Powered by Deep Web Technologies
Note: This page contains sample records for the topic "area miles mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Seven Mile Hole Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Seven Mile Hole Geothermal Area Seven Mile Hole Geothermal Area Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Seven Mile Hole Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (4) 10 References Area Overview Geothermal Area Profile Location: Wyoming Exploration Region: Yellowstone Caldera Geothermal Region GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content History and Infrastructure Operating Power Plants: 0 No geothermal plants listed. Add a new Operating Power Plant

2

Seven Mile Hole Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

form form View source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Page Edit with form History Facebook icon Twitter icon » Seven Mile Hole Geothermal Area (Redirected from Seven Mile Hole Area) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Seven Mile Hole Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (4) 10 References Area Overview Geothermal Area Profile Location: Wyoming Exploration Region: Yellowstone Caldera Geothermal Region GEA Development Phase:

3

Field Mapping At Seven Mile Hole Area (Larson, Et Al., 2009) | Open Energy  

Open Energy Info (EERE)

Seven Mile Hole Area (Larson, Et Al., 2009) Seven Mile Hole Area (Larson, Et Al., 2009) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Field Mapping At Seven Mile Hole Area (Larson, Et Al., 2009) Exploration Activity Details Location Seven Mile Hole Area Exploration Technique Field Mapping Activity Date Usefulness not indicated DOE-funding Unknown Notes The distribution of hydrothermally altered rocks was mapped over about 1 km2 in the Sevenmile Hole area. Two to four kilogram hand samples located by a handheld GPS were collected from many outcrops K735for laboratory analyses References Peter B. Larson, Allison Phillips, David John, Michael Cosca, Chad Pritchard, Allen Andersen, Jennifer Manion (2009) A Preliminary Study Of Older Hot Spring Alteration In Sevenmile Hole, Grand Canyon Of The

4

Rock Sampling At Seven Mile Hole Area (Larson, Et Al., 2009) | Open Energy  

Open Energy Info (EERE)

Seven Mile Hole Area (Larson, Et Al., 2009) Seven Mile Hole Area (Larson, Et Al., 2009) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Rock Sampling At Seven Mile Hole Area (Larson, Et Al., 2009) Exploration Activity Details Location Seven Mile Hole Area Exploration Technique Rock Sampling Activity Date Usefulness not indicated DOE-funding Unknown Notes The distribution of hydrothermally altered rocks was mapped over about 1 km2 in the Sevenmile Hole area. Two to four kilogram hand samples located by a handheld GPS were collected from many outcrops for laboratory analyses References Peter B. Larson, Allison Phillips, David John, Michael Cosca, Chad Pritchard, Allen Andersen, Jennifer Manion (2009) A Preliminary Study Of Older Hot Spring Alteration In Sevenmile Hole, Grand Canyon Of The

5

Isotopic Analysis At Seven Mile Hole Area (Larson, Et Al., 2009) | Open  

Open Energy Info (EERE)

2009) 2009) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Isotopic Analysis- Rock At Seven Mile Hole Area (Larson, Et Al., 2009) Exploration Activity Details Location Seven Mile Hole Area Exploration Technique Isotopic Analysis- Rock Activity Date Usefulness useful DOE-funding Unknown Notes The 40Ar/39Ar data were collected from a single fragment of alunite from sample Y-05-25, approximately 0.5 cm3 in size. References Peter B. Larson, Allison Phillips, David John, Michael Cosca, Chad Pritchard, Allen Andersen, Jennifer Manion (2009) A Preliminary Study Of Older Hot Spring Alteration In Sevenmile Hole, Grand Canyon Of The Yellowstone River, Yellowstone Caldera, Wyoming Retrieved from "http://en.openei.org/w/index.php?title=Isotopic_Analysis_At_Seven_Mile_Hole_Area_(Larson,_Et_Al.,_2009)&oldid=68747

6

Compound and Elemental Analysis At Seven Mile Hole Area (Larson, Et Al.,  

Open Energy Info (EERE)

2009) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Compound and Elemental Analysis At Seven Mile Hole Area (Larson, Et Al., 2009) Exploration Activity Details Location Seven Mile Hole Area Exploration Technique Compound and Elemental Analysis Activity Date Usefulness not indicated DOE-funding Unknown Notes Standard X-ray diffractometer (XRD) analyses were used in the laboratory to confirm the PIMA mineral identifications and to look for minerals that have poor SWIR response (e.g., quartz and feldspars) or were not present in great enough concentrations to be detected by the PIMA. Petrographic and electron microprobe analyses of selected samples were conducted in the laboratories of the GeoAnalytical Laboratory at Washington State

7

Analysis of soil and water at the Four Mile Creek seepline near the F- and H-Areas of SRS  

Science Conference Proceedings (OSTI)

Several soil and water samples were collected along the Four Mile Creek (FMC) seepline at the F and H Areas of the Savannah River Site. The samples were analyzed for concentrations of metals, radionuclides, and inorganic constituents. The results of the analyses are summarized for the soil and water samples.

Haselow, J.S.

2000-05-24T23:59:59.000Z

8

Population estimates for the areas within a 50-mile radius of four reference points on the Hanford Site  

SciTech Connect

This report presents population distributions within a 50-mile radius of four locations on the Hanford Site. The results are based on the US Bureau of Census 1980 population counts for Washington and Oregon. These results are documented in Tables 2 to 13 and 15 to 18 of this report.

Sommer, D.J.; Rau, R.G.; Robinson, D.C.

1981-11-01T23:59:59.000Z

9

Property:Area | Open Energy Information  

Open Energy Info (EERE)

Area Area Jump to: navigation, search Property Name Area Property Type Quantity Description Any unit of area. For example, the estimated area of Geothermal Regions. Use this type to express a quantity of two-dimensional space. The default unit is the square meter (m²). http://en.wikipedia.org/wiki/Area Acceptable units (and their conversions) are: Square Meters - 1 m²,m2,m^2,square meter,square meters,Square Meter,Square Meters,Sq. Meters,SQUARE METERS Square Kilometers - 0.000001 km²,km2,km^2,square kilometer,square kilometers,square km,square Kilometers,SQUARE KILOMETERS Square Miles - 0.000000386 mi²,mi2,mi^2,mile²,square mile,square miles,square mi,Square Miles,SQUARE MILES Square Feet - 10.7639 ft²,ft2,ft^2,square feet,square foot,FT²,FT2,FT^2,Square Feet, Square Foot

10

DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility

11

Property:PotentialOffshoreWindArea | Open Energy Information  

Open Energy Info (EERE)

PotentialOffshoreWindArea PotentialOffshoreWindArea Jump to: navigation, search Property Name PotentialOffshoreWindArea Property Type Quantity Description The area of potential offshore wind in a place. Use this type to express a quantity of two-dimensional space. The default unit is the square meter (m²). http://en.wikipedia.org/wiki/Area Acceptable units (and their conversions) are: Square Meters - 1 m²,m2,m^2,square meter,square meters,Square Meter,Square Meters,Sq. Meters,SQUARE METERS Square Kilometers - 0.000001 km²,km2,km^2,square kilometer,square kilometers,square km,square Kilometers,SQUARE KILOMETERS Square Miles - 0.000000386 mi²,mi2,mi^2,mile²,square mile,square miles,square mi,Square Miles,SQUARE MILES Square Feet - 10.7639 ft²,ft2,ft^2,square feet,square foot,FT²,FT2,FT^2,Square Feet, Square Foot

12

Property:PotentialOnshoreWindArea | Open Energy Information  

Open Energy Info (EERE)

PotentialOnshoreWindArea PotentialOnshoreWindArea Jump to: navigation, search Property Name PotentialOnshoreWindArea Property Type Quantity Description The area of potential onshore wind in a place. Use this type to express a quantity of two-dimensional space. The default unit is the square meter (m²). http://en.wikipedia.org/wiki/Area Acceptable units (and their conversions) are: Square Meters - 1 m²,m2,m^2,square meter,square meters,Square Meter,Square Meters,Sq. Meters,SQUARE METERS Square Kilometers - 0.000001 km²,km2,km^2,square kilometer,square kilometers,square km,square Kilometers,SQUARE KILOMETERS Square Miles - 0.000000386 mi²,mi2,mi^2,mile²,square mile,square miles,square mi,Square Miles,SQUARE MILES Square Feet - 10.7639 ft²,ft2,ft^2,square feet,square foot,FT²,FT2,FT^2,Square Feet, Square Foot

13

Miles Hand Grenade  

DOE Patents (OSTI)

A simulated grenade for MILES-type simulations generates a unique RF signal and a unique audio signal. A detector utilizes the time between receipt of the RF signal and the slower-traveling audio signal to determine the distance between the detector and the simulated grenade.

Harrington, John J. (Albuquerque, NM); Buttz, James H. (Albuquerque, NM); Maish, Alex B. (Corrales, NM); Page, Ray R. (Albuquerque, NM); Metcalf, Herbert E. (Albuquerque, NM)

2005-11-15T23:59:59.000Z

14

Three Mile Island  

SciTech Connect

The Three Mile Island accident was the worst accident ever experienced by the nuclear power industry. Although the radiation exposures were extremely low, the potential for greater public exposure did exist. Fortunately, the health and safety of the public were not affected by radiation, nor was anyone killed or injured; however, thousand of lives were disrupted by fear and anxiety and by a limited evacuation. The events and actions contributing to the accident are described.

Buhl, A.R.

1980-09-01T23:59:59.000Z

15

Salt Wells, Eight Mile Flat | Open Energy Information  

Open Energy Info (EERE)

Salt Wells, Eight Mile Flat Salt Wells, Eight Mile Flat Jump to: navigation, search OpenEI Reference LibraryAdd to library Web Site: Salt Wells, Eight Mile Flat Abstract Abstract unavailable. Author Nevada Bureau of Mines and Geology Published Online Nevada Encyclopedia, 2009 DOI Not Provided Check for DOI availability: http://crossref.org Online Internet link for Salt Wells, Eight Mile Flat Citation Nevada Bureau of Mines and Geology. Salt Wells, Eight Mile Flat [Internet]. 2009. Online Nevada Encyclopedia. [updated 2009/03/24;cited 2013/08/07]. Available from: http://www.onlinenevada.org/articles/salt-wells-eight-mile-flat Related Geothermal Exploration Activities Activities (1) Areas (1) Regions (0) Development Wells At Salt Wells Area (Nevada Bureau of Mines and Geology, 2009) Salt Wells Geothermal Area

16

miles-99.PDF  

NLE Websites -- All DOE Office Websites (Extended Search)

Vertical Velocity Statistics as Derived from 94-GHz Vertical Velocity Statistics as Derived from 94-GHz Radar Measurements N. L. Miles, D. M. Babb, and J. Verlinde The Pennsylvania State University University Park, Pennsylvania Introduction Profiles of millimeter-wavelength radar Doppler spectra contain information about both the mean vertical velocities and cloud microphysics. In order to obtain this information, it is necessary to remove the effects of turbulence. Stratocumulus clouds often contain various species of ice and liquid, including graupel, crystals, columns, plates, liquid droplets, and drizzle drops. Most of the previous work to remotely determine microphysics of stratus clouds has largely ignored the presence of drizzle and ice, restricting applicability to only liquid clouds with no drizzle, a relatively rare event. Since mixed phase

17

Miles Electric Vehicles | Open Energy Information  

Open Energy Info (EERE)

Miles Electric Vehicles Jump to: navigation, search Name Miles Electric Vehicles Place Santa Monica, California Zip 90405 Sector Vehicles Product California-based developer of...

18

Microsoft Word - Seven Mile CX.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

October 7, 2010 October 7, 2010 REPLY TO ATTN OF: KEC-4 SUBJECT: Environmental Clearence Memorandum - Seven Mile Project Erich Orth Project Manager - TEP-TPP-3 Proposed Action: Seven Mile Project Budget Information: Work Order 00211600 Task 03 Categorical Exclusions Applied (from Subpart D, 10 C.F.R. Part 1021: B1.11 "Installation of fencing... that will not adversely affect wildlife of surface water flow." B4.6 "Additions or modifications to electric power transmission facilities that would not affect the environment beyond the previously developed facility area..." B4.11 "Construction or electric power substations (including switching stations and support facilities) with power delivery at 230-kV or below, or modification (other than voltage increases) of existing

19

Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan

2008-09-30T23:59:59.000Z

20

Ozark 260-mile gas line system completed  

Science Conference Proceedings (OSTI)

Gathering gas in the Arkoma basin of Oklahoma and Arkansas for transport to market, the 260-mile Ozark gas line system runs from southwest of McAlester, Okla., to Natural Gas Pipeline Co. of America's station at Searcy, Ark. The recently completed mainline has an initial capacity of 170 million CF/day with a maximum operating pressure of 1200 psig and a delivery pressure of 700 psig at the NGPL station. The 20-in. pipeline is API 5LX-Grade X60, 0.281-in. wall thickness for Class 1 areas, 0.344 for Class 2 areas, 0.406 for Class 3 areas, and API 5LX-Grade X52, 0.500-in. wall thickness for river crossings.

Dixon, R.R.

1982-05-01T23:59:59.000Z

Note: This page contains sample records for the topic "area miles mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Health effects of the nuclear accident at Three Mile Island  

SciTech Connect

Between March 28 and April 15, 1979 the collective dose resulting from the radioactivity released to the population living within a 50-mile radius of the Three Mile Island nuclear plant was about 2000 person-rems, less than 1% of the annual natural background level. The average dose to a person living within 5 miles of the nuclear plant was less than 10% of annual background radiation. The maximum estimated radiation dose received by any one individual in the general population (excluding the nuclear plant workers) during the accident was 70 mrem. The doses received by the general population as a result of the accident were so small that there will be no detectable additional cases of cancer, developmental abnormalities, or genetic ill-health. Three Three Mile Island nuclear workers received radiation doses of about 3 to 4 rem, exceeding maximum permissible quarterly dose of 3 rem. The major health effect of the accident at Three Mile Island was that of a pronounced demoralizing effect on the general population in the Three Mile Island area, including teenagers and mothers of preschool children and the nuclear plant workers. However, this effect proved transient in all groups studied except the nuclear workers.

Fabrikant, J.I.

1980-05-01T23:59:59.000Z

22

square-mile Black Warrior Basin  

NLE Websites -- All DOE Office Websites (Extended Search)

will inject CO will inject CO 2 into a coalbed methane (CBM) well in Tuscaloosa County, Alabama, to assess the capability of mature CBM reservoirs to receive and adsorb large volumes of CO 2 . Injection began at the test site on June 15; the site was selected because it is representative of the 23,000- square-mile Black Warrior Basin located in northwestern Alabama and northeastern Mississippi. It is estimated that this area has the potential to store in the range of 1.1 to 2.3 Gigatons of CO 2 , which is approximately the amount that Alabama's coal-fired power plants emit in two decades. The targeted coal seams range from 940 to 1,800 feet deep and are one to six feet thick. Approximately 240 tons of CO 2 will be injected over a 45- to 60-day period. More information

23

Pennsylvania Nuclear Profile - Three Mile Island  

U.S. Energy Information Administration (EIA) Indexed Site

Three Mile Island" "Unit","Summer capacity (mw)","Net generation (thousand mwh)","Summer capacity factor (percent)","Type","Commercial operation date","License expiration date"...

24

Chapter 3. Vehicle-Miles Traveled  

U.S. Energy Information Administration (EIA) Indexed Site

3. Vehicle-Miles Traveled 3. Vehicle-Miles Traveled Chapter 3. Vehicle-Miles Traveled Vehicle-miles traveled--the number of miles that residential vehicles are driven--is probably the most important information collected by the Residential Transportation Energy Consumption Survey. Using the data on vehicle-miles traveled allows analysts to answer such questions as: "Are minivans driven more than passenger cars?" "Do people in the West drive more than people elsewhere?" "Do people conserve their new cars by driving them less?" "Who drives more--people in households with children, or other people?" "At what ages do people drive the most?" "How does growing income affect the amount of driving?" In addition to answering those kinds of questions, analysts also use the number of vehicle-miles traveled to compute estimated, on-road vehicle fuel consumption, economy, and expenditures, all of which have important implications for U.S. energy policy and national security (see Chapter 4).

25

Three Mile Canyon | Open Energy Information  

Open Energy Info (EERE)

Mile Canyon Mile Canyon Jump to: navigation, search Name Three Mile Canyon Facility Three Mile Canyon Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner John Deere Wind Developer Momentum RE Energy Purchaser PacifiCorp Location Morrow County OR Coordinates 45.717419°, -119.502258° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.717419,"lon":-119.502258,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

26

Pennsylvania Nuclear Profile - Three Mile Island  

U.S. Energy Information Administration (EIA)

snpt3pa8011 805 6,634 94.1 PWR Three Mile Island Unit Type Data for 2010 PWR = Pressurized Light Water Reactor. Note: Totals may not equal sum of ...

27

HEALTH EFFECTS OF THE NUCLEAR ACCIDENT AT THREE MILE ISLAND  

E-Print Network (OSTI)

In) Symposium on Nuclear Reactor Safety: Perspective. Ahealth effects of the nuclear reactor accident at Three Mile50-mile radius of the nuclear reactor site, approximately

Fabrikant, J.I.

2010-01-01T23:59:59.000Z

28

1st Mile | Open Energy Information  

Open Energy Info (EERE)

Mile Mile Jump to: navigation, search Name 1st Mile Place Lyngby, Denmark Zip 2800 Product Denmark-based company that provides research and screening for venture capitalists. Website http://www.1stmile.dk/ Coordinates 56.866669°, 8.31667° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":56.866669,"lon":8.31667,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

29

square miles | OpenEI Community  

Open Energy Info (EERE)

0 0 Varnish cache server Home Groups Community Central Green Button Applications Developer Utility Rate FRED: FRee Energy Database More Public Groups Private Groups Features Groups Blog posts Content Stream Documents Discussions Polls Q & A Events Notices My stuff Energy blogs 429 Throttled (bot load) Error 429 Throttled (bot load) Throttled (bot load) Guru Meditation: XID: 2142235190 Varnish cache server square miles Home Sfomail's picture Submitted by Sfomail(48) Member 25 June, 2013 - 12:10 Solar Land Use Data on OpenEI acres csp land use how much land land requirements pv land use solar land use square miles I'm happy to announce that a new report on Solar+Land+Use was just released by the National+Renewable+Energy+Laboratory. You can find a brief summary of the results at the Solar+Land+Use page on OpenEI.

30

Compound and Elemental Analysis At Seven Mile Hole Area (Larson...  

Open Energy Info (EERE)

present in great enough concentrations to be detected by the PIMA. Petrographic and electron microprobe analyses of selected samples were conducted in the laboratories of the...

31

Alternative Fuels Data Center: Vehicle Miles Traveled Tax Feasibility  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

Vehicle Miles Traveled Vehicle Miles Traveled Tax Feasibility Evaluation to someone by E-mail Share Alternative Fuels Data Center: Vehicle Miles Traveled Tax Feasibility Evaluation on Facebook Tweet about Alternative Fuels Data Center: Vehicle Miles Traveled Tax Feasibility Evaluation on Twitter Bookmark Alternative Fuels Data Center: Vehicle Miles Traveled Tax Feasibility Evaluation on Google Bookmark Alternative Fuels Data Center: Vehicle Miles Traveled Tax Feasibility Evaluation on Delicious Rank Alternative Fuels Data Center: Vehicle Miles Traveled Tax Feasibility Evaluation on Digg Find More places to share Alternative Fuels Data Center: Vehicle Miles Traveled Tax Feasibility Evaluation on AddThis.com... More in this section... Federal State Advanced Search All Laws & Incentives Sorted by Type

32

Alternative Fuels Data Center: Oregon Celebrates 200 Miles of Electric  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

Oregon Celebrates 200 Oregon Celebrates 200 Miles of Electric Highways to someone by E-mail Share Alternative Fuels Data Center: Oregon Celebrates 200 Miles of Electric Highways on Facebook Tweet about Alternative Fuels Data Center: Oregon Celebrates 200 Miles of Electric Highways on Twitter Bookmark Alternative Fuels Data Center: Oregon Celebrates 200 Miles of Electric Highways on Google Bookmark Alternative Fuels Data Center: Oregon Celebrates 200 Miles of Electric Highways on Delicious Rank Alternative Fuels Data Center: Oregon Celebrates 200 Miles of Electric Highways on Digg Find More places to share Alternative Fuels Data Center: Oregon Celebrates 200 Miles of Electric Highways on AddThis.com... April 18, 2012 Oregon Celebrates 200 Miles of Electric Highways " These [electric charging] stations will help create a corridor that, by the

33

March 28, 1979: Three Mile Island | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1979: Three Mile Island March 28, 1979 A partial meltdown of the core occurs at one of the two reactors at the Three Mile Island nuclear power plant near Harrisburg, Pennsylvania...

34

Vegetation survey of Pen Branch and Four Mile Creek wetlands  

SciTech Connect

One hundred-fifty plots were recently sampled (vegetational sampling study) at the Savannah River Site (SRS). An extensive characterization of the vascular flora, in four predetermined strata (overstory, Understory, shrub layer, and ground cover), was undertaken to determine dominance, co-dominance, and the importance value (I.V.) of each species. These results will be used by the Savannah River Laboratory (SRL) to evaluate the environmental status of Four Mile Creek, Pen Branch, and two upland pine stands. Objectives of this study were to: Describe in detail the plant communities previously mapped with reference to the topography and drainage, including species of plants present: Examine the successional trends within each sampling area and describe the extent to which current vegetation communities have resulted from specific earlier vegetation disturbances (e.g., logging and grazing); describe in detail the botanical field techniques used to sample the flora; describe the habitat and location of protected and/or rare species of plants; and collect and prepare plant species as herbarium quality specimens. Sampling was conducted at Four Mile Creek and Pen Branch, and in two upland pine plantations of different age growth.

Not Available

1992-01-01T23:59:59.000Z

35

Vegetation survey of Pen Branch and Four Mile Creek wetlands  

Science Conference Proceedings (OSTI)

One hundred-fifty plots were recently sampled (vegetational sampling study) at the Savannah River Site (SRS). An extensive characterization of the vascular flora, in four predetermined strata (overstory, Understory, shrub layer, and ground cover), was undertaken to determine dominance, co-dominance, and the importance value (I.V.) of each species. These results will be used by the Savannah River Laboratory (SRL) to evaluate the environmental status of Four Mile Creek, Pen Branch, and two upland pine stands. Objectives of this study were to: Describe in detail the plant communities previously mapped with reference to the topography and drainage, including species of plants present: Examine the successional trends within each sampling area and describe the extent to which current vegetation communities have resulted from specific earlier vegetation disturbances (e.g., logging and grazing); describe in detail the botanical field techniques used to sample the flora; describe the habitat and location of protected and/or rare species of plants; and collect and prepare plant species as herbarium quality specimens. Sampling was conducted at Four Mile Creek and Pen Branch, and in two upland pine plantations of different age growth.

Not Available

1992-10-01T23:59:59.000Z

36

A GEM Award (Going the Extra Mile)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

GEM Award GEM Award Going the Extra Mile A Gift Card Recognition Program Who may receive? All Headquarters Department of Energy Employees except Political Appointees (including Schedule C and non-career members of the SES). Any Employee may nominate. What is it? $25 or $50 Gift Cards from 100s Department Stores, Book Stores, Hotels and more. of nationally well known Movie Tickets, Restaurants, How do I do it? * Nominator fills out form. * Routes form through their organizational protocols. * Faxes or scans/emails to HQ Gift Card. * HQ Gift Card receives form, places order * Gift Certificate is sent to Recipient's Supervisor * Supervisor presents certificate to employee * Employee can redeem On-line or by phone for card their choice of When can I do this? HQ Gift Card is open for business now

37

Experiments on hydrogen for Three Mile Island  

DOE Green Energy (OSTI)

Starting on April 1, 1979, Billings Energy Corporation under the direction of EG and G Idaho, Inc., undertook a series of tests for Nuclear Regulatory Commission to provide information regarding (1) potential amount of hydrogen in the primary coolant water in the Three Mile Island 2 Reactor; (2) methods of scavenging gaseous hydrogen from the reactor system; and (3) the determination of the most efficient and also the safest means of depressurization. Although only small amounts of hydrogen were later found in the system, this study produced information of interest for similar accidents in which hydrogen remains in the system. No investigations of radiochemical effects were made; the study focused on non-radiation solubility and chemical effects.

Wooley, R.L.; Ruckman, J.H.; Kimball, G.L.; Ayers, A.L. Jr.; Liebenthal, J.L.

1980-01-01T23:59:59.000Z

38

Proposed study program of the effects on Hanford of a dam at Columbia River mile 348  

DOE Green Energy (OSTI)

At the request of Hanford Operations Office, Atomic Energy Commission, a study was made of the effects on the Hanford Facilities of a navigation and power dam at Columbia River mile 348, about five miles upstream of the 300 Area. The original study was based on a nominal slack-water pool elevation of 395 to 400 feet at the dam location. A supplemental study evaluated the effects on plant facilities of a dam at the same location but with slack-water pool elevation of 385 feet. In addition to effects of the dam on Hanford, a study was performed to evaluate the effects the dam would have on the environment.

Jasko, R.T.

1959-06-30T23:59:59.000Z

39

New York Nuclear Profile - Nine Mile Point Nuclear Station  

U.S. Energy Information Administration (EIA) Indexed Site

Nine Mile Point Nuclear Station" "Unit","Summer capacity (mw)","Net generation (thousand mwh)","Summer capacity factor (percent)","Type","Commercial operation date","License...

40

Entiat 4Mile WELLs Completion Report, 2006.  

DOE Green Energy (OSTI)

The Entiat 4-mile Wells (Entiat 4-mile) project is located in the Entiat subbasin and will benefit Upper Columbia steelhead, spring Chinook and bull trout. The goal of this project is to prevent juvenile fish from being diverted into an out-of-stream irrigation system and to eliminate impacts due to the annual maintenance of an instream pushup dam. The objectives include eliminating a surface irrigation diversion and replacing it with two wells, which will provide Bonneville Power Administration (BPA) and the Bureau of Reclamation (Reclamation) with a Federal Columbia River Power System (FCRPS) BiOp metric credit of one. Wells were chosen over a new fish screen based on biological benefits and costs. Long-term biological benefits are provided by completely eliminating the surface diversion and the potential for fish entrainment in a fish screen. Construction costs for a new fish screen were estimated at $150,000, which does not include other costs associated with implementing and maintaining a fish screening project. Construction costs for a well were estimated at $20,000 each. The diversion consisted of a pushup dam that diverted water into an off-channel pond. Water was then pumped into a pressurized system for irrigation. There are 3 different irrigators who used water from this surface diversion, and each has multiple water right claims totaling approximately 5 cfs. Current use was estimated at 300 gallons per minute (approximately 0.641 cfs). Some irrigated acreage was taken out of orchard production less than 5 years ago. Therefore, approximately 6.8 acre-feet will be put into the State of Washington Trust Water Right program. No water will be set aside for conservation savings. The construction of the two irrigation wells for three landowners was completed in September 2006. The Lower Well (Tippen/Wick) will produce up to 175 gpm while the Upper Well (Griffith) will produce up to 275 gpm during the irrigation season. The eight inch diameter wells were developed to a depth of 75 feet and 85 feet, respectively, and will be pumped with Submersible Turbine pumps. The irrigation wells have been fitted with new electric boxes and Siemens flowmeters (MAG8000).

Malinowksi, Richard

2007-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "area miles mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

Petroleum Reduction Strategies to Reduce Vehicle Miles Traveled |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Reduce Vehicle Miles Traveled Reduce Vehicle Miles Traveled Petroleum Reduction Strategies to Reduce Vehicle Miles Traveled October 7, 2013 - 11:52am Addthis YOU ARE HERE: Step 3 For reducing greenhouse gas emissions, the table below describes petroleum reduction strategies to reduce vehicle miles traveled, as well as guidance and best practices for each strategy. Table 1. Determining When and How to Promote the Use of Strategies to Reduce Vehicle Miles Traveled Strategy When Applicable Best Practices Consolidate trips Applicable to all vehicles, regardless of ownership or vehicle and fuel type Target vehicle operators who take longer trips Seek vehicle operator input and collaboration to identify regular or occasional trips that involve similar routes. Determine whether trips on multiple days or times can be consolidated into a single trip.

42

Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...

43

US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.

44

US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.

45

RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.

