Powered by Deep Web Technologies
Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

E-Print Network 3.0 - arlington va usa Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

20... th Street S Arlington, VA 22202 703-415-4560 Link Baileys Crossroads Performance Bicycle 5817... Arlington Blvd Fairfax, VA 22031 ... Source: George Mason University, Center...

2

LANL Fuel Cell Research 1HFCIT Program Kick-off Meeting, Arlington, VA, February 13-14, 2007  

E-Print Network [OSTI]

physicochemical characterization, electrochemical and fuel cell testing 路 Optimize catalysts, supportsLANL Fuel Cell Research 1HFCIT Program Kick-off Meeting, Arlington, VA, February 13-14, 2007 Laboratory Hydrogen, Fuel Cells and Infrastructure Technologies Radoslav Adzic Paolina Atanassova Cabot

3

ILASS Americas 17th Annual Conference on Liquid Atomization and Spray Systems, Arlington, VA, May 2004 Optimal Disturbance Structure and Development on a Sheared Interface  

E-Print Network [OSTI]

ILASS Americas 17th Annual Conference on Liquid Atomization and Spray Systems, Arlington, VA, May, viscosity and mean velocity all change. In the immediate vicinity of the interface, boundary layer flow thickness), density ratio r = 0.02 and viscosity ratio m = 0.025. The OD of this two-phase flow show some

Yecko, Philip

4

U.S. Department of Energy Hydrogen and Fuel Cells Program 2012 Annual Merit Review and Peer Evaluation Report: May 14-18, 2012, Arlington, VA  

SciTech Connect (OSTI)

This document summarizes the comments provided by peer reviewers on hydrogen and fuel cell projects presented at the fiscal year (FY) 2012 U.S. Department of Energy (DOE) Hydrogen and Fuel Cells Program and Vehicle Technologies Program Annual Merit Review and Peer Evaluation Meeting (AMR), held May 14-18, 2012, in Arlington, VA.

Not Available

2012-09-01T23:59:59.000Z

5

UT Arlington Residence Hall Handbook  

E-Print Network [OSTI]

............................................................17 FACILITIES MANAGEMENT .......................... 17 ROOM AND BUILDING MAINTENANCE.........................................................................21 ABANDONED PROPERTY .............................................21 UT ARLINGTON POLICE "OPERATION

Huang, Haiying

6

arlington arlington texas: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Undergraduate Assembly Engineering Websites Summary: section Department of Computer Science & Engineering CoThe University of Texas at Arlington Undergraduate Assembly...

7

Trust Prediction via Aggregating Heterogeneous Social University of Texas at Arlington  

E-Print Network [OSTI]

, TX 76013 feipingnie@gmail.com Heng Huang University of Texas at Arlington Arlington, TX 76013 heng

Tu, Yicheng

8

E-Print Network 3.0 - arlington texas usa Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Applications Robert Magnusson (UT Arlington, ... Source: Corley, Bill - Department of Industrial and Manufacturing Systems Engineering, University of Texas at Arlington...

9

Arlington County- Green Building Incentive Program  

Broader source: Energy.gov [DOE]

In October 1999, the County Board of Arlington adopted a Pilot Green Building Incentive Program using the standards established by the U. S. Green Building Council抯 Leadership in Energy and...

10

ARLINGTON/DEFOREST AREA CATERING INFORMATION  

E-Print Network [OSTI]

ARLINGTON/DEFOREST AREA CATERING INFORMATION Rude's Family Catering DeForest, WI 608-846-5959 (Debbie) Roadside Grill DeForest, WI 608-846-1874 (Pete) Piggly Wiggly Poynette, WI 608-635-2647 (Heidi INFORMATION Holiday Inn Express 7184 Morrisonville Rd. DeForest, WI 53532 608-846-8686 toll free 800-HOLIDAY

Balser, Teri C.

11

Engineering VA Health Care  

E-Print Network [OSTI]

Engineering VA Health Care The Department of Veterans Affairs is offering a unique career to all regions of the country and toward numerous health care leadership roles. B.S. degree or M engineers to be effective Healthcare Technology Program Managers in the Veterans Health Administration

Adams, Mark

12

Proceedings of the American Control Conference Arlington, VA June 25-27, 2001  

E-Print Network [OSTI]

system certain desirable properties such as complete dynamic separation between side-slip and yaw rate was then tested on an experimental vehicle system. 1. Introduction The independent use of either front steering, rear steering, and differential torque steering to control the yaw rate of a vehicle is a well

Brennan, Sean

13

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Engineering and Computer Science on the ASI Board of Directors Cell Phone:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

14

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

and Economics on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

15

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

16

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Engineering and Computer Science on ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

17

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Science and Mathematics on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

18

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

19

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

20

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Science Mathematics on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Health & Human Development on the ASI Board of Directors Cell Phone:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

22

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of the Arts on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

23

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

24

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

25

Zipping mechanism for force-generation by growing filament bundles  

E-Print Network [OSTI]

We investigate the force generation by polymerizing bundles of filaments, which form because of short-range attractive filament interactions. We show that bundles can generate forces by a zipping mechanism, which is not limited by buckling and operates in the fully buckled state. The critical zipping force, i.e. the maximal force that a bundle can generate, is given by the adhesive energy gained during bundle formation. For opposing forces larger than the critical zipping force, bundles undergo a force-induced unbinding transition. For larger bundles, the critical zipping force depends on the initial configuration of the bundles. Our results are corroborated by Monte Carlo simulations.

Torsten Kuehne; Reinhard Lipowsky; Jan Kierfeld

2011-03-02T23:59:59.000Z

26

Arlington, Virginia: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectricEnergyCT Biomass FacilityArdicaInformationContentssourceVA) Jump to:

27

ZipZone Technologies | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:SeadovCooperative JumpWilliamsonWoodsonCounty is aYoakumYuHange BatteryZim'sZipZone

28

REGULATORY MECHANISMS OF SLC39A4 (ZIP4) AND SLC39A5 (ZIP5) IN THE ADAPTIVE RESPONSE TO ZINC AVAILABILITY  

E-Print Network [OSTI]

The aims of this research were to determine how Zip4 and Zip5 are regulated in response to zinc availability and how Zip4 impacts development. Loss of Zip4 resulted in embryonic lethality. Heterozygosity negatively affected eye, heart, and brain...

Weaver, Benjamin Patrick

2009-04-06T23:59:59.000Z

29

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along  

E-Print Network [OSTI]

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along: Chakravarthi, R., & VanRullen, R. (2011). Bullet trains and steam engines: Exogenous attention zips

VanRullen, Rufin

30

The University of Texas at Arlington EMERGENCY PROCEDURES  

E-Print Network [OSTI]

The University of Texas at Arlington EMERGENCY PROCEDURES QUICK REFERENCE GUIDE Provided By: UTA-272-3003 1 The procedures contained in this "Quick Reference Guide" are suggested for general emergency procedures developed to assist the university community in complying with safety and environmental

Texas at Arlington, University of

31

NAME: STUDENT NUMBER (PID): CITY, STATE ZIP: DAYTIME PHONE NUMBER  

E-Print Network [OSTI]

NAME: STUDENT NUMBER (PID): ADDRESS: CITY, STATE ZIP: DAYTIME PHONE NUMBER: CELL PHONE NUMBER of financial institution. 14 Cell Phone Expenses 15 Other ordinary and necessary living expenses. 16 TOTAL (add

32

E-Print Network 3.0 - arlington virginia usa Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Are All Mavericks. The UT ... Source: Texas at Arlington, University of - Department of Industrial and Manufacturing Systems Engineering Collection: Engineering 3 3 IC4N 2011rd...

33

North Arlington, New Jersey: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(Utility Company) Jump to:City)Norristown, Pennsylvania: EnergyCoatingArlington is

34

City of Arlington, South Dakota (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORTOpenWendeGuoCatalystPathwaysAltamont City ofAnsley,ArcadiaArlington

35

NEW IPA Received from the VA Processing IPAs with the VA  

E-Print Network [OSTI]

NEW IPA Received from the VA Processing IPAs with the VA NEW IPA Received from the VA data and contact PDRF OSR will inform DFA/Division Admin and PI that we received the IPA department for Letter of Rehire OSR will sign/return the IPA to the VA for processing DFA/DA responsibilities: OSR

Kay, Mark A.

36

Arlington Heights, Ohio: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 East 300AlgoilEnergyElectric Coop Corp Place: ArkansasInformationArlington

37

Protein folding by zipping and assembly S. Banu Ozkan*  

E-Print Network [OSTI]

Protein folding by zipping and assembly S. Banu Ozkan* , G. Albert Wu* , John D. Chodera, CA, May 2, 2007 (received for review April 13, 2006) How do proteins fold so quickly? Some denatured proteins fold to their native structures in only microseconds, on average, implying that there is a folding

Southern California, University of

38

Early Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Calcasieu Parish Public Library Central Branch 301 W. Claude St. Lake Charles 70605 #12;STATE LIBRARYEarly Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP AL Dauphin Island Sea Laboratory. Walton 32548 FL Panama City Beach Public Library 125000 Hutchison Blvd Panama City Beach 32407 FL

39

VA's Performance Contracting Program Overview  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankCombustion |Energy Usage 禄of EnergyTheTwoVulnerabilities | Department of Energy 5:VA Energy2 1

40

Property:Incentive/Cont2Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County, Maine:PlugNumberOfArraProjectTypeTopic2GrossGenYes, PleaseAddrPagesZip

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear memory  

E-Print Network [OSTI]

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear-pseudosubstrate inhibitory peptide (ZIP) remains in the brain after infusion. Here, we demon- strate that foreground context the brain by 24 h after infusion. These data contribute to a growing body of lit- erature that demonstrates

Helmstetter, Fred J.

42

KENO V.a certification package  

SciTech Connect (OSTI)

KENO V.a has been certified. KENO V.a is a multigroup Monte Carlo criticality program used to calculate the k-effective of a 3-D system. It is part of the SCALE modular code system for performing Standardized Computer Analyses for Licensing Evaluation. SCALE was developed for the Nuclear Regulatory Commission to satisfy a need for a standardized method of analysis for the evaluation of nuclear fuel facility and package designs. In its present form, the system has the capability to perform criticality, shielding, and heat transfer analyses using well established functional modules tailored to the SCALE system. KENO V.a will be used at SRS to perform critical calculations related to nuclear criticality safety.

Niemer, K.A.

1994-04-01T23:59:59.000Z

43

Pre-Retrofit Lighting Study at the University of Texas at Arlington  

E-Print Network [OSTI]

.T. Arlington campus and to determine whether lamp locations within the fixture would impact the amount of light output. This was followed by a series of lab tests conducted at the Energy Systems Lab, located on the Texas A&M University campus, to compare...

Houcek, J. K.; Claridge, D. E.; Haberl, J. S.

1994-01-01T23:59:59.000Z

44

NATIONAL RADIO ASTRONOMY OBSERVATORY CHARLOTTESVILLE) VA  

E-Print Network [OSTI]

NATIONAL RADIO ASTRONOMY OBSERVATORY CHARLOTTESVILLE) VA ELECTRONICS DIVISION INTERNAL REPORT No ' : : lg Measurement Programs DETECTO R1 . 路 路 路 路 .路 路 路 . 路 路 路 路 路 路 路 NOISEL3.B. . 9路 路 . 路 路 路 路 路 路 路 路 . . . Automated ' : : lg Measurement Programs DETECTO R1

Groppi, Christopher

45

Name (last, first, middle initial) Date of birth City, State, ZIP/Postal code  

E-Print Network [OSTI]

Name (last, first, middle initial) Date of birth Address City, State, ZIP/Postal code Province or less. 1. Proponents of cognitive enhancement--the use of "smart pills," deep brain stimulation

46

Stability in MaVaN Models  

E-Print Network [OSTI]

Mass-varying neutrino (MaVaN) models propose a source of dark energy in a new scalar field called the acceleron. Recent work has shown that nonrelativistic neutrino fields in these theories are unstable to inhomogeneous fluctuations, and form structures that no longer behave as dark energy. One might expect that in multiple-neutrino models, the lighter species could continue to act as a source for the acceleron, generating dark energy without the help of heavier species. This paper shows that by considering the evolution of the acceleron field for a large class of models, the result of any neutrino component becoming unstable is that all components become unstable within a short time on cosmological scales. An alternate model employing a second scalar field in a hybrid potential is shown to have stable MaVaN dark energy even in the presence of unstable heavier components.

Christopher Spitzer

2006-06-26T23:59:59.000Z

47

MSW Program Application Requirements: Items 1-3 are processed by the UT Arlington Office of Admissions, Records and Registration and should be sent to  

E-Print Network [OSTI]

MSW Program Application Requirements: Items 1-3 are processed by the UT Arlington Office Fee*** *Submission of the 200 word essay entitled General Academic Plans is not required for MSW directly to the School of Social Work at the address listed below: UT Arlington School of Social Work MSW

Huang, Haiying

48

Category:Richmond, VA | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectricEnergyCTBarreis aCallahanWind FarmAdd aMinutesMapPlacesCategoryVA"

49

to be published in Proc. Reliability and Maintainability Symposium, Arlington, VA, Jan. 2005 1 Forecasting Technology Insertion Concurrent with Design Refresh  

E-Print Network [OSTI]

of sustainment-dominated systems include: avionics, military systems, and industrial equipment. Such products with their redesign due to stringent qualification/certification requirements. Ultimately systems are redesigned one-recurring engineering and system re-qualification costs. Unlike high-volume commercial products in which redesign

Sandborn, Peter

50

Can EDA Combat the Rise of Electronic Counterfeiting? Farinaz Koushanfar  

E-Print Network [OSTI]

, TX Saverio Fazzari Booz Allen Hamilton, Inc., Arlington, VA Carl McCants Defense Advanced Research

Potkonjak, Miodrag

51

Naval Research Laboratory Washington, DC 20375-5320  

E-Print Network [OSTI]

Arlington, VA 22217 11. SUPPLEMENTARY NOTES *Currently with Booz Allen Hamilton National Security Team, Mc

52

ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY  

E-Print Network [OSTI]

86 #12;87 ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY Amagansett 11930 11784 Brightwaters 11718 Kings Park 11754 Setauket 11733 Brookhaven 11719 Lake Grove 11755 Shelter River 11739 Port Jefferson Station 11776 NASSAU COUNTY Albertson 11507 Greenvale 11548 Old Westbury

Ohta, Shigemi

53

Early Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Public Library Central Branch 301 W. Claude St. Lake Charles 70605 29. LA Iberia Parish Library 445 EEarly Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP 1. AL Dauphin. Mobile 36606 6. AL City of Bayou La Batre Public Library 12747 Padgett Switch Road Irvington 36544 7. FL

54

Hydrogen Production and Dispensing Facility Opens at W. Va. Airport  

Broader source: Energy.gov [DOE]

A hydrogen production and dispensing station constructed and operated with support from the Office of Fossil Energy's National Energy Technology Laboratory was officially opened Monday at the Yeager Airport in Charleston, W.Va.

55

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's HeatMexico:CommunityNorthwestInformation GreatersourceOhmsettZip

56

Contract Connections @ ChallengeHER, Norfolk VA, October 14  

Broader source: Energy.gov [DOE]

The U.S. Small Business Administration (SBA), Women Impacting Public Policy (WIPP), and American Express OPEN have partnered to host this special FREE contracting event for women business owners. American Express OPEN will hold a Contract Connections session at the ChallengeHER Norfolk Event, on October 14th, 2014 at the Webb University Center, Norfolk, VA.

57

Health and Wellness @ U.Va. Department of Student Health  

E-Print Network [OSTI]

Health and Wellness @ U.Va. Department of Student Health Counseling and Psychological Services "Without health there is no happiness. An attention to health, then, should take the place of every other on Accreditation of Healthcare Organizations 2013 Parents Handbook p. 36-41 #12;Student Health Services 路 12:30am-2

Acton, Scott

58

E-Print Network 3.0 - adenovirus va rna-derived Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

va rna-derived Search Powered by Explorit Topic List Advanced Search Sample search results for: adenovirus va rna-derived Page: << < 1 2 3 4 5 > >> 1 MINI REVIEW MODIFIED...

59

E-Print Network 3.0 - avalieye tarahi va Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

RESEARCH (PROGRAM... ) FUNDS NOT SALARIED BY VA 1. NAME: 2. DEGREE: 3. SSN: 4. VA TITLE: CONTRACT WOC INVESTIGATOR'S SIGNATURE... Table 8) Code (If code 99, enter name of...

60

E-Print Network 3.0 - annamria zskai va Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

RESEARCH (PROGRAM... ) FUNDS NOT SALARIED BY VA 1. NAME: 2. DEGREE: 3. SSN: 4. VA TITLE: CONTRACT WOC INVESTIGATOR'S SIGNATURE... Table 8) Code (If code 99, enter name of...

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

Cost-Effective Energy Efficiency Measures for Above Code (ASHRAE 90.1-2001 and 2007) Small Office Buildings in the City of Arlington  

E-Print Network [OSTI]

COST-EFFECTIVE ENERGY EFFICIENCY MEASURES FOR ABOVE CODE (ASHRAE 90.1-2001 and 2007) SMALL OFFICE BUILDINGS IN THE CITY OF ARLINGTON A Research Project for the City of Arlington ENERGY SYSTEMS LABORATORY Texas Engineering Experiment Station Texas... of the review: Summary of above-code approaches that have been made in the CoA during the 2008-2010. ? Results of the current project: Recommendations of 17 energy efficiency measures (EEMs) to maximize energy savings for small office buildings in the Co...

2011-01-01T23:59:59.000Z

62

2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go to presentations and download.  

E-Print Network [OSTI]

Laboratory Geochemical Tools for Monitoring Geologic Carbon Sequestration, (David Cole, ORNL) Andre Duguid-surface carbon sequestration T.S. Ramakrishnan (Jim Johnson, speaker) Schlumberger Capacity and Injectivity2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go

Daniels, Jeffrey J.

63

Critical Materials Workshop Final Participant List  

Broader source: Energy.gov [DOE]

List of participants who attended the Critical Materials Workshop held on April 3, 2012 in Arlington, VA

64

High Temperature Membrane Working Group Meeting, May 14, 2007  

Broader source: Energy.gov [DOE]

This agenda provides information about the High Temperature Membrane Working Group Meeting on May 14, 2007 in Arlington, Va.

65

VA Energy Management Action Plan | Department of Energy  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankCombustion |Energy Usage 禄of EnergyTheTwoVulnerabilities | Department of Energy 5:VA Energy

66

Partners in Preparedness e American Red Cross in the National Capital Region  

E-Print Network [OSTI]

. Belvoir, VA 22060 (703) 805-2057 Loudoun County 604 South King Street, #006 Leesburg, VA 20175 (703) 777) 549-8300 Arlington County 4333 Arlington Boulevard Arlington, VA 22203 (703) 527-3010 Fairfax County 1050 West Perimeter Road Suite E1-23 Andrews Air Force Base, MD 20762 (240) 857-7315 Montgomery County

Acton, Scott

67

Final Report for The University of Texas at Arlington Optical Medical Imaging Section of Advanced Imaging Research Center  

SciTech Connect (OSTI)

The goal of this project was to create state-of-the-art optical medical imaging laboratories for the Biomedical Engineering faculty and student researchers of the University of Texas at Arlington (UTA) on the campus of the University of Texas Southwestern Medical Center (UTSW). This has been successfully achieved. These laboratories provide an unprecedented opportunity for the bioengineers (from UTA) to bring about new breakthroughs in medical imaging using optics. Specifically, three major laboratories have been successfully established and state-of-the-art scientific instruments have been placed in the labs. As a result of this grant, numerous journal and conference publications have been generated, patents for new inventions have been filed and received, and many additional grants for the continuation of the research has been received.

Khosrow Behbehani

2013-02-26T23:59:59.000Z

68

Report on the SNL/NSF International Workshop on Joint Mechanics, Arlington, Virginia, 16-18 October 2006.  

SciTech Connect (OSTI)

The NSF/SNL joint mechanics workshop, held in Arlington, Virginia, 16-18 October, 2006, attempted to assess the current state of the art for modeling joint mechanics for the purpose of structural dynamics calculation, to identify the underlying physics issues that must be addressed to advance the field, and to propose a path forward. Distinguished participants from several countries representing research communities that focus on very different length and time scales identified multiple challenges in bridging those scales. Additionally, two complementary points of view were developed for addressing those challenges. The first approach - the 'bottom-up' perspective - attempts to bridge scales by starting from the smallest length scale and working up. The other approach starts at the length scale of application and attempts to deduce mechanics at smaller length scales through reconciliation with laboratory observation. Because interface physics is a limiting element of predictive simulation in defense and transportation, this issue will be of continuing importance for the foreseeable future.

