National Library of Energy BETA

Sample records for area mt signal

  1. Mt Signal Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsourceII Jump to: navigation, searchsource HistoryCharleston,Peak Utility Jump to:PosoMt

  2. Marysville Mt Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource HistoryScenariosMarysville Mt Geothermal Area Jump to: navigation, search

  3. Water Sampling At Mt Princeton Hot Springs Geothermal Area (Olson...

    Open Energy Info (EERE)

    Water Sampling At Mt Princeton Hot Springs Geothermal Area (Olson & Dellechaie, 1976) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Water...

  4. Refraction Survey At Mt Princeton Hot Springs Geothermal Area...

    Open Energy Info (EERE)

    Refraction Survey At Mt Princeton Hot Springs Geothermal Area (Lamb, Et Al., 2012) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Refraction...

  5. Geothermometry At Mt Princeton Hot Springs Geothermal Area (Pearl...

    Open Energy Info (EERE)

    Et Al., 1976) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Geothermometry At Mt Princeton Hot Springs Geothermal Area (Pearl, Et Al., 1976)...

  6. Mt Rainier Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformationOliver, Pennsylvania:(CTI PFAN) | Open Energy(RECP)MtMt

  7. Mt Rainier Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformationOliver, Pennsylvania:(CTI PFAN) | Open Energy(RECP)Mt

  8. Mt St Helens Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformationOliver, Pennsylvania:(CTI PFAN) | OpenMt St HelensMt St

  9. Implied motion activation in cortical area MT can be explained by visual low-level features

    E-Print Network [OSTI]

    Oram, Mike

    ForReview Only Implied motion activation in cortical area MT can be explained by visual low Neuroscience #12;ForReview Only 1 Implied motion activation in cortical area MT can be explained by visual low, The Netherlands Page 1 of 51 Jounal of Cognitive Neuroscience 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

  10. Mt St Helens Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformationOliver, Pennsylvania:(CTI PFAN) | OpenMt St Helens

  11. Mt Princeton Hot Springs Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop Inc Jump to: navigation,Mereg GmbHMontebalitoMt Princeton Hot Springs Geothermal

  12. Micro-Earthquake At Marysville Mt Area (Blackwell) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource HistoryScenariosMarysville MtMedicalInformation 2-2005)1995) |Information

  13. 300 Area signal cable study

    SciTech Connect (OSTI)

    Whattam, J.W.

    1994-09-15

    This report was prepared to discuss the alternatives available for removing the 300 Area overhead signal cable system. This system, installed in 1969, has been used for various monitoring and communication signaling needs throughout the 300 Area. Over the years this cabling system has deteriorated, has been continually reconfigured, and has been poorly documented to the point of nonreliability. The first step was to look at the systems utilizing the overhead signal cable that are still required for operation. Of the ten systems that once operated via the signal cable, only five are still required; the civil defense evacuation alarms, the public address (PA) system, the criticality alarms, the Pacific Northwest Laboratory Facilities Management Control System (FMCS), and the 384 annunciator panel. Of these five, the criticality alarms and the FMCS have been dealt with under other proposals. Therefore, this study focused on the alternatives available for the remaining three systems (evacuation alarms, PA system, and 384 panel) plus the accountability aid phones. Once the systems to be discussed were determined, then three alternatives for providing the signaling pathway were examined for each system: (1) re-wire using underground communication ducts, (2) use the Integrated Voice/Data Telecommunications System (IVDTS) already installed and operated by US West, and (3) use radio control. Each alternative was developed with an estimated cost, advantages, and disadvantages. Finally, a recommendation was provided for the best alternative for each system.

  14. Ground Magnetics At Marysville Mt Area (Blackwell) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New PagesSustainableGlynn County,Solar JumpInformation Crump's Hot Springs Area (DOE

  15. Rock Sampling At Mt Ranier Area (Frank, 1995) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/ColoradoRemsenburg-Speonk, NewMichigan: Energy Resources JumpMt Ranier Area (Frank, 1995)

  16. EC305 Problem Set 1 1. Let x(t) = m(t) cos 2fct, where m(t) is a real lowpass signal with bandwidth W and

    E-Print Network [OSTI]

    Bhashyam, Srikrishna

    EC305 Problem Set 1 1. Let x(t) = m(t) cos 2fct, where m(t) is a real lowpass signal with bandwidth a bandpass signal x(t) = m1(t) cos 2fct - m2(t) sin 2fct. (a) Determine the in-phase and quadrature components of this signal when the local os- cillators used have a phase offset of , i.e., they are cos (2fct

  17. Overview of physical oceanographic measurements taken during the Mt. Mitchell Cruise to the ROPME Sea Area

    SciTech Connect (OSTI)

    Reynolds, R.M.

    1993-03-31

    The ROPME Sea Area (RSA) is one of the most important commercial waterways in the world. However, the number of direct oceanographic observations is small. An international program to study the effect of the Iraqi oil spill on the environment was sponsored by the ROPME, the Intergovernmental Oceanographic Commission, and the National Oceanic and Atmospheric Administration (NOAA).

  18. Direct-Current Resistivity Survey At Marysville Mt Area (Blackwell) | Open

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, Alabama (UtilityInstrumentsArea (DOE GTP) JumpDillard(Kauahikaua &

  19. Direct-Current Resistivity Survey At Mt Princeton Hot Springs Area

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, Alabama (UtilityInstrumentsArea (DOE GTP) JumpDillard(Kauahikaua &1986) |

  20. Power and area minimization for multidimensional signal processing

    E-Print Network [OSTI]

    Markovic, Dejan; Nikolic, Borivoje; Brodersen, Robert W.

    2007-01-01

    opti- mization tool for signal processing and communicationfor communication signal processing,” in Proc. Int. Conf.of communications and signal processing algorithms. He is

  1. Increase of global monsoon area and precipitation under global warming: A robust signal?

    E-Print Network [OSTI]

    Li, Tim

    Increase of global monsoon area and precipitation under global warming: A robust signal? Pang future sea surface temperature (SST) warming patterns. The results show that the global monsoon area. Zhao (2012), Increase of global monsoon area and precipitation under global warming: A robust signal

  2. Abstract--Genomic Signal Processing is a new area of research that combines advanced digital signal processing methodologies for enhanced genetic data analysis.

    E-Print Network [OSTI]

    Nebel, Jean-Christophe

    1 Abstract-- Genomic Signal Processing is a new area of research that combines advanced digital signal processing methodologies for enhanced genetic data analysis. It has many promising applications signal processing methods: linear predictive coding, wavelet decomposition and fractal dimension

  3. Vertical Electrical Sounding Configurations At Mt Princeton Hot...

    Open Energy Info (EERE)

    Vertical Electrical Sounding Configurations At Mt Princeton Hot Springs Geothermal Area (Zohdy, Et Al., 1971) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home...

  4. Direct-Current Resistivity Survey At Mt Princeton Hot Springs...

    Open Energy Info (EERE)

    Direct-Current Resistivity Survey At Mt Princeton Hot Springs Area (Richards, Et Al., 2010) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity:...

  5. Saving Mt. Fuji

    E-Print Network [OSTI]

    Hacker, Randi

    2013-09-12

    Broadcast Transcript: Mt. Fuji, or Fujisan is it is known here in Japan, has just been added to Unesco's World Heritage list as a cultural asset, honoring it for providing thousands of years of inspiration to artists, poets ...

  6. Pipeline MT Instructions Identification Number

    E-Print Network [OSTI]

    Hong, Don

    Pipeline MT Instructions Identification Number For identification purposes, you will be assigned a special identification number. M# You can activate your MT email, login to PipelineMT to register for classes or pay tuition and fees. Activating the MTSU Email and PipelineMT accounts: Visit the website

  7. DC Resistivity Survey (Dipole-Dipole Array) At Mt Princeton Hot...

    Open Energy Info (EERE)

    1971) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: DC Resistivity Survey (Dipole-Dipole Array) At Mt Princeton Hot Springs Geothermal Area...

  8. Mt Ranier Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformationOliver, Pennsylvania:(CTI PFAN) | Open

  9. Marysville Mt Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma,InformationIllinois:Martin, Michigan:

  10. Geothermal energy resource investigations at Mt. Spurr, Alaska

    SciTech Connect (OSTI)

    Turner, D.L.; Wescott, E.M. (eds.)

    1986-12-01

    Spurr volcano is a composite Quaternary cone of largely andesitic composition located on the west side of Cook Inlet about 80 miles west of Anchorage and about 40 miles from the Beluga electrical transmission line. Geologic mapping (Plate 1-1) shows that the present summit depression was produced by a Mt. St. Helens-type sector collapse, rather than by a caldera collapse. Geochronologic and previous tephrachronologic studies show that there has been an active magmatic system at Spurr volcano during the late Pleistocene-to-Holocene time interval that is of critical interest for geothermal energy resource assessment. Major effort was devoted to geochemical and geophysical surveys of the accessible area south of Mt. Spurr, in addition to geologic mapping and geochronologic studies. Many coincident mercury and helium anomalies were found, suggesting the presence of geothermal systems at depth. Extremely large electrical self-potential anomalies were also found, together with extensive zones of low resistivity discovered by our controlled-source audiomagnetotelluric survey. The juxtaposition of all of these different types of anomalies at certain areas on the south slope of Crater Peak indicates the presence of a geothermal system which should be accessible by drilling to about 2000 ft depth. It is also evident that there is a strong volcanic hazard to be evaluated in considering any development on the south side of Mt. Spurr. This hazardous situation may require angle drilling of production wells from safer areas and placement of power generation facilities at a considerable distance from hazardous areas.

  11. Mt. Baker Geothermal Project | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformationOliver, Pennsylvania:(CTI PFAN) | OpenMt St HelensMt StMt.

  12. 1000 IEEE JOURNAL ON SELECTED AREAS IN COMMUNICATIONS, VOL. 24, NO. 5, MAY 2006 Efficient Signal Proportional Allocation (ESPA)

    E-Print Network [OSTI]

    Liberzon, Daniel

    Proportional Allocation (ESPA) Mechanisms: Decentralized Social Welfare Maximization for Divisible Resources networks. We introduce a class of efficient signal proportional allocation (ESPA) mechanisms that yields

  13. MT1-MMP promotes cell growth and ERK activation through c-Src and paxillin in three-dimensional collagen matrix

    SciTech Connect (OSTI)

    Takino, Takahisa; Tsuge, Hisashi; Ozawa, Terumasa [Department of Molecular Virology and Oncology, Cancer Research Institute, Kanazawa University, Kakuma-machi, Kanazawa 920-1192 (Japan)] [Department of Molecular Virology and Oncology, Cancer Research Institute, Kanazawa University, Kakuma-machi, Kanazawa 920-1192 (Japan); Sato, Hiroshi, E-mail: vhsato@kenroku.kanazawa-u.ac.jp [Department of Molecular Virology and Oncology, Cancer Research Institute, Kanazawa University, Kakuma-machi, Kanazawa 920-1192 (Japan)] [Department of Molecular Virology and Oncology, Cancer Research Institute, Kanazawa University, Kakuma-machi, Kanazawa 920-1192 (Japan)

    2010-06-11

    Membrane-type 1 matrix metalloproteinase (MT1-MMP) is essential for tumor invasion and growth. We show here that MT1-MMP induces extracellular signal-regulated kinase (ERK) activation in cancer cells cultured in collagen gel, which is indispensable for their proliferation. Inhibition of MT1-MMP by MMP inhibitor or small interfering RNA suppressed activation of focal adhesion kinase (FAK) and ERK in MT1-MMP-expressing cancer cells, which resulted in up-regulation of p21{sup WAF1} and suppression of cell growth in collagen gel. Cell proliferation was also abrogated by the inhibitor against ERK pathway without affecting FAK phosphorylation. MT1-MMP and integrin {alpha}{sub v}{beta}{sub 3} were shown to be involved in c-Src activation, which induced FAK and ERK activation in collagen gel. These MT1-MMP-mediated signal transductions were paxillin dependent, as knockdown of paxillin reduced cell growth and ERK activation, and co-expression of MT1-MMP with paxillin induced ERK activation. The results suggest that MT1-MMP contributes to proliferation of cancer cells in the extracellular matrix by activating ERK through c-Src and paxillin.

  14. Compound and Elemental Analysis At Mt St Helens Area (Shevenell...

    Open Energy Info (EERE)

    Date Usefulness not indicated DOE-funding Unknown References L. Shevenell, F. Goff (2000) Temporal Geochemical Variations In Volatile Emissions From Mount St Helens, Usa,...

  15. Compound and Elemental Analysis At Mt St Helens Area (Shevenell...

    Open Energy Info (EERE)

    not indicated DOE-funding Unknown References Lisa Shevenell, Fraser Goff (1995) Evolution Of Hydrothermal Waters At Mount St Helens, Washington, Usa Additional References...

  16. Self Potential At Mt Princeton Hot Springs Geothermal Area (Richards...

    Open Energy Info (EERE)

    2008 - 2010 Usefulness useful DOE-funding Unknown Exploration Basis Determination of groundwater flux patterns Notes Researchers collected 2700 SP measurements. Equilibrium...

  17. Ground Gravity Survey At Marysville Mt Area (Blackwell) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New PagesSustainableGlynn County,Solar Jump to:ResourcesGriggsOpen| OpenAl., 1979)Al., 2003)

  18. Data Acquisition-Manipulation At Marysville Mt Area (Blackwell) | Open

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, Alabama (UtilityInstruments Inc JumpIowa: EnergyDarkEnergy InformationEnergy

  19. Field Mapping At Marysville Mt Area (Blackwell) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButtePowerEdisto ElectricMonaster And Coolbaugh, 2007)

  20. Magnetotelluric Techniques At Mt Princeton Hot Springs Geothermal Area

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource HistoryScenarios Towards 2050EnermarGeneration Jump to:New(Held & Henderson,

  1. Modeling-Computer Simulations At Dixie Valley Geothermal Area...

    Open Energy Info (EERE)

    and Multi-Scale Geothermal Fluid Connections in the Dixie Valley-Central Nevada Seismic Belt Area- Implications from Mt Resistivity Surveying Additional References Retrieved from...

  2. Developing Mt. Hope: The megawatt line

    SciTech Connect (OSTI)

    Rodzianko, P.; Fisher, F.S.

    1992-12-01

    After facing numerous obstacles, including opposition and competition, the Mt. Hope pumped-storage project in New Jersey has been licensed by FERC. That license will allow a former iron ore mine site to be used in producing a new resource-hydroelectricity. In early August 1992, after more than seven years of effort, the 2,000-MW Mt. Hope Waterpower Project was licensed by the Federal Energy Regulatory Commission (FERC). Getting the $1.8 billion pumped-storage project licensed was not an easy task. It involved 54 submittals to FERC, six public meetings, and costs of more than $12 million. Along the way, the project has withstood competing applications, community opposition, and legal battles. Getting a project of this magnitude off the ground is a challenge for even the most experienced developer. The effort was especially challenging for the Halecrest Company, a local family-owned and operated firm with no previous experience in hydroelectric development. When financing became tight, creative ways were found to raise seed capital for the project. When hydroelectric experience was needed, the company developed a world-class corporate team that carried Mt. Hope through the complexities of the licensing process and beyond. With license now in hand, the project developers are ready to move forward with negotiating power sales contracts and securing construction financing. The resulting project will be the second largest pumped-storage facility in the country-second only to the 2,100-MW Bath County project in Virginia. Mt. Hope will take six years to construct and is scheduled to be phased into operation beginning in 1999.

  3. Mt Wheeler Power, Inc | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop Inc Jump to: navigation,Mereg GmbHMontebalitoMt Princeton Hot Springs

  4. 3D Mt Resistivity Imaging For Geothermal Resource Assessment...

    Open Energy Info (EERE)

    3D Mt Resistivity Imaging For Geothermal Resource Assessment And Environmental Mitigation At The Glass Mountain Kgra, California Jump to: navigation, search OpenEI Reference...

  5. MT3DMS v5.3 Supplemental User's Guide

    E-Print Network [OSTI]

    Zheng, Chunmiao

    published by the U.S. Army Corps of Engineers (Zheng and Wang, 1999; available at http://hydro.geo.ua.edu/mt3d). Readers should refer to Zheng and Wang (1999) for complete information on the theoretical Tonkin, Henning Prommer, Chris Langevin, Ned Banta, Eileen Poeter, and Rui Ma in various aspects of MT3

  6. MOBILE INTERACTIVE VISITOR INFORMATION SERVICE: PUKAHA MT. BRUCE TRIAL RESULTS

    E-Print Network [OSTI]

    Zealand Tourism Research Institute Sept 2005 #12;New Zealand Tourism Research Institute September 2005 www Information Service (MIVIS) mobile phones to access audio information at Pukaha Mt Bruce (PMB) were collected and range of visitors using the MIVIS phones in the Pukaha Mt Bruce setting. #12;New Zealand Tourism

  7. WPA Omnibus Award MT Wind Power Outreach

    SciTech Connect (OSTI)

    Brian Spangler, Manager Energy Planning and Renewables

    2012-01-30

    The objective of this grant was to further the development of Montanaâ??s vast wind resources for small, medium, and large scale benefits to Montana and the nation. This was accomplished through collaborative work with wind industry representatives, state and local governments, the agricultural community, and interested citizens. Through these efforts MT Dept Environmental Quality (DEQ) was able to identify development barriers, educate and inform citizens, as well as to participate in regional and national dialogue that will spur the development of wind resources. The scope of DEQâ??s wind outreach effort evolved over the course of this agreement from the development of the Montana Wind Working Group and traditional outreach efforts, to the current focus on working with the stateâ??s university system to deliver a workforce trained to enter the wind industry.

  8. Chi tit mn hc mt bn kia.

    E-Print Network [OSTI]

    California at Davis, University of

    v xã hi, ý n môi trng và sáng to. "Th ô xe p ca Hoa K," Davis là mt cng ng a dng và nng ng chào ón, Phát �m và Nghe Trong Lãnh Vc Hc Tp, và các lãnh vc khác. Ngoài ra cng có nhiu c hi tham gia các t chc ti trng và phc v cng ng. Mun bit ngày tháng, hc phí và các chi tit khác, hãy n: www

  9. Recycling Lingware in a Multilingual MT System Steffen Leo Hansen

    E-Print Network [OSTI]

    Recycling Lingware in a Multilingual MT System Steffen Leo Hansen Manny Rayner David Carter Ivan (Rayner and Carter, 1997). The first is the most obvious: we start with a function- ing grammar

  10. Ground Gravity Survey At Mt Princeton Hot Springs Geothermal...

    Open Energy Info (EERE)

    lithologic distrubtions Notes Gravity low associated with Mt. Princeton Batholith; density contrast of -0.5 gcm3 of valley-fill sediments relative to batholith References J.E....

  11. NEAFS Y-mtDNA Workshop (Butler and Coble) November 1, 2006

    E-Print Network [OSTI]

    NEAFS Y-mtDNA Workshop (Butler and Coble) mtDNA November 1, 2006 http://www.cstl.nist.gov/biotech) mtDNA November 1, 2006 http://www.cstl.nist.gov/biotech/strbase/training.htm 2 Data Review-mtDNA Workshop (Butler and Coble) mtDNA November 1, 2006 http://www.cstl.nist.gov/biotech/strbase/training.htm 3

  12. Signal voter

    DOE Patents [OSTI]

    Goodwin, Roy L. (Chatsworth, CA)

    1981-01-01

    A voter for providing a single accurate output signal that is derived from the closest two signal levels of three input signals, each of which signals represents a measurement of the same phenomena. By means of the voting circuit, the signals are first sorted by level of amplitude and then ranked as highest, middle or lowest. The highest or lowest signal that is furthest from the middle signal is rejected, while the other highest or lowest signal is selected for processing. The selected high or low signal is then averaged with the middle signal to provide the output signal.

  13. A polymorphism in metallothionein 1A (MT1A) is associated with cadmium-related excretion of urinary beta 2?microglobulin

    SciTech Connect (OSTI)

    Lei, Lijian; Department of Epidemiology, School of Public Health, Shanxi Medical University, Shanxi ; Chang, Xiuli; Rentschler, Gerda; Tian, Liting; Zhu, Guoying; Chen, Xiao; Jin, Taiyi; Broberg, Karin

    2012-12-15

    Objectives: Cadmium (Cd) toxicity of the kidney varies between individuals despite similar exposure levels. In humans Cd is mainly bound to metallothioneins (MT), which scavenge its toxic effects. Here we analyzed whether polymorphisms in MT genes MT1A and MT2A influence Cd-related kidney damage. Methods: In a cross-sectional study N = 512 volunteers were selected from three areas in South-Eastern China, which to varying degree were Cd-polluted from a smelter (control area [median Cd in urine U-Cd = 2.67 ?g/L], moderately [U-Cd = 4.23 ?g/L] and highly [U-Cd = 9.13 ?g/L] polluted areas). U-Cd and blood Cd (B-Cd) concentrations were measured by graphite-furnace atomic absorption spectrometry. MT1A rs11076161 (G/A), MT2A rs10636 (G/C) and MT2A rs28366003 (A/G) were determined by Taqman assays; urinary N-Acetyl-beta-(D)-Glucosaminidase (UNAG) by spectrometry, and urinary ?2-microglobulin (UB2M) by ELISA. Results: Higher B-Cd (natural log-transformed) with increasing number of MT1A rs11076161 A-alleles was found in the highly polluted group (p-value trend = 0.033; all p-values adjusted for age, sex, and smoking). In a linear model a significant interaction between rs11076161 genotype and B-Cd was found for UNAG (p = 0.001) and UB2M concentrations (p = 0.001). Carriers of the rs11076161 AA genotype showed steeper slopes for the associations between Cd in blood and natural log-transformed UB2M (? = 1.2, 95% CI 0.72–1.6) compared to GG carriers (? = 0.30, 95% CI 0.15–0.45). Also for UNAG (natural log-transformed) carriers of the AA genotype had steeper slopes (? = 0.55, 95% CI 0.27–0.84) compared to GG carriers (? = 0.018, 95% CI ? 0.79–0.11). Conclusions: MT1A rs11076161 was associated with B-Cd concentrations and Cd-induced kidney toxicity at high exposure levels. -- Highlights: ? Cadmium is toxic to the kidney but the susceptibility differs between individuals. ? The toxic effect of cadmium is scavenged by metallothioneins. ? A common variant of metallothionein 1A was genotyped in 512 cadmium exposed humans. ? Variant carriers of this polymorphism showed more kidney damage from cadmium. ? The frequency of these variants needs to be taken into account in risk assessment.

  14. Probing the lexicon in evaluating commercial MT systems Martin Volk

    E-Print Network [OSTI]

    for self evaluation consisted of technical, linguistic and ergonomic issues. As part of the linguisticProbing the lexicon in evaluating commercial MT systems Martin Volk University of Zurich Department Abstract In the past the evaluation of machine trans- lation systems has focused on single sys- tem

  15. (Have we found the Holy Grail?) Panel at MT-Summit 2003

    E-Print Network [OSTI]

    Wu, Dekai

    (Have we found the Holy Grail?) Panel at MT-Summit 2003 #12;The HKUST Leading Question Translation? If not, is the Holy Grail just around the corner? Translation Are we just about done? #12;Dekai Wu, MT

  16. Altered Mitochondrial Retrograde Signaling in Response to mtDNA Depletion or a Ketogenic Diet

    E-Print Network [OSTI]

    Selfridge, Jennifer Eva

    2012-12-31

    pathways and general neuronal dependence on anaerobic metabolism. Specifically, the electron transport chain function is reduced both systemically and in brains of individuals affected by Alzheimer's disease, amyotrophic lateral sclerosis, and Parkinson...

  17. MT Energie GmbH Co KG | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma,Information MHKMHK5 < MHKKemblaSolar Jump to:Industries Inc JumpMT

  18. RAPID/Roadmap/12-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevada <UtahMontanasourceWA-aCA-aMT-a <

  19. RAPID/Roadmap/15-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎ | RoadmapCO-ceWA-eb <MT-a

  20. RAPID/Roadmap/17-MT-c | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎ |a < RAPID‎CA-aHI-aaMT-c

  1. RAPID/Roadmap/18-MT-b | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎ |a <-AK-b <CO-badMT-b

  2. RAPID/Roadmap/4-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎f <CA-aab <cdMT-a <

  3. RAPID/Roadmap/6-MT-d | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎fRAPID/Roadmap/6-CO-bacMT-d

  4. RAPID/Roadmap/6-MT-f | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/Water Use/Nevadaa < RAPID‎fRAPID/Roadmap/6-CO-bacMT-df

  5. City of Mt Pleasant, Utah (Utility Company) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar EnergyLawler, Iowa (UtilityIowa Phone Number: (319) 385-2121City of Mt

  6. RAPID/Roadmap/14-MT-b | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | Roadmap JumpNV-a <CA-cID-aMT-b <

  7. RAPID/Roadmap/14-MT-c | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | Roadmap JumpNV-a <CA-cID-aMT-b

  8. RAPID/Roadmap/14-MT-d | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | Roadmap JumpNV-a <CA-cID-aMT-bd

  9. RAPID/Roadmap/17-MT-d | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | Roadmap JumpNV-ad-MT-d < RAPID‎ |

  10. RAPID/Roadmap/20-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | RoadmapAK-a < RAPID‎ |MT-a <

  11. RAPID/Roadmap/8-MT-a | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-b < RAPID‎ | RoadmapAK-abFD-a < RAPID‎ID-eMT-a

  12. HERO Ski Trip to Mt. Hood Meadows February

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverse (Journalvivo Low-Dose Lowď‚— WeUpdateScienceForTrip to Mt. Hood Meadows

  13. Adaptive Fuzzy Systems for Multichannel Signal Processing

    E-Print Network [OSTI]

    Plataniotis, Konstantinos N.

    Adaptive Fuzzy Systems for Multichannel Signal Processing KONSTANTINOS N. PLATANIOTIS, MEMBER, IEEE Processing multichannel signals using digital signal process- ing techniques has received increased attention beginning in this area and 2) to provide a review for the reader who may be well versed in signal processing

  14. Getting Our Feet Wet: Water Management at Mt. Laguna in Cleveland National Forest

    E-Print Network [OSTI]

    Mumby, William Cade

    2013-01-01

    Strategies for Rural Communities. ” National Conference onallocation facing the rural community of Mt. Laguna? (EquityStrategies for Rural Communities. ” National Conference on

  15. Thermal And-Or Near Infrared At Marysville Mt Area (Blackwell) | Open

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al., 2013) |InformationThe2009) | Open Energy2008) | Open EnergyEnergy

  16. Thermal And-Or Near Infrared At Mt Ranier Area (Frank, 1995) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al., 2013) |InformationThe2009) | Open Energy2008) | Open

  17. Testing neural mechanisms that may underlie spatiotopic processing in area MT

    E-Print Network [OSTI]

    Ong, Wei Song

    2012-01-01

    Hence if motion processing occurs in retinal coordinates, wethat show motion processing do so in retinal coordinates, wein retinal coordinates, can have spatiotopic processing. In

  18. Geothermal Literature Review At Mt Ranier Area (Frank, 1995) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New PagesSustainable UrbanKentucky:Bore Technologies IncEnergy2002) | Open1957)

  19. Geothermometry At Mt St Helens Area (Shevenell & Goff, 1995) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New PagesSustainable UrbanKentucky:Bore TechnologiesAssessmentOpenFishOpen Energy1976)

  20. Self Potential At Mt St Helens Area (Bedrosian, Et Al., 2007) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/ColoradoRemsenburg-Speonk,SageScheucoSedco Hills,Information HualalaiInformation St

  1. Isotopic Analysis At Mt St Helens Area (Shevenell & Goff, 1995) | Open

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas: Energy ResourcesOrder at 8, 13RenewableIremInformation Goff, Et Al.,2002) |

  2. Isotopic Analysis At Mt St Helens Area (Shevenell & Goff, 2000) | Open

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas: Energy ResourcesOrder at 8, 13RenewableIremInformation Goff, Et Al.,2002)

  3. Refraction Survey At Mt Princeton Hot Springs Geothermal Area (Lamb, Et

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/Colorado <RAPID/Geothermal/WaterEnergyRedfield1989) Jump to:| Open1979) |Al., 2012) |

  4. Self Potential At Mt Princeton Hot Springs Geothermal Area (Richards, Et

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS Report UrlNM-bRenewableSMUDSectional Modelof the

  5. Thermal Gradient Holes At Mt Princeton Hot Springs Geothermal Area (Held &

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EISTJ AutomationTexas/WindEnergyOpen EnergyInformation Mcgee

  6. Water Sampling At Mt Princeton Hot Springs Geothermal Area (Olson &

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EISTJThinWarsaw, Poland: EnergyPageEnergyDellechaie, 1976) | Open Energy

  7. Water Sampling At Mt Ranier Area (Frank, 1995) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EISTJThinWarsaw, Poland: EnergyPageEnergyDellechaie, 1976) | Open

  8. Water Sampling At Mt St Helens Area (Shevenell & Goff, 1995) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EISTJThinWarsaw, Poland: EnergyPageEnergyDellechaie, 1976) |

  9. Aeromagnetic Survey At Mt Princeton Hot Springs Geothermal Area (Case, Et

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EAand DaltonSolar EnergyAerodyn Energiesysteme GmbHOpenAl., 1984) | Open

  10. Aeromagnetic Survey At Mt St Helens Area (Towle, 1983) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EAand DaltonSolar EnergyAerodyn Energiesysteme GmbHOpenAl., 1984) |

  11. Controlled Source Audio MT At Mccoy Geothermal Area (DOE GTP) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, Alabama (Utility Company)| Open(Evans, EtInformation Control of Well KS-8 in

  12. Geothermometry At Mt Princeton Hot Springs Geothermal Area (Pearl, Et Al.,

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource History View New Pages RecentPlant < Geothermal(Redirected

  13. Ground Gravity Survey At Mt Princeton Hot Springs Geothermal Area (Case, Et

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource History View New PagesInformationEnergy Information 2)EnergyAl., 1984) |

  14. Compound and Elemental Analysis At Mt St Helens Area (Shevenell & Goff,

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButtePower Ventures JumpCommercial Jump(Thompson, 1985) | Open1995) | Open Energy

  15. Compound and Elemental Analysis At Mt St Helens Area (Shevenell & Goff,

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButtePower Ventures JumpCommercial Jump(Thompson, 1985) | Open1995) | Open

  16. Controlled Source Audio MT At Cove Fort Area - Liquid (Combs 2006) | Open

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButtePower Ventures JumpCommercialRenewableGlobal L P Jump to: navigation,Energy

  17. Controlled Source Audio MT At Pilgrim Hot Springs Area (DOE GTP) | Open

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButtePower Ventures JumpCommercialRenewableGlobal L P Jump to:

  18. Controlled Source Audio MT At Roosevelt Hot Springs Area (Combs 2006) |

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButtePower Ventures JumpCommercialRenewableGlobal L P Jump to:Open Energy

  19. Searches for supersymmetry using the MT2 variable in hadronic events produced in pp collisions at 8 TeV

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Khachatryan, V.