46

Final Environmental Assessment for the Cheyenne-Miracle Mile and Ault-Cheyenne Transmission Line Rebuild Project  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Assessment Assessment Cheyenne-Miracle Mile and Ault-Cheyenne Transmission Line Rebuild Project DOE/EA -1456 U.S. Department of Energy Western Area Power Administration Rocky Mountain Region Loveland, Colorado October 2006 Final Environmental Assessment Cheyenne-Miracle Mile and Ault-Cheyenne Transmission Line Rebuild Project DOE/EA-1456 U.S. Department of Energy Western Area Power Administration Rocky Mountain Region Loveland, Colorado October 2006 Table of Contents CH-MM & AU-CH Transmission Line Rebuild Table of Contents i Table of Contents Summary ......................................................................................................................................... 1 1.0 Introduction ..................................................................................................................

47

HEALTH EFFECTS OF THE NUCLEAR ACCIDENT AT THREE MILE ISLAND  

E-Print Network (OSTI)

within 50 miles of the nuclear power plant was estimated tothe radiation from the nuclear power plant accident. From anand the Peach Bottom nuclear power plants, like the general

Fabrikant, J.I.

2010-01-01T23:59:59.000Z

48

Odometer Versus Self-Reported Estimates of Vehicle Miles Traveled  

Reports and Publications (EIA)

The findings described here compare odometer readings with self-reported estimates of Vehicle Miles Traveled (VMT) to investigate to what extent self-reported VMT is a reliable surrogate for odometer-based VMT.

Information Center

2000-08-01T23:59:59.000Z

49

Sacramento Area Voltage Support - Environment - Sierra Nevada...  

NLE Websites -- All DOE Office Websites (Extended Search)

Western's Sierra Nevada Region (SNR) operates and maintains more than 1,200 miles of transmission lines. These transmission lines are interconnected to other Sacramento area...

50

AREA  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

AREA AREA FAQ # Question Response 316 vs DCAA FAQ 1 An inquiry from CH about an SBIR recipient asking if a DCAA audit is sufficient to comply with the regulation or if they need to add this to their audit they have performed yearly by a public accounting firm. 316 audits are essentially A-133 audits for for-profit entities. They DO NOT replace DCAA or other audits requested by DOE to look at indirect rates or incurred costs or closeouts. DCAA would never agree to perform A-133 or our 316 audits. They don't do A-133 audits for DOD awardees. The purpose of the audits are different, look at different things and in the few instances of overlap, from different perspectives. 316

51

Taking the tire the final mile  

Science Conference Proceedings (OSTI)

In 1990 the Scott County Health Department formed a local Waste Tire Task Force to address the growing problem of illegally dumped tires in Scott County, Iowa. Strategies developed by the task force included providing convenient, low cost disposal; increasing public awareness; and promoting participation in recycling efforts. The task force has held several free waste tire collections, including Waste Tire Amnesty Days and an Earth Week event. At the recommendation of the task force, regular tire disposal fees at the Scott County Landfill, operated by the Scott Area Solid Waste Management Commission, were also reduced. Through the task force efforts, 107,000 waste tires, including several stockpiles, have been recovered in Scott County. Many were recycled, some at a local cement plant, which used them as fuel for a test burn. Complaints to the health department regarding accumulations of waste tires have decreased. The commitment to managing waste tires in Scott County is ongoing; the most recent free, tire disposal day was held in May 1994.

Moore, G.A. [Scott County Health Dept., Davenport, IA (United States); Wuestenberg, T.; Hall, J.

1995-07-01T23:59:59.000Z

52

Vehicle Technologies Office: Fact #369: April 25, 2005 Medium-Truck Miles  

NLE Websites -- All DOE Office Websites (Extended Search)

9: April 25, 9: April 25, 2005 Medium-Truck Miles by Age to someone by E-mail Share Vehicle Technologies Office: Fact #369: April 25, 2005 Medium-Truck Miles by Age on Facebook Tweet about Vehicle Technologies Office: Fact #369: April 25, 2005 Medium-Truck Miles by Age on Twitter Bookmark Vehicle Technologies Office: Fact #369: April 25, 2005 Medium-Truck Miles by Age on Google Bookmark Vehicle Technologies Office: Fact #369: April 25, 2005 Medium-Truck Miles by Age on Delicious Rank Vehicle Technologies Office: Fact #369: April 25, 2005 Medium-Truck Miles by Age on Digg Find More places to share Vehicle Technologies Office: Fact #369: April 25, 2005 Medium-Truck Miles by Age on AddThis.com... Fact #369: April 25, 2005 Medium-Truck Miles by Age Medium trucks (class 3-6) were driven an average of 14,439 miles in 2002.

53

MHK Projects/Fortyeight Mile Point Project | Open Energy Information  

Open Energy Info (EERE)

Fortyeight Mile Point Project Fortyeight Mile Point Project < MHK Projects Jump to: navigation, search << Return to the MHK database homepage Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"500px","height":"350px","centre":false,"title":"","label":"","icon":"File:Aquamarine-marker.png","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":30.0447,"lon":-90.6659,"alt":0,"address":"","icon":"http:\/\/prod-http-80-800498448.us-east-1.elb.amazonaws.com\/w\/images\/7\/74\/Aquamarine-marker.png","group":"","inlineLabel":"","visitedicon":""}]}

54

one mile underground into a deep saline formation. The injection  

NLE Websites -- All DOE Office Websites (Extended Search)

mile underground into a deep saline formation. The injection, mile underground into a deep saline formation. The injection, which will occur over a three-year period and is slated to start in early 2010, will compress up to 1 million metric tonnes of CO 2 from the ADM ethanol facility into a liquid-like, dense phase. The targeted rock formation, the Mt. Simon Sandstone, is the thickest and most widespread saline reservoir in the Illinois Basin, with an estimated CO 2 storage capacity of 27 to 109 billion metric tonnes. A comprehensive monitoring program, which will be evaluated yearly, will be implemented after the injection to ensure the injected CO 2 is stored safely and permanently. The RCSP Program was launched by the Office of Fossil Energy (FE)

55

MHK Projects/Twelve Mile Point Project | Open Energy Information  

Open Energy Info (EERE)

Twelve Mile Point Project Twelve Mile Point Project < MHK Projects Jump to: navigation, search << Return to the MHK database homepage Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"500px","height":"350px","centre":false,"title":"","label":"","icon":"File:Aquamarine-marker.png","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":29.9177,"lon":-89.9307,"alt":0,"address":"","icon":"http:\/\/prod-http-80-800498448.us-east-1.elb.amazonaws.com\/w\/images\/7\/74\/Aquamarine-marker.png","group":"","inlineLabel":"","visitedicon":""}]}

56

Seven Mile, Ohio: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Mile, Ohio: Energy Resources Mile, Ohio: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 39.480056°, -84.5518916° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.480056,"lon":-84.5518916,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

57

miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed

58

Lessons Learned from Three Mile Island Packaging, Transportation and Disposition that Apply to Fukushima Daiichi Recovery  

SciTech Connect

Following the massive earthquake and resulting tsunami damage in March of 2011 at the Fukushima Daiichi nuclear power plant in Japan, interest was amplified for what was done for recovery at the Three Mile Island Unit 2 (TMI-2) in the United States following its meltdown in 1979. Many parallels could be drawn between to two accidents. This paper presents the results of research done into the TMI-2 recovery effort and its applicability to the Fukushima Daiichi cleanup. This research focused on three topics: packaging, transportation, and disposition. This research work was performed as a collaboration between Japans Central Research Institute of Electric Power Industry (CRIEPI) and the Idaho National Laboratory (INL). Hundreds of TMI-2 related documents were searched and pertinent information was gleaned from these documents. Other important information was also obtained by interviewing employees who were involved first hand in various aspects of the TMI-2 cleanup effort. This paper is organized into three main sections: (1) Transport from Three Mile Island to Central Facilities Area at INL, (2) Transport from INL Central Receiving Facility to INL Test Area North (TAN) and wet storage at TAN, and (3) Transport from TAN to INL Idaho Nuclear Technology and Engineering Center (INTEC) and Dry Storage at INTEC. Within each of these sections, lessons learned from performing recovery activities are presented and their applicability to the Fukushima Daiichi nuclear power plant cleanup are outlined.

Layne Pincock; Wendell Hintze; Dr. Koji Shirai

2012-07-01T23:59:59.000Z

59

Vehicle Technologies Office: Fact #473: June 11, 2007 Vehicle-Miles per  

NLE Websites -- All DOE Office Websites (Extended Search)

3: June 11, 2007 3: June 11, 2007 Vehicle-Miles per Licensed Driver to someone by E-mail Share Vehicle Technologies Office: Fact #473: June 11, 2007 Vehicle-Miles per Licensed Driver on Facebook Tweet about Vehicle Technologies Office: Fact #473: June 11, 2007 Vehicle-Miles per Licensed Driver on Twitter Bookmark Vehicle Technologies Office: Fact #473: June 11, 2007 Vehicle-Miles per Licensed Driver on Google Bookmark Vehicle Technologies Office: Fact #473: June 11, 2007 Vehicle-Miles per Licensed Driver on Delicious Rank Vehicle Technologies Office: Fact #473: June 11, 2007 Vehicle-Miles per Licensed Driver on Digg Find More places to share Vehicle Technologies Office: Fact #473: June 11, 2007 Vehicle-Miles per Licensed Driver on AddThis.com... Fact #473: June 11, 2007 Vehicle-Miles per Licensed Driver

60

Figure 72. Vehicle miles traveled per licensed driver, 1970-2040 ...  

U.S. Energy Information Administration (EIA)

Sheet3 Sheet2 Sheet1 Figure 72. Vehicle miles traveled per licensed driver, 1970-2040 (thousand miles) History Reference case 1970.00 $8.69 1971.00 $9.01

Note: This page contains sample records for the topic "area miles mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

894 AP880212-0103 -1 ville is 60 miles east of Aspen , 40 ...  

Science Conference Proceedings (OSTI)

894 AP880212-0103 -1 ville is 60 miles east of Aspen , 40 miles south o 894 AP880328-0088 -1 all overnight , while 6 inches was reported at Asp ...

2002-04-29T23:59:59.000Z

62

MI  

NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)

63

Corrective Action Investigation Plan for Corrective Action Unit 447: Project Shoal Area, Nevada Subsurface Site  

SciTech Connect

This Corrective Action Investigation Plan (CAIP) describes the US Department of Energy's (DOE's) continued environmental investigation of the subsurface Project Shoal Area (PSA) Corrective Action Unit (CAU) 447. The PSA is located in the Sand Springs Mountains in Churchill County, Nevada, about 48 kilometers (km) (30 miles [mi]) southeast of Fallon, Nevada. Project Shoal was part of the Vela Uniform Program which was conducted to improve the US' ability to detect, identify, and locate underground nuclear detonations. The test consisted of detonating a 12-kiloton nuclear device deep underground in granitic rock to determine whether seismic waves produced by an underground nuclear test could be differentiated from seismic waves produced by a naturally occurring earthquake. The test was a joint effort conducted by the US Atomic Energy Commission (AEC) and the US Department of Defense (DoD) in October 1963 (AEC, 1964).

DOE /NV

1998-11-01T23:59:59.000Z

64

Vehicle Technologies Office: Fact #552: January 5, 2009 Vehicle Miles of  

NLE Websites -- All DOE Office Websites (Extended Search)

2: January 5, 2: January 5, 2009 Vehicle Miles of Travel by Region to someone by E-mail Share Vehicle Technologies Office: Fact #552: January 5, 2009 Vehicle Miles of Travel by Region on Facebook Tweet about Vehicle Technologies Office: Fact #552: January 5, 2009 Vehicle Miles of Travel by Region on Twitter Bookmark Vehicle Technologies Office: Fact #552: January 5, 2009 Vehicle Miles of Travel by Region on Google Bookmark Vehicle Technologies Office: Fact #552: January 5, 2009 Vehicle Miles of Travel by Region on Delicious Rank Vehicle Technologies Office: Fact #552: January 5, 2009 Vehicle Miles of Travel by Region on Digg Find More places to share Vehicle Technologies Office: Fact #552: January 5, 2009 Vehicle Miles of Travel by Region on AddThis.com... Fact #552: January 5, 2009

65

Methodology for Estimating ton-Miles of Goods Movements for U.S. Freight Mulitimodal Network System  

SciTech Connect

Ton-miles is a commonly used measure of freight transportation output. Estimation of ton-miles in the U.S. transportation system requires freight flow data at disaggregated level (either by link flow, path flows or origin-destination flows between small geographic areas). However, the sheer magnitude of the freight data system as well as industrial confidentiality concerns in Census survey, limit the freight data which is made available to the public. Through the years, the Center for Transportation Analysis (CTA) of the Oak Ridge National Laboratory (ORNL) has been working in the development of comprehensive national and regional freight databases and network flow models. One of the main products of this effort is the Freight Analysis Framework (FAF), a public database released by the ORNL. FAF provides to the general public a multidimensional matrix of freight flows (weight and dollar value) on the U.S. transportation system between states, major metropolitan areas, and remainder of states. Recently, the CTA research team has developed a methodology to estimate ton-miles by mode of transportation between the 2007 FAF regions. This paper describes the data disaggregation methodology. The method relies on the estimation of disaggregation factors that are related to measures of production, attractiveness and average shipments distances by mode service. Production and attractiveness of counties are captured by the total employment payroll. Likely mileages for shipments between counties are calculated by using a geographic database, i.e. the CTA multimodal network system. Results of validation experiments demonstrate the validity of the method. Moreover, 2007 FAF ton-miles estimates are consistent with the major freight data programs for rail and water movements.

Oliveira Neto, Francisco Moraes [ORNL; Chin, Shih-Miao [ORNL; Hwang, Ho-Ling [ORNL

2013-01-01T23:59:59.000Z

66

DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4

67

DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP

68

St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...

69

RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...

70

Corrective Action Investigation Plan for Corrective Action Unit 232: Area 25 Sewage Lagoons Nevada Test Site, Nevada  

Science Conference Proceedings (OSTI)

This Corrective Action Investigation Plan (CAIP) has been developed in accordance with the Federal Facility Agreement and Consent Order (FFACO) (1996) that was agreed to by the US Department of Energy, Nevada Operations Office (DOE/NV); the State of Nevada Division of Environmental Protection (NDEP); and the US Department of Defense. The CAIP is a document that provides or references all of the specific information for investigation activities associated with Corrective Action Units (CAUs) or Corrective Action Sites (CASs). According to the FFACO, CASs are sites potentially requiring corrective action(s) and may include solid waste management units or individual disposal or release sites. A CAU consists of one or more CASs grouped together based on geography, technical similarity, or agency responsibility for the purpose of determining corrective actions. This CAIP contains the environmental sample collection objectives and criteria for conducting site investigation activities at CAU 232, Area 25 Sewage Lagoons. Corrective Action Unit 232 consists of CAS 25-03-01, Sewage Lagoon, located in Area 25 of the Nevada Test Site (NTS). The NTS is approximately 65 miles (mi) northwest of Las Vegas, Nevada (Figure 1-1) (DOE/NV, 1996a). The Area 25 Sewage Lagoons (Figure 1-2) (IT, 1999b) are located approximately 0.3 mi south of the Test Cell 'C' (TCC) Facility and were used for the discharge of sanitary effluent from the TCC facility. For purposes of this discussion, this site will be referred to as either CAU 232 or the sewage lagoons.

DOE /NV Operations Office

1999-05-01T23:59:59.000Z

71

Vehicle Technologies Office: Fact #535: September 8, 2008 Vehicle Miles of  

NLE Websites -- All DOE Office Websites (Extended Search)

5: September 8, 5: September 8, 2008 Vehicle Miles of Travel (VMT) Declines in 2008 to someone by E-mail Share Vehicle Technologies Office: Fact #535: September 8, 2008 Vehicle Miles of Travel (VMT) Declines in 2008 on Facebook Tweet about Vehicle Technologies Office: Fact #535: September 8, 2008 Vehicle Miles of Travel (VMT) Declines in 2008 on Twitter Bookmark Vehicle Technologies Office: Fact #535: September 8, 2008 Vehicle Miles of Travel (VMT) Declines in 2008 on Google Bookmark Vehicle Technologies Office: Fact #535: September 8, 2008 Vehicle Miles of Travel (VMT) Declines in 2008 on Delicious Rank Vehicle Technologies Office: Fact #535: September 8, 2008 Vehicle Miles of Travel (VMT) Declines in 2008 on Digg Find More places to share Vehicle Technologies Office: Fact #535:

72

Vehicle Technologies Office: Fact #227: July 29, 2002 Vehicle Miles of  

NLE Websites -- All DOE Office Websites (Extended Search)

7: July 29, 2002 7: July 29, 2002 Vehicle Miles of Travel (VMT) and Age by Vehicle Type to someone by E-mail Share Vehicle Technologies Office: Fact #227: July 29, 2002 Vehicle Miles of Travel (VMT) and Age by Vehicle Type on Facebook Tweet about Vehicle Technologies Office: Fact #227: July 29, 2002 Vehicle Miles of Travel (VMT) and Age by Vehicle Type on Twitter Bookmark Vehicle Technologies Office: Fact #227: July 29, 2002 Vehicle Miles of Travel (VMT) and Age by Vehicle Type on Google Bookmark Vehicle Technologies Office: Fact #227: July 29, 2002 Vehicle Miles of Travel (VMT) and Age by Vehicle Type on Delicious Rank Vehicle Technologies Office: Fact #227: July 29, 2002 Vehicle Miles of Travel (VMT) and Age by Vehicle Type on Digg Find More places to share Vehicle Technologies Office: Fact #227:

73

Closure Report for Corrective Action Unit 407: Roller Coaster RADSAFE Area, Tonopah Test Range, Nevada  

SciTech Connect

This closure report (CR) provides documentation for the closure of the Roller Coaster RADSAFE Area (RCRSA) Corrective Action Unit (CAU) 407 identified in the Federal Facility Agreement and Consent Order (FFACO) (Nevada Division of Environmental Protection [NDEP] et al., 1996). CAU 407 is located at the Tonopah Test Range (TTR), Nevada. The TTR is approximately 225 kilometers (km) (140 miles [mi]) northwest of Las Vegas, Nevada (Figure 1). The RCRSA is located on the northeast comer of the intersection of Main Road and Browne's Lake Road, which is approximately 8 km (5 mi) south of Area 3 (Figure 1). The RCRSA was used during May and June of 1963 to decontaminate vehicles, equipment, and personnel from the Double Tracks and Clean Slate tests. Investigation of the RCRSA was conducted from June through November of 1998. A Corrective Action Decision Document (CADD) (U.S. Department of Energy, Nevada Operations Office [DOEN], 1999) was approved in October of 1999. The purpose of this CR is to: Document the closure activities as proposed in the Corrective Action Plan (CAP) (DOEM, 2000). Obtain a Notice of Completion from the NDEP. Recommend the movement of CAU 407 from Appendix III to Appendix IV of the FFACO. The following is the scope of the closure actions implemented for CAU 407: Removal and disposal of surface soils which were over three times background for the area. Soils identified for removal were disposed of at the Area 5 Radioactive Waste Management Site (RWMS) at the Nevada Test Site (NTS). Excavated areas were backfilled with clean borrow soil located near the site. A soil cover was constructed over the waste disposal pit area, where subsurface constituents of concern remain. The site was fenced and posted as an ''Underground Radioactive Material'' area.

T. M. Fitzmaurice

2001-12-01T23:59:59.000Z

74

DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.

75

miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either

76

Figure 1.8 Motor Vehicle Fuel Economy, 1973-2011 (Miles per Gallon)  

U.S. Energy Information Administration (EIA)

Figure 1.8 Motor Vehicle Fuel Economy, 1973-2011 (Miles per Gallon) U.S. Energy Information Administration / Monthly Energy Review August 2013 17

77

Three Mile Island accident and post-accident recovery: what did we learn  

SciTech Connect

A description of the accident at Three Mile Island-2 reactor is presented. Activities related to the cleanup and decontamination of the reactor are described.

Collins, E.D.

1982-01-01T23:59:59.000Z

78

Table A1. U.S. Number of Vehicles, Vehicle-Miles, Motor Fuel ...  

U.S. Energy Information Administration (EIA)

Number of Vehicles Vehicle-Miles Traveled Motor Fuel Consumption Motor Fuel 2001 Household and Vehicle Expenditures ... Age of Primary Driver 16 to 17 Years ...

79

NREL: Living in the Golden Area  

NLE Websites -- All DOE Office Websites (Extended Search)

the Golden Area The National Renewable Energy Laboratory (NREL) is located in Golden, Colorado, just west of Denver, the state's capital. Called the Mile High City because of its...

80

TMI-2 (Three Mile Island Unit 2) core region defueling  

SciTech Connect

In July of 1982, a video camera was inserted into the Three Mile Island Unit 2 reactor vessel providing the first visual evidence of core damage. This inspection, and numerous subsequent data acquisition tasks, revealed a central void /approx/1.5 m (5 ft) deep. This void region was surrounded by partial length fuel assemblies and ringed on the periphery by /approx/40 full-length, but partial cross-section, fuel assemblies. All of the original 177 fuel assemblies exhibited signs of damage. The bottom of the void cavity was covered with a bed of granular rubble, fuel assembly upper end fittings, control rod spiders, fuel rod fragments, and fuel pellets. It was obvious that the normal plant refueling system not suitable for removing the damaged core. A new system of defueling tools and equipment was necessary to perform this task. Design of the new system was started immediately, followed by >1 yr of fabrication. Delivery and checkout of the defueling system occurred in mid-1985. Actual defueling was initiated in late 1985 with removal of the debris bed at the bottom of the core void. Obstructions to the debris, such as end fittings and fuel rod fragments ere removed first; then /approx/23,000 kg (50,000lb) of granular debris was quickly loaded into canisters. Core region defueling was completed in late 1987, /approx/2 yr after it was initiated.

Rodabaugh, J.M.; Cowser, D.K.

1988-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "area miles mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...

82

DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical

83

DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated

84

Corrective Action Investigation Plan for Corrective Action Unit 551: Area 12 Muckpiles, Nevada Test Site, Nevada, Rev. No.: 0  

SciTech Connect

This Corrective Action Investigation Plan (CAIP) contains project-specific information including facility descriptions, environmental sample collection objectives, and criteria for conducting site investigation activities at Corrective Action Unit (CAU) 551, Area 12 muckpiles, Nevada Test Site (NTS), Nevada. This CAIP has been developed in accordance with the ''Federal Facility Agreement and Consent Order'' (FFACO) (1996) that was agreed to by the State of Nevada, the U.S. Department of Energy (DOE), and the U.S. Department of Defense. Corrective Action Unit 551 is located in Area 12 of the NTS, which is approximately 110 miles (mi) northwest of Las Vegas, Nevada (Figure 1-1). Area 12 is approximately 40 miles beyond the main gate to the NTS. Corrective Action Unit 551 is comprised of the four Corrective Action Sites (CASs) shown on Figure 1-1 and listed below: (1) 12-01-09, Aboveground Storage Tank and Stain; (2) 12-06-05, Muckpile; (3) 12-06-07, Muckpile; and (4) 12-06-08, Muckpile. Corrective Action Site 12-01-09 is located in Area 12 and consists of an above ground storage tank (AST) and associated stain. Corrective Action Site 12-06-05 is located in Area 12 and consists of a muckpile associated with the U12 B-Tunnel. Corrective Action Site 12-06-07 is located in Area 12 and consists of a muckpile associated with the U12 C-, D-, and F-Tunnels. Corrective Action Site 12-06-08 is located in Area 12 and consists of a muckpile associated with the U12 B-Tunnel. In keeping with common convention, the U12B-, C-, D-, and F-Tunnels will be referred to as the B-, C-, D-, and F-Tunnels. The corrective action investigation (CAI) will include field inspections, radiological surveys, and sampling of media, where appropriate. Data will also be obtained to support waste management decisions.

David A. Strand

2004-06-01T23:59:59.000Z

85

Corrective Action Investigation Plan for Corrective Action Unit 551: Area 12 Muckpiles, Nevada Test Site, Nevada, Rev. No. 0  

SciTech Connect

This Corrective Action Investigation Plan (CAIP) contains project-specific information including facility descriptions, environmental sample collection objectives, and criteria for conducting site investigation activities at Corrective Action Unit (CAU) 551, Area 12 muckpiles, Nevada Test Site (NTS), Nevada. This CAIP has been developed in accordance with the ''Federal Facility Agreement and Consent Order'' (FFACO) (1996) that was agreed to by the State of Nevada, the U.S. Department of Energy (DOE), and the U.S. Department of Defense. Corrective Action Unit 551 is located in Area 12 of the NTS, which is approximately 110 miles (mi) northwest of Las Vegas, Nevada (Figure 1-1). Area 12 is approximately 40 miles beyond the main gate to the NTS. Corrective Action Unit 551 is comprised of the four Corrective Action Sites (CASs) shown on Figure 1-1 and listed below: (1) 12-01-09, Aboveground Storage Tank and Stain; (2) 12-06-05, Muckpile; (3) 12-06-07, Muckpile; and (4) 12-06-08, Muckpile. Corrective Action Site 12-01-09 is located in Area 12 and consists of an above ground storage tank (AST) and associated stain. Corrective Action Site 12-06-05 is located in Area 12 and consists of a muckpile associated with the U12 B-Tunnel. Corrective Action Site 12-06-07 is located in Area 12 and consists of a muckpile associated with the U12 C-, D-, and F-Tunnels. Corrective Action Site 12-06-08 is located in Area 12 and consists of a muckpile associated with the U12 B-Tunnel. In keeping with common convention, the U12B-, C-, D-, and F-Tunnels will be referred to as the B-, C-, D-, and F-Tunnels. The corrective action investigation (CAI) will include field inspections, radiological surveys, and sampling of media, where appropriate. Data will also be obtained to support waste management decisions.

Robert F. Boehlecke

2004-06-01T23:59:59.000Z

86

Inventory of thermal springs and wells within a one-mile radius of Yucca Lodge, Truth or Consequences, New Mexico  

DOE Green Energy (OSTI)

Equity Management Corporation proposes (1) to build about 30 condominiums at the present site of the Yucca Lodge, Truth or Consequences, New Mexico and (2) to heat the condominiums with the natural thermal waters that discharge from the property. To do so the corporation must satisfy the rules and regulations of four state and federal agencies. To satisfy some of the data requirements of these agencies and to provide basic data on the geohydrology of the area this report provides the results of a field inventory of the springs and wells within one mile of the lodge. Table 1 summarizes the data for eight springs and three sites where springs once issued. Table 2 summarizes the data on forty-four operable wells and thirty wells that are unusable in their present condition. Appendices list (1) wells presumed to be in the area but not located during field inspection and (2) wells that could be in the area, but were found to be beyond the one-mile radius. Temperature and specific conductance of the water show only minor variation within the recognized hot-water.

Schwab, G.E.

1982-02-01T23:59:59.000Z

87

MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab

2008-10-01T23:59:59.000Z

88

Subsurface geology and geopressured/geothermal resource evaluation of the Lirette-Chauvin-Lake Boudreaux area, Terrebonne Parish, Louisiana  

Science Conference Proceedings (OSTI)

The geology of a 125 square mile area located about 85 miles southeast of Baton Rouge and about 12 miles southeast of Houma, Louisiana, has been studied to evaluate its potential for geopressured/geothermal energy resources. Structure, stratigraphy, and sedimentation were studied in conjunction with pressure and temperature distributions over a broad area to locate and identify reservoirs that may be prospective. Recommendations concerning future site specific studies within the current area are proposed based on these findings.

Lyons, W.S.

1982-12-01T23:59:59.000Z

89

Miles Below the Earth: The Next-Generation of Geothermal Energy |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Miles Below the Earth: The Next-Generation of Geothermal Energy Miles Below the Earth: The Next-Generation of Geothermal Energy Miles Below the Earth: The Next-Generation of Geothermal Energy February 7, 2011 - 12:34pm Addthis John Schueler John Schueler Former New Media Specialist, Office of Public Affairs What will the project do? Enhanced geothermal systems (EGS) essentially create man-made reservoirs that mimic naturally occurring pockets of steam- with the potential for use as a reliable, 24/7 source of renewable energy. For more than a century, traditional geothermal power plants have been generating electricity by extracting pockets of steam found miles below the Earth's surface. Until recently though, those plants could only be constructed in locations where pockets of steam had formed naturally. Enhanced geothermal systems (EGS) have been crafted to solve that problem

90

Autonomous personal vehicle for the first- and last-mile transportation services  

E-Print Network (OSTI)

This paper describes an autonomous vehicle testbed that aims at providing the first- and last- mile transportation services. The vehicle mainly operates in a crowded urban environment whose features can be extracted a ...