Ewins, David J. (Imperial College, London England, UK); Bergman, Lawrence A. (University of Illinois, Urbana, IL); Segalman, Daniel Joseph

2007-11-01T23:59:59.000Z

69

Unified Convolutional/Turbo Decoder Architecture Design Based on Triple-Mode MAP/VA Kernel  

E-Print Network [OSTI]

Unified Convolutional/Turbo Decoder Architecture Design Based on Triple-Mode MAP/VA Kernel Fan convolutional/ turbo decoder design. According to the triple-mode MAP/VA timing chart and by merging some similar modules in both the Viterbi decoder and the log-MAP turbo code decoder, we build one unified

Hung, Shih-Hao

70

Better Buildings Residential Network Program Sustainability Series Mastermind Call: Connecting the Dots Between the Real Estate Market and Residential Energy Efficiency Featuring Host Rich Dooley, Arlington County, VA, Call Slides and Discussion Summary  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:YearRound-Up fromDepartmentTie Ltd: ScopeDepartment1, 2011 BetterOctober25, 2013Trends in18,Series

71

Copyright 2004 IEEE ---Published in the Proceedings of the 2004 IEEE International Symposium on Biomedical Imaging (ISBI 2004), 1518 April 2004, Arlington, VA, USA. Personal use of this material is permitted. However, permission to reprint/republish this  

E-Print Network [OSTI]

4 Universidad de Los Andes, Facultad de Ingenier?? 锟絘, M?? erida, Venezuela 5 Northeastern UniversityZeneca; Dr. Medina was supported by the Universidad de Los Andes and FONACIT, Venezuela. --- # E颅mail: a

Wahle, Andreas

72

Copyright 2004 IEEE --Published in the Proceedings of the 2004 IEEE International Symposium on Biomedical Imaging (ISBI 2004), 15-18 April 2004, Arlington, VA, USA. Personal use of this material is permitted. However, permission to reprint/republish this  

E-Print Network [OSTI]

Andes, Facultad de Ingenier麓ia, M麓erida, Venezuela 5 Northeastern University, Mechanical, Industrial by the Universidad de Los Andes and FONACIT, Venezuela. -- E-mail: a.wahle@ieee.org cal vessel curvature. We have

Wahle, Andreas

73

VaPa - nuorten varhennettu kuntoutus Lappeenrannassa; Backdated rehabilitation of youngsters in Lappeenranta.  

E-Print Network [OSTI]

??Kehitt鋗ishanke k鋝ittelee Lappeenrannassa vuosina 2001-2003 toteutettua nuorten varhennettua kuntoutusta VaPa- hanketta. Kuntoutuskokeilun j鋜jestettiin Lappeenrannan sosiaali- ja terveysviraston ostopalveluna yhteis-voimin Lappeenrannan Kelan, ty鰒oimatoimiston ja toteuttajatahon Laptuote-s滗ti鰊 (more)

Korja,Minna-Liisa

2006-01-01T23:59:59.000Z

74

asparagine motale-e va: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

NWR PR National Marine; Fisheries Service; Cape Romain; Wilderness W Sc 2007-01-01 220 Millard W. Hall, Director VA1ume i, ilumber Environmental Sciences and Ecology Websites...

75

The Shorthorn: Casey Crane Robert Arrowood, Carrizo Oil and Gas, Inc. representative, takes local homeowners' questions about on-campus natural gas drilling in an Arlington office complex Tuesday.  

E-Print Network [OSTI]

homeowners' questions about on-campus natural gas drilling in an Arlington office complex Tuesday. Jenna that plans to drill on university property. Carrizo Oil and Gas, Inc. recently signed a one-year lease with the university and called the meeting to alleviate con- cerns about the drilling. They also strived to get

Chiao, Jung-Chih

76

1/10/14 Technologyuses micro-windmills to recharge cell phones -News Center -UT Arlington www.uta.edu/news/releases/2014/01/microwindmill-rao-chiao.php 1/4  

E-Print Network [OSTI]

1/10/14 Technologyuses micro-windmills to recharge cell phones - News Center - UT Arlington www power homes NEWS CENTER Technology uses micro-windmills to recharge cell phones Search News Center News of these tiny windmills. Hundreds of the windmills could be embedded in a sleeve for a cell phone. Wind, created

Chiao, Jung-Chih

77

VaR Constrained Hedging of Fixed Price Load-Following Obligations in Competitive  

E-Print Network [OSTI]

VaR Constrained Hedging of Fixed Price Load-Following Obligations in Competitive Electricity , and marketers at the prices determined by supply and demand equilibrium. Electricity mar- ket participants are exposed to risks in their net earnings due to uncertain wholesale market prices. Electricity market prices

78

Progress on development of the new FDIRC PID detector J. Va'vrak,  

E-Print Network [OSTI]

Progress on development of the new FDIRC PID detector J. Va'vrak, , N. Arnaudf , A. Yu. Barnyakove of PID detector called FDIRC, intended to be used at the SuperB experiment, which requires /K separation the DIRC PID detector (DIRC = Detector of Internally Reflected Cherenkov light) [1]. The original DIRC had

Paris-Sud XI, Universit茅 de

79

February 2006, NRAO, VA (or why H0 is the Dark Energy)  

E-Print Network [OSTI]

Wayne Hu February 2006, NRAO, VA (or why H0 is the Dark Energy) Dark Energy in Light of the CMB #12;If its not dark, it doesn't matter! 路 Cosmic matter-energy budget: Dark Energy Dark Matter Dark provide the high redshift cornerstone to cosmological inferences on the dark matter and dark energy WMAP

Hu, Wayne

80

MED-VaL 10, Manufacturing Science and Engineering --1999 Modeling of Gear Bobbing  

E-Print Network [OSTI]

Shifting, Optimization, Coatings I INTRODUCTION The lack o f a universal wear prediction method for gearMED-VaL 10, Manufacturing Science and Engineering -- 1999 ASME 1999 Modeling of Gear Bobbing Part models for gear hobbing were presented in the first pan of this paper. To determine the constants

Aristomenis, Antoniadis

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

PRECISION MEASUREMENT OF SINGLET P CAPTURE IN HYDROGEN V.A. Andreev1  

E-Print Network [OSTI]

PRECISION MEASUREMENT OF SINGLET 碌P CAPTURE IN HYDROGEN V.A. Andreev1 , T.I. Banks3 , B as a measurement of the deuterium depletion in the hydrogen gas. However, due to the reappearance of a hotspot-mounted readout electronics for cathodes and anodes. About 1500 new channels connected to new compressor modules

Kammel, Peter

82

DOE Spent Nuclear Fuel Information In Support of TSPA-VA  

SciTech Connect (OSTI)

RW has started the viability assessment (VA) effort to determine the feasibility of Yucca Mountain as the first geologic repository for spent nuclear fuel (SNF) and high-level waste. One component of the viability assessment will be a total system performance assessment (TSPA), based on the design concept and the scientific data and analysis available, describing the repository's probable behavior relative to the overall system performance standards. Thus, all the data collected from the Exploratory Studies Facility to-date have been incorporated into the latest TSPA model. In addition, the Repository Integration Program, an integrated probabilistic simulator, used in the TSPA has also been updated by Golder Associates Incorporated at December 1997. To ensure that the Department of Energy-owned (DOE-owned) SNF continues to be acceptable for disposal in the repository, it will be included in the TSPA-VA evaluation. A number of parameters are needed in the TSPA-VA models to predict the performance of the DOE-owned SNF materials placed into the potential repository. This report documents all of the basis and/or derivation for each of these parameters. A number of properties were not readily available at the time the TSPA-VA data was requested. Thus, expert judgement and opinion was utilized to determine a best property value. The performance of the DOE-owned SNF will be published as part of the TSPA-VA report. Each DOE site will be collecting better data as the DOE SNF program moves closer to repository license application. As required by the RW-0333P, the National Spent Nuclear Fuel Program will be assisting each site in qualifying the information used to support the performance assessment evaluations.

A. Brewer; D. Cresap; D. Fillmore; H. Loo; M. Ebner; R. McCormack

1998-09-01T23:59:59.000Z

83

E-Print Network 3.0 - attending ophthalmic outreach Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Hiram E. Fitzgerald Associate Provost for University Outreach... Association of Colleges of Pharmacy Interim Meeting Arlington, VA February 6, 2007 12;Defining...

84

Data Collection and Analysis  

Energy Savers [EERE]

DataCollecGon&Analysis MarloweKulley PortlandBureauofPlanning&Sustainability DOEConference|May20,2011|Arlington,VA 2...

85

Better Buildings Residential Network Program Sustainability Series...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Call: Connecting the Dots Between the Real Estate Market and Residential Energy Efficiency Featuring Host: Rich Dooley, Arlington County, VA Call Slides and Discussion Summary...

86

Solid State NMR Studies and Local Structure of Voltage Fade Materials  

Broader source: Energy.gov (indexed) [DOE]

with the Voltage Fade Team Michael Slater, Jason Croy, Kevin Gallagher, Christopher Johnson, Yang Ren DOE Vehicle Technologies Program Annual Merit Review Arlington, VA May 13 -...

87

CHARACTERIZING COSTS, SAVINGS AND BENEFITS OF A SELECTION OF ENERGY EFFICIENT EMERGING TECHNOLOGIES IN THE UNITED STATES  

E-Print Network [OSTI]

Characterization: Gas Turbines. Arlington, VA: ICF: Energy21, 191-237. Diesel & Gas Turbine Worldwide. (2006).Order Survey. Diesel & Gas Turbine Worldwide. (2007). 2007

Xu, T.

2011-01-01T23:59:59.000Z

88

Does species diversity really drive speciation? Henrique M. Pereira, Va^nia M. Proenca and Luis Vicente  

E-Print Network [OSTI]

Does species diversity really drive speciation? Henrique M. Pereira, Va^nia M. Proenc赂a and Luis Vicente H. M. Pereira (hpereira@stanfordalumni.org), CEHIDRO, Dept Civil Engineering, Inst. Superior Te

Pereira, Henrique Miguel

89

Validation of KENO V.a with ENDF/B-V cross sections for {sup 233}U systems  

SciTech Connect (OSTI)

A multigroup Monte carlo code KENO V.a is maintained at the ORNL as part of the standardized cmoputer analysis for licensing evaluation (SCALE) system. Included in the SCALE system are the 238-and 44-energy group ENDF/B-V cross section libraries. The purpose of this work was to validate the ENDF/B-V and KENO V.a for uranium 233 systems.

Dunn, M.E.; Basoglu, B.; Bentley, C.L.; Haught, C.; Plaster, M.J.; Wilkinson, A.D.; Yamamoto, T.; Dodds, H.L. [Univ. of Tennessee, Knoxville, TN (United States)

1994-12-31T23:59:59.000Z

90

W.Va. Mom Sees Benefits of Weatherization | Department of Energy  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankCombustion |Energy Usage 禄of| Department of Energy VentilationforEnergy Memorandum oflW. DavidW.Va.

91

VA-MD-DC Hydrogen Education for Decision Makers | Department of Energy  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankCombustion |Energy Usage 禄of EnergyTheTwoVulnerabilities | Department of Energy 5:VA4-BVA-MD-DC

92

Effect of flow rate of ethanol on growth dynamics of VA-SWNT -Transition from no-flow CVD to normal ACCVD  

E-Print Network [OSTI]

Effect of flow rate of ethanol on growth dynamics of VA-SWNT - Transition from no-flow CVD a growth model [2]. In this study, the flow rate of ethanol during the CVD was controlled precisely. Figure 1 shows the growth curve of VA-SWNT film for various ethanol flow rates. In the figure, "No

Maruyama, Shigeo

93

KH?O S罷 M?I QUAN H? GI?A ?? TH?M V ?NG SU?T V?A ...  

E-Print Network [OSTI]

Trong hai th?p ni阯 v?a qua, c醕 ph??ng ph醦 s? li阯 quan ??n s? t??ng t醕 gi?a ... In the last two decades, there has been strong emphasis on numerical...

GEOPET

2005-09-30T23:59:59.000Z

94

Jimmy Krozel is with Metron Aviation, Inc., Herndon, VA. Changkil Lee and Joseph S.B. Mitchell are with Stony Brook University, Stony Brook, NY.  

E-Print Network [OSTI]

. Jimmy Krozel is with Metron Aviation, Inc., Herndon, VA. Changkil Lee and Joseph S.B. Mitchell 1064-3818/95/030163-20 159 Turn-Constrained Route Planning for Avoiding Hazardous Weather Jimmy Krozel

Mitchell, Joseph S.B.

95

Reynolds Homestead Forestry Resources Research Center407HomesteadLane,Critz,VA24082276-694-4135www.arec.vaes.vt.edu/reynolds-homestead Physical Resources  

E-Print Network [OSTI]

Reynolds Homestead Forestry Resources Research Center407HomesteadLane,Critz,VA24082 Research and Extension Focus Areas Kyle Peer Extension Specialist, Forestry Christmas trees, works Professor, Forestry (FOR) Forestry best management practices and erosion control Amy Brunner Associate

Liskiewicz, Maciej

96

Comparing Extinction Rates: Past, Present, and Future Va^nia Proenc-a and Henrique Miguel Pereira, Faculdade de Cie^ncias da Universidade de Lisboa, Lisboa, Portugal  

E-Print Network [OSTI]

Comparing Extinction Rates: Past, Present, and Future Va^nia Proenc-a and Henrique Miguel Pereira et al., 2005; Pereira et al., 2010a). This is very worrying because species extinction

Pereira, Henrique Miguel

97

Single-cycle terahertz pulses with >0.2 V/A field amplitudes via coherent transition radiation  

SciTech Connect (OSTI)

We demonstrate terahertz pulses with field amplitudes exceeding 0.2 V/A generated by coherent transition radiation. Femtosecond, relativistic electron bunches generated at the Linac Coherent Light Source are passed through a beryllium foil, and the emitted radiation is characterized as a function of the bunch duration and charge. Broadband pulses centered at a frequency of 10 THz with energies of 140 {mu}J are measured. These far-below-bandgap pulses drive a nonlinear optical response in a silicon photodiode, with which we perform nonlinear autocorrelations that yield information regarding the terahertz temporal profile. Simulations of the spatiotemporal profile agree well with experimental results.

Daranciang, Dan [Department of Chemistry, Stanford University, Stanford, California 94305 (United States); PULSE Institute for Ultrafast Energy Science, SLAC National Accelerator Laboratory, Menlo Park, California 94025 (United States); Goodfellow, John [Department of Materials Science and Engineering, Stanford University, Stanford, California 94305 (United States); Stanford Institute for Materials and Energy Science, SLAC National Accelerator Laboratory, Menlo Park, California 94025 (United States); Fuchs, Matthias; Ghimire, Shambhu [PULSE Institute for Ultrafast Energy Science, SLAC National Accelerator Laboratory, Menlo Park, California 94025 (United States); Wen, Haidan [Advanced Photon Source, Argonne National Laboratory, Argonne, Illinois 60439 (United States); Reis, David A. [PULSE Institute for Ultrafast Energy Science, SLAC National Accelerator Laboratory, Menlo Park, California 94025 (United States); Stanford Institute for Materials and Energy Science, SLAC National Accelerator Laboratory, Menlo Park, California 94025 (United States); Department of Applied Physics, Stanford University, Stanford, California 94305 (United States); Loos, Henrik; Fisher, Alan S. [Linac Coherent Light Source, SLAC National Accelerator Laboratory, Menlo Park, California 94025 (United States); Lindenberg, Aaron M. [PULSE Institute for Ultrafast Energy Science, SLAC National Accelerator Laboratory, Menlo Park, California 94025 (United States); Department of Materials Science and Engineering, Stanford University, Stanford, California 94305 (United States); Stanford Institute for Materials and Energy Science, SLAC National Accelerator Laboratory, Menlo Park, California 94025 (United States)

2011-10-03T23:59:59.000Z

98

Search for V+A current in top quark decay in p anti-p collisions at s**(1/2) = 1.96-TeV  

SciTech Connect (OSTI)

The authors report an upper limit on the fraction of V + A current, f{sub V+A}, in top quark decays, using approximately 700 pb{sup -1} of p{bar p} collisions at {radical}s = 1.96 TeV acquired by the upgraded Collider Detector at Fermilab. For the decay t {yields} wb {yields} {ell}vb (where {ell} = e or {mu}), the invariant mass of the charged lepton and the bottom quark jet is sensitive to the polarization of the W boson. They determine f{sub V+A} = -0.06 {+-} 0.25 given a top quark mass of 175 GeV/c{sup 2}. They set an upper limit on f{sub V+A} of 0.29 at the 95% confidence level, which represents an improvement by a factor of two on the previous best direct limit.

Abulencia, A.; Adelman, J.; Affolder, T.; Akimoto, T.; Albrow, M.G.; Ambrose, D.; Amerio, S.; Amidei, D.; Anastassov, A.; Anikeev, K.; Annovi, A.; /Taiwan, Inst. Phys.

2006-08-01T23:59:59.000Z

99

Orange County Zip Codes Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

Irvine Anaheim Hills 92807 92603 Irvine Anaheim Hills 92808 92604 Irvine Anaheim Hills 92809 92605 Huntington Beach PO Box Only Anaheim Hills 92817 92606 Irvine Atwood 92870 92607 Laguna Beach Duplicate; PO 92609 Lake Forest PO Box Only Brea 92821 92610 El Toro Brea 92822 PO Box Only 92610 Foothill Ranch Brea

de Lijser, Peter

100

Orange County Zip Codes By Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

only 92607 Laguna Niguel Duplicate; PO Box only Brea 92823 92609 Lake Forest PO Box only Buena Park Valley 92728 Duplicate; PO Box only 92629 Dana Point Fullerton 92831 92630 Lake Forest Fullerton 92832 92637 Laguna Hills duplicate Fullerton 92833 92637 Laguna Woods duplicate Fullerton 92834 PO Box only

de Lijser, Peter

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

POSTGRADUATE MONTEREY, CALIFORNIA  

E-Print Network [OSTI]

(WISE), two deep water moorings were placed in the northeastern portion of the South China Sea deep, Arlington, VA 22202-4302, and to the Office of Management and Budget, Paperwork Reduction Project (0704

102

E-Print Network 3.0 - assisted deposition ibad Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

assisted deposition ibad Page: << < 1 2 3 4 5 > >> 1 Superconductivity for Electric Systems Annual Peer Review Arlington, VA July 25-27, 2006 Exploring New Directions in the...

103

Open Ontology Repository Kenneth Baclawski  

E-Print Network [OSTI]

University Boston, Massachusetts 02115 USA +1.617.373.4631 kenb@ccs.neu.edu Todd Schneider Raytheon 7700 Arlington Blvd. Fairfax, VA, 22042 USA +1.703.204.6463 todd.schneider@raytheon.com ABSTRACT The Open

Baclawski, Kenneth B.

104

Climate Leadership Conference | Department of Energy  

Office of Environmental Management (EM)

City 1250 S Hayes St. Arlington, VA 22202 Hosted and organized by the Association of Climate Change Officers (ACCO), Center for Climate and Energy Solutions (C2ES), and the...

105

Register Now for AMO's Workshop on Composite Manufacturing  

Broader source: Energy.gov [DOE]

The U.S. Department of Energy's Advanced Manufacturing Office will host a workshop on Fiber Reinforced Polymer Composite Manufacturing on January 13, 2014 at the Hilton Crystal City in Arlington, VA.

106

GEORGE LEA FOUNDER'S SCHOLARSHIP PUBLIC LANDS FOUNDATION  

E-Print Network [OSTI]

1 GEORGE LEA FOUNDER'S SCHOLARSHIP PUBLIC LANDS FOUNDATION P.O. Box 7226 Arlington, VA 22207 Scholarship Application Form This scholarship is being offered by the Public Lands Foundation, a national non

107

GTP Adds Meeting on the National Geothermal Data System Project...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

and activities of the NGDS team. The meeting will take place at the Hyatt Regency Crystal City in Arlington, VA, on Monday, May 17, 2010, just preceding the GTP Peer Review...

108

Critical Materials Workshop  

Broader source: Energy.gov [DOE]

AMO hosted a public workshop on Tuesday, April 3, 2012 in Arlington, VA to provide background information on critical materials assessment, the current research within DOE related to critical...

