments. As part of their gypsy moth suppression efforts, Washington State and Fairfax County have sprayed Bacillus thuringiensis var. kurstaki (Btk), a common organic pesticide for decades. Many of the spray zones have been in or near urban areas. LANL has collected surface and bulk samples from historical Seattle spray zones to characterize how long Btk persists at detectable levels in the environment, and how long it remains viable in different environmental matrices. This work will attempt to address three questions. First, how long does the agent remain viable at detectable levels? Second, what is the approximate magnitude and duration of resuspension? And third, does the agent transport into buildings? Data designed to address the first question will be presented. Preliminary results indicate Btk remains viable in the environment for at least two years.

Ticknor, Lawrence [Los Alamos National Laboratory; Van Cuyk, Sheila M [Los Alamos National Laboratory; Deshpande, Alina [Los Alamos National Laboratory; Omberg, Kristin M [Los Alamos National Laboratory

2008-01-01T23:59:59.000Z

171

Development of 100kVA AC superconducting coil using NbTi cables with a CuSi alloy matrix  

SciTech Connect (OSTI)

For implementation of AC superconducting equipment, it is imperative to develop low loss cables having highly stable characteristics. Here, newly developed NbTi superconducting cables using a CuSi alloy matrix are of low loss and are very promising as cables for practical application. However, since the CuSi alloy is a new material as a matrix for NbTi superconducting cables, many unknown factors as regards to optimum conditions for the manufacture of long cables, as well as superconducting characteristics are involved. For this new superconducting cable, a long strand (km class) was manufactured as a step for practical application, and a primary twisted cable was fabricated. Using this cable, a coil of the 100kVA class was fabricated for trial, and its performance characteristic with transport current was evaluated. This coil had no training phenomenon and had high stabilities. Furthermore, it permitted full AC current transmission of up to DCIc. Upon analysis of the coil loss, the hysteresis loss was smaller than coupling loss, and there was little increase of loss due to the current flow to the coil. consequently, by using CuSi alloy matrix superconducting cables, it was possible to provide an AC coil of low loss and high stability, and the present cable was found to be promising as a new AC superconducting cable in the future.

Kasahara, H.; Akita, S.; Torii, S. [CRIEPI, Tokyo (Japan)] [CRIEPI, Tokyo (Japan); Sugimoto, M.; Matsumoto, K.; Tanaka, Y. [Furukawa Electric Co., Ltd., Nikko (Japan)] [Furukawa Electric Co., Ltd., Nikko (Japan); Tachikawa, K. [Tokai Univ., Hiratsuka (Japan)] [Tokai Univ., Hiratsuka (Japan)

1996-07-01T23:59:59.000Z

172

The Nature Conservancy | Open Energy Information  

Open Energy Info (EERE)

Conservancy Conservancy Jump to: navigation, search Logo: The Nature Conservancy Name The Nature Conservancy Address 4245 North Fairfax Drive, Suite 100 Place Arlington, VA Zip 22203-1606 Region Northeast - NY NJ CT PA Area Year founded 1951 Phone number +1 (703) 841-5300 Website http://www.nature.org/?src=log Coordinates 38.8812654°, -77.1217107° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":38.8812654,"lon":-77.1217107,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

173

Conservation International | Open Energy Information  

Open Energy Info (EERE)

International International Jump to: navigation, search Logo: Conservation International Name Conservation International Address 2011 Crystal Drive, Suite 500 Place Arlington, VA Zip 22202 Region Northeast - NY NJ CT PA Area Number of employees 501-1000 Year founded 1987 Phone number 1 (703) 341-2400 Website http://www.conservation.org/Pa Coordinates 38.85566°, -77.048668° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":38.85566,"lon":-77.048668,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

174

Hydrogen Storage Systems Analysis Working Group Meeting: Summary Report  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Held in Conjunction with the DOE Hydrogen Program Annual Merit Review Crystal Gateway Marriott, Arlington, VA June 11, 2008 SUMMARY REPORT Compiled by Romesh Kumar Argonne National Laboratory and Elvin Yzugullu Sentech, Inc. July 18, 2008 SUMMARY REPORT Hydrogen Storage Systems Analysis Working Group Meeting June 11, 2008 Crystal Gateway Marriott, Arlington, VA Meeting Objectives This meeting was one of a continuing series of biannual meetings of the Hydrogen Storage Systems Analysis Working Group (SSAWG). The objective of these meetings is to bring together the DOE research community involved in systems analysis of hydrogen storage materials and processes for information exchange and to update the researchers on related

175

Aftermath of the Mark VA  

Science Journals Connector (OSTI)

... the sum of almost 600,000, although on this the consultants eventually offered a rebate of 30,000. Even so, the amount they received was rather more than ...

1976-08-12T23:59:59.000Z

176

VA's Performance Contracting Program Overview  

Broader source: Energy.gov (indexed) [DOE]

Kristan Higgins Kristan Higgins Phyllis Stange October 17, 2012 1 Keeping our promises to veterans through sustainability OVERVIEW  Veteran - Centric  Good stewards of the taxpayers dollars.  Process is about 14 months from Agency Developed Package Award  New stream-lined process on next slide  Removed 2-3 months 2 Keeping our promises to veterans through sustainability Requirement s Package Received by NEBC; NEBC and OAEM Validate Package Phase 1 - Project Planning Assemble Acquisition Team; Engage Project Facilitator; Build RFP/NOO 6 weeks Send RFP for Technical & Legal Review Interested ESCOs respond to NOO (Can't close until legal review is complete) Technical & Legal Reviews Completed Send Invitation for Preliminary Site Survey

177

ENVIRONMENTAL MANAGEMENT ADVISORY BOARD  

Broader source: Energy.gov (indexed) [DOE]

The Crystal City Marriott at Reagan National Airport 1999 Jefferson Davis Highway * Arlington, VA 22202 April 29, 2009 2 TABLE OF CONTENTS Meeting Participants........................................................................................................................ 3 Additional Materials........................................................................................................................ 4 List of Acronyms............................................................................................................................. 5 April 29, 2009 Opening Remarks ............................................................................................................................ 7 EM Program Update........................................................................................................................

178

Microsoft Word - March2010.MeetingMinutes.Final  

Broader source: Energy.gov (indexed) [DOE]

to the to the U.S. DEPARTMENT OF ENERGY PUBLIC MEETING MINUTES The Crystal Gateway Marriott 1700 Jefferson Davis Highway * Arlington, VA 22202 March 31, 2010 Environmental Management Advisory Board March 31, 2010 Meeting Minutes 2 TABLE OF CONTENTS Meeting Participants ........................................................................................................... 3 Additional Materials ........................................................................................................... 4 List of Acronyms ................................................................................................................ 5 Opening Remarks................................................................................................................ 7

179

Sediment Decontamination For Navigational And Environmental Restoration In NY/NJ Harbor Case Study: Passaic River, New Jersey  

E-Print Network [OSTI]

Sediment Decontamination For Navigational And Environmental Restoration In NY/NJ Harbor ­ Case, Arlington, VA 22230 Sediments in the NY/NJ Harbor are widely contaminated with toxic organic and inorganic compounds. Decontamination of these sediments is one tool that can be used to cope with the problems posed

Brookhaven National Laboratory

180

Optics, Acoustics and Stress in Situ (OASIS): Effects of Aggregation, Vertical Structure, and Relation to Physical Forcing.  

E-Print Network [OSTI]

Optics, Acoustics and Stress in Situ (OASIS): Effects of Aggregation, Vertical Structure. Arlington, VA 22203-1995 TITLE: Optics, Acoustics and Stress in Situ (OASIS): Effects of Aggregation of Research and Sponsored Programs #12;Abstract Nearbed optical and acoustical properties in coastal waters

Boss, Emmanuel S.

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Potential on-shore and off-shore reservoirs for CO2 sequestration in Central Atlantic magmatic province basalts  

Science Journals Connector (OSTI)

...measurements, and the borehole conditions were consistent...fracture porosity or large void space (secondary...features (34, 35). Drilling in the Nantucket...continental scientific drilling workshop, Arlington...guide to Earths largest continental flood...Culpeper basin, VA ( Drilling, Observation, and Sampling...

David S. Goldberg; Dennis V. Kent; Paul E. Olsen

2010-01-01T23:59:59.000Z

182

Hydrogen Technology Validation: DOE Hydrogen Program 2011 Annual Merit Review and Peer Evaluation Report  

Broader source: Energy.gov [DOE]

This document summarizes the comments provided by peer reviewers on hydrogen and fuel cell projects presented at the FY 2011 U.S. Department of Energy (DOE) Hydrogen Program and Vehicle Technologies Program Annual Merit Review and Peer Evaluation Meeting (AMR), held May 913, 2011 in Arlington, VA.

183

Critical Materials Workshop  

Broader source: Energy.gov [DOE]

AMO hosted a public workshop on Tuesday, April 3, 2012 in Arlington, VA to provide background information on critical materials assessment, the current research within DOE related to critical materials, and the foundational aspects of Energy Innovation Hubs. Additionally, the workshop solicited input from the critical materials community on R&D gaps that could be addressed by DOE.

184

Arlington Heights, Ohio: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

150583°, -84.4554978° 150583°, -84.4554978° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.2150583,"lon":-84.4554978,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

185

Mount Arlington, New Jersey: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

9259319°, -74.6348828° 9259319°, -74.6348828° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.9259319,"lon":-74.6348828,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

186

North Arlington, New Jersey: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

788434°, -74.1331988° 788434°, -74.1331988° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.788434,"lon":-74.1331988,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

187

Department of Civil Engineering The University of Texas Arlington  

E-Print Network [OSTI]

Profile: https://www.uta.edu/mentis/public/#profile/profile/view/id/1915/. Office Hours: Tuesdays. Prestressed Concrete Bridges 10. Load Balancing, One-Way Slabs (if time allows) GTA: Regina Waweru. RM 137

Chao, Shih-Ho

188

Energy Management Retrofit for Arlington Independent School District  

E-Print Network [OSTI]

and for the tracking of the measures to make sure the desired energy conservation goals were met. Finally, the school district requested, a guarantee that savings goal be attained by an agreement that the contractor pay for any "shortfall" in savings that might occur...

Nooner, D.

1989-01-01T23:59:59.000Z

189

Arlington High School Team Members: Joanna Abouezzi, Eric Lei,  

E-Print Network [OSTI]

The Average Number of Individuals of Various River Species along a Salinity Gradient in the Hudson River from in which they take samples and collect data from the Hudson River. The data sets we used � salinity levels investigated trends such as the variation of population levels of certain species at different salinity levels

Canham, Charles D.

190

Page 1 of 4 The University of Texas at Arlington  

E-Print Network [OSTI]

-face circular mechanized shield machine, usually of worker-entry diameter, steerable, and with a rotary cutting not applied to those machines where the pressure originates from the main Pipe Jacking rig in the Drive Shaft

Texas at Arlington, University of

191

Upper Arlington, Ohio: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Ohio: Energy Resources Ohio: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 39.9945084°, -83.0624078° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.9945084,"lon":-83.0624078,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

192

Arlington County, Virginia: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

816208°, -77.0909809° 816208°, -77.0909809° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":38.8816208,"lon":-77.0909809,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

193

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Aviation Fuels Development Center Baylor Aviation Fuels Development Center Baylor University Renewable Aviation Fuels Development Center One Bear Place Waco Texas http www baylor edu bias index php id Texas Area CSU Institute for the Built Environment CSU Institute for the Built Environment Oval Drive Fort Collins Colorado http www ibe colostate edu Rockies Area Caltech Center for Sustainable Energy Research Caltech Center for Sustainable Energy Research East California Boulvard Pasadena California http www ccser caltech edu Southern CA Area Calverton Business Incubator Calverton Business Incubator Middle Country Rd Calverton New York http www sunysb edu research calverton Northeast NY NJ CT PA Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org

194

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFS Trinity Power Corp AFS Trinity Power Corp Medina Washington State AFS Trinity Power Corp AFS Trinity Power Corp Medina Washington State Vehicles AGNI Motors AGNI Motors India Vehicles UK based manufacturer of DC Motors and Battery Management Systems for Electric Vehicles ATG GmbH ATG GmbH Gl tt Germany Vehicles Provider of products and solutions for using diesel or biodiesel at low temperatures and converting Diesel Operating Vehicles to Straight Vegetable Oil AVL Powertrain Engineering AVL Powertrain Engineering Halyard Drive Plymouth Michigan Vehicles https www avl com Able Energy Co Able Energy Co Mound View Rd River Falls Wisconsin Renewable Energy Services Gateway Solar Vehicles Solar EPC Contractor http www weknowsolar com Acciona Renault Nissan Alliance JV Acciona Renault Nissan Alliance JV Spain Vehicles Spain based joint venture to promote electric vehicles

195

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting products for wind solar and hydro http www tier com Pacific Northwest Area AltaRock Energy Inc AltaRock Energy Inc E Green Lake Drive N Seattle Washington Geothermal energy Creates geothermal energy reservoirs develops geothermal facilities http www altarockenergy com Pacific Northwest Area American Clean Coal Fuels American Clean Coal Fuels NW th ave Portland Oregon Biofuels Uses gasification to turn carbon based feedstocks into syngas for biofuels http www cleancoalfuels com Pacific Northwest Area Arzeda Corporation Arzeda Corporation th Ave NE Suite Seattle Washington Biofuels Makes enzymes for cellulosic biofuels http www arzeda com Pacific Northwest Area Bio Algene Bio Algene NE Northlake Way Seattle Washington Biofuels

196

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Center for Sustainable Center for Sustainable Energy Balboa Ave San Diego California Helps residents businesses and public agencies save energy reduce grid demand and generate their own power http energycenter org Southern CA Area Clean Tech Los Angeles Clean Tech Los Angeles Los Angeles California Collaboration between CRA LA Caltech DWP JPL Mayor s Office Port UCLA and USC to establish Los Angeles as the global leader in research commercialization and deployment of clean technologies http cleantechlosangeles org Southern CA Area Clean Tech San Diego Clean Tech San Diego Executive Drive San Diego California Non profit membership organization formed to accelerate San Diego as a world leader in the clean technology economy http www cleantechsandiego org Southern CA Area Community Environmental Council Community Environmental Council W Anapamu

197

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

ANV Partners ANV Partners Denver Colorado Hydro Hydrogen Services Gateway ANV Partners ANV Partners Denver Colorado Hydro Hydrogen Services Gateway Solar Wind energy AQWON Motors AQWON Motors Speinshart Germany Hydro Hydrogen AQWON Motors has developed the first hydrogen powered stroke engine scooter It has been approved by the German T V the official technical inspection agency ARRC H2 Alliance ARRC H2 Alliance Connecticut Hydro Hydrogen The objective of the ARRC H2 Alliance is to design and build the first viable prototype Hydrogen Fueling Station Information Center in key locations worldwide Acumentrics Corporation Acumentrics Corporation Southwest Park Westwood Massachusetts Hydrogen Development of fuel cells http www acumentrics com Greater Boston Area Ad Venta Ad Venta all e de Bourgogne Bourg de P age Hydrogen Hydrogen

198

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

McClellan Technology Incubator Clean Start McClellan Technology McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Corvalence Corvalence Jackson St San Francisco California Bay Area Energy BioSciences Institute Energy BioSciences Institute Berkeley California http www energybiosciencesinstitute org Bay Area Environmental Business Cluster Environmental Business Cluster North First Street Third Floor San Jose California http www environmentalcluster org Bay Area Global Climate and Energy Project Global Climate and Energy Project Via Ortega Suite Stanford California http gcep stanford edu Bay Area Google org Google org Amphitheatre Parkway Mountain View California http www google org Bay Area Lawrence Berkeley National Laboratory LBNL Lawrence Berkeley National

199

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products Technologies Technologies Hartwell Avenue North Lexington Massachusetts Gateway Solar Developer of technologies for enhancing PV efficiency including new cell wiring and wafer packaging systems http www tech com st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto California Gateway Solar http stlightenergy com Southern CA Area Century Solar Inc Century Solar Inc Garland Texas Gateway Solar Privately owned Garland based manufacturer of solar grade polysilicon

200

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Arch Venture Partners Owens Street San Francisco Arch Venture Partners Owens Street San Francisco California Venture capital firm investing in alternative energy production http www archventure com Bay Area Atrium Capital Atrium Capital Sand Hill Road Building Suite Menlo Park California Corporate strategic venture investing http www atriumcapital com Bay Area CMEA Capital CMEA Capital Embarcadero Center San Francisco California http www cmea com Bay Area CalCEF Clean Energy Angel Fund CalCEF Clean Energy Angel Fund Third Street Suite San Francisco California Seed Stage Venture Capital Firm http www calcefangelfund com Bay Area Clean Pacific Ventures Clean Pacific Ventures California Street Suite San Francisco California Venture capital firm investing in early stage clean technology companies http www cleanpacific com Bay Area

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

QuantumSphere Inc QuantumSphere Inc Santa Ana California Santa Ana QuantumSphere Inc QuantumSphere Inc Santa Ana California Santa Ana CA Manufacturer of metallic nanopowders for applications in aerospace defense energy biomedical and other markets demanding advanced material applications QuantumSphere Inc QuantumSphere Inc Tech Center Dr Santa Ana California Vehicles Advanced materials nanometal catalysts and components for batteries fuel cells emissions reduction and chemical synthesis applications http www qsinano com Southern CA Area Quanzhou Liupu Hydropower Co Ltd Quanzhou Liupu Hydropower Co Ltd Beijing Beijing Municipality China Hydro Beijing based small hydro project developer Queen s University of Belfast Queen s University of Belfast Belfast Northern Ireland United Kingdom BT7 NN Academic institute based in

202

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Brookhaven National Laboratory William Brookhaven National Laboratory William Floyd Parkway Upton New York http www bnl gov Northeast NY NJ CT PA Area Calverton Business Incubator Calverton Business Incubator Middle Country Rd Calverton New York http www sunysb edu research calverton Northeast NY NJ CT PA Area Consultative Group on International Agricultural Research Consultative Group on International Agricultural Research H Street NW Washington District of Columbia http www cgiar org Northeast NY NJ CT PA Area Knowledge Strategies Knowledge Strategies Atwell Ct Potomac Maryland Northeast NY NJ CT PA Area Passport to Knowledge Passport to Knowledge Morristown New Jersey http passporttoknowledge com Northeast NY NJ CT PA Area Rutgers EcoComplex Rutgers EcoComplex Florence Columbus Rd Bordentown

203

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institute Breakthrough Institute th Street Suite Oakland Institute Breakthrough Institute th Street Suite Oakland California http www thebreakthrough org Bay Area California Fuel Cell Partnership California Fuel Cell Partnership Industrial Blvd West Sacramento California Collaboration of organizations that work together to promote the commercialization of hydrogen fuel cell vehicles http www fuelcellpartnership net Bay Area ClimateWorks ClimateWorks Montgomery Street Suite San Francisco California http www climateworks org Bay Area Rahus Institute Rahus Institute Center Ave Martinez California Research and educational organization with a focus on resource efficiency http www californiasolarcenter org index html Bay Area San Francisco Biofuels Cooperative San Francisco Biofuels Cooperative Post St San Francisco California Mission is to facilitate access to

204

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products st century Green Solutions LLC st century Green Solutions LLC Grand Blanc Michigan Wind energy Exclusive rights to manufacture and distribute kW wind turbine technology in North America Degrees Degrees Embarcadero Center Suite San Francisco California Bioenergy Buildings Carbon Geothermal energy Services Gateway Solar Wind energy Environmental Commodities http www degreesinc com Bay Area E E Brussels Belgium Buildings Hydro Services Gateway Solar Wind energy

205

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

boro biofuel boro biofuel maiden lane New York New York Biofuels Multi boro biofuel boro biofuel maiden lane New York New York Biofuels Multi feed stock http borobiofuel com Northeast NY NJ CT PA Area A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder Colorado Biofuels Developing technology for producing valuable fuel and food from CO2 using algal photosynthesis and bio harvesting http www algaeatwork com Rockies Area AE Biofuels Inc formerly Marwich II Ltd AE Biofuels Inc formerly Marwich II Ltd West Palm Beach Florida Biofuels Marwich II Ltd OTC BB MWII OB merged in December with AE Biofuels Inc formerly American Ethanol Subsequently Marwich II Ltd has changed its name to AE Biofuels OTC AEBF AHL TECH AHL TECH PO Box Cincinnati Ohio Biofuels Manufacturing Research and development Other Efficient Utilization http www AHL TECH com

206

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was formed in to industrialize a novel heating element technology that requires significantly less energy to manufacture and offers significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Gateway Solar Wisconsin based based company that makes both water heating equipment and electric motors and also is in the water treatment business Its water heating focus includes a focus on high efficiency and solar suitable equipment A O Smith A O Smith Milwaukee Wisconsin Efficiency http www aosmith com A123 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area

207

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar PV Design and Installation http www a1suninc com Bay Area A10 Power A10 Power E Blithedale Ave Mill Valley California Gateway Solar Solar Financing and Integration http www a10power com Bay Area AEE Solar AEE Solar Redway Drive PO Box Redway California Gateway Solar http www aeesolar com Bay Area Acro Energy Acro Energy S Sierra Ave Oakdale California Gateway Solar solar energy systems http acroenergy com Bay Area Advance Power Inc Advance Power Inc N State St Calpella California Solar wind hydro http www advancepower net Bay Area Alten Alten J Old Middlefield Way Mountain View California Services Solar hot water and solar pool heating Bay Area Alten Solar Alten Solar Old Middlefield Way Suite J Mountain View California

208

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Laboratory Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org contact html Pacific Northwest Area Austin Clean Energy Incubator Austin Clean Energy Incubator West Braker Lane Austin Texas http www ati utexas edu clean energy clean energy html Texas Area Clean Edge Inc Clean Edge Inc Portland Oregon http www cleanedge com Pacific Northwest Area Clean Start McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Corvalence Corvalence Jackson St San Francisco California Bay Area E Co E Co Franklin Street Bloomfield New Jersey http www eandco net EcoElectron Ventures Inc EcoElectron Ventures Inc Second Street PMB Encinitas California http www ecoelectron com Southern CA Area

209

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Massachusetts Ballardvale Street Suite Massachusetts Ballardvale Street Suite A260 Wilmington Massachusetts Venture capital firm investing in early stage clean technology enterprises http www ventures com Greater Boston Area Advent International Advent International State Street Boston Massachusetts Global private equity firm http www adventinternational com Greater Boston Area Battery Ventures Battery Ventures Winter Street Suite Waltham Massachusetts Venture Capital http www battery com Greater Boston Area Black Coral Capital Black Coral Capital Union Street rd Floor Boston Massachusetts Cleantech private equity http www blackcoralcapital com Greater Boston Area Commons Capital Commons Capital Washington Street th floor Brookline Massachusetts Early stage venture capital fund http www commonscapital

210

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Century Silicon Inc Century Silicon Inc Firman Drive Suite Richardson Century Silicon Inc Century Silicon Inc Firman Drive Suite Richardson Texas Gateway Solar Solar Grade Silicon purity http www CenturySilicon com Texas Area Degrees Degrees Embarcadero Center Suite San Francisco California Bioenergy Buildings Carbon Geothermal energy Services Gateway Solar Wind energy Environmental Commodities http www degreesinc com Bay Area A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar PV Design and Installation http www a1suninc com Bay Area ALDACOR INC ALDACOR INC E th St Suite Idaho Falls Idaho Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com Acela Energy Group Inc Acela Energy Group Inc Main St Norfolk Massachusetts Efficiency Aims to reduce energy costs via rate negotiation conservation

211

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Fraunhofer Center Fraunhofer Center for Sustainable Energy Systems First St Suite Cambridge Massachusetts http cse fraunhofer org Greater Boston Area Gaia Worldwide Gaia Worldwide PO Box Cambridge Massachusetts Provider of Executive Search and headhunting services to solar and directly related industries http www gaiasearch com Greater Boston Area Greentech Media Greentech Media massachusetts avenue Cambridge Massachusetts http www greentechmedia com Greater Boston Area Harvard The Clean Energy Project Harvard The Clean Energy Project Massachusetts Avenue Cambridge Massachusetts http cleanenergy harvard edu Greater Boston Area MIT Center for st Century Energy MIT Center for st Century Energy Massachusetts Avenue Cambridge Massachusetts http web mit edu c21ce Greater Boston

212

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance for Sustainable Colorado Alliance for Sustainable Colorado Wynkoop Street Denver Colorado Mission of is to catalyze the shift to a truly sustainable world by fostering collaboration among nonprofits businesses governments and academia http www sustainablecolorado org Rockies Area American Solar Energy Society American Solar Energy Society Central Ave Boulder Colorado Nonprofit organization dedicated to increasing the use of solar energy energy efficiency and other sustainable technologies in the U S http www ases org Rockies Area Boulder Innovation Center Boulder Innovation Center th Street Boulder Colorado http www boulderinnovationcenter com Rockies Area Clean Economy Network Rockies Clean Economy Network Rockies Denver Colorado http rockies cleaneconomynetwork org Rockies Area

213

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Environmental Foundation Bonneville Environmental Foundation Environmental Foundation Bonneville Environmental Foundation SW st Avenue Portland Oregon https www b e f org Pacific Northwest Area Earth Share Oregon Earth Share Oregon SW Washington Street Portland Oregon Federation of leading local and national non profit conservation groups that provides a convenient way to support conservation and healthy communities http www earthshare oregon org Pacific Northwest Area Renewable Northwest Project Renewable Northwest Project SW Oak St Ste Portland Oregon Nonprofit Advocacy Organization http www RNP org Pacific Northwest Area Solar Oregon Solar Oregon SE Grand Ave Portland Oregon Non profit membership organization providing public education and community outreach to encourage Oregonians to choose solar energy http www solaroregon org Pacific

214

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

x America s Energy Future x America s Energy Future Maryland http www x America s Energy Future x America s Energy Future Maryland http www x25 org A View of the Rockies A View of the Rockies http www aviewoftherockies com ACORE ACORE PO Box Washington District of Columbia http www acore org AIT UNEP Regional Resource Centre for Asia and the Pacific AIT UNEP Regional Resource Centre for Asia and the Pacific rd Floor Outreach Building Moo Km http www rrcap unep org ASEAN Centre for Energy ASEAN Centre for Energy Jl HR Rasuna Said Blok X Kav Kuningan Jakarta Indonesia http www aseanenergy org African Development Bank African Development Bank Rue Joseph Anoma BP Abidjan Abidjan C te d Ivoire Ivory Coast http www afdb org en Alliance for Clean Energy New York Alliance for Clean Energy New York Washington Ave Albany New York Coalition dedicated to promoting clean