Chong, Z. J.

91

Regulations for Gas Transmission Lines Less than Ten Miles Long (New York)  

Energy.gov (U.S. Department of Energy (DOE))

Any person who wishes to construct a gas transmission line that is less than ten miles long must file documents describing the construction plans and potential land use and environmental impacts of...

92

Does telecommuting reduce vehicle-miles traveled? An aggregate time series analysis for the US  

E-Print Network (OSTI)

of Telecommuting. US DOE Office of Policy, Planning, andProgram Evaluation, Report No. DOE/PO-0026, Washington, DC.Holtzclaw, John (undated): Does a mile in a car equal a

Choo, Sangho; Mokhtarian, Patricia L; Salomon, Ilan

2005-01-01T23:59:59.000Z

93

Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)

2012-01-01T23:59:59.000Z

94

DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP

95

RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state

96

Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mkinen; Jorma Tarhio

2010-02-01T23:59:59.000Z

97

Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png

98

Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls

99

Toward 300 Miles on a Single Charge? | U.S. DOE Office of Science (SC)  

NLE Websites -- All DOE Office Websites (Extended Search)

Toward 300 Miles on a Single Charge? Toward 300 Miles on a Single Charge? Discovery & Innovation Stories of Discovery & Innovation Brief Science Highlights SBIR/STTR Highlights Contact Information Office of Science U.S. Department of Energy 1000 Independence Ave., SW Washington, DC 20585 P: (202) 586-5430 11.27.13 Toward 300 Miles on a Single Charge? Berkeley Lab scientists design a high-performance, long cycle-life lithium-sulfur battery. Print Text Size: A A A Subscribe FeedbackShare Page Click to enlarge photo. Enlarge Photo Scanning electron microscope image of sulfur graphene oxide. Photo courtesy of Lawrence Berkeley National Laboratory Scanning electron microscope image of sulfur graphene oxide. The batteries that pervade your life these days-from your cell phone to your sleek new tablet and even to your automobile, if you happen to drive

100

Methodology for Calculating Cost-per-Mile for Current and Future Vehicle Powertrain Technologies, with Projections to 2024: Preprint  

DOE Green Energy (OSTI)

Currently, several cost-per-mile calculators exist that can provide estimates of acquisition and operating costs for consumers and fleets. However, these calculators are limited in their ability to determine the difference in cost per mile for consumer versus fleet ownership, to calculate the costs beyond one ownership period, to show the sensitivity of the cost per mile to the annual vehicle miles traveled (VMT), and to estimate future increases in operating and ownership costs. Oftentimes, these tools apply a constant percentage increase over the time period of vehicle operation, or in some cases, no increase in direct costs at all over time. A more accurate cost-per-mile calculator has been developed that allows the user to analyze these costs for both consumers and fleets. The calculator was developed to allow simultaneous comparisons of conventional light-duty internal combustion engine (ICE) vehicles, mild and full hybrid electric vehicles (HEVs), and fuel cell vehicles (FCVs). This paper is a summary of the development by the authors of a more accurate cost-per-mile calculator that allows the user to analyze vehicle acquisition and operating costs for both consumer and fleets. Cost-per-mile results are reported for consumer-operated vehicles travelling 15,000 miles per year and for fleets travelling 25,000 miles per year.

Ruth, M.; Timbario, T. A.; Timbario, T. J.; Laffen, M.

2011-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "area miles mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

Comparative analysis of nuclear crisis communication: 2011 Fukushima nuclear crisis and 1979 Three Mile Island nuclear crisis.  

E-Print Network (OSTI)

??This paper examines the crisis management of two prominent nuclear crises - 2011 Fukushima Nuclear Crisis in Japan and 1979 Three Mile Island Nuclear Crisis (more)

Lu, Yang

2012-01-01T23:59:59.000Z

102

,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...

103

,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...

104

Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.

105

Fuel Economy of the 2013 Mitsubishi i-MiEV  

NLE Websites -- All DOE Office Websites (Extended Search)

the Mobile Version of This Page Automatic (A1) Electricity Compare Side-by-Side EV EPA Fuel Economy Miles per Gallon Personalize Electricity* 112 Combined 126 City 99 Highway...

106

Tables of co-located geothermal-resource sites and BLM Wilderness Study Areas  

DOE Green Energy (OSTI)

Matched pairs of known geothermal wells and springs with BLM proposed Wilderness Study Areas (WSAs) were identified by inspection of WSA and Geothermal resource maps for the states of Arizona, California, Colorado, Idaho, Montana, Nevada, New Mexico, Oregon, Utah, Washington and Wyoming. A total of 3952 matches, for geothermal sites within 25 miles of a WSA, were identified. Of these, only 71 (1.8%) of the geothermal sites are within one mile of a WSA, and only an additional 100 (2.5%) are within one to three miles. Approximately three-fourths of the matches are at distances greater than ten miles. Only 12 of the geothermal sites within one mile of a WSA have surface temperatures reported above 50/sup 0/C. It thus appears that the geothermal potential of WSAs overall is minimal, but that evaluation of geothermal resources should be considered in more detail for some areas prior to their designation as Wilderness.

Foley, D.; Dorscher, M.

1982-11-01T23:59:59.000Z

107

"Table 11. Fuel Economy, Selected Survey Years (Miles Per Gallon)"  

U.S. Energy Information Administration (EIA) Indexed Site

Fuel Economy, Selected Survey Years (Miles Per Gallon)" Fuel Economy, Selected Survey Years (Miles Per Gallon)" ,"Survey Years" ,1983,1985,1988,1991,1994,2001 "Total",15.1,16.1,18.3,19.3,19.8,20.2 "Household Characteristics" "Census Region and Division" " Northeast",15.6,"NA",19.6,20.9,20.7,20.85531 " New England",16.5,"NA",19.7,21.1,20.4,20.97907 " Middle Atlantic ",15.3,"NA",19.6,20.8,20.8,20.79659 " Midwest ",14.8,"NA",18.2,19,20.1,20.18362 " East North Central",14.9,"NA",18.4,19.4,20.1,20.26056 " West North Central ",14.5,"NA",17.8,17.9,20,20.01659 " South",15,"NA",18,19.2,19.6,20.17499 " South Atlantic",15.6,"NA",19,20.2,20.2,20.5718

108

MHK Projects/Thirty Five Mile Point Project | Open Energy Information  

Open Energy Info (EERE)

Thirty Five Mile Point Project Thirty Five Mile Point Project < MHK Projects Jump to: navigation, search << Return to the MHK database homepage Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"500px","height":"350px","centre":false,"title":"","label":"","icon":"File:Aquamarine-marker.png","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":30.0146,"lon":-90.4774,"alt":0,"address":"","icon":"http:\/\/prod-http-80-800498448.us-east-1.elb.amazonaws.com\/w\/images\/7\/74\/Aquamarine-marker.png","group":"","inlineLabel":"","visitedicon":""}]}

109

18 MILES NORTH OF PHlLADEl.PHlA HATBORO, PA. August  

Office of Legacy Management (LM)

8 MILES NORTH OF PHlLADEl.PHlA 8 MILES NORTH OF PHlLADEl.PHlA HATBORO, PA. August 27, 1948 ! ! Frank Giaccio' Commission / I This follows my letter of August ZOth, in which I promised to advise you of our thoughts concerning beryllium, after I had completed a series of con- tacts with both.Government and private,grou?s and had an opportunity to evaluate the possibilities of using our process from the point of view of industrial research. By this, I meanthe possibility of the research leading into substantial production of parts. I believe I mentioned some of the contacts to you when I was in your office, and that we still had more to make. It is my opinion now that as far as beryllium is concerned, I cannot visualize the possibility of large production runs of parts; because it is

110

MHK Projects/Eighty One Mile Point Project | Open Energy Information  

Open Energy Info (EERE)

Eighty One Mile Point Project Eighty One Mile Point Project < MHK Projects Jump to: navigation, search << Return to the MHK database homepage Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"500px","height":"350px","centre":false,"title":"","label":"","icon":"File:Aquamarine-marker.png","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":30.16,"lon":-91.0056,"alt":0,"address":"","icon":"http:\/\/prod-http-80-800498448.us-east-1.elb.amazonaws.com\/w\/images\/7\/74\/Aquamarine-marker.png","group":"","inlineLabel":"","visitedicon":""}]}

111

Three Mile Island Plugged Tube Severance: A Study of Damage Mechanisms  

Science Conference Proceedings (OSTI)

During Fall 2001 outages, eddy-current inspections at Three Mile Island Unit 1 and Oconee Nuclear Station Unit 1 revealed wear scars on tubes surrounding previously plugged tubes. In both cases, investigations determined that the plugged tubes had severed and impacted neighboring tubes. As a result, the Nuclear Regulatory Commission (NRC) issued Information Notice 2002-02, which did not require a response but did suggest the industry investigate the generic problem of plugged tubes damaging neighboring t...

2003-05-19T23:59:59.000Z

112

Nondestructive techniques for assaying fuel debris in piping at Three Mile Island Unit 2  

SciTech Connect

Four major categories of nondestructive techniques - ultrasonic, passive gamma ray, infrared detection, and remote video examination - have been determined to be feasible for assaying fuel debris in the primary coolant system of the Three Mile Island Unit 2 (TMI-2) Reactor. Passive gamma ray detection is the most suitable technique for the TMI-2 piping; however, further development of this technique is needed for specific application to TMI-2.

Vinjamuri, K.; McIsaac, C.V.; Beller, L.S.; Isaacson, L.; Mandler, J.W.; Hobbins, R.R. Jr.

1981-11-01T23:59:59.000Z

113

Area Lodging | Y-12 National Security Complex  

NLE Websites -- All DOE Office Websites (Extended Search)

Area Lodging Area Lodging Area Lodging Oak Ridge Area Comfort Inn 433 South Rutgers Avenue Oak Ridge, TN 37830 865.481.8200 (1.800.228.5150) fax 865.483.6142 1.2 miles from Y-12 Corporate Quarters, Inc. Fully Furnished Apartments Oak Ridge/Knoxville/Nationwide 10912 Murdock Road Knoxville, TN 37932 865.675.3146 (1.800.697.9312) Days Inn 206 South Illinois Avenue Oak Ridge, TN 37830 865.483.5615 (1.800.544.8313) fax 865.483.5615 1.7 miles from Y-12 DoubleTree® Hotel 215 South Illinois Avenue Oak Ridge, TN 37830 865.481.2468; 1.800.222.8733 (1.800.222.TREE) fax 865.481.2474 1.7 miles from Y-12 Hampton Inn 208 South Illinois Avenue Oak Ridge, TN 37830 865.482.7889 (1.800.HAMPTON) fax 865.482.7493 1.6 miles from Y-12 Quality Inn 216 South Rutgers Avenue Oak Ridge, TN 37830 865.483.6809 reservations: 505.247.2333

114

Table 5.1. U.S. Number of Vehicles, Vehicle-Miles, Motor Fuel Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

. U.S. Number of Vehicles, Vehicle-Miles, Motor Fuel Consumption . U.S. Number of Vehicles, Vehicle-Miles, Motor Fuel Consumption and Expenditures, 1994 1993 Household and 1994 Vehicle Characteristics RSE Column Factor: Number of Vehicles Vehicle-Miles Traveled Motor Fuel Consumption Motor Fuel Expenditures RSE Row Factor: (million) (percent) (billion) (percent) (billion gallons) (gallon percent) (quadril- lion Btu) (billion dollars) (percent) 0.9 0.8 1.1 1.0 1.1 1.0 1.1 1.1 1.0 Household Characteristics Total .................................................... 156.8 100.0 1,793 100.0 90.6 100.0 11.2 104.7 100.0 2.8 Census Region and Division Northeast ........................................... 26.6 17.0 299 16.7 14.5 16.0 1.8 17.2 16.4 5.7 New England ................................... 7.6 4.8 84 4.7 4.1 4.5 0.5 4.8 4.6 13.8 Middle Atlantic

115

Nuclear accident at Three Mile Island: its effect on a local community  

Science Conference Proceedings (OSTI)

This dissertation consists of a longitudinal case study of the extent to which the structure of community power in Riverside, (a pseudonym) Pennsylvania (the largest community located within five miles of the Three Mile Island nuclear facility) changed as a result of the March, 1979 accident. The investigation centers around testing a basic working hypothesis. Simply stated, this working hypothesis argues that Riverside's power structure has become more pluralistic in response to the Three Mile Island nuclear accident. An additional corollary to this working hypothesis is also tested. This corollary asserts that many of Riverside's community power actors have become much more cosmopolitan in their political-action tactics and problem-solving orientations as a results of the TMI crisis. The aforementioned working hypothesis and associated corollary are tested via the combined utilization of three different techniques for measuring the distribution of social power. The findings of the study clearly demonstrate the existence of increased pluralism, politicization, and cosmopolitanism within Riverside since March of 1979. Furthermore, these research results, and the entire dissertation itself, contribute to a number of subfields within the discipline of sociology. In particular,contributions are noted for the subfields of community power, social movements, and disaster research.

Behler, G.T. Jr.

1987-01-01T23:59:59.000Z

116

50,000 mile methanol/gasoline blend fleet study: a progress report  

DOE Green Energy (OSTI)

Seven current production automobiles are being used in a fleet study to obtain operational experience in using 10% methanol/90% gasoline blends as an automotive fuel. Data from chassis dynamometer tests (run according to the 1975--1978 Federal test procedure) have been obtained, showing fuel economy and exhaust emissions of carbon monoxide, oxides of nitrogen, unburned fuel, methanol, and aldehydes. These data are shown for each of the vehicles when operated on the 10% methanol blend, and on unleaded low octane Indolene. Chassis dynamometer tests were run at 5,000-mile intervals during the 35,000 miles accumulated on each of the four 1977 model-year vehicles and at 5,000 and 10,000 mile accumulation levels for each of the three 1978 model-year vehicles. These data show an average decrease in volumetric fuel economy (approx. = 5%) and a reduction in carbon monoxide emissions associated with the use of the 10% methanol blend. Exhaust emission deterioration factors are projected from the Federal test procedure urban cycle data. The most severe driveability problems that have been encountered thus far into the program are related to operating on a phase separated fuel and materials compatibility problems with an elastomer in the air-fuel control hardware of one vehicle.

Stamper, K R

1979-01-01T23:59:59.000Z

117

Corrective Action Investigation Plan for Corrective Action Unit 406: Area 3 Building 03-74 and Building 03-58 Under ground Discharge Points and Corrective Action Unit 429: Area 3 Building 03-55 and Area 9 Building 09-52 Underground Discharge Points, Tonopah Test Range, Nevada  

SciTech Connect

This Corrective Action Investigation Plan (CAIP) has been developed in accordance with the Federal Facility Agreement and Consent Order (FFACO) that was agreed to by the US Department of Energy, Nevada Operations Office (DOE/NV); the State of Nevada Division of Environmental Protection (NDEP); and the US Department of Defense (FFACO, 1996). The CAIP is a document that provides or references all of the specific information for investigation activities associated with Corrective Action Units (CAUs) or Corrective Action Sites (CASs). According to the FFACO (1996), CASs are sites potentially requiring corrective action(s) and may include solid waste management units or individual disposal or release sites. Corrective Action Units consist of one or more CASs grouped together based on geography, technical similarity, or agency responsibility for the purpose of determining corrective actions. This CAIP contains the environmental sample collection objectives and the criteria for conducting site investigation activities at the Underground Discharge Points (UDPs) included in both CAU 406 and CAU 429. The CAUs are located in Area 3 and Area 9 of the Tonopah Test Range (TTR). The TTR, included in the Nellis Air Force Range, is approximately 255 kilometers (km) (140 miles [mi]) northwest of Las Vegas, Nevada.

DOE /NV

1999-05-20T23:59:59.000Z

118

Corrective Action Investigation Plan for Corrective Action Unit 321: Area 22 Weather Station Fuel Storage, Nevada Test Site, Nevada  

SciTech Connect

This Corrective Action Investigation Plan (CAIP) has been developed in accordance with the Federal Facility Agreement and Consent Order (FFACO) that was agreed to by the US Department of Energy, Nevada Operations Office (DOE/NV); the State of Nevada Division of Environmental Protection (NDEP); and the US Department of Defense (FFACO, 1996). The CAIP is a document that provides or references all of the specific information for investigation activities associated with Corrective Action Units (CAUs) or Corrective Action Sites (CASs). According to the FFACO (1996), CASs are sites potentially requiring corrective action(s) and may include solid waste management units or individual disposal or release sites. A CAU consists of one or more CASs grouped together based on geography, technical similarity, or agency responsibility for the purpose of determining corrective actions. This CAIP contains the environmental sample collection objectives and the criteria for conducting site investigation activities at the CAU 321 Area 22 Weather Station Fuel Storage, CAS 22-99-05 Fuel Storage Area. For purposes of this discussion, this site will be referred to as either CAU 321 or the Fuel Storage Area. The Fuel Storage Area is located in Area 22 of the Nevada Test Site (NTS). The NTS is approximately 105 kilometers (km) (65 miles [mi]) northwest of Las Vegas, Nevada (Figure 1-1) (DOE/NV, 1996a). The Fuel Storage Area (Figure 1-2) was used to store fuel and other petroleum products necessary for motorized operations at the historic Camp Desert Rock facility which was operational from 1951 to 1958 at the Nevada Test Site, Nevada. The site was dismantled after 1958 (DOE/NV, 1996a).

DOE /NV

1999-01-28T23:59:59.000Z

119

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:

120

On 271 miles of Twin Cities-area roadways, bus drivers are allowed to operate their vehi-  

E-Print Network (OSTI)

Ferguson continued on page 2 Bus continued on page 3 Conference continued on page 2 Public-private of research at Reason Foundation, titled "P3s-- Public Private Partnerships? Or Peripatetic Pain in the Pants resources through the use of public-private partner- ships (P3s or PPPs) has become increasingly attractive

Minnesota, University of

Note: This page contains sample records for the topic "area miles mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Des Moines Area Community College | .EDUconnections  

NLE Websites -- All DOE Office Websites (Extended Search)

Ames Laboratory Ames Laboratory is one of DOE's 10 Office of Science world-class research laboratories, located on the Iowa State University campus just 35 miles from the Des Moines Area Community College. Ames Lab is operated by Iowa State University. Ames Laboratory Ames Laboratory is one of DOE's 10 Office of Science world-class research laboratories, located on the Iowa State University campus just 35 miles from the Des Moines Area Community College. Ames Lab is operated by Iowa State University. Scientific Programs Science Undergraduate Laboratory Internships at Ames Lab Pre-Service Teacher Program DOE Ames Lab Faculty and Student Program (FaST) DOE Ames Lab Community College Institute Program Des Moines Area Community College Des Moines Area Community College Des Moines, Iowa DOE Applauds DMACC's Science and Technical Programs Agri/Natural Resources Biology Biomass Operations Biotechnology Environmental Science Information Technology Manufacturing Technology Microcomputers Civil Engineering Pre-Medical Telecommunications

122

The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.

2005-05-01T23:59:59.000Z

123

Research and development activities on Three Mile Island Unit Two. Annual report for 1985  

Science Conference Proceedings (OSTI)

The year 1985 was significant in the cleanup of Three Mile Island Unit 2 (TMI-2). Major milestones in the project included lifting the plenum assembly from the reactor vessel and the start of operations to remove the damaged fuel from the reactor. This report summarizes these milestones and other TMI-2 related cleanup, research, and development activities. Other major topics include the following: waste immobilization and management; fuel shipping cask delivery and testing; sample acquisition and evaluation; and decontamination and dose reduction. 26 figs.

Not Available

1986-04-01T23:59:59.000Z

124

Compilation of Earthquakes from 1850-2007 within 200 miles of the Idaho National Laboratory  

SciTech Connect

An updated earthquake compilation was created for the years 1850 through 2007 within 200 miles of the Idaho National Laboratory. To generate this compilation, earthquake catalogs were collected from several contributing sources and searched for redundant events using the search criteria established for this effort. For all sets of duplicate events, a preferred event was selected, largely based on epicenter-network proximity. All unique magnitude information for each event was added to the preferred event records and these records were used to create the compilation referred to as INL1850-2007.

N. Seth Carpenter

2010-07-01T23:59:59.000Z

125

Data integrity review of Three Mile Island Unit 2. Hydrogen burn data. Volume 3  

DOE Green Energy (OSTI)

About 10 hours after the March 28, 1979 loss-of-coolant accident began at Three Mile Island Unit 2 (TMI-2), a hydrogen burn occurred inside the Reactor Building. This report reviews and presents data from 16 channels of resistance temperature detectors (RTDs), 2 steam generator pressure transmitters, 16 Reactor Building pressure switches, 2 channels of Reactor Building pressure measurements, and measurements of Reactor Building hydrogen, oxygen, and nitrogen concentrations with regard to their usefulness for determining the extent of the burn and the resulting pressure and temperature excursions inside the building.

Jacoby, J.K.; Nelson, R.A.; Nalezny, C.L.; Averill, R.H.

1983-09-01T23:59:59.000Z

126

DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;

127

DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP

128

DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co

129

Corrective Action Decision Document/Closure Report for Corrective Action Unit 529: Area 25 Contaminated Materials, Nevada Test Site, Nevada, Rev. No.: 1  

SciTech Connect

This Corrective Action Decision Document (CADD)/Closure Report (CR) has been prepared for Corrective Action Unit (CAU) 529, Area 25 Contaminated Materials, Nevada Test Site (NTS), Nevada, in accordance with the ''Federal Facility Agreement and Consent Order'' (FFACO) that was agreed to by the State of Nevada, U.S. Department of Energy (DOE), and the U.S. Department of Defense (FFACO, 1996). The NTS is approximately 65 miles (mi) northwest of Las Vegas, Nevada (Figure 1-1). Corrective Action Site (CAS) 25-23-17, Contaminated Wash, is the only CAS in CAU 529 and is located in Area 25 of the NTS, in Nye County, Nevada (Figure 1-2). Corrective Action Site 25-23-17, Contaminated Wash, was divided into nine parcels because of the large area impacted by past operations and the complexity of the source areas. The CAS was subdivided into separate parcels based on separate and distinct releases as determined and approved in the Data Quality Objectives (DQO) process and Corrective Action Investigation Plan (CAIP). Table 1-1 summarizes the suspected sources for the nine parcels. Corrective Action Site 25-23-17 is comprised of the following nine parcels: (1) Parcel A, Kiwi Transient Nuclear Test (TNT) 16,000-foot (ft) Arc Area (Kiwi TNT); (2) Parcel B, Phoebus 1A Test 8,000-ft Arc Area (Phoebus); (3) Parcel C, Topopah Wash at Test Cell C (TCC); (4) Parcel D, Buried Contaminated Soil Area (BCSA) l; (5) Parcel E, BCSA 2; (6) Parcel F, Borrow Pit Burial Site (BPBS); (7) Parcel G, Drain/Outfall Discharges; (8) Parcel H, Contaminated Soil Storage Area (CSSA); and (9) Parcel J, Main Stream/Drainage Channels.

Robert F. Boehlecke

2004-11-01T23:59:59.000Z

130

Corrective Action Plan for Corrective Action Unit 335: Area 6 Injection Well and Drain Pit Nevada Test Site, Nevada  

SciTech Connect

This Corrective Action Plan (CAP) has been prepared for Corrective Action Unit (CAU) 335, Area 6 Injection Well and Drain Pit, in accordance with the Federal Facility Agreement and Consent Order (FFACO) (1996). This CAP provides the methodology for implementing the approved corrective action alternative as listed in the Corrective Action Decision Document (CADD). However, there is one modification to the selected alternative. Due to the large area that would require fencing, it is proposed that instead of fencing, an appropriate number of warning signs attached to tee posts be used to delineate the use restriction area. CAU 335 is located in Area 6 of the Nevada Test Site (NTS) which is approximately 105 kilometers (km) (65 miles [mi]) northwest of Las Vegas, Nevada. CAU 335 is located in the Area 6 Well 3 Yard approximately 39 km (24 mi) north of Mercury, on the Mercury Highway and several hundred feet (ft) west along Road 6-06. CAU 335 consists of the following three Corrective Action Sites (CASs): CAS 06-20-01, Drums, Oil Waste, Spill; CAS 06-20-02, 20-inch Cased Hole; CAS 06-23-03, Drain Pit. The site history for CAU 335 is provided in the Corrective Action Investigation Plan (DOE/NV, 2000). Briefly, CAS 06-20-01, was used for storing material that was pumped out of CAS 06-20-02 and placed into four 208-liter (L) (55-gall [gal]) drums. The drums were taken to the NTS Area 5 Hazardous Waste Accumulation Site in 1991. CAS 06-20-01 will be closed with no further action required. Any spills associated with CAS 06-20-01 are addressed and considered part of CAS 06-20-02. CAS 06-20-02 was used for disposal of used motor oil, wastewater, and debris for an undetermined amount of time. In 1991, the casing was emptied of its contents, excavated, and backfilled. CAS 06-23-03 was used as a depository for effluent waste from truck-washing activities from 1960-1991.

K. B. Campbell

2002-10-01T23:59:59.000Z

131

Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011...

132

The Nevada Test Site as a Lunar Analog Test Area  

Science Conference Proceedings (OSTI)

The Nevada Test Site (NTS) is a large (1,350 square miles) secure site currently operated by National Security Technologies, LLC (NSTec), for the U.S. Department of Energy and was established in 1951 to provide a venue for testing nuclear weapons. Three areas with a variety of elevation and geological parameters were used for testing, but the largest number of tests was in Yucca Flat. The Yucca Flat area is approximately 5 miles wide and 20 miles long and approximately 460 subsidence craters resulted from testing in this area. The Sedan crater displaced approximately 12 million tons of earth and is the largest of these craters at 1,280 feet across and 320 feet deep. The profiles of Sedan and the other craters offer a wide variety of shapes and depths that are ideally suited for lunar analog testing.

Sheldon Freid

2007-02-13T23:59:59.000Z

133

Seven Mile Hill I & II Wind Farm | Open Energy Information  

Open Energy Info (EERE)

I & II Wind Farm I & II Wind Farm Jump to: navigation, search Name Seven Mile Hill I & II Wind Farm Facility Seven Mile Hill I & II Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner PacifiCorp Developer PacifiCorp Energy Purchaser PacifiCorp Location Between Hanna and Medicine Bow WY Coordinates 41.939079°, -106.372225° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.939079,"lon":-106.372225,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

134

Corrective Action Investigation Plan for Corrective Action Unit 135: Area 25 Underground Storage Tanks Nevada Test Site, Nevada  

SciTech Connect

This Corrective Action Investigation Plan (CAIP) has been developed in accordance with the Federal Facility Agreement and Consent Order (FFACO) that was agreed to by the US Department of Energy, Nevada Operations Office (DOE/NV); the State of Nevada Division of Environmental Protection (NDEP); and the US Department of Defense (FFACO, 1996). The CAIP is a document that provides or references all of the specific information for investigation activities associated with Corrective Action Units (CAUs) or Corrective Action Sites (CASs). According to the FFACO, CASs are sites potentially requiring corrective action(s) and may include solid waste management units or individual disposal or release sites (FFACO, 1996). Corrective Action Units consist of one or more CASs grouped together based on geography, technical similarity, or agency responsibility for the purpose of determining corrective actions. This CAIP contains the environmental sample collection objectives and the criteria for conducting site investigation activities at CAU 135, Area 25 Underground Storage Tanks (USTs), which is located on the Nevada Test Site (NTS). The NTS is approximately 105 kilometers (km) (65 miles [mi]) northwest of Las Vegas, Nevada.