109

Breaking the Fuel Cell Cost Barrier  

Broader source: Energy.gov (indexed) [DOE]

the Fuel Cell Cost Barrier AMFC Workshop May 8 th , 2011, Arlington, VA Shimshon Gottesfeld, CTO The Fuel Cell Cost Challenge 2 CellEra's goal - achieve price parity with...

110

Big Data Projects on Solar Tech Evolution and Diffusion  

Broader source: Energy.gov [DOE]

This is the meeting agenda from the Big Data Projects on Solar Technology Evolution and Diffusion kickoff meeting, held on July 15, 2013 in Arlington, VA and facilitated by the SunShot Initiative.

111

First-Principles Models of Properties of LMR-NMC Materials  

Broader source: Energy.gov (indexed) [DOE]

First-Principles Models of Properties of LMR-NMC Materials Project Id: ES193 R. Benedek, H. Iddir DOE Vehicle Technologies Program Annual Merit Review Arlington, VA May 13 - 17,...

112

Waste-to-Energy Roadmapping Workshop Agenda  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Waste-to-Energy Workshop Agenda November 5-6, 2014 DoubleTree Hotel Crystal City Arlington, VA 22202 Day 1: Wednesday, November 5, 2014 Time Activity 7:30 am Registration and...

113

Henderson Hall's Education and Career Fair | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Hall's Education and Career Fair September 25, 2014 2:00PM to 5:00PM EDT Location: Smith Gym, Henderson Hall, Arlington, VA POC: Donna Friend Website: http:www.mccshh.com...

114

Energy Efficiency Improvement and Cost Saving Opportunities for the Pharmaceutical Industry. An ENERGY STAR Guide for Energy and Plant Managers  

E-Print Network [OSTI]

Characterization: Gas Turbines. Arlington, VA. February.is higher than that of a gas turbine-based CHP system (74%,electrical efficiency of a gas turbine-based CHP system is

Galitsky, Christina

2008-01-01T23:59:59.000Z

115

A broad spectral, interdisciplinary investigation of the electromagnetic properties of sea ice  

E-Print Network [OSTI]

This paper highlights the interrelationship of research completed by a team of investigators and presented in the several individual papers comprising this Special Section on the Office of Naval Research (ONR), Arlington, VA, Sponsored Sea Ice...

Jezek, K. C.; Perovich, D. K.; Golden, K. M.; Luther, C.; Barber, D. G.; Gogineni, Sivaprasad; Grenfell, T. C.; Jordan, A. K.; Mobley, C. D.; Nghiem, S. V.; Onstott, R. G.

1998-09-01T23:59:59.000Z

116

A LOW COST MULTI-BAND/MULTI-MODE RADIO FOR PUBLIC SAFETY S.M. Hasan (Virginia Tech, Blacksburg, VA, U.S.A., hasan@vt.edu); P. Balister  

E-Print Network [OSTI]

A LOW COST MULTI-BAND/MULTI-MODE RADIO FOR PUBLIC SAFETY S.M. Hasan (Virginia Tech, Blacksburg, VA, U.S.A., hasan@vt.edu); P. Balister (Virginia Tech, Blacksburg, VA, U.S.A., balister@vt.edu); K. Lee

Ellingson, Steven W.

117

Validation of KENO V.a with ENDF/B-V cross sections for {sup 233}U systems  

SciTech Connect (OSTI)

The multigroup Monte Carlo code KENO V.a and the 238- and 44-energy-group ENDF/B-V cross-section libraries were validated for {sup 233}U systems. Fifty-one critical experiments involving {sup 233}UO{sub 2}(NO{sub 3}){sub 2}, {sup 233}UO{sub 2}F{sub 2}, or {sup 233}U metal were selected for the validation. The H/{sup 233}U ratios for the experiments range from 0 to 1986. Each experiment was modeled with KENO V.a, and the effective multiplication factor k{sub eff} was calculated for each system using the 44- and 238-group ENDF/B-V, the 27- and 218-group ENDF/B-IV, and the 16-group Hansen-Roach cross-section libraries. The mean calculated k{sub eff} for all experiments using the 44- and 238-group libraries is 1.0090 {+-} 0.0021 and 1.0064 {+-} 0.0020, respectively. For comparison, the mean calculated k{sub eff} using the 27-, 218-, and 16-group libraries is 1.0142 {+-} 0.0038, 1.0125 {+-} 0.0038, and 0.9991 {+-} 0.0019, respectively. In general, an improvement exists in the agreement between the calculated k{sub eff}`s and the experimental results (i.e., k{sub eff} = 1.0) obtained with the newer ENDF/B-V libraries relative to ENDF/B-IV. This study is pertinent to {sup 233}U storage outside of the reactor.

Dunn, M.E.; Basoglu, B.; Bentley, C.L.; Plaster, M.J.; Wilkinson, A.D.; Dodds, H.L. [Univ. of Tennessee, Knoxville, TN (United States). Nuclear Engineering Dept.; Haught, C. [Martin Marietta Energy Systems, Piketon, OH (United States); Yamamoto, T. [Japan Atomic Energy Research Inst., Tokai (Japan)

1995-08-01T23:59:59.000Z

118

Camenen, B., and Larson, M. 2007. A Total Load Formula for the Nearshore. Proceedings Coastal Sediments '07 Conference, ASCE Press, Reston, VA, 56-67.  

E-Print Network [OSTI]

Sediments '07 Conference, ASCE Press, Reston, VA, 56-67. A TOTAL LOAD FORMULA FOR THE NEARSHORE Benoit.larson@tvr.lth.se Abstract: A total load sediment transport formula based on recent studies on the bed load and suspended qualify and quantify the current-related and wave-related sediment transport. It appeared

US Army Corps of Engineers

119

RF CONTROL REQUIREMENTS FOR THE CEBAF ENERGY UPGRADE C. Hovater, J. Delayen, L. Merminga, T. Powers, C. Reece, Jefferson Lab, Newport News, VA  

E-Print Network [OSTI]

RF CONTROL REQUIREMENTS FOR THE CEBAF ENERGY UPGRADE CAVITIES* C. Hovater, J. Delayen, L. Merminga, T. Powers, C. Reece, Jefferson Lab, Newport News, VA Abstract The 6 GeV CEBAF accelerator superconducting cavity for the CEBAF and FEL upgrades. From the low-level RF (LLRF) controls perspective higher

120

PNL-SA-24733 Presented at the Advanced Information Systems and Technology Conference 28-30 March 1994 in Williamsburg, VA.  

E-Print Network [OSTI]

in the AGT-1500 gas turbine engine of the M1A1 Abrams tank. This paper describes the design and prototype 1994 in Williamsburg, VA. TEDANN: TURBINE ENGINE DIAGNOSTIC ARTIFICIAL NEURAL NETWORK Lars J. Kangas development of the diagnostic system, referred to as "TEDANN" for Turbine Engine Diagnostic Artificial Neural

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Royal SwediSh academy of engineeRing ScienceS (iVa) a TRibuTe To The memoRy of  

E-Print Network [OSTI]

Royal SwediSh academy of engineeRing ScienceS (iVa) a TRibuTe To The memoRy of SVanTe a; A TribuTe To The MeMory of PresenTed AT The 2008 AnnuAl MeeTing of The royAl swedish AcAdeMy; The Royal Swedish Academy of Engineering Sciences (IVA) is an independent, learned society that promotes

Ponce, V. Miguel

122

Advanced Battery Manufacturing (VA)  

SciTech Connect (OSTI)

LiFeBATT has concentrated its recent testing and evaluation on the safety of its batteries. There appears to be a good margin of safety with respect to overheating of the cells and the cases being utilized for the batteries are specifically designed to dissipate any heat built up during charging. This aspect of LiFeBATT抯 products will be even more fully investigated, and assuming ongoing positive results, it will become a major component of marketing efforts for the batteries. LiFeBATT has continued to receive prismatic 20 Amp hour cells from Taiwan. Further testing continues to indicate significant advantages over the previously available 15 Ah cells. Battery packs are being assembled with battery management systems in the Danville facility. Comprehensive tests are underway at Sandia National Laboratory to provide further documentation of the advantages of these 20 Ah cells. The company is pursuing its work with Hybrid Vehicles of Danville to critically evaluate the 20 Ah cells in a hybrid, armored vehicle being developed for military and security applications. Results have been even more encouraging than they were initially. LiFeBATT is expanding its work with several OEM customers to build a worldwide distribution network. These customers include a major automotive consulting group in the U.K., an Australian maker of luxury off-road campers, and a number of makers of E-bikes and scooters. LiFeBATT continues to explore the possibility of working with nations that are woefully short of infrastructure. Negotiations are underway with Siemens to jointly develop a system for using photovoltaic generation and battery storage to supply electricity to communities that are not currently served adequately. The IDA has continued to monitor the progress of LiFeBATT抯 work to ensure that all funds are being expended wisely and that matching funds will be generated as promised. The company has also remained current on all obligations for repayment of an IDA loan and lease payments for space to the IDA. A commercial venture is being formed to utilize the LiFeBATT product for consumer use in enabling photovoltaic powered boat lifts. Field tests of the system have proven to be very effective and commercially promising. This venture is expected to result in significant sales within the next six months.

Stratton, Jeremy

2012-09-30T23:59:59.000Z

123

ZERH Training: Harrisonburg, VA  

Broader source: Energy.gov [DOE]

This 3.5-hour training provides builders with a comprehensive review of zero energy-ready home construction including the business case, detailed specifications, and opportunities to be recognized...

124

UT Arlington 1895 Society Membership Roster  

E-Print Network [OSTI]

Shah (Patel) Thomas W. and Linda Simmons John Staniland Phillip and Janet Stephenson John Tapp David;Daniel W. and Linda Armstrong Mr. and Mrs. Vincent Ashwill Duncan and Sylvaine Aust Sunil Avadhanam John Ball Ray Barber Corlyce Barth Steven S. Barton Susan and Phillip Baxley Anonymous Jonathan Beard

Huang, Haiying

125

UT Arlington Rankin Society Membership Roster  

E-Print Network [OSTI]

Fairchild Aaron L. Farmer Shelly Frank William Frey David H. Gaines Robert Gamble Paul Geisel Randy and Beth Gideon Michael Gingrich John and Judy Goolsby Danny Griffin Mary Groner Sue Harl Ralph and Susan Hawkins. Wesson John and Darlene Wier Dale* and Cindy Will Stephen D. Willey Gretchen N. Williams David F. Wolf

Huang, Haiying

126

UT Arlington Nedderman Society Membership Roster  

E-Print Network [OSTI]

Randall R. Butler, Ph.D. William D. Caldwell Jonathan Campbell and Tanya Dowdey Alan R. Cannon #12;Estella David and Molly Albart Julie S. Alexander Cheri D. Allen Cheryl A. Anderson, Ph.D. Jason Anderson Mindi Ruthie Brock Lance and Amber Brown Julie A. Brown John and Amalia Buckwalter Brian Builta and Sarah

Huang, Haiying

127

Arlington, Virginia: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORTOpenWendeGuo Feng Bio Energy Co

128

Arlington, Texas: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 East 300AlgoilEnergyElectric Coop Corp Place:

129

Fermilab Today | University of Texas at Arlington  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: Vegetation ProposedUsing ZirconiaPolicyFeasibility ofSmall Works:Oklahomaat ChicagoNotre DamePuertoTexas

130

Property:Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar PowerstoriesNrelPartnerType Jump to: navigation,References Jump to:Business01 +

131

Proceedings of the International Conference on Lasers `95, eds. V.J. Corcoran and T.A. Goldman, STS Press, McLean VA, 1996, pp. 225-231. OPTIMIZING HIGH PRESSURE CHEMICAL OXYGEN-IODINE LASERS  

E-Print Network [OSTI]

Press, McLean VA, 1996, pp. 225-231. OPTIMIZING HIGH PRESSURE CHEMICAL OXYGEN-IODINE LASERS David L laser model was baselined to existing oxygen-iodine research assessment and device improvement chemical(1) generator. It may be possible to improve high pressure RADICL performance by increasing the number of large

Carroll, David L.

132

Proceedings of the International Conference on Lasers 2000, eds. V.J. Corcoran and T.A. Corcoran, STS Press, McLean VA, 2001, pp. 265-272.  

E-Print Network [OSTI]

oxygen-iodine laser (COIL) singlet oxygen generator (SOG) based on discharge excitation of molecular/2). Historically, this pumping reaction has been fed by a liquid chemistry singlet oxygen generator (SOG, STS Press, McLean VA, 2001, pp. 265-272. 265 ElectriCOIL: Preliminary Experiments of Excited Oxygen

Carroll, David L.

133

ADVANCED COMPOSITE MATERIALS TECHNOLOGY FOR ROTORCRAFT Andrew Makeev*, University of Texas at Arlington, Arlington, Texas, USA  

E-Print Network [OSTI]

ADVANCED COMPOSITE MATERIALS TECHNOLOGY FOR ROTORCRAFT Andrew Makeev*, University of Texas, Patz Materials & Technologies, Benicia, CA, USA Abstract Composite materials are increasingly used. In polymer-matrix composite structures, matrix-dominated failures impose severe limitations on structural

Texas at Arlington, University of

134

Arlington Campus Welcome Fair Stop by the Arlington Campus' annual Welcome celebration to  

E-Print Network [OSTI]

Pizza & Perspectives Guns in America: Policy and Politics Panelists: Richard E. Rubenstein, Professor Colin Goddard, Campaign Manager, Brady Campaign to Prevent Gun Violence FREE Pizza! 6:00pm-7:15pm

135

Sediment Decontamination For Navigational And Environmental Restoration In NY/NJ Harbor Case Study: Passaic River, New Jersey  

E-Print Network [OSTI]

Sediment Decontamination For Navigational And Environmental Restoration In NY/NJ Harbor 颅 Case, Arlington, VA 22230 Sediments in the NY/NJ Harbor are widely contaminated with toxic organic and inorganic compounds. Decontamination of these sediments is one tool that can be used to cope with the problems posed

Brookhaven National Laboratory

136

NATIONAL SCIENCE FOUNDATION Office of Budget, Finance & Award Management  

E-Print Network [OSTI]

Arlington, VA 22230 Dear Colleagues: We have published a revision to the NSF Grant Proposal Guide (GPG) (NSF had a unique place in the Federal Government: it is responsible for the overall health of science of science and engineering. It does this through grants and cooperative agreements to more than 2

137

Energy Manufacturing Matthew Realff and Steven Danyluk  

E-Print Network [OSTI]

Energy Manufacturing Matthew Realff and Steven Danyluk Georgia Institute of Technology This white Foundation and held in Arlington VA, on March 24-25, 2009 on Energy Manufacturing. The workshop attendees participated in discussions and presented their views on energy manufacturing and the presentations

Das, Suman

138

Optics, Acoustics and Stress in Situ (OASIS): Effects of Aggregation, Vertical Structure, and Relation to Physical Forcing.  

E-Print Network [OSTI]

Optics, Acoustics and Stress in Situ (OASIS): Effects of Aggregation, Vertical Structure. Arlington, VA 22203-1995 TITLE: Optics, Acoustics and Stress in Situ (OASIS): Effects of Aggregation of Research and Sponsored Programs #12;Abstract Nearbed optical and acoustical properties in coastal waters

Boss, Emmanuel S.

139

22 University Parking Stories  

E-Print Network [OSTI]

York's CitiBike bikeshare. Smart Lock vs. Smart Dock Smart lock or smart bike refers to the factMaio, bikeshare program manager for the City of Arlington, Va., and co-founder of MetroBike. Not only was Paul-tired bicycle from the City of Copenhagen's ByCyklen (City Bike) program in tow. We had a brain- storming

Devoret, Michel H.

140

U.S. NUclear WaSte techNical revieW Board  

E-Print Network [OSTI]

U.S. NUclear WaSte techNical revieW Board Report to The U.S. Congress and The Secretary STATES NUCLEAR WASTE TECHNICAL REVIEW BOARD 2300 Clarendon Boulevard, Suite 1300 Arlington, VA 22201 June Speaker Hastert, Senator Stevens, and Secretary Bodman: The U.S. Nuclear Waste Technical Review Board

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

UNITED STATES NUCLEAR WASTE TECHNICAL REVIEW BOARD  

E-Print Network [OSTI]

JEC187V3 UNITED STATES NUCLEAR WASTE TECHNICAL REVIEW BOARD 2300 Clarendon Boulevard, Suite 1300 of Energy 1000 Independence Avenue, SW Washington, DC 20585 Dear Secretary O'Leary: At the Nuclear Waste UNITED STATES NUCLEAR WASTE TECHNICAL REVIEW BOARD 2300 Clarendon Boulevard, Suite 1300 Arlington, VA

142

Other U.S. Nuclear Waste Technical Review Board Correspondence  

E-Print Network [OSTI]

Appendix F Appendix F Other U.S. Nuclear Waste Technical Review Board Correspondence 路 Letter UNITED STATES NUCLEAR WASTE TECHNICAL REVIEW BOARD 2300 Clarendon Boulevard, Suite 1300 Arlington, VA: Acknowledgement of letter 路 Letter from Robert R. Loux, Executive Director, Nevada Agency for Nuclear Projects

143

U.S. Department of Energy Energy Efficiency and Renewable Energy  

E-Print Network [OSTI]

U.S. Department of Energy Energy Efficiency and Renewable Energy Bringing you a prosperous future where energy is clean, abundant, reliable and affordable Report of the DOE Workshop on Hydrogen Separations and Purification September 8-9, 2004 Arlington, VA U.S. Department of Energy Office of Hydrogen

144

Hydrogen Technology Validation: DOE Hydrogen Program 2011 Annual Merit Review and Peer Evaluation Report  

Broader source: Energy.gov [DOE]

This document summarizes the comments provided by peer reviewers on hydrogen and fuel cell projects presented at the FY 2011 U.S. Department of Energy (DOE) Hydrogen Program and Vehicle Technologies Program Annual Merit Review and Peer Evaluation Meeting (AMR), held May 913, 2011 in Arlington, VA.

145

Page 1 of 4 The University of Texas at Arlington  

E-Print Network [OSTI]

-face circular mechanized shield machine, usually of worker-entry diameter, steerable, and with a rotary cutting not applied to those machines where the pressure originates from the main Pipe Jacking rig in the Drive Shaft

Texas at Arlington, University of

146

Department of Civil Engineering The University of Texas Arlington  

E-Print Network [OSTI]

Profile: https://www.uta.edu/mentis/public/#profile/profile/view/id/1915/. Office Hours: Tuesdays. Prestressed Concrete Bridges 10. Load Balancing, One-Way Slabs (if time allows) GTA: Regina Waweru. RM 137

Chao, Shih-Ho

147

Energy Management Retrofit for Arlington Independent School District  

E-Print Network [OSTI]

and for the tracking of the measures to make sure the desired energy conservation goals were met. Finally, the school district requested, a guarantee that savings goal be attained by an agreement that the contractor pay for any "shortfall" in savings that might occur...

Nooner, D.

1989-01-01T23:59:59.000Z

148

Upper Arlington, Ohio: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:Seadov PtyInformation UC 19-6-401 etWisconsin:california JumpEnergy

149

Arlington County, Virginia: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 East 300AlgoilEnergyElectric Coop Corp Place: ArkansasInformation ASHRAE

150

Arlington Heights, Illinois: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 East 300AlgoilEnergyElectric Coop Corp Place: ArkansasInformation

151

Mount Arlington, New Jersey: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to:46 -Energieprojekte3 Climate ZoneMontrose,StanleyAiry, Maryland: Energy

152

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

of Texas Congress Avenue Austin Texas http www biodieselcoalitionoftexas org Texas Area Boots on the Roof Boots on the Roof Automall Parkway Fremont California http www...

153

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Russia Cp Holdings Llc Cp Holdings Llc Stillwater Minnesota Carbon An external carbon advisor DHL Neutral Services DHL Neutral Services Bracknell United Kingdom RG12 AN Carbon...

154

Institution Name Institution Name Address Place Zip Notes Website...  

Open Energy Info (EERE)

www ecn nl home Energy Technology Data Exchange Energy Technology Data Exchange P O Box Oak Ridge Tennessee http www etde org home html Energy Environment and Development Network...

155

Name Name Address Place Zip Category Sector Telephone number...  

Open Energy Info (EERE)

Laboratory Inc Shrewsbury Street Holden Massachusetts Category Testing Facility Operators Hydro http www aldenlab com Alden Tow Tank Alden Wave Basin Alden Small Flume Alden Large...

156

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Solar Wisconsin based based company that makes both...