215

NAME ORGANIZATION ADDRESS CITY, ST ZIP Dear NAME:  

Broader source: Energy.gov (indexed) [DOE]

(commitments already made will likely utilize (commitments already made will likely utilize approximately two-thirds of the program's appropriated funds), deep pool of quality applicants, and statutorily imposed September 30, 2011 expiration date mean that not all projects under consideration will ultimately receive a loan guarantee. We are therefore focused on ensuring that we leverage the remaining funds as effectively as possible in the brief time that remains. Currently, there are a number of projects that are closer to the conditional commitment stage than yours, and we expect these projects, if they reach financial close, to utilize all of our remaining appropriation. Given this reality, we are unable to continue working on your application at this time. We wanted to let

216

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

3 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency 3 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area ATS Lighting Inc ATS Lighting Inc PO Box Concord Massachusetts Efficiency Effienct lighting and portable lighting systems http www atslighting com Greater Boston Area AXI LLC AXI LLC Quincy Massachusetts Biofuels Aims to make commercially feasible strains of algae for fuel production Greater Boston Area Acela Energy Group Inc Acela Energy Group Inc Main St Norfolk Massachusetts Efficiency Aims to reduce energy costs via rate negotiation conservation load management and competitive bidding http www acelaenergy com Greater Boston Area Aclara Software Aclara Software Laurel Avenue Wellesley Massachusetts Efficiency Software solutions for efficiency and demand management

217

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Cambridge Energy Alliance Cambridge St Cambridge Cambridge Energy Alliance Cambridge St Cambridge Massachusetts Helps Cambridge residential and business customers identify and arrange financing for all cost effective efficiency and renewable measures http www cambridgeenergyalliance org Greater Boston Area CleanTech Boston CleanTech Boston Boston Massachusetts Aggregating all of the Boston area networking events on one calendar http cleantechboston com Greater Boston Area Consortium for Energy Efficiency Consortium for Energy Efficiency North Washington St Boston Massachusetts Consortium of efficiency program administrators from across the U S and Canada who work together on common approaches to advancing efficiency http www cee1 org Greater Boston Area Mass Energy Consumers Alliance Mass Energy Consumers Alliance Centre

218

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Washington Second Washington Second Avenue Seattle Washington Venture capital firm investing in alternative energy production http www archventure com Pacific Northwest Area Cascadia Capital Cascadia Capital Fifth Avenue Seattle Washington Investment bank focusing on cleantech deals http www cascadiacapital com Pacific Northwest Area Eugene Water and Electric Board Eugene Water and Electric Board East th Avenue Eugene Oregon Electricity and Water http www eweb org Pacific Northwest Area McAdams Wright Ragen McAdams Wright Ragen th Ave Suite Seattle Washington Financial Services http www mwrinc com Pacific Northwest Area OVP Venture Partners OVP Venture Partners SW Macadam Ave Portland Oregon Cleantech venture fund http www ovp com Pacific Northwest Area OVP Venture Partners Washington OVP Venture Partners Washington Market

219

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

boro biofuel boro biofuel maiden lane New York New York Biofuels Multi boro biofuel boro biofuel maiden lane New York New York Biofuels Multi feed stock http borobiofuel com Northeast NY NJ CT PA Area AWS Truewind AWS Truewind New Karner Road Albany New York Wind energy Energy assessment resource mapping project engineering due diligence performance evaluation and forecasting http www awstruewind com Northeast NY NJ CT PA Area Advanced Solar Power Inc Advanced Solar Power Inc New York New York Gateway Solar Solar electric systems solar hot water http solarli com index html Northeast NY NJ CT PA Area Aircuity Inc Aircuity Inc W Evergreen Avenue Philadelphia Pennsylvania Efficiency Manufacturer of integrated sensing and control solutions http www aircuity com Marketing index asp Northeast NY NJ CT PA Area Allegheny Power Allegheny Power Cabin Hill Drive Greensburg Pennsylvania

220

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Texas Bridgepoint Texas Bridgepoint Parkway Austin Texas Venture capital firm investing in alternative energy production http www archventure com Texas Area Energy Capital Solutions Energy Capital Solutions North Harwood Street Suite Dallas Texas Investment banking firm focused on rainsing private capital and providing advisory services to public and private energy companies http www energycapitalsolutions com Texas Area Genesis Park Genesis Park San Felipe Houston Texas Private equity firm http www genesis park com Texas Area Haddington Ventures LLC Haddington Ventures LLC Augusta Suite Houston Texas Midstream energy private equity fund http www hvllc com Texas Area Sevin Rosen Funds Texas Austin Sevin Rosen Funds Texas Austin Bridgepoint Parkway Building Suite Austin Texas Venture capital fund http www srfunds

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

NAME ORGANIZATION ADDRESS CITY, ST ZIP Dear NAME:  

Broader source: Energy.gov (indexed) [DOE]

(commitments already made will likely utilize (commitments already made will likely utilize approximately two-thirds of the program's appropriated funds), deep pool of quality applicants, and statutorily imposed September 30, 2011 expiration date mean that not all projects under consideration will ultimately receive a loan guarantee. We are therefore focused on ensuring that we leverage the remaining funds as effectively as possible in the brief time that remains. We believe that it remains possible for your project to reach financial close by the September 30th deadline, assuming you can continue to meet important deadlines in the short timeframe that remains. While we remain committed to working closely with your team to move your project forward, we want to

222

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was formed in to industrialize a novel heating element technology that requires significantly less energy to manufacture and offers significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Gateway Solar Wisconsin based based company that makes both water heating equipment and electric motors and also is in the water treatment business Its water heating focus includes a focus on high efficiency and solar suitable equipment A O Smith A O Smith Milwaukee Wisconsin Efficiency http www aosmith com A123 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area

223

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

A P van den Berg A P van den Berg Heerenveen Netherlands P O Box AB A P van den Berg A P van den Berg Heerenveen Netherlands P O Box AB Geothermal energy Gateway Solar Designs and installs soil investigation systems geothermal systems producer of heat pumps heat pump boilers solar collectors and solar boilers ALDACOR ALDACOR E th St Suite Idaho Falls Idaho Buildings Efficiency Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com ALDACOR INC ALDACOR INC E th St Suite Idaho Falls Idaho Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com Advanced Solar LLC Advanced Solar LLC E Lincoln Street Westerville Ohio Geothermal energy Renewable Energy Gateway Solar Wind energy Agriculture Consulting Engineering architectural design Installation Maintenance

224

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Brad Thompson Company st Ct NE Kirkland Washington Brad Thompson Company st Ct NE Kirkland Washington Energy developer http www bradtco com Pacific Northwest Area Clean Tech Trade Alliance Clean Tech Trade Alliance Wheaton Way Bremerton Washington Internationally focused hybrid trade alliance that will create a successful Clean Technology business cluster http www cleantechtradealliance org Pacific Northwest Area Northwest Biodiesel Network Northwest Biodiesel Network Phinney Ave N Seattle Washington To promote the use and benefits of biodiesel through awareness campaigns educational programs and specific initiatives http www nwbiodiesel org Pacific Northwest Area Puget Sound Clean Air Agency Puget Sound Clean Air Agency Third Avenue Seattle Washington Special purpose regional agency chartered by state

225

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder Colorado Biofuels Developing technology for producing valuable fuel and food from CO2 using algal photosynthesis and bio harvesting http www algaeatwork com Rockies Area AC Solar Inc AC Solar Inc P O Box Florence Colorado Gateway Solar Solar and wind sales for residential http www acsolar com Rockies Area ALD Nanosolutions ALD Nanosolutions E Burbank Street Unit Broomfield Colorado http www aldnanosolutions com contact php Rockies Area Abengoa Solar Abengoa Solar W th Ave Lakewood Colorado Gateway Solar Solar developer http www abengoasolar com Rockies Area Abound Solar Abound Solar Rocky Mountain Avenue Suite Loveland Colorado Gateway Solar Thin film cadmium telluride solar modules http www abound

226

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institute for the Built Environment CSU Institute for the Built Institute for the Built Environment CSU Institute for the Built Environment Oval Drive Fort Collins Colorado http www ibe colostate edu Rockies Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org Rockies Area Colorado School of Mines Colorado Energy Research Institute Colorado School of Mines Colorado Energy Research Institute Illinois Street Golden Colorado http www ceri mines org Rockies Area Denver University International Institute for Environment and Enterprise Denver University International Institute for Environment and Enterprise S University Blvd Denver Colorado http www du edu enviro Research htm Rockies Area EverSealed Windows Inc EverSealed Windows Inc Interlocken Drive Evergreen

227

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance Apollo Alliance Townsend Street Suite San Francisco Alliance Apollo Alliance Townsend Street Suite San Francisco California Coalition of labor business environmental and community leaders working towards a clean energy revolution http apolloalliance org Bay Area Boots on the Roof Boots on the Roof Automall Parkway Fremont California http www bootsontheroof com Bay Area CalCEF Angel Network CalCEF Angel Network Third Street Suite San Francisco California http www calcefangelnetwork org Bay Area Cleantech Open Cleantech Open Broadway Street Redwood City California http www cleantechopen com Bay Area Go Solar California Go Solar California San Francisco California Joint effort of CA energy commission and CPUC http www gosolarcalifornia ca gov Bay Area Green Depot Green Depot P O Box Santa Monica California Non profit

228

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Partners Inc Advanced Materials Partners Inc Pine Partners Inc Advanced Materials Partners Inc Pine Street New Canaan Connecticut Venture investor http www amplink com Northeast NY NJ CT PA Area Akeida Capital Management Akeida Capital Management New York New York Financing Environmental Projects http www akeidacapital com Northeast NY NJ CT PA Area Ardour Capital Ardour Capital th ave New York New York http www ardourcapital com Northeast NY NJ CT PA Area Asia West LLC Asia West LLC One East Weaver Street Greenwich Connecticut Strategic investor in environmental technologies http www asiawestfunds com Northeast NY NJ CT PA Area BEV Capital BEV Capital Tresser Blvd th Floor Stamford Connecticut Venture capital firm http www bevcapital com Northeast NY NJ CT PA Area Battelle Ventures Battelle Ventures Carnegie Center Suite Princeton

229

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Washington Second Washington Second Avenue Suite Seattle Washington http www archventure com Pacific Northwest Area Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org contact html Pacific Northwest Area Big Sky Carbon Sequestration Partnership Big Sky Carbon Sequestration Partnership University Way rd Floor Bozeman Montana One of the US DOE s seven regional carbon sequestration partnerships http www bigskyco2 org Pacific Northwest Area Clean Edge Inc Clean Edge Inc Portland Oregon http www cleanedge com Pacific Northwest Area Northwest National Marine Renewable Energy Center Northwest National Marine Renewable Energy Center th Ave Seattle Washington http depts washington edu nnmrec Pacific Northwest Area

230

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Colorado Renewable Energy Society Colorado Renewable Energy Society PO Box Golden Colorado Works for the sensible adoption of cost effective energy efficiency and renewable energy technologies by Colorado businesses and consumers http www cres energy org Rockies Area Environmental Entrepreneurs E2 Environmental Entrepreneurs E2 Pearl Street Suite Boulder Colorado http www e2 org jsp controller docName roxchapterwebpage Rockies Area Hogan Hartson Hogan Hartson Walnut Street Boulder Colorado Climate Change Clean Energy http www hhlaw com Rockies Area Northern Colorado Clean Energy Cluster Northern Colorado Clean Energy Cluster Denver Colorado Business led project oriented group of regional partners seeking to have a global impact http www nccleanenergy com Rockies Area Sustainability Center of the Rockies Sustainability Center of the Rockies

231

Name Name Address Place Zip Category Sector Telephone number Website  

Open Energy Info (EERE)

Category Sector Telephone number Website Category Sector Telephone number Website Coordinates Testing Facilities Overseen References Alden Research Laboratory Inc Alden Research Laboratory Inc Shrewsbury Street Shrewsbury Street Holden Massachusetts Category Testing Facility Operators Hydro Hydro http www aldenlab com http www aldenlab com Alden Tow Tank Alden Wave Basin Alden Small Flume Alden Large Flume Bucknell University Bucknell University Civil Mechanical Engineering Departments Hydraulic Flume Moore Avenue Dana Engineering Building Lewisburg Pennsylvania Category Testing Facility Operators Hydro http www bucknell edu x16287 xml Bucknell Hydraulic Flume Colorado State University Hydrodynamics Colorado State University Hydrodynamics Daryl B Simons Building Engineering Research Center Campus Delivery

232

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Charge Inc Charge Inc Dallas Texas Developer of patented technology Charge Inc Charge Inc Dallas Texas Developer of patented technology for faster battery charging time which also extends battery lifetime Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products Technologies Technologies Hartwell Avenue North Lexington Massachusetts Gateway Solar Developer of technologies for enhancing PV efficiency including new cell wiring and wafer packaging systems http www tech com Soltech Inc Soltech Inc Richardson Texas Texas based PV module maker st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto

233

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto California Gateway Solar http stlightenergy com Southern CA Area th Day Energy th Day Energy River Belle Tollhouse California Gateway Solar Solar electric systems http www thdayenergy com Southern CA Area ABC Solar Inc ABC Solar Inc Hawthorne Blvd Torrance California Gateway Solar Solar power systems products http www abcsolar com Southern CA Area Achates Power Achates Power Sorrento Valley Boulevard San Diego California Vehicles Developing a fuel efficient cleaner burning diesel engine http www achatespower com Southern CA Area AdaptiveARC AdaptiveARC Sitio Manana Carlsbad California Biomass Waste to clean energy startup is developing an arc plasma reactor http www adaptivearc com Southern CA Area

234

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Incubator Austin Clean Energy Incubator West Braker Incubator Austin Clean Energy Incubator West Braker Lane Austin Texas http www ati utexas edu clean energy clean energy html Texas Area Bank of Italy Bank of Italy Via nazionale Rome Italy http www bancaditalia Brookhaven National Laboratory Brookhaven National Laboratory William Floyd Parkway Upton New York http www bnl gov Northeast NY NJ CT PA Area Centro de Energ as Renovables CER Centro de Energ as Renovables CER Agustinas piso Santiago Chile http www cer gov cl Clean Start McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org

235

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Clean Skies Foundation American Clean Skies Foundation st Clean Skies Foundation American Clean Skies Foundation st Street NE Suite Washington District of Columbia http www cleanskies org Northeast NY NJ CT PA Area Connecticut Clean Energy Fund Connecticut Clean Energy Fund Corporate Place Rocky Hill Connecticut Promotes develops and invests in clean energy sources for the benefit of Connecticut ratepayers http www ctcleanenergy com Northeast NY NJ CT PA Area Global Renewable Energy Network Global Renewable Energy Network P O Box Massapequa New York http www greenjuncture com Northeast NY NJ CT PA Area New Jersey s Clean Energy Program New Jersey s Clean Energy Program South Clinton Avenue Trenton New Jersey Promotes increased energy efficiency and the use of clean renewable sources of energy including solar wind

236

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AWEA American Wind Energy Association AWEA American Wind Energy Association AWEA M Street NW Suite Washington District of Columbia http www awea org Asociacion Argentina de Energia Eolica Asociacion Argentina de Energia Eolica Buenos Aires Argentina http www argentinaeolica org ar Clean Tech Trade Alliance Clean Tech Trade Alliance Wheaton Way Bremerton Washington Internationally focused hybrid trade alliance that will create a successful Clean Technology business cluster http www cleantechtradealliance org Pacific Northwest Area Clean Technology Sustainable Industries Organization Clean Technology Sustainable Industries Organization Coolidge Hwy Royal Oak Michigan http www ct si org Green Integrated Design Green Integrated Design Tempe Arizona http www GreenIntegratedDesign com Massachusetts Hydrogen Coalition Massachusetts Hydrogen Coalition Cummings

237

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting products for wind solar and hydro http www tier com Pacific Northwest Area boro biofuel boro biofuel maiden lane New York New York Biofuels Multi feed stock http borobiofuel com Northeast NY NJ CT PA Area A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar PV Design and Installation http www a1suninc com Bay Area A10 Power A10 Power E Blithedale Ave Mill Valley California Gateway Solar Solar Financing and Integration http www a10power com Bay Area A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder Colorado Biofuels Developing technology for producing valuable fuel and food from CO2 using algal photosynthesis and bio harvesting http www algaeatwork com Rockies Area

238

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Sumitomo and US based steel tank manufacturer T Bailey Kawar Energy Kawar Energy Amman Jordan Services Amman based project developer focused on bringing technologies solutions and...

239

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

in solar wind hydro bioethanol and biomass Al Husseini Amelio JV Al Husseini Amelio JV Jordan Solar JV company to develop a GW solar plant in Jordan and an integrated MW thin film...

240

Institution Name Institution Name Address Place Zip Notes Website...  

Open Energy Info (EERE)

IEn Institute of Power Engineering IEn Warsaw Poland http www ien com pl home Jordan National Energy Research Center Jordan National Energy Research Center P O Box Al...

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

technology partners for solar projects in India Kawar Energy Kawar Energy Amman Jordan Services Amman based project developer focused on bringing technologies solutions and...

242

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

gas http www afpc sy com new history htm Al Husseini Amelio JV Al Husseini Amelio JV Jordan Solar JV company to develop a GW solar plant in Jordan and an integrated MW thin film...

243

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

GmbH Braunschweig Germany Solar Manufactures and markets solar collectors hot water tanks and heating Solydair Energies Solydair Energies Miraval Les Thuiles Renewable Energy...

244

Name Address Place Zip Sector Product Stock Symbol Year founded...  

Open Energy Info (EERE)

Free Flow has raised some initial funding and is prototype testing in rivers and tanks http www free flow power com Functional Design Engineering Inc Marine and Hydrokinetic...

245

Exploring zipping and assembly as a protein folding principle  

E-Print Network [OSTI]

C. Are there pathways for protein folding? Journal de Chimieand the mechanism of protein folding. Ann Rev Biochem 1982;Baldwin RL. How does protein folding get started? TRENDS in

Voelz, Vince A; Dill, Ken A

2007-01-01T23:59:59.000Z

246

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

energy Wind energy Germany based power project developer particularly active in wind and biogas projects and now starting to do geothermal BE Geothermal GmbH BE Geothermal GmbH...

247

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

power http www relion inc com Pacific Northwest Area Roth Rau AG Roth Rau AG Zimmritz Germany Hydro Hydrogen Solar Roth Rau offers equipment for fully automated solar cell...

248

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Russia Cp Holdings Llc Cp Holdings Llc Stillwater Minnesota Carbon An external carbon advisor DHL Neutral Services DHL Neutral Services Bracknell United Kingdom RG12 AN Carbon...

249

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

developer expanding into biomass and wind and planning to raise a fund to invest in a pipeline of identified projects Howard Waste Recycling Ltd Howard Waste Recycling Ltd...

250

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Boston Area Green Fuel Technologies Corporation Green Fuel Technologies Corporation Smith Place Cambridge Massachusetts Biofuels Recycles CO2 from flue gases to produce...

251

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Energy Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany...

252

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

American Photovoltaics American Photovoltaics Houston Texas Gateway American Photovoltaics American Photovoltaics Houston Texas Gateway Solar Will manufacture thin film solar modules http apv us com Texas Area C Voltaics C Voltaics Cullen Blvd Science and Research Building Houston Texas Gateway Solar Novel manufacturing process for solar cells with initial focus on OPV http www c voltaics com Texas Area CMNA Power CMNA Power Technology Blvd Austin Texas Wind energy Developing non turbine wind power technology http www cmnapower com Texas Area CPower Texas CPower Texas Congress Avenue Suite Austin Texas Efficiency Provides various energy efficiency management services http www cpowered com Texas Area Celestial Power Celestial Power Hermitage Drive Austin Texas Gateway Solar Solar energy contractor http celestialpower biz Texas Area

253

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Ventures Massachusetts Ballardvale Street Suite Ventures Massachusetts Ballardvale Street Suite A260 Wilmington Massachusetts Venture capital firm investing in early stage clean technology enterprises http www ventures com Greater Boston Area Access Venture Partners Access Venture Partners Turnpike Drive Suite Westminster Colorado Venture Capital http www accessvp com Rockies Area Advanced Materials Partners Inc Advanced Materials Partners Inc Pine Street New Canaan Connecticut Venture investor http www amplink com Northeast NY NJ CT PA Area Advent International Advent International State Street Boston Massachusetts Global private equity firm http www adventinternational com Greater Boston Area African Development Bank African Development Bank Rue Joseph Anoma BP Abidjan Abidjan C te d Ivoire Ivory Coast http www afdb org en

254

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products Technologies Technologies Hartwell Avenue North Lexington Massachusetts Gateway Solar Developer of technologies for enhancing PV efficiency including new cell wiring and wafer packaging systems http www tech com st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto California Gateway Solar http stlightenergy com Southern CA Area Century Solar Inc Century Solar Inc Garland Texas Gateway Solar Privately owned Garland based manufacturer of solar grade polysilicon

255

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Angeleno Group Century Park East Suite Los Angeles California Angeleno Group Century Park East Suite Los Angeles California Private equity firm focused on high growth investments in energy and environmental technology companies http www angelenogroup com Southern CA Area Applied Ventures LLC Applied Ventures LLC Bowers Avenue Santa Clara California Venture capital http www appliedventures com Southern CA Area EcoElectron Ventures EcoElectron Ventures nd Street Encinitas California Seed stage capital investment fund http www ecoelectron com Southern CA Area GreenCore Capital GreenCore Capital Vista Sorrento Parkway San Diego California Invests in developing promising renewable energy companies http www greencorecapital com Southern CA Area Hydrogen Ventures Hydrogen Ventures N Studabaker Road Long Beach California

256

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Entrepreneurs Network Austin Solar Energy Entrepreneurs Entrepreneurs Network Austin Solar Energy Entrepreneurs Network Austin Texas Provide networking opportunities for professionals to generate and attract Solar Energy businesses to Central Texas http www austinseen googlepages com Texas Area Austin Technology Incubator Austin Technology Incubator West Braker Lane Austin Texas http www ati utexas edu Texas Area Biodiesel Coalition of Texas Biodiesel Coalition of Texas Congress Avenue Austin Texas Non profit corporation created by biodiesel pioneers and industry leaders to ensure that biodiesel receives favorable treatment by state regulatory agencies and the Texas Legislature http www biodieselcoalitionoftexas org Texas Area Texas Renewable Energy Industries Association Texas Renewable Energy Industries Association P O Box Austin Texas Represents over member

257

225 N. Washington Street Alexandria, VA 22314  

E-Print Network [OSTI]

, and adoptive families. ADOPTION TAX CREDIT AND OTHER FINANCIAL ASSISTANCE Issue Overview The adoption tax claim a maximum adoption tax credit of $12,650. Unlike tax years 2010 and 2011, the credit was no longer families cannot always receive the full benefit of the tax credit without refundability. Relevant

Oliver, Douglas L.

258

VA UESC with PG&E  

Broader source: Energy.gov (indexed) [DOE]

Federal Utility Partnership Working Group Spring 2013: May 22-23 San Francisco, CA Hosted by: Pacific Gas and Electric Company  Review Key Challenges  Strategies Utilized to Achieve Success  Lessons Learned  Project Profile  Project Challenges  UESC Energy Saving Results  Conclusion  Facilities Targeted: ◦ 3 VAMCs and 2 clinics within VISN 21 ◦ Over 2,000,000 square feet  Project Size: $9.9 Million  Project Timeline: ◦ Business development: May 2009 ◦ Awarded: October 2011 ◦ Construction completed: July 2013 Martinez Outpatient Clinic and Community Living Center Mather VAMC San Francisco VAMC Fresno VAMC McClellan Outpatient Clinic  FEMP UESC Workshop - April 2009  Review of Existing Audits 

259

Microsoft Word - MHI Comments to DOE-Regulatory Review 5-29-2012  

Broader source: Energy.gov (indexed) [DOE]

111 Wilson Blvd. Suite 100 Arlington, VA 22201 Tel: 703.558.0400 Fax: 703.558.0401 111 Wilson Blvd. Suite 100 Arlington, VA 22201 Tel: 703.558.0400 Fax: 703.558.0401 http://www.manufacturedhousing.org info@mfghome.org U.S. Department of Energy Office of Energy Efficiency and Renewable Energy, Building Technologies Program Mailstop EE-2J 1000 Independence Avenue, S.W. Washington, DC 20585-1585 May 29, 2012 Reference: Regulatory Burden RFI Dear Sir or Madam: On behalf of the Manufactured Housing Institute (MHI) I am pleased to respond to the Department of Energy's (DOE's) May 15, 2012 request for comments and information regarding regulations that should be modified, streamlined, expanded, or repealed as a part of its implementation of Executive Order

260

June 5 & 6, 2013 Meeting of the Electricity Advisory Committee | Department  

Broader source: Energy.gov (indexed) [DOE]

June 5 & 6, 2013 Meeting of the June 5 & 6, 2013 Meeting of the Electricity Advisory Committee June 5 & 6, 2013 Meeting of the Electricity Advisory Committee June 5 & 6, 2013 Meeting of the Electricity Advisory Committee Date: Wednesday, June 5, 2013 12:00 p.m. - 5:30 p.m. EDT Date: Thursday, June 6, 2013 8:00 a.m. - 4:00 p.m. EDT Location: National Rural Electric Cooperative Association (NRECA), 4301 Wilson Blvd, Arlington, VA 22203 Overview The Department of Energy's Electricity Advisory Committee held a meeting on Wednesday, June 5 and Thursday, June 6 at the National Rural Electric Cooperative Association, 4301 Wilson Blvd., Arlington, VA. Members of the public were invited on a first come, first served basis (depending on the availability of meeting room space) to listen to the Committee proceedings

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

Summary Report: Clean Cities Plug-In Electric Vehicle Community Readiness Partners Discussion Group  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

2101 Wilson Blvd., Suite 550 | Arlington, VA 22201 | 703-516-4146 | www.C2ES.org 2101 Wilson Blvd., Suite 550 | Arlington, VA 22201 | 703-516-4146 | www.C2ES.org MAY 7, 2012 4:30 PM - 6:00 PM LOS ANGELES, CA SUMMARY REPORT: CLEAN CITIES PLUG-IN ELECTRIC VEHICLE COMMUNITY READINESS PARTNERS DISCUSSION GROUP By: Nick Nigro, Center for Climate and Energy Solutions An opportunity to discuss challenges and share best practices regarding efforts to prepare your community/region for plug-in electric vehicles and charging infrastructure deployment Center for Climate and Energy Solutions 2 Table of Contents Table of Contents 2 About this Report 3 Disclaimer 3 Acknowledgements 3 Session Overview 4 Vehicle Demand and Availability 4 Law and Regulatory Environment 5 Public EVSE Signage 5 ADA Compliance 7 Multi-unit Dwellings 7

262

Hydrgoen Storage Systems Analysis Working Group Meeting Summary Report  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Systems Analysis Working Group Meeting Systems Analysis Working Group Meeting 2007 Hydrogen Program Annual Review Crystal Gateway Marriott, Arlington, VA May 17, 2007 SUMMARY REPORT Compiled by Romesh Kumar Argonne National Laboratory and Elvin Yuzugullu Sentech, Inc. June 28, 2007 SUMMARY REPORT Hydrogen Storage Systems Analysis Working Group Meeting May 17, 2007 Crystal Gateway Marriott, Arlington, VA Meeting Objectives This meeting was one of a continuing series of biannual meetings of this Working Group. The objective of these meetings is to bring together the DOE research community involved in systems analysis of hydrogen storage materials and processes for information exchange and to update the researchers on related developments within the DOE program. A major thrust of these meetings is to leverage expertise, complement related work of different individuals and

263

Report of the DOE Workshop on Hydrogen Separations and Purification  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Energy Energy Bringing you a prosperous future where energy is clean, abundant, reliable and affordable Report of the DOE Workshop on Hydrogen Separations and Purification September 8-9, 2004 Arlington, VA U.S. Department of Energy Office of Hydrogen, Fuel Cells & Infrastructure Technologies CONTENTS INTRODUCTION ...............................................................................................1 Background ................................................................................................................. 1 Current Hydrogen Separation Technology .................................................................. 2 Hydrogen Membrane Separation Technologies .......................................................... 3 HYDROGEN MEMBRANE SEPARATION PERFORMANCE TARGETS.........................6

264

4th U.S.-China Energy Efficiency Forum Documents  

Office of Energy Efficiency and Renewable Energy (EERE)

The U.S. Department of Energy and China's National Development and Reform Commission held the annual U.S.-China Energy Efficiency Forum (EEF) this past September in Arlington, VA. The day-long event featured keynotes from DOE Office of Energy Efficiency and Renewable Energy Assistant Secretary Dr. David Danielson, U.S. Special Envoy for Climate Change Todd Stern, and NDRC Vice Chairman Xie Zhenhua.