U.S. Department of Energy, Nevada Operations Office

1999-05-05T23:59:59.000Z

135

DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on

136

DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:

137

MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units

138

REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

139

Analysis of the Three Mile Island Unit 2 hydrogen burn. Volume 4  

DOE Green Energy (OSTI)

As a basis for the analysis of the hydrogen burn which occurred in the Three Mile Island Containment on March 28, 1979, a study of recorded temperatures and pressures was made. Long-term temperature information was obtained from the multipoint temperature recorder which shows 12 containment atmosphere temperatures plotted every 6 min. The containment atmosphere pressure recorder provided excellent long- and short-term pressure information. Short-term information was obtained from the multiplex record of 24 channels of data, recorded every 3 sec, and the alarm printer record which shows status change events and prints out temperatures, pressures, and the time of the events. The timing of these four data recording systems was correlated and pertinent data were tabulated, analyzed, and plotted to show average containment temperature and pressure versus time. Photographs and videotapes of the containment entries provided qualitative burn information.

Henrie, J.O.; Postma, A.K.

1983-03-01T23:59:59.000Z

140

Investigation of hydrogen-burn damage in the Three Mile Island Unit 2 reactor building  

DOE Green Energy (OSTI)

About 10 hours after the March 28, 1979 Loss-of-Coolant Accident began at Three Mile Island Unit 2, a hydrogen deflagration of undetermined extent occurred inside the reactor building. Examinations of photographic evidence, available from the first fifteen entries into the reactor building, yielded preliminary data on the possible extent and range of hydrogen burn damage. These data, although sparse, contributed to development of a possible damage path and to an estimate of the extent of damage to susceptible reactor building items. Further information gathered from analysis of additional photographs and samples can provide the means for estimating hydrogen source and production rate data crucial to developing a complete understanding of the TMI-2 hydrogen deflagration. 34 figures.

Alvares, N.J.; Beason, D.G.; Eidem, G.R.

1982-06-01T23:59:59.000Z

Note: This page contains sample records for the topic "area miles mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper

2012-02-20T23:59:59.000Z

142

Corrective Action Investigation Plan for Corrective Action Unit 309: Area 12 Muckpiles, Nevada Test Site, Nevada, Rev. No.: 0  

SciTech Connect

This Corrective Action Investigation Plan (CAIP) contains project-specific information including facility descriptions, environmental sample collection objectives, and criteria for conducting site investigation activities at Corrective Action Unit (CAU) 309, Area 12 Muckpiles, Nevada Test Site (NTS), Nevada. This CAIP has been developed in accordance with the Federal Facility Agreement and Consent Order (FFACO) (1996) that was agreed to by the State of Nevada, the U.S. Department of Energy (DOE), and the U.S. Department of Defense (DoD). Corrective Action Unit 309 is located in Area 12 of the NTS, which is approximately 65 miles (mi) northwest of Las Vegas, Nevada (Figure 1-1). Area 12 is approximately 40 mi beyond the main gate to the NTS. Corrective Action Unit 309 is comprised of the three Corrective Action Sites (CASs) shown on Figure 1-1 and listed below: CAS 12-06-09, Muckpile; CAS 12-08-02, Contaminated Waste Dump (CWD); and CAS 12-28-01, I, J, and K-Tunnel Debris. Corrective Action Sites 12-06-09 and 12-08-02 will be collectively referred to as muckpiles in this document. Corrective Action Site 12-28-01 will be referred to as the fallout plume because of the extensive lateral area of debris and fallout contamination resulting from the containment failures of the J-and K-Tunnels. The corrective action investigation (CAI) will include field inspections, radiological surveys, and media sampling, where appropriate. Data will also be obtained to support waste management decisions. The CASs in CAU 309 are being investigated because hazardous and/or radioactive constituents may be present in concentrations that could potentially pose a threat to human health and/or the environment. Existing information on the nature and extent of potential contamination at these sites are insufficient to evaluate and recommend corrective action alternatives for the CASs. Therefore, additional information will be obtained by conducting a CAI prior to evaluating corrective action alternatives and selecting the appropriate corrective action for each CAS.

David A. Strand

2004-12-01T23:59:59.000Z

143

Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani

2012-10-01T23:59:59.000Z

144

Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel

2010-01-01T23:59:59.000Z

145

MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani

2012-12-01T23:59:59.000Z

146

The Cleanup of Three Mile Island Unit 2, A Technical History: 1979 to 1990: A Technical History: 1979 to 1990  

Science Conference Proceedings (OSTI)

The fuel damage and the release of fission products after the Three Mile Island unit 2 (TMI-2) accident required unprecedented decisions regarding the enormous cleanup operations. The rationale for those decisions will provide valuable information for other managers who may face similar situations. Planning and response procedures can benefit from the insights gained from the TMI-2 accident.

1990-10-01T23:59:59.000Z

147

Three Mile Island-1, Crystal River-3, and Davis-Besse Fuel Crud Observations Assessment and Root Cause  

Science Conference Proceedings (OSTI)

This report shares information pertaining to elevated crud observed on fuel at Babcock Wilcox (BW) plants Crystal River-3, Davis-Besse, and Three Mile Island-1 and the subsequent causal investigation performed by AREVA, Inc. Discussion of industry operating experience, effects of crud, fuel inspection results, and preventive and corrective actions in future operating cycles are also included.

2011-10-26T23:59:59.000Z

148

Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)

2011-12-01T23:59:59.000Z

149

Area 6 Decontamination Pond Corrective Action Unit 92 Post-Closure Inspection Annual Report for the Period January 2000-December 2000  

SciTech Connect

The Area 6 Decontamination Pond, Corrective Action Unit 92, was closed in accordance with the Resource Conservation and Recovery Act (RCRA) Part B Operational Permit (Nevada Division of Environmental Protection [NDEP, 1995]) and the Federal Facility Agreement and Consent Order (NDEP, 1996) on May 11, 1999. Historically the Decontamination Pond was used for the disposal of partially treated liquid effluent discharged from the Decontamination Facility (Building 6-05) and the Industrial Laundry (Building 6-07) (U.S. Department of Energy, Nevada Operations Office [DOE/NV], 1996). The Decontamination Pond was constructed and became operational in 1979. Releases of RCRA-regulated hazardous waste or hazardous waste constituents have not been discharged to the Decontamination Pond since 1988 (DOE/NV, 1996). The pipe connecting the Decontamination Pond and Decontamination Facility and Industrial Laundry were cut and sealed at the Decontamination Pad Oil/Water Separator in 1992. The Decontamination Pond was closed in place by installing a RCRA cover. Fencing was installed around the periphery to prevent accidental damage to the cover. Post-closure monitoring at the site consists of quarterly inspections of the RCRA cover and fencing, and a subsidence survey. Additional inspections are conducted if: Precipitation occurs in excess of 1.28 centimeters (cm) (0.50 inches [in]) in a 24-hour period, or An earthquake occurs with a magnitude exceeding 4.5 on the Richter scale within 100 kilometers (km) (62 miles [mi]) of the closure.

J. L. Traynor

2001-03-01T23:59:59.000Z

150

Heatup of the TMI-2 (Three Mile Island Unit 2) lower head during core relocation  

SciTech Connect

According to current perceptions of the Three Mile Island Unit 2 (TMI-2) accident, corium largely relocated into the reactor vessel lower head at {approximately}224 min into the accident. Defueling examinations have revealed that the corium relocated from the molten core region to the lower head predominantly by way of drainage through the core former region (CFR) located between the vertical baffle plates immediately surrounding the fuel assemblies and the core barrel. An analysis has been carried out to assess the heatup of the reactor vessel lower head during the core relocation event, particularly the potential for a melting attack on the lower head wall and the in-core instrument nozzle penetration weldments. The analysis employed the THIRMAL computer code developed at Argonne National Laboratory (ANL) to predict the breakup and quenching or corium jets under film boiling conditions as well as the size distributions and quenching of the resultant molten droplets. The transient heatup and ablation of the vessel wall and penetration weldments due to impinging corium jets was calculated using the MISTI computer code.

Wang, S.K.; Sienicki, J.J.; Spencer, B.W. (Argonne National Laboratory, IL (USA))

1989-11-01T23:59:59.000Z

151

Timing of the Three Mile Island Unit 2 core degradation as determined by forensic engineering  

DOE Green Energy (OSTI)

Unlike computer simulation of an event, forensic engineering is the evaluation of recorded data and damaged as well as surviving components after an event to determine progressive causes of the event. Such an evaluation of the 1979 Three Mile Island Unit 2 accident indicates that gas began accumulating in steam, generator A at 6:10, or 130 min into the accident and, therefore, fuel cladding ruptures and/or zirconium-water reactions began at that time. Zirconium oxidation/hydrogen generation rates were highest ({approximately}70 kg of hydrogen per minute) during the core quench and collapse at 175 min. By 180 min, over 85% of the hydrogen generated by the zirconium-water reaction had been produced, and {approximately}400 kg of hydrogen had accumulated in the reactor coolant system. At that time, hydrogen concentrations at the steam/water interfaces in both steam generators approached 90%. By 203 min, the damaged reactor core had been reflooded and has not been uncovered since that time. Therefore, the core was completely under water at 225 min, when molten core material flowed into the lower head of the reactor vessel. 10 refs., 7 figs., 1 tab.

Henrie, J.O. (Hydrogen Control, Inc., Panguitch, UT (USA))

1988-01-01T23:59:59.000Z

152

Historical summary of the Three Mile Island Unit 2 core debris transportation campaign  

Science Conference Proceedings (OSTI)

Transport of the damaged core materials from the Unit 2 reactor of the Three Mile Island Nuclear Power Station (TMI-2) to the Idaho National Engineering Laboratory (INEL) for examination and storage presented many technical and institutional challenges, including assessing the ability to transport the damaged core; removing and packaging core debris in ways suitable for transport; developing a transport package that could both meet Federal regulations and interface with the facilities at TMI-2 and the INEL; and developing a transport plan, support logistics, and public communications channels suited to the task. This report is a historical summary of how the US Department of Energy addressed those challenges and transported, received, and stored the TMI-2 core debris at the INEL. Subjects discussed include preparations for transport, loading at TMI-2, institutional issues, transport operations, receipt and storage at the INEL, governmental inquiries/investigations, and lessons learned. Because of public attention focused on the TMI-2 Core Debris Transport Program, the exchange of information between the program and public was extensive. This exchange is a focus for parts of this report to explain why various operations were conducted as they were and why certain technical approaches were employed. And, because of that exchange, the program may have contributed to a better public understanding of such actions and may contribute to planning and execution of similar future actions.

Schmitt, R.C.; Tyacke, M.J. [EG and G Idaho, Inc., Idaho Falls, ID (United States); Quinn, G.J. [Wastren, Inc., Germantown, MD (United States)

1993-03-01T23:59:59.000Z

153

A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)

2012-07-15T23:59:59.000Z

154

Corrective Action Decision Document/Closure Report for Corrective Action Unit 551: Area 12 Muckpiles, Nevada Test Site, Nevada, Rev. No.: 1  

Science Conference Proceedings (OSTI)

This Corrective Action Decision Document (CADD)/Closure Report (CR) presents information supporting closure of Corrective Action Unit (CAU) 551, Area 12 Muckpiles, Nevada Test Site (NTS), Nevada. The corrective actions proposed in this document are in accordance with the Federal Facility Agreement and Consent Order (FFACO) that was agreed to by the State of Nevada, U.S. Department of Energy (DOE), and the U.S. Department of Defense (FFACO, 1996). The NTS is approximately 65 miles (mi) northwest of Las Vegas, Nevada (Figure 1-1). Corrective Action Unit 551 is comprised of the four Corrective Action Sites (CASs) that are shown on Figure 1-2 and listed below: CAS 12-01-09, Aboveground Storage Tank and Stain; CAS 12-06-05, U-12b Muckpile; CAS 12-06-07, Muckpile; and CAS 12-06-08, Muckpile. A detailed discussion of the history of this CAU is presented in the ''Corrective Action Investigation Plan (CAIP) for Corrective Action Unit 551: Area 12 Muckpiles'' (NNSA/NSO, 2004). This CADD/CR provides justification for the closure of CAU 551 in place with administrative controls. This justification is based upon process knowledge and the results of the investigative activities conducted in accordance with the CAIP (NNSA/NSO, 2004). The CAIP provides information relating to the history, planning, and scope of the investigation; therefore, this information will not be repeated in the CADD/CR. Corrective Action Unit 551, Area 12 Muckpiles, consists of four inactive sites located in the southwestern portion of Area 12. The four CAU 551 sites consist of three muckpiles, and an aboveground storage tank (AST) and stain. The CAU 551 sites were all used during underground nuclear testing at the B-, C-, D- and F-Tunnels in the late 1950s and early 1960s and have mostly remained inactive since that period.

Wickline, Alfred

2006-11-01T23:59:59.000Z

155

Radiation effects on resins and zeolites at Three Mile Island Unit II  

DOE Green Energy (OSTI)

Radiation effects on resin and zeolite used in the waste cleanup at Three Mile Island Unit II have been examined both experimentally and in-situ. Hydrogen and organic gases are generated due to absorbed radiation as a function of resin material, curie loading and residual water content. Significant oxygen scavaging was demonstrated in the organic resin liners. Hydrogen and oxygen gases in near stoichiometric quantities are generated from irradiation of residual water in inorganic zeolites. Gas generation was determined to be directly proportional to curie content but correlates poorly with residual water content in zeolite vessels. Results of the gas generation analyses of EPICOR II liners show that vessels with less than 166 curies had almost no hydrogen generated during two years of storage and therefore did not require safety measures for shipment or storage. Experimental measurements done at research laboratories predicted similar results associated with hydrogen gas generation and oxygen depletion. X-ray diffraction examinations and ion exchange capacity measurements indicated no evidence of irradiation effects on the structure or cesium exchange capacity for zeolites exposed to 10/sup 10/ rads. Darkening and damage of organic resin due to radiation has been identified. Breaking and agglomeration of the purification demineralizer resin is believed to be the result of temperature effects. No damage was identified from radiation effects on zeolite. Organic and inorganic sorbents used in the processing of contaminated waters at TMI-2 have been shown to be effective in maintaining long-term stability under high radiation conditions. The effects of radiolytic degradation have been shown by direct measurements and simulation tests and are of use in their general application throughout the industry.

Reilly, J.K.; Grant, P.J.; Quinn, G.J.; Hofstetter, K.J.

1984-01-01T23:59:59.000Z

156

Western Area Power Administration  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

v*Zy- i , . v*Zy- i , . r ,v * -i S # Af [, (e- . - o -A tl }r- 0 v-" l^~4~S J l ^-)^ I^U^ck iM clti ^ Area Power Administration Follow-up to Nov. 25, 2008 Transition Meeting Undeveloped Transmission Right-of-Way Western has very little undeveloped transmission right-of-way. There is a 7-mile right- of-way between Folsom, CA and Roseville, CA where Western acquired a 250' wide right-of-way but is only using half of it. Another line could be built parallel to Western's line to relieve congestion in the Sacramento area. In addition, Western has rights-of- way for many transmission lines that could be rebuilt to increase transmission capacity. For example, Western's Tracy-Livermore 230-kV line is a single circuit line but the existing towers could support a double circuit line. These rights-of-way would have to

157

Field Mapping At Truckhaven Area (Layman Energy Associates, 2008) | Open  

Open Energy Info (EERE)

Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Field Mapping At Truckhaven Area (Layman Energy Associates, 2008) Exploration Activity Details Location Truckhaven Area Exploration Technique Field Mapping Activity Date Usefulness not indicated DOE-funding Unknown Notes A geologic map covering an approximately 70 square mile area centered on the Truckhaven geothermal prospect is shown in Figure 4. This map was prepared by modifying Dibblee's (1984) map using the results of LEA's detailed field mapping in the vicinity of the Truckhaven No. 1 well. Further detail is provided in Figure 5, which shows the results of a portion of LEA's mapping efforts, on an orthophoto base, within an ~7 square mile area which includes the Truckhaven No. 1 and Holly Corp. wells.

158

DOE Hydrogen and Fuel Cells Program Record 5038: Hydrogen Cost Competitive on a Cents per Mile Basis - 2006  

NLE Websites -- All DOE Office Websites (Extended Search)

8 Date: May 22, 2006 8 Date: May 22, 2006 Title: Hydrogen Cost Competitive on a Cents per Mile Basis - 2006 Originator: Patrick Davis & Steve Chalk Approved by: JoAnn Milliken Approval Date: May 22, 2006 Item : Lower the cost of hydrogen from natural gas to be competitive on a cents per mile basis with conventional gasoline vehicles. Supporting Information: The results of a 2003 economic analysis were used to estimate the cost of hydrogen produced from distributed natural gas reforming at $5 per gallon of gasoline equivalent (gge) (See U.S. DOE Record 5030: Hydrogen Baseline Cost of $5 per gge in 2003; available at http://www.hydrogen.energy.gov/program_records). Since the original analysis, DOE-sponsored R&D has resulted in significant cost reductions,

159

Draft Supplement to the Environmental Statement Fiscal Year 1976 Proposed Program : Facility Location Evaluation for Pebble Springs-Marion 500-KV Line Study Area 75-B.  

SciTech Connect

Proposed is construction of an approximately 160 mile long, 500-kV, double-circuit transmission line from the proposed Pebble Springs Substation located southeast of Arlington, Oregon, to the existing Marion Substation, 11 miles west of Maupin, Oregon. Development is also proposed of a major switching complex, Pebble Springs Substation, near Arlington, Oregon. Depending on the final route chosen, from 45 to 71 miles of parallel, 9 to 42 miles of new, and 74 miles of existing right-of-way will be required. New access road requirements will range from 45 to 90 miles. Land use affected by the proposed facilities includes 800 to 855 acres of forestland removed from timber production. In addition, 50 miles of cropland, primarily wheat, and approximately 35 miles of grassland will be crossed. Disturbance to wildlife during construction will occur and habitat associated with the above land uses will be eliminated. Soil erosion and siltation, primarily during and immediately after construction will also occur. Visual impacts will occur near several highways, lakes, rivers, and recreation areas. Disturbances to nearby residents will occur during construction. An additional 45 acres of rangeland will be required for the proposed Pebble Springs Substation.

United States. Bonneville Power Administration.

1974-10-22T23:59:59.000Z

160

Simulation analysis of the unconfined aquifer, Raft River Geothermal Area,  

Open Energy Info (EERE)

Simulation analysis of the unconfined aquifer, Raft River Geothermal Area, Simulation analysis of the unconfined aquifer, Raft River Geothermal Area, Idaho-Utah Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Report: Simulation analysis of the unconfined aquifer, Raft River Geothermal Area, Idaho-Utah Details Activities (1) Areas (1) Regions (0) Abstract: This study covers about 1000 mi2 (2600 km2) of the southern Raft River drainage basin in south-central Idaho and northwest Utah. The main area of interest, approximately 200 mi2 (520 km2) of semiarid agricultural and rangeland in the southern Raft River Valley that includes the known Geothermal Resource Area near Bridge, Idaho, was modelled numerically to evaluate the hydrodynamics of the unconfined aquifer. Computed and estimated transmissivity values range from 1200 feet squared per day (110

Note: This page contains sample records for the topic "area miles mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

Corrective Action Decision Document/Closure Report for Corrective Action Unit 309: Area 12 Muckpiles, Nevada Test Site, Nevada, Rev. No.: 0 with Errata Sheet  

SciTech Connect

This Corrective Action Decision Document/Closure Report (CADD/CR) has been prepared for Corrective Action Unit (CAU) 309, Area 12 Muckpiles, Nevada Test Site (NTS), Nevada. The corrective actions proposed in this document are according to the ''Federal Facility Agreement and Consent Order'' (FFACO) that was agreed to by the State of Nevada, U.S. Department of Energy (DOE), and the U.S. Department of Defense (FFACO, 1996). The NTS is approximately 65 miles (mi) northwest of Las Vegas, Nevada (Figure 1-1). Corrective Action Unit 309 is comprised of the three Corrective Action Sites (CASs) (Figure 1-1) listed below: (1) CAS 12-06-09, Muckpile; (2) CAS 12-08-02, Contaminated Waste Dump (CWD); and (3) CAS 12-28-01, I-, J-, and K-Tunnel Debris. Corrective Action Sites 12-06-09 and 12-08-02 will be collectively referred to as muckpiles in this document. Corrective Action Site 12-28-01 will be referred to as the fallout plume because of the extensive lateral area of debris and fallout contamination resulting from the containment failures of the J- and K-Tunnels. A detailed discussion of the history of this CAU is presented in the ''Corrective Action Investigation Plan (CAIP) for Corrective Action Unit 309: Area 12 Muckpiles, Nevada Test Site (NTS), Nevada.'' (NNSA/NSO, 2004). This CADD/CR provides justification for the closure of CAU 309 without further corrective action. This justification is based on process knowledge and the results of the investigative activities conducted according to the CAIP (NNSA/NSO, 2004), which provides information relating to the history, planning, and scope of the investigation. Therefore, this information will not be repeated in this CADD/CR.

Alfred Wickline

2005-12-01T23:59:59.000Z

162

Corrective Action Decision Document/Closure Report for Corrective Action Unit 309: Area 12 Muckpiles, Nevada Test Site, Nevada, Rev. No.: 0 with Errata Sheet  

SciTech Connect

This Corrective Action Decision Document/Closure Report (CADD/CR) has been prepared for Corrective Action Unit (CAU) 309, Area 12 Muckpiles, Nevada Test Site (NTS), Nevada. The corrective actions proposed in this document are according to the ''Federal Facility Agreement and Consent Order'' (FFACO) that was agreed to by the State of Nevada, U.S. Department of Energy (DOE), and the U.S. Department of Defense (FFACO, 1996). The NTS is approximately 65 miles (mi) northwest of Las Vegas, Nevada (Figure 1-1). Corrective Action Unit 309 is comprised of the three Corrective Action Sites (CASs) (Figure 1-1) listed below: (1) CAS 12-06-09, Muckpile; (2) CAS 12-08-02, Contaminated Waste Dump (CWD); and (3) CAS 12-28-01, I-, J-, and K-Tunnel Debris. Corrective Action Sites 12-06-09 and 12-08-02 will be collectively referred to as muckpiles in this document. Corrective Action Site 12-28-01 will be referred to as the fallout plume because of the extensive lateral area of debris and fallout contamination resulting from the containment failures of the J- and K-Tunnels. A detailed discussion of the history of this CAU is presented in the ''Corrective Action Investigation Plan (CAIP) for Corrective Action Unit 309: Area 12 Muckpiles, Nevada Test Site (NTS), Nevada.'' (NNSA/NSO, 2004). This CADD/CR provides justification for the closure of CAU 309 without further corrective action. This justification is based on process knowledge and the results of the investigative activities conducted according to the CAIP (NNSA/NSO, 2004), which provides information relating to the history, planning, and scope of the investigation. Therefore, this information will not be repeated in this CADD/CR.

Alfred Wickline

2005-12-01T23:59:59.000Z

163

Citrus County Extension Office From I-75, take Exit # 329 (old # 66), SR 44 and go West on SR 44 toward Inverness/Crystal River (approx. 17 miles). Follow SR 44  

E-Print Network (OSTI)

on SR 44 toward Inverness/Crystal River (approx. 17 miles). Follow SR 44 through Inverness to traffic

Watson, Craig A.

164

Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.

1997-10-01T23:59:59.000Z

165

Geothermal resource assessment of Canon City, Colorado Area  

DOE Green Energy (OSTI)

In 1979 a program was initiated to fully define the geothermal conditions of an area east of Canon City, bounded by the mountains on the north and west, the Arkansas River on the south and Colorado Highway 115 on the east. Within this area are a number of thermal springs and wells in two distinct groups. The eastern group consists of 5 thermal artesian wells located within one mile of Colorado Highway 115 from Penrose on the north to the Arkansas river on the south. The western group, located in and adjacent to Canon City, consists of one thermal spring on the south bank of the Arkansas River on the west side of Canon City, a thermal well in the northeast corner of Canon City, another well along the banks of Four Mile Creek east of Canon City and a well north of Canon City on Four Mile Creek. All the thermal waters in the Canon City Embayment, of which the study area is part of, are found in the study area. The thermal waters unlike the cold ground waters of the Canon City Embayment, are a calcium-bicarbonate type and range in temperature from 79 F (26 C) to a high of 108 F (42 C). The total combined surface discharge o fall the thermal water in the study area is in excess of 532 acre feet (A.F.) per year.

Zacharakis, Ted G.; Pearl, Richard Howard

1982-01-01T23:59:59.000Z

166

T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab

2012-02-11T23:59:59.000Z

167

Review of Destructive Assay Methods for Nuclear Materials Characterization from the Three Mile Island (TMI) Fuel Debris  

SciTech Connect

This report provides a summary of the literature review that was performed and based on previous work performed at the Idaho National Laboratory studying the Three Mile Island 2 (TMI-2) nuclear reactor accident, specifically the melted fuel debris. The purpose of the literature review was to document prior published work that supports the feasibility of the analytical techniques that were developed to provide quantitative results of the make-up of the fuel and reactor component debris located inside and outside the containment. The quantitative analysis provides a technique to perform nuclear fuel accountancy measurements

Carla J. Miller

2013-09-01T23:59:59.000Z

168

Property:FirstWellDepth | Open Energy Information  

Open Energy Info (EERE)

FirstWellDepth FirstWellDepth Jump to: navigation, search Property Name FirstWellDepth Property Type Quantity Use this type to express a quantity of length. The default unit is the meter (m). Acceptable units (and their conversions) are: Meters - 1 m, meter, meters Meter, Meters, METER, METERS Kilometers - 0.001 km, kilometer, kilometers, Kilometer, Kilometers, KILOMETERS, KILOMETERS Miles - 0.000621371 mi, mile, miles, Mile, Miles, MILE, MILES Feet - 3.28084 ft, foot, feet, Foot, Feet, FOOT, FEET Yards - 1.09361 yd, yard, yards, Yard, Yards, YARD, YARDS Pages using the property "FirstWellDepth" Showing 5 pages using this property. B Blue Mountain Geothermal Area + 672 m0.672 km 0.418 mi 2,204.724 ft 734.906 yd + K Kilauea East Rift Geothermal Area + 1,968 m1.968 km

169

Property:AvgReservoirDepth | Open Energy Information  

Open Energy Info (EERE)

AvgReservoirDepth AvgReservoirDepth Jump to: navigation, search Property Name AvgReservoirDepth Property Type Quantity Description Average depth to reservoir Use this type to express a quantity of length. The default unit is the meter (m). Acceptable units (and their conversions) are: Meters - 1 m, meter, meters Meter, Meters, METER, METERS Kilometers - 0.001 km, kilometer, kilometers, Kilometer, Kilometers, KILOMETERS, KILOMETERS Miles - 0.000621371 mi, mile, miles, Mile, Miles, MILE, MILES Feet - 3.28084 ft, foot, feet, Foot, Feet, FOOT, FEET Yards - 1.09361 yd, yard, yards, Yard, Yards, YARD, YARDS Pages using the property "AvgReservoirDepth" Showing 24 pages using this property. A Amedee Geothermal Area + 213 m0.213 km 0.132 mi 698.819 ft 232.939 yd + B Beowawe Hot Springs Geothermal Area + 850 m0.85 km

170

OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown

2013-10-01T23:59:59.000Z

171

In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma

2013-06-01T23:59:59.000Z

172

NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk

173

An Econometric Analysis of the Elasticity of Vehicle Travel with Respect to Fuel Cost per Mile Using RTEC Survey Data  

Science Conference Proceedings (OSTI)

This paper presents the results of econometric estimation of the ''rebound effect'' for household vehicle travel in the United States based on a comprehensive analysis of survey data collected by the U.S. Energy Information Administration (EIA) at approximately three-year intervals over a 15-year period. The rebound effect is defined as the percent change in vehicle travel for a percent change in fuel economy. It summarizes the tendency to ''take back'' potential energy savings due to fuel economy improvements in the form of increased vehicle travel. Separate vehicles use models were estimated for one-, two-, three-, four-, and five-vehicle households. The results are consistent with the consensus of recently published estimates based on national or state-level data, which show a long-run rebound effect of about +0.2 (a ten percent increase in fuel economy, all else equal, would produce roughly a two percent increase in vehicle travel and an eight percent reduction in fuel use). The hypothesis that vehicle travel responds equally to changes in fuel cost-per-mile whether caused by changes in fuel economy or fuel price per gallon could not be rejected. Recognizing the interdependency in survey data among miles of travel, fuel economy and price paid for fuel for a particular vehicle turns out to be crucial to obtaining meaningful results.

Greene, D.L.; Kahn, J.; Gibson, R.