157

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

CECO Environmental Corp CECO Environmental Corp Cincinnati Ohio Services Provider of air pollution control products and services CEEG NanJing New Energy CEEG NanJing New...

158

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Boston Area Green Fuel Technologies Corporation Green Fuel Technologies Corporation Smith Place Cambridge Massachusetts Biofuels Recycles CO2 from flue gases to produce...

159

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Energy Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany...

160

Exploring zipping and assembly as a protein folding principle  

E-Print Network [OSTI]

C. Are there pathways for protein folding? Journal de Chimieand the mechanism of protein folding. Ann Rev Biochem 1982;Baldwin RL. How does protein folding get started? TRENDS in

Voelz, Vince A; Dill, Ken A

2007-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerCons Coop,

162

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerCons

163

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerConsSolar

164

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas

165

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar Energy

166

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar Energys

167

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar

168

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(UtilityCounty, Michigan:OregonTransmissionHeader.png Roadmap

169

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(UtilityCounty, Michigan:OregonTransmissionHeader.png RoadmapCambridge Energy

170

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)Columbus

171

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom Efficiency

172

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom EfficiencyLLC

173

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom EfficiencyLLCe

174

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom

175

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den Berg A

176

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den Berg

177

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den BergAG

178

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den

179

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan denAFS

180

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United KingdomvanPartners ANV

182

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United KingdomvanPartners

183

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Designs manufactures and exports solar tube thermal solar collectors solar storage tanks waste heat recovery systems solar controllers and related components Arava Power...

184

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Thessaloniki Greece Renewable Energy Solar Water Heaters Solar Collector Hot water Tanks http www mevaconh gr MGE UPS SYSTEMS Inc MGE UPS SYSTEMS Inc Costa Mesa California...

185

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

GmbH Braunschweig Germany Solar Manufactures and markets solar collectors hot water tanks and heating Solydair Energies Solydair Energies Miraval Les Thuiles Renewable Energy...

186

Name Address Place Zip Sector Product Stock Symbol Year founded...  

Open Energy Info (EERE)

Free Flow has raised some initial funding and is prototype testing in rivers and tanks http www free flow power com Functional Design Engineering Inc Marine and Hydrokinetic...

187

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Designs manufactures and exports solar tube thermal solar collectors solar storage tanks waste heat recovery systems solar controllers and related components Apros Solar Apros...

188

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

energy Wind energy Germany based power project developer particularly active in wind and biogas projects and now starting to do geothermal BE Geothermal GmbH BE Geothermal GmbH...

189

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

power http www relion inc com Pacific Northwest Area Roth Rau AG Roth Rau AG Zimmritz Germany Hydro Hydrogen Solar Roth Rau offers equipment for fully automated solar cell...

190

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to: navigation,CSU Institute

191

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to: navigation,CSU

192

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:

193

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:Fraunhofer Center for

194

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:Fraunhofer Center

195

Name Name Address Place Zip Category Sector Telephone number Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBus Jump to:NSTAR

196

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:

197

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:Washington Second

198

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:Washington

199

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:WashingtonTIER

200

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump23 Systems A123

202

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump23 Systems A1230

203

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <Foundation American

204

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <Foundation

205

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <FoundationFund

206

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives

207

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum California Coast

208

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum California

209

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum CaliforniaCompany

210

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORT Americium/CuriumSunways JVGroupChoice Logo: ColoradoVoltz Limited

211

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORT Americium/CuriumSunways JVGroupChoice Logo: ColoradoVoltz

212

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia Menlo Avenue

213

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia Menlo

214

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexas

215

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasInc

216

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasInc

217

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasIncA1

218

Property:Incentive/Cont4Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County, Maine:PlugNumberOfArraProjectTypeTopic2GrossGenYes,Phone"AEP

219

Property:Incentive/ContZip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County,ContAddr2 Jump to: navigation, search Property

220

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled Geothermal CapacityRenewable

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled Geothermal

222

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled GeothermalInstitution Name

223

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled GeothermalInstitution

224

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled

225

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalledResearch Caltech Center for

226

13286 J. Phys. Chem. 1994,98, 13286-13293 Kinetics of Ti(a3F,a5F)and V(a4F,a6D)Depletion by NH3 and H2S  

E-Print Network [OSTI]

) and V(a6D) upon interactions with NH3 and HzS are studied in a fast-flow reactor at a He pressure of 0) x Introduction Information about the gas-phase kinetics for the reactions of simple molecules studied the activation of NH3 and H2S by neutral titanium and vanadium atoms. In addition to the gas

Clemmer, David E.

227

4th U.S.-China Energy Efficiency Forum  

Office of Energy Efficiency and Renewable Energy (EERE)

The U.S. Department of Energy and China's National Development and Reform Commission held the annual U.S.-China Energy Efficiency Forum (EEF) this past September in Arlington, VA. The day-long event featured keynotes from DOE Office of Energy Efficiency and Renewable Energy Assistant Secretary Dr. David Danielson, U.S. Special Envoy for Climate Change Todd Stern, and NDRC Vice Chairman Xie Zhenhua.

228

VA-Squish User's Guide Introduction  

E-Print Network [OSTI]

functions (CAX4P) were used. The cartilage specimen diameter in the model was six times the diameter

Stanford University

229

Guide to VA Mental Health Services  

E-Print Network [OSTI]

, worthlessness, helplessness, hopelessness Unhealthy behavior (gambling, drugs Problems functioning at home #12 that is Sensitive to Gender and Culture #12;路 Care Close to Home 路 Evidence Based Treatment 路 Family and Couples, appetite, weight or sex Headaches/other body pain Muscle tension/weakness Decreased energy, motivation

Hardy, Christopher R.

230

US SoAtl VA Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

an average of 86 million Btu per year, about 4% less than the U.S. average. * Average electricity consumption and costs are higher for Virginia households than the national...

231

acia d髇de va el teatro en Cali!  

E-Print Network [OSTI]

quedan muecos. Esta repolarizaci髇 se hizo evidente en el movimiento teatral. Se polarizan las simpat韆s hacia las tendencias internacionales de la izquierda; aparecen los caf閟 conciertos; el Teatro Libre estableci la contradicci髇 frontal con el... por oficio, por apropiaci髇 de textos, de t閏nicas de montaje, de esquemas de direcci髇 de actores, de ayudas tecnol骻icas-para lograr ante todo un buen negocio. 110 LATIN AMERICAN THEATRE REVIEW Queremos recibir sorpresas de cr韙ica responsable...

Cajamarca Castro, Orlando

1990-10-01T23:59:59.000Z

232

US SoAtl VA Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S. NaturalA. Michael SchaalNovember 26,8,CoalThousandIL SiteMidAtl PANE MASoAtl

233

arlington virginia 16-18: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Virginia Tech has aggressively established collaborations. The foundation serves the university by generating significant funding from private sources and aggressively...

234

The University of Texas at Arlington College of Nursing Equivalency Chart for: St. Philips College  

E-Print Network [OSTI]

Course Name SPC Course Number SPC Course Name BIOL 2457 Human Anatomy and Physiology I BIOL 2401 Human/or POLS 2312 only if both courses were taken at SPC. If both courses were not taken at SPC contact a UTA

Huang, Haiying

235

The University of Texas at Arlington College of Nursing Equivalency Chart for: South Plains College  

E-Print Network [OSTI]

Course Name SPC Course Number SPC Course Name BIOL 2457 Human Anatomy and Physiology I BIOL 2401 Anatomy only if both courses were taken at SPC. If both courses were not taken at SPC contact a UTA nursing

Huang, Haiying

236

Center for Underground Infrastructure Research and Education The University of Texas at Arlington  

E-Print Network [OSTI]

practitioners. They have many years of experience in pipelines and trenchless technology construction, renewal design and construction inspection. Currently, he is district manager with National Clay Pipe Institute manufacturers and consultants, he has designed over 2,000 individual pipeline projects for a variety of pipe

Texas at Arlington, University of

237

Pre-Retrofit Lighting Study at the University of Texas at Arlington, Texas  

E-Print Network [OSTI]

Audit Report for the site, completed in 1991, recommended a lighting retrofit that included delamping, relamping with high efficiency lamps, the installation of high efficiency electronic ballasts, and the installation of specular reflectors. However...

Houcek, J. K.; Claridge, D. E.; Haberl, J. S.

1993-01-01T23:59:59.000Z

238

The University of Texas at Arlington Department of Materials Science & Engineering  

E-Print Network [OSTI]

, and (c) formulation of polymer gels with ionic liquids as potential electrolytes for lithium batteries' research utilizes molecular interactions and supramolecular assemblies to develop products with desired

Texas at Arlington, University of

239

PARKING INSTRUCTIONS FOR ACES 2014 ATTENDEES Crystal Gateway Marriott Hotel Arlington, Virginia  

E-Print Network [OSTI]

of the Capitol Tower) to check-in to your guestroom. From the hotel's front desk, the ACES meeting rooms

Florida, University of

240

This article was downloaded by:[UT Arlington] On: 7 September 2007  

E-Print Network [OSTI]

-distribution, re-selling, loan or sub-licensing, systematic supply or distribution in any form to anyone near Batticaloa at the coast of Sri Lanka encompasses coral reefs and sandy clay over gravel

Winguth, Arne

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Microsoft PowerPoint - [4] HVDC Technology Workshop Arlington April 2013 RevC [Compatibility Mode]  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankCombustion | Department ofT ib l L d F S i DOE Tribal Leader ForumStatus of theCustomer-Sited5/2007AGNeil

242

Arlington County, Virginia ASHRAE 169-2006 Climate Zone | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 East 300AlgoilEnergyElectric Coop Corp Place: ArkansasInformation ASHRAE 169-2006

243

The University of Texas at Arlington Trailblazers: Pathways to Effective Supervision  

E-Print Network [OSTI]

and Evaluations) VII. Keeping your traveling partners emotionally healthy: (Employee Assistance Program) VIII Handling) XV. When your Traveling Partners Need a Break (Vacation, Sick-leave, Holidays, Inclement Weather, FMLA) Appendix A: Trailblazers Program Appendix B: Trailblazers Course Descriptions Appendix C

Weems, Bob

244

A Unified and Integrated Energy Management System for HVAC Spaces and Power House  

E-Print Network [OSTI]

sense operations. Some of the are: control of lighting; shedding the loads on increase, electrical demand; operating the air moving fan intermittently to save energy. The interest here is 0 control and optimization methods to improve energ...", Bailey Controls Co., Wickliffe, Ohiq, U.S.A. 5. Matski, T.N., et ai, "Optimal Boiler Load Allocatior in Distributed Control", Proc. of 1962 ACq, Arlington, VA, USA. 6. Kaya, A., et ai, .. Load Control for Energ;y Converters", U.S. Patents 4, 412...

Kaya, A.; Debban, G. D.

245

Hybrid Bayesian Networks with Linear Deterministic Variables  

E-Print Network [OSTI]

Conference (UAI-05), 2005, AUAI Press, Arlington, VA. 136 Y X Z Figure 2: A Bayesian Network Representation of the Mixed Distribution for X. this example, Y is a discrete variable with state space ? Y = {1,2,3}, Z is a real-valued variable, and X is a... conditionally deterministic variable whose condi- tional distribution is described as follows: X |{y,z} = y if y =1,2 and X |{y,z} = z if y =3. Potentials of the type described above are used in this paper to represent distributions of variables in hy- brid...

Cobb, Barry R.; Shenoy, Prakash P.

2005-07-01T23:59:59.000Z

246

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United...

247

Functional genomics analysis of the arabidopsis ABI5 bZIP transcription factor  

E-Print Network [OSTI]

results correlated best with qRT-PCR validation data for selected genes. A small number of genes including AtCOR413 pm-1 showed a consistent expression pattern across the three platforms. A robust ABRE cis-regulatory element was identified in the promoter...

Hur, Jung-Im

2009-05-15T23:59:59.000Z

248

Address State: Zip: All participants: please complete the form below and return it to  

E-Print Network [OSTI]

to UCDEA Contact the Retiree Center via e-mail: retireecenter@ucdavis.edu or telephone: (530) 752-5182

Schladow, S. Geoffrey

249

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

Last Name URL Products/Services NAICS Code NAICS Description &yet 2008 140 Gage Blvd Suite 100 Richland and user experience professionals. Build products, consult, and educate internationally and locally. 5415 Engineering, construction--air conditioning 5413 Architectural, engineering, and related services Advanced

250

A circular electrostatic zipping actuator for the application of a MEMS tunable capacitor  

E-Print Network [OSTI]

Micromechanical circuits such as MEMS switches, tunable capacitors (varactors) or resonators in general have lower loss and consume less power than their CMOS counterparts and have seen an increase of applications in ...

Yang, Xue'en, 1975-

2005-01-01T23:59:59.000Z

251

LAST NAME: FIRST NAME: M.I.: MAILING ADDRESS: CITY: STATE: ZIP  

E-Print Network [OSTI]

AND ISI S INFORMATION ORIGINAL ISIS TRANSACTION NUMBER: ______________ AMOUNT CREDITED TO ISIS: $______________ NEW ISIS TRANSACTION NUMBER: ______________ REFUND DUE CUSTOMER: $______________ DATE PROCESSED IN ISIS: Distribution: White-Accounting Yellow-Customer CREDIT STUDENT (ISIS) ACCOUNT REFUND (CHECK

Tsien, Roger Y.

252

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

water heating systems in the Tri-cities and surrounding area 2382 Solar Heating equipment installation, Environmental Services, Calibration Services, Facilities Leasing, Industrial Development 2211 Electric power generation in irrigation canals 2211 Electric power generation, transmission and distribution Columbia Basin

253

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

is the premier provider of residential and commercial solar thermal water heating systems in the Tri, Environmental Services, Calibration Services, Facilities Leasing, Industrial Development 2211 Electric power-cities and surrounding area 2382 Solar Heating equipment installation Air Liquide America Corp 1902 231808 E Sr 397

254

3D compression: from A to Zip: a first complete example THOMAS LEWINER  

E-Print Network [OSTI]

the design of compression schemes adapted to specific class of models. The recent launch of Google Sketch'up

Lewiner, Thomas (Thomas Lewiner)

255

Phosphorylation of the Parsley bZIP Transcription Factor CPRF2 Is Regulated by Light*  

E-Print Network [OSTI]

in response to light, we analyzed the common plant regulatory factor 2 (CPRF2) from parsley (Petroselinum

Sch鋐er, Eberhard

256

Determining protein interaction specificity of native and designed bZIP family transcription factors  

E-Print Network [OSTI]

Protein-protein interactions are important for almost all cellular functions. Knowing which proteins interact with one another is important for understanding protein function as well as for being able to disrupt their ...

Reinke, Aaron W

2012-01-01T23:59:59.000Z

257

Quick Start The various sample data files after expansion (use Zip)  

E-Print Network [OSTI]

library (49 signature files and 1 library list file, all in ASCII, 300 KB). Duncan Knob.sdf Lidar full wave form SDF file (60 MB). Duncan Knob.idx Required index file for Duncan Knob.sdf (4.5 MB). sbet_mission 1.out Smoothed Best Estimate of Trajectory file. Needed for Duncan Knob.sdf (98 MB). Immediate

258

Photo of the Week: Power Up! Twenty Steps to Zip a Zipper | Department of  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankCombustion | Department ofT ib l L d F SSalesOE0000652GrowE-mail on August

259

Looking for a way to find utilites per zip code (a list?) | OpenEI  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climateJuno Beach,October,LighthouseInformationLongwood is

260

Name Address Place Zip Sector Product Stock Symbol Year founded Number  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's HeatMexico: EnergyMithun JumpMuscoy,Jump9 Case Data Survey Type LotNYSERDAZip

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

State Oil and Gas Board State Oil and Gas Board Address Place Zip Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revisionEnvReviewNonInvasiveExplorationUT-g GrantAtlas (PACA RegionSpringview IISt.StarlightSystem

262

Do we get actual vendor name while we searched with zip code? | OpenEI  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6 No revision has TypeGeothermal Area JumpSix Well Flow

263

Electric Utility Company Assigned to a Zip Code? | OpenEI Community  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Power Basics (The followingDirectLow CarbonOpen1Model | OpenCDWR) Jump

264

NoVaS Transformations: Flexible Inference for Volatility Forecasting  

E-Print Network [OSTI]

estimators of the parameters in GARCH processes, Annals ofand Switching-Regime GARCH Models, Stochastic Processes andParameter Changes in GARCH Models, Journal of Econo-

Politis, Dimitris N; Thomakos, Dimitrios D

2008-01-01T23:59:59.000Z

265

Physical Properties of Intermetallic FE2VA1  

SciTech Connect (OSTI)

Fe{sub 2}VAl has recently been discovered to have a negative temperature coefficient of resistivity, moderately enhanced specific heat coefficient, and a large DOS at the Fermi level by photoemission. This triggered a round of heated research to understand the ground state of this material, both theoretically and experimentally. here they report a comprehensive characterization of Fe{sub 2}VAl. X-ray diffraction exhibited appreciable antisite disorder in all of our samples. FTIR spectroscopy measurements showed that the carrier density and scattering time had little sample-to-sample variation or temperature dependence for near-stoichiometric samples. FTIR and DC resistivity suggest that the transport properties of Fe{sub 2}VAl are influenced by both localized and delocalized carriers, with the former primarily responsible for the negative temperature coefficient of resistivity. Magnetization measurements reveal that near-stoichiometric samples have superparamagnetic clusters with at least two sizes of moments. X-ray photoemission from Fe core level showed localized magnetic moments on site-exchanged Fe. They conclude that in Fe{sub 2}VAl, antisite disorder causes significant modification to the semi-metallic band structure proposed by LDA calculations. With antisite disorder considered, they are now able to explain most of the physical properties of Fe{sub 2}VAl.

Ye Feng

2002-05-30T23:59:59.000Z

266

amalkard va khavase: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Management 12;Sample page of a Business Book Summaries Comprehensive Summary n Finance n Global Business n with Business Book Summaries (BBS). BBS provides comprehensive yet...

267

amalkard va zoodrasi: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Management 12;Sample page of a Business Book Summaries Comprehensive Summary n Finance n Global Business n with Business Book Summaries (BBS). BBS provides comprehensive yet...

268

ByH enr T. Va G ner al ........ ...  

E-Print Network [OSTI]

The most popular and productive method of harvesting sponges in Libya is thr ough the use of Machin~ diving

269

Energy Department Recognizes City of Roanoke, VA for Leadership...  

Office of Environmental Management (EM)

Plan, the Better Buildings Challenge supports the goal of doubling American energy productivity by 2030 while motivating corporate and public sector leaders across the country to...

270

OfficeofAlumniRelations Charlottesville,VA22906-7726  

E-Print Network [OSTI]

types is critical fuel for Darden's success.Tracking data around alumni engagement activities provides at the following link: www.darden.virginia.edu/leadershipRT. Alternately, you can call +1-434-243-8977. Hotel Information We invite you to stay at the Inn at Darden (formerly Sponsors Executive Residence Center). To make

Acton, Scott

271

Communication and Collaboration Keep San Francisco VA Medical...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Francisco The VAMC is located on the historic site of Fort Miley, overlooking the Pacific Ocean and the Golden Gate Bridge in San Francisco. With 28 buildings and 1 million...

272

Contract Connections @ ChallengeHER Norfolk, VA, October 14, 2014  

Broader source: Energy.gov [DOE]

The U.S. Small Business Administration (SBA), Women Impacting Public Policy (WIPP), and American Express OPEN have partnered to host this special FREE contracting event for women business owners....

273

Proceedings of the RESOLVE Workshop 2006 Blacksburg, VA  

E-Print Network [OSTI]

#12;ii #12;iii Preface and Grade Resolve/C++ Programs ....................................6 Stephen H. Edwards, Virginia Tech Some Joan Krone, Denison University, and William F. Ogden, The Ohio State University Issues in the Creation

Edwards, Stephen H.

274

Chief, Medical Service VA Palo Alto Health Care System  

E-Print Network [OSTI]

Community Based Outpatient Clinics (CBOC). VAPAHCS has 833 operating beds, which include 100 acute care beds, and students are trained each year. As the Chief, Medical Service, the incumbent will maintain a joint

Quake, Stephen R.

275

Mitochondrial DNA phylogenetic analysis of Myrmecolacidae (Insecta: Strepsiptera) va  

E-Print Network [OSTI]

Guinea are determined. Methods were developed for extraction, amplification, and sequencing of mitochondrial DNA (mtDNA) from Strepsiptera. High-resolution mtDNA sequences obtained by these methods were used in the phylogenetic analysis of Myrmecolacidae...