265

2014 Wind Program Peer Review Report  

Broader source: Energy.gov [DOE]

The Wind Program Peer Review Meeting was held March 24-28, 2014 in Arlington, VA. Principle investigators from the Energy Department, National Laboratories, academic, and industry representatives presented the progress of their DOE-funded research. This report documents the formal, rigorous evaluation process and findings of nine independent reviewers who examined the technical, scientific, and business results of Wind Program funded projects, as well as the productivity and management effectiveness of the Wind Program itself.

266

DOE-NSF-NIH Workshop on Opportunities in THz Science, February 12-14, 2004  

SciTech Connect (OSTI)

This is the report of the Workshop on Opportunities in THz Science, held on February 12-14, 2004 in Arlington, VA. This workshop brought together researchers who use or produce THz radiation for physics, chemistry, biology, medicine, and materials science to discuss new research opportunities and common resource needs. The charge from the sponsors of the workshop was to focus on basic science questions within these disciplines that have and can be answered using THz radiation.

Sherwin, M.A.; Bucksbaum, P.H.; Schmuttenmaer, C. A.; Allen, J.; Biedron, S.; Carr, L.; Chamberlain, M.; Crowe, T.; DeLucia, F.; Hu, Q.; Jones, B.; Noordham, B.; Norris, T.; Orenstein, J.; Unterrainer, K.; Van der Meer, L.; Wilke, I.; Williams, G.; Zhang, X.-C.; Cheville, A.; Markelz, A.; Parks, B.; Plancken, P.; Shan, J.; Austin, B.; Basov, D.; Citrin, D.; Grundfest, W.; Heinz, T.; Kono, J.; Mittleman, D.; Siegel, P.; Taylor, T.; Jones, B.; Markelz, A.; Martin, M.; Nelson, K.; Smith, T.; Williams, G.; Allen, M.; Averitt, R.; Brunel, L.; Heilweil, T.; Heyman, J.; Jepsen, P.; Kaind, R.; Leemans, W.; Mihaly, L.; Rangan, C.; Tom, H.; Wallace, V.; Zimdars, D.

2004-02-14T23:59:59.000Z

267

Clark Energy Group LLC | Open Energy Information  

Open Energy Info (EERE)

Clark Energy Group LLC Clark Energy Group LLC Jump to: navigation, search Name Clark Energy Group LLC Place Arlington, Virginia Zip 22203 Sector Efficiency, Renewable Energy Product Virginia-based energy efficiency and renewable energy project developer. References Clark Energy Group LLC[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Clark Energy Group LLC is a company located in Arlington, Virginia . References ↑ "Clark Energy Group LLC" Retrieved from "http://en.openei.org/w/index.php?title=Clark_Energy_Group_LLC&oldid=343635" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link

268

GreenShift Industrial Design Corporation GIDC | Open Energy Information  

Open Energy Info (EERE)

Industrial Design Corporation GIDC Industrial Design Corporation GIDC Jump to: navigation, search Name GreenShift Industrial Design Corporation (GIDC) Place Mount Arlington, New Jersey Zip NJ 07856 Product Focused on the engineering and marketing of green innovations and processes that enhance manufacturing efficiencies, improve resource utilization and minimize waste. References GreenShift Industrial Design Corporation (GIDC)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. GreenShift Industrial Design Corporation (GIDC) is a company located in Mount Arlington, New Jersey . References ↑ "GreenShift Industrial Design Corporation (GIDC)" Retrieved from "http://en.openei.org/w/index.php?title=GreenShift_Industrial_Design_Corporation_GIDC&oldid=346110"

269

COMMONWEALTH OF VIRGINIA -UNIVERSITY OF VIRGINIA AUTOMOBILE LOSS NOTICE  

E-Print Network [OSTI]

, STOP LIGHTS, STOP SIGNS AND OTHER OBJECTS. SHOW STREET NAMES #1 MY AUTO #2 OTHER AUTO THIRD AUTO PHONE NUMBER 434-924-3055 ADDRESS: STREET CITY STATE ZIP CODE PO BOX 400205 Charlottesville VA 22904-4205 FAX NUMBER 434-982-2635 TIME AND PLACE OF INCIDENT DATE OF INCIDENT HOUR AM PM LOCATION STREET

Acton, Scott

270

Grayson County 4-H Camp Teen Leader Application  

E-Print Network [OSTI]

: ( ) Cell Phone: ( ) City State Zip Code Current E-mail Address: Male Female Age Birthdate Gender School Independence, VA 24348 276-773-2491(ph) 276-773-2729(fax) collindp@vt.edu Application Due on Friday, February, teen counselors often make the difference in the lives of younger campers with their energy, enthusiasm

Liskiewicz, Maciej

271

OSTI, US Dept of Energy, Office of Scientific and Technical Information |  

Office of Scientific and Technical Information (OSTI)

Speeding Nano Progress by Accelerating the Spread of Knowledge Speeding Nano Progress by Accelerating the Spread of Knowledge Slide01 Workshop on Nanoinformatics Strategies [exit federal site] Hosted by the National Nanomanufacturing Network Westin Arlington Gateway Hotel Arlington, VA June 12-13, 2007 Speeding Nano Progress by Accelerating the Spread of Knowledge Slide02 Slide 2: Three Topics Relating to Nano Info Diffusion We see three complementary approaches to improve information sharing and awareness - Modeling - it's possible - Metadata - numeric data, unlike textual data, requires metadata to ensure access - Stewardship - numeric data could follow model of textual STI management Speeding Nano Progress by Accelerating the Spread of Knowledge Slide03 Slide 3: OSTI's Mission To advance science and sustain technological creativity by making R&D

272

OSTI, US Dept of Energy, Office of Scientific and Technical Information |  

Office of Scientific and Technical Information (OSTI)

by Accelerating the Spread of Knowledge by Accelerating the Spread of Knowledge Slide01 Slide01 Workshop on Nanoinformatics Strategies [exit federal site] Hosted by the National Nanomanufacturing Network Westin Arlington Gateway Hotel Arlington, VA June 12-13, 2007 Slide02 Slide02 Slide 2: Three Topics Relating to Nano Info Diffusion We see three complementary approaches to improve information sharing and awareness - Modeling - it's possible - Metadata - numeric data, unlike textual data, requires metadata to ensure access - Stewardship - numeric data could follow model of textual STI management Slide03 Slide03 Slide 3: OSTI's Mission To advance science and sustain technological creativity by making R&D findings available and useful to DOE researchers and the American people. OSTI's creed: Knowledge is contagious - it's our job to make sure

273

Document  

Broader source: Energy.gov (indexed) [DOE]

31303 Federal Register 31303 Federal Register / Vol. 72, No. 108 / Wednesday, June 6, 2007 / Notices ADDRESSES: Sheraton Crystal City Hotel Arlington, 1800 Jefferson Davis Highway, Arlington, VA 22202. FOR FURTHER INFORMATION CONTACT: Elena Melchert or Bill Hochheiser, U.S. Department of Energy, Office of Oil and Natural Gas, Washington, DC 20585. Phone: 202-586-5600. SUPPLEMENTARY INFORMATION: Purpose of the Committee: The purpose of the Unconventional Resources Technology Advisory Committee is to provide advice on development and implementation of programs related to onshore unconventional natural gas and other petroleum resources to the Secretary of Energy; and provide comments and recommendations and priorities for the Department of Energy Annual Plan per requirements of the Energy Policy Act of

274

Research Magazine 2007 The University of Texas at Arlington Sensing a solution  

E-Print Network [OSTI]

years ago that he listened attentively to a talk by Shou-Jiang Tang, a clinician and assistant professor in place for 48 hours," Chiao said. Many patients are so conscious of the device that they stop regular cancer screening." Listening to the lecture, Chiao had a "eureka!" moment about the acid reflux

Chiao, Jung-Chih

275

PARKING INSTRUCTIONS FOR ACES 2014 ATTENDEES Crystal Gateway Marriott Hotel Arlington, Virginia  

E-Print Network [OSTI]

of the Capitol Tower) to check-in to your guestroom. From the hotel's front desk, the ACES meeting rooms

Florida, University of

276

E-Print Network 3.0 - arlington virginia 16-18 Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Forest Resources 9-Southern Piedmont 10... -Tidewater 11-Hampton Roads 12-Virginia Seafood 4-H Educational ... Source: Virginia Tech, Virginia Bioinformatics Institute,...

277

3D compression: from A to Zip: a first complete example THOMAS LEWINER  

E-Print Network [OSTI]

the design of compression schemes adapted to specific class of models. The recent launch of Google Sketch'up

Lewiner, Thomas (Thomas Lewiner)

278

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United...

279

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

Last Name URL Products/Services NAICS Code NAICS Description &yet 2008 140 Gage Blvd Suite 100 Richland and user experience professionals. Build products, consult, and educate internationally and locally. 5415 Engineering, construction--air conditioning 5413 Architectural, engineering, and related services Advanced

280

A circular electrostatic zipping actuator for the application of a MEMS tunable capacitor  

E-Print Network [OSTI]

Micromechanical circuits such as MEMS switches, tunable capacitors (varactors) or resonators in general have lower loss and consume less power than their CMOS counterparts and have seen an increase of applications in ...

Yang, Xue'en, 1975-

2005-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Design of protein-interaction specificity gives selective bZIP-binding peptides  

Science Journals Connector (OSTI)

... hydrazide. Proteins were printed on aldehyde-presenting glass slides (Thermo Fisher Scientific) using a Microgrid TAS Arrayer. Twelve identical subarrays were printed on each slide. Each protein was spotted ...

Gevorg Grigoryan; Aaron W. Reinke; Amy E. Keating

2009-04-16T23:59:59.000Z

282

Name (last, first, middle initial) Date of birth City, State, ZIP/Postal code  

E-Print Network [OSTI]

, as well as the social and professional consequences for those who cannot afford or choose not to use them that Art is not truth. Art is a lie that makes us realize truth, at least the truth that is given us to understand." Do you believe art is a lie? What kinds of truth may art (or if you prefer, fiction, music

283

Applicant Organization:  

Broader source: Energy.gov (indexed) [DOE]

Iogen Biorefinery Partners, LLC Iogen Biorefinery Partners, LLC Corporate HQ: Arlington, VA Proposed Facility Location: Shelley, Idaho Description: This project from a leading enzyme player will demonstrate a scaled up biochemical process with the flexibility to process a wide range of agricultural residues into cellulose ethanol. CEO or Equivalent: Brian Foody Participants: Iogen Corporation, Goldman Sachs; Royal Dutch Shell Oil Company; Others Production: * 18 million gallons/year in the first plant, 250 million gallons/year in future plants * Cellulose ethanol & co-products in first plant; future plants to be primarily cellulose ethanol Technology & Feedstocks: * Agricultural residues: wheat straw, barley straw, corn stover, switchgrass and rice

284

Energy Policy Act of 2002  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

and Beneficial Use of Coal and Beneficial Use of Coal Utilization Byproducts (CUBs) AWMA 2006 Waste Management Meeting Arlington, VA January 18, 2006 William W. Aljoe, Project Manager U.S. Department of Energy, National Energy Technology Laboratory AWMA Waste Management National Meeting, January 18, 2006 CCPs (Industry) = CUBs (DOE) * Coal Utilization Byproducts - Includes Fly ash, Bottom ash, FGD solids - Many other acronyms: CCBs, CCW, FFCW, CCR ... * Utilization includes: - Combustion - Gasification & Hybrid systems * Byproducts because: - $ from electricity sales >> $ from CUB sales - Become "Products" when sold or beneficially used - Become "Wastes" when sent to a permanent disposal site * Can still become "products" after disposal AWMA Waste Management National Meeting, January 18, 2006

285

DOE Hydrogen Analysis Repository: PEMFC Manufacturing Cost  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

PEMFC Manufacturing Cost PEMFC Manufacturing Cost Project Summary Full Title: Manufacturing Cost of Stationary Polymer Electrolyte Membrane (PEM) Fuel Cell Systems Project ID: 85 Principal Investigator: Brian James Keywords: Costs; fuel cells; stationary Performer Principal Investigator: Brian James Organization: Directed Technologies, Inc. (DTI) Address: 3601 Wilson Blvd., Suite 650 Arlington, VA 22201 Telephone: 703-243-3383 Email: brian_james@directedtechnologies.com Period of Performance End: November 1999 Project Description Type of Project: Analysis Category: Cross-Cutting Objectives: Estimate the cost of the fuel cell system using the Directed Technologies, Inc. cost database built up over the several years under U.S. Department of Energy and Ford Motor Company contracts.

286

1  

Broader source: Energy.gov (indexed) [DOE]

N N Framework for the Avian and Bat Monitoring Plan U.S. Department of the Interior Minerals Management Service MMS Cape Wind Energy Project January 2009 Final EIS Appendix N Framework for the Avian and Bat Monitoring Plan Framework for the Avian and Bat Monitoring Plan for the Cape Wind Proposed Offshore Wind Facility PREPARED BY: U.S. DEPARTMENT OF THE INTERIOR MINERALS MANAGEMENT SERVICE 381 ELDEN STREET HERNDON, VA 20170 AND CAPE WIND ASSOCIATES 75 ARLINGTON STREET SUITE 704 BOSTON, MA 02116 SEPTEMBER 19, 2008 TABLE OF CONTENTS 1.0 INTRODUCTION ................................................................................................................................. 1 2.0 SUMMARY OF AVAILABLE INFORMATON ON MONITORING TECHNIQUES AND THEIR

287

U.S. Department of Energy Electricity Advisory Committee Meeting  

Broader source: Energy.gov (indexed) [DOE]

Meeting Meeting NRECA Conference Center Arlington, VA June 5, 2013 Summary of Meeting 2 PARTICIPANTS EAC: BILLY BALL Southern Company LINDA BLAIR Executive Vice President, ITC Holdings MERWIN BROWN California Institute for Energy & Environment PAUL CENTOLELLA Vice President, Analysis Group BOB CURRY Commissioner Emeritus, NY; Charles River Associates CLARK GELLINGS Electric Power Research Institute DIAN GREUNICH Dian Greunich Consulting PAUL HUDSON Stratus Energy Group, Austin SUE KELLY American Public Power Association RALPH MASIELLO DNV KEMA RICH MEYER (for BARRY LAWSON) National Rural Electric Cooperative Association CLAIR MOELLER Midcontinent Independent System Operator GRANGER MORGAN Carnegie Mellon, Engineering & Public Policy

288

Hybrid Bayesian Networks with Linear Deterministic Variables  

E-Print Network [OSTI]

Conference (UAI-05), 2005, AUAI Press, Arlington, VA. 136 Y X Z Figure 2: A Bayesian Network Representation of the Mixed Distribution for X. this example, Y is a discrete variable with state space ? Y = {1,2,3}, Z is a real-valued variable, and X is a... conditionally deterministic variable whose condi- tional distribution is described as follows: X |{y,z} = y if y =1,2 and X |{y,z} = z if y =3. Potentials of the type described above are used in this paper to represent distributions of variables in hy- brid...

Cobb, Barry R.; Shenoy, Prakash P.

2005-07-01T23:59:59.000Z

289

Fiber Reinforced Polymer Composite Manufacturing Workshop  

Office of Energy Efficiency and Renewable Energy (EERE)

A workshop on Fiber Reinforced Polymer (FRP) Composite Manufacturing (held January 13, 2014, in Arlington, VA) brought together stakeholders from industry and academia to discuss manufacturing of composites. The workshop explored emerging FRP composite market applications in clean energy and barriers to the development and widespread commercial use of these lightweight, high-strength and high-stiffness materials. Improving the manufacturing speed and quality-and reducing their manufacturing costs-could accelerate their use in automotive, wind, compressed gas storage and other clean energy and industrial applications.

290

One and Two Potomac Yard  

High Performance Buildings Database

Arlington, VA One and Two Potomac Yard represent one of the first green speculative office projects in the Washington, D.C., area. Located in Crystal City, Virginia-at the gateway to the nation's capital-the two twelve-story buildings contain office and retail spaces as well as a fitness center for use by building occupants. Early on and throughout the delivery process, the developers, Crescent Resources, LLC, involved the lessee, GSA, and the primary tenant, EPA, in the review of the project.

291

Meeting Materials: April 21, 2008 | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

21, 2008 21, 2008 Meeting Materials: April 21, 2008 Crystal City Marriott at Reagan National Airport, 1999 Jefferson Davis Highway Arlington, VA 22202 Meeting Agenda Meeting Minutes Presentation: The Global Nuclear Energy Partnership Program by Paul Lisowski Presentation: The Global Nuclear Energy Partnership Status of Industry Engagement by Dan Stout Presentation: Assessment of Plutonium-238 Production Alternatives by Dennis Miotla Presentation: Nuclear Energy R&D Facility Requirements by Paul Kearns & Harold McFarlane Presentation: Global Nuclear Energy Partnership Research and Development Program by Phillip Finck Presentation: NGNP Briefing for NEAC by Thomas J. O'Connor Presentation: The Global Nuclear Energy Partnership From Vision to Reality by Edward McGinnis

292

ENERGY STAR Success Story VA Beach Convention Center  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

STAR Success Story: STAR Success Story: The Virginia Beach Convention Center Located in Virginia's most populous city, the Virginia Beach Convention Center (VBCC) comprises more than 516,000 square feet and typically hosts 400 events a year. Fully opened in 2007, the VBCC has served as the anchor for the successful revitalization of Virginia Beach's old beach district. With historical references and maritime themes integrated into the structure's modern design, the Center features many technological advances that make it a prime location for meetings, conferences, and trade shows. However, even with a newly constructed building, the VBCC has demonstrated an important energy management principle: all buildings, regardless of their age and building systems they employ, can reduce energy consumption, save money, and offset greenhouse gas

293

Physical Properties of Intermetallic FE2VA1  

SciTech Connect (OSTI)

Fe{sub 2}VAl has recently been discovered to have a negative temperature coefficient of resistivity, moderately enhanced specific heat coefficient, and a large DOS at the Fermi level by photoemission. This triggered a round of heated research to understand the ground state of this material, both theoretically and experimentally. here they report a comprehensive characterization of Fe{sub 2}VAl. X-ray diffraction exhibited appreciable antisite disorder in all of our samples. FTIR spectroscopy measurements showed that the carrier density and scattering time had little sample-to-sample variation or temperature dependence for near-stoichiometric samples. FTIR and DC resistivity suggest that the transport properties of Fe{sub 2}VAl are influenced by both localized and delocalized carriers, with the former primarily responsible for the negative temperature coefficient of resistivity. Magnetization measurements reveal that near-stoichiometric samples have superparamagnetic clusters with at least two sizes of moments. X-ray photoemission from Fe core level showed localized magnetic moments on site-exchanged Fe. They conclude that in Fe{sub 2}VAl, antisite disorder causes significant modification to the semi-metallic band structure proposed by LDA calculations. With antisite disorder considered, they are now able to explain most of the physical properties of Fe{sub 2}VAl.

Ye Feng

2002-05-30T23:59:59.000Z

294

OfficeofAlumniRelations Charlottesville,VA22906-7726  

E-Print Network [OSTI]

types is critical fuel for Darden's success.Tracking data around alumni engagement activities provides at the following link: www.darden.virginia.edu/leadershipRT. Alternately, you can call +1-434-243-8977. Hotel Information We invite you to stay at the Inn at Darden (formerly Sponsors Executive Residence Center). To make

Acton, Scott

295

Contract Connections @ ChallengeHER Norfolk, VA, October 14, 2014  

Broader source: Energy.gov [DOE]

The U.S. Small Business Administration (SBA), Women Impacting Public Policy (WIPP), and American Express OPEN have partnered to host this special FREE contracting event for women business owners....

296

Experimental evaluation of a 35 kVA downdraft gasifier  

Science Journals Connector (OSTI)

Energy conversion systems based on biomass are particularly interesting because biomass utilization effectively closes the carbon cycle besides achieving self-sustainability. Biomass is particularly useful for hi...

Ashok Jayawant Rao Keche; Gaddale Amba Prasad Rao

2013-09-01T23:59:59.000Z

297

Mitochondrial DNA phylogenetic analysis of Myrmecolacidae (Insecta: Strepsiptera) va  

E-Print Network [OSTI]

Guinea are determined. Methods were developed for extraction, amplification, and sequencing of mitochondrial DNA (mtDNA) from Strepsiptera. High-resolution mtDNA sequences obtained by these methods were used in the phylogenetic analysis of Myrmecolacidae...

Halbert, Natalie Rose

2013-02-22T23:59:59.000Z

298

VA-s--- ' At&LYTlCAL DATA SHEET  

Office of Legacy Management (LM)

the fire. b&,, Ro All wore Comfo type respirators and extinguished the fire from oil PH an upwind position. Sample No. Hour Sample Description Be Th (R ( T 1 Q 331 1400 I...

299

U.S. DEPARTIlIENT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION  

Broader source: Energy.gov (indexed) [DOE]

ENERGY ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION RECIPIENT:Arlington County, VA PROJECf TITLE : EECBG * Electric Vehicle Pilot in County Fleet Page 1 of2 STATE: VA Funding Opportunity Announcement Number DE-FOA-OOOOO13 Procurement Instrument Number OE-EEOOOOB851000 NEPA Control Number em Number GFO-OOOOsas-Q02 0 Based on my review of the information conce ... ning the proposed action, as NEPA Compliance Officer (authori7.ed under DOE Order 451.1A), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical

300

Point Of Contact Contractor Name and Address Code  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

15/2011 15/2011 Run Date: DE-SOL-0002014 Vendor List for Solicitation: Page 1 of 6 018572938 NETGAIN CORPORATION ERIN JONES Phone: 8656905811 Fax: 8656905814 ejones@netgain-corp.com 2095 LAKESIDE CENTRE WAY, SUITE 115 KNOXVILLE TN 379226592 040773264 PROTECTION STRATEGIES INCORPORATED KEITH P. HEDMAN Phone: 7035530561 Fax: 7035530562 khedman@protectionsi.com 2300 9TH STREET SOUTH SUITE 400 ARLINGTON VA 222042387 045509338 SECURIGUARD, INC. CHARLIE BORING Phone: 7038216777 Fax: 7037901696 charlie.boring@securiguardinc.com 6858 OLD DOMINION DR # 307 MC LEAN VA 221011383 073891921 WACKENHUT SERVICES, INCORPORATED MICHAEL GOLDEN Phone: 5614723645 Fax: 5614723679 mgolden@wsihq.com 7121 FAIRWAY DRIVE, SUITE 301 PALM BEACH GARDENS FL 334183766 085925480 BRANDAN ENTERPRISES INC GEORGES H. BRANDAN

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

newsletter5.cdr  

Broader source: Energy.gov (indexed) [DOE]

Howard Howard University School of Law (2900 Van Ness Street, NW, Washington, D.C. 20008) on May 27, 2009 Crystal City Doubletree Hotel (300 Army-Navy Drive, Arlington, VA 22202) on May 28 and 29, 2009 The State of Environmental Justice in America 2009 Conference The State of Environmental Justice in America 2009 Conference May 27-29, 2009 Issue 5 May 2009 Issue 5 May 2009 Directions from Howard University School of Law to Doubletree Hotel Crystal City Start out going west on Van Ness Street NW toward Connecticut Ave. Turn left onto Connecticut Avenue NW, which becomes 17th Street NW Turn left onto H Street NW Turn right on to 14th Street NW 14th Street St NW becomes US 1 South (crossing into Virginia) US-1 S becomes I-395 South Take the VA-27/Washington Blvd. exit, Exit 8A, toward Carpool Staging Area/Pentagon South Parking/South Arlington Ridge Road. Turn slight left to take the Carpool Staging

302

4th U.S.-China Energy Efficiency Forum | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

4th U.S.-China Energy Efficiency Forum 4th U.S.-China Energy Efficiency Forum 4th U.S.-China Energy Efficiency Forum 4th U.S.-China Energy Efficiency Forum 4th U.S.-China Energy Efficiency Forum 4th U.S.-China Energy Efficiency Forum 4th U.S.-China Energy Efficiency Forum 4th U.S.-China Energy Efficiency Forum 4th U.S.-China Energy Efficiency Forum 4th U.S.-China Energy Efficiency Forum 4th U.S.-China Energy Efficiency Forum September 25, 2013 Arlington, VA The U.S. Department of Energy and China's National Development and Reform Commission held the annual U.S.-China Energy Efficiency Forum (EEF) this past September in Arlington, VA. The day-long event featured keynotes from DOE Office of Energy Efficiency and Renewable Energy Assistant Secretary Dr. David Danielson, U.S. Special Envoy for Climate Change Todd Stern, and

303

Cost-Effective Energy Efficiency Measures for Above Code (2003 and 2009 IECC) Residential Buildings in the City of Arlington  

E-Print Network [OSTI]

) None Mechanical Systems Gas & Electric Type: Electric cooling (air conditioner) and natural gas heating (gas fired furnace) All Electric Type: Electric cooling and heating (air conditioner with heat pump) All Electric Type: 50-gallon tank type... Domestic Hot Water System (32 sq. ft. collector, 65 gal tank) ESL-TR-11-08-03 ENERGY SYSTEMS LABORATORY Proposed Energy Efficiency Measures (EEMs) 2003 IECC Code-Compliant House with Natural Gas Heating 6 Description of Individual Measures Site Source A...