1999-03-01T23:59:59.000Z

174

Preliminary evaluation of wind energy potential: Cook Inlet area, Alaska  

DOE Green Energy (OSTI)

This report summarizes work on a project performed under contract to the Alaska Power Administration (APA). The objective of this research was to make a preliminary assessment of the wind energy potential for interconnection with the Cook Inlet area electric power transmission and distribution systems, to identify the most likely candidate regions (25 to 100 square miles each) for energy potential, and to recommend a monitoring program sufficient to quantify the potential.

Hiester, T.R.

1980-06-01T23:59:59.000Z

175

STREAMLINED APPROACH FOR ENVIRONMENTAL RESTORATION PLAN FOR CORRECTIVE ACTION UNIT 116: AREA 25 TEST CELL C FACILITYNEVADA TEST SITE, NEVADA  

SciTech Connect

This Streamlined Approach for Environmental Restoration Plan identifies the activities required for the closure of Corrective Action Unit 116, Area 25 Test Cell C Facility. The Test Cell C Facility is located in Area 25 of the Nevada Test Site approximately 25 miles northwest of Mercury, Nevada.

NONE

2006-07-01T23:59:59.000Z

176

Corrective Action Plan for Corrective Action Unit 262: Area 25 Septic Systems and Underground Discharge Point, Nevada Test Site, Nevada  

DOE Green Energy (OSTI)

This Corrective Action Plan (CAP) provides selected corrective action alternatives and proposes the closure methodology for Corrective Action Unit (CAU) 262, Area 25 Septic Systems and Underground Discharge Point. CAU 262 is identified in the Federal Facility Agreement and Consent Order (FFACO) of 1996. Remediation of CAU 262 is required under the FFACO. CAU 262 is located in Area 25 of the Nevada Test Site (NTS), approximately 100 kilometers (km) (62 miles [mi]) northwest of Las Vegas, Nevada. The nine Corrective Action Sites (CASs) within CAU 262 are located in the Nuclear Rocket Development Station complex. Individual CASs are located in the vicinity of the Reactor Maintenance, Assembly, and Disassembly (R-MAD); Engine Maintenance, Assembly, and Disassembly (E-MAD); and Test Cell C compounds. CAU 262 includes the following CASs as provided in the FFACO (1996); CAS 25-02-06, Underground Storage Tank; CAS 25-04-06, Septic Systems A and B; CAS 25-04-07, Septic System; CAS 25-05-03, Leachfield; CAS 25-05-05, Leachfield; CAS 25-05-06, Leachfield; CAS 25-05-08, Radioactive Leachfield; CAS 25-05-12, Leachfield; and CAS 25-51-01, Dry Well. Figures 2, 3, and 4 show the locations of the R-MAD, the E-MAD, and the Test Cell C CASs, respectively. The facilities within CAU 262 supported nuclear rocket reactor engine testing. Activities associated with the program were performed between 1958 and 1973. However, several other projects used the facilities after 1973. A significant quantity of radioactive and sanitary waste was produced during routine operations. Most of the radioactive waste was managed by disposal in the posted leachfields. Sanitary wastes were disposed in sanitary leachfields. Septic tanks, present at sanitary leachfields (i.e., CAS 25-02-06,2504-06 [Septic Systems A and B], 25-04-07, 25-05-05,25-05-12) allowed solids to settle out of suspension prior to entering the leachfield. Posted leachfields do not contain septic tanks. All CASs located in CAU 262 are inactive or abandoned. However, some leachfields may still receive liquids from runoff during storm events. Results from the 2000-2001 site characterization activities conducted by International Technology (IT) Corporation, Las Vegas Office are documented in the Corrective Action Investigation Report for Corrective Action Unit 262: Area 25 Septic Systems and Underground Discharge Point, Nevada Test Site, Nevada. This document is located in Appendix A of the Corrective Action Decision Document for CAU 262. Area 25 Septic Systems and Underground Discharge Point, Nevada Test Site, Nevada. (DOE/NV, 2001).

K. B. Campbell

2002-06-01T23:59:59.000Z

177

Geology of the Soda Lake geothermal area  

DOE Green Energy (OSTI)

The Soda Lake geothermal area is located in the Carson Desert, west-central Nevada. Hot springs activity has occurred in the Soda Lake area in the past, resulting in surface deposits which have motivated present geothermal exploration. The geothermal anomaly is in Quaternary clastic sediments which are as much as 4600 feet thick. The sediments consist of interbedded deltaic, lacustrine, and alluvial sediments. Quaternary basaltic igneous activity has produced cinder cones, phreatic explosions that formed the maar occupied by Soda Lake, and possible dikes. Opal deposition and soil alteration are restricted to a small area two miles north of Soda Lake. The location of hot springs activity and the surface thermal anomaly may be partially controlled by north-northeast-trending faults.

Sibbett, B.S.

1979-12-01T23:59:59.000Z

178

Three Mile Island Unit-2 core status summary: a basis for tool development for reactor disassembly and defueling  

DOE Green Energy (OSTI)

The accident at Three Mile Island Unit-2 (TMI-2) on March 28, 1979 caused extensive damage to the core. A variety of analyses were performed using three general approaches to determine the extent of core damage. First, thermal-hydraulic events were reconstructed using available data, thermal-hydraulic principles, and computer analyses. Second, determinations of the hydrogen generated yielded estimates of the amount of zircaloy oxidized and embrittled. Third, the type and quantity of fission products released during the accident were used to estimate the location of core damage and the fuel temperatures which were achieved. Uncertainties exist in each type of determination due to the equivocal nature of the data. This paper reviews and summarizes the core damage assessments which have been made, identifies the minimum and maximum bounds of damage, and establishes a reference description for the current status of the core.

Croucher, D.W.

1981-05-01T23:59:59.000Z

179

Transformer failure and common-mode loss of instrument power at Nine Mile Point Unit 2 on August 13, 1991  

Science Conference Proceedings (OSTI)

On August 13, 1991, at Nine Mile Point Unit 2 nuclear power plant, located near Scriba, New York, on Lake Ontario, the main transformer experienced an internal failure that resulted in degraded voltage which caused the simultaneous loss of five uninterruptible power supplies, which in turn caused the loss of several nonsafety systems, including reactor control rod position indication, some reactor power and water indication, control room annunciators, the plant communications system, the plant process computer, and lighting at some locations. The reactor was subsequently brought to a safe shutdown. Following this event, the US Nuclear Regulatory Commission dispatched an Incident Investigation Team to the site to determine what happened, to identify the probable causes, and to make appropriate findings and conclusions. This report describes the incident, the methodology used by the team in its investigation, and presents and the team's findings and conclusions. 59 figs., 14 tabs.

Not Available

1991-10-01T23:59:59.000Z

180

Evaluation of nuclear facility decommissioning projects: Summary status report: Three Mile Island Unit 2. Radioactive waste and laundry shipments  

SciTech Connect

This document summarizes information concerning radioactive waste and laundry shipments from the Three Mile Island Nuclear Station Unit 2 to radioactive waste disposal sites and to protective clothing decontamination facilities (laundries) since the loss of coolant accident experienced on March 28, 1979. Data were collected from radioactive shipment records, summarized, and placed in a computerized data information retrieval/manipulation system which permits extraction of specific information. This report covers the period of April 9, 1979 through April 19, 1987. Included in this report are: waste disposal site locations, dose rates, curie content, waste description, container type and number, volumes and weights. This information is presented in two major categories: protective clothing (laundry) and radioactive waste. Each of the waste shipment reports is in chronological order.

Doerge, D. H.; Haffner, D. R.

1988-06-01T23:59:59.000Z

Note: This page contains sample records for the topic "area miles mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Evaluation of Juvenile Fish Bypass and Adult Fish Passage Facilities at Three-Mile Falls Dam; Umatilla River, Oregon, 1989 Annual Report.  

DOE Green Energy (OSTI)

We report on our progress from October 1989 through September 1990 on evaluating juvenile fish bypass and adult fish passage facilities at Three Mile Falls Dam on the Umatilla River. The study is a cooperative effort by the Oregon Department of Fish and Wildlife (ODFW) and the Confederated Tribes of the Umatilla Indian Reservation (CTUIR). Study objectives addressed by ODFW and CTUIR are: (1) ODFW (Report A): Operate and evaluate the juvenile fish bypass system in the West Extension Irrigation District canal at Three Mile Falls Dam; and (2) CTUIR (Report 8): Examine the passage of adult salmonids at Three Mile Falls Dam. The study is part of a program to rehabilitate anadromous fish stocks in the Umatilla River Basin that includes restorations of coho salmon Oncorhynchus Wsutch and chinook salmon 0. tshawytscha and enhancement of summer steelhead 0. mytiss.

Nigro, Anthony A.

1990-09-01T23:59:59.000Z

182

Enhancing Livability with Feeder Transit Services: Formulation and Solutions to First/Last Mile Connectivity Problem  

E-Print Network (OSTI)

This dissertation begins with proposing a novel street Connectivity Indicator (C.I.) to predict transit performance by identifying the role that street network connectivity plays in influencing the service quality of demand responsive feeder transit services. This new C.I. definition is dependent upon the expected shortest path between any two nodes in the network, includes spatial features with transit demand distribution information and is easy to calculate for any given service area. Subsequently, a methodology to identify and locate critical links within a grid street system for operating feeder transit services is also developed. A 'critical' street link causes the largest change in transit performance due to the link's removal or addition to an existing network. The most important contribution of this section on link criticality is to present a simple closed-form analytical formula in locating the critical link(s) for a grid street network system of 'any' size. Easily computable formulas have been provided and validated by simulation analyses. Another related model is proposed to compute the optimal grid street spacing that would enhance performance of a demand responsive feeder transit system. The model is tested using simulation. Lastly, an analytical model is also developed for estimating optimal service cycle length or headway of a demand responsive feeder transit service designed to serve passengers, especially during peak periods of demand. Simulation analyses over a range of networks have been conducted to validate the new C.I. definition. Results show a desirable monotonic relationship between transit performance and the proposed C.I., whose values are directly proportional and therefore good predictors of the transit performance, outperforming other available indicators, typically used by planners. Further, useful insights indicate a monotonic decrease in link criticality as we depart from the centrally located links to those located at boundaries. Using a real case example from Denver of the Call-n-Ride system operating similar to a demand responsive feeder transit, optimal cycle lengths differed very modestly from those computed using the model. Extensive simulations performed for different sets of feeder service areas and demand densities, further validated the optimal cycle length model.

Chandra, Shailesh

2012-08-01T23:59:59.000Z

183

Research Areas  

NLE Websites -- All DOE Office Websites (Extended Search)

Areas Areas Research Areas Print Scientists from a wide variety of fields come to the ALS to perform experiements. Listed below are some of the most common research areas covered by ALS beamlines. Below each heading are a few examples of the specific types of topics included in that category. Click on a heading to learn more about that research area at the ALS. Energy Science Photovoltaics, photosynthesis, biofuels, energy storage, combustion, catalysis, carbon capture/sequestration. Bioscience General biology, structural biology. Materials/Condensed Matter Correlated materials, nanomaterials, magnetism, polymers, semiconductors, water, advanced materials. Physics Atomic, molecular, and optical (AMO) physics; accelerator physics. Chemistry Surfaces/interfaces, catalysts, chemical dynamics (gas-phase chemistry), crystallography, physical chemistry.

184

Corrective Action Investigation Plan for Corrective Action Unit 552: Area 12 Muckpile and Ponds, Nevada Test Site, Nevada, Rev. No.: 1 with ROTC 1 and 2  

Science Conference Proceedings (OSTI)

This Corrective Action Investigation Plan (CAIP) contains project-specific information including facility descriptions, environmental sample collection objectives, and criteria for conducting site investigation activities at Corrective Action Unit (CAU) 552: Area 12 Muckpile and Ponds, Nevada Test Site (NTS), Nevada. This CAIP has been developed in accordance with the ''Federal Facility Agreement and Consent Order'' (FFACO) (1996) that was agreed to by the State of Nevada, the U.S. Department of Energy (DOE), and the U.S. Department of Defense. The NTS is approximately 65 miles (mi) northwest of Las Vegas, Nevada (Figure 1-1). Corrective Action Unit 552 is comprised of the one Corrective Action Site which is 12-23-05, Ponds. One additional CAS, 12-06-04, Muckpile (G-Tunnel Muckpile), was removed from this CAU when it was determined that the muckpile is an active site. A modification to the FFACO to remove CAS 12-06-04 was approved by the Nevada Division of Environmental Protection (NDEP) on December 16, 2004. The G-Tunnel ponds were first identified in the 1991 Reynolds Electrical & Engineering Co., Inc. document entitled, ''Nevada Test Site Inventory of Inactive and Abandoned Facilities and Waste Sites'' (REECo, 1991). Corrective Action Unit 552 is being investigated because existing information on the nature and extent of potential contamination is insufficient to evaluate and recommend corrective action alternatives. Therefore, additional information will be obtained by conducting a corrective action investigation (CAI) prior to evaluating and selecting the corrective action alternatives for the site. The CAI will include field inspections, radiological surveys, and sampling of appropriate media. Data will also be obtained to support investigation-derived waste (IDW) disposal and potential future waste management decisions.

David A. Strand

2005-01-01T23:59:59.000Z

185

Property:Geothermal/AboutArea | Open Energy Information  

Open Energy Info (EERE)

AboutArea AboutArea Jump to: navigation, search Property Name Geothermal/AboutArea Property Type Text Description About the Area Pages using the property "Geothermal/AboutArea" Showing 18 pages using this property. A A 3D-3C Reflection Seismic Survey and Data Integration to Identify the Seismic Response of Fractures and Permeable Zones Over a Known Geothermal Resource at Soda Lake, Churchill Co., NV Geothermal Project + Churchill County, NV Alum Innovative Exploration Project Geothermal Project + Alum geothermal project is located in Nevada ~150 miles SE of Reno. It consists of federal geothermal leases that are 100% owned by SGP. Application of 2D VSP Imaging Technology to the Targeting of Exploration and Production Wells in a Basin and Range Geothermal System Humboldt House-Rye Patch Geothermal Area Geothermal Project + Humboldt House-Rye Patch (HH-RP) geothermal resource area

186

Research Areas  

NLE Websites -- All DOE Office Websites (Extended Search)

Research Areas Print Research Areas Print Scientists from a wide variety of fields come to the ALS to perform experiements. Listed below are some of the most common research areas covered by ALS beamlines. Below each heading are a few examples of the specific types of topics included in that category. Click on a heading to learn more about that research area at the ALS. Energy Science Photovoltaics, photosynthesis, biofuels, energy storage, combustion, catalysis, carbon capture/sequestration. Bioscience General biology, structural biology. Materials/Condensed Matter Correlated materials, nanomaterials, magnetism, polymers, semiconductors, water, advanced materials. Physics Atomic, molecular, and optical (AMO) physics; accelerator physics. Chemistry Surfaces/interfaces, catalysts, chemical dynamics (gas-phase chemistry), crystallography, physical chemistry.

187

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA

188

miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay

189

AMENDMENT OF SOLICITATION/MODIFICATlON OF CONTRACT MI54 I See...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....

190

Aeromagnetic Survey At Coso Geothermal Area (1977) | Open Energy  

Open Energy Info (EERE)

77) 77) Exploration Activity Details Location Coso Geothermal Area Exploration Technique Aeromagnetic Survey Activity Date 1977 Usefulness useful regional reconnaissance DOE-funding Unknown Notes A detailed low-altitude aeromagnetic survey of 576 line-mi (927 line-km) was completed over a portion of the Coso Hot Springs KGRA. This survey defined a pronounced magnetic low that could help delineate the geothermal system that has an areal extent of approximately 10 sq mi (26 sq km) partially due to magnetite destruction by hydrothermal solutions associated with the geothermal system. The anomoly coincides with two other geophysical anomalies: 1) a bedrock electrical resistivity low and 2) an area of relatively high near-surface temperatures. References Fox, R. C. (1 May 1978) Low-altitude aeromagnetic survey of a

191

Assessment of extent and degree of thermal damage to polymeric materials in the Three Mile Island Unit 2 Reactor building  

DOE Green Energy (OSTI)

This paper describes assumptions and procedures used to perform thermal damage analysis caused by post loss-of-coolant-accident (LOCA) hydrogen deflagration at Three Mile Island Unit 2 Reactor. Examination of available photographic evidence yields data on the extent and range of thermal and burn damage. Thermal damage to susceptible material in accessible regions of the reactor building was distributed in non-uniform patterns. No clear explanation for non-uniformity was found in examined evidence, e.g., burned materials were adjacent to materials that appear similar but were not burned. Because these items were in proximity to vertical openings that extend the height of the reactor building, we assume the unburned materials preferentially absorbed water vapor during periods of high, local steam concentration. A control pendant from the polar crane located in the top of the reactor building sustained asymmetric burn damage of decreasing degree from top to bottom. Evidence suggests the polar-crane pendant side that experienced heaviest damage was exposed to intense radiant energy from a transient fire plume in the reactor containment volume. Simple hydrogen-fire-exposure tests and heat transfer calculations approximate the degree of damage found on inspected materials from the containment building and support for an estimated 8% pre-fire hydrogen.

Alvares, N.J.

1985-06-01T23:59:59.000Z

192

Building The last mile'  

SciTech Connect

Utilities may want to leverage the multibillion-dollar investment cable television is about to make. Virtually every utility has corporate objectives to focus more on the customer and change the way the customer is viewed. Utility supply strategy has been shifting away from building large, expensive power plants to making smaller investments with flexible options that can be adjusted to suit future conditions. This strategy is requisite to helping utilities keep and build their share of the market. One result is that utilities and regulators have adopted the concept of demand-side management (DSM) with enthusiasm. What's more, the last 10 years have brought new utility initiatives to explore customer value-oriented pricing structures that recognize the varying cost of production. These DSM opportunities and pricing initiatives require utilities to communicate with customers and help them manage their electricity use. New DSM programs that rely on communications technology include: (1) Providing real-time price signals for electricity-and eventually gas and water; (2) Implementing a direct- or shared-load control program for peak clipping or valley filling by interacting with properly equipped smart appliances; (3) Providing beyond-the-meter value-added services for residential customers, such as weather monitoring, video communications, home comfort automation, appliance monitoring and diagnostics, and energy efficiency tips; and (4) Obtaining detailed data on customers' electricity use patterns to develop new DSM programs. One action by the utility industry will determine whether this strategic vision is achieved: the establishment of a two-way, user-friendly, voice, data, and video communication path to the customer from the utility.

Gupta, P.C.; Bringenberg, J.

1994-03-15T23:59:59.000Z

193

Radiological Areas  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Revision to Clearance Policy Associated with Recycle of Scrap Metals Originating from Revision to Clearance Policy Associated with Recycle of Scrap Metals Originating from Radiological Areas On July 13, 2000, the Secretary of Energy imposed an agency-wide suspension on the unrestricted release of scrap metal originating from radiological areas at Department of Energy (DOE) facilities for the purpose of recycling. The suspension was imposed in response to concerns from the general public and industry groups about the potential effects of radioactivity in or on material released in accordance with requirements established in DOE Order 5400.5, Radiation Protection of the Public and Environment. The suspension was to remain in force until DOE developed and implemented improvements in, and better informed the public about, its release process. In addition, in 2001 the DOE announced its intention to prepare a

194

miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li

2009-01-01T23:59:59.000Z

195

Savannah River Plant construction [100 Area History]: Volume 3  

SciTech Connect

This report discusses five Reactor (100) Areas constructed at SRP. They were designated as 100-C, K, L, P and R. A minimum distance of two miles separated any two of the areas which were laid out in the form of a semi-circle, Each area contained approximately 40 permanent buildings and facilities for a total of 200 buildings for all of the 100 Areas. Construction was started on the R Area first and this was the first area to be completed and accepted by Operations. Construction of the other areas was started and completed in the following sequence: P, L, K and C. The difference in the design and construction of the various facilities in these areas is noted under the individual building discussion on the following pages of this section of the Construction History and also in the du Pont Engineering and Design History. In the series of manufacturing operations the separation of fissionable materials produced in the 100 Areas is accomplished by chemical and physical means in the 200 Areas These are the 200-F and 200-H Areas which have duplicate facilities in the process phase. However, a central laboratory, area shops, laundry, metallurgical and storage magazine buildings were constructed in the 200-F Area only and serve both areas. These activities are also presented in this report.

1957-01-01T23:59:59.000Z

196

Modal shifts in short-haul passenger travel and the consequent energy impacts. [Intercity travel under 500 miles  

SciTech Connect

A study was performed to evaluate the impacts of strategies to effect modal shifts in short-haul passenger travel (defined herein as intercity travel under 500 miles) from energy-intensive modes to those modes that are less energy-intensive. A series of individual strategies, ranging from incentives to the less energy-intensive modes (bus, rail) to penalties to the more energy-intensive modes (auto, air) was examined to determine energy saved and policy implications relative to strategy implementation. The most effective of the individual strategies were then combined in all permutations, and the analysis was repeated. As part of the analytical process, effects of factors other than energy (user cost and time, emissions, government subsidy, and travel fatailities) were examined in a benefit/cost analysis. Finally, energy savings, benefit/cost impacts, implementation considerations, and policy implications were evaluated to arrive at conclusions as to the effectiveness of the more-influential strategies and to the overall effectiveness of induced modal shifts. The principal conclusion of the study is that the maximum 1980 energy saving that might be realized by modal shifts, discounting the concurrent effects of demand suppression and improvement of mode efficiency, is approximately 83 x 10/sup 12/ Btu (46,500 bbl gasoline per day), 3.8% of the total projected 1980 energy consumption in the short-haul transportation sector and 0.23% of the total US petroleum use. It was also concluded that strategies to achieve these small savings by modal shifts would result in significant economic, social, and business disruptions.

Not Available

1980-03-01T23:59:59.000Z

197

Revisiting Insights from Three Mile Island Unit 2 Postaccident Examinations and Evaluations in View of the Fukushima Daiichi Accident  

Science Conference Proceedings (OSTI)

The Three Mile Island Unit 2 (TMI-2) accident, which occurred on March 28, 1979, led industry and regulators to enhance strategies to protect against severe accidents in commercial nuclear power plants. Investigations in the years after the accident concluded that at least 45% of the core had melted and that nearly 19 tonnes of the core material had relocated to the lower head. Postaccident examinations indicate that about half of that material formed a solid layer near the lower head and above it was a layer of fragmented rubble. As discussed in this paper, numerous insights related to pressurized water reactor accident progression were gained from postaccident evaluations of debris, reactor pressure vessel (RPV) specimens, and nozzles taken from the RPV. In addition, information gleaned from TMI-2 specimen evaluations and available data from plant instrumentation were used to improve severe accident simulation models that form the technical basis for reactor safety evaluations. Finally, the TMI-2 accident led the nuclear community to dedicate considerable effort toward understanding severe accident phenomenology as well as the potential for containment failure. Because available data suggest that significant amounts of fuel heated to temperatures near melting, the events at Fukushima Daiichi Units 1, 2, and 3 offer an unexpected opportunity to gain similar understanding about boiling water reactor accident progression. To increase the international benefit from such an endeavor, we recommend that an international effort be initiated to (a) prioritize data needs; (b) identify techniques, samples, and sample evaluations needed to address each information need; and (c) help finance acquisition of the required data and conduct of the analyses.

Joy Rempe; Mitchell Farmer; Michael Corradini; Larry Ott; Randall Gauntt; Dana Powers

2012-11-01T23:59:59.000Z

198

Final Environmental Assessment for the Proposed Consolidation of Certain Dynamic Experimentation Activities at the Two-Mile Mesa Complex Los Alamos National Laboratory, Los Alamos, New Mexico  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

47 47 Final Environmental Assessment for the Proposed Consolidation of Certain Dynamic Experimentation Activities at the Two-Mile Mesa Complex Los Alamos National Laboratory, Los Alamos, New Mexico November 3, 2003 Department of Energy National Nuclear Security Administration Los Alamos Site Office Environmental Assessment for the Proposed DX Division Strategic Facility Plan at LANL DOE LASO November 3, 2003 iii Contents Acronyms and Terms................................................................................................................................vii Executive Summary ...................................................................................................................................xi 1.0 Purpose and Need

199

Evaluation of the Submerged Demineralizer System (SDS) flowsheet for decontamination of high-activity-level water at the Three Mile Island Unit 2 Nuclear Power Station  

Science Conference Proceedings (OSTI)

This report discusses the Submerged Demineralizer System (SDS) flowsheet for decontamination of the high-activity-level water at the Three Mile Island Unit 2 Nuclear Power Station was evaluated at Oak Ridge National Laboratory in a study that included filtration tests, ion exchange column tests, and ion exchange distribution tests. The contaminated waters, the SDS flowsheet, and the experiments made are described. The experimental results were used to predict the SDS performance and to indicate potential improvements.

Campbell, D.O., Collins, E.D., King, L.J., Knauer, J.B.

1980-07-01T23:59:59.000Z

200

Forrest Conservation Area : Management & Implementation FY 2004 Annual Report.  

DOE Green Energy (OSTI)

The Confederated Tribes of Warm Springs Reservation of Oregon (Tribes) acquired the Forrest Conservation Area during July of 2002. The property is located in the Upper John Day subbasin within the Columbia basin. The property consists of two parcels comprising 4,232 acres. The Mainstem parcel consists of 3,445 acres and is located 1/2 mile to the east of Prairie City, Oregon on the mainstem John Day River. The Middle Fork parcel consists of 786 acres and is located one mile to the west of the town of Austin, OR on the Middle Fork John Day River. The Forrest Conservation Area is under a memorandum of agreement with the Bonneville Power Administration (BPA) to provide an annual written report generally describing the real property interests of the project and management activities undertaken or in progress. Acquisition of the Forrest Conservation Area was funded by BPA as part of their program to protect, mitigate, and enhance fish and wildlife habitat affected by hydroelectric facilities on the Columbia River and its tributaries. The intent of the Conservation Area is to partially mitigate fish and wildlife impacts for the John Day Dam on the Columbia River as outlined in the Northwest Power Planning Council's Wildlife Program (NPPC 1994, {section}11.1, {section}7.6). While the Tribes hold fee-title to the property, the BPA has assured a level of management funding for the protection and restoration of fish and wildlife habitat through a memorandum of agreement.

Smith, Brent

2008-12-01T23:59:59.000Z

Note: This page contains sample records for the topic "area miles mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Western Area Power Administration, Desert Southwest Region  

NLE Websites -- All DOE Office Websites (Extended Search)

5 5 Western Area Power Administration, Desert Southwest Region Liberty-Parker #2 230-kV Transmission Line Optical Power Ground Wire Repairs - Continuation Sheet Project Description The scope of work includes digging a trenching and burying a 1.25-inch OPGW conduit. The conduit trench will be about 4 feet deep and 10 inches wide, with warning tape placed above the conduit in the trench. Once the conduit has been placed, the trench will be backfilled with the original surface material. About 5.3 linear miles of trenching will be required, mostly within the existing dirt access road associated with the LIB-PAD #2 transmission line. Four pullboxes will be installed along the route. The pullboxes measure 2 feet by 3 feet by 2 feet and will be installed at least 24 inches below grade. An

202

Western Area Power Administration, Desert Southwest Region  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Western Area Power Administration, Desert Southwest Region Liberty-Parker #2 230-kV Transmission Line Optical Power Ground Wire Repairs - Continuation Sheet Project Description The scope of work includes digging a trenching and burying a 1.25-inch OPGW conduit. The conduit trench will be about 4 feet deep and 10 inches wide, with warning tape placed above the conduit in the trench. Once the conduit has been placed, the trench will be backfilled with the original surface material. About 5.3 linear miles of trenching will be required, mostly within the existing dirt access road associated with the LIB-PAD #2 transmission line. Four pullboxes will be installed along the route. The pullboxes measure 2 feet by 3 feet by 2 feet and will be installed at least 24 inches below grade. An

203

Corrective action investigation plan for CAU Number 453: Area 9 Landfill, Tonopah Test Range  

SciTech Connect

This Corrective Action Investigation Plan (CAIP) contains the environmental sample collection objectives and criteria for conducting site investigation activities at the Area 9 Landfill, Corrective Action Unit (CAU) 453/Corrective Action (CAS) 09-55-001-0952, which is located at the Tonopah Test Range (TTR). The TTR, included in the Nellis Air Force Range, is approximately 255 kilometers (140 miles) northwest of Las Vegas, Nevada. The Area 9 Landfill is located northwest of Area 9 on the TTR. The landfill cells associated with CAU 453 were excavated to receive waste generated from the daily operations conducted at Area 9 and from range cleanup which occurred after test activities.