    2015-05-15

    Searches for supersymmetry (SUSY) are performed using a sample of hadronic events produced in 8 TeV pp collisions at the CERN LHC. The searches are based on the MT2 variable, which is a measure of the transverse momentum imbalance in an event. The data were collected with the CMS detector and correspond to an integrated luminosity of 19.5 fb?ą. Two related searches are performed. The first is an inclusive search based on signal regions defined by the value of the MT2 variable, the hadronic energy in the event, the jet multiplicity, and the number of jets identified as originating frommore »bottom quarks. The second is a search for a mass peak corresponding to a Higgs boson decaying to a bottom quark-antiquark pair, where the Higgs boson is produced as a decay product of a SUSY particle. For both searches, the principal backgrounds are evaluated with data control samples. No significant excess over the expected number of background events is observed, and exclusion limits on various SUSY models are derived.« less

  20. Visual Field Maps, Population Receptive Field Sizes, and Visual Field Coverage in the Human MT Complex

    E-Print Network [OSTI]

    Dumoulin, Serge O.

    of processing in human motion-selective cortex. I N T R O D U C T I O N Neuroimaging experiments localize human by additional experiments. Defining human MT based on stimulus selectivity means that the identificationVisual Field Maps, Population Receptive Field Sizes, and Visual Field Coverage in the Human MT

  1. Bitcoin Transaction Malleability and MtGox Christian Decker and Roger Wattenhofer

    E-Print Network [OSTI]

    Bitcoin Transaction Malleability and MtGox Christian Decker and Roger Wattenhofer ETH Zurich International Publishing Switzerland 2014 #12;314 C. Decker and R. Wattenhofer exchanges its monopoly slowly doubled the withdrawn bitcoins, once from the withdrawal and once on its account on MtGox. In this work we

  2. An assessment of regional climate trends and changes to the Mt. Jaya glaciers of Irian Jaya 

    E-Print Network [OSTI]

    Kincaid, Joni L.

    2007-09-17

    on the Mt. Jaya glaciers has been lacking since the early 1970s. Using IKONOS satellite images, the ice extents of the Mt. Jaya glaciers in 2000, 2002, 2003, 2004, and 2005 were mapped. The mapping indicates that the recessional trend which began in the mid...

  3. Mt. Etna tropospheric ash retrieval and sensitivity analysis using Moderate Resolution Imaging

    E-Print Network [OSTI]

    Oxford, University of

    Mt. Etna tropospheric ash retrieval and sensitivity analysis using Moderate Resolution Imaging.pugnaghi@unimore.it, gabriele.gangale@unimore.it Abstract. A retrieval of tropospheric volcanic ash from Mt Etna has been. In order to derive the ash plume optical thickness, the particle effective radius and the total mass

  4. A MT System from Turkmen to Turkish Employing Finite State and Statistical Methods

    E-Print Network [OSTI]

    Yanikoglu, Berrin

    between close language pairs can be relatively easier and can still benefit from simple(r) paradigms in MT with a disambiguation post-processing stage based on statistical language models. The very productive inflectionalA MT System from Turkmen to Turkish Employing Finite State and Statistical Methods A. Cüneyd TANTU

  5. Graduate Research Opportunities in SIGNALS, SYSTEMS & COMPUTATIONAL INTELLIGENCE

    E-Print Network [OSTI]

    Rusu, Adrian

    Communications · Computer Networks · Bioinformatics · Biomedical Signal Processing & Modeling · Image Processing in relevant areas (signal processing, probability and statistics, linear algebra, programming, bioinformatics background courses. Electives offered include: · Advanced Digital Signal Processing · Wavelets Transforms

  6. Signal Processing 85 (2005) 571580 Constructive role of noise in signal detection from parallel

    E-Print Network [OSTI]

    Chapeau-Blondeau, François

    2005-01-01

    Signal Processing 85 (2005) 571­580 Constructive role of noise in signal detection from parallel transmission or processing of signals with arbitrary amplitude can be improved by added noises in arrays. r reported in many areas, under many different forms, with various types of signals, nonlinear processes

  7. MT3D: a 3 dimensional magnetotelluric modeling program (user's guide and documentation for Rev. 1)

    SciTech Connect (OSTI)

    Nutter, C.; Wannamaker, P.E.

    1980-11-01

    MT3D.REV1 is a non-interactive computer program written in FORTRAN to do 3-dimensional magnetotelluric modeling. A 3-D volume integral equation has been adapted to simulate the MT response of a 3D body in the earth. An integro-difference scheme has been incorporated to increase the accuracy. This is a user's guide for MT3D.REV1 on the University of Utah Research Institute's (UURI) PRIME 400 computer operating under PRIMOS IV, Rev. 17.

  8. NEAFS Y-mtDNA Workshop (Butler and Coble) Markers, Core Loci, and Kits

    E-Print Network [OSTI]

    ) ­ Ann Gross (MN) ­ Jill Smerick (FBI) ­ Sam Baechtel (FBI) ­ Roger Frappier (CFS) ­ Phil Kinsey (OR now MT) ­ Gary Sims (CA DOJ) ­ George Carmody (retired) ­ Mike Adamowicz (CT) ­ Bruce Budowle (FBI

  9. TIME-VARIABLEFILTERING OF MtTLTI[CHANNELSIGNALS USING MULTIPLE WINDOWS COHERENCEAND THE WEYL TRANSFORM

    E-Print Network [OSTI]

    Sandsten, Maria

    TIME-VARIABLEFILTERING OF MtTLTI[CHANNELSIGNALS USING MULTIPLE WINDOWS COHERENCEAND THE WEYL between all channel pairs. Time-frequency coherence functions are estimated using the multiple window

  10. The Genetic Structure of the Kuwaiti Population: mtDNA Inter- and Intra-population Variation

    E-Print Network [OSTI]

    Theyab, Jasem; Al-Bustan, Suzanne; Crawford, Michael H.

    2012-08-01

    it to their neighboring populations. These subpopulations were tested for genetic homogeneity and shown to be heterogeneous. Restriction fragment length polymorphism (RFLP) and mtDNA sequencing analyses of HVRI were used to reconstruct the genetic structure of Kuwait...

  11. Integrated Dense Array and Transect MT Surveying at Dixie Valley...

    Open Energy Info (EERE)

    Dixie Valley Geothermal Area, Nevada- Structural Controls, Hydrothermal Alteration and Deep Fluid Sources Jump to: navigation, search OpenEI Reference LibraryAdd to library...

  12. Thermal Gradient Holes At Mt Princeton Hot Springs Geothermal...

    Open Energy Info (EERE)

    the area References J. Held, F. Henderson (2012) New developments in Colorado geothermal energy projects Additional References Retrieved from "http:en.openei.orgw...

  13. Integrated Signal Processing and Signal Understanding1

    E-Print Network [OSTI]

    Massachusetts at Amherst, University of

    Integrated Signal Processing and Signal Understanding1 Victor Lesser, Hamid Nawaby, Malini Bhandaru processing and heuristic problem-solving in signal interpretation. The need for such a paradigm arises in signal understanding domains that require the processing of complicated interacting signals under

  14. Integrated Signal Processing and Signal Understanding 1

    E-Print Network [OSTI]

    Massachusetts at Amherst, University of

    Integrated Signal Processing and Signal Understanding 1 Victor Lesser, Hamid Nawab y , Malini processing and heuristic problem­solving in signal interpretation. The need for such a paradigm arises in signal understanding domains that require the processing of complicated interacting signals under

  15. Seismicity induced by seasonal groundwater recharge at Mt. Hood, Oregon

    E-Print Network [OSTI]

    Manga, Michael

    and narrow-width pore-fluid pressure signal. Time delays between this seasonal groundwater recharge-fluid pressure fraction, PP/P0W0.1, of the applied near-surface pore-fluid pressure perturbation, P0W0.1 MPa Elsevier B.V. All rights reserved. Keywords: hydroseismicity; groundwater; pore-Łuid pressure; permeability

  16. Uranium hydrogeochemical and stream-sediment reconnaissance of the Mt. Michelson NTMS quadrangle, Alaska

    SciTech Connect (OSTI)

    Zinkl, R.J.; Shettel, D.L. Jr.; Langfeldt, S.L.; Hardy, L.C.; D'Andrea, R.F. Jr.

    1982-04-01

    This report presents results of a Hydrogeochemical and Stream Sediment Reconnaissance (HSSR) of the Mt. Michelson NTMS quadrangle, Alaska. In addition to this abbreviated data release, more complete data are available to the public in machine-readable form. These machine-readable data, as well as quarterly or semiannual program progress reports containing further information on the HSSR program in general, or on the Los Alamos National Laboratory (LANL) portion of the program in particular, are available from DOE's Technical Library at its Grand Junction Area Office. Presented in this data release are location data, field analyses, and laboratory analyses of several different sample media. For the sake of brevity, many field site observations have not been included in this volume; these data are, however, available on the magnetic tape. Appendices A and B describe the sample media and summarize the analytical results for each medium. The data have been subdivided by one of the Los Alamos National Laboratory sorting programs of Zinkl and others (1981a) into groups of stream-sediment and lake-sediment samples. For each group which contains a sufficient number of observations, statistical tables, tables of raw data, and 1:1,000,000 scale maps of pertinent elements have been included in this report. Also included are maps showing results of multivariate statistical analyses. Information on the field and analytical procedures used by the Los Alamos National Laboratory during sample collection and analysis may be found in any HSSR data release prepared by the Laboratory and will not be included in this report.

  17. Scram signal generator

    DOE Patents [OSTI]

    Johanson, Edward W. (New Lenox, IL); Simms, Richard (Westmont, IL)

    1981-01-01

    A scram signal generating circuit for nuclear reactor installations monitors a flow signal representing the flow rate of the liquid sodium coolant which is circulated through the reactor, and initiates reactor shutdown for a rapid variation in the flow signal, indicative of fuel motion. The scram signal generating circuit includes a long-term drift compensation circuit which processes the flow signal and generates an output signal representing the flow rate of the coolant. The output signal remains substantially unchanged for small variations in the flow signal, attributable to long term drift in the flow rate, but a rapid change in the flow signal, indicative of a fast flow variation, causes a corresponding change in the output signal. A comparator circuit compares the output signal with a reference signal, representing a given percentage of the steady state flow rate of the coolant, and generates a scram signal to initiate reactor shutdown when the output signal equals the reference signal.

  18. An Optimization Model for Eco-Driving at Signalized Intersection 

    E-Print Network [OSTI]

    Chen, Zhi

    2013-07-15

    This research develops an optimization model for eco-driving at signalized intersection. In urban areas, signalized intersections are the “hot spots” of air emissions and have significant negative environmental and health impacts. Eco-driving is a...

  19. Experiment operations plan for the MT-4 experiment in the NRU reactor. [PWR

    SciTech Connect (OSTI)

    Russcher, G.E.; Wilson, C.L.; Parchen, L.J.; Marshall, R.K.; Hesson, G.M.; Webb, B.J.; Freshley, M.D.

    1983-06-01

    A series of thermal-hydraulic and cladding materials deformation experiments were conducted using light-water reactor fuel bundles as part of the Pacific Northwest Laboratory Loss-of-Coolant Accident (LOCA) Simulation Program. This report is the formal operations plan for MT-4 - the fourth materials deformation experiment conducted in the National Research Universal (NRU) reactor, Chalk River, Ontario, Canada. A major objective of MT-4 was to simulate a pressurized water reactor LOCA that could induce fuel rod cladding deformation and rupture due to a short-term adiabatic transient and a peak fuel cladding temperature of 1200K (1700/sup 0/F).

  20. Signal and imaging sciences workshop proceedings

    SciTech Connect (OSTI)

    Candy, J.V.

    1997-11-01

    Papers are presented in the areas of: Medical Technologies; Non-Destructive Evaluation; Applications of Signal/Image Processing; Laser Guide Star and Adaptive Optics; Computational Electromagnetic, Acoustics and Optics; Micro-Impulse Radar Processing; Optical Applications; TANGO Space Shuttle.

  1. LIZARD CHEMICAL SIGNALS Around Mt Isa. A Guide to the Flora and Fauna, Pair-bonding in chameleons. Naturwissenschaften

    E-Print Network [OSTI]

    Macedonia, Joseph

    and Coloration in the JamaicanRadiation of Anolis Lizards JOSEPH M. MACEDONIA,~,~SARAHJAMES,' W. WITTLE

  2. Dr. Joseph A. Shaw Electrical & Computer Engineering Dept., Montana State University, Bozeman, MT 59717

    E-Print Network [OSTI]

    Lawrence, Rick L.

    Dr. Joseph A. Shaw Electrical & Computer Engineering Dept., Montana State University, Bozeman, MT M.S. Electrical Engineering University of Utah 1987 B.S. Electrical Engineering University of Alaska Experience: 2008 ­ present Professor ­ Electrical & Computer Engineering (ECE) Department, Montana State

  3. Synchronous Dependency Insertion Grammars A Grammar Formalism for Syntax Based Statistical MT

    E-Print Network [OSTI]

    Synchronous Dependency Insertion Grammars A Grammar Formalism for Syntax Based Statistical MT Yuan formalism specifically designed for syntax-based sta- tistical machine translation. The synchro- nous between lan- guages, which many other synchronous grammars are unable to model. A Depend- ency Insertion

  4. MONTANA OUTDOORS 3130 MARCH APRIL 2014 FWP.MT.GOV/MTOUTDOORS Why mountain bluebirds

    E-Print Network [OSTI]

    Duckworth, Renée

    MONTANA OUTDOORS 3130 MARCH APRIL 2014 FWP.MT.GOV/MTOUTDOORS TURF WAR TWIST Why mountain bluebirds are good for this species in western Montana valleys but don't benefit, in the long run, mountain bluebirds. Although mountain blue- birds also lost nesting sites, they had evolved to also use habitats at higher

  5. Intermountain GIS Conference. April 1923 2010, Bozeman, MT. Patrick Lawrence, Maxwell BD, Rew LJ

    E-Print Network [OSTI]

    Maxwell, Bruce D.

    Intermountain GIS Conference. April 1923 2010, Bozeman, MT. Patrick Lawrence, Maxwell BD, Rew in the Python programming language, drawing on Python's builtin library, the RPy extension, ArcGIS geoprocessing and ArcGIS Server. As inputs, it accepts transect shapefiles, transect text files, or point

  6. MT3DMS, A Modular Three-Dimensional Multispecies Transport Model User Guide to the

    E-Print Network [OSTI]

    Zheng, Chunmiao

    .M. Cozzarelli, M.H. Lahvis, and B.A. Bekins. 1998. Ground water contamination by crude oil near Bemidji (LNAPL) contaminant through the unsaturated zone and the formation of an oil lens on the water tableMT3DMS, A Modular Three-Dimensional Multispecies Transport Model ­ User Guide to the Hydrocarbon

  7. Hybrid Rule-Based Example-Based MT: Feeding Apertium with Sub-sentential Translation Units

    E-Print Network [OSTI]

    Way, Andy

    Hybrid Rule-Based ­ Example-Based MT: Feeding Apertium with Sub-sentential Translation Units Felipe S´anchez-Mart´inez Mikel L. Forcada Andy Way Dept. Llenguatges i Sistemes Inform`atics Universitat University Dublin 9, Ireland {mforcada,away}@computing.dcu.ie Abstract This paper describes a hybrid machine

  8. Stress magnitude and its temporal variation at Mt. Asama Volcano, Japan, from seismic anisotropy and GPS

    E-Print Network [OSTI]

    Utrecht, Universiteit

    Stress magnitude and its temporal variation at Mt. Asama Volcano, Japan, from seismic anisotropy stress Japan The Earth's stress regime is fundamental to its physical processes, yet few methods can determine absolute stress, and measurements of temporal variations in stress are controversial. The Global

  9. Some Effects of Mt. St. Helens Volcanic Ash on Juvenile Salmon Smolts

    E-Print Network [OSTI]

    Some Effects of Mt. St. Helens Volcanic Ash on Juvenile Salmon Smolts TIMOTHY W. NEWCOMB and THOMAS. Helens, which was completely decimated with vol- canic ash and mud slides. Heavy sediment loads smolts were exposed to various concentrations ofairborne volcanic ash from the 18 May 1980 eruption

  10. High-latitude vegetation dynamics: 850 years of vegetation development on Mt Hekla, Iceland 

    E-Print Network [OSTI]

    Cutler, Nick

    2008-01-01

    on Mt Hekla in south-central Iceland. The chronosequence approach was used to infer 850 years of vegetation development from a suite of 14 lava flows (five of which had been disturbed by the deposition of volcanic tephra). The thesis is organised around...

  11. Geophys. 1. R. astr. Soc. (1987),89,7-18 MT and reflection: an essential combination

    E-Print Network [OSTI]

    Jones, Alan G.

    1987-01-01

    ) studies and seismic reflection profiles conducted. Unfortunately, over many more regions the seismic of the magnetotelluric (MT) technique as having a vertical resolution equivalent to the seismic refraction method, in almost every case, be made wherever a seismic reflection survey is undertaken. Examples are shown from

  12. Communications, and Signal Processing

    E-Print Network [OSTI]

    Prodić, Aleksandar

    : Digital signal processing ECE 462: Multimedia systems ECE 516 Intelligent image processing Biomedical: Digital signal processing ECE 462: Multimedia systems ECE 516 Intelligent image processing Biomedical: Digital signal processing ECE 462: Multimedia systems ECE 516 Intelligent image processing Biomedical

  13. Marysville Test Well Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource HistoryScenariosMarysville Mt Geothermal Area Jump to: navigation,

  14. Highlights of Statistical Signal and Array Processing June 29, 1998

    E-Print Network [OSTI]

    Hero, Alfred O.

    Highlights of Statistical Signal and Array Processing June 29, 1998 1 Background and Overview. Broadly stated, the Statistical Signal and Array Processing SSAP area is concerned with re- liable issue of the IEEE Transactions on Signal Processing to a SSAP paper the reader will probably see one

  15. Hazard assessment in geothermal exploration: The case of Mt. Parker, Southern Philippines

    SciTech Connect (OSTI)

    Delfin, F.G. Jr.; Salonga, N.D.; Bayon, F.E.B.

    1996-12-31

    Hazard assessment of the Mt. Parker geothermal prospect, conducted in parallel with the surface exploration from 1992 to 1994, was undertaken to determine the long-term suitability of the prospect for development. By comparison with other acidic magmatic-hydrothermal systems in the Philippines, the geochemical data indicated minimal input of acidic magmatic fluids into Mt. Parker`s hydrothermal system. This system was regarded to be a neutral-pH and high-enthalpy chloride reservoir with temperature of at least 200-250{degrees}C. These favorable geochemical indications contrasted sharply with the C-14 and volcanological data indicating a shallow magmatic body with a potential for future eruption. This hazard led PNOC EDC to discontinue the survey and abandon the prospect by late 1994. On September 6, 1995, a flashflood of non-volcanic origin from the caldera lake killed nearly 100 people on the volcano`s northwestern flank.

  16. Tidally dominated depositional environment for the Mt. Simon Sandstone in central Illinois

    SciTech Connect (OSTI)

    Sargent, M.L.; Lasemi, Z. (Illinois State Geological Survey, Champaign, IL (United States))

    1993-03-01

    Several hundred feet of core from the upper part of the Mt. Simon in central Illinois have been examined macroscopically. Grain sizes and their systematics, bedding characteristics, sedimentary structures, and relationships among beds show that the upper Mt. Simon Sandstone is composed of a series of fining-upward cycles up to 10 m (30 feet) thick. A typical cycle consists, in ascending order, of a sandy subtidal facies, a mixed sand and mud intertidal-flat facies, and a muddy upper tidal-flat facies upward through the succession, the maximum and average grain size becomes progressively finer and the cycles thinner. The lower sandstone of each cycle contains beds that are massive to cross bedded and cross laminated; some beds show scoured reactivation surfaces. A few cycles contain a middle unit characterized by flaser and lenticular bedding and abundant mudcracks. Mudcracks also are common in the shale beds at the top of each cycle. Sedimentary structures such as reactivation surfaces, flaser and lenticular bedding, and mudcracks suggest that these cycles were deposited in peritidal environments. The presence of Skolithos in some cycles suggests very shallow marine conditions. The within-cycle upward fining is caused by regression or progradation that reflects a progressive decrease in current velocity from subtidal to intertidal parts of the tidal flat. Frequent flooding of the tidal flat resulted in repeated fining-upward cycles within the upper part of the Mt. Simon Sandstone.

  17. Application of Remote Sensing Technology and Ecological Modeling of Forest Carbon Stocks in Mt. Apo Natural Park, Philippines 

    E-Print Network [OSTI]

    Leal, Ligaya Rubas

    2015-01-23

    This dissertation work explored the application of remote sensing technology for the assessment of forest carbon storage in Mt. Apo Natural Park. Biomass estimation is traditionally conducted using destructive sampling with high levels...

  18. Sequence Stratigraphy and Detrital Zircon Geochronology of Middle-Late Ordovician Mt. Wilson Quartzite, British Columbia, Canada 

    E-Print Network [OSTI]

    Hutto, Andrew Paul

    2012-07-16

    STRATIGRAPHY AND DETRITAL ZIRCON GEOCHRONOLOGY OF MIDDLE-LATE ORDOVICIAN MT. WILSON QUARTZITE, BRITISH COLUMBIA CANADA A Thesis by ANDREW PAUL HUTTO Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment... of the requirements for the degree of MASTER OF SCIENCE May 2012 Major Subject: Geology Sequence Stratigraphy and Detrital Zircon Geochronology of Middle-Late Ordovician Mt. Wilson...

  19. Mechanical Systems Signal Processing

    E-Print Network [OSTI]

    Verleysen, Michel

    Mechanical Systems and Signal Processing Mechanical Systems and Signal Processing 22 (2008) 155 Department of Mechanical Engineering, University of Sheffield, Mappin Street S1 3JD Sheffield, UK Received 27

  20. Remote sensing, imaging, and signal engineering

    SciTech Connect (OSTI)

    Brase, J.M.

    1993-03-01

    This report discusses the Remote Sensing, Imaging, and Signal Engineering (RISE) trust area which has been very active in working to define new directions. Signal and image processing have always been important support for existing programs at Lawrence Livermore National Laboratory (LLNL), but now these technologies are becoming central to the formation of new programs. Exciting new applications such as high-resolution telescopes, radar remote sensing, and advanced medical imaging are allowing us to participate in the development of new programs.

  1. From Signal Information Processing

    E-Print Network [OSTI]

    From Signal to Information Processing Don H. Johnson Computer and Information Technology Institute of signals o Here, all signals are assumed to be stochastic information source information encoder Information extraction systems--determining a from X(a)--fall into two categories h Classification: Which

  2. Mechanical Systems Signal Processing

    E-Print Network [OSTI]

    Ray, Asok

    Mechanical Systems and Signal Processing Mechanical Systems and Signal Processing 21 (2007) 866 and analytical models. This paper attempts to address this inadequacy by taking advantage of advanced signal processing and pattern recognition tools. Since a vast majority of structural components that are prone

  3. Research Areas

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.Theory ofDid youOxygen Generation |Publications TheGashome /Areas Research Areas

  4. Havre, MT Natural Gas Pipeline Imports From Canada (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming963 1.969CentralWellsMillion Cubic Feet) Havre, MT Natural Gas Pipeline

  5. Method and apparatus for improving resolution in spectrometers processing output steps from non-ideal signal sources

    DOE Patents [OSTI]

    Warburton, William K.; Momayezi, Michael

    2006-06-20

    A method and apparatus for processing step-like output signals (primary signals) generated by non-ideal, for example, nominally single-pole ("N-1P ") devices. An exemplary method includes creating a set of secondary signals by directing the primary signal along a plurality of signal paths to a signal summation point, summing the secondary signals reaching the signal summation point after propagating along the signal paths to provide a summed signal, performing a filtering or delaying operation in at least one of said signal paths so that the secondary signals reaching said summing point have a defined time correlation with respect to one another, applying a set of weighting coefficients to the secondary signals propagating along said signal paths, and performing a capturing operation after any filtering or delaying operations so as to provide a weighted signal sum value as a measure of the integrated area QgT of the input signal.

  6. Mechanical Systems Signal Processing

    E-Print Network [OSTI]

    Carvalho, Joăo B.

    , Northern Illinois University, DeKalb, IL 60115, USA c Department of Mechanical Engineering & VibrationMechanical Systems and Signal Processing Mechanical Systems and Signal Processing 21 (2007) 2715 Federal de Rio Grande do Sul, Brazil b Department of Mathematical Sciences & Vibration and Acoustic Center

  7. Uranium hydrogeochemical and stream sediment reconnaissance of the Mt. Hayes NTMS quadrangle, Alaska

    SciTech Connect (OSTI)

    Not Available

    1981-05-01

    Results of a hydrogeochemical and stream sediment reconnaissance of the Mt. Hayes quadrangle, Alaska, are presented. In addition to this abbreviated data release, more complete data are available to the public in machine-readable form. In this data release are location data, field analyses, and Laboratory analyses of several different sample media. For the sake of brevity, many field site observations have not been included in this volume. These data are, however, available on the magnetic tape. Appendices A to D describe the sample media and summarize the analytical results for each medium. The data were subsetted by one of the Los Alamos National Laboratory (LANL) sorting programs into groups of stream sediment, lake sediment, stream water, lake water, and ground water samples. For each group which contains a sufficient number of observations, statistical tables, tables of raw data, and 1:1000000 scale maps of pertinent elements have been included in this report.

  8. EIS-0092: Conversion to Coal, Holyoke Water Power Company, Mt. Tom Generating Station Unit 1 Holyoke, Hampden County, Massachusetts

    Broader source: Energy.gov [DOE]

    The Economic Regulatory Administration prepared this statement to assess the environmental impacts of prohibiting Unit 1 of the Mt. Tom Generation Station Unit 1 from using either natural gas or petroleum products as a primary energy source, which would result in the utility burning low-sulfur coal.

  9. The Mechanism of Inhibition of Antibody-based Inhibitors of Membrane-type Serine Protease 1 (MT-SP1)

    E-Print Network [OSTI]

    Craik, Charles S.

    The Mechanism of Inhibition of Antibody-based Inhibitors of Membrane-type Serine Protease 1 (MT-SP1, 600 16th St. Genentech Hall, San Francisco, CA 94143, USA The mechanisms of inhibition of two novel sc-SP1 at low pH, and is a standard mechanism inhibitor of the protease. The mechanisms of inhibition

  10. Mauna Loa Northeast Rift Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource HistoryScenariosMarysville Mt GeothermalMauna Loa Northeast Rift Geothermal Area

  11. Medical Area Total Egy Plt Inc | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource HistoryScenariosMarysville MtMedical Area Total Egy Plt Inc Jump to: navigation,

  12. Medical Hot Springs Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource HistoryScenariosMarysville MtMedical Area Total Egy Plt Inc Jump to:Medical Hot

  13. Mickey Hot Springs Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource HistoryScenariosMarysville MtMedical AreaInformationMickey Hot Springs

  14. Liquidity facilities and signaling

    E-Print Network [OSTI]

    Arregui, Nicolás

    2010-01-01

    This dissertation studies the role of signaling concerns in discouraging access to liquidity facilities like the IMF contingent credit lines (CCL) and the Discount Window (DW). In Chapter 1, I analyze the introduction of ...

  15. Hierarchical classification of modulation signals 

    E-Print Network [OSTI]

    Kim, Nam Jin

    2002-01-01

    This thesis addresses the problem of classifying both analog and digital modulation signals using different kinds of classifiers. The classification of modulation signals has both civilian and military applications. A total of 31 statistical signal...

  16. Digital Signal Processing applied to Physical Signals

    E-Print Network [OSTI]

    Alberto, Diego; Musa, L

    2011-01-01

    It is well known that many of the scientific and technological discoveries of the XXI century will depend on the capability of processing and understanding a huge quantity of data. With the advent of the digital era, a fully digital and automated treatment can be designed and performed. From data mining to data compression, from signal elaboration to noise reduction, a processing is essential to manage and enhance features of interest after every data acquisition (DAQ) session. In the near future, science will go towards interdisciplinary research. In this work there will be given an example of the application of signal processing to different fields of Physics from nuclear particle detectors to biomedical examinations. In Chapter 1 a brief description of the collaborations that allowed this thesis is given, together with a list of the publications co-produced by the author in these three years. The most important notations, definitions and acronyms used in the work are also provided. In Chapter 2, the last r...

  17. Rock Sampling At Roosevelt Hot Springs Geothermal Area (Ward, Et Al., 1978)

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/ColoradoRemsenburg-Speonk, NewMichigan: Energy Resources JumpMt Ranier Area (Frank, 1995)|

  18. Rock Sampling At San Francisco Volcanic Field Area (Warpinski, Et Al.,

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/ColoradoRemsenburg-Speonk, NewMichigan: Energy Resources JumpMt Ranier Area (Frank,

  19. Rock Sampling At Seven Mile Hole Area (Larson, Et Al., 2009) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/ColoradoRemsenburg-Speonk, NewMichigan: Energy Resources JumpMt Ranier Area

  20. Rock Sampling At Socorro Mountain Area (Armstrong, Et Al., 1995) | Open

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/ColoradoRemsenburg-Speonk, NewMichigan: Energy Resources JumpMt Ranier AreaEnergy

  1. ADAPTIVE OPTICAL SIGNAL PROCESSING FOR MICROWAVE-CARRIER BROADBAND SIGNALS

    E-Print Network [OSTI]

    Popovic, Zoya

    ADAPTIVE OPTICAL SIGNAL PROCESSING FOR MICROWAVE-CARRIER BROADBAND SIGNALS Paul Smith, Zoya Popovic antenna array in which adaptive processing of the received signals is performed by dynamic holographic to other signal-processing algorithms is also discussed. 1. INTRODUCTION A key challenge to present

  2. Reinforcement learning signals predict future decisions

    E-Print Network [OSTI]

    Cohen, Michael X; Ranganath, Charan

    2007-01-01

    Holroyd CB, Cohen JD (2005) ERP correlates of feedback andde-la-Pena MT (2004) ERP evidence of MI acti- vation withoutdecision-making. Analyses of ERP data focused on the

  3. Applications of stable isotopes in hydrological studies of Mt. Apo geothermal field, Philippines

    SciTech Connect (OSTI)

    Salonga, N.D.; Aragon, G.M.; Nogara, J.B.; Sambrano, B.G.

    1996-12-31

    The local precipitation in Mt. Apo is depleted of heavy isotopes owing to high elevation and landward location of the field. Rainwaters infiltrate the shallow grounds, circulate in short distances with almost no interaction with the host bed rocks, and effuse in the surface as cold springs. Lakes and rivers are affected by surface evaporation while the acid SO{sub 4} springs are affected by both evaporation and steam-heating. Only the neutral-pH Cl springs have the signature of the deep thermal fluids. The parent fluids of the deep thermal brine contain Cl of 4,800 to 5,000 mg/kg, {delta}{sup 18}O of -4.62 to -4.13 {per_thousand} and {delta}{sup 2}H of -60.0 to -57.8 {per_thousand}. Inside the Sandawa Collapse, boiling of the parent fluids resulted in a two-phase reservoir with lighter isotope contents. The thermal fluids laterally flow towards the west where they are affected by cooling and mixing of cold waters. Deep water recharge has {delta}{sup 18}O of -10.00 {per_thousand} and {delta}{sup 2}H = -61.20 {per_thousand} which come from the upper slopes of Sandawa Collapse (1580-1700 mASL).

  4. Four-year prospective study of the respiratory effects of volcanic ash from Mt. St. Helens

    SciTech Connect (OSTI)

    Buist, A.S.; Vollmer, W.M.; Johnson, L.R.; Bernstein, R.S.; McCamant, L.E.

    1986-04-01

    This report describes the 4-yr follow-up of 712 loggers exposed over an extended period to varying levels of fresh volcanic ash from the 1980 eruptions of Mt. St. Helens. Concerns related to the irritant effect the ash might have on the airways and also to its fibrogenic potential if exposures were intense and continued over many years. Our subjects were divided into 3 groups: high, low, and no exposure. Baseline testing was begun in June 1980, 1 month after the major eruption, and follow-up testing continued on an annual basis through 1984; 88% of the loggers have been tested at least 3 times. Analysis of lung function data showed that a significant, exposure-related decline in FEV1 occurred during the first year after the eruption. The decline was short-lived, however, and by 1984 the differences between exposure groups were no longer significant. Self-reported symptoms of cough, phlegm, and wheeze showed a similar pattern. No ash-related changes were seen in chest roentgenograms taken in 1980 and in 1984. Our findings are consistent with the hypothesis that the inhaled ash caused mucus hypersecretion and/or airway inflammation that reversed when the exposure levels decreased. The ash levels to which the loggers were exposed were low compared with permissible occupational levels for nuisance dusts, but generally higher than the total suspended particulate levels permissible in ambient air.