2011-01-01T23:59:59.000Z

304

AES Corporation | Open Energy Information  

Open Energy Info (EERE)

AES Corporation AES Corporation Jump to: navigation, search Name AES Corporation Place Arlington, Virginia Zip 22203 Sector Biomass, Carbon, Solar, Wind energy Product Virginia-based company that generates and distributes electrical power. The company has investments in various wind, biomass, carbon offset, solar and power storage projects. Coordinates 43.337585°, -89.379449° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.337585,"lon":-89.379449,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

305

Interior Board of Land Appeals | Open Energy Information  

Open Energy Info (EERE)

Interior Board of Land Appeals Interior Board of Land Appeals Jump to: navigation, search Name Interior Board of Land Appeals Address 801 N. Quincy Street, Suite 300 Place Arlington, Virginia Zip 22203 Phone number 703-235-9902 Website http://www.oha.doi.gov/about_i Coordinates 38.880369°, -77.107316° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":38.880369,"lon":-77.107316,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

306

Greenhouse Gas Services AES GE EFS | Open Energy Information  

Open Energy Info (EERE)

Greenhouse Gas Services AES GE EFS Greenhouse Gas Services AES GE EFS Jump to: navigation, search Name Greenhouse Gas Services (AES/GE EFS) Place Arlington, Virginia Zip 22203-4168 Product Develop and invest in a range of projects that reduce greenhouse gas emissions that produce verified GHG credits. Coordinates 43.337585°, -89.379449° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.337585,"lon":-89.379449,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

307

Gridpoint | Open Energy Information  

Open Energy Info (EERE)

Gridpoint Gridpoint Jump to: navigation, search Logo: Gridpoint, Inc Name Gridpoint, Inc Address 2801 Clarendon BLVD Place Arlington, Virginia Zip 22201 Product SmartGrid Software Platform Year founded 2003 Number of employees 51-200 Phone number 7036677000 Website http://www.GridPoint.com/ Coordinates 38.88859°, -77.091952° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":38.88859,"lon":-77.091952,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

308

Page not found | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

51 - 10860 of 28,905 results. 51 - 10860 of 28,905 results. Rebate Orlando Utilities Commission- Commercial Energy Efficiency Rebate Program (Florida) Orlando Utilities Commission (OUC) offers rebates on a variety of energy efficient improvements for commercial customers. Customers should view the program brochure on the web site listed above for... http://energy.gov/savings/orlando-utilities-commission-commercial-energy-efficiency-rebate-program-florida Download Meeting Materials: April 15- 16, 2002 April 15-16, 2002Nuclear Energy Research Advisory Committee MeetingMarriott Crystal City HotelArlington, Virginia http://energy.gov/ne/downloads/meeting-materials-april-15-16-2002 Download Reference Buildings by Building Type: Strip mall In addition to the ZIP file for each building type, you can directly view

309

Leveraged Green Energy LCC | Open Energy Information  

Open Energy Info (EERE)

Leveraged Green Energy LCC Leveraged Green Energy LCC Jump to: navigation, search Name Leveraged Green Energy LCC Place Arlington, Virginia Zip 22209 Sector Renewable Energy Product US-based private equity investment fund manager focused on renewable energy assets. Coordinates 43.337585°, -89.379449° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.337585,"lon":-89.379449,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

310

Positive Energy Inc | Open Energy Information  

Open Energy Info (EERE)

Positive Energy Inc Positive Energy Inc Place Arlington, Virginia Zip 22201 Sector Efficiency Product Demand-response and efficiency company which uses behavioral science and targeted direct marketing to reduce energy consumption. Coordinates 43.337585°, -89.379449° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.337585,"lon":-89.379449,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

311

Cape Wind | Open Energy Information  

Open Energy Info (EERE)

Wind Wind Jump to: navigation, search Name Cape Wind Address 75 Arlington Street Place Boston, Massachusetts Zip 02116 Sector Wind energy Product Developing America's first offshore wind farm Website http://www.capewind.org/ Coordinates 42.3511372°, -71.0703224° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.3511372,"lon":-71.0703224,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

312

Demilec | Open Energy Information  

Open Energy Info (EERE)

Demilec Demilec Jump to: navigation, search Name Demilec Place Arlington, TX Zip 76011 Website http://demilecusa.com/ Coordinates 32.7476492°, -97.0924899° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":32.7476492,"lon":-97.0924899,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

313

SAIL Venture Partners (Washington DC) | Open Energy Information  

Open Energy Info (EERE)

DC) DC) Name SAIL Venture Partners (Washington DC) Address 2900 S. Quincy St, Suite 375 Place Arlington, Virginia Zip 22206 Product Venture capital fund focusing on clean energy Year founded 2002 Phone number (703) 379-2713 Website http://www.sailvc.com/ Coordinates 38.839975°, -77.087781° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":38.839975,"lon":-77.087781,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

314

Environmental Regulation of Lateral Root Emergence in Medicago truncatula Requires the HD-Zip I Transcription Factor HB1  

Science Journals Connector (OSTI)

...significantly different between groups (Kruskal-Wallis test P 0.05, n 20 in every...and 10 wild-type siblings; Kruskal-Wallis test, P 0.05). Letters indicate...similar (n 20 per experiment; Kruskal-Wallis test, P 0.05). The letters...

Federico Ariel; Anouck Diet; Marion Verdenaud; Véronique Gruber; Florian Frugier; Raquel Chan; Martin Crespi

2010-07-30T23:59:59.000Z

315

Investigating the Aggregation of the Basic Leucine Zipper (bZIP) Domain of Activating Transcription Factor 5 (ATF5)  

E-Print Network [OSTI]

was amplified using PCR for insertion to a plasmid using the following primers: 5GCGCGCCCATGGGCCCTGCCACCACCCGA3 (forward primer with NcoI restriction site), 5GCGCGCCATATGCCTGCCACCACCCGAGGG3 (forward primer with NdeI restriction site), 5.... The NcoI site was used to insert the ATF5 gene following a Glutathione-S-Transferase (GST) tag, whereas insertion at the NdeI site generated a construct from which untagged ATF5 could be expressed. The ligation product was transformed into competent...

Ciaccio, Natalie Anne

2010-05-31T23:59:59.000Z

316

Arabidopsis bZIP16 Transcription Factor Integrates Light and Hormone Signaling Pathways to Regulate Early Seedling Development  

Science Journals Connector (OSTI)

...2008). We identified proteins using the Web-based search engine Mascot ( http://www.matrixscience.com/search_form...1995) GT9934 (bzip16-2) was obtained from the Cold Spring Harbor Laboratory. bzip16-2 was crossed to phyB-5, phyA-201...

Wen-Ping Hsieh; Hsu-Liang Hsieh; Shu-Hsing Wu

2012-10-26T23:59:59.000Z

317

March 6 & 7, 2013 Meeting of the Electricity Advisory Committee |  

Broader source: Energy.gov (indexed) [DOE]

March 6 & 7, 2013 Meeting of the March 6 & 7, 2013 Meeting of the Electricity Advisory Committee March 6 & 7, 2013 Meeting of the Electricity Advisory Committee Note: This meeting has been cancelled Due to a strong winter storm which is predicted to impact the Washington DC area, the March 6 & 7, 2013 meeting of the EAC has been cancelled. The meeting may possibly be rescheduled for a later date. If rescheduled, details will be posted online and published in a new Federal Register notice. Original date: March 6 & 7, 2013 Meeting of the Electricity Advisory Committee Date: Wednesday, March 6, 2013 12:45 p.m. - 5:45 p.m. EDT Date: Thursday, March 7, 2013 8:00 a.m. - 4:00 p.m. EDT Location: National Rural Electric Cooperative Association (NRECA), 4301 Wilson Blvd, Arlington, VA 22203

318

__  

Broader source: Energy.gov (indexed) [DOE]

Unconventional Resources Technology Advisory Committee Unconventional Resources Technology Advisory Committee Minutes of Meeting of June 22, 2007 Sheraton Crystal City, Arlington, VA Executive Session Bill Hochheiser, the Committee Management Officer (CMO), welcomed the Unconventional Resources Technology Advisory Committee (hereafter referred to as the Committee) at 8:15 a.m. on June 22, 2007. Bill noted that he shared the CMO responsibilities with Elena Melchert but, although she was not able to attend the meeting, she sent her regards to the Committee members. The Agenda for the meeting and Committee Member Sign-in sheet are provided as Appendix 1 and Appendix 2, respectively. After appointment and administration of Oath of Office for special Government employees, the Committee was briefed on conflict of interest statutes and the

319

Agenda12307 | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

3-4, 2007 3-4, 2007 Nuclear Science Advisory Committee (NSAC) NSAC Home Meetings Members Charges/Reports Charter .pdf file (629KB) NP Committees of Visitors NP Home Meetings December 3-4, 2007 Print Text Size: A A A RSS Feeds FeedbackShare Page DOE/NSF Nuclear Science Advisory Committee Meeting December 3-4, 2007 Where: Marriot Crystal City at Reagan National, 1999 Jefferson Davis Highway, Arlington, VA (Metro Blue or Yellow Line to Crystal City Metro Stop) Telephone Number: 703-413-5500 Fax Number: 703-413-0192 Purpose/Topics: Perspectives from Department of Energy and National Science Foundation Status Report on the Long Range Plan Status Report on Performance Measures and Milestones Public Comment For further information you may contact Brenda May at 301-903-0536 AGENDA December 3, 2007

320

Agenda11509 | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

5, 2009 5, 2009 Nuclear Science Advisory Committee (NSAC) NSAC Home Meetings Members Charges/Reports Charter .pdf file (629KB) NP Committees of Visitors NP Home Meetings November 5, 2009 Print Text Size: A A A RSS Feeds FeedbackShare Page DOE/NSF Nuclear Science Advisory Committee Meeting November 5, 2009 Where: Marriott Crystal Gateway Hotel, Salon V, 1700 Jefferson Davis Highway, Arlington, VA Telephone Number: 703-920-3230 Purpose/Topics: Perspectives from Department of Energy and National Science Foundation Presentation of the Second Report from the Isotope Subcommittee Discussion of the Committee of Visitors Charge Public Comment For further information you may contact Brenda May at 301-903-0536 AGENDA November 5, 2009 Time Topic Speaker 8:30 AM Welcome and Introductions S. Seestrom

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Agenda053003 | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

May 30, 2003 May 30, 2003 Nuclear Science Advisory Committee (NSAC) NSAC Home Meetings Members Charges/Reports Charter .pdf file (629KB) NP Committees of Visitors NP Home Meetings May 30, 2003 Print Text Size: A A A RSS Feeds FeedbackShare Page DOE/NSF Nuclear Science Advisory Committee Meeting Friday, May 30, 2003 Where: Comfort Inn 1211 Glebe Road Arlington, VA Phone #: (703) 247-3399 (A few blocks from the NSF and the Ballston Orange Line Metro Station) Purpose: The primary purpose of the meeting will be to receive and discuss the report from the NSAC subcommittee on fundamental neutron science. The charge to NSAC requests that an interim report be submitted by June 1. Agenda (Basic agenda items are fixed; there may be some rearrangements) Friday, May 30 Time Topic Speaker 9:00 AM Introduction

322

Agenda61505 | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

June 15, 2005 June 15, 2005 Nuclear Science Advisory Committee (NSAC) NSAC Home Meetings Members Charges/Reports Charter .pdf file (629KB) NP Committees of Visitors NP Home Meetings June 15, 2005 Print Text Size: A A A RSS Feeds FeedbackShare Page DOE/NSF Nuclear Science Advisory Committee Meeting Wednesday, June 15, 2005 Where: Marriott Crystal Gateway, 1700 Jefferson Davis Highway, Arlington, VA (Located on the Metro Blue Line) Telephone Number: 703-920-3230 Fax Number: 703-271-5212 Purpose/Topics: Perspectives from Department of Energy and National Science Foundation Presentation of the Implementation of the 2002 Long Range Plan Subcommittee Report Public Comment For further information you may contact Brenda May at 301-903-0536 Agenda: Wednesday, June 15, 2005 Time Topic Speaker

323

Agenda73010 | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

30, 2010 30, 2010 Nuclear Science Advisory Committee (NSAC) NSAC Home Meetings Members Charges/Reports Charter .pdf file (629KB) NP Committees of Visitors NP Home Meetings Minutes July 30, 2010 Print Text Size: A A A RSS Feeds FeedbackShare Page DOE/NSF Nuclear Science Advisory Committee Meeting July 30, 2010 Where: Crystal City Marriott Hotel, Salon D&E, 1999 Jefferson Davis Highway, Arlington, VA, Telephone Number: 703-413-5500 Purpose/Topics: Perspectives from Department of Energy and National Science Foundation Update from Department of Energy and National Science Foundation's Nuclear Physics Office Technical Talk on Deep Underground Science and Engineering Laboratory Public Comment For further information you may contact Brenda May at 301-903-0536 AGENDA July 30, 2010 Time Topic Speaker

324

BERAC Meeting September 5 2008 Gaithersburg MD | U.S. DOE Office of Science  

Office of Science (SC) Website

September 5 2008 Gaithersburg MD September 5 2008 Gaithersburg MD Biological and Environmental Research Advisory Committee (BERAC) BERAC Home Meetings BERAC Minutes BERAC Minutes Archive Members Charges/Reports Charter .pdf file (40KB) BER Committees of Visitors BER Home Meetings BERAC Meeting September 5 2008 Gaithersburg MD Print Text Size: A A A RSS Feeds FeedbackShare Page BER September 5, 2008 Arlington, VA Agenda Presentations Peg Riley .ppt file (357KB), Life and Medical Sciences Division Committee of Visitors Report Patricia Dehmer .ppt file (2.6MB), Report from the Office of Science Todd Anderson .ppt file (1.2MB), Scientific Focus Area (SFA) Rollout & Discussion Robert Dickinson .ppt file (6.1MB), Report on Climate Research Grand Challenges Mike Kuperberg .ppt file (975KB), Climate & Environmental Sciences

325

Agenda3807 | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

March 8-9, 2007 March 8-9, 2007 Nuclear Science Advisory Committee (NSAC) NSAC Home Meetings Members Charges/Reports Charter .pdf file (629KB) NP Committees of Visitors NP Home Meetings March 8-9, 2007 Print Text Size: A A A RSS Feeds FeedbackShare Page DOE/NSF Nuclear Science Advisory Committee Meeting March 8-9, 2007 Where: Sheraton Crystal City Hotel, 1800 Jefferson Davis Highway, Arlington, VA (Metro Blue or Yellow Line to Crystal City Metro Stop) Telephone Number: 703-486-1111 Fax Number: 703-769-3955 Purpose/Topics: Perspectives from Department of Energy and National Science Foundation Status Report - NuSAG Report from NuPECC Presentation and discussion on the Committee of Visitors Report from the Sub-Committee Status Report from NSAC RIB Task Force Town Meeting Updates Public Comment

326

November 2000 | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

0 0 Advanced Scientific Computing Advisory Committee (ASCAC) ASCAC Home Meetings November 2013 March 2013 October 2012 August 2012 March 2012 November 2011 August 2011 March 2011 November 2010 August 2010 March 2010 November 2009 August 2009 March 2009 October 2008 August 2008 February 2008 November 2007 August 2007 February 2007 November 2006 August 2006 March 2006 April 2004 March 2003 October 2002 May 2002 October 2001 May 2001 November 2000 Members Charges/Reports Charter .pdf file (38KB) ASCR Committees of Visitors ASCR Home Meetings November 2000 Print Text Size: A A A RSS Feeds FeedbackShare Page The first ASCAC meeting was October 31-November 1, 2000 at the Key Bridge Marriott, 1401 Lee Highway, Arlington, VA. * Agenda .pdf file (14KB) * Minutes .pdf file (106KB) * Presentations:

327

Previous Meetings | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

Previous Meetings Previous Meetings High Energy Physics Advisory Panel (HEPAP) HEPAP Home Meetings Previous Meetings Members .pdf file (20KB) Charges/Reports Charter .pdf file (44KB) HEP Committees of Visitors HEP Home Meetings Previous Meetings Print Text Size: A A A RSS Feeds FeedbackShare Page December 6-7, 2013 Gaithersburg, MD Agenda and Talks September 5-6, 2013 Arlington, VA Agenda and Talks March 11-12, 2013 Gaithersburg, MD Agenda and Talks December 5-6, 2012 Bethesda, MD Agenda and Talks Minutes .pdf file (5.7MB) August 27-28, 2012 Rockville, MD Agenda and Talks Minutes .pdf file (6.1MB) March 12-13, 2012 Washington, DC Agenda and Talks Minutes .pdf file (5.7MB) October 27-28, 2011 Washington, DC Agenda and Talks Minutes .docx file (72KB) Summary Letter from Chair .pdf file (94KB)

328

Agenda72709 | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

27, 2009 27, 2009 Nuclear Science Advisory Committee (NSAC) NSAC Home Meetings Members Charges/Reports Charter .pdf file (629KB) NP Committees of Visitors NP Home Meetings Minutes July 27, 2009 Print Text Size: A A A RSS Feeds FeedbackShare Page DOE/NSF Nuclear Science Advisory Committee Meeting July 27, 2009 Where: Marriott Crystal City at Reagan National Airport, Salon D&E, 1999 Jefferson Davis Highway, Arlington, VA Telephone Number: 703-413-5500 Purpose/Topics: Perspectives from Department of Energy and National Science Foundation Presentation of the Interim Report from the Isotope Subcommittee Discussion of the FY 2010 Budget Discussion of the Committee of Visitors Charge Public Comment For further information you may contact Brenda May at 301-903-0536 AGENDA July 27, 2009

329

Agenda030603 | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

6-7, 2003 6-7, 2003 Nuclear Science Advisory Committee (NSAC) NSAC Home Meetings Members Charges/Reports Charter .pdf file (629KB) NP Committees of Visitors NP Home Meetings March 6-7, 2003 Print Text Size: A A A RSS Feeds FeedbackShare Page DOE/NSF Nuclear Science Advisory Committee Meeting March 6 & 7, 2003 National Science Foundation Room 1235 (NSF Board Room) Arlington, VA Thursday, March 6 Time Topic Speaker 8:30 AM Introduction R. Casten 8:40 AM NSF Budget Outlook .pdf file (105KB) B. Keister 9:10 AM DOE Budget Outlook .pdf file (205KB) D. Kovar 9:40 AM Overview of MPS Directorate John Hunt, Acting Assistant Director for MPS 10:10 AM Break 10:30 AM Future Facilities Subcommittee Report .pdf file (156KB) C. Glashausser 11:00 AM Discussion of Report 12:00 PM Lunch

330

Agenda021904 | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

February 19-20, 2004 February 19-20, 2004 Nuclear Science Advisory Committee (NSAC) NSAC Home Meetings Members Charges/Reports Charter .pdf file (629KB) NP Committees of Visitors NP Home Meetings February 19-20, 2004 Print Text Size: A A A RSS Feeds FeedbackShare Page DOE/NSF Nuclear Science Advisory Committee Meeting Thursday, February 19, 2004 to Friday, February 20, 2004 Where: Crystal City Marriott, 1999 Jefferson Davis Highway, Arlington, VA (Located at the Crystal City Metro Station, (under the hotel)) Telephone Number: 703-413-0192 Fax Number: 703-413-0192 Purpose/Topics: Perspectives from Department of Energy and National Science Foundation Presentation and Discussion on the Report from the Sub-Committee on Committee of Visitors to the DOE Office of Nuclear Physics Discussion of NSAC Response and Transmittal Letter on Committee of

331

NETL Publications: First Annual Grid Technologies Collaborative National  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

First Annual Grid Technologies Collaborative National Conference First Annual Grid Technologies Collaborative National Conference Arlington, VA June 10, 2013 GTC Introduction-Reed Keynote-Hoffman 2012 R&D Progress Report Conference Attendees Breakout sessions Communication Converter Design Demonstration/Integration Smart Controls System Modeling and Simulation Posters AVESTAR Center - NETL CPES Converter for Energy Storage Systems Integration - Virginia Tech CPES Dynamic Interactions caused by Phase-locked Loops - Virginia Tech CPES Renewable Energy and Nanogrids - Virginia Tech CPES Survey of FACTS devices - Virginia Tech Grid-Related Materials Development Across the NETL-RUA - NETL IEEE 1547 and System Modeling - University of Pittsburgh Interface and Communication Protocols - West Virginia University Microgrid Modeling Controller Design - West Virginia University

332

NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Broader source: Energy.gov (indexed) [DOE]

Advanced Resources International Advanced Resources International SCNGO 2012/36 months Gary Covatch Arlington, VA Identifying & Developing Technology to Pursue Residual Oil Zone Fairways of the Permian Basin Select and examine an area to identify the potential of 3-D seismic analysis to assist with ROZ delineation and provide an estimate of the Permian Basin San Andres ROZ resource. Gary L. Covatch Digitally signed by Gary L. Covatch DN: cn=Gary L. Covatch, o=NETL, ou=SCNGO, email=gary.covatch@netl.doe.gov, c=US Date: 2012.02.01 10:02:19 -05'00' 02 01 2012 Jesse Garcia Digitally signed by Jesse Garcia DN: cn=Jesse Garcia, o=NETL, ou=ECD, email=Jesse.Garcia@netl.doe.gov, c=US Date: 2012.02.22 11:27:55 -06'00' 02 22 2012 This CX covers analysis, CX(A), activities only, conducted at ARI office location

333

newsletter6.cdr  

Broader source: Energy.gov (indexed) [DOE]

(2900 (2900 Van Ness Street, NW, Washington, D.C. 20008) on May 27, 2009 Crystal City Doubletree Hotel (300 Army-Navy Drive, Arlington, VA 22202) on May 28 and 29, 2009 The Conference started on Wednesday, May 27, 2009, at the Howard University School of Law in Washington, D.C. Craig Hooks, Acting Administrator for the Office of Administration and Resources Management, delivered the keynote speech. His speech was followed by a panel discussion on environmental justice and climate change. The panel members were Gina Wood, Director of Policy and Planning, Joint Center for Political and Economic Studies; Shankar Prasad, Executive Fellow, Coalition for Clean Air; Beverly Hogan, President, Tougaloo College; Doug Wyatt, Program Director, New Energy & Environmental Sciences, Lead, Integrated Carbon Solutions, URS Washington Division; John Atcheson, Program Specialist, Department

334

Microsoft PowerPoint - Junior_ONR  

Broader source: Energy.gov (indexed) [DOE]

Mi Mi it S i I tit ti (MSI ) Minority Serving Institutions (MSIs): Bridging the Gap between Federal g g p Agencies and MSIs Dr. Anthony Junior, Program Manager Naval Historically Black Colleges and University/Minority Institutions Program Office of Naval Research 874 North Randolph Street, Arlington, VA 22203 anthony.junior@navy.mil AVJ HBCU/MI SP Concepts V2 Agenda * The Requirement The Requirement * The Strategic Plan * HBCU/MI Full Engagement Model HBCU/MI Full Engagement Model * STEM Research Pipeline * HBCU/MI Accredited Engineering Schools * HBCU/MI Accredited Engineering Schools 2 10 USC 2362 Objective: Enhance defense-related research and education at HBCU/MIs to assist the Department in education at HBCU/MIs to assist the Department in defense-related research, development, testing, and

335

Low Dose Radiation Research Program: Earlier Events  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Earlier Events Earlier Events 2000 | 2001 | 2002 | 2003 | 2004 April 2000 Ionizing Radiation Science and Protection in the 21st Century, NCRP, April 5-6, Arlington, VA. RADIATION RESEARCH 2000, Association for Radiation Research, April 10-12, Bristol, UK. Florida Chapter of the Health Physics Society Spring 2000 Meeting, Gainesville, FL, April 13-14. 47th Annual Meeting of the Radiation Research Society, April 29-May 3, Albuquerque, NM. May 2000 IRPA-10 International Congress 2000, May 14-19, Hiroshima, Japan. IRPA-10 Secretariat, c/o Japan Convention Services, Inc., Nippon Press Center Building, 2-2-1, Uchisaiwai-cho, Chiyoda-ku, Tokyo 100, Japan. Phone: 81-3-3508-1214. Fax: 81-3-3508-0820. irpa10@convention.jp. 4th International Non-Ionizing Radiation Workshop, May 22-25, Kyoto,

336

Final_Tech_Session_Schedule_and_Location.xls  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

JPD0415205.PPT JPD0415205.PPT 1 Advanced Resources International, Inc. The Electricity Supply Wedge: A Strategic Plan to Reduce the Carbon Dioxide Intensity of Power Generation in the United States Washington, DC USA May 3-4, 2005 Jason Hummel Advanced Resources International Jhummel@adv-res.com Vello Kuuskraa Advanced Resources International Vkuuskraa@adv-res.com Co-Author Presented by: Phil DiPietro Advanced Resources International, Inc. Arlington, VA USA Pdipietro@adv-res.com Presented at: 4 th Annual Conference on Carbon Capture and Sequestration Paper #52 JPD0415205.PPT 2 Advanced Resources International, Inc. U.S. Global Climate Change Initiative (GCCI) 192 190 187 182 166 137 - 50 100 150 200 250 2000 2001 2002 2003 2012 2025 GHG Intensity of US GDP, mtC/$MM Progress is being made toward the

337

Electricity Advisory Committee - 2013 Meetings | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

2013 Meetings 2013 Meetings Electricity Advisory Committee - 2013 Meetings Electricity Advisory Committee - 2013 Meetings CANCELLED: OCTOBER 2 & 3, 2013 MEETING OF THE ELECTRICITY ADVISORY COMMITTEE This meeting has been cancelled due to the uncertainty of continuing operations of the Federal government. If this meeting is rescheduled for a later date, details will be posted online and published in a new Federal Register notice. Date: Wednesday, October 2, 2013 2:00 p.m. - 5:00 p.m. EDT Date: Thursday, October 3, 2013 8:00 a.m. - 4:00 p.m. EDT Location: National Rural Electric Cooperative Association (NRECA), 4301 Wilson Blvd, Arlington, VA 22203 A Federal Register Notice announcing the meeting is available. The meeting is open to the public. JUNE 5 & 6, 2013 MEETING OF THE ELECTRICITY ADVISORY COMMITTEE