NONE

1997-05-14T23:59:59.000Z

204

Draft Supplement to the Environmental Statement Fiscal Year 1976 Proposed Program : Facility Location Evaluation for Cheney-Four Lakes Area Service Study Area 76-7.  

SciTech Connect

Proposed is construction of approximately 26 miles of 230-kV transmission line from the Four Mounds Area west of Spokane to either Cheney or Four Lakes Substation. Proposed also is construction of a new substation in the Four Mounds area. Depending upon final route location chosen, between 20 and 27 miles of new right-of-way would be required between the proposed Greenwood Substation and either Cheney or Four Lakes Substation. Between 25 and 41 miles of access road would also be required. Depending upon the final route selected, the amount of impact upon forest land would range from zero to 97 acres permanently removed. The amount of land temporarily disrupted for rangeland and cropland would be 8 to 13 acres and 30 to 40 acres, respectively. In addition, between approximately 4 and 8 acres of rangeland would be removed due to construction of the proposed new substation. Other impacts would include the removal of wildlife habitat associated with the above mentioned right-of-way requirements. Disturbance to wildlife during construction would occur. Some erosion and sedimentation would occur. Visual impacts would result from clearing rights-of-way through heavily forested areas. Noise and other disturbances to residents will occur, primarily during construction.

United States. Bonneville Power Administration.

1975-04-15T23:59:59.000Z

205

An Aerial Radiological Survey of Selected Areas of the City of North Las Vegas  

SciTech Connect

As part of the proficiency training for the Radiological Mapping mission of the Aerial Measuring System (AMS), a survey team from the Remote Sensing Laboratory-Nellis (RSL-Nellis) conducted an aerial radiological survey of selected areas of the city of North Las Vegas for the purpose of mapping natural radiation background and locating any man-made radioactive sources. Survey areas were selected in collaboration with the City Manager's office and included four separate areas: (1) Las Vegas Motor Speedway (10.6 square miles); (2) North Las Vegas Downtown Area (9.2 square miles); (3) I-15 Industrial Corridor (7.4 square miles); and (4) Future site of University of Nevada Las Vegas campus (17.4 square miles). The survey was conducted in three phases: Phase 1 on December 11-12, 2007 (Areas 1 and 2), Phase 2 on February 28, 2008 (Area 3), and Phase 3 on March 19, 2008 (Area 4). The total completed survey covered a total of 44.6 square miles. The flight lines (without the turns) over the surveyed areas are presented in Figures 1, 2, 3, and 4. A total of eight 2.5-hour-long flights were performed at an altitude of 150 ft above ground level (AGL) with 300 feet of flight-line spacing. Water line and test line flights were conducted over the Lake Mead and Government Wash areas to ensure quality control of the data. The data were collected by the AMS data acquisition system (REDAR V) using an array of twelve 2-inch x 4-inch x 16-inch sodium iodide (NaI) detectors flown on-board a twin-engine Bell 412 helicopter. Data, in the form of gamma energy spectra, were collected continually (every second) over the course of the survey and were geo-referenced using a differential Global Positioning System. Collection of spectral data allows the system to distinguish between ordinary fluctuations in natural background radiation levels and the signature produced by man-made radioisotopes. Spectral data can also be used to identify specific radioactive isotopes. As a courtesy service, with the approval of the U.S. Department of Energy, National Nuclear Security Administration, Nevada Site Office, RSL-Nellis is providing this summary to the office of the Mayor of the City of North Las Vegas along with the gross-count-based exposure rate and man-made count contour maps and GIS shape files in electronic format on a compact disk.

Piotr Wasiolek

2008-06-01T23:59:59.000Z

206

Department of Energy Announces Start of Western Area Power Administration  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Start of Western Area Power Start of Western Area Power Administration Recovery Act Project Department of Energy Announces Start of Western Area Power Administration Recovery Act Project September 16, 2009 - 12:00am Addthis WASHINGTON, DC - With the goal of bringing new jobs and green power to the West, Energy Secretary Steven Chu announced today a large-scale transmission project to be financed using funding from the American Recovery and Reinvestment Act. The Western Area Power Administration will use borrowing authority under the Recovery Act to help build the $213 million Montana-Alberta Tie Limited (MATL) transmission project between Great Falls, Montana, and Lethbridge, Alberta. Almost two-thirds of the 214-mile transmission line will be located on U.S. soil, creating American

207

Modeling-Computer Simulations At Raft River Geothermal Area (1979) | Open  

Open Energy Info (EERE)

Jump to: navigation, search Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Modeling-Computer Simulations At Raft River Geothermal Area (1979) Exploration Activity Details Location Raft River Geothermal Area Exploration Technique Modeling-Computer Simulations Activity Date 1979 Usefulness useful DOE-funding Unknown Exploration Basis To evaluate the hydrodynamics of the unconfined aquifer. Notes This study covers about 1000 mi2 (2600 km2) of the southern Raft River drainage basin in south-central Idaho and northwest Utah. The main area of interest, approximately 200 mi2 (520 km2) of semiarid agricultural and rangeland in the southern Raft River Valley that includes the known Geothermal Resource Area near Bridge, Idaho, was modelled numerically. Computed and estimated transmissivity values range from 1200 ft2 per day

208

An aerial radiological survey of Project Rulison and surrounding area, Battlement Creek Valley, Colorado  

SciTech Connect

An aerial radiological survey was conducted over the Project Rulison site, 40 miles (64 kilometers) northeast of Grand Junction, Colorado, from July 6 through July 12, 1993. Parallel lines were flown at intervals of 250 feet (76 meters) over a 6.5-square-mile (17-square-kilometer) area at a 200-foot (61-meter) altitude surrounding Battlement Creek Valley. The gamma energy spectra obtained were reduced to an exposure rate contour map overlaid on a high altitude aerial photograph of the area. The terrestrial exposure rate varied from 3.5 to 12.5 {mu}R/h (excluding cosmic) at 1 meter above ground level. No anomalous or man-made isotopes were found.

NONE

1995-08-01T23:59:59.000Z

209

Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)

2010-01-01T23:59:59.000Z

210

Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)

2012-07-01T23:59:59.000Z

211

DEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE  

E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.

212

Field Area Network Demo - October 2013 Vendor Forum Presentations (Palo Alto)  

Science Conference Proceedings (OSTI)

The field area network (FAN) concept is emerging as a ubiquitous, high-performance, secure, reliable network providing "last mile" backhaul service for distribution supervisory control and data acquisition (SCADA) and advanced metering infrastructure (AMI) systems, as well as network access services for advanced distribution management and automation, distributed energy resources, and any future smart grid applications requiring connectivity from within and beyond the distribution ...

2013-11-13T23:59:59.000Z

213

Field Area Network Demo - May 2013 Advisors Meeting: Presentations and Minutes (United Illuminating)  

Science Conference Proceedings (OSTI)

The field area network (FAN) concept is emerging as a ubiquitous, high-performance, secure, reliable network providing "last mile" acquisition (SCADA) and advanced metering infrastructure (AMI)systems, as well as network access services for advanced distribution management and automation, distributed energy resources, and any future smart grid applications requiring connectivity from within and beyond the distribution substation.One objective of this project is to establish ...

2013-11-13T23:59:59.000Z

214

Field Area Network Demo - September 2013 Advisors Meeting - Presentations and Minutes (Hydro One Networks)  

Science Conference Proceedings (OSTI)

The field area network (FAN) concept is emerging as a ubiquitous, high-performance, secure, reliable network providing "last mile" acquisition (SCADA) and advanced metering infrastructure (AMI)systems, as well as network access services for advanced distribution management and automation, distributed energy resources, and any future smart grid applications requiring connectivity from within and beyond the distribution substation.One objective of this project is to establish ...

2013-11-13T23:59:59.000Z

215

Streamlined Approach for Environmental Restoration (SAFER) Plan for Corrective Action Unit 553: Areas 19, 20 Mud Pits and Cellars, Nevada Test Site, Nevada, Rev. No. 0  

SciTech Connect

This Streamlined Approach for Environmental Restoration (SAFER) Plan addresses the actions necessary for the closure of Corrective Action Unit (CAU) 553: Areas 19, 20 Mud Pits and Cellars, Nevada Test Site (NTS), Nevada. It has been developed in accordance with the ''Federal Facility Agreement and Consent Order'' (FFACO) (1996) that was agreed to by the State of Nevada, the U.S. Department of Energy (DOE), and the U.S. Department of Defense. A SAFER may be performed when the following criteria are met: (1) Conceptual corrective actions are clearly identified (although some degree of investigation may be necessary to select a specific corrective action before completion of the Corrective Action Investigation [CAI]); (2) Uncertainty of the nature, extent, and corrective action must be limited to an acceptable level of risk; (3) The SAFER Plan includes decision points and criteria for making data quality objective (DQO) decisions. The purpose of the investigation will be to document and verify the adequacy of existing information; to affirm the decision for clean closure, closure in place, or no further action; and to provide sufficient data to implement the corrective action. The actual corrective action selected will be based on characterization activities implemented under this SAFER Plan. This SAFER Plan identifies decision points developed in cooperation with the Nevada Department of Environmental Protection (NDEP), where the DOE, National Nuclear Security Administration Nevada Site Office (NNSA/NSO) will reach consensus with the NDEP before beginning the next phase of work. Corrective Action Unit 553 is located in Areas 19 and 20 of the NTS, approximately 65 miles (mi) northwest of Las Vegas, Nevada (Figure 1-1). Corrective Action Unit 553 is comprised of the four Corrective Action Sites (CASs) shown on Figure 1-1 and listed below: 19-99-01, Mud Spill; 19-99-11, Mud Spill; 20-09-09, Mud Spill; and 20-99-03, Mud Spill. There is sufficient information and process knowledge from historical documentation and investigations of similar sites (i.e., the expected nature and extent of contaminants of potential concern [COPCs]) to recommend closure of CAU 553 using the SAFER process (FFACO, 1996).

Boehlecke, Robert F.

2006-11-01T23:59:59.000Z

216

Hanford Area 1990 population and 50-year projections. [Appendix contains computer programming for population projections and graphs showing them by grid areas  

Science Conference Proceedings (OSTI)

The complex and comprehensive safety analysis activities carried out at Hanford for nonreactor nuclear facilities require data from a number of scientific and engineering disciplines. The types of data that are required include data pertaining to current population and population projections. The types of data found in this document include 1990 census totals for residential population within a 50-mile radius of the 100-N, 200, 300, and 400 Area meteorological towers. This document also contains 50-year projections for residential populations within a 50-mile radius of these four meteorological towers. The analysis of population projections indicates that residential population within a 50-mile radius of the four meteorological towers in question will continue to grow through 2040, although at a slower rate each decade. In all cases, the highest growth is projected for the decade ending in the year 2000. The annual growth rate for this period is projected to be 0.646, 0.633, 0.543, and 0.570 in the 100-N, 200, 300, and 400 Areas, respectively. By 2040, these growth rates are projected to drop to 0.082, 0.068, 0.078, 0.078, respectively. 4 refs., 1 figs., 4 tabs.

Beck, D.M.; Scott, M.J.; Shindle, S.F.; Napier, B.A.; Thurman, A.G.; Batishko, N.C. (Pacific Northwest Lab., Richland, WA (United States)); Davis, M.D. (Westinghouse Hanford Co., Richland, WA (United States)); Pittenger, D.B. (Demographics Lab., Olympia, WA (United States))

1991-10-01T23:59:59.000Z

217

Aeromagnetic Survey At Clear Lake Area (Skokan, 1993) | Open Energy  

Open Energy Info (EERE)

Clear Lake Area (Skokan, 1993) Clear Lake Area (Skokan, 1993) Exploration Activity Details Location Clear Lake Area Exploration Technique Aeromagnetic Survey Activity Date Usefulness not indicated DOE-funding Unknown Notes USGS aeromagnetic data (Rapolla and Keller, 1984) were acquired at an elevation of 4500 feet and flown with one-mile spacings. These data were dominated by patterns of highs that coincide with serpentinite outcrops. Serpentinite is one component of the complex Franciscan melange. Fracturing within the Franciscan provides the porosity needed for collection of hot water characteristic of the Geysers Field. The Clear Lake Volcanics overlie the Franciscan formation. These in turn, are overlain by the Great Valley Sequence. The susceptibilities of both the Clear Lake Volcanics and Great

218

Measurement and inspection of engines operated 50,000 miles on methanol/gasoline blends. Final report No. MED 120, December 1979-December 1980  

DOE Green Energy (OSTI)

The inspection of 6 commercial designed engines which were operated 50,000 miles on 10% methanol/90% unleaded gasoline blend were covered. The program was conducted at the Bartlesville Energy Technology Center, Department of Energy, Bartlesville, Oklahoma with the Mobile Energy Division, Southwest Research Institute providing the technical expertise for the technical inspection of the engines following program completion. These vehicles operated throughout this program with minimal or no operational problems, this report will only indicate engine wear and deposits as determined by standard CRC rating techniques.

Brown, J.G.; Tosh, J.D.

1980-12-01T23:59:59.000Z

219

Sagebrush Flat Wildlife Area 2008 Annual Report.  

Science Conference Proceedings (OSTI)

The Sagebrush Flat Wildlife Area is a 12,718 acre complex located in Douglas County, Washington. Four distinct management units make up the area: Bridgeport, Chester Butte, Dormaier and Sagebrush Flat. The four Units are located across a wide geographic area within Douglas County. The Units are situated roughly along a north/south line from Bridgeport in the north to the Douglas/Grant county line in the south, 60 miles away. The wildlife area was established to conserve and enhance shrubsteppe habitat for the benefit shrubsteppe obligate and dependent wildlife species. In particular, the Sagebrush Flat Wildlife Area is managed to promote the recovery of three state-listed species: Columbian sharp-tailed grouse (threatened), greater sage grouse (threatened) and the pygmy rabbit (endangered). The US Fish and Wildlife Service also list the pygmy rabbit as endangered. Wildlife area staff seeded 250 acres of old agricultural fields located on the Sagebrush Flat, Dormaier and Chester Butte units. This has been a three project to reestablish high quality shrubsteppe habitat on fields that had either been abandoned (Dormaier) or were dominated by non-native grasses. A mix of 17 native grasses and forbs, most of which were locally collected and grown, was used. First year maintenance included spot spraying Dalmatian toadflax on all sites and mowing annual weeds to reduce competition. Photo points were established and will be integral to long term monitoring and evaluation. Additional monitoring and evaluation will come from existing vegetation transects. This year weed control efforts included spot treatment of noxious weeds, particularly Dalmatian toadflax, in previously restored fields on the Bridgeport Unit (150 acres). Spot treatment also took place within fields scheduled for restoration (40 acres) and in areas where toadflax infestations are small and relatively easily contained. Where toadflax is so widespread that chemical treatment would be impractical, we use the bioagent Mecinus janthinus, available through Professor Gary Piper of Washington State University. This year we released 4,000 M. janthinus on the Bridgeport Unit at 6 separate locations. Since 2002 we have released approximately 14,400 of these insects, 80% of these on the Bridgeport Unit. Additional weed control activities included mowing and spot spraying more than 32 miles of roads, cutting and removal of annual weeds within fenced deer exclosures. We upgraded the solar powered irrigation system that supplies water to a stand of water birch trees planted in 2002. Wildlife area staff designed and built a new solar array and installed a higher capacity pump. The increased capacity will ensure that these trees receive adequate water through the hot summer months and allow us to create at least one additional stand. This project is an important part in our effort to expand the available winter habitat for sharp-tailed grouse on the Bridgeport Unit. Maintenance of fences, parking areas and roads continued during throughout the year. Two parking areas, at Chester Butte and Bridgeport, were graded and additional gravel added. Roads on the Bridgeport Unit were graded and repaired following spring runoff. Trespass and dumping issues have increased in recent years on the Bridgeport Unit. To address these problems we constructed four steel gates at access points on this unit. Each gate is tubular steel attached to 8-inch diameter steel posts, 10 feet long that are cemented into the ground. Two gates allow access to BPA substation facilities and power-line right-of ways so placement, construction and locking issues had to be coordinated with BPA's Real Estate staff in Spokane. Environmental Compliance Documentation issues were addressed again this year. This process has the potential to cause delays the completion of projects within the fiscal year. With this in mind and an eye toward the future, we requested that several projects planned for the coming years be surveyed this year. Beginning in August of 2007, area staff worked with BPA staff to identify work elements

Peterson, Dan [Washington Department of Fish and Wildlife

2008-11-03T23:59:59.000Z

220

Sagebrush Flat Wildlife Area 2008 Annual Report.  

DOE Green Energy (OSTI)

The Sagebrush Flat Wildlife Area is a 12,718 acre complex located in Douglas County, Washington. Four distinct management units make up the area: Bridgeport, Chester Butte, Dormaier and Sagebrush Flat. The four Units are located across a wide geographic area within Douglas County. The Units are situated roughly along a north/south line from Bridgeport in the north to the Douglas/Grant county line in the south, 60 miles away. The wildlife area was established to conserve and enhance shrubsteppe habitat for the benefit shrubsteppe obligate and dependent wildlife species. In particular, the Sagebrush Flat Wildlife Area is managed to promote the recovery of three state-listed species: Columbian sharp-tailed grouse (threatened), greater sage grouse (threatened) and the pygmy rabbit (endangered). The US Fish and Wildlife Service also list the pygmy rabbit as endangered. Wildlife area staff seeded 250 acres of old agricultural fields located on the Sagebrush Flat, Dormaier and Chester Butte units. This has been a three project to reestablish high quality shrubsteppe habitat on fields that had either been abandoned (Dormaier) or were dominated by non-native grasses. A mix of 17 native grasses and forbs, most of which were locally collected and grown, was used. First year maintenance included spot spraying Dalmatian toadflax on all sites and mowing annual weeds to reduce competition. Photo points were established and will be integral to long term monitoring and evaluation. Additional monitoring and evaluation will come from existing vegetation transects. This year weed control efforts included spot treatment of noxious weeds, particularly Dalmatian toadflax, in previously restored fields on the Bridgeport Unit (150 acres). Spot treatment also took place within fields scheduled for restoration (40 acres) and in areas where toadflax infestations are small and relatively easily contained. Where toadflax is so widespread that chemical treatment would be impractical, we use the bioagent Mecinus janthinus, available through Professor Gary Piper of Washington State University. This year we released 4,000 M. janthinus on the Bridgeport Unit at 6 separate locations. Since 2002 we have released approximately 14,400 of these insects, 80% of these on the Bridgeport Unit. Additional weed control activities included mowing and spot spraying more than 32 miles of roads, cutting and removal of annual weeds within fenced deer exclosures. We upgraded the solar powered irrigation system that supplies water to a stand of water birch trees planted in 2002. Wildlife area staff designed and built a new solar array and installed a higher capacity pump. The increased capacity will ensure that these trees receive adequate water through the hot summer months and allow us to create at least one additional stand. This project is an important part in our effort to expand the available winter habitat for sharp-tailed grouse on the Bridgeport Unit. Maintenance of fences, parking areas and roads continued during throughout the year. Two parking areas, at Chester Butte and Bridgeport, were graded and additional gravel added. Roads on the Bridgeport Unit were graded and repaired following spring runoff. Trespass and dumping issues have increased in recent years on the Bridgeport Unit. To address these problems we constructed four steel gates at access points on this unit. Each gate is tubular steel attached to 8-inch diameter steel posts, 10 feet long that are cemented into the ground. Two gates allow access to BPA substation facilities and power-line right-of ways so placement, construction and locking issues had to be coordinated with BPA's Real Estate staff in Spokane. Environmental Compliance Documentation issues were addressed again this year. This process has the potential to cause delays the completion of projects within the fiscal year. With this in mind and an eye toward the future, we requested that several projects planned for the coming years be surveyed this year. Beginning in August of 2007, area staff worked with BPA staff to identify work elements

Peterson, Dan [Washington Department of Fish and Wildlife

2008-11-03T23:59:59.000Z

Note: This page contains sample records for the topic "area miles mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

Zero Emission Bay Area (ZEBA) Fuel Cell Bus Demonstration: First...  

NLE Websites -- All DOE Office Websites (Extended Search)

hp horsepower HVAC heating, ventilation, and air conditioning in. inches kg kilograms kW kilowatts lb pounds MBRC miles between roadcalls mpDGE miles per diesel gallon...

222

AMENDMENT OF SOLICITATION/MODIFICATlON OF CONTRACT MI54 I See Block 16C I  

National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)

223

File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload

224

MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.

2011-05-01T23:59:59.000Z

225

Property:PotentialUrbanUtilityScalePVArea | Open Energy Information  

Open Energy Info (EERE)

PotentialUrbanUtilityScalePVArea PotentialUrbanUtilityScalePVArea Jump to: navigation, search Property Name PotentialUrbanUtilityScalePVArea Property Type Quantity Description The area of potential utility-scale PV in urban areas in a place. Use this type to express a quantity of two-dimensional space. The default unit is the square meter (m²). http://en.wikipedia.org/wiki/Area Acceptable units (and their conversions) are: Square Meters - 1 m²,m2,m^2,square meter,square meters,Square Meter,Square Meters,Sq. Meters,SQUARE METERS Square Kilometers - 0.000001 km²,km2,km^2,square kilometer,square kilometers,square km,square Kilometers,SQUARE KILOMETERS Square Miles - 0.000000386 mi²,mi2,mi^2,mile²,square mile,square miles,square mi,Square Miles,SQUARE MILES Square Feet - 10.7639 ft²,ft2,ft^2,square feet,square

226

Property:PotentialRuralUtilityScalePVArea | Open Energy Information  

Open Energy Info (EERE)

PotentialRuralUtilityScalePVArea PotentialRuralUtilityScalePVArea Jump to: navigation, search Property Name PotentialRuralUtilityScalePVArea Property Type Quantity Description The area of potential utility scale PV in rural areas in a place. Use this type to express a quantity of two-dimensional space. The default unit is the square meter (m²). http://en.wikipedia.org/wiki/Area Acceptable units (and their conversions) are: Square Meters - 1 m²,m2,m^2,square meter,square meters,Square Meter,Square Meters,Sq. Meters,SQUARE METERS Square Kilometers - 0.000001 km²,km2,km^2,square kilometer,square kilometers,square km,square Kilometers,SQUARE KILOMETERS Square Miles - 0.000000386 mi²,mi2,mi^2,mile²,square mile,square miles,square mi,Square Miles,SQUARE MILES Square Feet - 10.7639 ft²,ft2,ft^2,square feet,square

227

Assessment of the Geothermal Potential Within the BPA Marketing Area.  

DOE Green Energy (OSTI)

The potential of geothermal energy is estimated that can be used for direct heat applications and electrical power generation within the Bonneville Power Administration (BPA) marketing area. The BPA marketing area includes three principal states of Oregon, Washington, and Idaho and portions of California, Montana, Wyoming, Nevada, and Utah bordering on these three states. This area covers approximately 384,000 square miles and has an estimated population of 6,760,000. The total electrical geothermal potential within this marketing area is 4077 MW/sub e/ from hydrothermal resources and 16,000 MW/sub e/ from igneous systems, whereas the total thermal (wellhead) potential is 16.15 x 10/sup 15/ Btu/y. Approximately 200 geothermal resource sites were initially identified within the BPA marketing area. This number was then reduced to about 100 sites thought to be the most promising for development by the year 2000. These 100 sites, due to load area overlap, were grouped into 53 composite sites; 21-3/4 within BPA preference customer areas and 31-1/4 within nonpreference customer areas. The geothermal resource potential was then estimated for high-temperature (> 302/sup 0/F = 150/sup 0/C), intermediate-temperature (194 to 302/sup 0/F = 90 to 150/sup 0/C), and low-temperature (< 194/sup 0/F = 90/sup 0/C) resources.

Lund, John W.; Allen, Eliot D.

1980-07-01T23:59:59.000Z

228

Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab

2007-03-01T23:59:59.000Z

229

Reflection Survey At Coso Geothermal Area (2001) | Open Energy Information  

Open Energy Info (EERE)

Exploration Activity: Reflection Survey At Coso Geothermal Area (2001) Exploration Activity Details Location Coso Geothermal Area Exploration Technique Reflection Survey Activity Date 2001 Usefulness not indicated DOE-funding Unknown Exploration Basis Look for features that are characteristic of the geothermal producing region not originally seen by imaging the Coso Field using seismic Notes During December of 1999, approximately 32 miles of seismic data were acquired as part of a detailed seismic investigation undertaken by the US Navy Geothermal Program Office. Data acquisition was designed to make effective use of advanced data processing methods, which include Optim's proprietary nonlinear velocity optimization technique and pre-stack Kirchhoff migration. The velocity models from the 2-D lines were combined

230

Geothermal Literature Review At Coso Geothermal Area (1987) | Open Energy  

Open Energy Info (EERE)

7) 7) Exploration Activity Details Location Coso Geothermal Area Exploration Technique Geothermal Literature Review Activity Date 1987 Usefulness not indicated DOE-funding Unknown Exploration Basis Compare multiple theories of the structural control of the geothermal system Notes The geothermal system appears to be associated with at least one dominant north-south-trending feature which extends several miles through the east-central portion of the Coso volcanic field. The identified producing fractures occur in zones which range from 10 - 100s of feet in extent, separated by regions of essentially unfractured rock of similar composition. Wells in the Devil's Kitchen area have encountered fluids in excess of 4500F and flow rates of 1 million lb/hr at depths less than 4000

231

Ground Gravity Survey At Raft River Geothermal Area (1957-1961) | Open  

Open Energy Info (EERE)

Ground Gravity Survey At Raft River Geothermal Area (1957-1961) Ground Gravity Survey At Raft River Geothermal Area (1957-1961) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Ground Gravity Survey At Raft River Geothermal Area (1957-1961) Exploration Activity Details Location Raft River Geothermal Area Exploration Technique Ground Gravity Survey Activity Date 1957 - 1961 Usefulness not indicated DOE-funding Unknown Notes From 1957 to 1961 a regional gravity survey was made over the northern part of the Great Salt Lake Desert and adjacent areas in Utah, eastern Nevada, and southeastern Idaho. A total of 1040 stations were taken over an area of about 7000 square miles. The results were compiled as a Bouguer gravity anomaly map with a contour interval of 2 mgal. The Bouguer values ranged

232

Property:PotentialCSPArea | Open Energy Information  

Open Energy Info (EERE)

PotentialCSPArea PotentialCSPArea Jump to: navigation, search Property Name PotentialCSPArea Property Type Quantity Description An area of potential CSP generation. Use this type to express a quantity of two-dimensional space. The default unit is the square meter (m²). http://en.wikipedia.org/wiki/Area Acceptable units (and their conversions) are: Square Meters - 1 m²,m2,m^2,square meter,square meters,Square Meter,Square Meters,Sq. Meters,SQUARE METERS Square Kilometers - 0.000001 km²,km2,km^2,square kilometer,square kilometers,square km,square Kilometers,SQUARE KILOMETERS Square Miles - 0.000000386 mi²,mi2,mi^2,mile²,square mile,square miles,square mi,Square Miles,SQUARE MILES Square Feet - 10.7639 ft²,ft2,ft^2,square feet,square foot,FT²,FT2,FT^2,Square Feet, Square Foot

233

Supplement Analysis for the Transmission System Vegetation Management Program FEIS (DOE/EIS-0285/SA- 129) Ashe-Marion #2 [Mile 150-157]  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

7, 2003 7, 2003 REPLY TO ATTN OF: KEP-4 SUBJECT: Supplement Analysis for the Transmission System Vegetation Management Program FEIS (DOE/EIS-0285/SA- 129 Ashe-Marion #2 [Mile 150-157] Elizabeth Johnson Natural Resource Specialist- TFR/The Dalles Proposed Action: Vegetation Management for the Ashe-Marion #2 500 kV transmission line from structure 150/2 through structure 157/7 (reference line). The Buckley-Marion #1 transmission line is also present within the proposed corridor. Right of way width averages 135 feet. Location: The project location is within Wasco County, Oregon near the city of Pine Grove, and is within the Redmond Region. Proposed by: Bonneville Power Administration (BPA). Description of the Proposal: BPA proposes to remove unwanted vegetation along the right-of-

234

Evaluation of nuclear facility decommissioning projects. Three Mile Island Unit 2. Radioactive waste and laundry shipments. Volume 9. Summary status report  

SciTech Connect

This document summarizes information concerning radioactive waste and laundry shipments from the Three Mile Island Nuclear Station Unit 2 to radioactive waste disposal sites and to protective clothing decontamination facilities (laundries) since the loss of coolant accident experienced on March 28, 1979. Data were collected from radioactive shipment records, summarized, and placed in a computerized data information retrieval/manipulation system which permits extraction of specific information. This report covers the period of April 9, 1979 to May 5, 1985. Included in this report are: waste disposal site locations, dose rates, curie content, waste description, container type and number, volumes and weights. This information is presented in two major categories: protective clothing (laundry) and radioactive waste. Each of the waste shipment reports is in chronological order.