  5. CO2 flood tests on whole core samples of the Mt. Simon sandstone, Illinois Basin

    SciTech Connect (OSTI)

    O'Connor, William K.; Rush, Gilbert E.

    2005-09-01

    Geological sequestration of CO2, whether by enhanced oil recovery (EOR), coal-bed methane (CBM) recovery, or saline aquifer injection is a promising near-term sequestration methodology. While tremendous experience exists for EOR, and CBM recovery has been demonstrated in existing fields, saline aquifer injection studies have only recently been initiated. Studies evaluating the availability of saline aquifers suitable for CO2 injection show great potential, however, the long-term fate of the CO2 injected into these ancient aqueous systems is still uncertain. For the subject study, a series of laboratory-scale CO2 flood tests were conducted on whole core samples of the Mt. Simon sandstone from the Illinois Basin. By conducting these tests on whole core samples rather than crushed core, an evaluation of the impact of the CO2 flood on the rock mechanics properties as well as the geochemistry of the core and brine solution has been possible. This empirical data could provide a valuable resource for the validation of reservoir models under development for these engineered CO2 systems.

  6. Aural perception of NDE signals

    SciTech Connect (OSTI)

    Light, G.M.; Holt, A.E.; Polk, K.D.; Godwin, J.G.; Clayton, W.T.

    1994-12-31

    During nondestructive evaluation (NDE) of a material, the inspection signals are received typically by an NDE instrument. These signals usually are displayed electronically for visual interpretation. Work has been done to convert these signals into aural (audible) signals with the intent to enhance the accuracy of evaluation through the use of two senses (ears and eyes) instead of one. This paper describes auralization of ultrasonic NDE testing signals to improve characterization and evaluation of materials.

  7. Assignment 4 BS4a Actuarial Science Oxford MT 2011 IX A.4 Inflation, taxation and project appraisal

    E-Print Network [OSTI]

    Winkel, Matthias

    Assignment 4 ­ BS4a Actuarial Science ­ Oxford MT 2011 IX A.4 Inflation, taxation and project are indexed by reference to the value of a retail price index with a time lag of 8 months. The retail price index value in September 1996 was Q(-8/12) = 200 and in March 1997 was Q(-2/12) = 206. The issue price

  8. Wildlife Management Areas (Florida)

    Broader source: Energy.gov [DOE]

    Certain sites in Florida are designated as wildlife management areas, and construction and development is heavily restricted in these areas.

  9. Tailpulse signal generator

    DOE Patents [OSTI]

    Baker, John (Walnut Creek, CA); Archer, Daniel E. (Knoxville, TN); Luke, Stanley John (Pleasanton, CA); Decman, Daniel J. (Livermore, CA); White, Gregory K. (Livermore, CA)

    2009-06-23

    A tailpulse signal generating/simulating apparatus, system, and method designed to produce electronic pulses which simulate tailpulses produced by a gamma radiation detector, including the pileup effect caused by the characteristic exponential decay of the detector pulses, and the random Poisson distribution pulse timing for radioactive materials. A digital signal process (DSP) is programmed and configured to produce digital values corresponding to pseudo-randomly selected pulse amplitudes and pseudo-randomly selected Poisson timing intervals of the tailpulses. Pulse amplitude values are exponentially decayed while outputting the digital value to a digital to analog converter (DAC). And pulse amplitudes of new pulses are added to decaying pulses to simulate the pileup effect for enhanced realism in the simulation.

  10. Area Activation 1 Running Head: AREA ACTIVATION

    E-Print Network [OSTI]

    Pomplun, Marc

    Area Activation 1 Running Head: AREA ACTIVATION Advancing Area Activation towards a General Model at Boston 100 Morrissey Boulevard Boston, MA 02125-3393 USA Phone: 617-287-6485 Fax: 617-287-6433 e. Without great effort, human observers clearly outperform every current artificial vision system in tasks

  11. Dark Matter Particle Spectroscopy at the LHC: Generalizing M(T2) to Asymmetric Event Topologies

    SciTech Connect (OSTI)

    Konar, Partha; Kong, Kyoungchul; Matchev, Konstantin T.; Park, Myeonghun; /Florida U.

    2012-04-03

    We consider SUSY-like missing energy events at hadron colliders and critically examine the common assumption that the missing energy is the result of two identical missing particles. In order to experimentally test this hypothesis, we generalize the subsystem M{sub T2} variable to the case of asymmetric event topologies, where the two SUSY decay chains terminate in different 'children' particles. In this more general approach, the endpoint M{sub T2(max)} of the M{sub T2} distribution now gives the mass {tilde M}p({tilde M}{sub c}{sup (a)}, {tilde M}{sub c}{sup (b)}) of the parent particles as a function of two input children masses {tilde M}{sub c}{sup (a)} and {tilde M}{sub c}{sup (b)}. We propose two methods for an independent determination of the individual children masses M{sub c}{sup (a)} and M{sub c}{sup (b)}. First, in the presence of upstream transverse momentum PUTM the corresponding function {tilde M}p({tilde M}{sub c}{sup (a)}, {tilde M}{sub c}{sup (b)}, P{sub UTM}) is independent of P{sub UTM} at precisely the right values of the children masses. Second, the previously discussed MT2 'kink' is now generalized to a 'ridge' on the 2-dimensional surface {tilde M}p({tilde M}{sub c}{sup (a)}, {tilde M}{sub c}{sup (b)}). As we show in several examples, quite often there is a special point along that ridge which marks the true values of the children masses. Our results allow collider experiments to probe a multi-component dark matter sector directly and without any theoretical prejudice.

  12. Spectral Decomposition of Signaling Networks

    E-Print Network [OSTI]

    2006-01-01

    expressed. Signaling networks modeled as Petri nets are onenetwork. Although the results are limited to the Petri net

  13. MARQUETTE UNIVERSITY Speech Signal Enhancement

    E-Print Network [OSTI]

    Johnson, Michael T.

    in a multiple source environment. The goal of the system is to improve the quality of the primary speech signal techniques to improve those estimates while improving the signal to noise ratio of the primary source. #12;iv utilizing signal information rather than physically moving the array. They accomplish this through

  14. Detection of variable frequency signals using a fast chirp transform

    E-Print Network [OSTI]

    F. A. Jenet; T. A. Prince

    2000-12-07

    The detection of signals with varying frequency is important in many areas of physics and astrophysics. The current work was motivated by a desire to detect gravitational waves from the binary inspiral of neutron stars and black holes, a topic of significant interest for the new generation of interferometric gravitational wave detectors such as LIGO. However, this work has significant generality beyond gravitational wave signal detection. We define a Fast Chirp Transform (FCT) analogous to the Fast Fourier Transform (FFT). Use of the FCT provides a simple and powerful formalism for detection of signals with variable frequency just as Fourier transform techniques provide a formalism for the detection of signals of constant frequency. In particular, use of the FCT can alleviate the requirement of generating complicated families of filter functions typically required in the conventional matched filtering process. We briefly discuss the application of the FCT to several signal detection problems of current interest.

  15. A Platform for Collaborative Acoustic Signal Processing

    E-Print Network [OSTI]

    Hanbiao Wang; Lewis Girod; Nithya Ramanathan

    2005-01-01

    Graphic ori- ented signal processing language - gospl,” incollaborative acoustic signal processing, and demonstrateembedded system for signal processing and the recent work on

  16. MRI of the lung using hyperpolarized He-3 at very low magnetic field (3 mT)

    E-Print Network [OSTI]

    Bidinosti, C P; Tastevin, G; Vignaud, A; Nacher, P J

    2004-01-01

    Optical pumping of He-3 produces large (hyper) nuclear-spin polarizations independent of the magnetic resonance imaging (MRI) field strength. This allows lung MRI to be performed at reduced fields with many associated benefits, such as lower tissue susceptibility gradients and decreased power absorption rates. Here we present results of 2D imaging as well as accurate 1D gas diffusion mapping of the human lung using He-3 at very low field (3 mT). Furthermore, measurements of transverse relaxation in zero applied gradient are shown to accurately track pulmonary oxygen partial pressure, opening the way for novel imaging sequences.

  17. First event signalling correlations

    E-Print Network [OSTI]

    Debashis Saha; Marcin Paw?owski

    2015-04-20

    This work introduces the notion of First Event Signalling (FES) correlations in multipartite scenario where the first measurement on one subsystem influences the measurement outcomes of all the other local subsystems. It is shown that these correlations are related to bilocal ones but stronger than their variations proposed earlier. We propose a new Bell inequality which is satisfied by all FES models. Then we show quantum mechanical violation of this inequality, which can be regarded as an alternative definition of a stronger type of genuine multipartite nonlocality and a proof that quantum mechanics exhibits even more powerful correlations than these already known. We also introduce another Bell inequality which is satisfied by all bilocal correlations but violated by FES. The study of our new inequalities and the ones introduced previously allows us to analyze the relation between different types of tripartite nonlocality which reveals a very complex and interesting structure.

  18. Digitally programmable signal generator and method

    SciTech Connect (OSTI)

    Priatko, G.J.; Kaskey, J.A.

    1986-09-02

    A digitally programmable signal generator (DPSG) and method are disclosed. The DPSG can be used in applications such as Atomic Vapor Laser Isotope Separation (AVLIS) to create an optimal match between the process laser's spectral profile and that of the vaporized material. Other applications include optical telecommunications, non-optical telecommunication in the microwave and radio spectrum, radar, electronic countermeasures, high speed computer interconnects, local area networks, high definition video transport and the multiplexing of large quantities of slow digital memory into high speed data streams. This invention extends the operation of DPSGs into the GHz range, while preserving all of the current art's DPSGs' operational features.

  19. Signal Processing Techniques EnablingWideband A/D Converters

    E-Print Network [OSTI]

    Ghosh, Abhishek

    2013-01-01

    Signal processing . . . . . . . . . . . . . . . . . . . . .signal processing . . . . . . . . . . . . . . . . . . . . .prescribed filter . . 28 Signal processing model of total

  20. LOCA simulation in the national research universal reactor program: postirradiation examination results for the third materials experiment (MT-3)

    SciTech Connect (OSTI)

    Rausch, W.N.

    1984-04-01

    A series of in-reactor experiments were conducted using full-length 32-rod pressurized water reactor (PWR) fuel bundles as part of the Loss-of-Coolant Accident (LOCA) Simulation Program. The third materials experiment (MT-3) was the sixth in the series of thermal-hydraulic and materials deformation/rutpure experiments conducted in the National Research Universal (NRU) reactor, Chalk River, Ontario, Canada. The main objective of the experiment was to evaluate ballooning and rupture during active two-phase cooling in the temperature range from 1400 to 1500/sup 0/F (1030 to 1090 K). The 12 test rods in the center of the 32-rod bundle were initially pressurized to 550 psi (3.8 MPa) to insure rupture in the correct temperature range. All 12 of the rods ruptured, with an average peak bundle strain of approx. 55%. The UKAEA also funded destructive postirradiation examination (PIE) of several of the ruptured rods from the MT-3 experiment. This report describes the work performed and presents the PIE results. Information obtained during the PIE included cladding thickness measurements metallography, and particle size analysis of the cracked and broken fuel pellets.

  1. The Journal of Neuroscience, May 1994, 14(5): 2870-2892 Power Spectrum Analysis of Bursting Cells in Area MT in the

    E-Print Network [OSTI]

    Koch, Christof

    The Journal of Neuroscience, May 1994, 14(5): 2870-2892 Power Spectrum Analysis of Bursting CellsSI distribution and the power spectrum of the vast majority of bursting cells are compatible with the notion, 1992) as well as via bursting cells (Cattaneo et al., 1981 a; Bonds, 1992). We investigate the temporal

  2. The Journal of Neuroscience, May 1994, 74(5): 2870-2892 Power Spectrum Analysis of Bursting Cells in Area MT in the

    E-Print Network [OSTI]

    Newsome, William

    The Journal of Neuroscience, May 1994, 74(5): 2870-2892 Power Spectrum Analysis of Bursting Cells distribution and the power spectrum of the vast majority of bursting cells are compatible with the notion, 1992) as well as via bursting cells (Cattaneo et al., 1981 a; Bonds, 1992). We investigate the temporal

  3. Signal optimization at isolated intersections using pre-signals 

    E-Print Network [OSTI]

    Palekar, Trishul Ajit

    2006-10-30

    This research proposes a new signal operation strategy aimed at efficient utilization of green time by cutting down on the start up and response loss times. The idea is to have a "pre-signal" on each main approach a few ...

  4. STATISTICAL SIGNAL PROCESSING FOR AUTOMOTIVE SAFETY SYSTEMS Fredrik Gustafsson

    E-Print Network [OSTI]

    Gustafsson, Fredrik

    STATISTICAL SIGNAL PROCESSING FOR AUTOMOTIVE SAFETY SYSTEMS Fredrik Gustafsson Department The amount of software in general and safety systems in particular increases rapidly in the automotive- cessing area. 1. INTRODUCTION Henry Ford revolutionized the automotive industry more than 100 years ago

  5. Adaptive Signal Processing Course Information

    E-Print Network [OSTI]

    Tsakalides, Panagiotis

    of the theory to a variety of practical problems such as interference and echo cancellation, signal and system least squares adaptive algorithms 2 Properties of RLS 2 Applications: ADPCM speech encoding Non-Linear. Understanding of the theoretical foundations of adaptive signal processing theory will be achieved through

  6. Unit 51 - GIS Application Areas

    E-Print Network [OSTI]

    Unit 51, CC in GIS; Cowen, David; Ferguson, Warren

    1990-01-01

    51 - GIS APPLICATION AREAS UNIT 51 - GIS APPLICATION AREAS1990 Page 1 Unit 51 - GIS Application Areas Computers inyour students. UNIT 51 - GIS APPLICATION AREAS Compiled with

  7. Mercury Vapor At Silver Peak Area (Henkle, Et Al., 2005) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource HistoryScenariosMarysville MtMedical Area Total Egy PltMercurius

  8. Micro-Earthquake At Brady Hot Springs Geothermal Area (2011) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource HistoryScenariosMarysville MtMedical AreaInformationMickey Hot(Majer,

  9. Micro-Earthquake At Coso Geothermal Area (1974) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource HistoryScenariosMarysville MtMedical AreaInformationMickey Hot(Majer,74) Jump

  10. Micro-Earthquake At Coso Geothermal Area (1987) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource HistoryScenariosMarysville MtMedical AreaInformationMickey Hot(Majer,74)

  11. Micro-Earthquake At Coso Geothermal Area (1992-1997) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource HistoryScenariosMarysville MtMedical AreaInformationMickey

  12. Micro-Earthquake At Coso Geothermal Area (1993-1994) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource HistoryScenariosMarysville MtMedical AreaInformationMickeyInformation

  13. Micro-Earthquake At Coso Geothermal Area (1996) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource HistoryScenariosMarysville MtMedical AreaInformationMickeyInformation1996)

  14. Epitope-Guided Engineering of Monobody Binders for in Vivo Inhibition of Erk2 Signaling

    E-Print Network [OSTI]

    Ferkey, Denise

    Epitope-Guided Engineering of Monobody Binders for in Vivo Inhibition of Erk2 Signaling Jasdeep K a defined surface patch on the mitogen activated protein kinase (MAPK) Erk-2. The targeted area ("CD" domain be useful for regulating Erk- 2 signaling in vivo. Although the CD domain constitutes only a small

  15. Terminality implies non-signalling

    E-Print Network [OSTI]

    Bob Coecke

    2014-12-30

    A 'process theory' is any theory of systems and processes which admits sequential and parallel composition. `Terminality' unifies normalisation of pure states, trace-preservation of CP-maps, and adding up to identity of positive operators in quantum theory, and generalises this to arbitrary process theories. We show that terminality and non-signalling coincide in any process theory, provided one makes causal structure explicit. In fact, making causal structure explicit is necessary to even make sense of non-signalling in process theories. We conclude that because of its much simpler mathematical form, terminality should be taken to be a more fundamental notion than non-signalling.

  16. DC Resistivity Survey (Wenner Array) At Mt Princeton Hot Springs Geothermal

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, Alabama (UtilityInstruments Inc Jump to: navigation,(RECP) in Jump to: navigation,Area

  17. Soil Science Society of America Journal This work was presented at the 12th North American Forest Soils Conference, Whitefish, MT, 1620

    E-Print Network [OSTI]

    Martin, Timothy

    Soils Conference, Whitefish, MT, 16­20 June 2013, in the Production Systems for Biomass and Bioenergy silvicultural practices used, and when combined with suitable site preparation techniques and the deployment fourfold higher aboveground pine biomass than the C treatment (7.7 Mg ha-1); the untreated CF (17.9 Mg ha-1

  18. NEAFS Y-mtDNA Workshop (Butler and Coble) November 1, 2006 http://www.cstl.nist.gov/biotech/strbase/training.htm 1

    E-Print Network [OSTI]

    NEAFS Y-mtDNA Workshop (Butler and Coble) November 1, 2006 http://www.cstl.nist.gov/biotech textbook (now in its 2nd Edition) · STRBase website: http://www.cstl.nist.gov/biotech/strbase/ · Family: wife Terilynne and 6 children · Hobbies: reading and writing http://www.cstl.nist.gov/biotech

  19. Comment on ``A modified leapfrog scheme for shallow water equations'' by Wen-Yih Sun and Oliver M.T. Sun

    E-Print Network [OSTI]

    Williams, Paul

    Commentary Comment on ``A modified leapfrog scheme for shallow water equations'' by Wen-Yih Sun and Oliver M.T. Sun Paul D. Williams Department of Meteorology, University of Reading, UK a r t i c l e i n f integration of the shallow-water equa- tions using the leapfrog time-stepping scheme [Sun Wen-Yih, Sun Oliver

  20. ECE 468 Digital Signal Processing 1. History

    E-Print Network [OSTI]

    Chen, Ying "Ada"

    , digital image processing, signal processing for communications, biomedical signal processing, seismic dataECE 468 Digital Signal Processing 1. History: · Digital signal processing has its roots in 17th and Gauss and as new as digital computers and integrated circuits 2. Definition: · Digital signal processing

  1. Signal focusing through active transport

    E-Print Network [OSTI]

    Aljaz Godec; Ralf Metzler

    2015-01-13

    In biological cells and novel diagnostic devices biochemical receptors need to be sensitive to extremely small concentration changes of signaling molecules. The accuracy of such molecular signaling is ultimately limited by the counting noise imposed by the thermal diffusion of molecules. Many macromolecules and organelles transiently bind to molecular motors and are then actively transported. We here show that a random albeit directed delivery of signaling molecules to within a typical diffusion distance to the receptor reduces the correlation time of the counting noise, effecting an improved sensing precision. The conditions for this active focusing are indeed compatible with observations in living cells. Our results are relevant for a better understanding of molecular cellular signaling and the design of novel diagnostic devices.

  2. Electromagnetic Signals from Bacterial DNA

    E-Print Network [OSTI]

    A. Widom; J. Swain; Y. N. Srivastava; S. Sivasubramanian

    2012-02-09

    Chemical reactions can be induced at a distance due to the propagation of electromagnetic signals during intermediate chemical stages. Although is is well known at optical frequencies, e.g. photosynthetic reactions, electromagnetic signals hold true for muck lower frequencies. In E. coli bacteria such electromagnetic signals can be generated by electric transitions between energy levels describing electrons moving around DNA loops. The electromagnetic signals between different bacteria within a community is a "wireless" version of intercellular communication found in bacterial communities connected by "nanowires". The wireless broadcasts can in principle be of both the AM and FM variety due to the magnetic flux periodicity in electron energy spectra in bacterial DNA orbital motions.

  3. Robust Congestion Signaling , Neil Spring

    E-Print Network [OSTI]

    Spring, Neil

    ], with active queue management in the form of RED gateways [10], has been proposed as a standard mechanism IPSEC tun- nels because congestion signals may be inadvertently lost at the tunnel endpoint when one

  4. Radiolocation using AM broadcast signals

    E-Print Network [OSTI]

    Hall, Timothy Douglas, 1970-

    2002-01-01

    (cont.) Previous attempts at signal-of-opportunity navigation using carrier phase sidestepped the ambiguity problem by requiring that the initial position of the rover be known and that phase variations be tracked without ...

  5. Automated classification of power signals

    E-Print Network [OSTI]

    Proper, Ethan R. (Ethan Richard)

    2008-01-01

    The Non-Intrusive Load Monitor (NILM) is a device that utilizes voltage and current measurements to monitor an entire system from a single reference point. The NILM and associated software convert the V/I signal to spectral ...

  6. Site Monitoring Area Maps

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    and roads The spatial location and boundaries for each Site shown on the Site Monitoring Area maps originate from activities conducted under the Compliance Order on Consent with...

  7. Study on the reduction of atmospheric mercury emissions from mine waste enriched soils through native grass cover in the Mt. Amiata region of Italy

    SciTech Connect (OSTI)

    Fantozzi, L., E-mail: l.fantozzi@iia.cnr.it [CNR-Institute of Atmospheric Pollution Research, c/o: UNICAL-Polifunzionale, 87036 Rende (Italy); Ferrara, R., E-mail: romano.ferrara@pi.ibf.cnr.it [CNR-Institute of Biophysics, San Cataldo Research Area, Via G. Moruzzi 1, 56124 Pisa (Italy); Dini, F., E-mail: fdiniprotisti@gmail.com [University of Pisa, Department of Biology, Via A. Volta 4, 56126 Pisa (Italy); Tamburello, L., E-mail: ltamburello@biologia.unipi.it [University of Pisa, Department of Biology, Via Derna 1, I-56126 Pisa (Italy); Pirrone, N.; Sprovieri, F. [CNR-Institute of Atmospheric Pollution Research, c/o: UNICAL-Polifunzionale, 87036 Rende (Italy)] [CNR-Institute of Atmospheric Pollution Research, c/o: UNICAL-Polifunzionale, 87036 Rende (Italy)

    2013-08-15

    Atmospheric mercury emissions from mine-waste enriched soils were measured in order to compare the mercury fluxes of bare soils with those from other soils covered by native grasses. Our research was conducted near Mt. Amiata in central Italy, an area that was one of the largest and most productive mining centers in Europe up into the 1980s. To determine in situ mercury emissions, we used a Plexiglas flux chamber connected to a portable mercury analyzer (Lumex RA-915+). This allowed us to detect, in real time, the mercury vapor in the air, and to correlate this with the meteorological parameters that we examined (solar radiation, soil temperature, and humidity). The highest mercury flux values (8000 ng m{sup ?2} h{sup ?1}) were observed on bare soils during the hours of maximum insulation, while lower values (250 ng m{sup ?2} h{sup ?1}) were observed on soils covered by native grasses. Our results indicate that two main environmental variables affect mercury emission: solar radiation intensity and soil temperature. The presence of native vegetation, which can shield soil surfaces from incident light, reduced mercury emissions, a result that we attribute to a drop in the efficiency of mercury photoreduction processes rather than to decreases in soil temperature. This finding is consistent with decreases in mercury flux values down to 3500 ng m{sup ?2} h{sup ?1}, which occurred under cloudy conditions despite high soil temperatures. Moreover, when the soil temperature was 28 °C and the vegetation was removed from the experimental site, mercury emissions increased almost four-fold. This increase occurred almost immediately after the grasses were cut, and was approximately eight-fold after 20 h. Thus, this study demonstrates that enhancing wild vegetation cover could be an inexpensive and effective approach in fostering a natural, self-renewing reduction of mercury emissions from mercury-contaminated soils. -- Highlights: ? Mercury air/surface exchange from grass covered soil is different from bare soil. ? Light enhances mercury emissions and is the main parameter driving the process. ? The presence of wild vegetation covering the soil reduces mercury emission. ? Vegetative covers could be a solution to reduce atmospheric mercury pollution.

  8. Geothermal br Resource br Area Geothermal br Resource br Area...

    Open Energy Info (EERE)

    Area Central Nevada Seismic Zone Pull Apart in Strike Slip Fault Zone Ordovician shale quartzite MW K Blue Mountain Geothermal Area Blue Mountain Geothermal Area Northwest...

  9. Magnetotellurics At Kilauea Southwest Rift And South Flank Area...

    Open Energy Info (EERE)

    Unknown Notes Magnetotelluric Imaging, G. Michael Hoversten. The project title derived from its inception. The project however moved from the application of MT on Kilauea...

  10. Analysing weak orbital signals in Gaia data

    E-Print Network [OSTI]

    Lucy, L B

    2014-01-01

    Anomalous orbits are found when minimum-chi^{2} estimation is applied to synthetic Gaia data for weak orbital signals - i.e., orbits whose astrometric signatures are comparable to the single-scan measurement error (Pourbaix 2002). These orbits are nearly parabolic, edge-on, and their major axes align with the line-of-sight to the observer. Such orbits violate the Copernican principle (CPr) and as such could be rejected. However, the preferred alternative is to develop a statistical technique that incorporates the CPr as a fundamental postulate. This can be achieved in the context of Bayesian estimation by defining a Copernican prior. With this development, Pourbaix's anomalous orbits no longer arise. Instead, orbits with a somewhat higher chi^{2} but which do not violate the CPr are selected. Other areas of astronomy where the investigator must analyse data from 'imperfect experiments' might similarly benefit from appropriately- defined Copernican priors.

  11. Semiconductor detectors with proximity signal readout

    SciTech Connect (OSTI)

    Asztalos, Stephen J. [XIA, LLC, Hayward, CA (United States)

    2014-01-30

    Semiconductor-based radiation detectors are routinely used for the detection, imaging, and spectroscopy of x-rays, gamma rays, and charged particles for applications in the areas of nuclear and medical physics, astrophysics, environmental remediation, nuclear nonproliferation, and homeland security. Detectors used for imaging and particle tracking are more complex in that they typically must also measure the location of the radiation interaction in addition to the deposited energy. In such detectors, the position measurement is often achieved by dividing or segmenting the electrodes into many strips or pixels and then reading out the signals from all of the electrode segments. Fine electrode segmentation is problematic for many of the standard semiconductor detector technologies. Clearly there is a need for a semiconductor-based radiation detector technology that can achieve fine position resolution while maintaining the excellent energy resolution intrinsic to semiconductor detectors, can be fabricated through simple processes, does not require complex electrical interconnections to the detector, and can reduce the number of required channels of readout electronics. Proximity electrode signal readout (PESR), in which the electrodes are not in physical contact with the detector surface, satisfies this need.

  12. Neutron Science Research Areas | ORNL

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Home | Science & Discovery | Neutron Science | Research Areas SHARE Research Areas Neutron scattering research at ORNL covers four broad research areas: biology and soft...

  13. Geographic Area Month

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    Fuels by PAD District and State (Cents per Gallon Excluding Taxes) - Continued Geographic Area Month No. 1 Distillate No. 2 Distillate a No. 4 Fuel b Sales to End Users Sales for...

  14. Decontamination & decommissioning focus area

    SciTech Connect (OSTI)

    1996-08-01

    In January 1994, the US Department of Energy Office of Environmental Management (DOE EM) formally introduced its new approach to managing DOE`s environmental research and technology development activities. The goal of the new approach is to conduct research and development in critical areas of interest to DOE, utilizing the best talent in the Department and in the national science community. To facilitate this solutions-oriented approach, the Office of Science and Technology (EM-50, formerly the Office of Technology Development) formed five Focus AReas to stimulate the required basic research, development, and demonstration efforts to seek new, innovative cleanup methods. In February 1995, EM-50 selected the DOE Morgantown Energy Technology Center (METC) to lead implementation of one of these Focus Areas: the Decontamination and Decommissioning (D & D) Focus Area.

  15. 300 Area Disturbance Report

    SciTech Connect (OSTI)

    LL Hale; MK Wright; NA Cadoret

    1999-01-07

    The objective of this study was to define areas of previous disturbance in the 300 Area of the U.S. Department of Energy (DOE) Hanford Site to eliminate these areas from the cultural resource review process, reduce cultural resource monitoring costs, and allow cultural resource specialists to focus on areas where subsurface disturbance is minimal or nonexistent. Research into available sources suggests that impacts from excavations have been significant wherever the following construction activities have occurred: building basements and pits, waste ponds, burial grounds, trenches, installation of subsurface pipelines, power poles, water hydrants, and well construction. Beyond the areas just mentioned, substrates in the' 300 Area consist of a complex, multidimen- sional mosaic composed of undisturbed stratigraphy, backfill, and disturbed sediments; Four Geographic Information System (GIS) maps were created to display known areas of disturbance in the 300 Area. These maps contain information gleaned from a variety of sources, but the primary sources include the Hanford GIS database system, engineer drawings, and historic maps. In addition to these maps, several assumptions can be made about areas of disturbance in the 300 Area as a result of this study: o o Buried pipelines are not always located where they are mapped. As a result, cultural resource monitors or specialists should not depend on maps depicting subsurface pipelines for accurate locations of previous disturbance. Temporary roads built in the early 1940s were placed on layers of sand and gravel 8 to 12 in. thick. Given this information, it is likely that substrates beneath these early roads are only minimally disturbed. Building foundations ranged from concrete slabs no more than 6 to 8 in. thick to deeply excavated pits and basements. Buildings constructed with slab foundations are more numerous than may be expected, and minimally disturbed substrates may be expected in these locations. Historic black and white photographs provide a partial record of some excavations, including trenches, building basements, and material lay-down yards. Estimates of excavation depth and width can be made, but these estimates are not accurate enough to pinpoint the exact location where the disturbedhmdisturbed interface is located (e.g., camera angles were such that depths and/or widths of excavations could not be accurately determined or estimated). In spite of these limitations, these photographs provide essential information. Aerial and historic low-level photographs have captured what appears to be backfill throughout much of the eastern portion of the 300 Area-near the Columbia River shoreline. This layer of fill has likely afforded some protection for the natural landscape buried beneath the fill. This assumption fits nicely with the intermittent and inadvertent discoveries of hearths and stone tools documented through the years in this part of the 300 Area. Conversely, leveling of sand dunes appears to be substantial in the northwestern portion of the 300 Area during the early stages of development. o Project files and engineer drawings do not contain information on any impromptu but necessary adjustments made on the ground during project implementation-after the design phase. Further, many projects are planned and mapped but never implemented-this information is also not often placed in project files. Specific recommendations for a 300 Area cultural resource monitoring strategy are contained in the final section of this document. In general, it is recommended that monitoring continue for all projects located within 400 m of the Columbia River. The 400-m zone is culturally sensitive and likely retains some of the most intact buried substrates in the 300 Area.