Halbert, Natalie Rose

2013-02-22T23:59:59.000Z

276

VA-1-B Wholesale Power Rate Schedule | Department of Energy  

Office of Environmental Management (EM)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "of EnergyEnergyENERGYWomen Owned SmallOf The 2012Nuclear Guide Remote Access08:Energy 94:Service2 1 2

277

VA-2-B Wholesale Power Rate Schedule | Department of Energy  

Office of Environmental Management (EM)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "of EnergyEnergyENERGYWomen Owned SmallOf The 2012Nuclear Guide Remote Access08:Energy 94:Service2 1 22-B

278

VA-3-B Wholesale Power Rate Schedule | Department of Energy  

Office of Environmental Management (EM)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "of EnergyEnergyENERGYWomen Owned SmallOf The 2012Nuclear Guide Remote Access08:Energy 94:Service2 1

279

VA-4-B Wholesale Power Rate Schedule | Department of Energy  

Office of Environmental Management (EM)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "of EnergyEnergyENERGYWomen Owned SmallOf The 2012Nuclear Guide Remote Access08:Energy 94:Service2 14-B

280

Heavy ion beam probe operation in time va  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: Vegetation ProposedUsingFun with Bigfront.jpgcommunity200cellHeat Transfer in GEoperation in time varying

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Energy Secretary Moniz's Remarks at Hampton University in Hampton, Va. --  

Broader source: Energy.gov (indexed) [DOE]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "ofEarly Career Scientists'Montana.Program -Department oftoThese WebThese caseEnergy WashingtonEmployees|As

282

DOE - Office of Legacy Management -- Mobil Oil Corp - VA 01  

Office of Legacy Management (LM)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "ofEarlyEnergyDepartment ofDepartment ofof EnergyYou are herePA 30 Minneapolis-HoneywellMobil Oil

283

DOE - Office of Legacy Management -- Norfolk Naval Station - VA 05  

Office of Legacy Management (LM)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "ofEarlyEnergyDepartment ofDepartment ofof EnergyYou are herePA 3003A AECMexicoEnglandNorfolk

284

DOE - Office of Legacy Management -- Reynolds Metals Co - VA 04  

Office of Legacy Management (LM)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "ofEarlyEnergyDepartment ofDepartment ofof EnergyYou are herePAOsborne Co -0-19GasKReedRevere

285

Energy Secretary Moniz's Remarks at Hampton University in Hampton, Va. --  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:YearRound-UpHeat PumpRecord ofESPC ENABLE:2009Applications - Report |of Energy toVisits|to|As

286

VA's Performance Contracting Program Overview | Department of Energy  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:YearRound-Up from theDepartment of Dept. ofUSAPotentially SensitiveUsers ExecuteDepartment

287

VA-s--- ' At&LYTlCAL DATA SHEET  

Office of Legacy Management (LM)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "ofEarlyEnergyDepartment ofDepartment ofof EnergyYou$0.C. 20545 OCTTO: FILEWAWINQTON,ocyAUG* ->V,

288

DiVaDiVa is een Digitale nieuwsbrief van de vier Vakbonden vertegenwoordigd op de TU/e  

E-Print Network [OSTI]

. Nieuwe benadering van de indeling van secretaressefuncties Er is op basis van het primaire UFO TU/e. De UFO-indelingscriteria zijn concreter benoemd en de functiezwaarte elementen zijn voor de

Franssen, Michael

289

DiVaDiVa is een Digitale nieuwsbrief van de vier Vakbonden vertegenwoordigd op de TU/e  

E-Print Network [OSTI]

faculteit TM 路 Rouwprotocol 路 Heroverwegingsbesluit UFO 路 FPU-opgave aanvragen via " Mijn.v. bij overlijden). Binnenkort kunt u de tekst vinden op de site van de TU/e. Heroverwegingsbesluit UFO Als u het niet eens bent met de UFO- indeling van uw functie, bijv. omdat taken niet meegewogen zijn

Franssen, Michael

290

DiVaDiVa is een Digitale nieuwsbrief van de vier Vakbonden vertegenwoordigd op de TU/e  

E-Print Network [OSTI]

gedefinieerd als werknemers met een aanstelling voor bepaalde tijd die zijn ingedeeld op UFO u er alsnog op attent maken dat de UFO-indelingscriteria concreter zijn benoemd en de functiezwaarte

Franssen, Michael

291

Helen Gordon Child Development Center WAITLIST APPLICATION  

E-Print Network [OSTI]

____ Zip Code________ Cell Phone _______________ Other Phone ________________ E ____ Zip Code________ Cell Phone _______________ Other Phone ________________ E

Lafferriere, Gerardo

292

MEDICAL ENTRANCE FORM (REQUIRED) UNDER 18 YEARS OF AGE ONLY  

E-Print Network [OSTI]

: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ____________ Daytime phone: _________________ Evening phone: _________________ Email

Weitz, Joshua S.

293

AIAA 99-2448 Experiments on Weakly-Ionized Air and  

E-Print Network [OSTI]

National Cheng Kung University Tainan, TAIWAN and W.S. Stuessy The University of Texas at Arlington Facility Development F.K. Lu, D.R. Wilson The University of Texas at Arlington Arlington, TX H.-C. Liu

Texas at Arlington, University of

294

ADDRESS: STATE: ZIP: Please complete the appropriate section of this form along with your check made payable to UC Regents.  

E-Print Network [OSTI]

@ucdavis.edu or telephone: (530) 752-5182 No tickets will be sent. You will receive a reminder via e-mail prior to the event

Thomases, Becca

295

Name AKA_FKA Contract # Start Date End Date Contract Scope City State Zip Phone Site Last Review  

E-Print Network [OSTI]

experience Fossil OR 97830 541.763.2725 3 Ashland Pediatrics AFF-2009-1389 04/15/2010 06/30/2015 Nursing students clinical learning experience Ashland OR 97520 541.482.8114 1 Ashland School District #5 AFF-2012-0933 07/01/2012 06/30/2017 Nursing students clinical learning experience Ashland OR 97520 541.482.8771 6

Chapman, Michael S.

296

Investigating the Aggregation of the Basic Leucine Zipper (bZIP) Domain of Activating Transcription Factor 5 (ATF5)  

E-Print Network [OSTI]

was amplified using PCR for insertion to a plasmid using the following primers: 5扜CGCGCCCATGGGCCCTGCCACCACCCGA3 (forward primer with NcoI restriction site), 5扜CGCGCCATATGCCTGCCACCACCCGAGGG3 (forward primer with NdeI restriction site), 5.... The NcoI site was used to insert the ATF5 gene following a Glutathione-S-Transferase (GST) tag, whereas insertion at the NdeI site generated a construct from which untagged ATF5 could be expressed. The ligation product was transformed into competent...

Ciaccio, Natalie Anne

2010-05-31T23:59:59.000Z

297

2011-2012 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang

298

Cal State Fullerton Alumni Association Candidate Information Sheet  

E-Print Network [OSTI]

________________________________________________________________________ City____________________________________________State_________ ZIP__________________ Home phone__________________________Cell phone_______________________________________ Company name________________________________________________________________________ City____________________________________________State_________ ZIP____________________ Business Phone

de Lijser, Peter

299

2012-2013 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang

300

International Microwave Power Institute 15 V.A. Mechenova1,2  

E-Print Network [OSTI]

technique (Bandler et al., 1997, 2001) and some other schemes (e.g., Alessandri et al., 1993, 1997, Zhang

Yakovlev, Vadim

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

E-Print Network 3.0 - aspire-va pilot study Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

aircraft and both pilots of the UAVs in this study seemed slightly more accepting of a UAV role... , should not be automated. However, as demonstrated by ... Source: Cummings,...

302

Microsoft Word - DM_VA-#126832-v3-Smart_Grid_Comments_--_DOE...  

Broader source: Energy.gov (indexed) [DOE]

social norms to help shape energy consumption. As a result of this historic pattern of energy consumption, there has until recently been little effective demand among consumers...

303

adi-e abiari va: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Management 12;Sample page of a Business Book Summaries Comprehensive Summary n Finance n Global Business n with Business Book Summaries (BBS). BBS provides comprehensive yet...

304

abiari va tanesh-e: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Management 12;Sample page of a Business Book Summaries Comprehensive Summary n Finance n Global Business n with Business Book Summaries (BBS). BBS provides comprehensive yet...

305

Dynamical Models Explaining Social Balance and Evolution of Cooperation V.A. Traag,1  

E-Print Network [OSTI]

are bal- anced. Such a balanced network can be split into (at most) two opposing factions with posi- tive links within a faction and negative links be- tween them.3 Although inherently dynamical, the theory has Unbalanced Two Factions FIG. 1. Social Balance. The two upper triads are balanced, while the two lower triads

De Leenheer, Patrick

306

E-Print Network 3.0 - alphavirus vector va7 Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

virus (40). Alphaviruses... of Marine Mammals: a New Alphavirus Isolated from the Elephant Seal Louse, Lepidophthirus macrorhini MAY LA... Accepted 29 January 2001 A novel...

307

A VaR Black-Litterman Model for the Construction of Absolute ...  

E-Print Network [OSTI]

rithmic technique is very efficient, outperforming, in terms of both speed and ..... It can be seen that the error term vector ? does not directly enter the Black-

2009-06-02T23:59:59.000Z

308

Naval Station Norfolk, VA- Energy Conservation Program UESC Partnership Success Story  

Broader source: Energy.gov [DOE]

Presentation梘iven at the Federal Utility Partnership Working Group (FUPWG) Fall 2008 meeting梒overs the basis for success of a U.S. Navy utility energy service contract (UESC) project at a Naval Station in Norfolk, Virginia, including the project phases and why the utility partnership works.

309

Economic Impact of the ACESA of 2009 on the W.Va. Economy 1 Policy Brief  

E-Print Network [OSTI]

.9 million. #12;Industry Sector/Entitlement Program ARRA Direct Expenditures Forestry, Fishing, Related or they may be jobs that were saved. Industry Sector Change in Employment Forestry, Fishing, Related

Mohaghegh, Shahab

310

Communication and Collaboration Keep San Francisco VA Medical Center Project on Track  

Broader source: Energy.gov [DOE]

The Veterans Affairs Medical Center in San Francisco is saving almost 3 million kilowatt-hours of electricity, more than 70,000 therms of natural gas, and more than $500,000 annually. The energy savings are enough to power 400 homes and supply natural gas to more than 100 homes each year in California. These savings were realized by taking advantage of Super Energy Savings Performance Contracts (Super ESPCs) developed by the U.S. Department of Energy's Federal Energy Management Program (FEMP).

311

Requisitos de Postulacin La postulacin deber realizarse por va electrnica o  

E-Print Network [OSTI]

Clases: Marzo. Duraci贸n: 18 meses. Tiempo de Dedicaci贸n: Jornada Vespertina. Becas OMC y WTI: Otorgadas

Rapaport, Iv谩n

312

FEBRUARY Results 24--Danville College Danville, VA 1:00 DH L 9-15  

E-Print Network [OSTI]

Mt. Vernon, OH 4:30 L 0-6 9-- Southern State College Newark, OH 1:00 DH W 7-0 W 7-0 11/12/13 ORC University Hamilton 1:00 W 10-8 13-- Miami University Hamilton 1:00 W 4-0 漏 ORC Conference Game #12;

313

If you reside in WASHINGTON, DC - MD -VA - WV your salary will...  

National Nuclear Security Administration (NNSA)

165,300 05 EKEJEN 148,510 165,300 If you are employed in OAKLANDLIVERMORE, CA your salary will range from: Pay Band Pay Plan(s) Minimum Maximum Developmental EN...

314

E-Print Network 3.0 - absorption va vibrational Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of a protein, which deviate only... direct insights into the reaction mechanism at the atomic level. Absorption spectrum of a protein... In Figure 1 a typical absorption...

315

V&A Medieval & Renaissance Galleries: A Passive Approach to Humidity Control  

E-Print Network [OSTI]

Victoria & Albert Museum, London Medieval & Renaissance Galleries: A Passive Approach to Humidity Control Andrew Lerpiniere Steve Walker Michael Bingham Associate Director Associate Director Engineer Arup London, UK ABSTRACT The new... of the galleries. REFERENCES 1. Victoria & Albert Museum; Medieval & Renaissance; Environmental Analysis of Perimeter galleries; November 2006; Andrew Lerpiniere, Michael Bingham, Steve Walker ? Arup 2. Museum Environmental Conditions in an Era...

Lerpiniere, A.

2011-01-01T23:59:59.000Z

316

8618 Westwood Center Drive, Tysons, VA 22182 www.delcan.com Seventeenth Annual Freight and  

E-Print Network [OSTI]

- Railroads - Water - Oil Pipelines - Air - Forwarders OTHER COSTS 路 Shipper Related Costs 路 Logistics Carriers Railroads Water (International 27, Domestic 7) Oil Pipelines Air (International 13, Domestic 20 of the Federal Reserve System 0 1 2 3 4 5 6Percent Federal Reserve's Commercial Paper Rate #12;8 Capacity

Minnesota, University of

317

Microsoft Word - Moving to a Clean Energy Economy-VA 9 24 09...  

Broader source: Energy.gov (indexed) [DOE]

Liquids - - 2007 Recoverable Coal at Producing Mines 256 million short tons 1.4 % 2007 Rotary Rigs & Wells Virginia Share of U.S. Period Rotary Rigs in Operation 5 0.3% 2008...

318

E-Print Network 3.0 - aftab-gardan va soya Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

(B40). Among four available emissions (CO, ... Source: Kuhl, Michael E. - Department of Industrial and Systems Engineering, Rochester Institute of Technology Collection:...

319

Case Study- The Department of Veterans Affairs West Haven Campus, VA Connecticut Health Care System  

Broader source: Energy.gov [DOE]

The West Haven (Connecticut) Campus of the Veterans Affairs Connecticut Health Care System was the first Veteran's Hospital to award a shared energy savings (SES) contract (now known as energy savings performance contracts). The project involves replacement of the lighting system, installation of a cooling system, maintenance of the new chiller equipment, and several smaller efforts. Up-front costs are being provided through a $3.9 million investment by the contractor, EUA Cogenex, about $400,000 in rebates from the local utilities for gas and electric service (Southern Connecticut Gas and United Illuminating Company, respectively), and guaranteed energy cost savings over the life of the contract. The Government's share of energy savings over the 16 year contract is expected to be $880,000.

320

POLARIZED TARGETS AND BEAMS PARALLEL SESSION Je erson Lab, Newport News, VA23606, USA  

E-Print Network [OSTI]

targets, D. Crabb Virginia re- ported the progress at Je erson Lab on the polarized solid targets. New developments and improvements are still emerging to meet the increasing demand of this eld at a certain temperature T, the energy split of the di erent particle spin states depends on B kT, where

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

JONATHAN V. L. KISER, M.B.A. President, Kiser Environmental Consulting, Harrisonburg, VA 22801  

E-Print Network [OSTI]

Economics and Public Policy, George Washington U., 1992 B.S., Resource Economics, University of New Hampshire, 1980. PROFESSIONAL AFFILIATIONS Solid Waste Association of North America (SWANA) Columbia Waste Services Association Staff Alumni & former Manager with National Solid Wastes Mgt. Association

322

Review: Lenka Va?kov et al.: Emotionalit鋞 in deutschen und tschechischen Medientexten  

E-Print Network [OSTI]

?? ? ????????????????????????????????????? ?????????????? (Emotionsdarstel lung in Leserbriefen im deutsch璽sche chischen Vergleich???????????????????? 1 ?????????????????????????????????????????????????????????Ausdrucksmittel der Emotio nalit鋞 im deutsch...

Jesen歟k, Vida

2014-02-03T23:59:59.000Z

323

E-Print Network 3.0 - amplicon va derived Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

amplicons were accomplished using Big Dye Terminator version 3.1 (Ap- plied Biosystems, Inc Source: Forsyth, Mark - Department of Biology, College of William and Mary Collection:...

324

DOE Zero Ready Home Case Study: Promethean Homes, Gross-Shepard Residence, Charlottesville, VA  

Broader source: Energy.gov (indexed) [DOE]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "ofEarly Career Scientists'Montana. DOCUMENTSof EnergyAllianceDepartment of Energy SpiritIndoorPromethean

325

MARTIN H. DAVIES Department of Economics Washington and Lee University Lexington, VA 24450 USA  

E-Print Network [OSTI]

, and Technology Transfer Supervisor: J. Peter Neary Examiners: Richard Baldwin (external), Simon Cowan (internal; Paper: Technology Transfer and North-South Trade US International Trade Commission, Washington DC, 20, 2011; Paper presented: Technology Transfer and North-South Trade Midwest International Economics Group

Marsh, David

326

If you reside in WASHINGTON, DC - MD -VA - WV your salary will range from:  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: Vegetation ProposedUsingFun withconfinementEtching. |Endecaheme c-Type| EMSLemployed in the

327

DOE - Office of Legacy Management -- Naval Proving Ground - VA 0-01  

Office of Legacy Management (LM)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "ofEarlyEnergyDepartment ofDepartment ofof EnergyYou are herePA 3003A AECMexico - NMPlantProving

328

DOE - Office of Legacy Management -- Reactor Site - Fort Belvoir - VA 0-02  

Office of Legacy Management (LM)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "ofEarlyEnergyDepartment ofDepartment ofof EnergyYou are herePAOsborne Co -0-19GasK LeRaritanReactor

329

Energy Department Recognizes City of Roanoke, VA for Leadership in Better  

Office of Environmental Management (EM)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "of Energy Power SystemsResources DOEElectrical SafetyEnergy PlantsDevelopment | Department ofBuildings

330

File:EIA-Appalach6-WV-VA-BOE.pdf | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublicIDAPowerPlantSitingConstruction.pdf JumpApschem.pdf Jump to:December 2010 Thumbnail forMB)Gas

331

File:EIA-Appalach6-WV-VA-GAS.pdf | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublicIDAPowerPlantSitingConstruction.pdf JumpApschem.pdf Jump to:December 2010 Thumbnail forMB)GasSouthern West

332

File:EIA-Appalach6-WV-VA-LIQ.pdf | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublicIDAPowerPlantSitingConstruction.pdf JumpApschem.pdf Jump to:December 2010 Thumbnail forMB)GasSouthern West 脳

333

Jefferson Lab in Va awards $14.1 million contract (Daily Press) | Jefferson  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: Vegetation ProposedUsingFunInfraredJefferson LabJefferson Lab educational,Lab hosts

334

engineering home news home press releases subscribe to e-news annual re UT Arlington Moving Ideas from Laboratories to Marketplace  

E-Print Network [OSTI]

Weidong Zhou have developed a unique process that should reduce the cost of solar-generated electricity the performance of various types of fixed-orientation solar panels, such as those used on roof tops. Drs. Tao to begin human trials and develop a refined, commercially-viable product. Universal and Cost

Chiao, Jung-Chih

335

Cost-Effective Energy Efficiency Measures for Above Code(ASHRAE 90.1-2001 and 2007) Small Office Buildings in the City of Arlington  

E-Print Network [OSTI]

Table 1. Base-Case Building Description Building Type Number of occupants = 73 Gross Area (sq. ft.) PNNL-19341 (Thornton et al. 2010) and CoA Aspect Ratio PNNL-19341 (Thornton et al. 2010) Square shape Number of Floors PNNL-19341 (Thornton et al.... 2010) Floor-to-Floor Height (ft.) ASHRAE 90.1-1989 13.7.1 Floor-to-Ceiling Height = 9 ft Orientation PNNL-19341 (Thornton et al. 2010) Wall Construction CoA Roof Configuration PNNL-19341 (Thornton et al. 2010) Foundation Construction PNNL-19341...

Kim, H.; Do, S.; Kim, K.H.; Baltazar, J.C.; Haberl, J.S.; Lewis, C.

336

Cost-Effective Energy Efficiency Measures for Above Code (ASHRAE 90.1-2001 and 2007) Small Retail Buildings in the City of Arlington  

E-Print Network [OSTI]

.34 & 0.19 SHGC) w ith Dimming Control 16.2% 23.9% $5,596 27.0% $960 $6,556 $55,700 - $83,550 8.5 - 12.7 E Renewable Power Measure 16 28 kW Photovoltaic Array 15.3% 18.7% $4,227 17.1% $607 $4,834 $140,000 - $210,000 29.0 - 43.4 Description of Combined... Control 7.4% 10.1% $2,011 12.8% $402 $2,413 $15,723 - $23,584 6.5 - 9.8 15 Sky light (3% SRR, U-0.34 & 0.19 SHGC) w ith Dimming Control 15.3% 21.9% $4,369 25.1% $789 $5,158 $55,700 - $83,550 10.8 - 16.2 E Renewable Power Measure 16 28 kW Photovoltaic...