Doerge, D. H.; Miller, R. L.; Scotti, K. S.

1986-05-01T23:59:59.000Z

235

Refraction Survey At Coso Geothermal Area (1989) | Open Energy Information  

Open Energy Info (EERE)

Refraction Survey At Coso Geothermal Area (1989) Refraction Survey At Coso Geothermal Area (1989) Exploration Activity Details Location Coso Geothermal Area Exploration Technique Refraction Survey Activity Date 1989 Usefulness useful DOE-funding Unknown Exploration Basis Determine the crustul structure of the Coso geothermal system Notes In mid-1989 the authors designed and collected four seismic reflection/refraction profiles that addressed the crustal structure of the Coso geothermal field. The two main east-west and north-south profiles crossed at the southeastern most base of Sugar Loaf Mountain. Both in-line and cross-line Vibroseis and explosion data were recorded on each of these approximately 12-mi lines. This was accomplished with the simultaneous operation of two 1024-channel sign bit recording systems while four

236

Area Hydrologic Units Calwater Subbasins ---(Planning Watersheds) 425,411 Acres 18050004 2204200400 Oakland (20805 Acres)  

E-Print Network (OSTI)

Acres) 665 Square Miles 2204300102 Lost Canyon (3325 Acres) 2204 2204300103 Beauregard Creek (5018 Acres

237

Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A

2008-01-01T23:59:59.000Z

238

EA-1050: Test Area North Pool Stabilization Project, Idaho Falls, Idaho |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

50: Test Area North Pool Stabilization Project, Idaho Falls, 50: Test Area North Pool Stabilization Project, Idaho Falls, Idaho EA-1050: Test Area North Pool Stabilization Project, Idaho Falls, Idaho SUMMARY This EA evaluates the environmental impacts of the U.S. Department of Energy's Idaho National Engineering Laboratory's proposal to remove 344 canisters of Three Mile Island core debris and commercial fuels from the Test Area North Pool and transfer them to the Idaho Chemical Processing Plant for interim dry storage until an alternate storage location other than INEL, or a permanent federal spent nuclear fuel repository is available. PUBLIC COMMENT OPPORTUNITIES None available at this time. DOCUMENTS AVAILABLE FOR DOWNLOAD May 6, 1996 EA-1050: Finding of No Significant Impact Test Area North Pool Stabilization Project

239

Stepout-Deepening Wells At Coso Geothermal Area (1986) | Open Energy  

Open Energy Info (EERE)

Stepout-Deepening Wells At Coso Geothermal Area (1986) Stepout-Deepening Wells At Coso Geothermal Area (1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Step-out Well At Coso Geothermal Area (1986) Exploration Activity Details Location Coso Geothermal Area Exploration Technique Step-out Well Activity Date 1986 Usefulness not indicated DOE-funding Unknown Notes A step-out exploration/production well drilled in 1986 to a depth of 6553 ft located several miles south of the Devil's Kitchen region along the identified north-south feature produced fluids with a temperature greater than 640 F. References Austin, C.F.; Bishop, B.P.; Moore, J. (1 May 1987) Structural interpretation of Coso Geothermal field, Inyo County, California Retrieved from "http://en.openei.org/w/index.php?title=Stepout-Deepening_Wells_At_Coso_Geothermal_Area_(1986)&oldid=687864"

240

An aerial radiological survey of the southwest drainage basin area of the Savannah River Site  

SciTech Connect

An aerial radiological survey was conducted over a 106-square-mile area of the Savannah River Site (SRS), formerly the Savannah River Plant. The survey was conducted from August 24 through September 8, 1988, to collect baseline radiological data over the area. Both natural and man-made gamma emitting radionuclides were detected in the area. The detected man-made sources were confined to creeks, branches, and SRS facilities in the surveyed area and were a result of SRS operations. Naturally-occurring radiation levels were consistent with those levels detected in adjacent areas during previous surveys. The annual dose levels were within the range of levels found throughout the United States.

Feimster, E.L.

1994-04-01T23:59:59.000Z

Note: This page contains sample records for the topic "area miles mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Geothermal investigations in Idaho. Part 3. An evaluation of thermal water in the Weiser area, Idaho  

DOE Green Energy (OSTI)

The Weiser area encompasses about 200 square miles in southwest Idaho and contains two thermal water areas: (1) the Crane Creek subarea, which is 12 miles east of Weiser, Idaho, and (2) the Weiser Hot Springs subarea, which is 5 miles northwest of Weiser. Volcanic and sedimentary rocks of Miocene to Pleistocene age have been faulted and folded to form the northwest-trending anticlines present in much of the area. Basalt of the Columbia River Group or underlying rocks are believed to constitute the reservoir for the hot water. Gravity and magnetic anomalies are present in both subareas. A preliminary audio-magnetotelluric survey indicates that a shallow conductive zone is associated with each thermal site. Above-normal ground temperatures measured at a depth of 1 metre below the land surface in the Weiser Hot Springs subarea correlate with relatively high concentrations of boron in underlying ground waters, which, in turn, are usually associated with thermal waters in the study area. Sampled thermal waters are of a sodium chloride sulfate or sodium sulfate type, having dissolved-solids concentrations that range from 225 to 1,140 milligrams per litre. Temperatures of sampled waters ranged from 13/sup 0/ to 92.0/sup 0/C. Minimum aquifer temperatures calculated from chemical analysis of water, using geochemical thermometers, were 170/sup 0/ and 150/sup 0/C in the Crane Creek and Weiser Hot Springs subareas, respectively. Estimated maximum temperatures ranged from 212/sup 0/ to 270/sup 0/C and 200/sup 0/ to 242/sup 0/C, respectively, in these subareas. The probable heat sources for both subareas are (1) young magmatic intrusive rocks underlying the basalt or (2) above-normal temperatures resulting from thinning of the earth's crust. Maps are included.

Young, H.W.; Whitehead, R.L.

1974-01-01T23:59:59.000Z

242

Strategic Focus Areas  

NLE Websites -- All DOE Office Websites (Extended Search)

Focus Areas Lockheed Martin on behalf of Sandia National Laboratories will consider grant requests that best support the Corporation's strategic focus areas and reflect effective...

243

C:\\DS\\08-2225 - Final with Errata Page.wpd  

NLE Websites -- All DOE Office Websites (Extended Search)

per liter MgO magnesium oxide mi milemiles mi 2 square miles mL millilitermilliliters MOU memorandum of understanding mph miles per hour mrem milliremmillirem MRL method...

244

Showering with the Sun at Chickasaw National Recreation Area  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

ark Golnar, a mechanical engineer with the National Park Service (NPS), describes solar water heating as the "perfect heat source" for the comfort stations at Chickasaw National Recreation Area. "The demand for hot water coincides with the availabil- ity of sunlight, which makes solar water heaters the obvious choice," he says. "As a bonus, the solar systems are an environmentally sound and cost- effective way to heat water." Located about 100 miles (161 km) south of Oklahoma City, Oklahoma, on Lake of the Arbuckles, the facility is used primarily in the summer, when solar energy is abundant. The solar water heating systems supply all the hot water for one large comfort station and two small ones at the Buckhorn Campground. (There are no

245

Showering with the Sun at Chickasaw National Recreation Area  

NLE Websites -- All DOE Office Websites (Extended Search)

ark Golnar, a mechanical engineer with ark Golnar, a mechanical engineer with the National Park Service (NPS), describes solar water heating as the "perfect heat source" for the comfort stations at Chickasaw National Recreation Area. "The demand for hot water coincides with the availabil- ity of sunlight, which makes solar water heaters the obvious choice," he says. "As a bonus, the solar systems are an environmentally sound and cost- effective way to heat water." Located about 100 miles (161 km) south of Oklahoma City, Oklahoma, on Lake of the Arbuckles, the facility is used primarily in the summer, when solar energy is abundant. The solar water heating systems supply all the hot water for one large comfort station and two small ones at the Buckhorn Campground. (There are no

246

Superfund Record of Decision (EPA Region 8): Silver Bow Creek/Butte Area, MT. (Second remedial action), June 1992. Interim report  

Science Conference Proceedings (OSTI)

The Silver Bow Creek/Butte Area site is a mining and processing area located 7 miles east of Anaconda in the Upper Clark Fork River Basin, Deer Lodge County, Montana. Site contamination is the result of over 100 years of mining and process operations in the area. Until the early 1970's, mining, milling, and smelting wastes were dumped directly into Silver Bow Creek and transported downstream. The ROD addresses an interim remedy for all media at OU12. The primary contaminants of concern affecting the soil, sediment, ground water, and surface water in the Inactive area are metals, including arsenic, chromium, and lead; and inorganics.

Not Available

1992-06-30T23:59:59.000Z

247

Supplement Analysis for the Transmission System Vegetation Management Program FEIS (DOE/EIS-0285/SA - 128 - Olympia-Satsop #3 [Mile1-6]  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

6, 2003 6, 2003 REPLY TO ATTN OF: KEP-4 SUBJECT: Supplement Analysis for the Transmission System Vegetation Management Program FEIS (DOE/EIS-0285/SA- 128 - Olympia-Satsop #3 [Mile 1-6] James Jellison Natural Resource Specialist - TFO/Olympia Proposed Action: Vegetation Management for the Olympia-Satsop #3 230 kV transmission line corridor (reference line) from structure 1/1 through structure 6/1 and between structures 8/3 and 8/4. Other lines which are present in the proposed corridor are the Paul-Satsop #1 500 kV, Olympia-Satsop #2 500 kV, Olympia-South Elma #1 115 kV, Olympia-Kitsap #3 230 kV, Olympia-Shelton #3 230 kV, Olympia-Shelton #4 230 kV, and Olympia-Shelton #1 115 kV. Right of way width averages 615 feet. Location: The project location is within Thurston County, Washington and is within the

248

PREFERRED WATERFLOOD MANAGEMENT PRACTICES FOR THE SPRABERRY TREND AREA  

SciTech Connect

The naturally fractured Spraberry Trend Area is one of the largest reservoirs in the domestic U.S. and is the largest reservoir in area extent in the world. Production from Spraberry sands is found over a 2,500 sq. mile area and Spraberry reservoirs can be found in an eight county area in west Texas. Over 150 operators produce 65,000 barrels of oil per day (bopd) from the Spraberry Trend Area from more than 9,000 production wells. Recovery is poor, on the order of 7-10% due to the profoundly complicated nature of the reservoir, yet billions of barrels of hydrocarbons remain. We estimate over 15% of remaining reserves in domestic Class III reservoirs are in Spraberry Trend Area reservoirs. This tremendous domestic asset is a prime example of an endangered hydrocarbon resource in need of immediate technological advancements before thousands of wells are permanently abandoned. This report describes the final work of the project, ''Preferred Waterflood Management Practices for the Spraberry Trend Area.'' The objective of this project is to significantly increase field-wide production in the Spraberry Trend in a short time frame through the application of preferred practices for managing and optimizing water injection. Our goal is to dispel negative attitudes and lack of confidence in water injection and to document the methodology and results for public dissemination to motivate waterflood expansion in the Spraberry Trend. This objective has been accomplished through research in three areas: (1) detail historical review and extensive reservoir characterization, (2) production data management, and (3) field demonstration. This provides results of the final year of the three-year project for each of the three areas.

David S. Schechter

2004-08-31T23:59:59.000Z

249

Water budget for SRP burial ground area  

SciTech Connect

Radionuclide migration from the SRP burial ground for solid low-level waste has been studied extensively. Most of the buried radionuclides are fixed on the soil and show negligible movement. The major exception is tritium, which when leached from the waste by percolating rainfall, forms tritiated water and moves with the groundwater. The presence of tritium has been useful in tracing groundwater flow paths to outcrop. A subsurface tritium plume moving from the southwest corner of the burial ground toward an outcrop near Four Mile Creek has been defined. Groundwater movement is so slow that much of the tritium decays before reaching the outcrop. The burial ground tritium plume defined to date is virtually all in the uppermost sediment layer, the Barnwell Formation. The purpose of the study reported in this memorandum was to investigate the hypothesis that deeper flow paths, capable of carrying substantial amounts of tritium, may exist in the vicinity of the burial ground. As a first step in seeking deeper flow paths, a water budget was constructed for the burial ground site. The water budget, a materials balance used by hydrologists, is expressed in annual area inches of rainfall. Components of the water budget for the burial ground area were analyzed to determine whether significant flow paths may exist below the tan clay. Mean annual precipitation was estimated as 47 inches, with evapotranspiration, run-off, and groundwater recharge estimated as 30, 2, and 15 inches, respectively. These estimates, when combined with groundwater discharge data, suggest that 5 inches of the groundwater recharge flow above the tan clay and that 10 inches flow below the tan clay. Therefore, two-thirds of the groundwater recharge appears to follow flow paths that are deeper than those previously found. 13 references, 10 figures, 5 tables.

Hubbard, J.E.; Emslie, R.H.

1984-03-19T23:59:59.000Z

250

Construction of MV-6 Well Pad at the Central Nevada Test Area Completed |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Construction of MV-6 Well Pad at the Central Nevada Test Area Construction of MV-6 Well Pad at the Central Nevada Test Area Completed Construction of MV-6 Well Pad at the Central Nevada Test Area Completed October 22, 2013 - 6:10pm Addthis What does this project do? Goal 1. Protect human health and the environment A new groundwater monitoring/validation (MV) well was installed at the Central Nevada Test Area (CNTA) in September 2013. LM proposed this well to the Nevada Division of Environmental Protection (NDEP) to enhance the existing monitoring network and to expedite the Federal Facility Agreement and Consent Order (FFACO) closure process for the CNTA Subsurface Corrective Action Unit. CNTA is located in Hot Creek Valley in Nye County, Nevada, adjacent to U.S. Highway 6, about 30 miles north of Warm Springs, Nevada. CNTA was the site of "Project Faultless," a test site where a

251

Construction of MV-6 Well Pad at the Central Nevada Test Area Completed |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Construction of MV-6 Well Pad at the Central Nevada Test Area Construction of MV-6 Well Pad at the Central Nevada Test Area Completed Construction of MV-6 Well Pad at the Central Nevada Test Area Completed October 22, 2013 - 6:10pm Addthis What does this project do? Goal 1. Protect human health and the environment A new groundwater monitoring/validation (MV) well was installed at the Central Nevada Test Area (CNTA) in September 2013. LM proposed this well to the Nevada Division of Environmental Protection (NDEP) to enhance the existing monitoring network and to expedite the Federal Facility Agreement and Consent Order (FFACO) closure process for the CNTA Subsurface Corrective Action Unit. CNTA is located in Hot Creek Valley in Nye County, Nevada, adjacent to U.S. Highway 6, about 30 miles north of Warm Springs, Nevada. CNTA was the site of "Project Faultless," a test site where a

252

Refraction Survey At Rye Patch Area (Feighner, Et Al., 1999) | Open Energy  

Open Energy Info (EERE)

Rye Patch Area (Feighner, Et Al., 1999) Rye Patch Area (Feighner, Et Al., 1999) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Refraction Survey At Rye Patch Area (Feighner, Et Al., 1999) Exploration Activity Details Location Rye Patch Area Exploration Technique Refraction Survey Activity Date Usefulness not indicated DOE-funding Unknown Notes Because the results of the VSP indicated apparent reflections, TGI proceeded with the collection of 3.0 square miles of 3-D surface seismic data over the Rye Patch reservoir. The data acquisition (which included the use of LBNL's three-component high temperature borehole geophone in well 44-28) was accomplished in August 1998. Initial processed results provided by the subcontractor Subsurface Exploration Co. (SECO) were delivered to

253

Corrective action investigation plan for Project Shoal Area CAU No. 416  

SciTech Connect

This Corrective Action Investigation Plan (CAIP) is part of an ongoing US Department of Energy (DOE)-funded project for the investigation of Corrective Action Unit (CAU) No. 416, Project Shoal Area (PSA). Project Shoal was conducted to determine whether seismic waves produced by underground nuclear testing could be differentiated from naturally occurring earthquakes. The PSA site is located approximately 30 miles southeast of Fallon, Nevada, in the northern portion of Sand Springs Mountains in Churchill County. This CAIP will be implemented in accordance with the Federal Facility Agreement and Consent Order, the Industrial Sites Quality Assurance Project Plan, and all applicable Nevada Division of Environmental Protection policies and regulations.

NONE

1996-08-01T23:59:59.000Z

254

Effects of uranium mining of ground water in Ambrosia Lake area, New Mexico  

SciTech Connect

The principal ore-bearing zone in the Ambrosia Lake area of the Grants uranium district is the Westwater Canyon Member of the Morrison Formation (Jurassic). This unit is also one of the major artesian aquifers in the region. Significant declines in the potentiometric lead within the aquifer have been recorded, although cones of depression do not appear to have spread laterally more than a few miles. Loss of potentiometric head in the Westwater Canyon Member has resulted in the interformational migration of ground water along fault zones from overlying aquifers of Cretaceous age. This migration has produced local deterioration in chemical quality of the ground water.

Kelly, T.E.; Link, R.L.; Schipper, M.R.

1980-01-01T23:59:59.000Z

255

Three Mile Island Generating Station  

E-Print Network (OSTI)

ii TABLE OF CONTENTS I. Executive Summary................................................................................................................ 1 II. Introduction............................................................................................................................. 3 III. Exercise Overview.............................................................................................................. 6

Technological Hazards Branch

2009-01-01T23:59:59.000Z

256

Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester

2012-07-01T23:59:59.000Z

257

PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos

2008-06-27T23:59:59.000Z

258

LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance

259

Division/ Interest Area Information  

Science Conference Proceedings (OSTI)

Learn more about Divisions and Interest areas. Division/ Interest Area Information Membership Information achievement application award Awards distinguished division Divisions fats job Join lipid lipids Member member get a member Membership memori

260

DOE Designates Southwest Area and Mid-Atlantic Area National...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Designates Southwest Area and Mid-Atlantic Area National Interest Electric Transmission Corridors October 2, 2007 DOE Designates Southwest Area and Mid-Atlantic Area National...

Note: This page contains sample records for the topic "area miles mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

DOE Designates Southwest Area and Mid-Atlantic Area National...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Designates Southwest Area and Mid-Atlantic Area National Interest Electric Transmission Corridors DOE Designates Southwest Area and Mid-Atlantic Area National Interest Electric...

262

Geothermal br Resource br Area Geothermal br Resource br Area...  

Open Energy Info (EERE)

Brady Hot Springs Geothermal Area Brady Hot Springs Geothermal Area Northwest Basin and Range Geothermal Region MW K Coso Geothermal Area Coso Geothermal Area Walker Lane...

263

Water information bulletin No. 30: geothermal investigations in Idaho. Part 11. Geological, hydrological, geochemical and geophysical investigations of the Nampa-Caldwell and adjacent areas, southwestern Idaho  

DOE Green Energy (OSTI)

The area under study included approximately 925 sq km (357 sq mi) of the Nampa-Caldwell portion of Canyon County, an area within the central portion of the western Snake River Plain immediately west of Boise, Idaho. Geologic mapping, hydrologic, geochemical, geophysical, including detailed gravity and aeromagnetic surveys, were run to acquire needed data. In addition, existing magnetotelluric and reflection seismic data were purchased and reinterpreted in light of newly acquired data.

Mitchell, J.C. (ed.)

1981-12-01T23:59:59.000Z

264

An Aerial Radiological Survey of Selected Areas of Area 18 - Nevada Test Site  

Science Conference Proceedings (OSTI)

As part of the proficiency training for the Radiological Mapping mission of the Aerial Measuring System (AMS), a survey team from the Remote Sensing Laboratory-Nellis (RSL-Nellis) conducted an aerial radiological survey of selected areas of Area 18 of the Nevada Test Site (NTS) for the purpose of mapping man-made radiation deposited as a result of the Johnnie Boy and Little Feller I tests. The survey area centered over the Johnnie Boy ground zero but also included the ground zero and deposition area of the Little Feller I test, approximately 7,000 feet (2133 meters) southeast of the Johnnie Boy site. The survey was conducted in one flight. The completed survey covered a total of 4.0 square miles. The flight lines (with the turns) over the surveyed areas are presented in Figure 1. One 2.5-hour-long flight was performed at an altitude of 100 ft above ground level (AGL) with 200 foot flight-line spacing. A test-line flight was conducted near the Desert Rock Airstrip to ensure quality control of the data. The test line is not shown in Figure 1. However, Figure 1 does include the flight lines for a ''perimeter'' flight. The path traced by the helicopter flying over distinct roads within the survey area can be used to overlay the survey data on a base map or image. The flight survey lines were flown in an east-west orientation perpendicular to the deposition patterns for both sites. This technique provides better spatial resolution when contouring the data. The data were collected by the AMS data acquisition system (REDAR V) using an array of twelve 2-inch x 4-inch x 16-inch sodium iodide (NaI) detectors flown on-board a twin-engine Bell 412 helicopter. Data, in the form of gamma energy spectra, were collected every second over the course of the survey and were geo-referenced using a differential Global Positioning System. Spectral data allows the system to distinguish between ordinary fluctuations in natural background radiation levels and the signature produced by man-made radioisotopes. Spectral data can also identify specific radioactive isotopes. Based on the results of the RSL NTS 1994 surveys, this area was chosen for a resurvey to improve the spatial resolution of the reported depositions for the Johnnie Boy and Little Feller I events. In addition, the survey was expected to confirm the absence of detectable concentrations of Americium-241 (Am-241) at the Johnnie Boy site and attempt to confirm the presence of Uranium-235 (U-235).

Craig Lyons

2009-07-31T23:59:59.000Z

265

Economic Effects of Land Subsidence Due to Excessive Groundwater Withdrawal in the Texas Gulf Coast Area  

E-Print Network (OSTI)

Land surface subsidence continues to be a destructive force in the Texas Gulf Coast area. The sinking of the surface has been linked by engineers to the withdrawal of groundwater. Subsidence causes damages and property value losses as saltwater encroachment is increased, property is permanently inundated, and temporary flooding is intensified. This study provides estimates of private and public costs attributable to land subsidence in a 945 square mile area that has subsided one foot or more since 1943. Estimates are divided into three sub-areas within this total area to provide insight into the incidence of subsidence-related costs. The sub-areas considered in this study were sub-area I, an 83 square mile area between Houston and Baytown containing square mile sample blocks adjacent to the upper Galveston bay and/or Buffalo Bayou and the Houston Ship Channel; sub-area II, the 25 square mile area surrounding Clear Lake and adjacent land fronting on Galveston bay; and sub-area III, the remaining area within the total 945 square mile area that had experienced subsidence of approximately two feet or more since 1943. Personal interviews, using questionnaires designed for reporting of damages and property value losses by a random sample of owners of residential, commercial and industrial property, comprised the data base for estimating total private costs attributable to subsidence. Public costs (federal, state, county and municipal) were obtained from personal interviews with public officials. In total, over 1100 interviews were conducted in the study area. Data from these interviews were expanded to total cost estimates for the subsiding area. Physical effects of surface subsidence were found to be largely dependent upon location of the property. Most damages and losses in property value occur in those areas in close proximity to Galveston bay and/or major waterways. Temporary flooding, permanent inundation, bulkheading and landfilling were the major subsidence-related causes of cost and/or losses in property value. Structural damages, largely from subsidence aggravated surface faults, were also significant. These comprised a higher proportion of damages in areas remote from the waterfront than in low lying areas subject to frequent flooding or permanent inundation. Estimated annual costs and property value losses totaled over $31.7 million per year for the study area as a whole. These were primarily costs to residential, commercial and industrial property owners, but included over $.5 million per year in public costs for damage abatement or repair to public facilities. Estimated costs by sub-areas revealed a higher incidence and intensity of damage and property value loss in waterfront (I and II) than in non-waterfront areas (III). Estimated costs in sub-areas I, II and III were $8.79 million, $5 million and $17.4 million, respectively. Sub-area I, which made up about 8.8 percent of the total study area, experienced 27.7 percent of total subsidence-related costs. Sub-area II experienced 15.8 percent of total costs while occupying only 3 percent of the total study area. And, although sub-area III had almost 55 percent of the total costs, it includes over 88 percent of the total area. Hence, subsidence damages and losses in property value are concentrated heavily in areas in close proximity to the immediate coastline of Galveston bay, Buffalo Bayou, Clear Lake and Taylor Lake. Other sections throughout the study area experienced damages and property losses but less frequently and less intensively. A comparative analysis of the total costs of groundwater pumping with alternative surface water importation was developed to examine the economic feasibility of importing surface water to displace groundwater as a means of avoiding annual subsidence costs. A break-even analysis revealed that for the five year period 1969-73, the importation of surface water to meet all the area's water needs (up to 198.16 billion gallons per year) would have been economically justifi

Jones, L. L.; Larson, J.

1975-09-01T23:59:59.000Z

266

DOE/EIS-0285/SA-133: Supplement Analysis for the Transmission System Vegetation Management Program FEIS Hanford-Ostrander [Mile 126/1-146/4] (3/20/03)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

0, 2003 0, 2003 REPLY TO ATTN OF: KEP-4 SUBJECT: Supplement Analysis for the Transmission System Vegetation Management Program FEIS (DOE/EIS-0285/SA-133 Hanford-Ostrander [Mile 126/1-146/4] Elizabeth Johnson Natural Resource Specialist- TFR/The Dalles Proposed Action: Vegetation Management for the Hanford-Ostrander Corridor from structure 126/1 through structure 146/4. Right of way width averages 312 feet. Location: The project location is within Skamania County, Washington. The project commences to the west of the White Salmon River and proceeds in a westerly directly for approximately 20 miles. Proposed by: Bonneville Power Administration (BPA). Description of the Proposal: BPA proposes to remove unwanted vegetation along the right-of-

267

Material Disposal Areas  

NLE Websites -- All DOE Office Websites (Extended Search)

Material Disposal Areas Material Disposal Areas Material Disposal Areas Material Disposal Areas, also known as MDAs, are sites where material was disposed of below the ground surface in excavated pits, trenches, or shafts. Contact Environmental Communication & Public Involvement P.O. Box 1663 MS M996 Los Alamos, NM 87545 (505) 667-0216 Email Material Disposal Areas at LANL The following are descriptions and status updates of each MDA at LANL. To view a current fact sheet on the MDAs, click on LA-UR-13-25837 (pdf). MDA A MDA A is a Hazard Category 2 nuclear facility comprised of a 1.25-acre, fenced, and radiologically controlled area situated on the eastern end of Delta Prime Mesa. Delta Prime Mesa is bounded by Delta Prime Canyon to the north and Los Alamos Canyon to the south.

268

Vertical Seismic Profiling At Rye Patch Area (Feighner, Et Al., 1999) |  

Open Energy Info (EERE)

Feighner, Et Al., 1999) Feighner, Et Al., 1999) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Vertical Seismic Profiling At Rye Patch Area (Feighner, Et Al., 1999) Exploration Activity Details Location Rye Patch Area Exploration Technique Vertical Seismic Profiling Activity Date Usefulness useful DOE-funding Unknown Notes In December 1997 LBNL obtained a VSP in well 46-28 to determine the seismic reflectivity in the area and to obtain velocity information for the design and potential processing of the proposed 3-D seismic survey Feighner et al. (1998). Because the results of the VSP indicated apparent reflections, TGI proceeded with the collection of 3.0 square miles of 3-D surface seismic data over the Rye Patch reservoir. References M. Feighner, R. Gritto, T. M. Daley, H. Keers, E. L. Majer (1999)

269

Naval applications study areas  

SciTech Connect

This memorandum discusses study areas and items that will require attention for the naval studies of the utilization of nuclear propulsion in a submarine-based missile system.

Hadley, J. W.