  16. Statistical Signal Processing Debasis Kundu 1

    E-Print Network [OSTI]

    Kundu, Debasis

    Statistical Signal Processing Debasis Kundu 1 Signal processing may broadly be considered, statistical techniques play an important role in signal processing. Statistics is used in the formulation for estimation of model parameters, and the assessment of model performances. Statistical Signal Processing

  17. Computational Aspects in Statistical Signal Processing

    E-Print Network [OSTI]

    Kundu, Debasis

    14 Computational Aspects in Statistical Signal Processing D. Kundu 14.1 Introduction Signal such as communi- cations, radio location of objects, seismic signal processing and computer assisted medical diagnosis. Statistical signal processing is also used in many physical science applications

  18. Dynamic models for nonstationary signal segmentation

    E-Print Network [OSTI]

    Penny, Will

    Dynamic models for nonstationary signal segmentation William D. Penny and Stephen J. Roberts w.penny

  19. Improvements in the M-T relation and mass function and the measured Omega_m through clusters evolution

    E-Print Network [OSTI]

    A. Del Popolo

    2003-09-05

    In this paper, I revisit the constraints obtained by several authors (Reichart et al. 1999; Eke et al. 1998; Henry 2000) on the estimated values of Omega_m, n and sigma_8 in the light of recent theoretical developments: 1) new theoretical mass functions (Sheth & Tormen 1999, Sheth, Mo & Tormen 1999, Del Popolo 2002b); 2) a more accurate mass-temperature relation, also determined for arbitrary Omega_m and Omega_{\\Lambda} (Voit 2000, Pierpaoli et al. 2001, Del Popolo 2002a). Firstly, using the quoted improvements, I re-derive an expression for the X-ray Luminosity Function (XLF), similarly to Reichart et al. (1999), and then I get some constraints to \\Omega_m and n, by using the ROSAT BCS and EMSS samples and maximum-likelihood analysis. Then I re-derive the X-ray Temperature Function (XTF), similarly to Henry (2000) and Eke et al. (1999), re-obtaining the constraints on Omega_m, n, sigma_8. Both in the case of the XLF and XTF, the changes in the mass function and M-T relation produces an increase in Omega_m of \\simeq 20% and similar results in sigma_8 and n.

  20. Phosphoinositide 3-kinase: a critical signalling event in pulmonary cells

    E-Print Network [OSTI]

    2000-06-08

    ISSN 1465-9921; Online ISSN 1465-993X) ARDS = acute respiratory distress syndrome; ASM = airways smooth muscle; ERK = extracellular signal-regulated protein kinase; PDGF = platelet- derived growth factor; PDK1 = phosphoinositide-dependent kinase-1; PI-3... with structural changes within the airway wall. The most prominent feature of the remodelled airway is an increase in airways smooth muscle (ASM). Heard and Hossain [2] demonstrated a threefold increase in both the cross-sectional area and number of smooth...

  1. Optically isolated signal coupler with linear response

    DOE Patents [OSTI]

    Kronberg, James W. (Aiken, SC)

    1994-01-01

    An optocoupler for isolating electrical signals that translates an electrical input signal linearly to an electrical output signal. The optocoupler comprises a light emitter, a light receiver, and a light transmitting medium. The light emitter, preferably a blue, silicon carbide LED, is of the type that provides linear, electro-optical conversion of electrical signals within a narrow wavelength range. Correspondingly, the light receiver, which converts light signals to electrical signals and is preferably a cadmium sulfide photoconductor, is linearly responsive to light signals within substantially the same wavelength range as the blue LED.

  2. A Complete Solution Classification and Unified Algorithmic Treatment for the One- and Two-Step Asymmetric S-Transverse Mass (MT2) Event Scale Statistic

    E-Print Network [OSTI]

    Joel W. Walker

    2014-08-29

    The MT2 or "s-transverse mass" statistic was developed to associate a parent mass scale to a missing transverse energy signature, given that escaping particles are generally expected in pairs, while collider experiments are sensitive to just a single transverse momentum vector sum. This document focuses on the generalized extension of that statistic to asymmetric one- and two-step decay chains, with arbitrary child particle masses and upstream missing transverse momentum. It provides a unified theoretical formulation, complete solution classification, taxonomy of critical points, and technical algorithmic prescription for treatment of the MT2 event scale. An implementation of the described algorithm is available for download, and is also a deployable component of the author's selection cut software package AEACuS (Algorithmic Event Arbiter and Cut Selector). Appendices address combinatoric event assembly, algorithm validation, and a complete pseudocode.

  3. Journal club Multivariate Signal integration

    E-Print Network [OSTI]

    Journal club Multivariate Signal integration A fundamental aspect of biological systems is that they are multivariate: cells receive, integrate and respond to hundreds or thousands of concurrent environmental cues in the context of the cell's multivariate network state. Because this depends on cues in the environment

  4. Signals & Systems Prof. Mark Fowler

    E-Print Network [OSTI]

    Fowler, Mark

    = 2f0 ) AM Radio: around 1 MHz FM Radio: around 100 MHz Cell Phones: around 900 MHz, around 1.8 GHz Transmitter (Tx) Modulator )(X FT of Message Signal Choose f0 > 10 kHz to enable efficient radiation (with 0

  5. Probing the Mechanism of the Mycobacterium tuberculosis [beta]-Ketoacyl-Acyl Carrier Protein Synthase III mtFabH: Factors Influencing Catalysis and Substrate Specificity

    SciTech Connect (OSTI)

    Brown, Alistair K.; Sridharan, Sudharsan; Kremer, Laurent; Lindenberg, Sandra; Dover, Lynn G.; Sacchettini, James C.; Besra, Gurdyal S.

    2010-11-30

    Mycolic acids are the dominant feature of the Mycobacterium tuberculosis cell wall. These {alpha}-alkyl, {beta}-hydroxy fatty acids are formed by the condensation of two fatty acids, a long meromycolic acid and a shorter C{sub 24}-C{sub 26} fatty acid. The component fatty acids are produced via a combination of type I and II fatty acid synthases (FAS) with FAS-I products being elongated by FAS-II toward meromycolic acids. The {beta}-ketoacyl-acyl carrier protein (ACP) synthase III encoded by mtfabH (mtFabH) links FAS-I and FAS-II, catalyzing the condensation of FAS-I-derived acyl-CoAs with malonyl-acyl carrier protein (ACP). The acyl-CoA chain length specificity of mtFabH was assessed in vitro; the enzyme extended longer, physiologically relevant acyl-CoA primers when paired with AcpM, its natural partner, than with Escherichia coli ACP. The ability of the enzyme to use E. coli ACP suggests that a similar mode of binding is likely with both ACPs, yet it is clear that unique factors inherent to AcpM modulate the substrate specificity of mtFabH. Mutation of proposed key mtFabH residues was used to define their catalytic roles. Substitution of supposed acyl-CoA binding residues reduced transacylation, with double substitutions totally abrogating activity. Mutation of Arg{sup 46} revealed its more critical role in malonyl-AcpM decarboxylation than in the acyl-CoA binding role. Interestingly, this effect was suppressed intragenically by Arg{sup 161} {yields} Ala substitution. Our structural studies suggested that His{sup 258}, previously implicated in malonyl-ACP decarboxylation, also acts as an anchor point for a network of water molecules that we propose promotes deprotonation and transacylation of Cys{sup 122}.

  6. Approved Module Information for EE3SPR, 2014/5 Module Title/Name: Signal Processing Module Code: EE3SPR

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for EE3SPR, 2014/5 Module Title/Name: Signal Processing Module Code: EE the analytical basis of discrete time and digital signal processing. To introduce the design and implementation of real- time digital signal processing systems. To extend the concepts to other areas such as image

  7. Structural and tectonic implications of pre-Mt. Simon strata -- or a lack of such -- in the western part of the Illinois basin

    SciTech Connect (OSTI)

    Sargent, M.L. (Illinois State Geological Survey, Champaign, IL (United States))

    1993-03-01

    The discovery of a pre-Mt. Simon lithic arenite (arkose) in southwestern Ohio has lead to reevaluation of many basement tests in the region. Several boreholes in adjacent states have been reexamined by others and are now believed to bottom in the Middle Run Formation. Seismic-reflection sections in western Ohio and Indiana have indicated pre-Mt. Simon basins filled with layered rocks that are interpreted to be Middle Run, however, the pre-Mt. Simon basins and east of Illinois. Samples from Illinois basement tests were reexamined to determine whether they had encountered similar strata. All reported crystalline-basement tests in Illinois show diagnostic igneous textures and mineralogical associations. Coarsely crystalline samples in cores show intergrown subhedral grains of quartz, microcline, and sodic plagioclase. Medium-crystalline rocks in cuttings samples show numerous examples of micrographic intergrowths of quartz and K-feldspar. This texture cannot be authigenically grown in a sediment and probably could not have survived a single cycle of erosion and deposition. Aphanitic rocks show porphyritic and spherulitic textures that are distinctly igneous and would be destroyed by weathering. Substantial relief on the Precambrian crystalline surface in Illinois is postulated for major structural features like the LaSalle Anticlinorium, the Sparta Shelf, the Ste. Genevieve Fault zone, etc. Paleotopographic relief up to 300 m (1,000 feet) is documented from drilling on the western flank of the basin.

  8. OLED area illumination source

    DOE Patents [OSTI]

    Foust, Donald Franklin (Scotia, NY); Duggal, Anil Raj (Niskayuna, NY); Shiang, Joseph John (Niskayuna, NY); Nealon, William Francis (Gloversville, NY); Bortscheller, Jacob Charles (Clifton Park, NY)

    2008-03-25

    The present invention relates to an area illumination light source comprising a plurality of individual OLED panels. The individual OLED panels are configured in a physically modular fashion. Each OLED panel comprising a plurality of OLED devices. Each OLED panel comprises a first electrode and a second electrode such that the power being supplied to each individual OLED panel may be varied independently. A power supply unit capable of delivering varying levels of voltage simultaneously to the first and second electrodes of each of the individual OLED panels is also provided. The area illumination light source also comprises a mount within which the OLED panels are arrayed.

  9. Electromagnetics-Related Aspects of Signaling and Signal Processing for UWB Short Range Radios*

    E-Print Network [OSTI]

    Southern California, University of

    Electromagnetics-Related Aspects of Signaling and Signal Processing for UWB Short Range Radios* A in electromagnetic-related aspects of UWB signaling schemas and signal processing. First, pulse shaping is developed in both the transmitter and receiver, and signal processing at the receiver end. To create efficient

  10. 3572 IEEE TRANSACTIONS ON SIGNAL PROCESSING, VOL. 56, NO. 8, AUGUST 2008 Algebraic Signal Processing Theory

    E-Print Network [OSTI]

    Moura, José

    3572 IEEE TRANSACTIONS ON SIGNAL PROCESSING, VOL. 56, NO. 8, AUGUST 2008 Algebraic Signal, IEEE Abstract--This paper introduces a general and axiomatic ap- proach to linear signal processing (SP) that we refer to as the al- gebraic signal processing theory (ASP). Basic to ASP is the linear signal

  11. Plutonium focus area

    SciTech Connect (OSTI)

    NONE

    1996-08-01

    To ensure research and development programs focus on the most pressing environmental restoration and waste management problems at the U.S. Department of Energy (DOE), the Assistant Secretary for the Office of Environmental Management (EM) established a working group in August 1993 to implement a new approach to research and technology development. As part of this new approach, EM developed a management structure and principles that led to the creation of specific Focus Areas. These organizations were designed to focus the scientific and technical talent throughout DOE and the national scientific community on the major environmental restoration and waste management problems facing DOE. The Focus Area approach provides the framework for intersite cooperation and leveraging of resources on common problems. After the original establishment of five major Focus Areas within the Office of Technology Development (EM-50, now called the Office of Science and Technology), the Nuclear Materials Stabilization Task Group (EM-66) followed the structure already in place in EM-50 and chartered the Plutonium Focus Area (PFA). The following information outlines the scope and mission of the EM, EM-60, and EM-66 organizations as related to the PFA organizational structure.

  12. Subsurface contaminants focus area

    SciTech Connect (OSTI)

    1996-08-01

    The US Department of Enregy (DOE) Subsurface Contaminants Focus Area is developing technologies to address environmental problems associated with hazardous and radioactive contaminants in soil and groundwater that exist throughout the DOE complex, including radionuclides, heavy metals; and dense non-aqueous phase liquids (DNAPLs). More than 5,700 known DOE groundwater plumes have contaminated over 600 billion gallons of water and 200 million cubic meters of soil. Migration of these plumes threatens local and regional water sources, and in some cases has already adversely impacted off-site rsources. In addition, the Subsurface Contaminants Focus Area is responsible for supplying technologies for the remediation of numerous landfills at DOE facilities. These landfills are estimated to contain over 3 million cubic meters of radioactive and hazardous buried Technology developed within this specialty area will provide efective methods to contain contaminant plumes and new or alternative technologies for development of in situ technologies to minimize waste disposal costs and potential worker exposure by treating plumes in place. While addressing contaminant plumes emanating from DOE landfills, the Subsurface Contaminants Focus Area is also working to develop new or alternative technologies for the in situ stabilization, and nonintrusive characterization of these disposal sites.

  13. Nuclear sensor signal processing circuit

    DOE Patents [OSTI]

    Kallenbach, Gene A. (Bosque Farms, NM); Noda, Frank T. (Albuquerque, NM); Mitchell, Dean J. (Tijeras, NM); Etzkin, Joshua L. (Albuquerque, NM)

    2007-02-20

    An apparatus and method are disclosed for a compact and temperature-insensitive nuclear sensor that can be calibrated with a non-hazardous radioactive sample. The nuclear sensor includes a gamma ray sensor that generates tail pulses from radioactive samples. An analog conditioning circuit conditions the tail-pulse signals from the gamma ray sensor, and a tail-pulse simulator circuit generates a plurality of simulated tail-pulse signals. A computer system processes the tail pulses from the gamma ray sensor and the simulated tail pulses from the tail-pulse simulator circuit. The nuclear sensor is calibrated under the control of the computer. The offset is adjusted using the simulated tail pulses. Since the offset is set to zero or near zero, the sensor gain can be adjusted with a non-hazardous radioactive source such as, for example, naturally occurring radiation and potassium chloride.

  14. Systems theory of Smad signaling

    E-Print Network [OSTI]

    D. C. Clarke; M. D. Betterton; X. Liu

    2006-03-22

    Transforming Growth Factor-beta (TGF-beta) signalling is an important regulator of cellular growth and differentiation. The principal intracellular mediators of TGF-beta signalling are the Smad proteins, which upon TGF-beta stimulation accumulate in the nucleus and regulate transcription of target genes. To investigate the mechanisms of Smad nuclear accumulation, we developed a simple mathematical model of canonical Smad signalling. The model was built using both published data and our experimentally determined cellular Smad concentrations (isoforms 2, 3, and 4). We found in mink lung epithelial cells that Smad2 (8.5-12 x 10^4 molecules/cell) was present in similar amounts to Smad4 (9.3-12 x 10^4 molecules/cell), while both were in excess of Smad3 (1.1-2.0 x 10^4 molecules/cell). Variation of the model parameters and statistical analysis showed that Smad nuclear accumulation is most sensitive to parameters affecting the rates of RSmad phosphorylation and dephosphorylation and Smad complex formation/dissociation in the nucleus. Deleting Smad4 from the model revealed that rate-limiting phospho-R-Smad dephosphorylation could be an important mechanism for Smad nuclear accumulation. Furthermore, we observed that binding factors constitutively localised to the nucleus do not efficiently mediate Smad nuclear accumulation if dephosphorylation is rapid. We therefore conclude that an imbalance in the rates of R-Smad phosphorylation and dephosphorylation is likely an important mechanism of Smad nuclear accumulation during TGF-beta signalling.

  15. A signal oriented stream processing system for pipeline monitoring

    E-Print Network [OSTI]

    Tokmouline, Timur

    2006-01-01

    In this thesis, we develop SignalDB, a framework for composing signal processing applications from primitive stream and signal processing operators. SignalDB allows the user to focus on the signal processing task and avoid ...

  16. Test Planning for Mixed-Signal SOCs with Wrapped Analog Cores Anuja Sehgal, Fang Liu, Sule Ozev and Krishnendu Chakrabarty

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Test Planning for Mixed-Signal SOCs with Wrapped Analog Cores Anuja Sehgal, Fang Liu, Sule Ozev. Even though the test cost for such mixed-signal SOCs is significantly higher than that for digital SOCs, most prior research in this area has focused exclusively on digital cores. We propose a low-cost test

  17. Correction of complex nonlinear signal response from a pixel array detector

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    van Driel, Tim Brandt; Herrmann, Sven; Carini, Gabriella; Nielsen, Martin Meedom; Lemke, Henrik Till

    2015-04-22

    The pulsed free-electron laser light sources represent a new challenge to photon area detectors due to the intrinsic spontaneous X-ray photon generation process that makes single-pulse detection necessary. Intensity fluctuations up to 100% between individual pulses lead to high linearity requirements in order to distinguish small signal changes. In real detectors, signal distortions as a function of the intensity distribution on the entire detector can occur. Here a robust method to correct this nonlinear response in an area detector is presented for the case of exposures to similar signals. The method is tested for the case of diffuse scattering frommore »liquids where relevant sub-1% signal changes appear on the same order as artifacts induced by the detector electronics.« less

  18. Program Areas | National Security | ORNL

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Organizations National Security Home | Science & Discovery | National Security | Program Areas SHARE Program Areas image Oak Ridge National Laboratory (ORNL) has a robust...

  19. Signaling pathways that regulate cellular senescence

    E-Print Network [OSTI]

    Freund, Adam Mark

    2010-01-01

    M) p53 inactivation increases DDR signaling but not p38MAPKexpression does not induce a DDR. Cells were infected asthat DNA damage response (DDR) signaling is essential but

  20. Long Signaling Cascades Tend to Attenuate Retroactivity

    E-Print Network [OSTI]

    Ossareh, Hamid R.

    Signaling pathways consisting of phosphorylation/dephosphorylation cycles with no explicit feedback allow signals to propagate not only from upstream to downstream but also from downstream to upstream due to retroactivity ...

  1. Legibility of freeway Lane Control Signals 

    E-Print Network [OSTI]

    Tallamraju, Satya S

    1994-01-01

    This thesis documents the results of a laboratory study designed to evaluate and compare the glance legibility distance of commercially available freeway Lane Control Signals (LCS). Two prototype fiber-optic lane control signals were evaluated...

  2. MICROFLUIDIC CONTROL OF STEM CELL DIFFUSIBLE SIGNALING

    E-Print Network [OSTI]

    Voldman, Joel

    MICROFLUIDIC CONTROL OF STEM CELL DIFFUSIBLE SIGNALING Katarina Blagovi, Lily Y. Kim, Alison M cell differentiation. KEYWORDS: Embryonic stem cells, microfluidic perfusion, diffusible signaling; they secrete molecules to which they respond. Microfluidics offers a potential solution to this challenge

  3. Passive, Noiseless, Intensity Amplification of Repetitive Signals

    E-Print Network [OSTI]

    Maram, R; Li, M; Azańa, J

    2014-01-01

    Amplification of signal intensity is essential for initiating physical processes, diagnostics, sensing, communications, and scientific measurement. During traditional amplification, the signal is amplified by multiplying the signal carriers through an active gain process using an external power source. However, for repetitive waveforms, sufficient energy for amplification often resides in the signal itself. In such cases, the unneeded external power is wasted, and the signal is additionally degraded by noise and distortions that accompany active gain processes. We show noiseless, intensity amplification of repetitive optical pulse waveforms with a gain from 2 to ~20 without using active gain, by recycling energy already stored in the input repetitive signal. This "green" method uses dispersion-induced self-imaging (Talbot) effects to precisely re-distribute the original signal energy into fewer replica waveforms. This approach simply requires a suitable manipulation of the input signal's phase profile along t...

  4. Innovative Methodology Decomposition of Surface EMG Signals

    E-Print Network [OSTI]

    De Luca, Carlo J.

    for decomposing surface electromyographic (sEMG) signals into the constituent motor unit (MU) action potential limb muscles. I N T R O D U C T I O N The electromyographic (EMG) signal is composed of the action

  5. Seven Traffic Signals in Two Minutes

    Broader source: Energy.gov [DOE]

    Topeka, Kansas has activated the first of three key traffic corridors to receive a "green light tunnel," a real-time adaptive traffic signal system that synchronizes signals to create a series of...

  6. Evaluation of traffic signal controller transition methods 

    E-Print Network [OSTI]

    Hamilton, Curtis Lloyd

    2000-01-01

    A coordinated signal system achieves the best traffic progression when the signal plans are optimized at the correct offsets and intervals. When traffic conditions change and a transition to a new timing plan is warranted, it is important to reach...

  7. Bayesian network models of biological signaling pathways

    E-Print Network [OSTI]

    Sachs, Karen, Ph. D. Massachusetts Institute of Technology

    2006-01-01

    Cells communicate with other cells, and process cues from their environment, via signaling pathways, in which extracellular cues trigger a cascade of information flow, causing signaling molecules to become chemically, ...

  8. Digital signal generation for wireless communication systems

    E-Print Network [OSTI]

    Rode, Jeremy

    2010-01-01

    MHz would require a synchronous PWM generator to be clockedof signal generators have a synchronous output, time-

  9. Signal Processing for Neural Spike Trains

    E-Print Network [OSTI]

    Berger, Theodore W.

    Editorial: Signal processing and statistics have been playing a pivotal role in computational neuroscience and neural engineering research.

  10. Littleton Mt. Washington

    E-Print Network [OSTI]

    Pringle, James "Jamie"

    · Across New Hampshire IN TRAVELING NEW HAMPSHIRE HIGHWAYS AND BACK ROADS, you'll discover New Hampshire, Keene Nashua Community College, Nashua BAE Systems of N.A., Nashua University of New Hampshire, Durham Great Bay Community College, Portsmouth New Hampshire Space grant Consortium 1 23 4 56 7 8 9 10 11 12 13

  11. versity (MT Assistant o

    E-Print Network [OSTI]

    discipline um vitae, s and contac electronica cmsearch@ 2011, an trategic Fac nitiative ates are en rsities

  12. Activin/Nodal signalling in stem cells

    E-Print Network [OSTI]

    Pauklin, Siim; Vallier, Ludovic

    2015-02-15

      1       Activin/Nodal  Signaling  in  Stem  Cells       Siim  Pauklin1  and  Ludovic  Vallier1,*     1  Anne  McLaren  Laboratory  For  Regenerative  Medicine,  West  Forvie  Building... ESC   pluripotency  does  not  require  an  inductive  signalling  pathway  but  rather,  that  it  is  the   result   of   a   passive   balance   between   different   signalling   pathways   repressing...

  13. Stochastic Search for Signal Processing Algorithm Optimization

    E-Print Network [OSTI]

    Stochastic Search for Signal Processing Algorithm Optimization Bryan Singer Manuela Veloso May address the complex task of signal processing optimization. We first introduce and discuss the complexities of this domain. In general, a single signal processing algorithm can be represented by a very

  14. Wavelets and Signal Processing John E. Gilbert

    E-Print Network [OSTI]

    Knopf, Dan

    Wavelets and Signal Processing John E. Gilbert Mathematics in Science Lecture April 30, 2002. #12 of wavelets came from seismology, physics, and signal process- ing as much as from mathematics itself. In turn will describe some basic wave- let ideas and how they can be used in signal analysis and data detection

  15. Wideband Array Signal Processing Using MCMC Methods

    E-Print Network [OSTI]

    Reilly, James P.

    1 Wideband Array Signal Processing Using MCMC Methods William Ng, James P. Reilly*, Thia structure for array signal processing. A new interpolation model is formed where the observations are linear processing, a mature and specialized branch of signal processing, has found use in radar, sonar

  16. BIOSIGNAL 2002 A Biomedical Signal Processing Toolbox

    E-Print Network [OSTI]

    BIOSIGNAL 2002 A Biomedical Signal Processing Toolbox Mateo Aboy1 , Cristina Crespo1 , James McNames1 , Jules Bassale1 , Laura Jenkins1 , Brahm Goldstein2 1 Biomedical Signal Processing Laboratory@pdx.edu Abstract. This paper describes a biomedical signal processing (BSP) toolbox for the analysis of physiologic

  17. 100 Area - Hanford Site

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.Theory ofDidDevelopmentataboutScalablePhysicist: Christian Bauer 101000 Area

  18. 300 Area - Hanford Site

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.TheoryTuesday, August 10, 20102016 News Below are newsBelle-IIProcesses -1300 Area

  19. 700 Area - Hanford Site

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.TheoryTuesday, August 10, 20102016 News Below are4B Drawings 4B618-10 and700 Area

  20. Tank Farm Area Closure

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorking With U.S. Coal StocksSuppliers Tag:Take Action APPENDIX-11CoverArea

  1. Tank Farm Area Closure

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorking With U.S. Coal StocksSuppliers Tag:Take Action APPENDIX-11CoverArea

  2. Material Disposal Areas

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformationJesse BergkampCentermillion toMSDS onBudgetMaterial Disposal Areas Material

  3. datamanagementgroup 2011 SURVEY AREA SUMMARY

    E-Print Network [OSTI]

    Toronto, University of

    Collingwood CFB Borden 0 10 20 Kilometers Area = 521,900 Hectares #12;POPULATION CHARACTERISTICS Population

  4. Biologically-based signal processing system applied to noise removal for signal extraction

    DOE Patents [OSTI]

    Fu, Chi Yung; Petrich, Loren I.

    2004-07-13

    The method and system described herein use a biologically-based signal processing system for noise removal for signal extraction. A wavelet transform may be used in conjunction with a neural network to imitate a biological system. The neural network may be trained using ideal data derived from physical principles or noiseless signals to determine to remove noise from the signal.

  5. Resonance-Based Signal Decomposition: A New Sparsity-Enabled Signal Analysis Ivan W. Selesnick

    E-Print Network [OSTI]

    Selesnick, Ivan

    Numerous signals arising from physiological and physical processes, in addition to being non to disentangle by linear methods. Examples of such signals include speech, biomedical, and geophysical signals. Introduction Frequency-based analysis and filtering are fundamental tools in signal processing. However

  6. Signal and Image Processing Research at the Lawrence Livermore National Laboratory

    SciTech Connect (OSTI)

    Roberts, R S; Poyneer, L A; Kegelmeyer, L M; Carrano, C J; Chambers, D H; Candy, J V

    2009-06-29

    Lawrence Livermore National Laboratory is a large, multidisciplinary institution that conducts fundamental and applied research in the physical sciences. Research programs at the Laboratory run the gamut from theoretical investigations, to modeling and simulation, to validation through experiment. Over the years, the Laboratory has developed a substantial research component in the areas of signal and image processing to support these activities. This paper surveys some of the current research in signal and image processing at the Laboratory. Of necessity, the paper does not delve deeply into any one research area, but an extensive citation list is provided for further study of the topics presented.

  7. T-1 Training Area

    ScienceCinema (OSTI)

    None

    2015-01-09

    Another valuable homeland security asset at the NNSS is the T-1 training area, which covers more than 10 acres and includes more than 20 separate training venues. Local, County, and State first responders who train here encounter a variety of realistic disaster scenarios. A crashed 737 airliner lying in pieces across the desert, a helicopter and other small aircraft, trucks, buses, and derailed train cars are all part of the mock incident scene. After formal classroom education, first responders are trained to take immediate decisive action to prevent or mitigate the use of radiological or nuclear devices by terrorists. The Counterterrorism Operations Support Center for Radiological Nuclear Training conducts the courses and exercises providing first responders from across the nation with the tools they need to protect their communities. All of these elements provide a training experience that cannot be duplicated anywhere else in the country.

  8. T-1 Training Area

    SciTech Connect (OSTI)

    2014-11-07

    Another valuable homeland security asset at the NNSS is the T-1 training area, which covers more than 10 acres and includes more than 20 separate training venues. Local, County, and State first responders who train here encounter a variety of realistic disaster scenarios. A crashed 737 airliner lying in pieces across the desert, a helicopter and other small aircraft, trucks, buses, and derailed train cars are all part of the mock incident scene. After formal classroom education, first responders are trained to take immediate decisive action to prevent or mitigate the use of radiological or nuclear devices by terrorists. The Counterterrorism Operations Support Center for Radiological Nuclear Training conducts the courses and exercises providing first responders from across the nation with the tools they need to protect their communities. All of these elements provide a training experience that cannot be duplicated anywhere else in the country.

  9. Acquired tolerance in cadmium-adapted lung epithelial cells: Roles of the c-Jun N-terminal kinase signaling pathway and basal level of metallothionein

    SciTech Connect (OSTI)

    Lau, Andy T.Y. [Department of Anatomy, Faculty of Medicine, University of Hong Kong, Pokfulam, Hong Kong (China); Zhang Jian [Department of Biochemistry, University of Vermont College of Medicine, Burlington, VT 05405 (United States); Chiu, J.-F. [Department of Anatomy, Faculty of Medicine, University of Hong Kong, Pokfulam, Hong Kong (China) and Department of Biochemistry, University of Vermont College of Medicine, Burlington, VT 05405 (United States)]. E-mail: jfchiu@hkucc.hku.hk

    2006-08-15

    Cadmium-resistant cells were developed in our laboratory with rat lung epithelial cells (LECs) by stepwise exposure of LECs to cadmium chloride from 1 {mu}M to 20 {mu}M after 20 passages. To investigate the Cd-resistant phenotype in a long-term perspective, cadmium-resistant cells adapted to 20 {mu}M cadmium (Cd{sup R}) were then cultured in the absence of cadmium for various passages [Cd{sup R}(-n)]. All these adapted cells were significantly protected from cadmium toxicity as compared to parental cadmium-sensitive LECs (Cd{sup S}). The cadmium-resistant phenotype of adapted cells was relatively stable in the absence of cadmium for as long as 40 passages. Basal mRNA level of metallothionein-1 (MT-1) was dramatically higher in Cd{sup R} than in Cd{sup R}(-), which may account for the higher Cd-resistance of Cd{sup R} than Cd{sup R}(-). MT-1 mRNA level decreased drastically in Cd{sup R} after cadmium removal, suggesting that the high basal level of MT-1 in Cd{sup R} may be only partially responsible for cadmium-resistance. Treatment of cells with high levels of cadmium resulted in decreased phosphorylation of c-Jun N-terminal kinase (JNK1/2) in adapted cells than in sensitive cells and this cadmium-induced JNK activity was blocked by JNK inhibitor II, SP600125. Ro318220, a strong activator of JNK, reverted cadmium-sensitive phenotype in adapted cells. Taken together, our results suggest that during cadmium adaptation, cells develop tolerance to cell death, generally due to perturbation of the JNK signaling pathway and the nonresponsiveness of JNK phosphorylation is critical for the Cd-tolerance in these cells.

  10. Repair of DNA double strand breaks and radiosensitivity: modulation of DNA repair and radiosensitivity by microRNA-335 and mtPAP

    E-Print Network [OSTI]

    Martin, Nathan

    2014-01-01

    DDR by at least three mechanisms: 1) maintaining ROS homeostasis, 2) mediating apoptotic signals, and 3) producing energy

  11. DOE Designates Southwest Area and Mid-Atlantic Area National...

    Energy Savers [EERE]

    Corridors DOE Designates Southwest Area and Mid-Atlantic Area National Interest Electric Transmission Corridors October 2, 2007 - 2:50pm Addthis WASHINGTON, DC - U.S. Department...

  12. Wavelet transform techniques and signal analysis

    SciTech Connect (OSTI)

    Perez, R.B.; Mattingly, J.K. |; Perez, J.S.

    1993-03-01

    Traditionally, the most widely used signal analysis tool is the Fourier transform which, by producing power spectral densities (PSDs), allows time dependent signals to be studied in the frequency domain. However, the Fourier transform is global -- it extends over the entire time domain -- which makes it ill-suited to study nonstationary signals which exhibit local temporal changes in the signal`s frequency content. To analyze nonstationary signals, the family of transforms commonly designated as short-time Fourier transforms (STFTs), capable of identifying temporally localized changes in the signal`s frequency content, were developed by employing window functions to isolate temporal regions of the signal. For example, the Gabor STFT uses a Gaussian window. However, the applicability of STFTs is limited by various inadequacies. The Wavelet transform (NW), recently developed by Grossman and Morlet and explored in depth by Daubechies (2) and Mallat, remedies the inadequacies of STFTs. Like the Fourier transform, the WT can be implemented as a discrete transform (DWT) or as a continuous (integral) transform (CWT). This paper briefly illustrates some of the potential applications of the wavelet transform algorithms to signal analysis.