338

iBlank Portrait Template  

Broader source: Energy.gov (indexed) [DOE]

Suite 600, 1901 North Moore Street Suite 600, 1901 North Moore Street Arlington, VA 22209-1728 Phone: (703) 522-0086 | Fax: (703) 522-0548 Email: hpbamail@hpba.org Web Site: www.hpba.org HPBA Comments NOPR on Energy Conservation Standards for Direct Heating Equipment Docket No. EERE-2011-BT-STD-0047 RIN 1904-AC56 October 14, 2011 The Hearth, Patio & Barbecue Association (HPBA) provides these comments in response to the Department of Energy (DOE) Notice of Proposed Rulemaking entitled "Energy Conservation Program: Energy Conservation Standards for Direct Heating Equipment," published at 76 Fed. Reg. 43941 (July 22, 2011) (the NOPR). HPBA is the North American industry association for 2500 member manufacturers, retailers, and distributors of hearth products. The vast majority of these entities are small businesses

339

Breaking the Fuel Cell Cost Barrier  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Breaking the Fuel Cell Cost Barrier Breaking the Fuel Cell Cost Barrier AMFC Workshop May 8 th , 2011, Arlington, VA Shimshon Gottesfeld, CTO The Fuel Cell Cost Challenge 2 CellEra's goal - achieve price parity with incumbents earlier on in market entry process ! Mainstream Polymer Electrolyte Fuel Cell ( PEM) Cost Barriers 3 Graphite / stainless steel hardware Acidic membrane Platinum based electrodes Cost barriers deeply embedded in core tech materials BOM-based cost barriers - 90% of stack cost Cost volatility - Platinum $500/Oz - $2,500/Oz The possibility of an OH - ion conducting membrane 4 Non-acidic membrane CellEra Took Advantage of this Opportunity A new type of membrane component with potential for strong fuel cell cost cuts was revealed in 2006, but was accompanied by general industry skepticism

340

October 2 & 3, 2013 Meeting of the Electricity Advisory Committee |  

Broader source: Energy.gov (indexed) [DOE]

October 2 & 3, 2013 Meeting of the October 2 & 3, 2013 Meeting of the Electricity Advisory Committee October 2 & 3, 2013 Meeting of the Electricity Advisory Committee Note: This meeting has been cancelled The Electricity Advisory Committee meeting scheduled to be held October 2 - October 3 has been cancelled, due to the uncertainty of continuing operations of the Federal government. If this meeting is rescheduled for a later date, details will be posted online and published in a new Federal Register notice. Original Date: October 2 & 3, 2013 Meeting of the Electricity Advisory Committee Date: Wednesday, October 2, 2013 12:00 p.m. - 5:30 p.m. EDT Date: Thursday, October 3, 2013 8:00 a.m. - 4:00 p.m. EDT Location: National Rural Electric Cooperative Association (NRECA), 4301 Wilson Blvd, Arlington, VA 22203

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

DOE Electricity Transmission System Workshop  

Broader source: Energy.gov (indexed) [DOE]

TRANSMISSION SYSTEM WORKSHOP TRANSMISSION SYSTEM WORKSHOP Mapping Challenges and Opportunities to Help Guide DOE R&D Investments over the Next Five Years DoubleTree Crystal City, 300 Army Navy Drive, Arlington, VA November 1-2, 2012 AGENDA Thursday, November 1, 2012 8:00-8:10 Welcome and Kickoff David Sandalow, Acting Undersecretary of Energy 8:10-8:30 Introduction to the Grid Tech Team (GTT), Vision, and Framework Distribution Workshop Summary Dr. Anjan Bose, Grid Tech Team Lead 8:30-8:50 OE Vision, Activities, and Issues Patricia A. Hoffman, Assistant Secretary for the Office of Electricity Delivery and Energy Reliability (OE) 8:50-9:10 EERE Vision, Activities, and Issues Dr. David Danielson, Assistant Secretary for the Office of Energy Efficiency and Renewable Energy (EERE)

342

DOE/NETL's Phase II Plans for Full-Scale Mercury Removal Technology Field-Testing  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Phase II Plans for Full-Scale Phase II Plans for Full-Scale Mercury Removal Technology Field-Testing Air Quality III September 12, 2002 Arlington, Va Scott Renninger, Project Manager for Mercury Control Technology Enviromental Projects Division Presentation Outline * Hg Program goals & objectives * Focus on Future Hg control R&D * Q&As President Bush's Clear Skies Initiative Current Mid-Term 2008-2010 2018 SO 2 11 million tons 4.5 million tons 3 million tons NOx 5 million tons 2.1 million tons 1.7 million tons Mercury 48 tons 26 tons 15 tons Annual U.S. Power Plant Emissions Mercury Control * Developing technologies ready for commercial demonstration: - By 2005, reduce emissions 50-70% - By 2010, reduce emissions by 90% - Cost 25-50% less than current estimates 2000 Year 48 Tons $2 - 5 Billion @ 90% Removal w/Activated

343

Microsoft PowerPoint - DOD Microgrid 102513 SHORT.pptx  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Success Stories in DOE's Success Stories in DOE's ARRA Smart Grid Program Steve Bossart, Senior Energy Analyst Smart Grids & Microgrids for Government & Military Symposium October 24-25, 2013, Arlington, VA ‹#› Topics * OE ARRA Smart Grid Program * OE ARRA Smart Grid Progress * Case Studies/Success Stories * Life After ARRA Smart Grid ‹#› DOE OE ARRA Smart Grid Program ‹#› American Recovery and Reinvestment Act ($4.5B) * Smart Grid Investment Grants (99 projects) - $3.4 billion Federal; $4.7 billion private sector - > 800 PMUs covering almost 100% of transmission - ~ 8000 distribution automation circuits - > 15 million smart meters * Smart Grid Demonstration Projects (32 projects) - $685 million Federal; $1 billion private sector - 16 storage projects - 16 regional demonstrations

344

Annual Energy Outlook 2000 Conference  

Gasoline and Diesel Fuel Update (EIA)

Summary of Last Year's Conference Summary of Last Year's Conference The Energy Information Administration (EIA) will host its eighth annual National Energy Modeling System/Annual Energy Outlook Conference on March 21, 2000, at the Crystal Gateway Marriott, 1700 Jefferson Davis Highway, Arlington, VA, near the Crystal City Metro station. The conference includes speakers and attendees from Federal and State governments, private industry, and trade associations, discussing energy issues particularly related to EIA’s Annual Energy Outlook 2000, which was released in November 1999, and the National Energy Modeling System. Conference Registration Conference registration is free, but space is limited. You can register on-line or fax this form to: Peggy Wells Energy Information Administration, EI-84

345

Electricity Advisory Committee  

Broader source: Energy.gov (indexed) [DOE]

October 3, 2011 Page 1 October 3, 2011 Page 1 Electricity Advisory Committee Meeting National Rural Electric Cooperative Association Headquarters 4301 Wilson Boulevard Arlington, VA Agenda October 19, 2011 2:00 - 5:00 pm EDT 1:30 - 2:00 pm Registration 2:00 - 2:15 pm WELCOME and Introductions Richard Cowart, Chair, Electricity Advisory Committee Patricia Hoffman, Assistant Secretary for Electricity Delivery and Energy Reliability, U.S. Department of Energy (DOE) 2:15 - 3:15 pm Presentation on U.S. Department of Energy's Vision of a Future Grid Bill Parks, Senior Advisor, DOE Office Electricity Delivery and Energy Reliability 3:15 - 3:30 pm Break 3:30 - 4:15 pm Response to U.S. Department of Energy's Vision of a Future Grid Honorable Robert Curry, Commissioner, New York State Public Service

346

Page not found | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

11 - 6020 of 28,560 results. 11 - 6020 of 28,560 results. Download TBZ-0104 In the Matter of Hansford F. Johnson This Decision will consider a Motion to Dismiss filed by B&W Pantex LLC (B&W), the Management and Operating Contractor for the Department of Energy's (DOE) Pantex Plant (Pantex), in... http://energy.gov/oha/downloads/tbz-0104-matter-hansford-f-johnson Download 4th U.S.-China Energy Efficiency Forum The U.S. Department of Energy and China's National Development and Reform Commission held the annual U.S.-China Energy Efficiency Forum (EEF) this past September in Arlington, VA. The day-long event featured keynotes from DOE Office of Energy Efficiency and Renewable Energy Assistant Secretary Dr. David Danielson, U.S. Special Envoy for Climate Change Todd Stern, and NDRC Vice Chairman Xie Zhenhua.

347

EJ Conference  

Broader source: Energy.gov (indexed) [DOE]

EJ Conference, Inc. EJ Conference, Inc. Presents DOUBLETREE HOTEL CRYSTAL CITY 300 ARMY NAVY DRIVE ARLINGTON, VA 22202 MAY 27-29, 2009 Meet the Agencies and Exhibit Registration Form One of the recommendations from the 2008 State of Environmental Justice in America Conference was the introduction of an activity through which participants would have an opportunity to engage in short-but-informative conversations with representatives of various Federal agencies It was noted that the conference is one of few for many local community participants to obtain an audience with high- level Federal officials. Since one of the stated purposes of the conference is to bring together diverse groups of individuals interested in environmental justice through a process of substantive and honest

348

Notice of Availability of the Remediation of the Moab Uranium Mill Tailings, Grand and San Juan Counties, Utah, Draft Environmental Impact Statement (DOE/EIS-0355D) (12/3/04)  

Broader source: Energy.gov (indexed) [DOE]

256 256 Federal Register / Vol. 69, No. 232 / Friday, December 3, 2004 / Notices 877-8339 between 8 a.m. and 8 p.m. Eastern time, Monday through Friday. SUPPLEMENTARY INFORMATION: The changes to the agenda for the December 2004 meeting of the National Advisory Committee, to be held at the Ritz Carlton Hotel at Pentagon City, 1250 South Hayes Street, Arlington, VA, are as follows: (1) On Monday, December 13, and Tuesday, December 14, 2004, the National Advisory Committee is now scheduled to meet from 8 a.m. to approximately 6 p.m. The National Advisory Committee will not meet on Wednesday, December 15, 2004. (2) On Wednesday, December 15, the Accreditation and State Liaison Staff will provide an informational briefing on the new Web-based process for electronic submission of petitions for

349

Microsoft PowerPoint - [9] Jack McCall Slides - HVDC Workshop April 2013  

Broader source: Energy.gov (indexed) [DOE]

Tres Tres Amigas Superstation: Opportunity, Technology, Challenges U.S. DOE Applications for High-Voltage Direct U.S. DOE Applications for High-Voltage Direct Current Transmission Technologies Workshop April 22, 2013 Arlington, VA Project Value Creation Connects the three US asynchronous power grids through a DC hub that can regulate the direction and level of power flows between the grids Provides economic incentives to further drive the growth of the nation's renewable resources 2 Optimizes the value of existing and planned AC and DC/ HTS infrastructure Provides open-access and cost-effective transmission services consistent with NERC standards and regional reliability requirements Provides voltage support, capacity firming and other value-added and ancillary

350

Electricity Advisory Committee Meeting Agenda  

Broader source: Energy.gov (indexed) [DOE]

Agenda Agenda October 2 and 3, 2013 NRECA Building, Arlington, VA 1 Wednesday, October 2, 2013 12:00 to 1:00 pm EAC Leadership Committee Meeting 12:00 to 1:00 pm Registration Public Signups for Comments on Day 2 1:00 to 1:10 pm Welcome, Introductions and Developments since our June 2013 Meeting Richard Cowart, EAC Chair and David Meyer, EAC Designated Federal Officer 1:10 to 1:30 pm Update on the U.S. Department of Energy (DOE), Office of Electricity Delivery and Energy Reliability's (OE) 2013 Programs and Initiatives Honorable Patricia Hoffman, Assistant Secretary for Electricity Delivery and Energy Reliability 1:30 to 2:10 pm Keynote: Melanie Kenderdine, Energy Counselor to the Secretary of Energy (Invited) 2:10 to 2:20 pm Break

351

Department of Energy Releases Details of Tribal Summit | Department of  

Broader source: Energy.gov (indexed) [DOE]

WASHINGTON, D.C. - U.S. Department of Energy today released details of the upcoming Tribal Summit with American Indian and Alaska Native Leaders that will be held on May 4-5, 2011, at the Crystal City Gateway Marriott in Arlington, Va. The summit will build on Secretary Chu's continued commitment to partnering with Native Americans to support the development of clean energy projects on tribal lands that will help reduce energy use, limit carbon pollution, and create new jobs for tribal communities across the country. "Tribal Nations are well-positioned to take advantage of the benefits of clean energy. This summit will provide an opportunity for meaningful dialogue between the Department of Energy and Tribal Nations on a broad range of energy and environmental issues," said Secretary Chu. "Working

352

PhaseII1.PDF  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Stakeholder Meeting Stakeholder Meeting DOE-NETL Proposed Phase II Large Scale Mercury Control Technology Field Testing Program September 12, 2002 Meeting Summary A meeting was held in Arlington, VA on September 12 on DOE-NETL's plans to go forward with a second phase of field testing of advanced mercury control technology. The meeting was held in conjunction with the Air Quality III Conference and was attended by approximately 53 representatives from the coal and electric-utility industries, technology developers, EPA, and other interested parties (see attached attendees list). Scott Renninger provided a brief overview of DOE-NETL's current mercury field testing program. A summary of the results from an earlier stakeholder meeting held in Washington on June 4 were also presented as a starting point for discussion to help

353

DOE Hydrogen Analysis Repository: Using HyPro to Evaluate Competing  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Using HyPro to Evaluate Competing Hydrogen Pathways Using HyPro to Evaluate Competing Hydrogen Pathways Project Summary Full Title: Using HyPro to Evaluate Competing Hydrogen Pathways Project ID: 217 Principal Investigator: Brian D. James Keywords: Steam methane reforming (SMR); electrolysis; biomass; fuel cell vehicles (FCV); costs Purpose This project provides analysis of the options and trade-offs associated with establishing the required hydrogen production infrastructure to provide hydrogen to fuel cell vehicles in the 2020 timeframe and beyond. Performer Principal Investigator: Brian D. James Organization: Directed Technologies, Inc. (DTI) Address: 3601 Wilson Blvd., Suite 650 Arlington, VA 22201 Telephone: 703-778-7114 Email: Brian_James@directedtechnologies.com Additional Performers: Sentech, Inc.; H2Gen Innovations, Inc.; ChevronTexaco Technology Ventures; Teledyne Energy Services

354

Microsoft Word - 2007hsn-infocom-paper-lehman-etal.doc  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

2 2 Control Plane Architecture and Design Considerations for Multi-Service, Multi-Layer, Multi- Domain Hybrid Networks Tom Lehman 1 , Xi Yang 1 , Chin P. Guok 2 , Nageswara S. V. Rao 3 , Andy Lake 4 , John Vollbrecht 4 , Nasir Ghani 5 1 Information Sciences Institute East, University of Southern California, Arlington, VA 22203, USA, Email: {tlehman,xyang}@isi.edu 2 Network Engineering Services Group, ESnet, Berkeley, CA 94720, USA, Email: chin@es.net 3 Computer Science and Mathematics Division, Oak Ridge National Laboratory, Oak Ridge, TN 37831, USA, Email: raons@ornl.edu 4 University Corporation for Advanced Internet Development, Internet2, Ann Arbor, MI 48104, USA, Email: {jrv,alake}@internet2.edu 5 Department of Electrical and Computer Engineering, Tennessee Technological University, Cookville, TN 38505, USA,

355

NETL: News Release - Converting Emissions into Energy - Three Companies to  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

September 14, 2000 September 14, 2000 Converting Emissions into Energy - Three Companies To Develop Technologies for Tapping Coal Mine Methane Methane, the chief constituent of natural gas, is a potent greenhouse gas, and millions of cubic feet of it escape daily from active coal mines. Now, three projects selected the U.S. Department of Energy propose new ways to capture the gas and convert it to useful energy -- reducing an environmental threat while adding to the nation's supplies of clean natural gas and electric power. The National Energy Technology Laboratory, the Energy Department's chief field site for its fossil energy research program, has selected: Appalachian-Pacific Coal Mine Methane Power Co., LLC, Arlington, VA, to work with West Virginia University Research Corp., Morgantown, WV, and Invitation Energy, Mannington, WV, to convert coal mine methane from mines in Marion County, WV, and surrounding areas into liquefied natural gas (LNG) to fuel heavy trucks.

356

A Perspective on the Potential Role of Geologic Options in a National Carbon Management Strategy  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Perspective On The Potential Role Of Geologic Options Perspective On The Potential Role Of Geologic Options In A National Carbon Management Strategy David A. Beecy (David.Beecy@hq.doe.gov; 301-903-2787) U.S. Department of Energy, Office of Environmental Systems 19901 Germantown Rd., FE-23, Building GTN Germantown, MD 20874 Vello A. Kuuskraa (vkuuskraa@adv-res.com; 703-528-8420) Advanced Resources International, Inc. 1110 N. Glebe, Suite 600 Arlington, VA 22201 Charles Schmidt (Charles.Schmidt@netl.doe.gov; 412-386-6090) U.S. Department of Energy, National Energy Technical Laboratory 626 Cochrans Mill Road Pittsburgh, PA 15236 Abstract. Carbon sequestration is the critical "third-option" for addressing greenhouse gas emissions, along with increased energy efficiency and expanded use of low-carbon fuels.

357

Condensed Matter Physics & Materials Science Department, Brookhaven  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Presetations Presetations Homepage | Contacts "How can we make an isotropic high-temperature superconductor?," Seminar at Condensed Matter Physics Department, (Brookhaven National Laboratory, Upton, NY, November 27 2007). PDF "Enhancement of Jc in thick MOD and BaF2 coatings through the structure improvement " DOE "Superconductivity for Power Systems" Annual Peer Review, (Arlington, VA, August 7-9 2007). PDF "Texture Development in 2-3 μm Thick YBCO Films Synthesized by BaF2 and MOD Processes on Metal RABiTS(tm) " Materials Research Society Spring Meeting, (San Francisco, CA, April 20 2007). PDF "Films and Crystals: Search for the Perfect Structure. ," Seminar at Condensed Matter Physics Department, (Brookhaven National Laboratory, Upton, NY, March 12 2007). PDF

358

NIST's Advanced Technology Program  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

NIST's Advanced NIST's Advanced Technology Program NIST's Advanced Technology Program DOE Workshop on Hydrogen Separation and Purification Technologies Arlington, VA, Sept. 8-9, 2004 Jason Huang 301-975-4197 National Institute of Standards and Technology 100 Bureau Drive Stop 4730 Gaithersburg, MD 20899-4730 http://www.atp.nist.gov National Institute of Standards and Technology * Technology Administration * U.S. Department of Commerce ATP is part of NIST Helping America Measure Up NIST Mission ATP is part of NIST NIST Mission: Strengthen the U.S. economy and improve the quality of life by working with industry to develop and apply technology, measurements, and standards. * * * * * * 3,000 employees $771 million annual budget 2,000 field agents 1,800 guest researchers $2.2 billion co-funding of

359

OSTI, US Dept of Energy, Office of Scientific and Technical Information |  

Office of Scientific and Technical Information (OSTI)

Open Innovation Enabled by Global Networking of Science and Technical Open Innovation Enabled by Global Networking of Science and Technical Knowledge Slide01 Slide01 Collaborative Expedition Workshop National Science Foundation, Arlington, VA Walt Warnick, Ph.D. Director, Office of Scientific and Technical Information U.S. Department of Energy Now Loading Slide02 Slide02 OSTI Mission To advance science and sustain technological creativity by making R&D findings available and useful to DOE researchers and the public Slide03 Slide03 Science progresses as knowledge is shared OSTI Corollary: If the sharing of knowledge is accelerated, then discovery is accelerated "If I have seen further, it is by standing on the shoulders of giants." - Isaac Newton 1676 Profound implications for everyone in the information business. Slide04

360

Microsoft PowerPoint - EIA PG V3a.pptx  

U.S. Energy Information Administration (EIA) Indexed Site

EIA/ARI World Shale Gas and Shale Oil Resource Assessment EIA/ARI World Shale Gas and Shale Oil Resource Assessment 1 1 EIA/ARI World Shale Gas and Shale Oil Resource Assessment Prepared For: U.S. Department of Energy U.S. Energy Information Administration EIA 2013 Energy Conference Prepared By: Vello A. Kuuskraa, President ADVANCED RESOURCES INTERNATIONAL, INC. Arlington, VA June 17, 2013 ▪ Washington, DC JAF2013_043.PPT EIA/ARI World Shale Gas and Shale Oil Resource Assessment 1 EIA/ARI "World Shale Gas and Shale Oil Resource Assessment" The EIA/ARI "World Shale Gas and Shale Oil Resource Assessment" report represents a major new shale resource assessment : * 41 distinct countries (42 with U.S.). * 95 shale basins with 137 shale gas and shale oil formations. * ~700 page report with 26 Chapters.

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Natural Analogs for Geologic Storage of CO2: An Integrated Global Research Program  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

JAF21006.DOC JAF21006.DOC First National Conference on Carbon Sequestration U.S. Department of Energy National Energy Technology Laboratory May 15-17, 2001 Washington, D.C. Natural Analogs for Geologic Storage of CO 2 : An Integrated Global Research Program S. H. Stevens (sstevens@adv-res.com, (703) 528 8420) Advanced Resources International, Inc. 1110 N. Glebe Road, Suite 600 Arlington, VA USA 22201 703-528-8420 J. M. Pearce (jmpe@bgs.ac.uk, (0)115 9363 222) British Geological Survey Nottingham, NG12 5GG, United Kingdom. A. A. J. Rigg (a.rigg@petroleum.crc.org.au, 61-2-9490 8225) Australian Petroleum Cooperative Research Centre Sydney, NSW Australia ABSTRACT Coordinated research efforts are underway on three continents (North America, Europe,

362

Stationary Fuel Cell System Cost Analysis - DOE Hydrogen and Fuel Cells Program FY 2012 Annual Progress Report  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

DOE Hydrogen and Fuel Cells Program FY 2012 Annual Progress Report Brian D. James (Primary Contact), Andrew B. Spisak, Whitney G. Colella Strategic Analysis, Inc. 4075 Wilson Blvd. Suite 200 Arlington, VA 22203 Phone: (703) 778-7114 Email: bjames@sainc.com DOE Managers HQ: Jason Marcinkoski Phone: (202) 586-7466 Email: Jason.Marcinkoski@ee.doe.gov GO: Gregory Kleen Phone: (720) 356-1672 Email: Gregory.Kleen@go.doe.gov Technical Advisor Bryan Pivovar Phone: (303) 275-3809 Email: bryan.pivovar@nrel.gov Sub-Contract Number No: AGB-0-40628-01 under Prime Contract No. DE-AC36-08G028308 Project Start Date: July 8, 2010 Project End Date: September 7, 2012 Fiscal Year (FY) 2012 Objectives Perform Design for Manufacturing and Assembly * (DFMA ® ) cost analysis for low-temperature (LT)

363

Department of Energy Releases Details of Tribal Summit | Department of  

Broader source: Energy.gov (indexed) [DOE]

WASHINGTON, D.C. - U.S. Department of Energy today released details of the WASHINGTON, D.C. - U.S. Department of Energy today released details of the upcoming Tribal Summit with American Indian and Alaska Native Leaders that will be held on May 4-5, 2011, at the Crystal City Gateway Marriott in Arlington, Va. The summit will build on Secretary Chu's continued commitment to partnering with Native Americans to support the development of clean energy projects on tribal lands that will help reduce energy use, limit carbon pollution, and create new jobs for tribal communities across the country "Tribal Nations are well-positioned to take advantage of the benefits of clean energy. This summit will provide an opportunity for meaningful dialogue between the Department of Energy and Tribal Nations on a broad range of energy and environmental issues," said Secretary Chu. "Working

364

EJ Conference  

Broader source: Energy.gov (indexed) [DOE]

Howard University School of Law (Washington, DC) on May 27, 2009 Howard University School of Law (Washington, DC) on May 27, 2009 Crystal City Doubletree Hotel (300 Army Navy Drive, Arlington, VA 22202) on May 28 and 29, 2009 Meet the Agencies Request for Appointment One of the recommendations from the 2008 State of Environmental Justice in America Conference was the introduction of an activity through which participants would have an opportunity to engage in short-but-informative conversations with representatives of various Federal agencies. It was noted that the conference is one of few occasions for many local community participants to obtain an audience with high-level Federal officials. Since one of the stated purposes of the conference is to bring together diverse groups of individuals interested in

365

Electricity Advisory Committee Meeting June 5-6, 2013 | Department of  

Broader source: Energy.gov (indexed) [DOE]

June 5-6, 2013 June 5-6, 2013 Electricity Advisory Committee Meeting June 5-6, 2013 May 15, 2013 - 11:20am Addthis The next meeting of the Department of Energy's Electricity Advisory Committee will be held on Wednesday and Thursday, June 5 and 6, 2013 at the the National Rural Electric Cooperative Association, 4301 Wilson Blvd., Arlington, VA. The final agenda is available; additional materials from including minutes will be posted after the meeting. The Federal Register Notice of the open meeting provides more information on the purpose of the committe and the opportunities for public participation. Addthis Related Articles Open Electricity Advisory Committee Meeting Oct 19-20, 2011 EAC Meeting Cancelled Due to Weather Electricity Advisory Committee Meeting March 5-6, 2012

366

newsletter2.cdr  

Broader source: Energy.gov (indexed) [DOE]

Washington, Washington, DC) on May 27, 2009 Crystal City Doubletree Hotel ( on May 28 and 29 300 Army Navy Drive, Arlington, VA 22202) , 2009 The State of Environmental Justice in America 2009 Conference The State of Environmental Justice in America 2009 Conference May 27-29, 2009 The Third Annual State of Environmental Justice in America Conference will convene at the Howard University School of Law on May 27, and the Crystal City Doubletree Hotel in Crystal City, Virginia, on May 28 and 29. The 2009 conference is moving to larger quarters to provide greater services to participants. This year's conference will concentrate on climate change, community benefits, and youth involvement. The conference continues to bring together participants from Federal agencies, academia, business and industry, non-profit organizations, and faith-based organizations, as well as local community activists

367

TEST - SECRETARY STEVEN CHU'S REMARKS AS PREPARED FOR DELIVERY TO THE DOE TRIBAL SUMMIT  

Broader source: Energy.gov (indexed) [DOE]

Tribal Summit Tribal Summit Secretary Steven Chu Remarks as Prepared for Delivery Thursday, May 5, 2011 Arlington, VA Good morning. Thank you all for joining us today, including those of you watching online. The Obama Administration is committed to strong engagement with Tribal Nations. As a sign of that commitment, you heard from Secretary Vilsack yesterday, and today you will also hear from Secretary Salazar, Administrator Jackson, and White House officials. When I started as Energy Secretary, I made a commitment to hold this summit because it's important to hear directly from you about our shared energy challenges and opportunities. The second commitment I made was to support the Department of Energy's Office of Indian Energy Policy and Programs, which was established under the 2005 Energy Policy Act.