Do, S.; Baltazar, J.C.; Haberl, J.; Lewis, C.; Kim, K.H.; Kim, H.

337

Cost-Effective Energy Efficiency Measures for Above Code (ASHRAE 90.1-2001 and 2007) Restaurant Buildings in the City of Arlington  

E-Print Network [OSTI]

) EPLUS file, Deru et al. 2011 c) College Station Restaurant SurveyPackaged single zone units w/ gas fired furnace Static pressure : 2.5 in-wc Fan efficiency: Overall Eff: 55% (Motor eff. @1800rpm: 87.5) Service Hot Water Peak Hot Water Flow Rate - 133....1 2001 Table 9.4.5 ASHRAE 90.1 2007 Extra Power Allowance N.A 5% Section 9.4.5 ASHRAE 90.1 2007 Equipment Electric Equipment in Dining Space Table 9, Deru et al., 2011 HVAC Systems Zoning HVAC System Type HVAC Efficiency ?240,000 Btu/hr and < 760...

2011-01-01T23:59:59.000Z

338

Cost-Effecitive Energy Efficiency Measure for Above 2003 and 2009 IECC Code-Compliant Residential and Commercial Buildings in the City of Arlington  

E-Print Network [OSTI]

of the surface or surfaces), above-code percentages, Home Energy Rating System (HERS) index, and emission reductions. All 21 houses are new construction complied with the 2003 IECC. Five houses used the ESL?s International Code Compliance Calculator (IC3) tool.... The emissions reductions (lbs/yr) estimated for NOx, SOx, and CO2 were extracted from IC3 or ENERGY STAR compliant reports. 3. ENERGY STAR version 2.0 was active from 7/1/2006 to 4/1/2011 (Source from http://www.energystar.gov/index.cfm?c=new_homes...

Kim, H.; Do, S.; Baltazar, J.C.; Haberl, J.; Lewis, C.

339

Cost-Effective Energy Efficiency Measures for Above Code(ASHRAE 90.1-2001 and 2007) Small Restaurant Buildings in the City of Arlington  

E-Print Network [OSTI]

error-free. Reference herein to any specific commercial product, process, or service by trade name, trademark, manufacturer, or otherwise, does not constitute or imply its endorsement, recommendation, or favoring by the Energy Systems Laboratory or any....2 17 Demand Control Ventilation System 25.6% 14.3% $2,593 1.8% $43 $2,637 $737 - $1,105 0.3 - 0.4 E Service Hot Water Heater Measures 18 Improved Eff iicency for Service Water Heaters (From Et 80% to Et 95%) 2.7% 1.3% $225 0.0% $0 $225 $342 - $513 1...

Mukhopadhyay, J.; Kim, H.; Do, S.; Kim, K.H.; Baltazar, J.C.; Haberl, J.; Lewis, C.

340

Non-negative Laplacian Embedding Dijun Luo, Chris Ding, Heng Huang  

E-Print Network [OSTI]

Non-negative Laplacian Embedding Dijun Luo, Chris Ding, Heng Huang Computer Science and Engineering Department University of Texas at Arlington Arlington, Texas, 76019 dijun.luo@gmail.com, {chqding,heng

Li, Tao

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

May 24, 2008 17:24 WSPC/Trim Size: 11in x 8.5in for Proceedings 105henghuang GABORLOCAL: PEAK DETECTION IN MASS SPECTRUM BY GABOR FILTERS AND  

E-Print Network [OSTI]

Engineering, University of Texas at Arlington, TX, USA Email: nhn3175@exchange.uta.edu Heng Huang Department of Computer Science and Engineering, University of Texas at Arlington, TX, USA Email: heng@uta.edu Soontorn

Huang, Heng

342

Integration of Non-Traditional Membranes into MEAs  

Broader source: Energy.gov [DOE]

Presented at the 2009 High Temperature Membrane Working Group Meeting held May 18, 2009, in Arlington, Virginia

343

E-Print Network 3.0 - annual technology review Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of Texas at Arlington Collection: Engineering 2 Assessment Plan (MSU) Mechanical & Industrial Engineering Department Summary: Coordinator Department Head Faculty ...

344

Procedure for Performing PEM Single Cell Testing  

Broader source: Energy.gov [DOE]

Presented at the 2009 High Temperature Membrane Working Group Meeting held May 18, 2009, in Arlington, Virginia

345

Procedure for Performing In-Plane Membrane Conductivity Testing  

Broader source: Energy.gov [DOE]

Presented at the 2009 High Temperature Membrane Working Group Meeting held May 18, 2009, in Arlington, Virginia

346

Automotive Perspective on PEM Evaluation  

Broader source: Energy.gov [DOE]

Presented at the 2009 High Temperature Membrane Working Group Meeting held May 18, 2009, in Arlington, Virginia

347

Agenda: High Temperature Membrane Working Group Meeting  

Broader source: Energy.gov [DOE]

Agenda for the High Temperature Membrane Working Group (HTMWG) meeting on May 18, 2009, in Arlington, Virginia

348

MEA Fabrication  

Broader source: Energy.gov [DOE]

Presented at the 2009 High Temperature Membrane Working Group Meeting held May 18, 2009, in Arlington, Virginia

349

HTMWG, May 18, 2009, Welcome!  

Broader source: Energy.gov [DOE]

Presented at the 2009 High Temperature Membrane Working Group Meeting held May 18, 2009, in Arlington, Virginia

350

16 au Spring 2012 esri.com Areas of concern defined by ZIP Code Water quality monitoring station and hydro buffers  

E-Print Network [OSTI]

on implementing best management practices on livestock farms and mitigating failing septic systems. [Nonpoint landowners whose land-use practices might be contributing to the impair- ment of water bodies in the Catawba and are generally carried off the land by storm water. According to the EPA, a TMDL "is the amount of a single

Short, Daniel

351

The Excel model for Beta testing is available for download at http://www.ornl.gov/HTSC/pdf/HTSMarketBeta.zip. Please provide feedback or  

E-Print Network [OSTI]

1 The Excel model for Beta testing is available for download at http://www.ornl.gov/HTSC/pdf/HTSMarketBeta

352

Codes for the fast SSS QR eigens  

E-Print Network [OSTI]

Fortran 90 codes (zip file); Matlab codes (zip file). Please email. A fast O(n^2) time QR eigensolver for companion matrices/polynomials. Fortran 90 codes (zip...

353

Microsoft Word - VIPERS instructions.doc  

Office of Environmental Management (EM)

Name Number Recipient Information Number Fill in if applicable and Street and Street City, State Recipient Information City, State and ZIP Code and ZIP Code 11. COMPUTATION OF...

354

1 V.A. Andreev, E.J. Barnes, R.M. Carey, W. Gohn, V.A. Ganzha, A. Gardestig, T. Gorringe, F.E. Gray, D.W. Hertzog,  

E-Print Network [OSTI]

Meeting of the APS Division of Nuclear Physics and the Physical Society of Japan Volume 59, Number 10 Help to Increase the Energy Output of Fusion Reactors? The 21st International Symposium on Spin Physics 芦- 2014禄, 1-4 2014, Book of abstracts, p. 218 2 .. - MUSUN 64 芦- 2014禄, 1-4 2014, Book

Titov, Anatoly

355

1.) Rivanna Snapshot Open House December 7, 2012 LOCATION CORRECTION: CitySpace (on the Downtown Mall), Charlottesville, VA  

E-Print Network [OSTI]

of watershed management tools and plans designed to be utilized by its member local governments and Soil Water for Sustainability for Water and Wastewater Utilities 颅 December 13, 2012 9.) EPA Grant Opportunities to Assist State Septic Programs in Managing Water Quality Impacts in the Chesapeake Bay Watershed 颅 Comment

Virginia Tech

356

Single-cycle Terahertz Pulses with >0.2 V/A Field Amplitudes via Coherent Transition Radiation  

SciTech Connect (OSTI)

We demonstrate terahertz pulses with field amplitudes exceeding 0.2 V/{angstrom} generated by coherent transition radiation. Femtosecond, relativistic electron bunches generated at the Linac Coherent Light Source are passed through a beryllium foil, and the emitted radiation is characterized as a function of the bunch duration and charge. Broadband pulses centered at a frequency of 10 THz with energies of 140 {mu}J are measured. These far-below-bandgap pulses drive a nonlinear optical response in a silicon photodiode, with which we perform nonlinear autocorrelations that yield information regarding the terahertz temporal profile. Simulations of the spatiotemporal profile agree well with experimental results.

Daranciang, Dan; /Stanford U., Chem. Dept.; Goodfellow, John; /Stanford U. Materials Sci. Dept.; Fuchs, Matthias; /SIMES, Stanford /SLAC, PULSE; Wen, Haidan; /ANL, APS; Ghimire, Shambhu; /SLAC, PULSE; Reis, David A.; /SIMES, Sanford /SLAC, PULSE /Stanford U., Appl. Phys. Dept.; Loos, Henrik; Fisher, Alan S.; /SLAC, LCLS; Lindenberg, Aaron M.; /Stanford U. Materials Sci. Dept. /SIMES, Stanford /SLAC, PULSE

2012-02-15T23:59:59.000Z

357

EMF Measurements, Surveys & Risk Assessment 115 Juliad Court, Suite 105 EMF Mitigation -Shielding & Cancellation Fredericksburg, VA 22406  

E-Print Network [OSTI]

the site. AC ELF Electromagnetic Interference (EMI) Electron microscopes (SEMs, TEMs, STEMs), Focus Ion (audio, video, telephone & data), electromagnetic induction generates electromagnetic interference (EMI

Ohta, Shigemi

358

F O R G I N G T H E L I N K AP-27 County of York, VA  

E-Print Network [OSTI]

or potential reservoirs from the effects of pollution or sedimentation. (C). Definitions. For the purposes to or exceeding 660 gallons [2500L] in a single aboveground container Development. Any construction, external of Hazardous Wastes, 40 C.F.R. 搂261 (1987). (2) Land applications of industrial wastes. (E). Special

359

Reprinted from: Trends in new crops and new uses. 2002. J. Janick and A. Whipkey (eds.). ASHS Press, Alexandria, VA.  

E-Print Network [OSTI]

than 100%. Other biomass feedstocks rich in sugars (materials known as saccharides) include sugar beet

Laughlin, Robert B.

360

P-157 / Z. Ge P-157: A Single Cell-gap Transflective VA LCD using Positive Liquid Crystal  

E-Print Network [OSTI]

Science, University of Central Florida, Orlando, FL 32816 2 College of Optics and Photonics, University efficiency is also enhanced and it only requires a single gamma curve for both transmissive and reflective the optical efficiency. But the need for accurate control of the cell gaps results in complicated fabrication

Wu, Shin-Tson

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Microsoft Word - DM_VA-#126832-v3-Smart_Grid_Comments_--_DOE_--_Policy_and_Logistical_Challenges.DOC  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankCombustion | Department ofT ib l L d F S i DOE Tribal LeaderDE-OE0000660 Page 1June DELPHI October

362

VA VT CT RI MT WY CO ID UT OR NV CA AZ NM WA TN WV NC AR OK  

Office of Environmental Management (EM)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "of EnergyEnergyENERGYWomen Owned SmallOf The 2012Nuclear Guide Remote Access08:Energy 94:Service2 1

363

VA VT CT RI MT WY CO ID UT OR NV CA AZ NM WA TN WV NC AR OK  

Office of Environmental Management (EM)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "of EnergyEnergyENERGYWomen Owned SmallOf The 2012Nuclear Guide Remote Access08:Energy 94:Service2 1 2 1

364

VA VT CT RI MT WY CO ID UT OR NV CA AZ NM WA TN WV NC AR OK  

Office of Environmental Management (EM)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "of EnergyEnergyENERGYWomen Owned SmallOf The 2012Nuclear Guide Remote Access08:Energy 94:Service2 1 2 1

365

``In-bone'' Utricle CulturesVA Simplified, Atraumatic Technique for In Situ Cultures of the Adult Mouse  

E-Print Network [OSTI]

effectively in stud- ies of hair cell regeneration and hair cell death, as well as various agents that protect and protection. Background: The current in vitro technique for studying hair cells of the mature mouse utricle to the protective drug tacrine resulted in sig- nificant protection against neomycin (p G 0.05, 3-way analysis

Rubel, Edwin

366

The Proceedings of the 2008 International Conference on Mobile Data Xiaofeng Meng Hui Lei Stephane Grumbach Hong Va Leong  

E-Print Network [OSTI]

. 12. ,,. Deep Web . , 31(8): 1412-142120088. 13. ,,,: XML Twig . 45 ()354-359, 2008.10(, ) 14 . , 45 ()37-42, 2008.10. (, ) 17. TEXEM . 45 ()269-274, 2008.10 1 Deep Web Key Techniques on Deep Web Data Integration2008.5.16 2 Deep Web Study on Query Results Processing of Deep Web Data

367

Superfund record of decision (EPA Region 3): Naval Weapons Station, operable unit 2, Yorktown, VA, September 29, 1995  

SciTech Connect (OSTI)

This decision document presents a determination that the No Further Remedial Action Decision with Institutional Controls is sufficient to protect human health and the environment for Operable Unit No. II (OU II), Site 16, the West Road Landfill and Site Screening Area (SSA) 16, the Building 402 Metal Disposal Area at the Naval Weapons Station (WPNSTA) Yorktown (Site 16/SSA 16).

NONE

1996-05-01T23:59:59.000Z

368

Boise State University Human Resource Services Employee Information Form  

E-Print Network [OSTI]

: ____________________ State: ___ Zip: ______ Home Phone: _________________Work Phone: _________________ Cell Phone: ____________________________________ Relationship__________________________ Home Phone: _________________Work Phone: _________________ Cell Phone

Barrash, Warren

369

Peat as an energy alternative  

SciTech Connect (OSTI)

This symposium, Peat as an Energy Alternative, was organized to facilitate in-depth discussion of the various topics at the last conference. The scope of the symposium was international and included papers from Brazil, Canada, Finland, Israel, Jamaica, and Sweden. The presentations were designed to provide the latest information relating to the following areas of interest: peat resources; peat deposit location; countries using peat for energy; countries showing inerest in considering peat for energy; status of the technologies for harvesting, dewatering, beneficiation, combustion, and conversion to synthetic fuels; environmental and socioeconomic issues relating to large-scale peat utilization; peat reclamation options; Federal and State government plans for peat utilization; and organizations working on developments relating to peat as an energy alternative. The symposium, sponsored by the Institute of Gas Technology, was held at Arlington, VA, December 1-3, 1980. Forth-six papers have been entered individually into EDB and ten also into ERA; two paper had been entered previously from other sources. (LTN)

Not Available

1980-01-01T23:59:59.000Z

370

Measure Guideline: Optimizing the Configuration of Flexible Duct Junction Boxes  

SciTech Connect (OSTI)

This measure guideline offers additional recommendations to heating, ventilation, and air conditioning (HVAC) system designers for optimizing flexible duct, constant-volume HVAC systems using junction boxes within Air Conditioning Contractors of America (ACCA) Manual D guidance (Rutkowski, H. Manual D -- Residential Duct Systems, 3rd edition, Version 1.00. Arlington, VA: Air Conditioning Contractors of America, 2009.). IBACOS used computational fluid dynamics software to explore and develop guidance to better control the airflow effects of factors that may impact pressure losses within junction boxes among various design configurations (Beach, R., Prahl, D., and Lange, R. CFD Analysis of Flexible Duct Junction Box Design. Golden, CO: National Renewable Energy Laboratory, submitted for publication 2013). These recommendations can help to ensure that a system aligns more closely with the design and the occupants' comfort expectations. Specifically, the recommendations described herein show how to configure a rectangular box with four outlets, a triangular box with three outlets, metal wyes with two outlets, and multiple configurations for more than four outlets. Designers of HVAC systems, contractors who are fabricating junction boxes on site, and anyone using the ACCA Manual D process for sizing duct runs will find this measure guideline invaluable for more accurately minimizing pressure losses when using junction boxes with flexible ducts.

Beach, R.; Burdick, A.

2014-03-01T23:59:59.000Z

371

New Membranes for PEM Fuel Cells  

Broader source: Energy.gov [DOE]

Presentation on New Membranes for PEM Fuel Cells to the High Temperature Membrane Working Group Meeting held in Arlington, Virginia, May 26,2005.

372

Model Compound Studies of Fuel Cell Membrane Degradation  

Broader source: Energy.gov [DOE]

Presentation on Model Compound Studies of Fuel Cell Membrane Degradation to the High Temperature Membrane Working Group Meeting held in Arlington, Virginia, May 26,2005.

373

What You Need to Know About Gypsum  

E-Print Network [OSTI]

TestCa(ppm) Arlington Ashland Lancaster Spooner 0 100 200 300 400 500 600 700 SoilTestMg(ppm) Arlington Ashland applied (t/a) 5.8 6.0 6.2 6.4 6.6 6.8 7.0 SoilpH Arlington Ashland Lancaster Spooner 5.8 6.0 6.2 6.4 6.6 6.8 7.0 7.2 SoilpH Arlington Ashland Lancaster Spooner 0 1 4 16 Effect of gypsum additions on soil p

Balser, Teri C.

374

Critical Materials Research in DOE Video (Text Version)  

Broader source: Energy.gov [DOE]

This is a text version of the "Critical Materials Research in DOE" video presented at the Critical Materials Workshop, held on April 3, 2012 in Arlington, Virginia.

375

E-Print Network 3.0 - artery revascularization improves Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

the prosthetic graft and the native artery and include vein cuffs, vein patches, vein boots Source: Yang, Jian - Department of Bioengineering, University of Texas at Arlington...

376

E-Print Network 3.0 - artery in-stent restenosis Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

the prosthetic graft and the native artery and include vein cuffs, vein patches, vein boots Source: Yang, Jian - Department of Bioengineering, University of Texas at Arlington...

377

Energy Efficiency and Conservation Block Grant Program  

Broader source: Energy.gov (indexed) [DOE]

of Energy Categorical Exclusion Determination Form Program or Field Office: Energy Efficiency and Conservation Block Grant Program Project Title IL-City-Arlington Heights,...

378

2009 Wind Technologies Market Report  

E-Print Network [OSTI]

Prepared for the Utility Wind Integration Group. Arlington,Consult. 2010. International Wind Energy Development: WorldUBS Global I/O: Global Wind Sector. UBS Investment Research.

Wiser, Ryan

2010-01-01T23:59:59.000Z

379

National Academies Criticality Methodology and Assessment Video (Text Version)  

Broader source: Energy.gov [DOE]

This is a text version of the "National Academies Criticality Methodology and Assessment" video presented at the Critical Materials Workshop, held on April 3, 2012 in Arlington, Virginia.

380

DOE Hydrogen Program: 2009 Annual Merit Review and Peer Evaluation Report  

SciTech Connect (OSTI)

This report summarizes comments from the Peer Review Panel at the FY 2009 DOE Hydrogen Program Annual Merit Review, held on May 18 -22, 2009, in Arlington, Virginia.

Satyapal, S.

2009-11-01T23:59:59.000Z

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

Meeting Materials: Nov 17-18, 1998 | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Nov 17-18, 1998 Meeting Materials: Nov 17-18, 1998 NEAC Meeting Hyatt Regency Crystal City Arlington, Virginia Meeting Minutes More Documents & Publications Meeting Materials:...

382

DEPARTMENT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DETI...  

Broader source: Energy.gov (indexed) [DOE]

Arlington Agricultural Research Station Oconlo County, WI (existing well) Nicolet Forest Project, Oconto County, WI *Highway Pit, Clark County, WI https:llwww,eere-pmc.energy.govI...

383

2009 Wind Technologies Market Report  

E-Print Network [OSTI]

Prepared for the Utility Wind Integration Group. Arlington,Arizona Public Service Wind Integration Cost Impact Study.an Order Revising the Wind Integration Rate for Wind Powered

Wiser, Ryan

2010-01-01T23:59:59.000Z

384

E-Print Network 3.0 - aptitude Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

and Manufacturing Systems Engineering, University of Texas at Arlington Collection: Engineering 25 OFFICE OF THE RESIDENCY COORDINATOR Eastman Institute for Oral Health...

385

E-Print Network 3.0 - additional fenicr-base high Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

internet services can be ... Source: Corley, Bill - Department of Industrial and Manufacturing Systems Engineering, University of Texas at Arlington Collection: Engineering 19...