  13. Signal to Noise Analysis of iRadar sensors

    SciTech Connect (OSTI)

    Fritzke, A; Top, P

    2009-09-10

    This document follows my process of testing; comparing; and contrasting several iRadars signal to noise ratios for both HH and VV polarization. A brief introduction is given explaining the basics of iRadar technology and what data I was collecting. The process section explains the steps I took to collect my data along with any procedures I followed. The analysis section compares and contrasts five different radars and the two different polarizations. The analysis also details the radars viewing limitations and area. Finally, the report delves into the effects of two radars interfering with each other. A conclusion goes over the success and findings of the project.

  14. Audio-Magnetotellurics At Roosevelt Hot Springs Geothermal Area...

    Open Energy Info (EERE)

    MT data. References S. H. Ward, W. T. Parry, W. P. Nash, W. R. Sill, K. L. Cook, R. B. Smith, D. S. Chapman, F. H. Brown, J. A. Whelan, J. R. Bowman (1978) A Summary of the...

  15. Signal and Image Processing with Sinlets

    E-Print Network [OSTI]

    Davydov, Alexander Y

    2012-01-01

    This paper presents a new family of localized orthonormal bases - sinlets - which are well suited for both signal and image processing and analysis. One-dimensional sinlets are related to specific solutions of the time-dependent harmonic oscillator equation. By construction, each sinlet is differentiable infinitely many times and has a well-defined and smoothly-varied instantaneous frequency known in analytical form. For square-integrable transient signals with infinite support, one-dimensional sinlet basis provides an advantageous alternative to the Fourier transform by rendering accurate signal representation via a countable set of real-valued coefficients. The properties of sinlets make them suitable for analyzing many real-world signals whose frequency content changes with time including radar and sonar waveforms, music, speech, biological echolocation sounds, biomedical signals, seismic acoustic waves, and signals employed in wireless communication systems. One-dimensional sinlet bases can be used to con...

  16. F Reactor Area Cleanup Complete

    Broader source: Energy.gov [DOE]

    RICHLAND, Wash. – U.S. Department of Energy (DOE) contractors have cleaned up the F Reactor Area, the first reactor area at the Hanford Site in southeastern Washington state to be fully remediated.

  17. Monroe Urbanized Area MTP 2035 

    E-Print Network [OSTI]

    Monroe Urbanized Area Metropolitan Planning Organization

    2010-10-31

    /plain; charset=ISO-8859-1 Monroe Urbanized Area MTP 2035 The 2035 Metropolitan Transportation Plan for the Monroe Urbanized Area Developed for The Monroe Urbanized Area Metropolitan Planning Organization and The Louisiana Department... of Transportation and Development Developed by In association with Neel-Schaffer, Inc. **DRAFT** Adopted Date Here This document was prepared in cooperation with: The Monroe Urbanized Area MPO Technical Advisory Committee and The Louisiana...

  18. Communication in Home Area Networks

    E-Print Network [OSTI]

    Wang, Yubo

    2012-01-01

    used in area like smart buildings, street light controls andbuilding. This section focuses on HAN design to address two smart

  19. Automated detection and location of indications in eddy current signals

    DOE Patents [OSTI]

    Brudnoy, David M. (Albany, NY); Oppenlander, Jane E. (Burnt Hills, NY); Levy, Arthur J. (Schenectady, NY)

    2000-01-01

    A computer implemented information extraction process that locates and identifies eddy current signal features in digital point-ordered signals, signals representing data from inspection of test materials, by enhancing the signal features relative to signal noise, detecting features of the signals, verifying the location of the signal features that can be known in advance, and outputting information about the identity and location of all detected signal features.

  20. datamanagementgroup 2011 SURVEY AREA SUMMARY

    E-Print Network [OSTI]

    Toronto, University of

    RidgeRd. SimcoeSt. Hwy.7&12 RegRd.57 0 4 8 Kilometers Area = 51,980 Hectares #12;POPULATION CHARACTERISTICSdatamanagementgroup 2011 SURVEY AREA SUMMARY DEPARTMENT OF CIVIL ENGINEERING - UNIVERSITY Drivers Vehicles Trips/day 2011 2006 1996 1986 datamanagementgroup 2011 SURVEY AREA SUMMARY DEPARTMENT

  1. datamanagementgroup 2011 SURVEY AREA SUMMARY

    E-Print Network [OSTI]

    Toronto, University of

    .7 4.1 5.8 27.9 TRIPS MADE TO TTS AREA 4,070,800 22.8% 51% 22% 6% 21% 61% 13% 12% 2% 8% 4% 7.1 3.3 7datamanagementgroup 2011 SURVEY AREA SUMMARY DEPARTMENT OF CIVIL ENGINEERING - UNIVERSITY OF TORONTO PREPARED BY 5 TRANSPORTATION TOMORROW SURVEY AREA City of Orillia Durham Region City

  2. Detection of superimposed periodic signals using wavelets

    E-Print Network [OSTI]

    X. Otazu; M. Ribo; M. Peracaula; J. M. Paredes; J. Nunez

    2002-02-05

    In this paper we present a wavelet based algorithm that is able to detect superimposed periodic signals in data with low signal-noise ratio. In this context, the results given by classical period determination methods highly depend on the intrinsic characteristics of each periodic signal, like amplitude or profile. It is then difficult to detect the different periods present in the data set. The results given by the wavelet based method for period determination we present here are independent of the characteristics of the signals.

  3. Bistatic SAR: Signal Processing and Image Formation.

    SciTech Connect (OSTI)

    Wahl, Daniel E.; Yocky, David A.

    2014-10-01

    This report describes the significant processing steps that were used to take the raw recorded digitized signals from the bistatic synthetic aperture RADAR (SAR) hardware built for the NCNS Bistatic SAR project to a final bistatic SAR image. In general, the process steps herein are applicable to bistatic SAR signals that include the direct-path signal and the reflected signal. The steps include preprocessing steps, data extraction to for a phase history, and finally, image format. Various plots and values will be shown at most steps to illustrate the processing for a bistatic COSMO SkyMed collection gathered on June 10, 2013 on Kirtland Air Force Base, New Mexico.

  4. cAMP Signaling in the Gonadotropes

    E-Print Network [OSTI]

    Yeh, Debra Ming-Yi

    2012-01-01

    36 PACAP activates ERK and ELKgrowth response protein 1 ERK extracellular signal-regulated37 Figure 16: PACAP can activate ERK and

  5. Window Signaling Systems: Control Strategies & Occupant Behavior

    E-Print Network [OSTI]

    Ackerly, Katie; Brager, Gail

    2012-01-01

    Control Strategies & Occupant Behavior Katie Ackerly a ,signals play a role in occupant behavior and response. Theignored. Results: Occupant Behavior While thermal comfort

  6. San Pablo Avenue Pedestrian Signal Timing Optimization

    E-Print Network [OSTI]

    Nguyen, Ahn; Ragland, David R.

    2007-01-01

    Signals to Accommodate Pedestrian Travel. Road EngineeringM. Cynecki. A Review of Pedestrian Safety Research in theWalking Speeds for Pedestrian Clearance Timing Based on

  7. Technique for extending the range of a signal measuring circuit

    DOE Patents [OSTI]

    Chaprnka, Anthony G. (Cockeysville, MD); Sun, Shan C. (Pittsburgh, PA); Vercellotti, Leonard C. (Verona, PA)

    1978-01-01

    An input signal supplied to a signal measuring circuit is either amplified or attenuated as necessary to establish the magnitude of the input signal within the defined dynamic range of the measuring circuit and the output signal developed by the measuring circuit is subsequently readjusted through amplification or attenuation to develop an output signal which corresponds to the magnitude of the initial input signal.

  8. A 110?W 10Mb/s eTextiles transceiver for body area networks with remote battery power

    E-Print Network [OSTI]

    Mercier, Patrick Philip

    A transceiver for communicating over an electronic textiles medium is implemented for body area networks. A supply-rail-coupled differential signaling scheme permits time-sharing of the eTextiles medium between communication ...

  9. A 110?W 10Mb/s eTextiles Transceiver for Body Area Networks with Remote Batter Power

    E-Print Network [OSTI]

    Mercier, Patrick Philip

    A transceiver for communicating over an electronic textiles medium is implemented for body area networks. A supply-rail-coupled differential signaling scheme permits time-sharing of the eTextiles medium between communication ...

  10. Integrated Approach to Use Natural Chemical and Isotopic Tracers to Estimate Fracture Spacing and Surface Area in EGS Systems

    Broader source: Energy.gov [DOE]

    DOE Geothermal Peer Review 2010 - Presentation. This objective of this project is to develop an innovative approach to estimate fracture surface area and spacing through interpretation of signals of natural chemical and isotopic tracers.

  11. Adaptive Resource Allocation in SDMA-based Wireless Broadband Networks with OFDM Signaling

    E-Print Network [OSTI]

    Koutsopoulos, Iordanis

    of wireless broadband access in local and wide area networks is the main expression of the need for flexible to adjust pa- rameters such as transmission power, modulation level, symbol rate or forward error correctionAdaptive Resource Allocation in SDMA-based Wireless Broadband Networks with OFDM Signaling Iordanis

  12. Geothermal resource area 9: Nye County. Area development plan

    SciTech Connect (OSTI)

    Pugsley, M.

    1981-01-01

    Geothermal Resource area 9 encompasses all of Nye County, Nevada. Within this area there are many different known geothermal sites ranging in temperature from 70/sup 0/ to over 265/sup 0/ F. Fifteen of the more major sites have been selected for evaluation in this Area Development Plan. Various potential uses of the energy found at each of the resource sites discussed in this Area Development Plan were determined after evaluating the area's physical characteristics, land ownership and land use patterns, existing population and projected growth rates, and transportation facilities, and comparing those with the site specific resource characteristics. The uses considered were divided into five main categories: electrical generation, space heating, recreation, industrial process heat, and agriculture. Within two of these categories certain subdivisions were considered separately. The findings about each of the 15 geothermal sites considered in this Area Development Plan are summarized.

  13. Wavelet transform techniques and signal analysis

    SciTech Connect (OSTI)

    Perez, R.B.; Mattingly, J.K. Tennessee Univ., Knoxville, TN . Dept. of Nuclear Engineering); Perez, J.S. . Facultad de Informatica)

    1993-01-01

    Traditionally, the most widely used signal analysis tool is the Fourier transform which, by producing power spectral densities (PSDs), allows time dependent signals to be studied in the frequency domain. However, the Fourier transform is global -- it extends over the entire time domain -- which makes it ill-suited to study nonstationary signals which exhibit local temporal changes in the signal's frequency content. To analyze nonstationary signals, the family of transforms commonly designated as short-time Fourier transforms (STFTs), capable of identifying temporally localized changes in the signal's frequency content, were developed by employing window functions to isolate temporal regions of the signal. For example, the Gabor STFT uses a Gaussian window. However, the applicability of STFTs is limited by various inadequacies. The Wavelet transform (NW), recently developed by Grossman and Morlet and explored in depth by Daubechies (2) and Mallat, remedies the inadequacies of STFTs. Like the Fourier transform, the WT can be implemented as a discrete transform (DWT) or as a continuous (integral) transform (CWT). This paper briefly illustrates some of the potential applications of the wavelet transform algorithms to signal analysis.

  14. Long Signaling Cascades Tend to Attenuate Retroactivity

    E-Print Network [OSTI]

    Del Vecchio, Domitilla

    to propagate not only from upstream to downstream but also from downstream to upstream due to retroactivity unknown. Here, we determine the downstream-to- upstream steady state gain at each stage of the signaling, resulting in a system where the signal travels only from upstream to downstream. Theoretical work, however

  15. Neurofibromin Regulation of ERK Signaling Modulates

    E-Print Network [OSTI]

    Silva, Alcino

    Neurofibromin Regulation of ERK Signaling Modulates GABA Release and Learning Yijun Cui,1 Rui M@mednet.ucla.edu DOI 10.1016/j.cell.2008.09.060 SUMMARY We uncovered a role for ERK signaling in GABA re- lease, long demonstrate that neurofibromin modulates ERK/synapsin I-dependent GABA re- lease, which in turn modulates

  16. Detector signal correction method and system

    DOE Patents [OSTI]

    Carangelo, Robert M. (Glastonbury, CT); Duran, Andrew J. (Oviedo, FL); Kudman, Irwin (Boca Raton, FL)

    1995-07-11

    Corrective factors are applied so as to remove anomalous features from the signal generated by a photoconductive detector, and to thereby render the output signal highly linear with respect to the energy of incident, time-varying radiation. The corrective factors may be applied through the use of either digital electronic data processing means or analog circuitry, or through a combination of those effects.

  17. Bayesian fluorescence in situ hybridisation signal classification

    E-Print Network [OSTI]

    Lerner, Boaz

    hybridisation (FISH) signals for the detection of genetic abnormalities. Based on well-discriminating features hybridisation (FISH); Gaussian mixture model; Naive Bayesian classifier; Signal classification Artificial.artmed.2003.11.005 #12;1. Introduction Fluorescence in situ hybridisation (FISH) allows selective staining

  18. Seven Traffic Signals in Two Minutes

    SciTech Connect (OSTI)

    None

    2011-01-01

    Topeka, KS has activated the first of three key traffic corridors to receive a "green light tunnel," a real-time adaptive traffic signal system that synchronizes signals to create a series of green lights for motorists. The result is fewer stops, less travel time and -- most importantly -- a lot of saved gasoline.

  19. Optimal signal patterns for dynamical cellular communication

    E-Print Network [OSTI]

    Hasegawa, Yoshihiko

    2015-01-01

    Cells transmit information via signaling pathways, using temporal dynamical patterns. As optimality with respect to environments is the universal principle in biological systems, organisms have acquired an optimal way of transmitting information. Here we obtain optimal dynamical signal patterns which can transmit information efficiently (low power) and reliably (high accuracy) using the optimal control theory. Adopting an activation-inactivation decoding network, we reproduced several dynamical patterns found in actual signals, such as steep, gradual and overshooting dynamics. Notably, when minimizing the power of the input signal, optimal signals exhibit the overshooting pattern, which is a biphasic pattern with transient and steady phases; this pattern is prevalent in actual dynamical patterns as it can be generated by an incoherent feed-forward loop (FFL), a common motif in biochemical networks. We also identified conditions when the three patterns, steep, gradual and overshooting, confer advantages.

  20. The plasticity of TGF-beta signaling

    E-Print Network [OSTI]

    Geraldine Celliere; Georgios Fengos; Marianne Herve; Dagmar Iber

    2011-11-02

    The family of TGFb ligands is large and its members are involved in many different signaling processes. These signaling processes strongly differ in type with TGFb ligands eliciting both sustained or transient responses. Members of the TGFb family can also act as morphogen and cellular responses would then be expected to provide a direct read-out of the extracellular ligand concentration. We were interested to define the set of minimal modifications that are required to change the type of signal processing in the TGFb signaling network. To define the key aspects for signaling plasticity we focused on the core of the TGFb signaling network. With the help of a parameter screen we identified ranges of kinetic parameters and protein concentrations that give rise to transient, sustained, or oscillatory responses to constant stimuli, as well as those parameter ranges that enable a proportional response to time-varying ligand concentrations (as expected in the read-out of morphogens). A combination of a strong negative feedback and fast shuttling to the nucleus biases signaling to a transient rather than a sustained response, while oscillations were obtained if ligand binding to the receptor is weak and the turn-over of the I-Smad is fast. A proportional read-out required inefficient receptor activation in addition to a low affinity of receptor-ligand binding. We find that targeted modification of single parameters suffices to alter the response type. The architecture of the TGFb pathway enables the observed signaling plasticity. The observed range of signaling outputs to TGFb ligand in different cell types and under different conditions can be explained with differences in cellular protein concentrations and with changes in effective rate constants due to cross-talk with other signaling pathways.

  1. datamanagementgroup 2011 SURVEY AREA SUMMARY

    E-Print Network [OSTI]

    Toronto, University of

    % 7% 6.5 5.5 6.5 68.5 30,100 10% 5% 51% 34% 73% 17% 1% * 3% 7% 7.0 7.2 10.0 * ANCASTER AREA CITYdatamanagementgroup 2011 SURVEY AREA SUMMARY DEPARTMENT OF CIVIL ENGINEERING - UNIVERSITY OF TORONTO PREPARED BY 85 ANCASTER AREA CITY OF HAMILTON Mohawk Rd. Main St. Carluke Rd. Governors Rd. Garner

  2. datamanagementgroup 2011 SURVEY AREA SUMMARY

    E-Print Network [OSTI]

    Toronto, University of

    ,213,000 38% 13% 35% 14% 60% 14% 16% 1% 7% 2% 5.7 4.1 6.6 30.0 TRIPS MADE TO TTS AREA 3,168,200 23.5% 51% 22datamanagementgroup 2011 SURVEY AREA SUMMARY DEPARTMENT OF CIVIL ENGINEERING - UNIVERSITY OF TORONTO PREPARED BY 5 GREATER TORONTO HAMILTON AREA Durham Region Peel Region City of Hamilton City

  3. Kodiak Area Management Reports, 19242010 Kodiak Area Management Reports, 19242010

    E-Print Network [OSTI]

    367 Kodiak Area Management Reports, 1924­2010 APPENDIX 4 Kodiak Area Management Reports, 1924­2010 1924: Fred R. Lucas. Report of Kodiak-Afognak Fish- eries District to August 31, 1924. U.S. Bureau of Fisheries, Afognak, AK (5 September 1924). 8 p. 1924: Fred R. Lucas. Report of Kodiak-Afognak Dis- trict

  4. Communication in Home Area Networks

    E-Print Network [OSTI]

    Wang, Yubo

    2012-01-01

    and implementation of smart home energy management systemsStandard Technologies for Smart Home Area Networks EnablingInteroperability framework for smart home systems”, Consumer

  5. Quantifying Uncertainty in Chemical Systems Modeling M.T. Reagan1, H.N. Najm1, P.P. Pebay1, O.M. Knio2 and R.G. Ghanem2

    E-Print Network [OSTI]

    Frey, Pascal

    Quantifying Uncertainty in Chemical Systems Modeling M.T. Reagan1, H.N. Najm1, P.P. P´ebay1, O The Johns Hopkins University, Baltimore, MD 21218, USA Abstract. This study compares two techniques of Chemical Kinetics 1. Introduction Chemical kinetics computations require the specification of a number

  6. A new A&P Food Market in Mt. Kisco, New York, is enjoying annual energy cost savings of nearly $130,000 with the installation of an integrated microturbine power system

    E-Print Network [OSTI]

    Pennycook, Steve

    Background A new A&P Food Market in Mt. Kisco, New York, is enjoying annual energy cost savings, heating and power solutions, was installed in 2005 in the 57,000- square-foot facility. The New York supermarket was the first U.S. customer to take delivery of the new system. The PureComfort system is designed

  7. Visualizing the Surface Infrastructure Used to Move 2 MtCO2/year from the Dakota Gasification Company to the Weyburn CO2 Enhanced Oil Recovery Project: Version of July 1, 2009

    SciTech Connect (OSTI)

    Dooley, James J.

    2009-07-09

    Google Earth Pro has been employed to create an interactive flyover of the world’s largest operational carbon dioxide capture and storage project. The visualization focuses on the transport and storage of 2 MtCO2/year which is captured from the Dakota Gasification Facility (Beula, North Dakota) and transported 205 miles and injected into the Weyburn oil field in Southeastern Saskatchewan.

  8. Apparatus and method for mapping an area of interest

    DOE Patents [OSTI]

    Staab, Torsten A. (Los Alamos, NM) Cohen, Daniel L. (Ithaca, NY); Feller, Samuel (Fairfax, VA)

    2009-12-01

    An apparatus and method are provided for mapping an area of interest using polar coordinates or Cartesian coordinates. The apparatus includes a range finder, an azimuth angle measuring device to provide a heading and an inclinometer to provide an angle of inclination of the range finder as it relates to primary reference points and points of interest. A computer is provided to receive signals from the range finder, inclinometer and azimuth angle measurer to record location data and calculate relative locations between one or more points of interest and one or more primary reference points. The method includes mapping of an area of interest to locate points of interest relative to one or more primary reference points and to store the information in the desired manner. The device may optionally also include an illuminator which can be utilized to paint the area of interest to indicate both points of interest and primary points of reference during and/or after data acquisition.

  9. Signal Speed in Nanomagnetic Logic Chains

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effect Photovoltaics -7541 UnlimitedShift EndShutdown 2013SignalSignal SpeedSignal

  10. datamanagementgroup 2011 SURVEY AREA SUMMARY

    E-Print Network [OSTI]

    Toronto, University of

    datamanagementgroup 2011 SURVEY AREA SUMMARY DEPARTMENT OF CIVIL ENGINEERING - UNIVERSITY OF TORONTO PREPARED BY 51 TOWN OF RICHMOND HILL REGIONAL MUNICIPALITY OF YORK LeslieSt. Stouffville Rd. King 6 Kilometers Area = 10,180 Hectares #12;POPULATION CHARACTERISTICS Population Age Daily

  11. Area Health Education Center of

    E-Print Network [OSTI]

    Collins, Gary S.

    Area Health Education Center of Eastern Washington Washington State University Extension's Area Health Education Center of Eastern Washington works with university and community allies to promote health for underserved and at-risk populations. It is part of a network of AHEC organiza- tions

  12. Syllabus: EE 313 Linear Signals and Systems Spring 2012 1

    E-Print Network [OSTI]

    Heath Jr., - Robert W.

    , and biomedical engineering among others. The emphasis of this course is on signal processing tools but we Linear Signals and Systems Spring 2012 2 Course Introduction Signal processing is rich with tools will be your first introduction to the concepts of signal processing, especially processing signals with linear

  13. Short communication Deterministic models for simulating electrocardiographic signals

    E-Print Network [OSTI]

    Gidea, Marian

    . Synthetic electrocardiographic signals based on deterministic chaos can be used to test signal processing elec- trocardiographic signals (ECGs) are employed in biomedical engineering to assess signal processing techniques. The appli- cations include the design of filters to de-noise ECG signals, ECG data

  14. Before Mapping After Mapping Area Power Area Delay Power

    E-Print Network [OSTI]

    Pedram, Massoud

    32 Exam- ples Before Mapping After Mapping Area Power Area Delay Power 5xp1 0.93 0.98 0.86 0.82 0 1.01 1.01 1.02 1.07 0.99 duke2 1.01 1.01 0.99 1.13 0.97 e64 1.00 0.51 0.83 1.16 0.50 ex5 0.99 0.89 0.99 0.92 0.96 1.05 0.90 Table 2: Area, delay and power statistics for power script (normalized

  15. Discrimination of the binary coherent signal: Gaussian-operation limit and simple non-Gaussian near-optimal receivers

    E-Print Network [OSTI]

    Masahiro Takeoka; Masahide Sasaki

    2008-08-14

    We address the limit of the Gaussian operations and classical communication in the problem of quantum state discrimination. We show that the optimal Gaussian strategy for the discrimination of the binary phase shift keyed (BPSK) coherent signal is a simple homodyne detection. We also propose practical near-optimal quantum receivers that beat the BPSK homodyne limit in all areas of the signal power. Our scheme is simple and does not require realtime electrical feedback.

  16. Signal connection for a downhole tool string

    DOE Patents [OSTI]

    Hall, David R.; Hall, Jr., H. Tracy; Pixton, David S.; Bradford, Kline; Fox, Joe; Briscoe, Michael

    2006-08-29

    A signal transmission connection for a tool string used in exploration and production of natural resources, namely: oil, gas, and geothermal energy resources. The connection comprises first and second annular elements deployed in cooperative association with each other. The respective elements comprise inductive transducers that are capable of two-way signal transmission between each other, with downhole components of the tool string, and with ground-level equipment. The respective inductive transducers comprise one or more conductive loops housed within ferrite troughs, or within ferrite trough segments. When energized, the conductive loops produce a magnetic field suitable for transmitting the signal. The second element may be rotational in drilling applications. The respective elements may be fitted with electronic equipment to aid and manipulate the transmission of the signal. The first element may also be in communication with the World Wide Web.

  17. ORIGINAL PAPER Interacting selection diversifies warning signals

    E-Print Network [OSTI]

    Cummings, Molly E.

    : an examination with the strawberry poison frog Molly E. Cummings · Laura R. Crothers Received: 1 October 2012 signal evolution of the highly polytypic strawberry poison frog, Oophaga pumilio, of Bocas del Toro

  18. Signal Timing Optimization to Improve Air Quality 

    E-Print Network [OSTI]

    Lv, Jinpeng 1983-

    2012-12-11

    the gap that the research on signal optimization at intersections lags behind the development of emissions models. The methodology development includes four levels: the vehicle level, the movement level, the intersection level, and the arterial level...

  19. Emerging local warming signals in observational data

    E-Print Network [OSTI]

    Mahlstein, Irina

    The global average temperature of the Earth has increased, but year-to-year variability in local climates impedes the identification of clear changes in observations and human experience. For a signal to become obvious in ...

  20. Signal Processing 85 (2005) 18591868 Short communication

    E-Print Network [OSTI]

    Ray, Asok

    2005-01-01

    Signal Processing 85 (2005) 1859­1868 Short communication Symbolic time series analysis for anomaly anomalies. Time series data of observed process variables on the fast time-scale of dynamical systems

  1. Signal approximation using the bilinear transform

    E-Print Network [OSTI]

    Venkataraman, Archana, Ph. D. Massachusetts Institute of Technology

    2007-01-01

    This thesis explores the approximation properties of a unique basis expansion. The expansion implements a nonlinear frequency warping between a continuous-time signal and its discrete-time representation according to the ...

  2. Detector signal correction method and system

    DOE Patents [OSTI]

    Carangelo, R.M.; Duran, A.J.; Kudman, I.

    1995-07-11

    Corrective factors are applied so as to remove anomalous features from the signal generated by a photoconductive detector, and to thereby render the output signal highly linear with respect to the energy of incident, time-varying radiation. The corrective factors may be applied through the use of either digital electronic data processing means or analog circuitry, or through a combination of those effects. 5 figs.

  3. Data Capture Technique for High Speed Signaling

    DOE Patents [OSTI]

    Barrett, Wayne Melvin (Rochester, MN); Chen, Dong (Croton On Hudson, NY); Coteus, Paul William (Yorktwon Heights, NY); Gara, Alan Gene (Mount Kisco, NY); Jackson, Rory (Eastchester, NY); Kopcsay, Gerard Vincent (Yorktown Hieghts, NY); Nathanson, Ben Jesse (Teaneck, NY); Vranas, Paylos Michael (Bedford Hills, NY); Takken, Todd E. (Brewster, NY)

    2008-08-26

    A data capture technique for high speed signaling to allow for optimal sampling of an asynchronous data stream. This technique allows for extremely high data rates and does not require that a clock be sent with the data as is done in source synchronous systems. The present invention also provides a hardware mechanism for automatically adjusting transmission delays for optimal two-bit simultaneous bi-directional (SiBiDi) signaling.

  4. Mcdermitt Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource HistoryScenariosMarysville Mt GeothermalMauna LoaMcAdooWindII Jump to:IVMcdermitt

  5. Mcleod 88 Geothermal Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource HistoryScenariosMarysville Mt GeothermalMauna LoaMcAdooWindII Jump

  6. Signal and Image Processing with Sinlets

    E-Print Network [OSTI]

    Alexander Y. Davydov

    2012-09-17

    This paper presents a new family of localized orthonormal bases - sinlets - which are well suited for both signal and image processing and analysis. One-dimensional sinlets are related to specific solutions of the time-dependent harmonic oscillator equation. By construction, each sinlet is infinitely differentiable and has a well-defined and smooth instantaneous frequency known in analytical form. For square-integrable transient signals with infinite support, one-dimensional sinlet basis provides an advantageous alternative to the Fourier transform by rendering accurate signal representation via a countable set of real-valued coefficients. The properties of sinlets make them suitable for analyzing many real-world signals whose frequency content changes with time including radar and sonar waveforms, music, speech, biological echolocation sounds, biomedical signals, seismic acoustic waves, and signals employed in wireless communication systems. One-dimensional sinlet bases can be used to construct two- and higher-dimensional bases with variety of potential applications including image analysis and representation.

  7. IEEE TRANSACTIONS ON SIGNAL PROCESSING, VOL. XX, NO. XX, JANUARY XXXX 1 Relaxed Conditions for Sparse Signal Recovery

    E-Print Network [OSTI]

    IEEE TRANSACTIONS ON SIGNAL PROCESSING, VOL. XX, NO. XX, JANUARY XXXX 1 Relaxed Conditions the convention of modern digital signal processing by establishing that exact signal reconstruction is possible the fundamental doctrine of signal processing has been Shannon's theorem, which states that any continuous signal

  8. Sensor Signals for Interaction This is a brief tutorial on algorithms for processing sensor signals. When developing interactive

    E-Print Network [OSTI]

    Olsen Jr., Dan R.

    Sensor Signals for Interaction This is a brief tutorial on algorithms for processing sensor signals for performing the recognition at interactive speeds. Signal processing vs. interaction The topics covered in this tutorial traditionally fall under signal processing. Some of the techniques described are drawn from signal

  9. HER receptor-mediated dynamic signalling in breast cancer cells 

    E-Print Network [OSTI]

    Hu, Huizhong

    2011-07-05

    The dynamics of cell signalling are critical to cell fate decisions. Human Epidermal growth factor Receptors (HERs)-mediated Ras/Raf/MEK/ERK and PI3K/Akt signalling cascades relay extracellular signals from the plasma ...

  10. Adventures in Radio Astronomy Instrumentation and Signal Processing

    E-Print Network [OSTI]

    Masci, Frank

    Adventures in Radio Astronomy Instrumentation and Signal Processing by Peter Leonard Mc Alan Langman, Karoo Array Telescope 1 Center for Astronomy Signal Processing and Electronics Research and implementation of several instruments for digi- tizing and processing analogue astronomical signals collected

  11. Channel modeling, signal processing and coding for perpendicular magnetic recording

    E-Print Network [OSTI]

    Wu, Zheng

    2009-01-01

    1.2 Signal Processing and Coding Techniques in ReadCRC Handbook for Coding and Signal Processing for RecordingCRC Handbook for Coding and Signal Processing for Recording

  12. Biomedical signal processing --application of optimization methods for machine learning

    E-Print Network [OSTI]

    Absil, Pierre-Antoine

    Biomedical signal processing -- application of optimization methods for machine learning problems Biomedical signal processing -- application of optimization methods for machi #12;Data mining cocktail-party problem F. Theis Biomedical signal processing -- application of optimization methods for machi #12;Data

  13. A nonlinear optoelectronic filter for electronic signal processing

    E-Print Network [OSTI]

    Loh, William

    The conversion of electrical signals into modulated optical waves and back into electrical signals provides the capacity for low-loss radio-frequency (RF) signal transfer over optical fiber. Here, we show that the unique ...