368

newsletter3.cdr  

Broader source: Energy.gov (indexed) [DOE]

2900 2900 Van Ness Street, NW, Washington, D.C. 20008) on May 27, 2009 Crystal City Doubletree Hotel (300 Army-Navy Drive, Arlington, VA 22202) on May 28 and 29, 2009 The State of Environmental Justice in America 2009 Conference The State of Environmental Justice in America 2009 Conference May 27-29, 2009 The Third Annual State of Environmental Justice in America Conference will convene at the Howard University School of Law on May 27, and the Crystal City Doubletree Hotel in Crystal City, Virginia, on May 28 and 29. The 2009 conference is moving to larger quarters to provide greater services to participants. This year's conference will concentrate on climate change, community benefits, and youth involvement. The conference continues to bring together participants from Federal agencies, academia, business and industry, non-profit organizations, and faith-based organizations,

369

Mass-Production Cost Estimation for Automotive Fuel Cell Systems - DOE Hydrogen and Fuel Cells Program FY 2012 Annual Progress Report  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

DOE Hydrogen and Fuel Cells Program FY 2012 Annual Progress Report Brian D. James (Primary Contact), Kevin Baum, Andrew B. Spisak, Whitney G. Colella Strategic Analysis, Inc. 4075 Wilson Blvd. Suite 200 Arlington VA 22203 Phone: (703) 778-7114 Email: bjames@sainc.com DOE Managers HQ: Jason Marcinkoski, Phone: (202) 586-7466 Email: Jason.Marcinkoski@ee.doe.gov GO: Gregory Kleen Phone: (720) 356-1672 Email: Gregory.Kleen@go.doe.gov Contract Number: DE-EE0005236 Project Start Date: September 30, 2011 Project End Date: September 30, 2016 Fiscal Year (FY) 2012 Objectives Update 2011 automotive fuel cell cost model to include * latest performance data and system design information. Examine costs of fuel cell systems (FCSs) for light-duty * vehicle and bus applications.

370

Hydrogen Storage Cost Analysis, Preliminary Results - DOE Hydrogen and Fuel Cells Program FY 2012 Annual Progress Report  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

2 2 DOE Hydrogen and Fuel Cells Program FY 2012 Annual Progress Report Brian D. James (Primary Contact), Andrew B. Spisak, Whitney G. Colella Strategic Analysis, Inc. 4075 Wilson Blvd. Suite 200 Arlington, VA 22203 Phone: (703) 778-7114 E-mail: bjames@sainc.com DOE Managers HQ: Grace Ordaz Phone: (202) 586-8350 Email: Grace.Ordaz@ee.doe.gov GO: Katie Randolph Phone: (720) 356-1759 Email: Katie.Randolph@go.doe.gov Contract Number: DE-EE0005253 Project Start Date: September 30, 2012 Project End Date: September 29, 2016 Fiscal Year (FY) 2012 Objectives Develop cost models of carbon fiber hydrogen storage * pressure vessels. Explore the sensitivity of pressure vessel cost to design * parameters including hydrogen storage quantity, storage

371

Agenda12810 | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

8, 2010 8, 2010 Nuclear Science Advisory Committee (NSAC) NSAC Home Meetings Members Charges/Reports Charter .pdf file (629KB) NP Committees of Visitors NP Home Meetings December 8, 2010 Print Text Size: A A A RSS Feeds FeedbackShare Page DOE/NSF Nuclear Science Advisory Committee Meeting December 8, 2010 Where: Holiday Inn National Airport Hotel, Shenandoah Ballroom I & II, 2650 Jefferson Davis Highway, Arlington, VA, Phone Number: 703-684-7200. Purpose/Topics: Perspectives from Department of Energy and National Science Foundation Update from the Department of Energy and National Science Foundation's Nuclear Physics Offices Technical Talk on F-RIB Presentation of New Charge Public Comment For further information you may contact Brenda May at 301-903-0536 AGENDA December 8, 2010

372

Agenda82108 | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

August 21, 2008 August 21, 2008 Nuclear Science Advisory Committee (NSAC) NSAC Home Meetings Members Charges/Reports Charter .pdf file (629KB) NP Committees of Visitors NP Home Meetings August 21, 2008 Print Text Size: A A A RSS Feeds FeedbackShare Page DOE/NSF Nuclear Science Advisory Committee Meeting August 21, 2008 Where: Marriott Crystal Gateway Hotel, 1700 Jefferson Davis Highway, Arlington, VA. (Crystal City Metro Stop can be accessed from hotel lobby) Telephone Number: 703-920-3230 Purpose/Topics: Perspectives from Department of Energy and National Science Foundation Report on Performance Measures Update on Deep Underground Science and Engineering Laboratory User Facility Reports Update on Fundamental Neutron Physics Beam Public Comment For further information you may contact Brenda May at 301-903-0536

373

DOE Hydrogen Analysis Repository: H2A Case Study: Future Distributed  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Natural Gas Steam Reformer Natural Gas Steam Reformer Project Summary Full Title: H2A Case Study: Future (2025) Natural Gas Steam Reformer (SMR) at Forecourt 1500 kg/day Project ID: 243 Principal Investigator: Brian James Keywords: Hydrogen production; forecourt; distributed; ethanol; steam reforming Purpose The purpose of this analysis is to determine a baseline delivered cost of hydrogen for the forecourt production of hydrogen from ethanol steam reforming. Performer Principal Investigator: Brian James Organization: Directed Technologies, Inc. (DTI) Address: 3601 Wilson Blvd., Suite 650 Arlington, VA 22201 Telephone: 703-243-3383 Email: Brian_James@DirectedTechnologies.com Sponsor(s) Name: Fred Joseck Organization: DOE/EERE/HFCIT Telephone: 202-586-7932 Email: Fred.Joseck@ee.doe.gov

374

OLENDER REPORTING, INC.  

Broader source: Energy.gov (indexed) [DOE]

2 a.m. through 3:34 p.m. 2 a.m. through 3:34 p.m. March 10, 2011 National Rural Electric Cooperative Conference Center 4301 Wilson Boulevard Arlington, VA 22203 OLENDER REPORTING, INC. 1100 Connecticut Ave., NW, Suite 810, Washington, DC 20036 Washington: (202) 898-1108 / Baltimore: (410) 752-3376 Toll Free: (888) 445-3376 2 ELECTRICITY ADVISORY MEMBERS PRESENT: Richard Cowart, Chair Regulatory Assistance Project The Honorable Lauren Azar, Vice Chair Wisconsin Public Utilities Commission Guido Bartels, IBM Rick Bowen, Alcoa Frederick Butler, Retired Salmon Ventures Ltd. and New Jersey Board of Public Utilities (Ret.) The Honorable Robert Curry New York State Public Service Commission José Delgado, Retired American Transmission Company (Ret.)

375

NASA Perspectives on Cryo H2 Storage  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Perspectives on Cryo H2 Perspectives on Cryo H2 Storage DOE Hydrogen Storage Workshop Marriott Crystal Gateway Arlington, VA February 15, 2011 David J. Chato NASA Glenn Research Center Michael P. Doherty NASA Glenn Research Center 2 Objectives Purposes of this Presentation * To show the role of Cryogenics in NASA prior missions * To show recent NASA accomplishments in cryogenic fluid management technology * To highlight the importance of long term cryogenic storage to future NASA missions (especially Human Space flight) 3 What is Cryogenic Fluid Management? 3 The Cartoon Guide to Cryogenic Fluid Management Illustrating Key Concepts in Iconic Form 4 GRC Cryogenic Fluid Management Accomplishments Pioneering cryogenic propellant properties, behavior, and instrumentation studies 1960s-70s 1962-> Centaur

376

OSTI, US Dept of Energy, Office of Scientific and Technical Information |  

Office of Scientific and Technical Information (OSTI)

Open Innovation Enabled by Global Networking of Science and Technical Open Innovation Enabled by Global Networking of Science and Technical Knowledge Slide01 Collaborative Expedition Workshop National Science Foundation, Arlington, VA Walt Warnick, Ph.D. Director, Office of Scientific and Technical Information U.S. Department of Energy Now Loading Open Innovation Enabled by Global Networking of Science and Technical Knowledge Slide02 OSTI Mission To advance science and sustain technological creativity by making R&D findings available and useful to DOE researchers and the public Open Innovation Enabled by Global Networking of Science and Technical Knowledge Slide03 Science progresses as knowledge is shared OSTI Corollary: If the sharing of knowledge is accelerated, then discovery is accelerated "If I have seen further, it is by standing on the shoulders of giants."

377

DOE Hydrogen Analysis Repository: H2A Case Study: Current Distributed  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Natural Gas Steam Reformer Natural Gas Steam Reformer Project Summary Full Title: H2A Case Study: Current (2005) Steam Methane Reformer (SMR) at Forecourt 1500 kg/day Project ID: 236 Principal Investigator: Brian James Keywords: Hydrogen production; forecourt; steam methane reforming; natural gas; distributed Purpose The purpose of this analysis is to determine a baseline delivered cost of hydrogen for the forecourt production of hydrogen from natural gas steam reforming. Performer Principal Investigator: Brian James Organization: Directed Technologies, Inc. (DTI) Address: 3601 Wilson Blvd., Suite 650 Arlington, VA 22201 Telephone: 703-243-3383 Email: Brian_James@DirectedTechnologies.com Sponsor(s) Name: Fred Joseck Organization: DOE/EERE/HFCIT Telephone: 202-586-7932 Email: Fred.Joseck@ee.doe.gov

378

Meeting Materials: April 21, 2008 | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

April 21, 2008 April 21, 2008 Meeting Materials: April 21, 2008 Crystal City Marriott at Reagan National Airport, 1999 Jefferson Davis Highway Arlington, VA 22202 Meeting Agenda Meeting Minutes Presentation: The Global Nuclear Energy Partnership Program by Paul Lisowski Presentation: The Global Nuclear Energy Partnership Status of Industry Engagement by Dan Stout Presentation: Assessment of Plutonium-238 Production Alternatives by Dennis Miotla Presentation: Nuclear Energy R&D Facility Requirements by Paul Kearns & Harold McFarlane Presentation: Global Nuclear Energy Partnership Research and Development Program by Phillip Finck Presentation: NGNP Briefing for NEAC by Thomas J. O'Connor Presentation: The Global Nuclear Energy Partnership From Vision to Reality by Edward McGinnis

379

Buildings Energy Data Book: 7.8 State Building Energy Codes  

Buildings Energy Data Book [EERE]

3 3 Building Energy Rating and Disclosure Policies in the United States Commercial Buildings Commercial Buildings Public Buildings Homes Existing Policy Policy Being Considered Rating Requirement Disclosure Requirement Austin, TX Connecticut Arlington County, VA Alaska California Colorado Denver, CO Austin, TX District of Columbia Illinois Hawaii Kansas New York, NY Maine Michigan Montgomery County, MD San Francisco, CA Maryland Minnesota Nevada Seattle, WA Massachusetts Ohio New York Washington New Mexico West Chester, PA Santa Fe, NM Oregon South Dakota Portland, OR Tennessee Vermont Note(s): Source(s): Map depicts the policy landscape as of March 17, 2011. More information available at www.BuildingRating.org. Institute for Market Transformation, "Rating Policy Map and Timeline."

380

Draft Environmental Impact Statement for a Container System  

Broader source: Energy.gov (indexed) [DOE]

the Navy (Lead Agency) the Navy (Lead Agency) Naval Nuclear Propulsion Program Department of Energy (Cooperating Agency) - DOE/EIS-0251 Prepared in accordance with: National Environmental Policy Act Section 102 (2) (C) FINAL ENVIRONMENTAL IMPACT STATEMENT FOR A CONTAINER SYSTEM FOR THE MANAGEMENT OF NAVAL SPENT NUCLEAR FUEL Contact: William Knoll Department of the Navy Code NAVSEA 08U 2531 Jefferson Davis Highway Arlington, VA 22242-5160 Telephone Number: 703-602-8229 Abstract: This Final Environmental Impact Statement (EIS) addresses six general alternative systems for the loading, storage, transport, and possible disposal of naval spent nuclear fuel following examination. It supersedes the Draft Environmental Impact Statement for a Container System for the Management of Naval Spent Nuclear Fuel dated May 1996.

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

NDIA_PMSC_SurveillanceGuide_Oct2004.doc  

Broader source: Energy.gov (indexed) [DOE]

National Defense Industrial Association (NDIA) National Defense Industrial Association (NDIA) Program Management Systems Committee (PMSC) Surveillance Guide October 2004 Edition © 2004 National Defense Industrial Association (NDIA) Program Management Systems Committee (PMSC). NDIA PMSC Surveillance Guide October 2004 Edition Permission to copy and distribute this document is hereby granted provided that this notice is retained on all copies, that copies are not altered, and that the NDIA PMSC is credited when the material is used to form other copyright policies. National Defense Industrial Association 2111 Wilson Blvd., Suite 400 Arlington, VA 22201 (703) 522-1820 Fax: (703) 522-1885 www.ndia.org NDIA PMSC Surveillance Guide i October 2004 CONTENTS 1 INTRODUCTION

382

Microsoft PowerPoint - [2] Nari Hingorani Slides - HVDC Workshop April 2013  

Broader source: Energy.gov (indexed) [DOE]

Energy's Grid Tech Team Energy's Grid Tech Team Workshop Applications for High Voltage Direct Current (HVDC) Transmission Technologies April 22, 2013 NRECA Conference Center NRECA Conference Center Arlington, VA 22203 Keynote Speaker: Nari Hingorani HVDC Overview Today's HVDC * Power System in general has to be AC, because there is no DC Transformers * Therefore Today's HVDC involves conversion of AC to DC and back to AC * To justify HVDC, there needs to be enough cost or performance benefit to pay for the converters. Hingorani Applications for HVDC * Moving large amounts of power over long distances. * Moving power by cable over moderate to long * Moving power by cable over moderate to long distances. * Moving power between asynchronous systems. * Forcing ordered power into an area Hingorani

383

Case Study - National Rural Electric Cooperative Association Smart Grid Investment Grant  

Broader source: Energy.gov (indexed) [DOE]

National Rural Electric Cooperative Association Smart Grid Investment Grant National Rural Electric Cooperative Association Smart Grid Investment Grant 1 Helping America's Electric Cooperatives Build a Smarter Grid to Streamline Operations and Improve Service Electric cooperatives play an important role in the U.S. energy infrastructure, delivering electricity to 44 million consumers across over 70% of the geography of the country every day. Implementing smart grid technology is seen by co-ops as a cost-effective way to improve reliability, streamline the restoration of electricity following outages and improve customer service. At the National Rural Electric Cooperative Association (NRECA), an Arlington, VA-based organization that provides services to more than 900 not- for-profit electric cooperatives nationwide, work is underway to study the impacts of smart grid

384

Electricity Advisory Committee Meeting  

Broader source: Energy.gov (indexed) [DOE]

June 5 and 6, 2013 June 5 and 6, 2013 NRECA Building, Arlington, VA 1 Wednesday, June 5, 2013 12:00 to 1:00 pm EAC Leadership Committee Meeting 12:00 to 1:00 pm Registration Public Signups for Comments on Day 2 1:00 to 1:15 pm Welcome and Developments since our October 2012 Meeting Sonny Popowsky, EAC Vice Chair and David Meyer, EAC Designated Federal Officer 1:15 to 1:45 pm Update on the U.S. Department of Energy (DOE), Office of Electricity Delivery and Energy Reliability's (OE) 2013 Programs and Initiatives Honorable Patricia Hoffman, Assistant Secretary for Electricity Delivery and Energy Reliability, U.S. Department of Energy 1:45 to 2:35 pm EAC Race to the Top Initiative Working Group Discussion Sonny Popowsky, Working Group Chair

385

Electricity Advisory Committee Meeting  

Broader source: Energy.gov (indexed) [DOE]

March 6 and 7, 2013 March 6 and 7, 2013 NRECA Building, Arlington, VA 1 March 6, 2013 12:15 to 1:15 pm EAC Leadership Committee Meeting 12:15 to 1:15 pm Registration Public Signups for Comments on Day 2 1:15 to 1:30 pm Welcome and Developments since our October 2012 Meeting Richard Cowart, EAC Chair and David Meyer, EAC Designated Federal Officer 1:30 to 2:00 pm Update on the U.S. Department of Energy (DOE), Office of Electricity Delivery and Energy Reliability's (OE) 2013 Programs and Initiatives Honorable Patricia Hoffman, Assistant Secretary for Electricity Delivery and Energy Reliability, U.S. Department of Energy 2:00 to 2:30 pm Briefing on Special DOE Initiative: Race to the Top Holmes Hummel, U.S. Department of Energy 2:30 to 2:50 pm EAC Member Discussion of DOE's Race to the Top Initiative

386

untitled  

Broader source: Energy.gov (indexed) [DOE]

April 29, 2009 April 29, 2009 Crystal City Marriott at Reagan National Airport 1999 Jefferson Davis Highway * Arlington, VA 22202 April 29, 2009 9:00 a.m. Welcome and Overview * James Ajello, EMAB Chair 9:15 a.m. EM Program Update * Inés R. Triay, Acting Assistant Secretary for Environmental Management 9:45 a.m. Roundtable Discussion * Discussion Leader: James Ajello, Chair 10:15 a.m. Strategic Initiatives * Discretionary Budgeting and EM Footprint Reduction - Merle Sykes, Deputy Assistant Secretary for Program Planning and Budget * Energy Parks Initiative - Mark Gilbertson, Deputy Assistant Secretary for Engineering and Technology 10:45 a.m. Roundtable Discussion * Discussion Leaders: Dennis Ferrigno, Vice Chair 11:15 a.m. Break 11:30 a.m.

387

Page not found | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

71 - 29680 of 31,917 results. 71 - 29680 of 31,917 results. Download NA-54 IPR Production http://energy.gov/management/downloads/na-54-ipr-production Download Before the Senate Energy and Natural Resources Committee Subject: Nomination Hearing By: Jose Antonio Garcia, Nominee, Director, Office of Minority Economic Impact http://energy.gov/congressional/downloads/senate-energy-and-natural-resources-committee-36 Download U.S. Department of Energy Electricity Advisory Committee Meeting Agenda, October 29, 2010 Agenda for the October 29, 2010 meeting of the U.S. Department of Energy Electricity Advisory Committee in Arlington VA. http://energy.gov/oe/downloads/us-department-energy-electricity-advisory-committee-meeting-agenda-october-29-2010 Download Pensacola Smart Grid RFI Addressing Policy and Logistical

388

DOE Hydrogen Analysis Repository: Evaluation of Energy Recovery Act Fuel  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Evaluation of Energy Recovery Act Fuel Cell Initiative Evaluation of Energy Recovery Act Fuel Cell Initiative Project Summary Full Title: Evaluation of U.S. DOE Energy Recovery Act Fuel Cell (Technologies Program) Initiative (ARRA-FCI) Project ID: 284 Principal Investigator: Brian James Brief Description: An evaluation was conducted to assess the early stage "market change" impacts of the Fuel Cell (Technologies Program) Initiative of the American Recovery and Reinvestment Act (ARRA-FCI) to accelerate fuel cell deployment and commercialization. Performer Principal Investigator: Brian James Organization: Strategic Analysis, Inc. Address: 4075 Wilson Blvd. Suite 200 Arlington, VA 22203 Telephone: 703-778-7114 Email: bjames@sainc.com Sponsor(s) Name: Fred Joseck Organization: DOE/EERE/FCTO Telephone: 202-586-7932

389

PEMFC R&D at the DOE Fuel Cell Technologies Program  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

FUEL CELL TECHNOLOGIES PROGRAM DOD/DOE Shipboard Fuel Cell Workshop PEMFC R&D at the DOE Fuel C ll T h l i P Dr. Dimitrios Papageorgopoulos Fuel Cell Technologies Program Cell Technologies Program Fuel Cell Technologies Program U.S. Department of Energy Fuel Cells Team Leader March 29, 2011 Arlington, VA - - Key Challenges The Program has been addressing the key challenges facing the widespread The Program has been addressing the key challenges facing the widespread commercialization of fuel cells. commercialization of fuel cells. Fuel Cell Cost & Durability nology iers* Targets*: Stationary Systems: $750 per kW, 40,000-hr durability Vehicles: $30 per kW, 5,000-hr durability Technology Validation:

390

OLENDER REPORTING, INC. 1100 Connecticut Ave., NW, Suite 810, Washington, DC  

Broader source: Energy.gov (indexed) [DOE]

100 Connecticut Ave., NW, Suite 810, Washington, DC 100 Connecticut Ave., NW, Suite 810, Washington, DC 20036 Washington: (202) 898-1108 / Baltimore: (410) 752-3376 Toll Free: (888) 445-3376 1 Electricity Advisory Committee Meeting 8:33 a.m. through 2:49 p.m. October 29, 2010 OLENDER REPORTING, INC. 1100 Connecticut Ave., NW, Suite 810, Washington, DC 20036 Washington: (202) 898-1108 / Baltimore: (410) 752-3376 Toll Free: (888) 445-3376 2 National Rural Electric Cooperative Conference Center 4301 Wilson Boulevard Arlington, VA 22203 OLENDER REPORTING, INC. 1100 Connecticut Ave., NW, Suite 810, Washington, DC 20036 Washington: (202) 898-1108 / Baltimore: (410) 752-3376 Toll Free: (888) 445-3376 3 ELECTRICITY ADVISORY MEMBERS PRESENT: Richard Cowart

391

Effects of Technology Cost Parameters on Hydrogen Pathway Succession - DOE Hydrogen and Fuel Cells Program FY 2012 Annual Progress Report  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

5 5 FY 2012 Annual Progress Report DOE Hydrogen and Fuel Cells Program Mark F. Ruth* (Primary Contact), Victor Diakov*, Brian James † , Julie Perez ‡ , Andrew Spisak † *National Renewable Energy Laboratory 15013 Denver West Pkwy. Golden, CO 80401 Phone: (303) 817-6160 Email: Mark.Ruth@nrel.gov and Victor.Diakov@nrel.gov † Strategic Analysis, Inc. ‡ New West Technologies DOE Manager HQ: Fred Joseck Phone: (202) 586-7932 Email: Fred.Joseck@ee.doe.gov Subcontractor: Strategic Analysis, Inc., Arlington, VA Project Start Date: February 1, 2009 Project End Date: October 31, 2011 Fiscal Year (FY) 2012 Objectives Develop a macro-system model (MSM): * Aimed at performing rapid cross-cutting analysis - Utilizing and linking other models - Improving consistency between models -

392

Ultra-Deepwater Advisory Committee  

Broader source: Energy.gov (indexed) [DOE]

Ultra-Deepwater Advisory Committee Ultra-Deepwater Advisory Committee Minutes of Meeting of June 21, 2007 Crystal City Marriott, Arlington, VA Executive Session Bill Hochheiser, the Committee Management Officer (CMO), welcomed the Ultra- Deepwater Advisory Committee (hereafter referred to as the Committee) at 8:35 a.m. on June 21, 2007. Bill noted that he shared the CMO responsibilities with Elena Melchert but, although she was not able to attend the meeting, she sent her regards to the Committee members. The Agenda for the meeting and Committee Member Sign-in sheet are provided as Appendix 1 and Appendix 2, respectively. After appointment and administration of Oath of Office for special Government employees, the Committee was briefed on conflict of interest statutes and the

393

OLENDER REPORTING, INC.  

Broader source: Energy.gov (indexed) [DOE]

1 a.m. through 4:23 p.m. 1 a.m. through 4:23 p.m. July 12, 2011 National Rural Electric Cooperative Conference Center 4301 Wilson Boulevard Arlington, VA 22203 OLENDER REPORTING, INC. 1100 Connecticut Ave., NW, Suite 810, Washington, DC 20036 Washington: (202) 898-1108 / Baltimore: (410) 752-3376 Toll Free: (888) 445-3376 2 ELECTRICITY ADVISORY MEMBERS PRESENT: Richard Cowart, Chair Regulatory Assistance Project The Honorable Lauren Azar, Vice Chair Wisconsin Public Utilities Commission Rick Bowen, Alcoa Frederick Butler, Retired Salmon Ventures Ltd. and New Jersey Board of Public Utilities (Ret.) Ralph Cavanaugh Natural Defense Resources Council Lisa Crutchfield National Grid USA The Honorable Robert Curry New York State Public Service Commission

394

PowerPoint Presentation  

Broader source: Energy.gov (indexed) [DOE]

Area: Resource Adequacy Area: Resource Adequacy Reliability and Markets: Project 3A Long-term Planning and Investment for Transmission and Generation Tim Mount, Cornell University Fernando Alvarado, U. of Wisconsin 18 October 2006 Arlington, VA OE Visualization and Controls Peer Review Page 2 2 OUTLINE Maintaining Generation Adequacy Missing Money and Capacity Markets. Co-Optimization in Markets for Energy and Reserves. Testing the Forward Capacity Market in New England. Economic Cost of Congestion Increasing Transmission Congestion due to Voltage. Modeling the Financial Risk of Spatial Price Differences. New Responsibilities for FERC in EPAct05. Summary and Outreach to Stakeholders Publications Collaboration with System Operators Next steps Page 3 3 Source: "2005 NERC Long-Term Reliability Assessment", Fig. 4

395

Microsoft Word - HVDC Workshop Agenda - Final  

Broader source: Energy.gov (indexed) [DOE]

US Department of Energy's Grid Tech Team US Department of Energy's Grid Tech Team hosts Applications for High-Voltage Direct Current Transmission Technologies April 22, 2013 NRECA Conference Center 4301 Wilson Blvd. Arlington, VA 22203 Objective This workshop is aimed at developing a better understanding of the potential for High Voltage Direct Current (HVdc) transmission technologies and its application in the North American electric grid. Through a series of case studies and group discussions, DOE would like to identify the state-of-the-art for HVdc transmission technologies, including performance and benefits. The workshop will also discuss technical and institutional barriers to greater deployment and possible opportunities to address those barriers. Background The advantages of HVdc transmission over conventional High Voltage Alternating Current

396

Document  

Broader source: Energy.gov (indexed) [DOE]

197 Federal Register 197 Federal Register / Vol. 74, No. 117 / Friday, June 19, 2009 / Notices Instructions: All submissions received must include the agency name, docket number and title for this Federal Register document. The general policy for comments and other submissions from members of the public is to make these submissions available for public viewing on the Internet at http:// www.regulations.gov as they are received without change, including any personal identifiers or contact information. DoD Clearance Officer: Ms. Patricia Toppings. Written requests for copies of the information collection proposal should be sent to Ms. Toppings at WHS/ESD/ Information Management Division, 1777 North Kent Street, RPN, Suite 11000, Arlington, VA 22209-2133. Dated: May 31, 2009.