386

--No Title--  

Broader source: Energy.gov (indexed) [DOE]

Energy Conservation projects as being the most productive in reducing energy consumption and carbon footprint. The Arlington High School's primary heating plant boiler is...

387

CX-000151: Categorical Exclusion Determination | Department of...  

Broader source: Energy.gov (indexed) [DOE]

Energy Conservation projects as being the most productive in reducing energy consumption and carbon footprint. The Arlington High School's primary heating plant boiler is...

388

Development of Advanced High Temperature Fuel Cell Membranes  

Broader source: Energy.gov [DOE]

Presentation on Development of Advanced High Temperature Fuel Cell Membranes to the High Temperature Membrane Working Group Meeting held in Arlington, Virginia, May 26,2005.

389

Department of Energy Critical Materials Strategy Video (Text Version)  

Broader source: Energy.gov [DOE]

This is a text version of the "Department of Energy Critical Materials Strategy" video presented at the Critical Materials Workshop, held on April 3, 2012 in Arlington, Virginia.

390

E-Print Network 3.0 - acid-gas removal systems Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

University of Texas at Arlington Collection: Engineering 37 CHLORINE VERSUS DIOXINS -CONTROL METHODS TO MINIMIZE Joseph J. Santoleri, P.E. Summary: of having both TSP...

391

E-Print Network 3.0 - analysis program fort Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

are facilitated by lead- ing academic experts Source: Corley, Bill - Department of Industrial and Manufacturing Systems Engineering, University of Texas at Arlington...

392

E-Print Network 3.0 - airox process Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Releases mo... Detonation process more efficient than deflagration. Releases morere energy from ... Source: Texas at Arlington, University of - Department of Mechanical and...

393

Design Optimization of Piezoceramic Multilayer Actuators for...  

Broader source: Energy.gov (indexed) [DOE]

May 21, 2009, Arlington, Virginia Project ID: pm05lin This presentation does not contain any proprietary, confidential, or otherwise restricted information 2 Managed by...

394

Fullerene-Nafion Composite Recast Membranes  

Broader source: Energy.gov [DOE]

Presentation on Fullerene-Nafion Composite Recast Membranes to the High Temperature Membrane Working Group Meeting held in Arlington, Virginia, May 26,2005.

395

E-Print Network 3.0 - affecting lethal graft Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of Bioengineering, University of Texas at Arlington Collection: Materials Science ; Engineering 18 Rapid Publication In Vivo Retroviral Gene Transfer into Human Bronchial...

396

E-Print Network 3.0 - aisc american institute Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Texas at Austin, University of - Center for Transportation Research Collection: Energy Storage, Conversion and Utilization 12 University of Texas, Arlington Department of...

397

Energy Efficiency Improvement and Cost Saving Opportunities for the Dairy Processing Industry  

E-Print Network [OSTI]

Characterization: Steam Turbines. Arlington, Virginia.scale CHP systems use steam turbines. Switching to naturalsystem efficiency of a steam turbine-based CHP system (80%

Brush, Adrian

2012-01-01T23:59:59.000Z

398

DOE and Critical Materials Video (Text Version)  

Broader source: Energy.gov [DOE]

This is a text version of the "DOE and Critical Materials" video presented at the Critical Materials Workshop, held on April 3, 2012 in Arlington, Virginia.

399

Waste-to-Energy Roadmapping Workshop Agenda | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Waste-to-Energy Roadmapping Workshop Agenda Waste-to-Energy Roadmapping Workshop Agenda Waste-to-Energy Roadmapping Workshop Agenda, November 5-6, 2014, Arlington, Virginia....

400

MMPA- Residential Energy Efficiency Program  

Broader source: Energy.gov [DOE]

Minnesota Municipal Power Agency (MMPA) generates and purchases electricity for 11 member communities in Minnesota. The following eight members participate in the MMPA We Save Program: Arlington,...

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

1/12/14 Researchers develop tinywindmills that can power your gadgets (video) www.engadget.com/2014/01/11/university-texas-arlington-micro-windmills/ 1/9  

E-Print Network [OSTI]

, universityoftexasarlington, WindEnergy 40 COMMENTS SHARE TAGS: 22 hours ago Newest | Oldest | Top Comments RPAK1975 SignPowell bound2hell DonkeyPunch Grendel 16 hours agodr.vadlamudi Wow, you really are searching for a stereotype possible? along with solar panels. sick of funding these energy cartels 1 Like Reply 22 hours ago 33

Chiao, Jung-Chih

402

4/7/2014 ACES -The Universityof Texas at Arlington -Annual Celebration of Excellence byStudents (ACES) http://www.uta.edu/aces/awards.php 1/4  

E-Print Network [OSTI]

Students (ACES) http://www.uta.edu/aces/awards.php 1/4 ACES 2014 ACES schedule PRESENTATIONS Oral Presentation of Excellence byStudents (ACES) http://www.uta.edu/aces/awards.php 2/4 Undergraduate Poster Presentation of Excellence byStudents (ACES) http://www.uta.edu/aces/awards.php 3/4 Graduate Poster Presentation President

Chiao, Jung-Chih

403

Cost-Effective Energy Efficiency Measures for Above Code (ASHRAE 90.1-2001 and 2007) Small Retail Buildings in the City of Arlington (Presentation) (Revised) , Energy Systems Laboratory, Texas A&M University.  

E-Print Network [OSTI]

of occupants = 120 Gross Area (sq. ft.) CoA Aspect Ratio PNNL 20405:ASHRAE 90.1-2010 245 ft (L) X 61 ft (W) Number of Floors PNNL 20405:ASHRAE 90.1-2010 Floor-to-Floor Height (ft.) PNNL 20405:ASHRAE 90.1-2010 Floor-to-Ceiling Height = 17 ft Orientation PNNL... 20405:ASHRAE 90.1-2010 Wall Construction CoA Roof Configuration PNNL 20405:ASHRAE 90.1-2010 Foundation Construction PNNL 20405:ASHRAE 90.1-2010 Wall Absorptance DOE 2.1E BDL SUMMARY, Page 12 Assuming gray, light oil paint Wall Insulation (hr...

Kim, H.; Do, S; Kim, K.; Baltazar, J. C.; Haberl, J.; Lewis, C.

2011-01-01T23:59:59.000Z

404

Head to the Arlington Fourth of July parade, then join us at the Planetarium for a few shows! We've extended our public show schedule for the 4th  

E-Print Network [OSTI]

: Big Bird's Adventure One World, One Sky: Big Bird's Adventure begins on Sesame Street when Elmo's friend, Hu Hu Zhu, visits from China. Together, Big Bird, Elmo and Hu Hu Zhu locate the Big Dipper rides the solar system has to offer! No Public Shows July 22nd 颅 July 25th Due to a professional

Texas at Arlington, University of

405

August 30, 2010 C U R R I C U L U M V I T A E  

E-Print Network [OSTI]

, VA. 2003-2004: Consultant, Booz Allen & Hamilton, Inc., McLean, VA. 2002-2003: Consultant, Solers Inc

Burns, John A.

406

November 1, 2011 C U R R I C U L U M V I T A E  

E-Print Network [OSTI]

, VA. 2003-2004: Consultant, Booz Allen & Hamilton, Inc., McLean, VA. 2002-2003: Consultant, Solers Inc

Burns, John A.

407

May 1, 2013 C U R R I C U L U M V I T A E  

E-Print Network [OSTI]

, VA. 2003-2004: Consultant, Booz Allen & Hamilton, Inc., McLean, VA. 2002-2003: Consultant, Solers Inc

Burns, John A.

408

February 1, 2011 C U R R I C U L U M V I T A E  

E-Print Network [OSTI]

, VA. 2003-2004: Consultant, Booz Allen & Hamilton, Inc., McLean, VA. 2002-2003: Consultant, Solers Inc

Burns, John A.

409

Alexander A. Puretzky Senior R&D Staff  

E-Print Network [OSTI]

. of VA); T. Campbell (Univ. of VA); J. Chan (Univ. of VA); E. Chung (VA Tech); F. Corwin (VA Commonwealth Commonwealth Univ.); H. Hu (Chase Corp.); R. Hurt (Brown Univ.); A. Kane (Brown Univ.); I. Kulaots (Brown Univ.); J. Kushmerick (NIST); J. Liu (Brown Univ.); J. Liu (Duke Univ.); X. Liu (Brown Univ.); M. Manson (VA

Pennycook, Steve

410

Honors Program Parent Society MEMBERSHIP INFORMATION  

E-Print Network [OSTI]

: State: Zip: Home Phone: Business Phone: Cell Phone: Email: Name of Business: UGAAlum: Yes No Graduation 30602 Parent/Guardian Name: Home Address: City: State: Zip: Home Phone: Business Phone: Cell Phone

Arnold, Jonathan

411

E-Print Network 3.0 - addressing medical coding Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Summer Camp Registration Form Child's Name Date of Birth Sex Summary: Phone Work or Cell Phone Address Address City, ST ZIP Code City, ST ZIP Code Medical Information... 's...

412

[ Enter captions text ] THURSDAY, AUGUST 26, 2010.  

E-Print Network [OSTI]

MARIA AND WE HAVE ZIP CAR ON CAMPUS. A CAR SHARING PROGRAM. WE HAVE AN ESCORT VAN THAT RUNS, ISSUES AROUND CAMPUS TO ZIP CAR, TRANSIT. ANYTHING ALTERNATIVE TRANSPORTATION. >> THAT'S YOUR THING

Sze, Lawrence

413

AIAA 90 -0080 DEVELOPMENT OF THE UTA HYPERSONIC  

E-Print Network [OSTI]

AIAA 90 - 0080 DEVELOPMENT OF THE UTA HYPERSONIC SHOCK TUNNEL W. S. Stuessy, R. G. Murtugudde, F. K;DBVELOPMENT OF THE UTA HYPERSONIC SHOCK RJNNEI. W. S. Stuessy,' R. G.Murtugudde,+ F. K. Lu,' and D. R. Wilson" The University of Texas at Arlington Arlington, Texas 76019 Abstracl The development of a new hypersonic shock

Texas at Arlington, University of

414

99--MarMar--0707 11AERODYNAMIC RESEARCH CENTER MECHANICAL AND AEROSPACE ENGINEERING DEPARTMENT  

E-Print Network [OSTI]

99--MarMar--0707 11AERODYNAMIC RESEARCH CENTER MECHANICAL AND AEROSPACE ENGINEERING DEPARTMENT and The National Science Council, Taiwan, ROC 路Philip K. Panicker Aerodynamic Research Center, University of Texas Department, UT Arlington, Arlington, Texas, 76019 #12;99--MarMar--0707 22AERODYNAMIC RESEARCH CENTER

Texas at Arlington, University of

415

American Institute of Aeronautics and Astronautics Figure 1. Relative Fuel Volume Requirements  

E-Print Network [OSTI]

it on-board into a hydrogen-rich gas mixture to be injected into the engine combustors. To investigate Hydrogen Yield Results from Experimental Arc Pyrolysis of Methane C.M. Roseberry* , D.R. Wilson , and F.K. Lu University of Texas at Arlington, Arlington, TX 76019 Although hydrogen is an attractive fuel

Texas at Arlington, University of

416

216 Recent Patents on Biomedical Engineering 2009, 2, 216-227 1874-7647/09 $100.00+.00 2009 Bentham Science Publishers Ltd.  

E-Print Network [OSTI]

216 Recent Patents on Biomedical Engineering 2009, 2, 216-227 1874-7647/09 $100.00+.00 漏 2009 of Texas at Arlington, Arlington, TX 76019 Joint Biomedical Engineering Program, The University of Texas found widespread application in many areas of biomedical engineering such as tissue engineering, drug

Yang, Jian

417

Microstructure Reconstruction and Direct Evaluation of Li-Ion Battery Cathodes Fuqiang Liu* and N A Siddique  

E-Print Network [OSTI]

Microstructure Reconstruction and Direct Evaluation of Li-Ion Battery Cathodes Fuqiang Liu* and N of Texas at Arlington, Arlington, Texas 76019, USA High-capacity Li-ion batteries are among the best of the major challenges in Li-ion batteries is to improve mass transport across multiple phase interfaces

Liu, Fuqiang

418

The University of Utah Alumni Association Young Alumni  

E-Print Network [OSTI]

________________________________________________________________ Cell Phone __________________ Work Phone _____________________________________ Address ___________________________________________________________________________ Address _________________________________________________________________________ City State Zip Cell Phone ___________________ Work Phone _________________ Work FAX _______________ Home Phone

419

SOLARPERMIT.ORG  

Energy Science and Technology Software Center (OSTI)

003183WKSTN00 The National Solar Permitting Database https://github.com/solarpermit/solarpermit/archive/devel.zip

420

UCR 05/2013 Washington Academic Internship Program  

E-Print Network [OSTI]

: Address: City: State: Zip: Home Phone: ( ) Cell Phone: ( ) Work Phone: ( ) Email: Permanent Address (if: Address: City: State: Zip: Home Phone: ( ) Cell Phone: ( ) Work Phone: ( ) Email: #12;UCR 05/2013 Do you different from above): Address: City: State: Zip: Phone: ( ) Emergency Contact Info: Name: Relationship

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

AQUATIC PLANT CONTROL RESEARCH PROGRAM  

E-Print Network [OSTI]

. Michael Smart, John W. Barko Environmental Laboratory DEPARTMENT OF THE ARMY Waterways Experiment. ADDRESS (City, State, and ZIP Code) 7b. ADDRESS (City, State, and ZIP Code) PO Box 631 Vicksburg, MS NUMBER ORGANIZATION (If IIPplicable) US Army Corps of Engineers 8c. ADDRESS (City, State, and ZIP Code

US Army Corps of Engineers

422

For permission to copy or to republish, contact the American Institute of Aeronautics and Astronautics, 1801 Alexander Bell Drive, Suite 500, Reston, VA, 20191-4344.  

E-Print Network [OSTI]

, adsorption, wetting and electrokinetics2 . Cp Specific heat at constant pressure Specific heat ratio Mean for fluid applications like micro-pumps, micro-valves, micro-turbines, microthrusters etc. This emerging

Roy, Subrata

423

Study of Lead Coolant Technology A.D. Efanov, Yu.I. Orlov, P.N. Martynov, V.A. Gylevsky  

E-Print Network [OSTI]

Scientific Center of Russian Federation - Institute of Physics and Power Engineering Named after Academician. The low working pressure of the coolant in the loop increases the facility reliability and safety of the physics-chemical processes and mass transfer are increased, this affects the maintenance procedures

McDonald, Kirk

424

2011 The NEED Project P.O. Box 10101, Manassas, VA 20108 1.800.875.5029 www.NEED.org 43 How a Photovoltaic CellWorks  

E-Print Network [OSTI]

a Photovoltaic CellWorks Step 1 A slab (or wafer) of pure silicon is used to make a PV cell. The top of the slab electricfield PHOTONS n-type p-type p-n junction POSITIVE CHARGE NEGATIVE CHARGE SUNSTEP 3 PHOTOVOLTAIC CELLS that motivates the energetic electrons out of the cell created when light strikes the PV cell. The phosphorous

Oregon, University of

425

Thermodynamic Optimization of Finite Time Processes By R.S. Berry, V.A. Kazakov, S. Sieniutycz, Z. Szwast, and A.M. Tsirlin  

E-Print Network [OSTI]

driven by solar energy. These areas have all been significantly impacted by the ideas and methods-time thermodynamics problems including the much-needed disclaimers of exactly what the subject can and cannot do examples of finite-time thermodynamics problems that illustrate the theory as it is developed

Salamon, Peter

426

36 Volume 74 Number 6 A d VA N c E M E N T O f T H E SCIENCE  

E-Print Network [OSTI]

dermatitis, congenital defects, and cancer. This article discusses the adverse effects of continual exposure that is quite soluble in water. Form- aldehyde is colorless at room temperature and has an irritating, pungent of formaldehyde gas in water. In the body, form- aldehyde quickly metabolizes to formic acid. The measurement

Short, Daniel

427

For permission to copy or to republish, contact the American Institute of Aeronautics and Astronautics, 1801 Alexander Bell Drive, Suite 500, Reston, VA, 20191-4344.  

E-Print Network [OSTI]

of fluids in microchannels. Typically, mechanical devices with dimensions below 1 mm up to 1 碌m are called of Mechanical Engineering Kettering University, Flint, Michigan 48504, USA Heat transfer characteristics as working fluid and the Knudsen number ranges from slip to transition regime. Presented results show

Roy, Subrata

428

U.S. ARMY CORPS OF ENGINEERS Conflict Resolution & Public Participation Center of Expertise 7701 Telegraph Rd., Alexandria, VA 22315. www.iwr.usace.army.mil/cpc  

E-Print Network [OSTI]

a Shared Vision Planning and Public Involvement process in support of a "Responses to Climate Change" Pilot services, training, and courses on public involvement, risk communication and collaborative modeling. CPC during the 2011 Mississippi Flood Fight, Collaboration & communication during the 2011 Missouri Flood

US Army Corps of Engineers

429

Symposium on Wetlands of th'e Unglaclated Appalachian Region West Virginia University, Margantown, W.Va., May 26-28, 1982  

E-Print Network [OSTI]

habitats in southeastern Ohio. The botanical diversity of theseareas haslong been recognized. Beatley (1959

Spooner, David

430

Energy Exchange Nov 2001 The NEED Project PO Box 10101 Manassas, VA 20108 1-800-875-5029 INTERMEDIATE ACTIVITY: Solar Cooking  

E-Print Network [OSTI]

might insulate your cooker to improve energy efficiency. 8. Will your cooker work in artificial light the film into place. 4. Make small holes in the metal end of the can and in the plastic lid. Remove the plastic lid from the can. 5. Put a hot dog onto the skewer, slide the skewer into the can, and place

Benitez-Nelson, Claudia

431

PLA DE POLTICA LINGSTICA Aquest Pla de Poltica Lingstica, elaborat per la Comissi de Llengua, va ser aprovat pel Consell General  

E-Print Network [OSTI]

PLA DE POL脥TICA LING?脥STICA 2011-2013 #12;L Aquest Pla de Pol铆tica Ling眉铆stica, elaborat per la 2012. 漏 Xarxa Vives d'Universitats #12;LING?脥STICA 2011-2013 PLA DE POL脥TICA LING?脥STICA 2011- 2013 PLA I. CRITERIS GENERALS DE POL脥TICA LING?脥STICA II. PLA DE TREBALL 2011-2013. EIXOS I OBJECTIUS

Geffner, Hector

432

HIGH POWER COUPLER FOR THE TESLA SUPERSTRUCTURE , J. T. Susta, G. Cheng, AMAC International Inc., Newport News, VA 23606, U.S.A.  

E-Print Network [OSTI]

HIGH POWER COUPLER FOR THE TESLA SUPERSTRUCTURE CAVITIES* Q. S. Shu# , J. T. Susta, G. Cheng, AMAC are required to reduce this risk. The TESLA superstructure cavity requires a new coupler for the higher power TESLA cylindrical ceramic windows, uses two planar disc windows separated by a vacuum space

Boyer, Edmond

433

YouTube i la destrucci del temps 1. El 22 de novembre del passat 2008, es va emetre (i s'emet) mundialment en directe  

E-Print Network [OSTI]

'emet) mundialment en directe 颅des de San Francisco i Tokio, via stream颅 l'esdeveniment intern脿utic de la temporada enfilall d'actuacions i performances intimistes, m茅s pr貌pies de la stand-up comedy nord

Geffner, Hector

434

In Lassner, D., McNaught, C. (Eds.): Proceedings of ED-Media 2003, Honolulu, USA. Norfok, VA: AACE. pp 48-51 An Integrated Development Environment for  

E-Print Network [OSTI]

or production processes. If a specific didactical approach is chosen (e.g. an "explorative model") this leads of L眉beck Germany Hartwig|Hadley|Herczeg@imis.uni-luebeck.de Abstract: The production process of multimedia-coded system. A system was created to support the devel- opment and production processes, which follows

L眉beck, Universit盲t zu

435

NETL Researcher Honored with 2013 Federal Laboratory Award Morgantown, W.Va. - Dr. Stephen E. Zitney of the National Energy Technology  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Opticalhttp://www.fnal.gov/directorate/nalcal/nalcal02_07_05_files/nalcal.gifA Comparison95519LocalizedWater and EnergyAward

436

Eastern Shore Agricultural Research and Extension Center33446ResearchDrive,Painter,VA23420757-414-0724www.arec.vaes.vt.edu/eastern-shore Physical Resources  

E-Print Network [OSTI]

, and fumigant alternatives Mark S. Reiter Assistant Professor, Crop and Soil Environmental Sciences (CSES) Soils and Focus Area Jane Corson-Lassiter Reiter MALS Student; Soil Fertility/Environmental Science Concentration Ursula Deitch Reiter/Freeman MALS Student; Soil Fertility/Environmental Science Concentration Kathryn

Liskiewicz, Maciej

437

18 Volume 75 Number 8 A d vA n c e m e n t o f t h e ScienceA d vA n c e m e n t o f t h e Science  

E-Print Network [OSTI]

room for growth still exists. According to the Centers for Disease Control and Prevention (CDC) (Mead a public restroom (Harris Interactive, 2010). Self-reports of hand washing behavior have been criticized, & Curtis, 2009) and observational research sug- gests these high self-report rates are inflated (Harris

Liu, Taosheng

438

2011-2012 Internship Positions Rotation A Supervisor A Rotation B Supervisor B  

E-Print Network [OSTI]

Rehabilitation Jak VA Behavioral Medicine: Primary Care Heppner VA Alcohol Drug Treatment Program Wall Abuse/Mental Illness (SAMI) Trim/Tapert VA OEF/OIF PTSD Clinic S. Norman VA Substance Abuse UCSD Medical Center Neuropsychological Assessment M. Norman VA Behavioral Medicine: Primary Care Afari

Squire, Larry R.