  14. Guest Editorial Sparse Approximations in Signal and Image Processing

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Guest Editorial Sparse Approximations in Signal and Image Processing Sparse approximation to solve many other signal processing problems, including blind source separation, feature extraction techniques to images as well as audio and biomedical signals, new efficient im- plementations of greedy

  15. Compensation of the AKT signaling by ERK signaling in transgenic mice hearts overexpressing TRIM72

    SciTech Connect (OSTI)

    Ham, Young-Mi, E-mail: youngmi_ham@hms.harvard.edu [College of Life Science and Biotechnology, Korea University, Seoul (Korea, Republic of); Department of Cell Biology, Harvard Medical School, Boston, MA 02115 (United States); Mahoney, Sarah Jane [Department of Cell Biology, Harvard Medical School, Boston, MA 02115 (United States)

    2013-06-10

    The AKT and ERK signaling pathways are known to be involved in cell hypertrophy, proliferation, survival and differentiation. Although there is evidence for crosstalk between these two signaling pathways in cellulo, there is less evidence for cross talk in vivo. Here, we show that crosstalk between AKT and ERK signaling in the hearts of TRIM72-overexpressing transgenic mice (TRIM72-Tg) with alpha-MHC promoter regulates and maintains their heart size. TRIM72, a heart- and skeletal muscle-specific protein, downregulates AKT-mTOR signaling via IRS-1 degradation and reduces the size of rat cardiomyocytes and the size of postnatal TRIM72-Tg hearts. TRIM72 expression was upregulated by hypertrophic inducers in cardiomyocytes, while IRS-1 was downregulated by IGF-1. TRIM72 specifically regulated IGF-1-dependent AKT-mTOR signaling, resulting in a reduction of the size of cardiomyocytes. Postnatal TRIM72-Tg hearts were smaller than control-treated hearts with inhibition of AKT-mTOR signaling. However, adult TRIM72-Tg hearts were larger than of control despite the suppression of AKT-mTOR signaling. Activation of ERK, PKC-?, and JNK were observed to be elevated in adult TRIM72-Tg, and these signals were mediated by ET-1 via the ET receptors A and B. Altogether, these results suggest that AKT signaling regulates cardiac hypertrophy in physiological conditions, and ERK signaling compensates for the absence of AKT signaling during TRIM72 overexpression, leading to pathological hypertrophy. -- Highlights: • TRIM72 inhibits AKT signaling through ubiquitination of IRS-1 in cardiac cells. • TRIM72 regulates the size of cardiac cells. • TRIM72 regulates size of postnatal TRIM72-overexpressing transgenic mice hearts. • Adult TRIM72-overexpressing transgenic mice hearts showed cardiac dysfunction. • Adult TRIM72 transgenic mice hearts showed higher expression of endothelin receptors.

  16. AREA

    Broader source: Energy.gov (indexed) [DOE]

    or if they need to add this to their audit they have performed yearly by a public accounting firm. 316 audits are essentially A-133 audits for for-profit entities. They DO...

  17. Communication in Home Area Networks

    E-Print Network [OSTI]

    Wang, Yubo

    2012-01-01

    21] ZigBee Alliance. "ZigBee Smart Energy V2.0”, 2011 [22]Secure remote access to Smart Energy Home area Networks”,Density HEMS SEP Smart Energy Profile HV Home Energy

  18. Progress Update: M Area Closure

    ScienceCinema (OSTI)

    Cody, Tom

    2012-06-14

    A progress update of the Recovery Act at work at the Savannah River Site. The celebration of the first area cleanup completion with the help of the Recovery Act.

  19. Security Area Vouching and Piggybacking

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2000-06-05

    Establishes requirements for the Department of Energy (DOE) Security Area practice of "vouching" or "piggybacking" access by personnel. DOE N 251.40, dated 5-3-01, extends this directive until 12-31-01.

  20. Variable area fuel cell cooling

    DOE Patents [OSTI]

    Kothmann, Richard E. (Churchill Borough, PA)

    1982-01-01

    A fuel cell arrangement having cooling fluid flow passages which vary in surface area from the inlet to the outlet of the passages. A smaller surface area is provided at the passage inlet, which increases toward the passage outlet, so as to provide more uniform cooling of the entire fuel cell. The cooling passages can also be spaced from one another in an uneven fashion.

  1. Multi-area network analysis 

    E-Print Network [OSTI]

    Zhao, Liang

    2005-02-17

    -1 MULTI-AREA NETWORK ANALYSIS A Dissertation by LIANG ZHAO Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY... December 2004 Major Subject: Electrical Engineering MULTI-AREA NETWORK ANALYSIS A Dissertation by LIANG ZHAO Submitted to Texas A&M University in partial fulfillment of the requirements for the degree of DOCTOR...

  2. Improved Engine Control Strategies Enabled by Digital Signal...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Engine Control Strategies Enabled by Digital Signal-Processing Method for Zirconia Exhaust Sensors Improved Engine Control Strategies Enabled by Digital Signal-Processing Method...

  3. Research Areas | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Stewardship Science Academic Alliances Research Areas Research Areas Properties of Materials under Extreme Conditions and Hydrodynamics During open solicitations research...

  4. Gated integrator with signal baseline subtraction

    DOE Patents [OSTI]

    Wang, X.

    1996-12-17

    An ultrafast, high precision gated integrator includes an opamp having differential inputs. A signal to be integrated is applied to one of the differential inputs through a first input network, and a signal indicative of the DC offset component of the signal to be integrated is applied to the other of the differential inputs through a second input network. A pair of electronic switches in the first and second input networks define an integrating period when they are closed. The first and second input networks are substantially symmetrically constructed of matched components so that error components introduced by the electronic switches appear symmetrically in both input circuits and, hence, are nullified by the common mode rejection of the integrating opamp. The signal indicative of the DC offset component is provided by a sample and hold circuit actuated as the integrating period begins. The symmetrical configuration of the integrating circuit improves accuracy and speed by balancing out common mode errors, by permitting the use of high speed switching elements and high speed opamps and by permitting the use of a small integrating time constant. The sample and hold circuit substantially eliminates the error caused by the input signal baseline offset during a single integrating window. 5 figs.

  5. Gated integrator with signal baseline subtraction

    DOE Patents [OSTI]

    Wang, Xucheng (Lisle, IL)

    1996-01-01

    An ultrafast, high precision gated integrator includes an opamp having differential inputs. A signal to be integrated is applied to one of the differential inputs through a first input network, and a signal indicative of the DC offset component of the signal to be integrated is applied to the other of the differential inputs through a second input network. A pair of electronic switches in the first and second input networks define an integrating period when they are closed. The first and second input networks are substantially symmetrically constructed of matched components so that error components introduced by the electronic switches appear symmetrically in both input circuits and, hence, are nullified by the common mode rejection of the integrating opamp. The signal indicative of the DC offset component is provided by a sample and hold circuit actuated as the integrating period begins. The symmetrical configuration of the integrating circuit improves accuracy and speed by balancing out common mode errors, by permitting the use of high speed switching elements and high speed opamps and by permitting the use of a small integrating time constant. The sample and hold circuit substantially eliminates the error caused by the input signal baseline offset during a single integrating window.

  6. Large area photodetector based on microwave cavity perturbation techniques

    SciTech Connect (OSTI)

    Braggio, C., E-mail: caterina.braggio@unipd.it; Carugno, G.; Sirugudu, R. K. [Dip. di Fisica e Astronomia and INFN Sez. di Padova, Via F. Marzolo 8, I-35131 Padova (Italy); Lombardi, A.; Ruoso, G. [INFN, Laboratori Nazionali di Legnaro, Viale dell'Universitŕ 2, I-35020 Legnaro (Italy)

    2014-07-28

    We present a preliminary study to develop a large area photodetector, based on a semiconductor crystal placed inside a superconducting resonant cavity. Laser pulses are detected through a variation of the cavity impedance, as a consequence of the conductivity change in the semiconductor. A novel method, whereby the designed photodetector is simulated by finite element analysis, makes it possible to perform pulse-height spectroscopy on the reflected microwave signals. We measure an energy sensitivity of 100 fJ in the average mode without the employment of low noise electronics and suggest possible ways to further reduce the single-shot detection threshold, based on the results of the described method.

  7. Automatic Mapping of Real Time Radio Astronomy Signal Processing Pipelines onto Heterogeneous Clusters

    E-Print Network [OSTI]

    Filiba, Terry

    2013-01-01

    Astronomy Signal Processing Pipelines onto HeterogeneousAstronomy Signal Processing Pipelines onto HeterogeneousAstronomy Signal Processing Pipelines onto Heterogeneous

  8. Energy-Efficient VLSI Signal Processing for Wideband Spectrum Sensing in Cognitive Radios

    E-Print Network [OSTI]

    Yu, Tsung-Han

    2013-01-01

    point Signal Processing . . . . . . . . . . . . . . . . . 84Acoustics, Speech, and Signal Processing (ICASSP), vol. 4,Optimization Tool for Signal Processing and Communication

  9. Nonlinear multivariate analysis of Neurophysiological Signals

    E-Print Network [OSTI]

    Ernesto Pereda; Rodrigo Quian Quiroga; Joydeep Bhattacharya

    2005-10-31

    Multivariate time series analysis is extensively used in neurophysiology with the aim of studying the relationship between simultaneously recorded signals. Recently, advances on information theory and nonlinear dynamical systems theory have allowed the study of various types of synchronization from time series. In this work, we first describe the multivariate linear methods most commonly used in neurophysiology and show that they can be extended to assess the existence of nonlinear interdependences between signals. We then review the concepts of entropy and mutual information followed by a detailed description of nonlinear methods based on the concepts of phase synchronization, generalized synchronization and event synchronization. In all cases, we show how to apply these methods to study different kinds of neurophysiological data. Finally, we illustrate the use of multivariate surrogate data test for the assessment of the strength (strong or weak) and the type (linear or nonlinear) of interdependence between neurophysiological signals.

  10. Detecting the cosmological recombination signal from space

    E-Print Network [OSTI]

    Desjacques, Vincent; Silk, Joseph; de Bernardis, Francesco; Doré, Olivier

    2015-01-01

    Spectral distortions of the CMB have recently experienced an increased interest. One of the inevitable distortion signals of our cosmological concordance model is created by the cosmological recombination process, just a little before photons last scatter at redshift $z\\simeq 1100$. These cosmological recombination lines, emitted by the hydrogen and helium plasma, should still be observable as tiny deviation from the CMB blackbody spectrum in the cm--dm spectral bands. In this paper, we present a forecast for the detectability of the recombination signal with future satellite experiments. We argue that serious consideration for future CMB experiments in space should be given to probing spectral distortions and, in particular, the recombination line signals. The cosmological recombination radiation not only allows determination of standard cosmological parameters, but also provides a direct observational confirmation for one of the key ingredients of our cosmological model: the cosmological recombination histo...

  11. Signal processing method and system for noise removal and signal extraction

    DOE Patents [OSTI]

    Fu, Chi Yung (San Francisco, CA); Petrich, Loren (Lebanon, OR)

    2009-04-14

    A signal processing method and system combining smooth level wavelet pre-processing together with artificial neural networks all in the wavelet domain for signal denoising and extraction. Upon receiving a signal corrupted with noise, an n-level decomposition of the signal is performed using a discrete wavelet transform to produce a smooth component and a rough component for each decomposition level. The n.sup.th level smooth component is then inputted into a corresponding neural network pre-trained to filter out noise in that component by pattern recognition in the wavelet domain. Additional rough components, beginning at the highest level, may also be retained and inputted into corresponding neural networks pre-trained to filter out noise in those components also by pattern recognition in the wavelet domain. In any case, an inverse discrete wavelet transform is performed on the combined output from all the neural networks to recover a clean signal back in the time domain.

  12. Resolving small signal measurements in experimental plasma environments using calibrated subtraction of noise signals

    SciTech Connect (OSTI)

    Fimognari, P. J. Demers, D. R.; Chen, X.; Schoch, P. M.

    2014-11-15

    The performance of many diagnostic and control systems within fusion and other fields of research are often detrimentally affected by spurious noise signals. This is particularly true for those (such as radiation or particle detectors) working with very small signals. Common sources of radiated and conducted noise in experimental fusion environments include the plasma itself and instrumentation. The noise complicates data analysis, as illustrated by noise on signals measured with the heavy ion beam probe (HIBP) installed on the Madison Symmetric Torus. The noise is time-varying and often exceeds the secondary ion beam current (in contrast with previous applications). Analysis of the noise identifies the dominant source as photoelectric emission from the detectors induced by ultraviolet light from the plasma. This has led to the development of a calibrated subtraction technique, which largely removes the undesired temporal noise signals from data. The advantages of the technique for small signal measurement applications are demonstrated through improvements realized on HIBP fluctuation measurements.

  13. EFFECTS OF RADIO WAVE PROPAGATION IN URBANIZED AREAS ON UAV-GCS COMMAND AND CONTROL

    E-Print Network [OSTI]

    Jenn, David C.

    EFFECTS OF RADIO WAVE PROPAGATION IN URBANIZED AREAS ON UAV-GCS COMMAND AND CONTROL Lock Wai Lek In an urban environment, the linkage between UAVs and ground control stations are subjected to multipath multipath can result in a nearly complete loss of command signals, which can limit the UAV's operational

  14. Apparatus for millimeter-wave signal generation

    DOE Patents [OSTI]

    Vawter, G. Allen (Albuquerque, NM); Hietala, Vincent M. (Placitas, NM); Zolper, John C. (Albuquerque, NM); Mar, Alan (Albuquerque, NM); Hohimer, John P. (Albuquerque, NM)

    1999-01-01

    An opto-electronic integrated circuit (OEIC) apparatus is disclosed for generating an electrical signal at a frequency .gtoreq.10 GHz. The apparatus, formed on a single substrate, includes a semiconductor ring laser for generating a continuous train of mode-locked lasing pulses and a high-speed photodetector for detecting the train of lasing pulses and generating the electrical signal therefrom. Embodiments of the invention are disclosed with an active waveguide amplifier coupling the semiconductor ring laser and the high-speed photodetector. The invention has applications for use in OEICs and millimeter-wave monolithic integrated circuits (MMICs).

  15. Signal Speed in Nanomagnetic Logic Chains

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effect Photovoltaics -7541 UnlimitedShift EndShutdown 2013SignalSignal Speed in

  16. Signal Speed in Nanomagnetic Logic Chains

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effect Photovoltaics -7541 UnlimitedShift EndShutdown 2013SignalSignal Speed

  17. Signal Speed in Nanomagnetic Logic Chains

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservation ofAlbuquerque|Sensitive Species3 Outlook for Gulf ofSifting ThroughSignalSignal

  18. H-Area Seepage Basins

    SciTech Connect (OSTI)

    Stejskal, G.

    1990-12-01

    During the third quarter of 1990 the wells which make up the H-Area Seepage Basins (H-HWMF) monitoring network were sampled. Laboratory analyses were performed to measure levels of hazardous constituents, indicator parameters, tritium, nonvolatile beta, and gross alpha. A Gas Chromatograph Mass Spectrometer (GCMS) scan was performed on all wells sampled to determine any hazardous organic constituents present in the groundwater. The primary contaminants observed at wells monitoring the H-Area Seepage Basins are tritium, nitrate, mercury, gross alpha, nonvolatile beta, trichloroethylene (TCE), tetrachloroethylene, lead, cadmium, arsenic, and total radium.

  19. Unsupervised Learning Methods for Source Separation in Monaural Music Signals

    E-Print Network [OSTI]

    Virtanen, Tuomas

    Institute of Signal Processing, Tampere University of Technology, Korkeakoulunkatu 1, 33720 Tampere, Finland

  20. Functional organization of PLC signaling microdomains in neurons

    E-Print Network [OSTI]

    Brown, David

    Functional organization of PLC signaling microdomains in neurons Patrick Delmas1 , Marcel Crest1 of phospholipase C (PLC) signaling. Supramolecular complexes organize the cor- rect repertoires of receptors of signal transduction events. However, not all PLC signals nucleate around scaffold proteins, although

  1. Agilent E8267D PSG Vector Signal Generator

    E-Print Network [OSTI]

    Anlage, Steven

    Agilent E8267D PSG Vector Signal Generator Configuration Guide This guide is intended to assist you with the ordering process of the PSG vector signal generators. #12;2 Agilent PSG Vector Signal Generator Options generator. E8267D-532 Frequency range from 250 kHz to 31.8 GHz Selects the maximum frequency of the signal

  2. A Signal Processing Approach To Fair Surface Design Charles Robertson

    E-Print Network [OSTI]

    Kazhdan, Michael

    A Signal Processing Approach To Fair Surface Design Slide 1 Charles Robertson A Signal Processing: Charles Robertson A Signal Processing Approach To Fair Surface Design Slide 2 Charles Robertson Overview Introduction Fairing Subdivision Constraints Conclusions A Signal Processing Approach To Fair Surface Design

  3. A nonlinear optoelectronic filter for electronic signal processing

    E-Print Network [OSTI]

    Ram, Rajeev J.

    A nonlinear optoelectronic filter for electronic signal processing William Loh1,2 , Siva signals into modulated optical waves and back into electrical signals provides the capacity for low-loss radio-frequency (RF) signal transfer over optical fiber. Here, we show that the unique properties

  4. Signal Processing Track Assoc. Prof. idem Erolu Erdem

    E-Print Network [OSTI]

    Ünay, Devrim

    Processing Computer Vision Biomedical Signal / Image Processing Computer Graphics Statistical Signal02.05.2013 1 Signal Processing Track Assoc. Prof. Çidem Erolu Erdem Bahçeehir University Department Digital? Can be processed by digital computers and digital signal processors (flexibility) More robust

  5. Trafficking Coordinate Description of Intracellular Transport Control of Signaling Networks

    E-Print Network [OSTI]

    Saiz, Leonor

    to precisely describe these processes and we apply it explicitly to the TGF-b signal transduction network intracellular signals. These receptors are not just passive signal transducers but are able to process the signals before passing them downstream. In organisms like bacteria, processing is typically done

  6. Tunable Signal Processing in Synthetic MAP Kinase Cascades

    E-Print Network [OSTI]

    Collins, James J.

    Tunable Signal Processing in Synthetic MAP Kinase Cascades Ellen C. O'Shaughnessy,1 Santhosh Palani profiles. This work demonstrates that tunable signal processing is inherent to minimal MAPK modules are ubiquitous, versatile signaling modules found in all eukaryotic cells. They transmit and process signals

  7. Early Warning Signals for Critical Transitions: A Generalized Modeling Approach

    E-Print Network [OSTI]

    rangelands [9], and desertification [10]. Warning signals for impending critical transitions are highly

  8. The evolutionary origins of electric signal complexity Philip K. Stoddard*

    E-Print Network [OSTI]

    Stoddard, Philip

    the evolutionary origins of waveform complexity in electric organ discharges (EODs) of weakly electric fish. I signal to the second simplest signal in the gymnotiform electric fishes. The simplest electric signal is typically viewed as a restraining force on evolution of communication signals, but among the electric fishes

  9. Automatic Musical Genre Classification Of Audio Signals

    E-Print Network [OSTI]

    Tzanetakis, George

    genre classification for digitally available music has been performed manually. Therefore techniquesAutomatic Musical Genre Classification Of Audio Signals George Tzanetakis Computer Science to structure the increasing amounts of music available in digital form on the Web and are important for music

  10. Incredible journey: how do developmental signals travel

    E-Print Network [OSTI]

    Scott, Matthew

    be controlled by the rate of signal production, modification, active transport, trapping along the path not have far to go. Many critical cell fate-determining events occur in small early em- bryos or when organ enormous implications for the larger organs that grow from the primordia. The short-range action of most

  11. Intracellular Signaling by the Unfolded Protein

    E-Print Network [OSTI]

    Mullins, Dyche

    reticulum stress, signal transduction, organelle homeostasis, protein folding, regulated mRNA splicing triggers an exten- sive transcriptional response, which adjusts the ER protein folding capacity according to reestablish homeostasis in the cell's protein folding capacity or--if this cannot be achieved-- commit cells

  12. Aureobasidium pullulans xylanase, gene and signal sequence

    DOE Patents [OSTI]

    Li Xinliang; Ljungdahl, L.G.

    1997-01-07

    A xylanase from Aureobasidium pullulans having a high specific activity is provided, as well as a signal protein for controlling excretion into cell culture medium of proteins to which it is attached. DNA encoding these proteins is also provided. 4 figs.

  13. INCREMENTAL LEARNING OF ULTRASONIC WELD INSPECTION SIGNALS

    E-Print Network [OSTI]

    Polikar, Robi

    the classification performance of the algorithm on ultrasonic signals obtained from nuclear submarine hulls], in tubings and pipings of nuclear power plants [2,3], in artificial heart valves, etc. Currently used ASC applications warrant incremental learning algorithms. For example, in nuclear power plants, data are collected

  14. IEEE SIGNAL PROCESSING LETTERS 1 Optimum Update

    E-Print Network [OSTI]

    Girod, Bernd

    energy in motion-compensated predictive cod- ing. The appropriate motion compensation for the update stepIEEE SIGNAL PROCESSING LETTERS 1 Optimum Update for Motion-Compensated Lifting Bernd Girod, Fellow-compensated lifting, the update step typically reverses the motion vectors from the prediction step. Where motion

  15. Lithospheric Heat Flow and Dynamics! obvious signals!

    E-Print Network [OSTI]

    Sandwell, David T.

    · $d( ) heat = flow scalar subsidence rate constant X #12;heat flow related to subsidence rate (qb ! quLithospheric Heat Flow and Dynamics! ! · obvious signals! - heat flow, depth, and geoid height?! - are transform faults thermal contraction cracks?! #12;global heat budget! 7.5 TW 44 TW 25-15 TW 3-13 TW

  16. Performance Analysis of Isolated Intersection Traffic Signals 

    E-Print Network [OSTI]

    Yin, Kai

    2013-08-01

    This dissertation analyzes two unsolved problems to fulfill the gap in the literature: (1). What is the vehicle delay and intersection capacity considering left-turn traffic at a pre-timed signal? (2). What are the mean and variance of delay...

  17. NOVEL SIGNAL PROCESSING WITH NONLINEAR TRANSMISSION LINES

    SciTech Connect (OSTI)

    D. REAGOR; ET AL

    2000-08-01

    Nonlinear dielectrics offer uniquely strong and tunable nonlinearities that make them attractive for current devices (for example, frequency-agile microwave filters) and for future signal-processing technologies. The goal of this project is to understand pulse propagation on nonlinear coplanar waveguide prototype devices. We have performed time-domain and frequency-domain experimental studies of simple waveguide structures and pursued a theoretical understanding of the propagation of signals on these nonlinear waveguides. To realistically assess the potential applications, we used a time-domain measurement and analysis technique developed during this project to perform a broadband electrodynamics characterization in terms of nonlinear, dispersive, and dissipative effects. We completed a comprehensive study of coplanar waveguides made from high-temperature superconducting thin-film YBa{sub 2}Cu{sub 3}O{sub 7{minus}{delta}} electrodes on nonlinear dielectric single-crystal SrTiO{sub 3} substrates. By using parameters determined from small-signal (linear) transmission characteristics of the waveguides, we develop a model equation that successfully predicts and describes large-signal (nonlinear) behavior.

  18. Civilian GPS Jammer Signal Tracking and Geolocation

    E-Print Network [OSTI]

    Psiaki, Mark L.

    Civilian GPS Jammer Signal Tracking and Geolocation Ryan H. Mitch, Mark L. Psiaki, Brady W. O'Hanlon and filtering, and GNSS in- tegrity. Mark L. Psiaki is a Professor in the Sibley School of Mechanical, and detection. Brady W. O'Hanlon is a Ph.D. candidate in the School of Electrical and Computer Engineering

  19. Advanced signal processing in geophysical remote sensing

    SciTech Connect (OSTI)

    Witten, A.J.; King, W.C.

    1993-06-01

    This paper describes advanced signal processing methods which have improved the capabilities to detect and image the subsurface environment with geophysical remote sensing techniques. Field results are presented showing target detection, subsurface characterizations, and imaging of insitu waste treatment processes, all previously unachievable with such tools as ground penetrating radar, magnetometry and seismic.

  20. Advanced signal processing in geophysical remote sensing

    SciTech Connect (OSTI)

    Witten, A.J. ); King, W.C. . Dept. of Geography and Environmental Engineering)

    1993-01-01

    This paper describes advanced signal processing methods which have improved the capabilities to detect and image the subsurface environment with geophysical remote sensing techniques. Field results are presented showing target detection, subsurface characterizations, and imaging of insitu waste treatment processes, all previously unachievable with such tools as ground penetrating radar, magnetometry and seismic.

  1. Exploring nu signals in dark matter detectors

    E-Print Network [OSTI]

    Roni Harnik; Joachim Kopp; Pedro A. N. Machado

    2015-08-03

    We investigate standard and non-standard solar neutrino signals in direct dark matter detection experiments. It is well known that even without new physics, scattering of solar neutrinos on nuclei or electrons is an irreducible background for direct dark matter searches, once these experiments each the ton scale. Here, we entertain the possibility that neutrino interactions are enhanced by new physics, such as new light force carriers (for instance a "dark photon") or neutrino magnetic moments. We consider models with only the three standard neutrino flavors, as well as scenarios with extra sterile neutrinos. We find that low-energy neutrino--electron and neutrino--nucleus scattering rates can be enhanced by several orders of magnitude, potentially enough to explain the event excesses observed in CoGeNT and CRESST. We also investigate temporal modulation in these neutrino signals, which can arise from geometric effects, oscillation physics, non-standard neutrino energy loss, and direction-dependent detection efficiencies. We emphasize that, in addition to providing potential explanations for existing signals, models featuring new physics in the neutrino sector can also be very relevant to future dark matter searches, where, on the one hand, they can be probed and constrained, but on the other hand, their signatures could also be confused with dark matter signals.

  2. University of Virginia Housing Areas

    E-Print Network [OSTI]

    Huang, Wei

    University of Virginia Housing Areas Copeley Hill Faulkner Copeley III & IV Piedmont Hereford Gardens Lile-Maupin House 2372 Tuttle - Dunnington House 2373 Shannon House 2374 Gibbons House 2375 IvyGardensWay Tree House Drive Grady Avenue University Court Farrish Circle W estview Road Engineer'sWay Gildersleve

  3. 200 area TEDF sample schedule

    SciTech Connect (OSTI)

    Brown, M.J.

    1995-03-22

    This document summarizes the sampling criteria associated with the 200 Area Treatment Effluent Facility (TEDF) that are needed to comply with the requirements of the Washington State Discharge Permit No. WA ST 4502 and good engineering practices at the generator streams that feed into TEDF. In addition, this document Identifies the responsible parties for both sampling and data transference.

  4. Nitric Oxide in Astrocyte-Neuron Signaling

    SciTech Connect (OSTI)

    Nianzhen Li

    2002-06-27

    Astrocytes, a subtype of glial cell, have recently been shown to exhibit Ca{sup 2+} elevations in response to neurotransmitters. A Ca{sup 2+} elevation can propagate to adjacent astrocytes as a Ca{sup 2+} wave, which allows an astrocyte to communicate with its neighbors. Additionally, glutamate can be released from astrocytes via a Ca{sup 2+}-dependent mechanism, thus modulating neuronal activity and synaptic transmission. In this dissertation, the author investigated the roles of another endogenous signal, nitric oxide (NO), in astrocyte-neuron signaling. First the author tested if NO is generated during astrocytic Ca{sup 2+} signaling by imaging NO in purified murine cortical astrocyte cultures. Physiological concentrations of a natural messenger, ATP, caused a Ca{sup 2+}-dependent NO production. To test the roles of NO in astrocytic Ca{sup 2+} signaling, the author applied NO to astrocyte cultures via addition of a NO donor, S-nitrosol-N-acetylpenicillamine (SNAP). NO induced an influx of external Ca{sup 2+}, possibly through store-operated Ca{sup 2+} channels. The NO-induced Ca{sup 2+} signaling is cGMP-independent since 8-Br-cGMP, an agonistic analog of cGMP, did not induce a detectable Ca{sup 2+} change. The consequence of this NO-induced Ca{sup 2+} influx was assessed by simultaneously monitoring of cytosolic and internal store Ca{sup 2+} using fluorescent Ca{sup 2+} indicators x-rhod-1 and mag-fluo-4. Blockage of NO signaling with the NO scavenger PTIO significantly reduced the refilling percentage of internal stores following ATP-induced Ca{sup 2+} release, suggesting that NO modulates internal store refilling. Furthermore, locally photo-release of NO to a single astrocyte led to a Ca{sup 2+} elevation in the stimulated astrocyte and a subsequent Ca{sup 2+} wave to neighbors. Finally, the author tested the role of NO inglutamate-mediated astrocyte-neuron signaling by recording the astrocyte-evoked glutamate-dependent neuronal slow inward current (SIC). Although NO is not required for the SIC,PTIO reduced SIC amplitude, suggesting that NO modulates glutamate release from astrocytes or glutamate receptor sensitivity of neurons.

  5. EA-1177: Salvage/Demolition of 200 West Area, 200 East Area, and 300 Area Steam Plants, Richland, Washington

    Broader source: Energy.gov [DOE]

    This EA evaluates the environmental impacts for the proposal to salvage and demolish the 200 West Area, 200 East Area, and 300 Area steam plants and their associated steam distribution piping...

  6. IEEE SIGNAL PROCESSING LETTERS, VOL. 10, NO. 9, SEPTEMBER 2003 259 Multichannel Signal Detection Based on the

    E-Print Network [OSTI]

    Cohen, Israel

    IEEE SIGNAL PROCESSING LETTERS, VOL. 10, NO. 9, SEPTEMBER 2003 259 Multichannel Signal Detection components based on the transient beam-to-reference ratio. Index Terms--Adaptive signal processing, array, Israel (e-mail: icohen@ee.technion.ac.il). B. Berdugo is with Lamar Signal Processing Ltd., Andrea

  7. IEEE TRANSACTIONS ON SIGNAL PROCESSING, VOL. 51, NO. 7, JULY 2003 1905 Bussgang Blind Deconvolution for Impulsive Signals

    E-Print Network [OSTI]

    Douglas, Scott C.

    IEEE TRANSACTIONS ON SIGNAL PROCESSING, VOL. 51, NO. 7, JULY 2003 1905 Bussgang Blind Deconvolution-Gaussian signals. I. INTRODUCTION BLIND deconvolution is a signal processing task that is important for several to appear in the signal processing literature [3]. This algorithm remains quite popular today, having become

  8. IEEE SIGNAL PROCESSING LETTERS, VOL. 9, NO. 8, AUGUST 2002 233 On a New Blind Signal Extraction Algorithm

    E-Print Network [OSTI]

    Cichocki, Andrzej

    , this is the case in biomedical signal processing applications such as electroencephalographicIEEE SIGNAL PROCESSING LETTERS, VOL. 9, NO. 8, AUGUST 2002 233 On a New Blind Signal Extraction Brain Signal Processing, Brain Science Institute, Riken, Japan, and also with the Department

  9. Understanding the Signal Structure in DVB-T Signals for Passive Radar Detection

    E-Print Network [OSTI]

    Nehorai, Arye

    Audio Broadcast (DAB), Digital Video Broadcast (DVB), FM radio, cellphone base-stations, and various attractive opportunity for radar. Digital television transmitters offer a powerful, well-defined signal

  10. Variable area light reflecting assembly

    DOE Patents [OSTI]

    Howard, T.C.

    1986-12-23

    Device is described for tracking daylight and projecting it into a building. The device tracks the sun and automatically adjusts both the orientation and area of the reflecting surface. The device may be mounted in either a wall or roof of a building. Additionally, multiple devices may be employed in a light shaft in a building, providing daylight to several different floors. The preferred embodiment employs a thin reflective film as the reflecting device. One edge of the reflective film is fixed, and the opposite end is attached to a spring-loaded take-up roller. As the sun moves across the sky, the take-up roller automatically adjusts the angle and surface area of the film. Additionally, louvers may be mounted at the light entrance to the device to reflect incoming daylight in an angle perpendicular to the device to provide maximum reflective capability when daylight enters the device at non-perpendicular angles. 9 figs.

  11. Variable area light reflecting assembly

    DOE Patents [OSTI]

    Howard, Thomas C. (Raleigh, NC)

    1986-01-01

    Device for tracking daylight and projecting it into a building. The device tracks the sun and automatically adjusts both the orientation and area of the reflecting surface. The device may be mounted in either a wall or roof of a building. Additionally, multiple devices may be employed in a light shaft in a building, providing daylight to several different floors. The preferred embodiment employs a thin reflective film as the reflecting device. One edge of the reflective film is fixed, and the opposite end is attached to a spring-loaded take-up roller. As the sun moves across the sky, the take-up roller automatically adjusts the angle and surface area of the film. Additionally, louvers may be mounted at the light entrance to the device to reflect incoming daylight in an angle perpendicular to the device to provide maximum reflective capability when daylight enters the device at non-perpendicular angles.