397

Helen Gordon Child Development Center WAITLIST APPLICATION  

E-Print Network [OSTI]

____ Zip Code________ Cell Phone _______________ Other Phone ________________ E ____ Zip Code________ Cell Phone _______________ Other Phone ________________ E

Lafferriere, Gerardo

398

MEDICAL ENTRANCE FORM (REQUIRED) UNDER 18 YEARS OF AGE ONLY  

E-Print Network [OSTI]

: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ____________ Daytime phone: _________________ Evening phone: _________________ Email

Weitz, Joshua S.

399

File:EIA-Appalach6-WV-VA-LIQ.pdf | Open Energy Information  

Open Energy Info (EERE)

LIQ.pdf LIQ.pdf Jump to: navigation, search File File history File usage Appalachian Basin, Southern West Virginia and Southwestern Virginia By 2001 Liquids Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 18.77 MB, MIME type: application/pdf) Description Appalachian Basin, Southern West Virginia and Southwestern Virginia By 2001 Liquids Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States West Virginia, Virginia File history Click on a date/time to view the file as it appeared at that time.

400

JONATHAN V. L. KISER, M.B.A. President, Kiser Environmental Consulting, Harrisonburg, VA 22801  

E-Print Network [OSTI]

Economics and Public Policy, George Washington U., 1992 B.S., Resource Economics, University of New Hampshire, 1980. PROFESSIONAL AFFILIATIONS Solid Waste Association of North America (SWANA) Columbia Waste Services Association Staff Alumni & former Manager with National Solid Wastes Mgt. Association

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Review: Lenka Va?kov et al.: Emotionalitt in deutschen und tschechischen Medientexten  

E-Print Network [OSTI]

?? ? ????????????????????????????????????? ?????????????? (Emotionsdarstel lung in Leserbriefen im deutschtsche chischen Vergleich???????????????????? 1 ?????????????????????????????????????????????????????????Ausdrucksmittel der Emotio nalitt im deutsch...

Jesenek, Vida

2014-02-03T23:59:59.000Z

402

FEBRUARY Results 24--Danville College Danville, VA 1:00 DH L 9-15  

E-Print Network [OSTI]

-5 W 13-2 10-- Southern State College Newark, OH 3:00 DH W 8-7 W 18-4 13-- Lorain College Newark, OH 1-- Lorain College Elyria, OH 1:00 DH W 7-0 W 18-5 21-- Miami University Middletown © Newark, OH 1:00 DH W 7

403

Building an optimal portfolio using a mean-VaR framework  

Science Journals Connector (OSTI)

The area of finance has been a continuous source of challenging problems that have influenced research efforts on analytical and numerical solution methods for complex decision problems. In this paper we propose an original algorithm for portfolio optimization. ... Keywords: estimation, optimization, principal components analysis, risk, selection of assets, value at risk

Florentin ?erban; Maria Viorica ?tef?nescu; Silvia Dedu

2011-11-01T23:59:59.000Z

404

VA Palo Alto Stanford University STANFORD BIOMOTION LAB STUDY DRIVING DIRECTIONS  

E-Print Network [OSTI]

parking is located at Santa Teresa and Samuel Morris Parking Structure at Panama and Via Ortega: From 101 on Campus Drive 4. Turn left on Panama 5. Parking structure with visitor parking is located at Panama on Campus Drive *West* 4. Turn right on Panama 5. Parking structure with visitor parking is located

Stanford University

405

Communication and Collaboration Keep San Francisco VA Medical Center Project on Track  

Broader source: Energy.gov [DOE]

The Veterans Affairs Medical Center in San Francisco is saving almost 3 million kilowatt-hours of electricity, more than 70,000 therms of natural gas, and more than $500,000 annually. The energy savings are enough to power 400 homes and supply natural gas to more than 100 homes each year in California. These savings were realized by taking advantage of Super Energy Savings Performance Contracts (Super ESPCs) developed by the U.S. Department of Energy's Federal Energy Management Program (FEMP).

406

Requisitos de Postulacin La postulacin deber realizarse por va electrnica o  

E-Print Network [OSTI]

Clases: Marzo. Duración: 18 meses. Tiempo de Dedicación: Jornada Vespertina. Becas OMC y WTI: Otorgadas

Rapaport, Iván

407

E-Print Network 3.0 - amplicon va derived Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

7 0021-91930204.00 0 DOI: 10.1128JB.184.7.18731879.2002 Summary: . However, two primer pairs derived from strain EDL933 failed to yield an amplicon with strain 86... -24,...

408

MARTIN H. DAVIES Department of Economics Washington and Lee University Lexington, VA 24450 USA  

E-Print Network [OSTI]

, and Technology Transfer Supervisor: J. Peter Neary Examiners: Richard Baldwin (external), Simon Cowan (internal; Paper: Technology Transfer and North-South Trade US International Trade Commission, Washington DC, 20, 2011; Paper presented: Technology Transfer and North-South Trade Midwest International Economics Group

Marsh, David

409

Appears in Proc. Third International Workshop on Self Adaptive Software Rosslyn, VA, June 2003  

E-Print Network [OSTI]

Honeywell Laboratories musliner@htc.honeywell.com Robert P. Goldman SIFT, LLC rpgoldman@sift.info Kurt D

Krebsbach, Kurt D.

410

Naval Station Norfolk, VA- Energy Conservation Program UESC Partnership Success Story  

Broader source: Energy.gov [DOE]

Presentationgiven at the Federal Utility Partnership Working Group (FUPWG) Fall 2008 meetingcovers the basis for success of a U.S. Navy utility energy service contract (UESC) project at a Naval Station in Norfolk, Virginia, including the project phases and why the utility partnership works.

411

E-Print Network 3.0 - aspire-va pilot study Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Carolina State University Collection: Engineering 45 Case studies from the Vital Wave mHealth Report Richard Anderson1 and Noah Perin, November, 2009 Summary: Case studies from...

412

E-Print Network 3.0 - alphavirus vector va7 Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

virus (40). Alphaviruses... of Marine Mammals: a New Alphavirus Isolated from the Elephant Seal Louse, Lepidophthirus macrorhini MAY LA... Accepted 29 January 2001 A novel...

413

A VaR Black-Litterman Model for the Construction of Absolute ...  

E-Print Network [OSTI]

rithmic technique is very efficient, outperforming, in terms of both speed and ..... It can be seen that the error term vector ? does not directly enter the Black-

2009-06-02T23:59:59.000Z

414

E-Print Network 3.0 - absorption va vibrational Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of a protein, which deviate only... direct insights into the reaction mechanism at the atomic level. Absorption spectrum of a protein... In Figure 1 a typical absorption...

415

E-Print Network 3.0 - aftab-gardan va soya Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

(B40). Among four available emissions (CO, ... Source: Kuhl, Michael E. - Department of Industrial and Systems Engineering, Rochester Institute of Technology Collection:...

416

V&A Medieval & Renaissance Galleries: A Passive Approach to Humidity Control  

E-Print Network [OSTI]

the existing fabric, where possible taking advantage of original chimneys and trenches. Addressing sustainability in the project required the balancing and optimisation of a range of issues that had the potential to create conflicts; artefact conservation... proportion of the time, around 7% of the occupied hours or 3 and a half weeks. This is because solar gain, occupancy load and the lighting load act to heat the space up in the morning. Eliminating low humidity levels entirely is difficult due...

Lerpiniere, A.

2011-01-01T23:59:59.000Z

417

Case Study- The Department of Veterans Affairs West Haven Campus, VA Connecticut Health Care System  

Broader source: Energy.gov [DOE]

The West Haven (Connecticut) Campus of the Veterans Affairs Connecticut Health Care System was the first Veteran's Hospital to award a shared energy savings (SES) contract (now known as energy savings performance contracts). The project involves replacement of the lighting system, installation of a cooling system, maintenance of the new chiller equipment, and several smaller efforts. Up-front costs are being provided through a $3.9 million investment by the contractor, EUA Cogenex, about $400,000 in rebates from the local utilities for gas and electric service (Southern Connecticut Gas and United Illuminating Company, respectively), and guaranteed energy cost savings over the life of the contract. The Government's share of energy savings over the 16 year contract is expected to be $880,000.

418

Energy Department Recognizes City of Roanoke, VA for Leadership in Better Buildings Challenge  

Office of Energy Efficiency and Renewable Energy (EERE)

As part of the Obama Administrations effort to cut energy waste in the nations buildings, the Energy Department today recognized the city of Roanoke, Virginia for its leadership.

419

POLARIZED TARGETS AND BEAMS PARALLEL SESSION Je erson Lab, Newport News, VA23606, USA  

E-Print Network [OSTI]

targets, D. Crabb Virginia re- ported the progress at Je erson Lab on the polarized solid targets. New developments and improvements are still emerging to meet the increasing demand of this eld at a certain temperature T, the energy split of the di erent particle spin states depends on B kT, where

420

Microsoft Word - Moving to a Clean Energy Economy-VA 9 24 09.doc  

Broader source: Energy.gov (indexed) [DOE]

Virginia Virginia United States Department of Energy September 24, 2009 2 OVERVIEW: VIRGINIA HAS MAJOR ECONOMIC OPPORTUNITIES IN A CLEAN ENERGY ECONOMY The threat of climate change caused by carbon pollution poses a major challenge to the United States and the world, but it also represents an unprecedented opportunity to create new industries and build a strong, thriving clean energy economy. The clean energy sector is one of the fastest growing industries in the world -- the demand for solar panels and wind turbines, for example, has been growing exponentially over the past few years. Among industrialized nations, the race is on for the clean energy jobs of the future. China is investing $12.6 million per hour in clean energy. Denmark has made significant investments in wind capacity and is now

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

Cost-Effective Energy Efficiency Measures for Above Code(ASHRAE 90.1-2001 and 2007) Small Restaurant Buildings in the City of Arlington  

E-Print Network [OSTI]

error-free. Reference herein to any specific commercial product, process, or service by trade name, trademark, manufacturer, or otherwise, does not constitute or imply its endorsement, recommendation, or favoring by the Energy Systems Laboratory or any....2 17 Demand Control Ventilation System 25.6% 14.3% $2,593 1.8% $43 $2,637 $737 - $1,105 0.3 - 0.4 E Service Hot Water Heater Measures 18 Improved Eff iicency for Service Water Heaters (From Et 80% to Et 95%) 2.7% 1.3% $225 0.0% $0 $225 $342 - $513 1...

Mukhopadhyay, J.; Kim, H.; Do, S.; Kim, K.H.; Baltazar, J.C.; Haberl, J.; Lewis, C.

422

Cost-Effecitive Energy Efficiency Measure for Above 2003 and 2009 IECC Code-Compliant Residential and Commercial Buildings in the City of Arlington  

E-Print Network [OSTI]

payback calculations. Figure 1 through Figure 4 present a description of the individual measures and combinations of these measures which achieve 15% savings above the 2003 and 2009 IECC code-compliant house. Annual energy savings, estimated costs..., simple payback, and NOx, SO2, and CO2 emissions reduction are provided. CoA Residential Project, p.iii July 2011 Energy Systems Laboratory, Texas A&M University Figure 1. Individual and Combined Energy Efficiency Measures for 2003 IECC Code-Compliant...

Kim, H.; Do, S.; Baltazar, J.C.; Haberl, J.; Lewis, C.

423

Cost-Effective Energy Efficiency Measures for Above Code (ASHRAE 90.1-2001 and 2007) Restaurant Buildings in the City of Arlington  

E-Print Network [OSTI]

#1; 5,500 ft2, one- story, building Dining space modeled (4,000 ft2) #1; Steel frame construction #1; 35% WWR for front wall only (17% WWR for an entire building) #1; Packaged rooftop air conditioner (CAV, DX, gas furnace) ASHRAE 2001...: Table 4, Deru et al. (2011), ASHRAE 62.1 (70 people / 1000 sqft) Outside Air Dining: 20cfm/person5350 cfm Dining: 7.5 cfm/person+0.18cfm/sqft 2720 cfm ASHRAE 62.1 2001 ASHRAE 62.1 2007 Air Infiltration Rate Sec 3.2.2.5, Hale et al. 2008 Thermostat...

2011-01-01T23:59:59.000Z

424

Cost-Effective Energy Efficiency Measures for Above Code (ASHRAE 90.1-2001 and 2007) Small Retail Buildings in the City of Arlington  

E-Print Network [OSTI]

Control 7.4% 10.1% $2,011 12.8% $402 $2,413 $15,723 - $23,584 6.5 - 9.8 15 Sky light (3% SRR, U-0.34 & 0.19 SHGC) w ith Dimming Control 15.3% 21.9% $4,369 25.1% $789 $5,158 $55,700 - $83,550 10.8 - 16.2 E Renewable Power Measure 16 28 kW Photovoltaic... Roof and Wall Insulation R-Value (from 15 to 25 for roof and none to 11.4c.i. for walls) 174.6 118.6 413.5 120.7 28.8 856.2 2,240 162.1 13.8% 6.6% $1,066 $22,832 - $34,248 20.2 - 30.3 2 Decreased Glazing U-Value (from 1.22 to 0.35) 185.4 186.5 413...

Do, S.; Baltazar, J.C.; Haberl, J.; Lewis, C.; Kim, K.H.; Kim, H.

425

Cost-Effective Energy Efficiency Measures for Above Code(ASHRAE 90.1-2001 and 2007) Small Office Buildings in the City of Arlington  

E-Print Network [OSTI]

Office Building] Description of Individual Measures Site Source A Envelope and Fenestration Measures 1 Increased Roof and Wall Insulation R-Value (from 15 to 25 for roof and 13 to 13+3.8c.i. for w alls) 1.9% 1.1% $163 0.5% $16 $179 $14,332 - $21....3 - 5.0 15 Daylight Dimming Control 6.4% 8.7% $1,733 11.9% $409 $2,141 $15,723 - $23,584 7.3 - 11.0 16 Automatic Receptacle Control for Off ices using Occupancy Sensors 1.7% 2.3% $466 3.2% $109 $575 $7,587 - $11,380 13.2 - 19.8 E Renewable Power...

Kim, H.; Do, S.; Kim, K.H.; Baltazar, J.C.; Haberl, J.S.; Lewis, C.

426

engineering home news home press releases subscribe to e-news annual re UT Arlington Moving Ideas from Laboratories to Marketplace  

E-Print Network [OSTI]

reserves for Texas lignite at current consumption rates. The Texas Ignition Fund grant will help create. Liquefaction of Texas Lignite to Low-cost Heavy Crude Oil Mechanical Engineering Assistant Professor Brian. Richard Billo have been funded to develop a low-cost process to convert lignite coal into heavy crude oil

Chiao, Jung-Chih

427

Document1  

Broader source: Energy.gov (indexed) [DOE]

Partner Partner Location Projected DOE Funding Projected Partner Funding Northern Power Systems Waitsfield, VT 5,641,927 2,655,000 GE Global Research Niskayuna, NY 8,000,000 19,587,872 Valmont Industries Omaha, NE 1,973,445 1,315,629 TPI Composites, Inc. Warren, RI 1,999,182 856,792 Clipper Windpower Carpinteria, CA 626,875 268,661 HITCO Carbon Composites Gardena, CA 1,836,129 555,000 Tennessee Valley Infrastructure Chattanooga, TN 2,000,000 1,040,738 GE Global Research Niskayuna, NY 1,995,042 1,995,040 Genesis Horsham, PA 1,153,507 494,360 Knight and Carver National City, CA 1,999,609 856,975 QinetiQ Arlington, VA 117,406 90,000 Behnke, Erdman, and Whitaker Livermore, CA 197,656 Massachusetts Institute of Tech. Cambridge, MA 198,920 AWS Scientific Albany, NY 200,000 400,000 New Generation Motors Ashburn, VA

428

The Excel model for Beta testing is available for download at http://www.ornl.gov/HTSC/pdf/HTSMarketBeta.zip. Please provide feedback or  

E-Print Network [OSTI]

-1 APPENDIX 2 MARKET PENETRATION MODEL 2-1 APPENDIX 3 U.S. ELECTRICAL SYSTEM LOSS ANALYSIS 3-1 APPENDIX 4 LOAD OF TRANSMISSION LOSSES 9-1 APPENDIX 10 ELECTRICITY USED IN LARGE ELECTRIC MOTORS 10-1 APPENDIX 11 REPLACEMENT RATE is large. Using a conventional market-penetration model with parameters typical of the electric

429

Molecular Characterization of the PEND Protein, a Novel bZIP Protein Present in the Envelope Membrane That Is the Site of Nucleoid Replication in Developing Plastids  

Science Journals Connector (OSTI)

...migrates as a 130-kD polypeptide during lithium dodecyl sulfate (LDS)-PAGE and binds...Bedford, MA). The protein was analyzed by lithium dodecyl sulfate (LDS)-PAGE and then...as indicated. x8 indicates eightfold excess over the probe. Plus and minus signs...

Naoki Sato; Kimihisa Ohshima; Ai Watanabe; Niji Ohta; Yoshitaka Nishiyama; Jacques Joyard; Roland Douce

430

The Arabidopsis NPR1/NIM1 Protein Enhances the DNA Binding Activity of a Subgroup of the TGA Family of bZIP Transcription Factors  

Science Journals Connector (OSTI)

...the LS5 probe and a 10-fold excess of various mutant oligonucleotides...binding specificity, a 10-fold excess of cold wild-type or mutant...cells were transformed using a lithium acetate-based protocol and...to 3). A 10-fold molar excess of mutant as-1 (lane 2...

Charles Després; Catherine DeLong; Sarah Glaze; Enwu Liu; Pierre R. Fobert

431

UV-B-Responsive Association of the Arabidopsis bZIP Transcription Factor ELONGATED HYPOCOTYL5 with Target Genes, Including Its Own Promoter  

Science Journals Connector (OSTI)

...response to UV-B are unclear. In order to test whether UV-B specifically affects the...and Is Negatively Regulated by RUP2 To test whether the UV-B-enhanced association...We performed two lines of experiments to test our hypothesis that HY5 and/or its homolog...

Melanie Binkert; László Kozma-Bognár; Kata Terecskei; Lieven De Veylder; Ferenc Nagy; Roman Ulm

2014-10-28T23:59:59.000Z

432

Development and comparison of algorithms for generating a scan sequence for a random access scanner. [ZAP (and flow charts for ZIP and SCAN), in FORTRAN for DEC-10  

SciTech Connect (OSTI)

Many data acquisition systems incorporate high-speed scanners to convert analog signals into digital format for further processing. Some systems multiplex many channels into a single scanner. A random access scanner whose scan sequence is specified by a table in random access memory will permit different scan rates on different channels. Generation of this scan table can be a tedious manual task when there are many channels (e.g. 50), when there are more than a few scan rates (e.g. 5), and/or when the ratio of the highest scan rate to the lowest scan rate becomes large (e.g. 100:1). An algorithm is developed which will generate these scan sequences for the random access scanner and implements the algorithm on a digital computer. Application of number theory to the mathematical statement of the problem led to development of several algorithms which were implemented in FORTRAN. The most efficient of these algorithms operates by partitioning the problem into a set of subproblems. Through recursion they solve each subproblem by partitioning it repeatedly into even smaller parts, continuing until a set of simple problems is created. From this process, a pictorial representation or wheel diagram of the problem can be constructed. From the wheel diagram and a description of the original problem, a scan table can be constructed. In addition, the wheel diagram can be used as a method of storing the scan sequence in a smaller amount of memory. The most efficient partitioning algorithm solved most scan table problems in less than a second of CPU time. Some types of problems, however, required as much as a few minutes of CPU time. 26 figures, 2 tables.

Eason, R. O.

1980-09-01T23:59:59.000Z

433

UV-B-Responsive Association of the Arabidopsis bZIP Transcription Factor ELONGATED HYPOCOTYL5 with Target Genes, Including Its Own Promoter  

Science Journals Connector (OSTI)

...Plant Biology, University of Geneva, Sciences III, CH-1211 Geneva 4, Switzerland...Research Centre of the Hungarian Academy of Sciences, H-6726 Szeged, Hungary c Department...Ghent, Belgium e School of Biological Sciences, University of Edinburgh, EH9 3JR Edinburgh...

Melanie Binkert; László Kozma-Bognár; Kata Terecskei; Lieven De Veylder; Ferenc Nagy; Roman Ulm

2014-10-28T23:59:59.000Z

434

Physician Name Phone Fax Street Suite City State Zip Specialty ABACI,ASLI 585-271-0444 585-271-1464 980 WESTFALL RD ROCHESTER NY 14619  

E-Print Network [OSTI]

-000-0000 955 E 11400 S SANDY UT 84094 ABBISI,SAIFY A 814-642-7205 814-642-9189 45 PINE STREET PORT ALLEGANY PA

Goldman, Steven A.

435

THE PERRYMAN GROUP 510 N. Valley Mills Dr., Suite 300  

E-Print Network [OSTI]

THE PERRYMAN GROUP 510 N. Valley Mills Dr., Suite 300 Waco, TX 76710 ph. 254.751.9595, fax 254 by The Perryman Group Introduction The University of Texas at Arlington (UT Arlington or UTA) has long been

Huang, Haiying

436

Integration of Non-Traditional Membranes into MEAs  

Broader source: Energy.gov [DOE]

Presented at the 2009 High Temperature Membrane Working Group Meeting held May 18, 2009, in Arlington, Virginia

437

Procedure for Performing PEM Single Cell Testing  

Broader source: Energy.gov [DOE]

Presented at the 2009 High Temperature Membrane Working Group Meeting held May 18, 2009, in Arlington, Virginia

438

Procedure for Performing In-Plane Membrane Conductivity Testing  

Broader source: Energy.gov [DOE]

Presented at the 2009 High Temperature Membrane Working Group Meeting held May 18, 2009, in Arlington, Virginia

439

MEA Fabrication  

Broader source: Energy.gov [DOE]

Presented at the 2009 High Temperature Membrane Working Group Meeting held May 18, 2009, in Arlington, Virginia

440

Automotive Perspective on PEM Evaluation  

Broader source: Energy.gov [DOE]

Presented at the 2009 High Temperature Membrane Working Group Meeting held May 18, 2009, in Arlington, Virginia

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

HTMWG, May 18, 2009, Welcome!  

Broader source: Energy.gov [DOE]

Presented at the 2009 High Temperature Membrane Working Group Meeting held May 18, 2009, in Arlington, Virginia

442

Agenda: High Temperature Membrane Working Group Meeting  

Broader source: Energy.gov [DOE]

Agenda for the High Temperature Membrane Working Group (HTMWG) meeting on May 18, 2009, in Arlington, Virginia

443

USET Impact Week Meeting  

Broader source: Energy.gov [DOE]

The United South and Eastern Tribes (USET) is hosting impact week in Arlington, Virginia, Feb. 9-11, 2015.

444

Stichting Triodos PV Partners defunct | Open Energy Information  

Open Energy Info (EERE)

Stichting Triodos PV Partners defunct Stichting Triodos PV Partners defunct Jump to: navigation, search Name Stichting Triodos PV Partners - defunct Place Arlington, Virginia Zip 22209 Product Stichting Triodos PV Partners, a JV Triodos Bank Group, Environmental Enterprises Assistance Fund, & Global Transition Consulting, was wound up and the management of the SDC fund was transferred back to Triodos. Coordinates 43.337585°, -89.379449° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.337585,"lon":-89.379449,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

445

Pew Center on Global Climate Change | Open Energy Information  

Open Energy Info (EERE)

Pew Center on Global Climate Change Pew Center on Global Climate Change Jump to: navigation, search Name Pew Center on Global Climate Change Place Arlington, Virginia Zip 22201 Product Established in 1998 as a non-profit, non-partisan and independent organisation aiming to provide unbiased information and solutions in the efforts to tackle climate change. Coordinates 43.337585°, -89.379449° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.337585,"lon":-89.379449,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

446

Value Added Energy Information Systems VAEIS | Open Energy Information  

Open Energy Info (EERE)

Value Added Energy Information Systems VAEIS Value Added Energy Information Systems VAEIS Jump to: navigation, search Name Value Added Energy Information Systems (VAEIS) Place Arlington, New Hampshire Zip 2474 Sector Solar, Wind energy Product Provides turn-key monitoring systems for the performance of solar, wind, fuel cell and other distributed generation installations. Coordinates 43.337585°, -89.379449° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.337585,"lon":-89.379449,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

447

2011-2012 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang

448

Cal State Fullerton Alumni Association Candidate Information Sheet  

E-Print Network [OSTI]

________________________________________________________________________ City____________________________________________State_________ ZIP__________________ Home phone__________________________Cell phone_______________________________________ Company name________________________________________________________________________ City____________________________________________State_________ ZIP____________________ Business Phone

de Lijser, Peter

449

2012-2013 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang

450

Visualization and Phospholipid Identification (VaLID): online integrated search engine capable of identifying and visualizing glycerophospholipids with given mass  

Science Journals Connector (OSTI)

......atom was marked by an x, y and z coordinate and exported into Autodesk Maya v2012. Rigid and dynamic models were derived using Maya...S.F. S.B.); NSERC CREATE (to D.F., G.S.); Autodesk Research, CFI (to S.F.). A.B., G.M., N.V......