439

SME Annual Meeting Feb. 28-Mar. 03, 2010, Phoenix, AZ  

E-Print Network [OSTI]

-066 DESIGNING AND MODELING WIRELESS MESH COMMUNICATIONS IN UNDERGROUND COAL MINES K. R. Griffin, Virginia Tech, Blacksburg, VA S. J. Schafrik, Virginia Tech, Blacksburg, VA M. E. Karmis, Virginia Tech, Blacksburg, VA

440

Robust Tensor Factorization Using R1 Norm Computer Science and Engineering  

E-Print Network [OSTI]

Robust Tensor Factorization Using R1 Norm Heng Huang Computer Science and Engineering University of Texas at Arlington heng@uta.edu Chris Ding Computer Science and Engineering University of Texas

Huang, Heng

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

Denoising of Array-Based DNA Copy Number Data Using The Dual-tree Complex Wavelet Transform  

E-Print Network [OSTI]

Nguyen, Heng Huang, Soontorn Oraintara and Yuhang Wang搂 Department of Electrical Engineering, University and Engineering, University of Texas at Arlington Email: heng@uta.edu Department of Electrical Engineering

Huang, Heng

442

A New Smoothing Model for Analyzing Array Nha Nguyen, Heng Huang, Soontorn Oraintara and An Vo  

E-Print Network [OSTI]

A New Smoothing Model for Analyzing Array CGH Data Nha Nguyen, Heng Huang, Soontorn Oraintara, University of Texas at Arlington Email: heng@uta.edu Abstract--Array based Comparative Genomic Hybridization

Huang, Heng

443

Image Annotation Using Multi-label Correlated Green's Function Hua Wang, Heng Huang, Chris Ding  

E-Print Network [OSTI]

Image Annotation Using Multi-label Correlated Green's Function Hua Wang, Heng Huang, Chris Ding Computer Science and Engineering Department University of Texas at Arlington huawang2007@mavs.uta.edu {heng

Huang, Heng

444

BioMed Central Page 1 of 11  

E-Print Network [OSTI]

Research Array CGH data modeling and smoothing in Stationary Wavelet Packet Transform domain Heng Huang*1, Nha at Arlington, Texas, USA Email: Heng Huang* - heng@uta.edu; Nha Nguyen - nhn3175@exchange.uta.edu; Soontorn

Oraintara, Soontorn

445

advanced composites technology: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

15 16 17 18 19 20 21 22 23 24 25 Next Page Last Page Topic Index 1 ADVANCED COMPOSITE MATERIALS TECHNOLOGY FOR ROTORCRAFT Andrew Makeev*, University of Texas at Arlington,...

446

advanced technology composite: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

15 16 17 18 19 20 21 22 23 24 25 Next Page Last Page Topic Index 1 ADVANCED COMPOSITE MATERIALS TECHNOLOGY FOR ROTORCRAFT Andrew Makeev*, University of Texas at Arlington,...

447

High Temperature/Low Humidity Polymer Electrolytes Derived from Ionic Liquids  

Broader source: Energy.gov [DOE]

Presentation on High Temperature/Low Humidity Polymer Electrolytes Derived from Ionic Liquids to the High Temperature Membrane Working Group Meeting held in Arlington, Virginia, May 26,2005.

448

NATIONALSCIENCE FOUNDATION 4201 WILSON BOULEVARD  

E-Print Network [OSTI]

NATIONALSCIENCE FOUNDATION 4201 WILSON BOULEVARD ARLINGTON, VIRGINIA 22230 January 29,2007 OFFICE Institutes of Health (NIH) and the National Science Foundation (NSF) have agreed upon the following Deputy Director National Institutes of Health National ScienceFoundation #12;

Baker, Chris I.

449

2011 Federal Energy and Water Management Award Winners | Department...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

community leaders, and local schools. David Guthrie U.S Department of the Interior U.S. Fish and Wildlife Service Arlington, Virginia David Guthrie is the energy coordinator for...

450

2008 WIND TECHNOLOGIES MARKET REPORT  

E-Print Network [OSTI]

Prepared for the Utility Wind Integration Group. Arlington,Wind Logics, Inc. 2004. Wind Integration Study桭inal Report.EnerNex Corp. 2006. Wind Integration Study for Public

Bolinger, Mark

2010-01-01T23:59:59.000Z

451

CX-005793: Categorical Exclusion Determination | Department of...  

Broader source: Energy.gov (indexed) [DOE]

CX(s) Applied: A1, A9, A11, B2.5, B5.1 Date: 05022011 Location(s): Arlington Heights, Illinois Office(s): Energy Efficiency and Renewable Energy Energy Efficiency and...

452

New Polymeric Proton Conductors for Water-free and High-temperature Fuel Cells  

Broader source: Energy.gov [DOE]

Presentation on New Polymeric Proton Conductors for Water-free and High-temperature Fuel Cells to the High Temperature Membrane Working Group Meeting held in Arlington, Virginia, May 26,2005.

453

IEEE Transactions on Vehicular Technology CALL FOR PAPERS  

E-Print Network [OSTI]

), Renewable Energy Systems and Vehicular Technology Laboratory, University of Texas- Arlington, E, circuit, and system level issues for energy storage, power electronics, and electromechanical energy-cycle effects Fault-tolerant control of electromechanical energy convertors Reliability and availability

Fang, Yuguang "Michael"

454

Catalysis Working Group Kick-Off Meeting Agenda | Department...  

Energy Savers [EERE]

Kick-Off Meeting Agenda Agenda for the kick-off meeting of the U.S. Department of Energy Fuel Cell Technologies Program's Catalysis Working Group, held May 14, 2012, in Arlington,...

455

Fuel Cells Vehicle Systems Analysis (Fuel Cell Freeze Investigation)  

SciTech Connect (OSTI)

Presentation on Fuel Cells Vehicle Systems Analysis (Fuel Cell Freeze Investigation) for the 2005 Hydrogen, Fuel Cells & Infrastructure Technologies Program Annual Review held in Arlington, Virginia on May 23-26, 2005.

Pesaran, A.; Kim, G.; Markel, T.; Wipke, K.

2005-05-01T23:59:59.000Z

456

HEALTH IN FRAGILE STATES COUNTRY CASE STUDY: NORTHERN UGANDA  

E-Print Network [OSTI]

HEALTH IN FRAGILE STATES COUNTRY CASE STUDY: NORTHERN UGANDA JUNE 2006 This publication COUNTRY CASE STUDY: NORTHERN UGANDA The authors' views expressed in this publication do not necessarily States, Country Case Study: Northern Uganda. Arlington, Virginia, USA: Basic Support

Scharfstein, Daniel

457

SEA and DOE Extension Comments  

Broader source: Energy.gov (indexed) [DOE]

the plant. Further, by increasing the geographic area, the DOE used Arlington's Aurora Hills monitoring station to achieve a PM 2.5 measure of 14.4 micrograms per cubic...

458

Dark tourism: understanding visitor motivation at sites of death and disaster  

E-Print Network [OSTI]

, numerous sites of death and disaster attract millions of visitors from all around the world: Auschwitz-Birkenau, Anne Frank's House, Graceland, Oklahoma City, Gettysburg, Vimy Ridge, the Somme, Arlington National Cemetery. The list grows each year...

Yuill, Stephanie Marie

2004-09-30T23:59:59.000Z

459

Hydrogen Fuel Quality (Presentation)  

SciTech Connect (OSTI)

Jim Ohi of NREL's presentation on Hydrogen Fuel Quality at the 2007 DOE Hydrogen Program Annual Merit Review and Peer Evaluation on May 15-18, 2007 in Arlington, Virginia.

Ohi, J.

2007-05-17T23:59:59.000Z

460

--No Title--  

Broader source: Energy.gov (indexed) [DOE]

Energy Office 14,752,100 MA Amherst City 162,000 MA Arlington City 159,700 MA Attleboro City 179,600 MA Barnstable Town City 202,400 MA Beverly City 169,600 MA...

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

2/24/2014 Using TinyWindmills To Power Portable Electronics http://searchforthegood.com/using-tiny-windmills-to-power-portable-electronics/ 1/4  

E-Print Network [OSTI]

a approach to strap "wind energy" in regions not matched to a deployment of vast breeze turbines. The University of Texas during Arlington provides more: Rao's prior work in micro-robotic inclination primarily

Chiao, Jung-Chih

462

Transportation Planning & Decision Science Group Transportation Systems Research Group Diane Davidson Keith Kahl  

E-Print Network [OSTI]

Annual Merit Review Meeting The U.S. Department of Energy's (DOE's) 2013 Annual Merit Review and Peer will be held on May 13颅17, 2013, in Arlington, Virginia. At the DOE Vehicle Technologies Annual Merit Review

463

Saving the Fuel Cell Dream: Making Non Noble Metal Electrocatalysts a Reality?  

Broader source: Energy.gov [DOE]

Presentation about non noble metal electrocatalysts, presented by Sanjeev Mukerjee, Northeastern University, at the kick-off meeting of the U.S. Department of Energy Fuel Cell Technologies Program's Catalysis Working Group, held May 14, 2012, in Arlington, Virginia.

464

Protecting Important Sites for Biodiversity Contributes to Meeting Global Conservation Targets  

E-Print Network [OSTI]

Protecting Important Sites for Biodiversity Contributes to Meeting Global Conservation Targets Environment Programme World Conservation Monitoring Centre, Cambridge, United Kingdom, 3 National Centre, Nairobi, Kenya, 6 The Nature Conservancy, Arlington, Virginia, United States of America, 7 Nature

Vermont, University of

465

UW-Approved Waste Disposal, Recycling and Treatment Sites Hazardous waste disposal at the University of Washington is coordinated by the EH&S Environmental Programs Office  

E-Print Network [OSTI]

UW-Approved Waste Disposal, Recycling and Treatment Sites Hazardous waste disposal, WA Rabanco Recycling Co Landfill Roosevelt, WA Waste Management, Columbia Ridge Landfill Arlington Refrigeration Shop Recovery Seattle, WA Fluorescent light tubes - intact Ecolights NW Recycle Seattle, WA Shop

Wilcock, William

466

Energy Efficiency Improvement and Cost Saving Opportunities for the Dairy Processing Industry  

E-Print Network [OSTI]

Characterization: Gas Turbines. Arlington, Virginia.is higher than that of a gas turbine-based CHP system (74%electrical efficiency of a gas turbine-based CHP system is

Brush, Adrian

2012-01-01T23:59:59.000Z

467

Most Hallowed A Special Departure for Williams College Alumni  

E-Print Network [OSTI]

Arlington National Cemetery. Bear witness to heroism and sacrifice on a private tour including gravesites with an expert guide. Meals BLD July 4 颅 weikert FarM/Harpers Ferry Enjoy an exclusive visit to Jacob Weikert

Aalberts, Daniel P.

468

Federal Energy and Water Management Awards 2014  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

E. Creek VA Medical Center Amarillo, Texas In 2013 the Amarillo Veterans Affairs (VA) Health Care System constructed a 2.28 megawatt photovoltaic (PV) covered parking project...

469

GAO-12-120G, GAO Schedule Assessment Guide  

Energy Savers [EERE]

and accountability. The Department of Veterans Affairs (VA) operates one of the largest health care systems in the country. As of August 2009, VA's Veterans Health Administration...

470

Case Study - The Department of Veterans Affairs West Haven Campus...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

The Department of Veterans Affairs West Haven Campus, VA Connecticut Health Care System Case Study - The Department of Veterans Affairs West Haven Campus, VA Connecticut Health...

471

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Broader source: Energy.gov (indexed) [DOE]

White Picket Trail Mount Crawford, VA Eastern BioPlastics - Manufacturing of keratin (poultry feathers) for use in bioplastics Expansion of VA keratin bioplastic production using...

472

Name * First Last Address Street Address Address Line 2 City State ...  

E-Print Network [OSTI]

Name * First Last; Address. Street Address Address Line 2. City State / Province / Region Postal / Zip Code. United States, United Kingdom, Australia, Canada...

473

Encore Energy Systems formerly Energy Vision International formerly...  

Open Energy Info (EERE)

Oxford, Massachusetts Zip: 38655 Sector: Geothermal energy Product: Provider geothermal heat pumps primarily for heating and air conditioning. Coordinates: 43.781517,...

474

Institute of Chemical Engineering and High Temperature Chemical...  

Open Energy Info (EERE)

Chemical Processes ICEHT Jump to: navigation, search Name: Institute of Chemical Engineering and High Temperature Chemical Processes (ICEHT) Place: Hellas, Greece Zip:...

475

National Interest Security Company NISC Formerly Technology Management...  

Open Energy Info (EERE)

search Name: National Interest Security Company (NISC) (Formerly Technology & Management Services (TMS) Inc.) Place: Gaithersburg, Maryland Zip: 20879 Product: TMS provides...

476

Wind: wind power density GIS data at 50m above ground and 1km...  

Open Energy Info (EERE)

of Columns: 735Number of Rows: 949Pixel Resolution (m): 1000Data Type: integer Spatial Reference Information (End) ** Data and Resources Download DataZIP Download Data...

477

E-Print Network 3.0 - aldrich death rode Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Spruce Street City, State, Zip... (S) Wear self-contained breathing apparatus, rubber boots, and heavy rubber gloves. ALDRICH - B85927 ... Source: Choi, Kyu Yong - Department of...

478

Institute of Photo Electronic Thin Film Devices and Technology...  

Open Energy Info (EERE)

Technology of Nankai University Place: Tianjin Municipality, China Zip: 300071 Sector: Solar Product: A thin-film solar cell research institute in China. References: Institute...

479

E-Print Network 3.0 - american industry classification Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

... Source: Knuth, Kevin H. - Department of Physics, State University of New York at Albany Collection: Physics 22 City Zip 98104 Industry description (e.g., Manufacture of motor...

480

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

A Minneapolis, Minnesota Reference Buildings by Climate Zone and Representative City: 6A Minneapolis, Minnesota In addition to the ZIP file for each building type, you can directly...

Note: This page contains sample records for the topic "arlington va zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

E-Print Network 3.0 - acute abdomen pt Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

PHYSICIAN'S PERSONAL COPY TO: STREET CITY ZIP Summary: % BILIRUBIN mg% RBC HOSPITAL TUBE STATION 31 Platelet Count: INR: PT: PTT: 12;GASTRO INTESTINAL ANGIOGRAPHIC... CONTRAST)...

482

Cape Peninsula University of Technology - Centre for Distributed...  

Open Energy Info (EERE)

Peninsula University of Technology Address: Symphony way, Bellville Place: Cape Town, South Africa Zip: 7535 Region: Western cape Number of Employees: 11-50 Year Founded: 2004...

483

THE JOHNS HOPKINS UNIVERSITY School of Nursing  

E-Print Network [OSTI]

: (__ __ __) __ __ __ - __ __ __ __ 8. Cell Phone: (__ __ __) __ __ __ - __ __ __ __ 9. Emergency Phone: ______________________________________________________________________ If Maryland address, County name______________________ Street City State Zip Code 5. Local Phone: (__ __ __) __ __ __ - __ __ __ __ 6. Permanent Phone: (__ __ __) __ __ __ - __ __ __ __ 7. Work Phone

Connor, Ed

484

CSUF CHILDREN'S CENTER SUMMER SESSION 2014 ENROLLMENT APPLICATION  

E-Print Network [OSTI]

#________________________Work Phone______/_______________Cell Phone______/__________________ Email (print clearly #______________________Work Phone_______/________________Cell Phone______/_________________ Email (print clearly:__________________________________________________________________________________________ City_________________________________ Zip___________ Home Phone: _______/_______________________ Parent

de Lijser, Peter

485

Furman Graduate Studies Registration Form Spring 2014 Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone ___________________________________ Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone: (864) 294

486

Furman Graduate Studies Registration Form 2013 Fall Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone ___________________________________ Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone: (864) 294

487

Hot Topics | Photosynthetic Antenna Research Center  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

taught * Home Address Address * City * State * Zip Code * Home Phone * Work Phone * Cell Phone * Work Email * Home Email * Would you like to receive School Partnership news...

488

Furman Graduate Studies Registration Form 2012 Fall Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone ___________________________________ Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone: (864) 294

489

FLORIDA ATLANTIC UNIVERSITY OFFICE OF INTERNATIONAL PROGRAMS  

E-Print Network [OSTI]

: ____________________________ Alt. Email: _______________________________ Cell phone number: ___________________ Home phone number State Zip code Cell phone number: ___________________ Office phone number: _____________________ Home: ________________________________________________________ Z number: _________________________ Office phone number: _______________________ Email

Fernandez, Eduardo

490

CSUF CHILDREN'S CENTER SUMMER SESSION 2013 ENROLLMENT APPLICATION  

E-Print Network [OSTI]

#________________________Work Phone______/_______________Cell Phone______/__________________ Email (print clearly #______________________Work Phone_______/________________Cell Phone______/_________________ Email (print clearly:__________________________________________________________________________________________ City_________________________________ Zip___________ Home Phone: _______/_______________________ Parent

de Lijser, Peter

491

Participant Medical Record Ocean Classroom Foundation  

E-Print Network [OSTI]

____________________________ Day phone (_____)________________ Evening phone (_____)________________ Cell phone/State/Zip __________________________________________________________ Day phone ____________________________________ Evening phone _____________________________ Cell ____________________________________ Evening phone _____________________________ Cell/other phone _________________________ Email

Pontius Jr., Duane H.

492

Furman Graduate Studies Registration Form Spring 2015 Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone) Financial Aid Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone

493

Furman Graduate Studies Registration Form 2014 Fall Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone) Financial Aid Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone

494

Indian Ministry of New and Renewable Energy formerly Ministry...  

Open Energy Info (EERE)

Renewable Energy (formerly Ministry of Non-Conventional Energy Sources) Place: New Delhi, India Zip: 110 003 Product: Involved in policy making, planning, programme formulation and...

495

E-Print Network 3.0 - assembly competent proteins Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Paper 2270 Summary: A. Voelz and Ken A. Dill, "Exploring zipping and assembly as a protein folding principle" (2007... :repositories.cdlib.orgpostprints2270 12;Exploring...

496

Hawaii Department of Land and Natural Resources Commission on...  

Open Energy Info (EERE)

Hawaii Department of Land and Natural Resources Commission on Water Resource Management Address: Kalanimoku Building 1151 Punchbowl Street Room 227 Place: Honolulu, Hawaii Zip:...

497

Hawaii Department of Land and Natural Resources Division of Forestry...  

Open Energy Info (EERE)

Name: Hawaii Department of Land and Natural Resources Division of Forestry and Wildlife Address: Kalanimoku Building 1151 Punchbowl St., Room 325 Place: Honolulu, Hawaii Zip:...

499

Tss4U BV formerly Holecsol R S Renewable Energy Systems and Shell...  

Open Energy Info (EERE)

Holecsol, R&S Renewable Energy Systems and Shell Solar Energy) Place: Veldhoven, Netherlands Zip: 5503 Sector: Solar, Wind energy Product: Provides small solar and wind for...

500

african higher education: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

counterfactual Danforth, Bryan Nicholas 134 Application for Higher Education Internship City: Zip Code Mathematics Websites Summary: Application for Higher Education Internship...