  12. Signal Analysis by Generalized Hilbert Transforms on the Unit Sphere

    SciTech Connect (OSTI)

    Wietzke, Lennart; Fleischmann, Oliver; Sommer, Gerald [Institute of Computer Science, Chair of Cognitive Systems, Christian-Albrechts-University of Kiel (Germany)

    2008-09-01

    In 1D signal processing local energy and phase can be determined by the analytic signal. Local energy, phase and orientation of 2D signals can be analyzed by the monogenic signal for all i(ntrinsic)1D signals in an rotational invariant way by the generalized Hilbert transform. In order to analyze both i1D and i2D signals in one framework the main idea of this contribution is to lift up 2D signals to the higher dimensional conformal space in which the original signal can be analyzed with more degrees of freedom by the generalized Hilbert transform on the unit sphere. An appropriate embedding of 2D signals on the unit sphere results in an extended feature space spanned by local energy, phase, orientation/direction and curvature. In contrast to classical differential geometry, local curvature can now be determined by the generalized Hilbert transform in monogenic scale space without any derivatives.

  13. Innovation investment area: Technology summary

    SciTech Connect (OSTI)

    Not Available

    1994-03-01

    The mission of Environmental Management`s (EM) Office of Technology Development (OTD) Innovation Investment Area is to identify and provide development support for two types of technologies that are developed to characterize, treat and dispose of DOE waste, and to remediate contaminated sites. They are: technologies that show promise to address specific EM needs, but require proof-of-principle experimentation; and (2) already proven technologies in other fields that require critical path experimentation to demonstrate feasibility for adaptation to specific EM needs. The underlying strategy is to ensure that private industry, other Federal Agencies, universities, and DOE National Laboratories are major participants in developing and deploying new and emerging technologies. To this end, about 125 different new and emerging technologies are being developed through Innovation Investment Area`s (IIA) two program elements: RDDT&E New Initiatives (RD01) and Interagency Agreements (RD02). Both of these activities are intended to foster research and development partnerships so as to introduce innovative technologies into other OTD program elements for expedited evaluation.

  14. Estimating Temperature Distributions In Geothermal Areas Using...

    Open Energy Info (EERE)

    Areas Using A Neuronet Approach Abstract A method is proposed for predicting the distribution of temperatures in geothermal areas using the neuronet approach and, in particular,...

  15. LED Outdoor Area Lighting Fact Sheet

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Outdoor Area Lighting LED technology is rapidly becoming competitive with high-intensity discharge light sources for outdoor area lighting. This document reviews the major design...

  16. Outdoor Area Lighting | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    for outdoor areas. Outdoor Area Lighting (June 2008) More Documents & Publications Philadelphia International Airport Apron Lighting: LED System Performance in a Trial...

  17. Radar transponder apparatus and signal processing technique

    DOE Patents [OSTI]

    Axline, Jr., Robert M. (Albuquerque, NM); Sloan, George R. (Albuquerque, NM); Spalding, Richard E. (Albuquerque, NM)

    1996-01-01

    An active, phase-coded, time-grating transponder and a synthetic-aperture radar (SAR) and signal processor means, in combination, allow the recognition and location of the transponder (tag) in the SAR image and allow communication of information messages from the transponder to the SAR. The SAR is an illuminating radar having special processing modifications in an image-formation processor to receive an echo from a remote transponder, after the transponder receives and retransmits the SAR illuminations, and to enhance the transponder's echo relative to surrounding ground clutter by recognizing special transponder modulations from phase-shifted from the transponder retransmissions. The remote radio-frequency tag also transmits information to the SAR through a single antenna that also serves to receive the SAR illuminations. Unique tag-modulation and SAR signal processing techniques, in combination, allow the detection and precise geographical location of the tag through the reduction of interfering signals from ground clutter, and allow communication of environmental and status information from said tag to be communicated to said SAR.

  18. Radar transponder apparatus and signal processing technique

    DOE Patents [OSTI]

    Axline, R.M. Jr.; Sloan, G.R.; Spalding, R.E.

    1996-01-23

    An active, phase-coded, time-grating transponder and a synthetic-aperture radar (SAR) and signal processor means, in combination, allow the recognition and location of the transponder (tag) in the SAR image and allow communication of information messages from the transponder to the SAR. The SAR is an illuminating radar having special processing modifications in an image-formation processor to receive an echo from a remote transponder, after the transponder receives and retransmits the SAR illuminations, and to enhance the transponder`s echo relative to surrounding ground clutter by recognizing special transponder modulations from phase-shifted from the transponder retransmissions. The remote radio-frequency tag also transmits information to the SAR through a single antenna that also serves to receive the SAR illuminations. Unique tag-modulation and SAR signal processing techniques, in combination, allow the detection and precise geographical location of the tag through the reduction of interfering signals from ground clutter, and allow communication of environmental and status information from said tag to be communicated to said SAR. 4 figs.

  19. Carlsbad Area Office strategic plan

    SciTech Connect (OSTI)

    NONE

    1995-10-01

    This edition of the Carlsbad Area Office Strategic Plan captures the U.S. Department of Energy`s new focus, and supercedes the edition issued previously in 1995. This revision reflects a revised strategy designed to demonstrate compliance with environmental regulations earlier than the previous course of action; and a focus on the selected combination of scientific investigations, engineered alternatives, and waste acceptance criteria for supporting the compliance applications. An overview of operations and historical aspects of the Waste Isolation Pilot Plant near Carlsbad, New Mexico is presented.

  20. Texas Area | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LIST OFAMERICA'SHeavyAgencyTendo New Energy EquipmentSvendborgTecsisArea Jump to:

  1. Geothermal Areas | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource History View New Pages Recent Changes All Special PagesGeotermica JumpAreas Jump

  2. Geothermal resource evaluation of the Yuma area

    SciTech Connect (OSTI)

    Poluianov, E.W.; Mancini, F.P.

    1985-11-29

    This report presents an evaluation of the geothermal potential of the Yuma, Arizona area. A description of the study area and the Salton Trough area is followed by a geothermal analysis of the area, a discussion of the economics of geothermal exploration and exploitation, and recommendations for further testing. It was concluded economic considerations do not favor geothermal development at this time. (ACR)

  3. 6.003 Signals and Systems, Spring 2010

    E-Print Network [OSTI]

    Freeman, Dennis

    6.003 covers the fundamentals of signal and system analysis, focusing on representations of discrete-time and continuous-time signals (singularity functions, complex exponentials and geometrics, Fourier representations, ...

  4. High-performance signal acquisition algorithms for wireless communications receivers 

    E-Print Network [OSTI]

    Shi, Kai

    2006-10-30

    Due to the uncertainties introduced by the propagation channel, and RF and mixed signal circuits imperfections, digital communication receivers require efficient and robust signal acquisition algorithms for timing and ...

  5. Search for Acoustic Signals from Ultra-High Energy Neutrinos...

    Office of Scientific and Technical Information (OSTI)

    Search for Acoustic Signals from Ultra-High Energy Neutrinos in 1500 Km3 of Sea Water Citation Details In-Document Search Title: Search for Acoustic Signals from Ultra-High Energy...

  6. Using System Partition Method to Improve Arterial Signal Coordination 

    E-Print Network [OSTI]

    Zhang, Tao

    2013-06-06

    A heuristic approach to the application of bandwidth-oriented signal coordination is proposed based on a system partition technique. The proposed approach divides a large signalized arterial into subsystems based on clustering results considering...

  7. Presenilin complexes in Arabidopsis: Novel plant cell-signalling components? 

    E-Print Network [OSTI]

    Walker, J. Ross

    2010-01-01

    Intercellular signalling is essential for multicellular organisms to coordinate growth and development, and is mediated by a huge variety of proteins. Some signalling pathways rely on the proteolytic cleavage of membrane ...

  8. EE599: Vector Space Methods for Signal Processing Spring 2013

    E-Print Network [OSTI]

    Leahy, Richard M.

    for Engineers Recommended Texts: T. Moon and W. Sterling, Mathematical Methods and Algorithms for Signal Algebra for Engineering EE 483 ­ Introduction to Digital Signal Processing EE 464 ­ Probability Theory

  9. Probing Embryonic Stem Cell Autocrine and Paracrine Signaling Using Microfluidics

    E-Print Network [OSTI]

    Przybyla, Laralynne

    Although stem cell fate is traditionally manipulated by exogenously altering the cells' extracellular signaling environment, the endogenous autocrine and paracrine signals produced by the cells also contribute to their two ...

  10. Chikungunya virus capsid protein contains nuclear import and export signals

    E-Print Network [OSTI]

    Thomas, Saijo; Rai, Jagdish; John, Lijo; Schaefer, Stephan; Pützer, Brigitte M; Herchenröder, Ottmar

    2013-01-01

    CRM1-mediated nuclear export of proteins and drug resistanceS: Leucine-rich nuclear-export signals: born to be weak.A supraphysiological nuclear export signal is required for

  11. Intrinsic optical signals in neural tissues: measurements, mechanisms, and applications

    E-Print Network [OSTI]

    Fang-Yen, Christopher

    Intrinsic optical signals in neural tissues: measurements, mechanisms, and applications Christopher optical signals, including changes in absorption, scattering, birefringence, refractive index, and nerve in scattering, birefringence (2), and optical activity (3) during the action potential in numerous invertebrate

  12. Agilent E8267D PSG Vector Signal Generator

    E-Print Network [OSTI]

    Anlage, Steven

    Agilent E8267D PSG Vector Signal Generator Data Sheet The Agilent E8267D is a fully synthesized signal generator with high output power, low phase noise, and I/Q modulation capability. Specifications . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15 Internal pulse generator

  13. Multi-signal gesture recognition using body and hand poses

    E-Print Network [OSTI]

    Song, Yale

    2010-01-01

    We present a vision-based multi-signal gesture recognition system that integrates information from body and hand poses. Unlike previous approaches to gesture recognition, which concentrated mainly on making it a signal ...

  14. Optimization of Signal Processing Software for Control System Implementation

    E-Print Network [OSTI]

    Bhattacharyya, Shuvra S.

    Optimization of Signal Processing Software for Control System Implementation Shuvra S for design and optimization of signal processing software are important in achieving efficient controller that techniques developed for optimizing DSP software apply equally well to controller software. However

  15. Phase Retrieval of Sparse Signals from Magnitude Information 

    E-Print Network [OSTI]

    Apaydin, Meltem

    2014-07-11

    The ability to recover the phase information of a signal of interest from a measurement process plays an important role in many practical applications. When only the Fourier transform magnitude of the signal is recorded, recovering the complete...

  16. Scanning microwave-induced thermoacoustic tomography: Signal, resolution, and contrast

    E-Print Network [OSTI]

    Wang, Lihong

    Scanning microwave-induced thermoacoustic tomography: Signal, resolution, and contrast Geng Ku Scanning thermoacoustic tomography was explored in the microwave region of the electromagnetic spectrum ultrasonic transducer detected the time-resolved thermoacoustic signals. Based on the microwave

  17. DATA REPROCESSING IN SIGNAL UNDERSTANDING SYSTEMS A Dissertation Presented

    E-Print Network [OSTI]

    Massachusetts at Amherst, University of

    DATA REPROCESSING IN SIGNAL UNDERSTANDING SYSTEMS A Dissertation Presented by FRANK I. KLASSNER Copyright by Frank I. Klassner, III 1996 All Rights Reserved #12;DATA REPROCESSING IN SIGNAL UNDERSTANDING

  18. Method And Aparatus For Improving Resolution In Spectrometers Processing Output Steps From Non-Ideal Signal Sources

    DOE Patents [OSTI]

    Warburton, William K. (1300 Mills St., Menlo Park, CA 94025); Momayezi, Michael (San Francisco, CA)

    2003-07-01

    A method and apparatus for processing step-like output signals generated by non-ideal, nominally single-pole ("N-1P") devices responding to possibly time-varying, pulse-like input signals of finite duration, wherein the goal is to recover the integrated areas of the input signals. Particular applications include processing step-like signals generated by detector systems in response to absorbed radiation or particles and, more particularly, to digitally processing such step-like signals in high resolution, high rate gamma ray (.gamma.-ray) spectrometers with resistive feedback preamplifiers connected to large volume germanium detectors. Superconducting bolometers can be similarly treated. The method comprises attaching a set of one or more filters to the device's (e.g., preamplifier's) output, capturing a correlated multiple output sample from the filter set in response to a detected event, and forming a weighted sum of the sample values to accurately recover the total area (e.g., charge) of the detected event.

  19. Multidimensional signal modulation and/or demodulation for data communications

    DOE Patents [OSTI]

    Smith, Stephen F. (London, TN); Dress, William B. (Camas, WA)

    2008-03-04

    Systems and methods are described for multidimensional signal modulation and/or demodulation for data communications. A method includes modulating a carrier signal in a first domain selected from the group consisting of phase, frequency, amplitude, polarization and spread; modulating the carrier signal in a second domain selected from the group consisting of phase, frequency, amplitude, polarization and spread; and modulating the carrier signal in a third domain selected from the group consisting of phase, frequency, amplitude, polarization and spread.

  20. Empirical Evaluation of a New Method for Calculating Signal to...

    Office of Scientific and Technical Information (OSTI)

    METHODS; DATA ANALYSIS; DNA; EVALUATION; GENES; HYBRIDIZATION; OLIGONUCLEOTIDES; PROBES; SIGNAL-TO-NOISE RATIO; TARGETS Comparative Genomics, Microarrays, Transcriptomics...

  1. Separating Signal from Noise in Global Warming Bert W. Rust

    E-Print Network [OSTI]

    Rust, Bert W.

    Separating Signal from Noise in Global Warming Bert W. Rust Reprinted from the CD Rust, B. W. (2003) "Separating Signal from Noise in Global Warming," Computing Science and Statistics, 35, 263-277. ­ or ­ Rust, B. W. (2003) "Separating Signal from Noise in Global Warming," Computing Science and Statistics, 35

  2. The global warming signal is the average of

    E-Print Network [OSTI]

    Jones, Peter JS

    The global warming signal is the average of years 70-80 in the increasing CO2 run minus the average represent significant uncertainty in the global warming signal (Fig. 5). The differences at high latitudes, uncertainty in the isopycnal diffusivity causes uncertainty of up to 50% in the global warming signal

  3. Picasso: Full Duplex Signal Shaping to Exploit Fragmented Spectrum

    E-Print Network [OSTI]

    Pratt, Vaughan

    .00. Legacy WiFi Client 1 ZigBee 1 Signal Shaping AP ZigBee 2 ZigBee 3 Legacy WiFi Client 2 Signal ShapingMHz) Figure 1: 3 ZigBee Interferers shown in red. Signal Shaping AP can simultaneously service

  4. Science Signaling: Research, Teach, and Discover with the Weekly Journal

    E-Print Network [OSTI]

    Napp, Nils

    Science Signaling: Research, Teach, and Discover with the Weekly Journal Devoted to Cellular Signal Journal January 2008: Change name from Science's STKE to Science Signaling September 2008: First issue compilation #12;Journal Content Editorial Guides Editorials Editors' Choice Research Articles and Resources

  5. RECORDING ELECTROMYOGRAPHIC SIGNALS IN A CLASSICAL CONDITIONING EXPERIMENT

    E-Print Network [OSTI]

    Lübeck, Universität zu

    RECORDING ELECTROMYOGRAPHIC SIGNALS IN A CLASSICAL CONDITIONING EXPERIMENT S. Jannasch 1 , R.Jannasch@isip.uni-luebeck.de Abstract We describe in the following a measurement system for electromyographic signals created for an ex painful stimuli. We are recording seven electromyographic signals from muscles close to the body surface

  6. Optimal Training Signals for MIMO OFDM Channel Estimation

    E-Print Network [OSTI]

    Minn, Hlaing

    Optimal Training Signals for MIMO OFDM Channel Estimation Hlaing Minn*, Member, IEEE and Naofal Al.minn@utdallas.edu, aldhahir@utdallas.edu Abstract--This paper presents general classes of optimal train- ing signals transform are used to derive the optimal training signals which minimize the channel estimation mean square

  7. Signal processing underlying extrinsic control of stem cell fate

    E-Print Network [OSTI]

    Zandstra, Peter W.

    Signal processing underlying extrinsic control of stem cell fate Ryan E. Davey and Peter W to control stem cell fate. Keywords stem cells, systems biology, signaling networks, extrinsic control Curr and the discovery that both bone mor- phogenic protein and Wnt signaling also promote self- renewal in mouse ES

  8. Assessing Stability for Adaptive Filtering Algorithms in Signal Processing

    E-Print Network [OSTI]

    Le Borne, Richard C.

    1 Assessing Stability for Adaptive Filtering Algorithms in Signal Processing Richard C. Le Borne1 the 1940's. However, the struc- ture of algorithms in signal processing prevent the direct application techniques for signal processing al- gorithms that are currently in the literature. In addition, to provide

  9. C. Project Description Transient Signal Processing for Realistic Imagery

    E-Print Network [OSTI]

    Reif, Rafael

    C. Project Description Transient Signal Processing for Realistic Imagery Capturing and reproducing Fourier analysis. As the geometric and visual complexity of 3D scenes continues to grow, a solid signal-processing acquisition. As illustrated in Fig. 1, our goal is to derive a signal-processing framework for all mechanisms

  10. Lab 4--Signal Processing III: Diodes PHYS 309 Name

    E-Print Network [OSTI]

    Herman, Rhett

    Lab 4--Signal Processing III: Diodes PHYS 309 Name: A. Introduction Diodes are essentially one it into . B. Basic circuits and signal processing Build the circuit shown below. Note the ground! Use a = 100 is set on "dc." Lab 4-1 #12;Lab 4--Signal Processing III: Diodes PHYS 309 Name: Now add a diode to your

  11. THE DESIGN AND DEVELOPMENT OF AN UNDERGRADUATE SIGNAL PROCESSING LABORATORY

    E-Print Network [OSTI]

    Liang, Huizhi "Elly"

    THE DESIGN AND DEVELOPMENT OF AN UNDERGRADUATE SIGNAL PROCESSING LABORATORY S.Sridharan V.Ghandran M. Dawson Signal Processing Research Centre School of Electrical and Electronic Systems Engineering to the teach- ing of signal processing techniques. The motivation for the development of this laboratory

  12. Adaptive Filters and Multichannel Signal Processing A.N. Venetsanopoulos

    E-Print Network [OSTI]

    Plataniotis, Konstantinos N.

    Adaptive Filters and Multichannel Signal Processing A.N. Venetsanopoulos Department of ECE in developing efficient and cost effective processing techniques for multichannel signals. In recent years, significantadvanceshave been made in the develop- ment of multichannel signal processing techniques. Such techniques

  13. IEEE SIGNAL PROCESSING MAGAZINE Sotirios A. Tsaftaris, Aggelos K. Katsaggelos,

    E-Print Network [OSTI]

    Tsaftaris, Sotirios

    IEEE SIGNAL PROCESSING MAGAZINE Sotirios A. Tsaftaris, Aggelos K. Katsaggelos, Thrasyvoulos N. Pappas, and Eleftherios T. Papoutsakis How Can DNA Computing Be Applied to Digital Signal Processing computing from a signal processing perspective. To assist in our presentation we also provided a very short

  14. Department of Electrical & Computer Engineering SIGNAL PROCESSING FOR COGNITIVE RADIOS

    E-Print Network [OSTI]

    New Mexico, University of

    Department of Electrical & Computer Engineering SIGNAL PROCESSING FOR COGNITIVE RADIOS (A Fall 2015 of signal processing and machine learning in achieving self-awareness, subsequent intelligent decision-making and radio reconfiguration cannot be over-emphasized. In fact, one may argue that it is signal processing

  15. PIECEWISE CONVEX ESTIMATION FOR SIGNAL PROCESSING Kurt S. Riedel

    E-Print Network [OSTI]

    PIECEWISE CONVEX ESTIMATION FOR SIGNAL PROCESSING Kurt S. Riedel Courant Institute, New York of the unknown function. We outline how piecewise convex fitting may be applied to signal recov­ ery neighborhood about each first­stage change point. 1. SIGNAL RECOVERY Our basic tenet is that ``Naturally

  16. Wavelet-Based Transformations for Nonlinear Signal Processing

    E-Print Network [OSTI]

    Nowak, Robert

    Wavelet-Based Transformations for Nonlinear Signal Processing Robert D. Nowak Department.dsp.rice.edu Submitted to IEEE Transactions on Signal Processing, February 1997 Revised June 1998 EDICS Numbers: SP-2 in the analysis and processing of real-world signals. In this paper, we introduce two new structures for nonlinear

  17. Assignment 3 Objective: Signal processing through simple time domain operations.

    E-Print Network [OSTI]

    Naik, Naren

    Assignment 3 Objective: Signal processing through simple time domain operations. Part 1 : Q1. Play millisecond and alpha = 0.2 . Compare your output with signal generated by an audio processing software. Audacity Software: It is a open source software to do basic signal processing operations over audio

  18. PIECEWISE CONVEX ESTIMATION FOR SIGNAL PROCESSING Kurt S. Riedel

    E-Print Network [OSTI]

    PIECEWISE CONVEX ESTIMATION FOR SIGNAL PROCESSING Kurt S. Riedel Courant Institute, New York of the unknown function. We outline how piecewise convex #12;tting may be applied to signal recov- ery sign in a small neighborhood about each #12;rst-stage change point. 1. SIGNAL RECOVERY Our basic tenet

  19. RTL Hardware Design Chapter 4 1 Concurrent Signal Assignment

    E-Print Network [OSTI]

    Chu, Pong P.

    1 RTL Hardware Design Chapter 4 1 Concurrent Signal Assignment Statements RTL Hardware Design signal assignment RTL Hardware Design Chapter 4 3 1. Combinational vs. sequential circuit · Combinational · Sequential circuit to be discussed later RTL Hardware Design Chapter 4 4 2. Simple signal assignment

  20. Hindawi Publishing Corporation EURASIP Journal on Advances in Signal Processing

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    and Mohammad B. Shamsollahi1 1 Biomedical Signal and Image Processing Laboratory (BiSIPL), School of ElectricalHindawi Publishing Corporation EURASIP Journal on Advances in Signal Processing Volume 2007 pregnancies. The applicability of the model for the evaluation of signal processing algorithms is illustrated

  1. BLIND EXTRACTION OF SOURCE SIGNALS WITH SPECIFIED STOCHASTIC FEATURES

    E-Print Network [OSTI]

    Vialatte, François

    interestinmanyapplicationssuchas biomedical signal processing (ECG or EEG), speech recog- nition (cocktail party problem), imageBLIND EXTRACTION OF SOURCE SIGNALS WITH SPECIFIED STOCHASTIC FEATURES Ruck THAWONMAS 3 and Andrzej a neural-network approach which allows se- quential extraction of source signals from a linear mixture

  2. BLIND EXTRACTION OF SOURCE SIGNALS WITH SPECIFIED STOCHASTIC FEATURES

    E-Print Network [OSTI]

    Thawonmas, Ruck

    is a problem of interest in many applications such as biomedical signal processing (ECG or EEG), speech recogBLIND EXTRACTION OF SOURCE SIGNALS WITH SPECIFIED STOCHASTIC FEATURES Ruck THAWONMAS 3 and Andrzej a neural­network approach which allows se­ quential extraction of source signals from a linear mixture

  3. Introduction The structure and function of animal communication signals, like

    E-Print Network [OSTI]

    Stoddard, Philip

    many other socially relevant behaviors. Across the suite of signal forms, the amount of energy; Rutowski et al., 2010), should require the least energy investment on the part of the signaler, because the sun provides the energy in the signal, although pigment accumulation or growth of diffracting

  4. Identification of cell density signal molecule

    DOE Patents [OSTI]

    Schwarz, R.I.

    1998-04-21

    Disclosed herein is a novel proteinaceous cell density signal molecule (CDS) between 25 and 35 kD, which is secreted by fibroblastic primary avian tendon cells in culture, and causes the cells to self-regulate their proliferation and the expression of differentiated function. It effects an increase of procollagen production in avian tendon cell cultures of ten fold while proliferation rates are decreased. CDS, and the antibodies which recognize them, are important for the development of diagnostics and treatments for injuries and diseases involving connective tissues, particularly tendon. Also disclosed are methods of production and use. 2 figs.

  5. Identification of cell density signal molecule

    DOE Patents [OSTI]

    Schwarz, Richard I. (Oakland, CA)

    1998-01-01

    Disclosed herein is a novel proteinaceous cell density signal molecule (CDS) between 25 and 35 kD, which is secreted by fibroblastic primary avian tendon cells in culture, and causes the cells to self-regulate their proliferation and the expression of differentiated function. It effects an increase of procollagen production in avian tendon cell cultures of ten fold while proliferation rates are decreased. CDS, and the antibodies which recognize them, are important for the development of diagnostics and treatments for injuries and diseases involving connective tissues, particularly tendon. Also disclosed are methods of production and use.

  6. Signal Speed in Nanomagnetic Logic Chains

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effect Photovoltaics -7541 UnlimitedShift EndShutdown 2013Signal

  7. Signal Speed in Nanomagnetic Logic Chains

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservation ofAlbuquerque|Sensitive Species3 Outlook for Gulf ofSifting ThroughSignal Speed

  8. Signal Speed in Nanomagnetic Logic Chains

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservation ofAlbuquerque|Sensitive Species3 Outlook for Gulf ofSifting ThroughSignal

  9. A Methodology for Obtaining Signal Coordination within A Distributed Real-Time Network Signal Control System with Transit Priority

    E-Print Network [OSTI]

    Hellinga, Bruce

    with downstream signal timings, downstream queues, downstream transit activities, upstream signal timings are instructed to consider the timing plans of adjacent controllers, the vehicle departures from upstream adjacent intersections, and the projected vehicle arrivals at downstream adjacent intersections. This paper

  10. Sealed head access area enclosure

    DOE Patents [OSTI]

    Golden, Martin P. (Trafford, PA); Govi, Aldo R. (Greensburg, PA)

    1978-01-01

    A liquid-metal-cooled fast breeder power reactor is provided with a sealed head access area enclosure disposed above the reactor vessel head consisting of a plurality of prefabricated structural panels including a center panel removably sealed into position with inflatable seals, and outer panels sealed into position with semipermanent sealant joints. The sealant joints are located in the joint between the edge of the panels and the reactor containment structure and include from bottom to top an inverted U-shaped strip, a lower layer of a room temperature vulcanizing material, a separator strip defining a test space therewithin, and an upper layer of a room temperature vulcanizing material. The test space is tapped by a normally plugged passage extending to the top of the enclosure for testing the seal or introducing a buffer gas thereinto.

  11. Large Area Vacuum Deposited Coatings

    SciTech Connect (OSTI)

    Martin, Peter M.

    2003-04-30

    It's easy to make the myriad of types of large area and decorative coatings for granted. We probably don't even think about most of them; the low-e and heat mirror coatings on our windows and car windows, the mirrors in displays, antireflection coatings on windows and displays, protective coatings on aircraft windows, heater coatings on windshields and aircraft windows, solar reflectors, thin film solar cells, telescope mirrors, Hubble mirrors, transparent conductive coatings, and the list goes on. All these products require large deposition systems and chambers. Also, don't forget that large batches of small substrates or parts are coated in large chambers. In order to be cost effective hundreds of ophthalmic lenses, automobile reflectors, display screens, lamp reflectors, cell phone windows, laser reflectors, DWDM filters, are coated in batches.

  12. W.A. SERDIJN: "A CLASSIFICATION OF ELECTRONIC SIGNAL-PROCESSING FUNCTIONS" 1 A classification of electronic signal-processing

    E-Print Network [OSTI]

    Serdijn, Wouter A.

    W.A. SERDIJN: "A CLASSIFICATION OF ELECTRONIC SIGNAL-PROCESSING FUNCTIONS" 1 A classification classification of electronic signal-processing functions is proposed. Electronic signals can either be 1 sources, wave- shaping circuits, digital logic functions, digital memories, power supplies, and converters

  13. IEEE TRANSACTIONS ON SIGNAL PROCESSING, VOL. 57, NO. 3, MARCH 2009 977 High-Rate Interpolation of Random Signals

    E-Print Network [OSTI]

    Eldar, Yonina

    IEEE TRANSACTIONS ON SIGNAL PROCESSING, VOL. 57, NO. 3, MARCH 2009 977 High-Rate Interpolation of Random Signals From Nonideal Samples Tomer Michaeli and Yonina C. Eldar, Senior Member, IEEE Abstract--We address the problem of reconstructing a random signal from samples of its filtered version using a given

  14. IEEE SIGNAL PROCESSING LETTERS, VOL. 7, NO. 7, JULY 2000 205 Nonlinear Test Statistic to Improve Signal Detection

    E-Print Network [OSTI]

    Chapeau-Blondeau, François

    IEEE SIGNAL PROCESSING LETTERS, VOL. 7, NO. 7, JULY 2000 205 Nonlinear Test Statistic to Improve in signal processing because they usually allow a thorough theoretical treatment and can often be proved Signal Detection in Non-Gaussian Noise François Chapeau-Blondeau, Member, IEEE Abstract--We compare two

  15. 104 IEEE SIGNAL PROCESSING LETTERS, VOL. 10, NO. 4, APRIL 2003 Extension of the Signal Subspace Speech

    E-Print Network [OSTI]

    Ephraim, Yariv

    104 IEEE SIGNAL PROCESSING LETTERS, VOL. 10, NO. 4, APRIL 2003 Extension of the Signal Subspace, Fellow, IEEE Abstract--The signal subspace approach for speech enhance- ment is extended to colored-noise processes. Explicit forms for the linear time-domain- and spectral-domain-constrained estimators

  16. Transient Pulse Formation in Jasmonate Signaling Pathway

    E-Print Network [OSTI]

    Subhasis Banerjee; Indrani Bose

    2010-03-03

    The jasmonate (JA) signaling pathway in plants is activated as defense response to a number of stresses like attacks by pests or pathogens and wounding by animals. Some recent experiments provide significant new knowledge on the molecular detail and connectivity of the pathway. The pathway has two major components in the form of feedback loops, one negative and the other positive. We construct a minimal mathematical model, incorporating the feedback loops, to study the dynamics of the JA signaling pathway. The model exhibits transient gene expression activity in the form of JA pulses in agreement with experimental observations. The dependence of the pulse amplitude, duration and peak time on the key parameters of the model is determined computationally. The deterministic and stochastic aspects of the pathway dynamics are investigated using both the full mathematical model as well as a reduced version of it. We also compare the mechanism of pulse formation with the known mechanisms of pulse generation in some bacterial and viral systems.

  17. Nonlinear Biochemical Signal Processing via Noise Propagation

    E-Print Network [OSTI]

    Kyung Hyuk Kim; Hong Qian; Herbert M. Sauro

    2013-09-10

    Single-cell studies often show significant phenotypic variability due to the stochastic nature of intra-cellular biochemical reactions. When the numbers of molecules, e.g., transcription factors and regulatory enzymes, are in low abundance, fluctuations in biochemical activities become significant and such "noise" can propagate through regulatory cascades in terms of biochemical reaction networks. Here we develop an intuitive, yet fully quantitative method for analyzing how noise affects cellular phenotypes based on identifying a system's nonlinearities and noise propagations. We observe that such noise can simultaneously enhance sensitivities in one behavioral region while reducing sensitivities in another. Employing this novel phenomenon we designed three biochemical signal processing modules: (a) A gene regulatory network that acts as a concentration detector with both enhanced amplitude and sensitivity. (b) A non-cooperative positive feedback system, with a graded dose-response in the deterministic case, that serves as a bistable switch due to noise-induced bimodality. (c) A noise-induced linear amplifier for gene regulation that requires no feedback. The methods developed in the present work allow one to understand and engineer nonlinear biochemical signal processors based on fluctuation-induced phenotypes.