Alexandre P. Blanchard; Graeme S. V. McDowell; Nico Valenzuela; Hongbin Xu; Sarah Gelbard; Martin Bertrand; Gary W. Slater; Daniel Figeys; Stephen Fai; Steffany A. L. Bennett

2013-01-15T23:59:59.000Z

451

``In-bone'' Utricle CulturesVA Simplified, Atraumatic Technique for In Situ Cultures of the Adult Mouse  

E-Print Network [OSTI]

effectively in stud- ies of hair cell regeneration and hair cell death, as well as various agents that protect and protection. Background: The current in vitro technique for studying hair cells of the mature mouse utricle to the protective drug tacrine resulted in sig- nificant protection against neomycin (p G 0.05, 3-way analysis

Rubel, Edwin

452

Single-cycle Terahertz Pulses with >0.2 V/A Field Amplitudes via Coherent Transition Radiation  

SciTech Connect (OSTI)

We demonstrate terahertz pulses with field amplitudes exceeding 0.2 V/{angstrom} generated by coherent transition radiation. Femtosecond, relativistic electron bunches generated at the Linac Coherent Light Source are passed through a beryllium foil, and the emitted radiation is characterized as a function of the bunch duration and charge. Broadband pulses centered at a frequency of 10 THz with energies of 140 {mu}J are measured. These far-below-bandgap pulses drive a nonlinear optical response in a silicon photodiode, with which we perform nonlinear autocorrelations that yield information regarding the terahertz temporal profile. Simulations of the spatiotemporal profile agree well with experimental results.

Daranciang, Dan; /Stanford U., Chem. Dept.; Goodfellow, John; /Stanford U. Materials Sci. Dept.; Fuchs, Matthias; /SIMES, Stanford /SLAC, PULSE; Wen, Haidan; /ANL, APS; Ghimire, Shambhu; /SLAC, PULSE; Reis, David A.; /SIMES, Sanford /SLAC, PULSE /Stanford U., Appl. Phys. Dept.; Loos, Henrik; Fisher, Alan S.; /SLAC, LCLS; Lindenberg, Aaron M.; /Stanford U. Materials Sci. Dept. /SIMES, Stanford /SLAC, PULSE

2012-02-15T23:59:59.000Z

453

EMF Measurements, Surveys & Risk Assessment 115 Juliad Court, Suite 105 EMF Mitigation -Shielding & Cancellation Fredericksburg, VA 22406  

E-Print Network [OSTI]

the site. AC ELF Electromagnetic Interference (EMI) Electron microscopes (SEMs, TEMs, STEMs), Focus Ion (audio, video, telephone & data), electromagnetic induction generates electromagnetic interference (EMI

Ohta, Shigemi

454

Superfund record of decision (EPA Region 3): H and H Burn Pit Superfund Site, Hanover County, VA, June 30, 1995  

SciTech Connect (OSTI)

This Record of Decision (ROD) presents the final remedial action selected for the HH Burn Pit Superfund Site, located in Hanover County, Virginia (Site). This remedy addresses contaminated soil, sediment, surface water, and ground water at the Site. The Site has been identified using different names in many of the documents in the Administrative Record and on the National Priorities List. This Record of Decision will refer to the Site as the `HH Burn Pit Superfund Site.`

NONE

1995-07-01T23:59:59.000Z

455

F O R G I N G T H E L I N K AP-27 County of York, VA  

E-Print Network [OSTI]

by the department of environmental and development services to be essential to protection of such existing or potential reservoirs from the effects of pollution or sedimentation. (C). Definitions. For the purposes repair, land disturbing activity, grading, road building, pipe laying, or other activity resulting

456

Determining the neutrino mass hierarchy and CP violation in NoVA with a second off-axis detector  

SciTech Connect (OSTI)

We consider a Super-NOVA-like experimental configuration based on the use of two detectors in a long-baseline experiment as NOVA. We take the far detector as in the present NOVA proposal and add a second detector at a shorter baseline. The location of the second off-axis detector is chosen such that the ratio L/E is the same for both detectors, being L the baseline and E the neutrino energy. We consider liquid argon and water- Cerenkov techniques for the second off-axis detector and study, for different experimental setups, the detector mass required for the determination of the neutrino mass hierarchy, for different values of {theta}{sub 13}. We also study the capabilities of such an experimental setup for determining CP-violation in the neutrino sector. Our results show that by adding a second off-axis detector a remarkable enhancement on the capabilities of the current NOVA experiment could be achieved.

Mena, Olga; /Fermilab; Palomares-Ruiz, Sergio; /Vanderbilt U.; Pascoli, Silvia; /CERN /Durham U., IPPP

2005-10-01T23:59:59.000Z

457

Mental Health Diagnoses and Utilization of VA Non-Mental Health Medical Services Among Returning Iraq and Afghanistan Veterans  

E-Print Network [OSTI]

Soldiers Returning From the Iraq War. Jama. 2007;298:21418.returning from deployment to Iraq or Afghanistan. JAMA.soldiers returning from the Iraq war. JAMA. 2007;298:21418.

Cohen, Beth E.; Gima, Kris; Bertenthal, Daniel; Kim, Sue; Marmar, Charles R.; Seal, Karen H.

2010-01-01T23:59:59.000Z

458

The Proceedings of the 2008 International Conference on Mobile Data Xiaofeng Meng Hui Lei Stephane Grumbach Hong Va Leong  

E-Print Network [OSTI]

. 12. ,,. Deep Web . , 31(8): 1412-142120088. 13. ,,,: XML Twig . 45 ()354-359, 2008.10(, ) 14 . , 45 ()37-42, 2008.10. (, ) 17. TEXEM . 45 ()269-274, 2008.10 1 Deep Web Key Techniques on Deep Web Data Integration2008.5.16 2 Deep Web Study on Query Results Processing of Deep Web Data

459

,"Virginia Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

1: Prices" "Sourcekey","N3050VA3","N3010VA3","N3020VA3","N3035VA3","N3045VA3" "Date","Natural Gas Citygate Price in Virginia (Dollars per Thousand Cubic Feet)","Virginia Price...

460

20130905 | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

September 5-6, 2013 September 5-6, 2013 High Energy Physics Advisory Panel (HEPAP) HEPAP Home Meetings Previous Meetings Members .pdf file (20KB) Charges/Reports Charter .pdf file (44KB) HEP Committees of Visitors HEP Home Meetings High Energy Physics Advisory Panel September 5-6, 2013 Print Text Size: A A A RSS Feeds FeedbackShare Page DOE / NSF icons Agenda High Energy Physics Advisory Panel The National Science Foundation 4201 Wilson Blvd. Stafford II, Room 555 Arlington, VA September 5-6, 2013 10:00 a.m. Opening/Agenda Overview A.Lankford 10:10 a.m. Snowmass Reports: Introduction & Overview N. Hadley .pdf file (2.6MB) 10:25 a.m. Discussion 10:30 a.m. Energy Frontier R. Brock .pdf file (31.0MB) 11:00 a.m. Discussion 11:15 a.m. Cosmic Frontier J. Feng .pdf file (4.4MB) 11:45 a.m. Discussion 12:00 p.m.

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

Agenda110102 | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

1, 2002 1, 2002 Nuclear Science Advisory Committee (NSAC) NSAC Home Meetings Members Charges/Reports Charter .pdf file (629KB) NP Committees of Visitors NP Home Meetings November 1, 2002 Print Text Size: A A A RSS Feeds FeedbackShare Page DOE/NSF Nuclear Science Advisory Committee Meeting November 1, 2002 National Science Foundation Room 1235 (NSF Board Room) Arlington, VA Agenda Friday, November 1, 2002 TIME TOPIC SPEAKER 9:00 a.m. Welcome J. Symons NSF Update .pdf file (141KB) B. Keister DOE Update .pdf file (923KB) D. Kovar 9:45 a.m. HEPAP Long Range Plan .pdf file (1.6MB) J Bagger 10:15 a.m. BREAK 10:30 a.m. Vision of Office of Science R Orbach 11:30 a.m. Report on DOE CT Workshop L Schroeder 12:00 p.m. NNSA Programs .pdf file (426KB) M Kreisler 12:20 p.m. LUNCH

462

Agenda031402 | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

14-15, 2002 14-15, 2002 Nuclear Science Advisory Committee (NSAC) NSAC Home Meetings Members Charges/Reports Charter .pdf file (629KB) NP Committees of Visitors NP Home Meetings March 14-15, 2002 Print Text Size: A A A RSS Feeds FeedbackShare Page DOE/NSF Nuclear Science Advisory Committee Meeting March 14-15, 2002 National Science Foundation Stafford II Building, Room 595 Arlington, VA Agenda Thursday, March 14, 2002 TIME SPEAKER TOPIC 9:00 T. J. Symons LRP Rollout/ Presentation 9:40 R. Eisenstein .pdf file (1.8MB) .pdf file (1.8MB) NSF/MPS .pdf file (1.8MB) .pdf file (1.8MB) 10:00 R. Orbach [J. Decker] DOE/SC 10:20 BREAK 10:30 J. Dehmer NSF/PHY 10:50 B. Keister .pdf file (33KB) .pdf file (33KB) NSF/NP .pdf file (33KB) .pdf file (33KB) 11:10 D. Kovar DOE/NP 11:30 BREAK 11:45 J. Schiffer .pdf file (1.5MB) .pdf file (1.5MB)

463

Measure Guideline: Optimizing the Configuration of Flexible Duct Junction Boxes  

SciTech Connect (OSTI)

This measure guideline offers additional recommendations to heating, ventilation, and air conditioning (HVAC) system designers for optimizing flexible duct, constant-volume HVAC systems using junction boxes within Air Conditioning Contractors of America (ACCA) Manual D guidance (Rutkowski, H. Manual D -- Residential Duct Systems, 3rd edition, Version 1.00. Arlington, VA: Air Conditioning Contractors of America, 2009.). IBACOS used computational fluid dynamics software to explore and develop guidance to better control the airflow effects of factors that may impact pressure losses within junction boxes among various design configurations (Beach, R., Prahl, D., and Lange, R. CFD Analysis of Flexible Duct Junction Box Design. Golden, CO: National Renewable Energy Laboratory, submitted for publication 2013). These recommendations can help to ensure that a system aligns more closely with the design and the occupants' comfort expectations. Specifically, the recommendations described herein show how to configure a rectangular box with four outlets, a triangular box with three outlets, metal wyes with two outlets, and multiple configurations for more than four outlets. Designers of HVAC systems, contractors who are fabricating junction boxes on site, and anyone using the ACCA Manual D process for sizing duct runs will find this measure guideline invaluable for more accurately minimizing pressure losses when using junction boxes with flexible ducts.

Beach, R.; Burdick, A.

2014-03-01T23:59:59.000Z

464

Greenlight Energy Resources Inc GER | Open Energy Information  

Open Energy Info (EERE)

GER GER Jump to: navigation, search Name Greenlight Energy Resources Inc (GER) Place Charlottesville, Virginia Zip VA 22902 Sector Biofuels, Renewable Energy, Solar, Wind energy Product Charlottesville-based venture capital investor in early-stage renewable energy companies in the biofuels, solar, & wind sectors. Coordinates 38.03213°, -78.477529° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":38.03213,"lon":-78.477529,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

465

United States Geological Survey | Open Energy Information  

Open Energy Info (EERE)

Survey Survey Jump to: navigation, search Logo: United States Geological Survey Name United States Geological Survey Address USGS National Center 12201 Sunrise Valley Drive Place Reston, VA Zip 20192 Region Northeast - NY NJ CT PA Area Year founded 1879 Phone number 703-648-5953 Website http://www.usgs.gov/ Coordinates 38.947077°, -77.370315° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":38.947077,"lon":-77.370315,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

466

Virginia Center for Innovative Technology CIT | Open Energy Information  

Open Energy Info (EERE)

Innovative Technology CIT Innovative Technology CIT Jump to: navigation, search Name Virginia Center for Innovative Technology (CIT) Place Herndon, Virginia Zip VA 20170-4 Product CIT is a state-chartered not-for profit corporation with a mission to accelerate Virginia's next generation of technology and technology companies. References Virginia Center for Innovative Technology (CIT)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Virginia Center for Innovative Technology (CIT) is a company located in Herndon, Virginia . References ↑ "Virginia Center for Innovative Technology (CIT)" Retrieved from "http://en.openei.org/w/index.php?title=Virginia_Center_for_Innovative_Technology_CIT&oldid=352847"

467

Clean Energy Group Virginia | Open Energy Information  

Open Energy Info (EERE)

Virginia Virginia Jump to: navigation, search Name Clean Energy Group (Virginia) Place Reston, Virginia Zip VA 20191 Product Virginia-based state regional office of the Clean Energy Group which promotes the commercialization of clean energy technologies. Coordinates 38.959374°, -77.354571° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":38.959374,"lon":-77.354571,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

468

AMENDMENT OF SOLlClTATlONlMODlFlCATlON OF CONTRACT ID PAGE I OF 2  

National Nuclear Security Administration (NNSA)

/ ' / ' ID PAGE I OF 2 PAGES - . Albuquerque, NM 87185-5400 I Amarillo, TX 79120 I ( DE-AC04-00AL66620 10B. DATED (SEE ITEM 13) 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code) Babcock & W ~ ~ C O X Technical Services Pantex, LLC 800 Main Street Lynchburg, VA 24505 2 . AMENDMENTIMODIFICATION NO. MI50 9A. AMENDMENT OF SOLICITATION NO. 9B. DATED (SEE ITEM 11) 10A. MODIFICATION OF CONTRACTIORDER NO. Offers must acknowledge receipt of this amendment prior to the hour and date specified in the solicitation as amended, by one of the following methods: (a) By completing Items 8 and 15, and returning - copies of the amendment; (b) By acknowledging receipt of this amendment on each copy of the offer submitted; or (c) By separate letter or telegram which includes a reference to the solicitation and amendment numbers. FAILURE OF YOUR

469

AMENDMENT OF SOLICITATION/MODIFICATlON OF CONTRACT BWXT Pantex, LLC  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

BWXT Pantex, LLC BWXT Pantex, LLC Route 726, Mt. Athos Road Lynchburg, VA 24506 . - ~ . ~ - - Albuquerque, NM 87185-5400 I Amarillo, TX 79120 9B. DATED (SEE ITEM 11) CONTRACT ID CODE 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code) DE-AC04-00AL66620 I I IOB. DATED (SEE ITEM 13) PAGE I OF 2 PAGES 2. AMENDMENTIMODIFICATION NO. MI06 9A. AMENDMENT OF SOLICITATION NO. Offers must acknowledge receipt of this amendment prior to the hour and date specified in the solicitation as amended, by one of the following methods: (a) By completing Items 8 and 15, and returning - copies of the amendment; (b) By acknowledging receipt of this amendment on each copy of the offer submitted; or (c) By separate letter or telegram which includes a reference to the solicitation and amendment numbers. FAILURE OF YOUR

470

AMENDMENT OF SOLlClTATlONlMODlFlCATlON OF CONTFWCT I 1 CONTRACT ID CODE PAGE I OF 2  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

CONTFWCT I CONTFWCT I 1 CONTRACT ID CODE PAGE I OF 2 PAGES MI10 I See Block 16C I REQ. NO. BWXT Pantex, LLC Route 726, Mt. Athos Road Lynchburg, VA 24506 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUISITIONIPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e l . a , U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 871 85-5400 96. DATED (SEE ITEM 1 1 ) 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 J CODE U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 DE-AC04-00AL66620 1 1 106. DATED (SEE ITEM 1 0 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)

471

AMENDMENT OF SOLICITATIONIMODIFICATION OF CONTRACT I '. CONTRACT ID CODE  

National Nuclear Security Administration (NNSA)

SOLICITATIONIMODIFICATION OF CONTRACT I '. SOLICITATIONIMODIFICATION OF CONTRACT I '. CONTRACT ID CODE BWXT Pantex, LLC Route 726, Mt. Athos Road Lynchburg, VA 24506 PAGE I OF 12 PAGES Albuquerque, NM 871 85-5400 I Amarillo, TX 79120 I I 90. DATED (SEE ITEM 1 1 ) 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code) I 10A. MODIFICATION OF CONTRACTIORDER NO. 2. AMENDMENT/MODIFICATION NO. MI67 9A. AMENDMENT OF SOLICITATION NO. I 1 DE-AC04-00AL66620 100. DATED (SEE ITEM 13) 3. EFFECTIVE DATE See Block 16C Offers must acknowledge receipt of this amendment prior to the hour and date specified in the solicitation as amended, by one of the following methods: (a) By completing Items 8 and 15, and returning - copies of the amendment; (b) By acknowledging receipt of this amendment on each copy of the

472

AMENDMENT OF SOLlClTATlONlMODlFlCATlON OF CONTRACT ID PAGE I OF 2  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

/ ' / ' ID PAGE I OF 2 PAGES - . Albuquerque, NM 87185-5400 I Amarillo, TX 79120 I ( DE-AC04-00AL66620 10B. DATED (SEE ITEM 13) 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code) Babcock & W ~ ~ C O X Technical Services Pantex, LLC 800 Main Street Lynchburg, VA 24505 2 . AMENDMENTIMODIFICATION NO. MI50 9A. AMENDMENT OF SOLICITATION NO. 9B. DATED (SEE ITEM 11) 10A. MODIFICATION OF CONTRACTIORDER NO. Offers must acknowledge receipt of this amendment prior to the hour and date specified in the solicitation as amended, by one of the following methods: (a) By completing Items 8 and 15, and returning - copies of the amendment; (b) By acknowledging receipt of this amendment on each copy of the offer submitted; or (c) By separate letter or telegram which includes a reference to the solicitation and amendment numbers. FAILURE OF YOUR

473

fleetappforms04f1298.doc  

Broader source: Energy.gov (indexed) [DOE]

R R e t u r n C o p y t o : Bank of America Government Card Services Unit P.O. Box 1637 Norfolk, VA 23501-1637 Facsimile: 757.624.6323 Toll Free Fax: 877.217.1033 Form S04F1298 Revised: 05/9/99 Fleet Account Setup (Fields in Bold are Mandatory) ___ Driver Assigned ___ Vehicle Assigned Account Hierarchy Hierarchy Point HL1 HL2 HL3 HL4 HL5 HL6 HL7 HL8 General Information : Agency/Organization Name Business Phone Central Account Number Billing Address, Line 1 Master Accounting Code Billing Address, Line 2 Tax Exempt Number City Driver/Contact Name State Embossing Name 1 Zip/Postal Code Embossing Name 2 Account Information and Spending Limits: a) Driver ID f) Max. cycle dollar limit $ b) Credit limit g) Max. cycle number of

474

EarthCraft Virginia | Open Energy Information  

Open Energy Info (EERE)

EarthCraft Virginia EarthCraft Virginia Jump to: navigation, search Name EarthCraft Virginia Place Richmond, VA Zip 23220 Website http://www.ecvirginia.org/ Coordinates 37.5464259°, -77.4644607° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.5464259,"lon":-77.4644607,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

475

USGS | OpenEI  

Open Energy Info (EERE)

USGS USGS Dataset Summary Description The USGS published spatial data to supplement the report published in 2007 entitled, Geologic Assessment of Undiscovered Oil and Gas Resources of the Black Warrior Basin Province, Alabama and Mississippi. The GIS shapefiles and related metadata are included here. Source USGS Date Released April 11th, 2007 (7 years ago) Date Updated Unknown Keywords gas GIS oil USGS Data application/zip icon au650101cg.zip (zip, 8.7 KiB) application/zip icon au650101g.zip (zip, 9 KiB) application/zip icon au650102cg.zip (zip, 145.6 KiB) application/zip icon au650102g.zip (zip, 7.2 KiB) application/zip icon au650281cg.zip (zip, 138.8 KiB) application/zip icon au650281g.zip (zip, 15.1 KiB) application/zip icon pr6500g.zip (zip, 86.9 KiB)

476

1/12/14 Researchers develop tinywindmills that can power your gadgets (video) www.engadget.com/2014/01/11/university-texas-arlington-micro-windmills/ 1/9  

E-Print Network [OSTI]

, universityoftexasarlington, WindEnergy 40 COMMENTS SHARE TAGS: 22 hours ago Newest | Oldest | Top Comments RPAK1975 Sign

Chiao, Jung-Chih

477

4/7/2014 ACES -The Universityof Texas at Arlington -Annual Celebration of Excellence byStudents (ACES) http://www.uta.edu/aces/awards.php 1/4  

E-Print Network [OSTI]

Students (ACES) http://www.uta.edu/aces/awards.php 1/4 ACES 2014 ACES schedule PRESENTATIONS Oral Presentation of Excellence byStudents (ACES) http://www.uta.edu/aces/awards.php 2/4 Undergraduate Poster Presentation of Excellence byStudents (ACES) http://www.uta.edu/aces/awards.php 3/4 Graduate Poster Presentation President

Chiao, Jung-Chih

478

Atcitty_Ultra-HighSIC_RD100v8.2.indd  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

R R & D 1 0 0 * 2 0 1 1 * E N T R Y S U B M I S S I O N 1. DEVELOPER INFORMATION A. Primary submitting organization GeneSiC Semiconductor Inc. Contact Name: Dr. Ranbir Singh Address: 43670 Trade Center Place, Suite 155 City/State: Dulles, VA Zip/Postal Code: 20166 Country: USA Phone: 703-996-8200 x105 Fax: 703-373-6918 Email: ranbir.singh@genesicsemi.com Web URL: www.genesicsemi.com B. Joint submitters Sandia National Laboratories Describe role of joint submitter in development of technology: Reviewing/Mentoring Address: PO Box 5800 MS 0614 City: Albuquerque State: NM Zip/Postal: 87185 Country: USA Web URL: www.sandia.gov Contact Name: Dr. Stanley Atcitty Phone: 505-284-2701 Fax: 505-844-6972 Email: satcitt@sandia.gov ULTRA HIGH VOLTAGE SILICON CARBIDE THYRISTOR 3 S A N D I A N A T I O N A L L

479

--No Title--  

Broader source: Energy.gov (indexed) [DOE]

consumption and carbon footprint. The Arlington High School's primary heating plant boiler is 29 years old with an optimal efficiency rating of 65%. Replacing this unit with a...

480

Critical Materials Research in DOE Video (Text Version)  

Broader source: Energy.gov [DOE]

This is a text version of the "Critical Materials Research in DOE" video presented at the Critical Materials Workshop, held on April 3, 2012 in Arlington, Virginia.

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

E-Print Network 3.0 - affecting lethal graft Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of Bioengineering, University of Texas at Arlington Collection: Materials Science ; Engineering 18 Rapid Publication In Vivo Retroviral Gene Transfer into Human Bronchial...

482

2009 Wind Technologies Market Report  

E-Print Network [OSTI]

Prepared for the Utility Wind Integration Group. Arlington,Arizona Public Service Wind Integration Cost Impact Study.an Order Revising the Wind Integration Rate for Wind Powered

Wiser, Ryan

2010-01-01T23:59:59.000Z

483

E-Print Network 3.0 - acid anhydride cured Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Arlington Collection: Materials Science ; Engineering 18 On the Networking Mechanisms of Additives-Accelerated PhenolFormaldehyde Polycondensates Summary: curing, with what type...

484

Energy Efficiency Improvement and Cost Saving Opportunities for the Dairy Processing Industry  

E-Print Network [OSTI]

Characterization: Steam Turbines. Arlington, Virginia.scale CHP systems use steam turbines. Switching to naturalsystem efficiency of a steam turbine-based CHP system (80%

Brush, Adrian

2012-01-01T23:59:59.000Z

485

ACKLESON, STEVEN G. Light in shallow waters: A brief research ...  

Science Journals Connector (OSTI)

Office of Naval Research, 800 N. Quincy Street, Arlington, Virginia 22043 ... ecosystems, such as coral reefs or seagrasses, the in-water light field is often...

2003-01-02T23:59:59.000Z

486

E-Print Network 3.0 - aisc american institute Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Texas at Austin, University of - Center for Transportation Research Collection: Energy Storage, Conversion and Utilization 12 University of Texas, Arlington Department of...

487

Model Compound Studies of Fuel Cell Membrane Degradation  

Broader source: Energy.gov [DOE]

Presentation on Model Compound Studies of Fuel Cell Membrane Degradation to the High Temperature Membrane Working Group Meeting held in Arlington, Virginia, May 26,2005.

488

E-Print Network 3.0 - anatomical teaching school Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Systems Engineering, University of Texas at Arlington Collection: Engineering 56 314 Westcott Building, 222 S. Copeland Avenue, P.O. Box 3061480, Tallahassee, FL 32306-1480...

489

Development of Advanced High Temperature Fuel Cell Membranes  

Broader source: Energy.gov [DOE]

Presentation on Development of Advanced High Temperature Fuel Cell Membranes to the High Temperature Membrane Working Group Meeting held in Arlington, Virginia, May 26,2005.

490

E-Print Network 3.0 - adult gastrointestinal tract Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Department, University of Texas at Arlington Collection: Engineering 13 Latham & Poulin--Helminths of Larus dominicanus 253 Gochfeld 1996). The New Zealand population of L....

491

National Academies Criticality Methodology and Assessment Video (Text Version)  

Broader source: Energy.gov [DOE]

This is a text version of the "National Academies Criticality Methodology and Assessment" video presented at the Critical Materials Workshop, held on April 3, 2012 in Arlington, Virginia.

492

E-Print Network 3.0 - artery revascularization improves Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

the prosthetic graft and the native artery and include vein cuffs, vein patches, vein boots Source: Yang, Jian - Department of Bioengineering, University of Texas at Arlington...

493

E-Print Network 3.0 - artery in-stent restenosis Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

the prosthetic graft and the native artery and include vein cuffs, vein patches, vein boots Source: Yang, Jian - Department of Bioengineering, University of Texas at Arlington...

494

Virginia - SEP | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

- SEP Virginia - SEP Virginia's Multi-state Model for Catalyzing the National Home Energy Retrofit Market Location: Charlottesville, Richmond, Arlington County, City of...

495

E-Print Network 3.0 - arsenide junction-field-effect transistors...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Texas at Arlington Materials Science and Engineering Department Summary: and optoelectronic devices. Topics include electrical properties of semiconductors, p-n junctions,...

496

E-Print Network 3.0 - aptitude Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

and Manufacturing Systems Engineering, University of Texas at Arlington Collection: Engineering 25 OFFICE OF THE RESIDENCY COORDINATOR Eastman Institute for Oral Health...

497

Department of Energy Critical Materials Strategy Video (Text Version)  

Broader source: Energy.gov [DOE]

This is a text version of the "Department of Energy Critical Materials Strategy" video presented at the Critical Materials Workshop, held on April 3, 2012 in Arlington, Virginia.

498

E-Print Network 3.0 - acid-gas removal systems Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

University of Texas at Arlington Collection: Engineering 37 CHLORINE VERSUS DIOXINS -CONTROL METHODS TO MINIMIZE Joseph J. Santoleri, P.E. Summary: of having both TSP...

499

New Membranes for PEM Fuel Cells  

Broader source: Energy.gov [DOE]

Presentation on New Membranes for PEM Fuel Cells to the High Temperature Membrane Working Group Meeting held in Arlington, Virginia, May 26,2005.

500

E-Print Network 3.0 - airox process Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Releases mo... Detonation process more efficient than deflagration. Releases morere energy from ... Source: Texas at Arlington, University of - Department of Mechanical and...