  18. A Signal Processing Model of Quantum Mechanics

    E-Print Network [OSTI]

    Chris Thron; Johnny Watts

    2012-05-08

    This paper develops a deterministic model of quantum mechanics as an accumulation-and-threshold process. The model arises from an analogy with signal processing in wireless communications. Complex wavefunctions are interpreted as expressing the amplitude and phase information of a modulated carrier wave. Particle transmission events are modeled as the outcome of a process of signal accumulation that occurs in an extra (non-spacetime) dimension. Besides giving a natural interpretation of the wavefunction and the Born rule, the model accommodates the collapse of the wave packet and other quantum paradoxes such as EPR and the Ahanorov-Bohm effect. The model also gives a new perspective on the 'relational' nature of quantum mechanics: that is, whether the wave function of a physical system is "real" or simply reflects the observer's partial knowledge of the system. We simulate the model for a 2-slit experiment, and indicate possible deviations of the model's predictions from conventional quantum mechanics. We also indicate how the theory may be extended to a field theory.

  19. Multichannel heterodyning for wideband interferometry, correlation and signal processing

    DOE Patents [OSTI]

    Erskine, David J. (Oakland, CA)

    1999-01-01

    A method of signal processing a high bandwidth signal by coherently subdividing it into many narrow bandwidth channels which are individually processed at lower frequencies in a parallel manner. Autocorrelation and correlations can be performed using reference frequencies which may drift slowly with time, reducing cost of device. Coordinated adjustment of channel phases alters temporal and spectral behavior of net signal process more precisely than a channel used individually. This is a method of implementing precision long coherent delays, interferometers, and filters for high bandwidth optical or microwave signals using low bandwidth electronics. High bandwidth signals can be recorded, mathematically manipulated, and synthesized.

  20. Multichannel heterodyning for wideband interferometry, correlation and signal processing

    DOE Patents [OSTI]

    Erskine, D.J.

    1999-08-24

    A method is disclosed of signal processing a high bandwidth signal by coherently subdividing it into many narrow bandwidth channels which are individually processed at lower frequencies in a parallel manner. Autocorrelation and correlations can be performed using reference frequencies which may drift slowly with time, reducing cost of device. Coordinated adjustment of channel phases alters temporal and spectral behavior of net signal process more precisely than a channel used individually. This is a method of implementing precision long coherent delays, interferometers, and filters for high bandwidth optical or microwave signals using low bandwidth electronics. High bandwidth signals can be recorded, mathematically manipulated, and synthesized. 50 figs.

  1. Signal Processing 87 (2007) 28592860 Guest editorial

    E-Print Network [OSTI]

    Pinotti, Maria Cristina

    2007-01-01

    in wireless sensor networks The rapid progress of wireless communication and embedded micro-sensing MEMS technologies has made wireless sensor networks possible. A wireless sensor network normally comes a large area with many inexpensive, tiny sensor nodes, each capable of collecting, processing, and storing environmental

  2. Fabrication of large area Si cylindric drift detectors

    SciTech Connect (OSTI)

    Chen, W.; Kraner, H.W.; Li, Z.; Rehak, P. [Brookhaven National Lab., Upton, NY (United States); Hess, F. [Heidelberg Univ. (Germany). Dept. of Physics

    1993-04-01

    Advanced Si drift detector, a large area cylindrical drift detector (CDD), processing steps, with the exception of the ion implantation, were carried out in the BNL class 100 cleanroom. The double-side planer process technique was developed for the fabrication of CDD. Important improvements of the double-side planer process in this fabrication are the introduction of Al implantation protection mask and the remaining of a 1000 Angstroms oxide layer in the p-window during the implantation. Another important design of the CDD is the structure called ``river,`` which ,allows the current generated on Si-SiO{sub 2} interface to ``flow`` into the guard anode, and thus can minimize the leakage current at the signed anode. The test result showed that most of the signal anodes have the leakage current about 0.3 nA/cm{sup 2} for the best detector.

  3. Diversity combining in laser Doppler vibrometry for improved signal reliability

    SciTech Connect (OSTI)

    Dräbenstedt, Alexander

    2014-05-27

    Because of the speckle nature of the light reflected from rough surfaces the signal quality of a vibrometer suffers from varying signal power. Deep signal outages manifest themselves as noise bursts and spikes in the demodulated velocity signal. Here we show that the signal quality of a single point vibrometer can be substantially improved by diversity reception. This concept is widely used in RF communication and can be transferred into optical interferometry. When two statistically independent measurement channels are available which measure the same motion on the same spot, the probability for both channels to see a signal drop-out at the same time is very low. We built a prototype instrument that uses polarization diversity to constitute two independent reception channels that are separately demodulated into velocity signals. Send and receive beams go through different parts of the aperture so that the beams can be spatially separated. The two velocity channels are mixed into one more reliable signal by a PC program in real time with the help of the signal power information. An algorithm has been developed that ensures a mixing of two or more channels with minimum resulting variance. The combination algorithm delivers also an equivalent signal power for the combined signal. The combined signal lacks the vast majority of spikes that are present in the raw signals and it extracts the true vibration information present in both channels. A statistical analysis shows that the probability for deep signal outages is largely decreased. A 60 fold improvement can be shown. The reduction of spikes and noise bursts reduces the noise in the spectral analysis of vibrations too. Over certain frequency bands a reduction of the noise density by a factor above 10 can be shown.

  4. Two-dimensional spatio-temporal signal processing for dispersion compensation in time-stretched ADC

    E-Print Network [OSTI]

    Tarighat, Alireza; Gupta, Shalabh; Sayed, Ali H.; Jalali, Bahrain

    2007-01-01

    SPATIO-TEMPORAL SIGNAL PROCESSING [4] P. W. Juodawlkis, J.are in communication theory and signal processing, includingon Acoustics, Speech, and Signal Processing, 2008. Bahram

  5. Tunable electro-optic devices for fiber optical RF signal processing

    E-Print Network [OSTI]

    Chen, Jianxiao

    2006-01-01

    for the coherent signal processing and by introducing afiber delay-line signal processing, IEEE Trans. MicrowaveFiber-optic lattice signal processing”, Proc. IEEE, Vol. 72,

  6. Non-Maximally Decimated Filter Bank and Its Applications in Wideband Signal Processing /

    E-Print Network [OSTI]

    Chen, Xiaofei

    2014-01-01

    Diagram of Primary Signal Processing in a Typical DigitalW. Schafer, Digital Signal Processing. Prentice-Hall, [14]Manolakis, Digital Signal Processing. Pearson Prentice Hall,

  7. Game Preserves and Closed Areas (Montana)

    Broader source: Energy.gov [DOE]

    Game preserves and closed areas exist within the state of Montana for the protection of all the game animals and birds. Construction and development is limited in these areas. Currently, only three...

  8. MARINE PROTECTED AREAS Fisheries Science and Management

    E-Print Network [OSTI]

    Limburg, Karin E.

    1 MARINE PROTECTED AREAS Fisheries Science and Management Rita OLIVEIRA MONTEIRO Cover photo of a mpa (coast and underwater) MARINE PROTECTED AREAS OBJECTIVES FOR TODAY: · definitions · historical · habitat degradation · invasive species · harmful algal blooms · marine epidemics · mass mortalities

  9. Center symmetry and area laws

    E-Print Network [OSTI]

    Thomas D. Cohen

    2014-07-15

    SU($N_c$) gauge theories containing matter fields may be invariant under transformations of some subgroup of the $\\mathbb{Z}_{N_c}$ center; the maximum such subgroup is $\\mathbb{Z}_{p}$, with $p$ depending on $N_c$ and the representations of the various matter fields in the theory. Confining SU($N_c$) gauge theories in either 3+1 or 2+1 space-time dimensions and with matter fields in any representation have string tensions for representation $R$ given by $\\sigma_R =\\sigma_f \\, \\, \\frac{p_R (p-p_R) \\, \\, g\\left (p_R (p-p_R) \\right )}{(p-1) \\, \\, g(p -1 )} $ with $p_R={n_R \\, \\rm mod}(p)$, where $\\sigma_f $ is the string tension for the fundamental representation, $g$ is a positive finite function and $n_R$ is the n-ality of $R$. This implies that a necessary condition for a theory in this class to have an area law is invariance of the theory under a nontrivial subgroup of the center. Significantly, these results depend on $p$ regardless of the value of $N_c$.

  10. Geothermal Literature Review At International Geothermal Area...

    Open Energy Info (EERE)

    Geothermal Literature Review At International Geothermal Area, Italy (Ranalli & Rybach, 2005) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity:...

  11. Geothermal Literature Review At International Geothermal Area...

    Open Energy Info (EERE)

    Geothermal Literature Review At International Geothermal Area, Iceland (Ranalli & Rybach, 2005) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity:...

  12. Considering LEDs for Street and Area Lighting

    Broader source: Energy.gov [DOE]

    View Jim Brodrick's keynote video from the September 2009 IES Street and Area Lighting Conference in Philadelphia.

  13. Large Area Silicon Tracking Detectors with Fast Signal Readout for the Large Hadron Collider (LHC) at CERN

    E-Print Network [OSTI]

    Köstner, S

    2005-01-01

    The Standard Model of elementary particles, which is summarized briefly in the second chapter, incorporates a number of successful theories to explain the nature and consistency of matter. However not all building blocks of this model could yet be tested by experiment. To confirm existing theories and to improve nowadays understanding of matter a new machine is currently being built at CERN, the Large Hadron Collider (LHC), described in the third chapter. LHC is a proton-proton collider which will reach unprecedented luminosities and center of mass energies. Five experiments are attached to it to give answers to questions like the existence of the Higgs meson, which allows to explain the mass content of matter, and the origin of CP-violation, which plays an important role in the baryogenesis of the universe. Supersymmetric theories, proposing a bosonic superpartner for each fermion and vice versa, will be tested. By colliding heavy ions, high energy and particle densities can be achieved and probed. This stat...

  14. New Academic Subject Area Information Sheet To be completed for new Academic Subject Areas only

    E-Print Network [OSTI]

    Fleming, Andrew J.

    New Academic Subject Area Information Sheet To be completed for new Academic Subject Areas only New Academic Subject Area:____________________ (Maximum 4 Letters eg: INFO; except for ELFSC: Maximum of 6

  15. Part-of-Speech tagging Dividing area

    E-Print Network [OSTI]

    Yanai, Keiji

    Part-of-Speech tagging Dividing area -Grids by 1 degree lat & lng Evaluation area weight Date Area (lat, lng) snow 9/1/2012 38~39, -78~-77 sunset 13/1/2012 47~48,-123~-122 Grammy 12/2/2012 34

  16. Lake Charles Urbanized Area MTP 2034 

    E-Print Network [OSTI]

    Lake Charles Urbanized Area Metropolitan Planning Organization

    2009-08-04

    CONSTRAINED AND UNCONSTRAINED PLAN PROJECTS . C-1 ? Lake Charles Urbanized Area MTP 2034 ? Page v Alliance Transportation Group, Inc. Adopted August 4, 2009 Table of Tables Table 2-1 Stakeholders Present... ......................................................................................................... 3-1 ? Lake Charles Urbanized Area MTP 2034 ? Page iii Alliance Transportation Group, Inc. Adopted August 4, 2009 LAKE CHARLES URBANIZED AREA TRAVEL DEMAND MODEL .............................................................. 3-2 SOCIOECONOMIC...

  17. SWOPE PARK INDUSTRIAL AREA Kansas City, Missouri

    E-Print Network [OSTI]

    US Army Corps of Engineers

    SWOPE PARK INDUSTRIAL AREA Kansas City, Missouri MODIFICATION REQUEST Modification to support this request. PROJECT PURPOSE Swope Park Industrial Area is located in the south-central portion safe ingress/egress during flooding. The Swope Park Industrial Area has limited access, one

  18. Signal enhancement using a switchable magnetic trap

    DOE Patents [OSTI]

    Beer, Neil Reginald (Pleasanton, CA)

    2012-05-29

    A system for analyzing a sample including providing a microchannel flow channel; associating the sample with magnetic nanoparticles or magnetic polystyrene-coated beads; moving the sample with said magnetic nanoparticles or magnetic polystyrene-coated beads in the microchannel flow channel; holding the sample with the magnetic nanoparticles or magnetic polystyrene-coated beads in a magnetic trap in the microchannel flow channel; and analyzing the sample obtaining an enhanced analysis signal. An apparatus for analysis of a sample includes magnetic particles connected to the sample, a microchip, a flow channel in the microchip, a source of carrier fluid connected to the flow channel for moving the sample in the flow channel, an electromagnet trap connected to the flow line for selectively magnetically trapping the sample and the magnetic particles, and an analyzer for analyzing the sample.

  19. Polished Downhole Transducer Having Improved Signal Coupling

    DOE Patents [OSTI]

    Hall, David R. (Provo, UT); Fox, Joe (Spanish Fork, UT)

    2006-03-28

    Apparatus and methods to improve signal coupling in downhole inductive transmission elements to reduce the dispersion of magnetic energy at the tool joints and to provide consistent impedance and contact between transmission elements located along the drill string. A transmission element for transmitting information between downhole tools is disclosed in one embodiment of the invention as including an annular core constructed of a magnetically conductive material. The annular core forms an open channel around its circumference and is configured to form a closed channel by mating with a corresponding annular core along an annular mating surface. The mating surface is polished to provide improved magnetic coupling with the corresponding annular core. An annular conductor is disposed within the open channel.

  20. Signal Processing in the PVLAS Experiment

    E-Print Network [OSTI]

    E. Zavattini; G. Zavattini; G. Ruoso; E. Polacco; E. Milotti; M. Karuza; U. Gastaldi; G. Di Domenico; F. Della Valle; R. Cimino; S. Carusotto; G. Cantatore; M. Bregant

    2005-09-22

    Nonlinear interactions of light with light are well known in quantum electronics, and it is quite common to generate harmonic or subharmonic beams from a primary laser with photonic crystals. One suprising result of quantum electrodynamics is that because of the quantum fluctuations of charged fields, the same can happen in vacuum. The virtual charged particle pairs can be polarized by an external field and vacuum can thus become birefringent: the PVLAS experiment was originally meant to explore this strange quantum regime with optical methods. Since its inception PVLAS has found a new, additional goal: in fact vacuum can become a dichroic medium if we assume that it is filled with light neutral particles that couple to two photons, and thus PVLAS can search for exotic particles as well. PVLAS implements a complex signal processing scheme: here we describe the double data acquisition chain and the data analysis methods used to process the experimental data.

  1. Sensitivity of CTA to dark matter signals from the Galactic Center

    E-Print Network [OSTI]

    Mathias Pierre; Jennifer M. Siegal-Gaskins; Pat Scott

    2014-10-13

    (abridged) The Galactic Center is one of the most promising targets for indirect detection of dark matter with gamma rays. We investigate the sensitivity of the upcoming Cherenkov Telescope Array (CTA) to dark matter annihilation and decay in the Galactic Center. As the inner density profile of the Milky Way's dark matter halo is uncertain, we study the impact of the slope of the Galactic density profile, inwards of the Sun, on the prospects for detecting a dark matter signal with CTA. We find that the sensitivity achieved by CTA to annihilation signals is strongly dependent on the inner profile slope, whereas the dependence is more mild in the case of dark matter decay. Surprisingly, we find that the optimal choice of signal and background regions is virtually independent of the assumed density profile. For the fiducial case of a Navarro-Frenk-White profile, we find that CTA will be able to probe annihilation cross sections well below the canonical thermal relic value for dark matter masses from a few tens of GeV up to $\\sim 5$ TeV for annihilation to $\\tau^{+}\\tau^{-}$, and will achieve only a slightly weaker sensitivity for annihilation to $b\\bar{b}$ or $\\mu^{+}\\mu^{-}$. CTA will improve significantly on current sensitivity to annihilation signals for dark matter masses above $\\sim 100$ GeV, covering parameter space that is complementary to that probed by searches with the Fermi Large Area Telescope. The interpretation of apparent excesses in the measured cosmic-ray electron and positron spectra as signals of dark matter decay will also be testable with CTA observations of the Galactic Center. We demonstrate that both for annihilation and for decay, including spectral information for hard channels (such as $\\mu^{+}\\mu^{-}$ and $\\tau^{+}\\tau^{-}$) leads to enhanced sensitivity for dark matter masses above $m_{\\rm DM}\\sim 200$ GeV.

  2. Eruptive history and petrochemistry of the Bulusan volcanic complex: Implications for the hydrothermal system and volcanic hazards of Mt. Bulusan, Philippines

    SciTech Connect (OSTI)

    Delfin, F.G. Jr.; Panem, C.C.; Defant, M.J.

    1993-10-01

    Two contrasting conceptual models of the postcaldera magmatic system of the Bulusan volcanic complex are constructed on the basis of a synthesis of volcanological, petrochemical, and petrologic data. These models predict that hydrothermal convection below the complex will occur either in discrete, structurally-focused zones or over a much broader area. Both models, however, agree that hydrothermal fluids at depth will be highly acidic and volcanic-related. Future ash-fall eruptions and mudflows are likely to affect the area previously chosen for possible drilling. Such risks, combined with the expected acidic character of the hydrothermal system, argue against drilling into this system.

  3. Transfer Area Mechanical Handling Calculation

    SciTech Connect (OSTI)

    B. Dianda

    2004-06-23

    This calculation is intended to support the License Application (LA) submittal of December 2004, in accordance with the directive given by DOE correspondence received on the 27th of January 2004 entitled: ''Authorization for Bechtel SAX Company L.L. C. to Include a Bare Fuel Handling Facility and Increased Aging Capacity in the License Application, Contract Number DE-AC28-01R W12101'' (Arthur, W.J., I11 2004). This correspondence was appended by further Correspondence received on the 19th of February 2004 entitled: ''Technical Direction to Bechtel SAIC Company L.L. C. for Surface Facility Improvements, Contract Number DE-AC28-OIRW12101; TDL No. 04-024'' (BSC 2004a). These documents give the authorization for a Fuel Handling Facility to be included in the baseline. The purpose of this calculation is to establish preliminary bounding equipment envelopes and weights for the Fuel Handling Facility (FHF) transfer areas equipment. This calculation provides preliminary information only to support development of facility layouts and preliminary load calculations. The limitations of this preliminary calculation lie within the assumptions of section 5 , as this calculation is part of an evolutionary design process. It is intended that this calculation is superseded as the design advances to reflect information necessary to support License Application. The design choices outlined within this calculation represent a demonstration of feasibility and may or may not be included in the completed design. This calculation provides preliminary weight, dimensional envelope, and equipment position in building for the purposes of defining interface variables. This calculation identifies and sizes major equipment and assemblies that dictate overall equipment dimensions and facility interfaces. Sizing of components is based on the selection of commercially available products, where applicable. This is not a specific recommendation for the future use of these components or their related manufacturer. A component produced by one manufacturer certainly varies dimensionally from a similar product produced by a different manufacturer. The internal envelope dimensions are dependent on the selection of the individual components. The external envelope dimensions, as well as, key interface dimensions are established within this calculation and are to be treated as bounding dimensions.

  4. Tone signal generator for producing multioperator tone signals using an operator circuit including a waveform generator, a selector and an enveloper

    DOE Patents [OSTI]

    Dong, Q.; Jenkins, M.V.; Bernadas, S.R.

    1997-09-09

    A frequency modulation (FM) tone signal generator for generating a FM tone signal is disclosed. The tone signal generator includes a waveform generator having a plurality of wave tables, a selector and an enveloper. The waveform generator furnishes a waveform signal in response to a phase angle address signal. Each wave table stores a different waveform. The selector selects one of the wave tables in response to a plurality of selection signals such that the selected wave table largely provides the waveform signal upon being addressed largely by the phase angle address signal. Selection of the selected wave table varies with each selection signal. The enveloper impresses an envelope signal on the waveform signal. The envelope signal is used as a carrier or modulator for generating the FM tone signal. 17 figs.

  5. Physics-based signal processing algorithms for micromachined cantilever arrays

    DOE Patents [OSTI]

    Candy, James V; Clague, David S; Lee, Christopher L; Rudd, Robert E; Burnham, Alan K; Tringe, Joseph W

    2013-11-19

    A method of using physics-based signal processing algorithms for micromachined cantilever arrays. The methods utilize deflection of a micromachined cantilever that represents the chemical, biological, or physical element being detected. One embodiment of the method comprises the steps of modeling the deflection of the micromachined cantilever producing a deflection model, sensing the deflection of the micromachined cantilever and producing a signal representing the deflection, and comparing the signal representing the deflection with the deflection model.

  6. IP3 signalling regulates exogenous RNAi in Caenorhabditis elegans

    E-Print Network [OSTI]

    Nagy, Anikó I.; Vázquez-Manrique, Rafael P.; Lopez, Marie; Christov, Christo; Sequedo, María Dolores; Herzog, Mareike; Herlihy, Anna E; Bodak, Maxime; Gatsi, Roxani; Baylis, Howard A.

    2015-01-21

    -proteins acting downstream of GPCRs [34]. Thus signalling through a GPCR may be important to the alterations in RNAi sensitivity. Increased IP3 signalling causes RNAi resistance. To ascertain whether IP3 signalling is capable of modulating the RNAi... : cgcgttcaccactcgaccaccgaac and tttttatgggttttggtaggttttag) [7], a 1.19 kb promoter region of unc-47 (terminal sequences: gatcccggaacagtcg and ctgtaatgaaataaatgt) were amplified from genomic DNA and cloned upstream of the itr-1 cDNA using restriction enzyme splicing...

  7. Secure Communication using Compound Signal from Generalized Synchronizable Chaotic Systems

    E-Print Network [OSTI]

    K. Murali; M. Lakshmanan

    1997-09-20

    By considering generalized synchronizable chaotic systems, the drive-auxiliary system variables are combined suitably using encryption key functions to obtain a compound chaotic signal. An appropriate feedback loop is constructed in the response-auxiliary system to achieve synchronization among the variables of the drive-auxiliary and response-auxiliary systems. We apply this approach to transmit analog and digital information signals in which the quality of the recovered signal is higher and the encoding is more secure.

  8. Nonlocal quantum information transfer without superluminal signalling and communication

    E-Print Network [OSTI]

    Jan Walleczek; Gerhard Groessing

    2015-03-13

    It is a frequent assumption that - via superluminal information transfers - superluminal signals capable of enabling communication are necessarily exchanged in any quantum theory that posits hidden superluminal influences. However, does the presence of hidden superluminal influences automatically imply superluminal signalling and communication? The non-signalling theorem mediates the apparent conflict between quantum mechanics and the theory of special relativity. However, as a 'no-go' theorem there exist two opposing interpretations of the non-signalling constraint: foundational and operational. Concerning Bell's theorem, we argue that Bell employed both interpretations at different times. Bell finally pursued an explicitly operational position on non-signalling which is often associated with ontological quantum theory, e.g., de Broglie-Bohm theory. This position we refer to as "effective non-signalling". By contrast, associated with orthodox quantum mechanics is the foundational position referred to here as "axiomatic non-signalling". In search of a decisive communication-theoretic criterion for differentiating between "axiomatic" and "effective" non-signalling, we employ the operational framework offered by Shannon's mathematical theory of communication. We find that an effective non-signalling theorem represents two sub-theorems, which we call (1) non-transfer-control (NTC) theorem, and (2) non-signification-control (NSC) theorem. Employing NTC and NSC theorems, we report that effective, instead of axiomatic, non-signalling is entirely sufficient for prohibiting nonlocal communication. An effective non-signalling theorem allows for nonlocal quantum information transfer yet - at the same time - effectively denies superluminal signalling and communication.

  9. Complex signal amplitude analysis for complete fusion nuclear reaction products

    E-Print Network [OSTI]

    Yu. S. Tsyganov

    2015-06-07

    A complex analysis has been performed on the energy amplitude signals corresponding to events of Z=117 element measured in the 249Bk+48Ca complete fusion nuclear reaction. These signals were detected with PIPS position sensitive detector. The significant values of pulse height defect both for recoils (ER) and fission fragments (FF) were measured. Comparison with the computer simulations and empirical formulae has been performed both for ER and FF signals.

  10. Complex signal amplitude analysis for complete fusion nuclear reaction products

    E-Print Network [OSTI]

    Tsyganov, Yu S

    2015-01-01

    A complex analysis has been performed on the energy amplitude signals corresponding to events of Z=117 element measured in the 249Bk+48Ca complete fusion nuclear reaction. These signals were detected with PIPS position sensitive detector. The significant values of pulse height defect both for recoils (ER) and fission fragments (FF) were measured. Comparison with the computer simulations and empirical formulae has been performed both for ER and FF signals.

  11. Characterization of Cardio signals by time-frequency domain analysis

    E-Print Network [OSTI]

    Sayan Mukherjee; Sanjay Kumar Palit; Santo Banerjee; MRK Ariffin; Lamberto Rondoni; Dilip Kumar Bhattacharya

    2014-09-04

    Long term behavior of nonlinear deterministic continuous time signals can be studied in terms of their reconstructed attractors. Reconstructed attractors of a continuous signal are meant to be topologically equivalent representations of the dynamics of the unknown dynamical system which generates the signal. Sometimes, geometry of the attractor or its complexity may give important information on the system of interest. However, if the trajectories of the attractor behave as if they are not coming from continuous system or there exists many spike like structures on the path of the system trajectories, then there is no way to characterize the shape of the attractor. In this article, the traditional attractor reconstruction method is first used for two types of ECG signals: Normal healthy persons (NHP) and Congestive Heart failure patients (CHFP). As common in such a framework, the reconstructed attractors are not at all well formed and hence it is not possible to adequately characterize their geometrical features. Thus, we incorporate frequency domain information to the given time signals. This is done by transforming the signals to a time frequency domain by means of suitable Wavelet transforms (WT). The transformed signal concerns two non homogeneous variables and is still quite difficult to use to reconstruct some dynamics out of it. By applying a suitable mapping, this signal is further converted into integer domain and a new type of 3D plot, called integer lag plot, which characterizes and distinguishes the ECG signals of NHP and CHFP, is finally obtained.

  12. (U) modulator to provide a continuous stepped frequency signal format

    DOE Patents [OSTI]

    Walters, Glenn A. (Escondido, CA)

    1991-01-01

    A modulator provides a continuous signal format composed of discrete freqcy steps and is designed to eliminate frequency overlap or smearing normally associated with filter ringing.

  13. The Impact of Plant Enemies Shows a Phylogenetic Signal

    E-Print Network [OSTI]

    Gilbert, Gregory S; Briggs, Heather M; Magarey, Roger; Perovic, Dragan

    2015-01-01

    tools for phytosanitary risk analysis: phyloge- netic signalFor instance, phytosanitary risk analysis of ecological andagronomy, and phytosanitary risk analysis. PLOS ONE | DOI:

  14. A Minimax Theorem with Applications to Machine Learning, Signal ...

    E-Print Network [OSTI]

    2007-11-13

    bust Fisher linear discriminant analysis), signal processing (robust ...... by the Focus Center Research Program Center for Circuit & System Solutions award 2003 ...

  15. Window signalling systems: control strategies and occupant behaviour

    E-Print Network [OSTI]

    Ackerly, Katie; Brager, Gail

    2013-01-01

    strategies and occupant behavior”. Building Research &control strategies and occupant behavior Katie Ackerly a,signals play a role in occupant behavior and response. The

  16. Salmonella typhimurium intercepts Escherichia coli signaling to enhance antibiotic tolerance

    E-Print Network [OSTI]

    Collins, James J.

    Salmonella typhimurium intercepts Escherichia coli signaling to enhance antibiotic tolerance Nicole Salmonella typhimurium increases its antibiotic toler- ance in response to indole, even though S. typhimurium

  17. Acoustic signal detection through the cross-correlation method in experiments with different signal to noise ratio and reverberation conditions

    E-Print Network [OSTI]

    Adrián-Martínez, S; Bou-Cabo, M; Felis, I; Llorens, C; Martínez-Mora, J A; Saldańa, M

    2015-01-01

    The study and application of signal detection techniques based on cross-correlation method for acoustic transient signals in noisy and reverberant environments are presented. These techniques are shown to provide high signal to noise ratio, good signal discernment from very close echoes and accurate detection of signal arrival time. The proposed methodology has been tested on real data collected in environments and conditions where its benefits can be shown. This work focuses on the acoustic detection applied to tasks of positioning in underwater structures and calibration such those as ANTARES and KM3NeT deep-sea neutrino telescopes, as well as, in particle detection through acoustic events for the COUPP/PICO detectors. Moreover, a method for obtaining the real amplitude of the signal in time (voltage) by using cross correlation has been developed and tested and is described in this work.

  18. Publish date: 06/27/2011 ECE 4364: Digital Signal Processing

    E-Print Network [OSTI]

    Gelfond, Michael

    Publish date: 06/27/2011 ECE 4364: Digital Signal Processing Credit / Contact hours: 3 / 3 Course Signal Processing, 3E, Prentice Hall, 2009. Catalog description: An introduction to digital signal digital signal processing techniques to analyze discrete time signals and systems. 3. Apply digital signal

  19. Optimal signal processing for continuous qubit readout

    E-Print Network [OSTI]

    Shilin Ng; Mankei Tsang

    2014-08-06

    The measurement of a quantum two-level system, or a qubit in modern terminology, often involves an electromagnetic field that interacts with the qubit, before the field is measured continuously and the qubit state is inferred from the noisy field measurement. During the measurement, the qubit may undergo spontaneous transitions, further obscuring the initial qubit state from the observer. Taking advantage of some well known techniques in stochastic detection theory, here we propose a novel signal processing protocol that can infer the initial qubit state optimally from the measurement in the presence of noise and qubit dynamics. Assuming continuous quantum-nondemolition measurements with Gaussian or Poissonian noise and a classical Markov model for the qubit, we derive analytic solutions to the protocol in some special cases of interest using It\\={o} calculus. Our method is applicable to multi-hypothesis testing for robust qubit readout and relevant to experiments on qubits in superconducting microwave circuits, trapped ions, nitrogen-vacancy centers in diamond, semiconductor quantum dots, or phosphorus donors in silicon.

  20. Rediscovering signal complexity as a teleseismic discriminant

    SciTech Connect (OSTI)

    Anderson, Dale N [Los Alamos National Laboratory; Taylor, Steven R [Los Alamos National Laboratory

    2008-01-01

    We re-examine the utility of teleseismic seismic complexity discriminants in a multivariate setting using United Kingdom array data. We measure a complexity discriminant taken on array beams by simply taking the logarithm of the ratio of the P-wave coda signal to that of the first arriving direct P wave ({beta}{sub CF}). The single station complexity discriminant shows marginal performance with shallow earthquakes having more complex signatures than those from explosions or deep earthquakes. Inclusion of secondary phases in the coda window can also degrade performance. However, performance improves markedly when two-station complexity discriminants are formed showing false alarm rates similar to those observed for network m{sub b} - M{sub s}. This suggests that multistation complexity discriminants may ameliorate some of the problems associated with m{sub b} - M{sub s} discrimination at lower magnitudes. Additionally, when complexity discriminants are combined with m{sub b} - M{sub s} there is a tendency for explosions, shallow earthquakes and deep earthquakes to form three distinct populations. Thus, complexity discriminants may follow a logic that is similar to m{sub b} - M{sub s} in terms of the separation of shallow earthquakes from nuclear explosions, although the underlying physics of the two discriminants is significantly different.