1962-06-20T23:59:59.000Z

270

Boulder Area Transportation  

Science Conference Proceedings (OSTI)

... NIST does not endorse or guarantee the quality or services provided by these businesses. All Denver/Boulder area transportation companies. ...

2011-11-16T23:59:59.000Z

271

NIST Aperture area measurements  

Science Conference Proceedings (OSTI)

... particularly critical, for example, in climate and weather applications on ... of aperture areas used in exo-atmospheric solar irradiance measurements; ...

2011-11-03T23:59:59.000Z

272

Application for a Permit to Operate a Class III Solid Waste Disposal Site at the Nevada Test Site Area 5 Asbestiform Low-Level Solid Waste Disposal Site  

SciTech Connect

The NTS solid waste disposal sites must be permitted by the state of Nevada Solid Waste Management Authority (SWMA). The SWMA for the NTS is the Nevada Division of Environmental Protection, Bureau of Federal Facilities (NDEP/BFF). The U.S. Department of Energy's National Nuclear Security Administration Nevada Site Office (NNSA/NSO) as land manager (owner), and National Security Technologies (NSTec), as operator, will store, collect, process, and dispose all solid waste by means that do not create a health hazard, a public nuisance, or cause impairment of the environment. NTS disposal sites will not be included in the Nye County Solid Waste Management Plan. The NTS is located approximately 105 kilometers (km) (65 miles [mi]) northwest of Las Vegas, Nevada (Figure 1). The U.S. Department of Energy (DOE) is the federal lands management authority for the NTS, and NSTec is the Management and Operations contractor. Access on and off the NTS is tightly controlled, restricted, and guarded on a 24-hour basis. The NTS has signs posted along its entire perimeter. NSTec is the operator of all solid waste disposal sites on the NTS. The Area 5 RWMS is the location of the permitted facility for the Solid Waste Disposal Site (SWDS). The Area 5 RWMS is located near the eastern edge of the NTS (Figure 2), approximately 26 km (16 mi) north of Mercury, Nevada. The Area 5 RWMS is used for the disposal of low-level waste (LLW) and mixed low-level waste. Many areas surrounding the RWMS have been used in conducting nuclear tests. A Notice of Intent to operate the disposal site as a Class III site was submitted to the state of Nevada on January 28, 1994, and was acknowledged as being received in a letter to the NNSA/NSO on August 30, 1994. Interim approval to operate a Class III SWDS for regulated asbestiform low-level waste (ALLW) was authorized on August 12, 1996 (in letter from Paul Liebendorfer to Runore Wycoff), with operations to be conducted in accordance with the ''Management Plan for the Disposal of Low-Level Waste with Regulated Asbestos Waste.'' A requirement of the authorization was that on or before October 9, 1999, a permit was required to be issued. Because of NDEP and NNSA/NSO review cycles, the final permit was issued on April 5, 2000, for the operation of the Area 5 Low-Level Waste Disposal Site, utilizing Pit 7 (P07) as the designated disposal cell. The original permit applied only to Pit 7, with a total design capacity of 5,831 cubic yards (yd{sup 3}) (157,437 cubic feet [ft{sup 3}]). NNSA/NSO is expanding the SWDS to include the adjacent Upper Cell of Pit 6 (P06), with an additional capacity of 28,037 yd{sup 3} (756,999 ft{sup 3}) (Figure 3). The proposed total capacity of ALLW in Pit 7 and P06 will be approximately 33,870 yd{sup 3} (0.9 million ft{sup 3}). The site will be used for the disposal of regulated ALLW, small quantities of low-level radioactive hydrocarbon-burdened (LLHB) media and debris, LLW, LLW that contains PCB Bulk Product Waste greater than 50 ppm that leaches at a rate of less than 10 micrograms of PCB per liter of water, and small quantities of LLHB demolition and construction waste (hereafter called permissible waste). Waste containing free liquids, or waste that is regulated as hazardous waste under the Resource Conservation and Recovery Act (RCRA) or state-of-generation hazardous waste regulations, will not be accepted for disposal at the site. The only waste regulated under the Toxic Substances Control Act (TSCA) that will be accepted at the disposal site is regulated asbestos-containing materials (RACM). The term asbestiform is used throughout this document to describe this waste. Other TSCA waste (i.e., polychlorinated biphenyls [PCBs]) will not be accepted for disposal at the SWDS. The disposal site will be used as a depository of permissible waste generated both on site and off site. All generators designated by NNSA/NSO will be eligible to dispose regulated ALLW at the Asbestiform Low-Level Waste Disposal Site in accordance with the U.S. Department of Energy, Nevada Operations Office (DOE/NV) 325

NSTec Environmental Programs

2010-09-14T23:59:59.000Z

273

Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.

2003-12-01T23:59:59.000Z

274

CLOSURE REPORT FOR CORRECTIVE ACTION UNIT165: AREA 25 AND 26 DRY WELL AND WASH DOWN AREAS, NEVADA TEST SITE, NEVADA  

SciTech Connect

This Closure Report (CR) documents the closure activities for Corrective Action Unit (CAU) 165, Area 25 and 26 Dry Well and Washdown Areas, according to the Federal Facility Agreement and Consent Order (FFACO) of 1996. CAU 165 consists of 8 Corrective Action Sites (CASs) located in Areas 25 and 26 of the Nevada Test Site (NTS). The NTS is located approximately 105 kilometers (65 miles) northwest of Las Vegas, nevada. Site closure activities were performed according to the Nevada Division of Environmental Protection (NDEP)-approved Corrective Action Plan (CAP) for CAU 165. CAU 165 consists of the following CASs: (1) CAS 25-07-06, Train Decontamination Area; (2) CAS 25-07-07, Vehicle Washdown; (3) CAS 25-20-01, Lab Drain Dry Well; (4) CAS 25-47-01, Reservoir and French Drain; (5) CAS 25-51-02, Drywell; (6) CAS 25-59-01, Septic System; (7) CAS 26-07-01, Vehicle Washdown Station; and (8) CAS 26-59-01, Septic System. CAU 165, Area 25 and 26 Dry Well and Washdown Areas, consists of eight CASs located in Areas 25 and 26 of the NTS. The approved closure alternatives included No Further Action, Clean Closure, and Closure in Place with Administrative Controls.

BECHTEL NEVADA

2005-12-01T23:59:59.000Z

275

DC Resistivity Survey (Dipole-Dipole Array) At Coso Geothermal Area (1977)  

Open Energy Info (EERE)

Dipole Array) At Coso Geothermal Area (1977) Dipole Array) At Coso Geothermal Area (1977) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: DC Resistivity Survey (Dipole-Dipole Array) At Coso Geothermal Area (1977) Exploration Activity Details Location Coso Geothermal Area Exploration Technique DC Resistivity Survey (Dipole-Dipole Array) Activity Date 1977 Usefulness useful regional reconnaissance DOE-funding Unknown Notes Detailed electrical resistivity survey for a 54 line-km. This survey has defined a bedrock resistivity low at least 4 sq mi (10 sq km) in extent; survey data indicate that a 10 to 20 ohm-meter zone extends from near surface to a depth greater than 750 meters. References Fox, R. C. (1 May 1978) Dipole-dipole resistivity survey of a portion of the Coso Hot Springs KGRA, Inyo County, California

276

Fueling area site assessment  

SciTech Connect

This report provides results of a Site Assessment performed at the Fuel Storage Area at Buckley ANG Base in Aurora, Colorado. Buckley ANG Base occupies 3,328 acres of land within the City of Aurora in Arapahoe County, Colorado. The Fuel Storage Area (also known as the Fueling Area) is located on the west side of the Base at the intersection of South Powderhorn Street and East Breckenridge Avenue. The Fueling Area consists of above ground storage tanks in a bermed area, pumps, piping, valves, an unloading stand and a fill stand. Jet fuel from the Fueling Area is used to support aircraft operations at the Base. Jet fuel is stored in two 200,000 gallon above ground storage tanks. Fuel is received in tanker trucks at the unloading stand located south and east of the storage tanks. Fuel required for aircraft fueling and other use is transferred into tanker trucks at the fill stand and transported to various points on the Base. The Fuel Storage Area has been in operation for over 20 years and handles approximately 7 million gallons of jet fuel annually.

1996-08-15T23:59:59.000Z

277

NSTB Summarizes Vulnerable Areas  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NSTB Summarizes Vulnerable Areas NSTB Summarizes Vulnerable Areas Commonly Found in Energy Control Systems Experts at the National SCADA Test Bed (NSTB) discovered some common areas of vulnerability in the energy control systems assessed between late 2004 and early 2006. These vulnerabilities ranged from conventional IT security issues to specific weaknesses in control system protocols. The paper "Lessons Learned from Cyber Security Assessments of SCADA and Energy Management Systems" describes the vulnerabilities and recommended strategies for mitigating them. It should be of use to asset owners and operators, control system vendors, system integrators, and third-party vendors interested in enhancing the security characteristics of current and future products.

278

area | OpenEI  

Open Energy Info (EERE)

area area Dataset Summary Description These estimates are derived from a composite of high resolution wind resource datasets modeled for specific countries with low resolution data originating from the National Centers for Environmental Prediction (United States) and the National Center for Atmospheric Research (United States) as processed for use in the IMAGE model. The high resolution datasets were produced by the National Renewable Energy Laboratory (United States), Risø DTU National Laboratory (Denmark), the National Institute for Space Research (Brazil), and the Canadian Wind Energy Association. The data repr Source National Renewable Energy Laboratory Date Released Unknown Date Updated Unknown Keywords area capacity clean energy international National Renewable Energy Laboratory

279

Nevada Test Site 2007 Data Report: Groundwater Monitoring Program Area 5 Radioactive Waste Management Site  

SciTech Connect

This report is a compilation of the groundwater sampling results from three monitoring wells located near the Area 5 Radioactive Waste Management Site (RWMS) at the Nevada Test Site (NTS), Nye County, Nevada, for calendar year 2007. The NTS is an approximately 3,561 square kilometer (1,375 square mile) restricted-access federal installation located approximately 105 kilometers (65 miles) northwest of Las Vegas, Nevada (Figure 1). Pilot wells UE5PW-1, UE5PW-2, and UE5PW-3 are used to monitor the groundwater at the Area 5 RWMS (Figure 2). In addition to groundwater monitoring results, this report includes information regarding site hydrogeology, well construction, sample collection, and meteorological data measured at the Area 5 RWMS. The disposal of low-level radioactive waste and mixed low-level radioactive waste at the Area 5 RWMS is regulated by U.S. Department of Energy (DOE) Order 435.1, 'Radioactive Waste Management'. The disposal of mixed low-level radioactive waste is also regulated by the state of Nevada under the Resource Conservation and Recovery Act (RCRA) regulation Title 40 Code of Federal Regulations (CFR) Part 265, 'Interim Status Standards for Owners and Operators of Hazardous Waste Treatment, Storage, and Disposal Facilities' (CFR, 1999). The format of this report was requested by the Nevada Division of Environmental Protection (NDEP) in a letter dated August 12, 1997. The appearance and arrangement of this document have been modified slightly since that date to provide additional information and to facilitate the readability of the document. The objective of this report is to satisfy any Area 5 RWMS reporting agreements between DOE and NDEP.

NSTec Environmental Management

2008-01-01T23:59:59.000Z

280

Geographic Area Month  

Gasoline and Diesel Fuel Update (EIA)

Fuels by PAD District and State (Cents per Gallon Excluding Taxes) - Continued Geographic Area Month No. 1 Distillate No. 2 Distillate a No. 4 Fuel b Sales to End Users Sales for...

Note: This page contains sample records for the topic "area miles mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

3. Producing Areas  

U.S. Energy Information Administration (EIA)

The OCS area provides surplus capacity to meet major seasonal swings in the lower 48 States gas requirements. The ... Jun-86 9,878 17,706 1,460 19,166 9,288 51.5

282

Western Area Power Administration  

NLE Websites -- All DOE Office Websites (Extended Search)

Loveland Area Projects November 29-30, 2011 2 Agenda * Overview of Western Area Power Administration * Post-1989 Loveland Area Projects (LAP) Marketing Plan * Energy Planning and Management Program * Development of the 2025 PMI Proposal * 2025 PMI Proposal * 2025 PMI Comment Period & Proposal Information * Questions 3 Overview of Western Area Power Administration (Western) * One of four power marketing administrations within the Department of Energy * Mission: Market and deliver reliable, renewable, cost-based Federal hydroelectric power and related services within a 15-state region of the central and western U.S. * Vision: Provide premier power marketing and transmission services Rocky Mountain Region (RMR) is one of five regional offices 4 Rocky Mountain Region

283

300 AREA URANIUM CONTAMINATION  

SciTech Connect

{sm_bullet} Uranium fuel production {sm_bullet} Test reactor and separations experiments {sm_bullet} Animal and radiobiology experiments conducted at the. 331 Laboratory Complex {sm_bullet} .Deactivation, decontamination, decommissioning,. and demolition of 300 Area facilities

BORGHESE JV

2009-07-02T23:59:59.000Z

284

Decontamination & decommissioning focus area  

Science Conference Proceedings (OSTI)

In January 1994, the US Department of Energy Office of Environmental Management (DOE EM) formally introduced its new approach to managing DOE`s environmental research and technology development activities. The goal of the new approach is to conduct research and development in critical areas of interest to DOE, utilizing the best talent in the Department and in the national science community. To facilitate this solutions-oriented approach, the Office of Science and Technology (EM-50, formerly the Office of Technology Development) formed five Focus AReas to stimulate the required basic research, development, and demonstration efforts to seek new, innovative cleanup methods. In February 1995, EM-50 selected the DOE Morgantown Energy Technology Center (METC) to lead implementation of one of these Focus Areas: the Decontamination and Decommissioning (D & D) Focus Area.

NONE

1996-08-01T23:59:59.000Z

285

APS Area Emergency Supervisors  

NLE Websites -- All DOE Office Websites (Extended Search)

Area Emergency Supervisors BUILDING AES AAES 400-EAA Raul Mascote Debra Eriksen-Bubulka 400-A (SPX) Tim Jonasson 400-Sectors 25-30 Reggie Gilmore 401-CLO Steve Downey Ed Russell...

286

Evapotranspiration Cover for the 92-Acre Area Retired Mixed Waste Pits:Interim CQA Report  

SciTech Connect

This Interim Construction Quality Assurance (CQA) Report is for the 92-Acre Evapotranspiration Cover, Area 5 Waste Management Division (WMD) Retired Mixed Waste Pits, Nevada National Security Site, Nevada for the period of January 20, 2011 to May 12, 2011. This Interim Construction Quality Assurance (CQA) Report is for the 92-Acre Evapotranspiration Cover, Area 5 Waste Management Division (WMD) Retired Mixed Waste Pits, Nevada National Security Site, Nevada for the period of January 20, 2011 to May 12, 2011. Construction was approved by the Nevada Division of Environmental Protection (NDEP) under the Approval of Corrective Action Decision Document/Corrective Action Plan (CADD/CAP) for Corrective Action Unit (CAU) 111: Area 5 WMD Retired Mixed Waste Pits, Nevada National Security Site, Nevada, on January 6, 2011, pursuant to Subpart XII.8a of the Federal Facility Agreement and Consent Order. The project is located in Area 5 of the Radioactive Waste Management Complex (RWMC) at the Nevada National Security Site (NNSS), formerly known as the Nevada Test Site, located in southern Nevada, approximately 65 miles northwest of Las Vegas, Nevada, in Nye County. The project site, in Area 5, is located in a topographically closed basin approximately 14 additional miles north of Mercury Nevada, in the north-central part of Frenchman Flat. The Area 5 RWMS uses engineered shallow-land burial cells to dispose of packaged waste. The 92-Acre Area encompasses the southern portion of the Area 5 RWMS, which has been designated for the first final closure operations. This area contains 13 Greater Confinement Disposal (GCD) boreholes, 16 narrow trenches, and 9 broader pits. With the exception of two active pits (P03 and P06), all trenches and pits in the 92-Acre Area had operational covers approximately 2.4 meters thick, at a minimum, in most areas when this project began. The units within the 92-Acre Area are grouped into the following six informal categories based on physical location, waste types and regulatory requirements: (1) Pit 3 Mixed Waste Disposal Unit (MWDU); (2) Corrective Action Unit (CAU) 111; (3) CAU 207; (4) Low-level waste disposal units; (5) Asbestiform low-level waste disposal units; and (6) One transuranic (TRU) waste trench.

The Delphi Groupe, Inc., and J. A. Cesare and Associates, Inc.

2011-06-20T23:59:59.000Z

287

Report of biological investigations at the Los Medanos Waste Isolation Pilot Plant (WIPP) area of New Mexico during FY 1978  

Science Conference Proceedings (OSTI)

The US Department of Energy is considering the construction of a Waste Isolation Pilot Plant (WIPP) in Eddy County, NM. This location is approximately 40 km east of Carlsbad, NM. Biological studies during FY 1978 were concentrated within a 5-mi radius of drill hole ERDA 9. Additional study areas have been established at other sites in the vicinity, e.g., the Gnome site, the salt lakes and several stations along the Pecos River southward from Carlsbad, NM, to the dam at Red Bluff Reservoir in Texas. The precise locations of all study areas are presented and their biology discussed.

Best, T.L.; Neuhauser, S. (eds.)

1980-03-01T23:59:59.000Z

288

Geology and hydrocarbon potential of the Sepik-Ramu area, Ramu basin, Papua New Guinea  

Science Conference Proceedings (OSTI)

Improvements in seismic processing have made new interpretations of the structural and depositional history of the northwestern portion of the Ramu basin possible. Support for a wrench tectonic model for this area is observed in the reprocessed seismic data. Strike-slip movement along major fault zones has allowed compressional forces to be translated laterally and resulted in only minor deformation occurring in the Sepik-Ramu area. The major tectonic event is thought to have occurred during late Miocene-early Pliocene, and not during the middle Miocene, as earlier hypothesized. Consequently, Miocene deposition is postulated to have occurred uninterrupted by periods of erosion. A thick Miocene section is preserved in this region and is postulated to contain slope, reef, and shelf carbonates of early to middle Miocene age. This interpretation has led to the identification of a reef trend over 7 mi wide and at least 42 mi long containing numerous pinnacle reefs. The pinnacle reefs are analogous to those found in the Salawati basin of Irian Jaya, Indonesia. The reefs are overlain by deep-water shales, a combination that provides potential reservoirs and seals necessary for the entrapment of hydrocarbons. The presence of oil and gas seeps document the existence of a source. These three factors justify hydrocarbon exploration in this area. The numerous potential drilling targets may lead to the discovery of significant quantities of hydrocarbons.

Donaldson, J.C.; Wilson, J.T. (Anderman/Smith Operating Co., Denver, CO (USA))

1990-06-01T23:59:59.000Z

289

Reflection Survey At Rye Patch Area (Feighner, Et Al., 1999) | Open Energy  

Open Energy Info (EERE)

Feighner, Et Al., 1999) Feighner, Et Al., 1999) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Reflection Survey At Rye Patch Area (Feighner, Et Al., 1999) Exploration Activity Details Location Rye Patch Area Exploration Technique Reflection Survey Activity Date Usefulness not indicated DOE-funding Unknown Notes Because the results of the VSP indicated apparent reflections, TGI proceeded with the collection of 3.0 square miles of 3-D surface seismic data over the Rye Patch reservoir. The data acquisition (which included the use of LBNL's three-component high temperature borehole geophone in well 44-28) was accomplished in August 1998. Initial processed results provided by the subcontractor Subsurface Exploration Co. (SECO) were delivered to TGI in December 1998. After the initial analysis of SECO's results, it was

290

Corrective action investigation plan for CAU No. 424: Area 3 Landfill Complex, Tonopah Test Range, Nevada  

Science Conference Proceedings (OSTI)

This Correction Action Investigation Plan contains the environmental sample collection objectives and the criteria for conducting site investigation activities at the Area 3 Landfill Complex, CAU No. 424, which is located at the Tonopah Test Range (TTR). The TTR, included in the Nellis Air Force Range, is approximately 255 kilometers (140 miles) northwest of Las Vegas, nevada. The CAU 424 is comprised of eight individual landfill sites that are located around and within the perimeter of the Area 3 Compound. Due to the unregulated disposal activities commonly associated with early landfill operations, an investigation will be conducted at each CAS to complete the following tasks: identify the presence and nature of possible contaminant migration from the landfills; determine the vertical and lateral extent of possible contaminant migration; ascertain the potential impact to human health and the environment; and provide sufficient information and data to develop and evaluate appropriate corrective action strategies for each CAS.

NONE

1997-04-01T23:59:59.000Z

291

A solar powered distillation plant and pump station for use in ocean side desert areas  

DOE Green Energy (OSTI)

There are thousands of miles of ocean shoreline which could sustain a productive human existence if sufficient fresh water were available for human consumption and for irrigation of crops. While solar stills can be built to produce fresh water at or close to sea level, raising water to a height sufficient to irrigate crops, even with minimum water usage crops, requires a significant amount of energy. This paper describes a ``no-external power`` process by which seawater can be purified and raised to a height above sea level sufficient to carry on a productive living in certain areas of the world. This device, the Solar Evaporation and Pumping System (SEAPS) is described as to function and areas of use.

Dearien, J.A.; Priebe, S.J.

1994-12-31T23:59:59.000Z

292

Closure Report for Corrective Action Unit 425: Area 9 Main Lake Construction Debris Disposal Area, Tonopah Test Range, Nevada  

SciTech Connect

Corrective Action Unit (CAU) 425 is located on the Tonopah Test Range, approximately 386 kilometers (240 miles) northwest of Las Vegas, Nevada. CAU 425 is listed in the Federal Facility Agreement and Consent Order (FFACO, 1996) and is comprised of one Corrective Action Site (CAS). CAS 09-08-001-TA09 consisted of a large pile of concrete rubble from the original Hard Target and construction debris associated with the Tornado Rocket Sled Tests. CAU 425 was closed in accordance with the FFACO and the Nevada Division of Environmental Protection-approved Streamlined Approach for Environmental Restoration Plan for CAU 425: Area 9 Main Lake Construction Debris Disposal Area, Tonopah Test Range, Nevada (U.S. Department of Energy, Nevada Operations Office, 2002). CAU 425 was closed by implementing the following corrective actions: The approved corrective action for this unit was clean closure. Closure activities included: (1) Removal of all the debris from the site. (2) Weighing each load of debris leaving the job site. (3) Transporting the debris to the U.S. Air Force Construction Landfill for disposal. (4) Placing the radioactive material in a U.S. Department of Transportation approved container for proper transport and disposal. (5) Transporting the radioactive material to the Nevada Test Site for disposal. (6) Regrading the job site to its approximate original contours/elevation.

K. B. Campbell

2003-03-01T23:59:59.000Z

293

Operational Area Monitoring Plan  

Office of Legacy Management (LM)

' ' SECTION 11.7B Operational Area Monitoring Plan for the Long -Term H yd rol og ical M o n i to ri ng - Program Off The Nevada Test Site S . C. Black Reynolds Electrical & Engineering, Co. and W. G. Phillips, G. G. Martin, D. J. Chaloud, C. A. Fontana, and 0. G. Easterly Environmental Monitoring Systems Laboratory U. S. Environmental Protection Agency October 23, 1991 FOREWORD This is one of a series of Operational Area Monitoring Plans that comprise the overall Environmental Monitoring Plan for the DOE Field Office, Nevada (DOEINV) nuclear and non- nuclear testing activities associated with the Nevada Test Site (NTS). These Operational Area Monitoring Plans are prepared by various DOE support contractors, NTS user organizations, and federal or state agencies supporting DOE NTS operations. These plans and the parent

294

Resource investigation of low- and moderate-temperature geothermal areas in San Bernardino, California  

SciTech Connect

The California Division of Mines and Geology (CDMG) selected the San Bernardino area for detailed geothermal resource investigation because the area was known to contain promising geothermal resource sites, the area contained a large population center, and the City of San Bernardino had expressed serious interest in developing the area's geothermal resource. Ninety-seven geothermal wells and springs were identified and plotted on a compiled geologic map of the 40-square-mile study area. These wells and springs were concentrated in three distinguishable resource areas: Arrowhead Hot Springs, South San Bernardino, and Harlem Hot Springs--in each of which detailed geophysical, geochemical, and geological surveys were conducted. The Arrowhead Hot Springs geothermal area lies just north of the City of San Bernardino in the San Bernardino Mountains astride a shear zone (offshoot of the San Andreas fault) in pre-Cambrian gneiss and schist. The Harlem Hot Springs geothermal area, on the east side of the City, and the South San Bernardino geothermal area, on the south side, have geothermal reservoirs in Quaternary alluvial material which overlies a moderately deep sedimentary basin bound on the southwest by the San Jacinto fault (a ground water barrier). Geothermometry calculations suggest that the Arrowhead Hot Springs geothermal area, with a maximum reservoir temperature of 142 C, may have the highest maximum reservoir temperature of the three geothermal areas. The maximum temperature recorded by CDMG in the South San Bernardino geothermal area was 56 C from an artesian well, while the maximum temperature recorded in the Harlem Hot Springs geothermal areas was 49.5 C at 174 meters (570 feet) in an abandoned water well.

Youngs, Leslie G.

1982-07-01T23:59:59.000Z

295

"1. Nine Mile Point","Gas","Entergy Louisiana Inc",1756 "2. Willow Glen","Gas","Entergy Gulf States Louisiana LLC",1752  

U.S. Energy Information Administration (EIA) Indexed Site

Louisiana" Louisiana" "1. Nine Mile Point","Gas","Entergy Louisiana Inc",1756 "2. Willow Glen","Gas","Entergy Gulf States Louisiana LLC",1752 "3. Big Cajun 2","Coal","Louisiana Generating LLC",1743 "4. Brame Energy Center","Coal","Cleco Power LLC",1423 "5. R S Nelson","Coal","Entergy Gulf States Louisiana LLC",1366 "6. Little Gypsy","Gas","Entergy Louisiana Inc",1170 "7. Waterford 3","Nuclear","Entergy Louisiana Inc",1168 "8. Acadia Energy Center","Gas","Acadia Power Partners",1063 "9. River Bend","Nuclear","Entergy Gulf States Louisiana LLC",974

296

Reflection Survey At Lightning Dock Area (Cunniff & Bowers, 2005) | Open  

Open Energy Info (EERE)

Reflection Survey At Lightning Dock Area (Cunniff & Reflection Survey At Lightning Dock Area (Cunniff & Bowers, 2005) Exploration Activity Details Location Lightning Dock Area Exploration Technique Reflection Survey Activity Date Usefulness useful DOE-funding Unknown Notes After reviewing bids from six firms, LDG contracted with Bird Geophysical Services ("Bird") to conduct a test to determine if relatively small, spring-assisted, drop weights could be used to successfully acquire deep reflections. This test showed that the contractor could produce usable data to depths of more than 1,500 ms two-way travel time. (For a given velocity model, this two-way travel time is equivalent to several kilometers of depth penetration.) Subsequently, LDG used Bird's services to acquire new traverses totaling about 27.6 km (17.2 mi.) along roads leading through the

297

Rockies Area | Open Energy Information  

Open Energy Info (EERE)

Rockies Area Rockies Area Jump to: navigation, search Contents 1 Clean Energy Clusters in the Rockies Area 1.1 Products and Services in the Rockies Area 1.2 Research and Development Institutions in the Rockies Area 1.3 Networking Organizations in the Rockies Area 1.4 Investors and Financial Organizations in the Rockies Area 1.5 Policy Organizations in the Rockies Area Clean Energy Clusters in the Rockies Area Products and Services in the Rockies Area Loading map... {"format":"googlemaps3","type":"ROADMAP","types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"limit":500,"offset":0,"link":"all","sort":[""],"order":[],"headers":"show","mainlabel":"","intro":"","outro":"","searchlabel":"\u2026

298

Bay Area | Open Energy Information  

Open Energy Info (EERE)

Bay Area Bay Area Jump to: navigation, search Contents 1 Clean Energy Clusters in the Bay Area 1.1 Products and Services in the Bay Area 1.2 Research and Development Institutions in the Bay Area 1.3 Networking Organizations in the Bay Area 1.4 Investors and Financial Organizations in the Bay Area 1.5 Policy Organizations in the Bay Area Clean Energy Clusters in the Bay Area Products and Services in the Bay Area Loading map... {"format":"googlemaps3","type":"ROADMAP","types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"limit":500,"offset":0,"link":"all","sort":[""],"order":[],"headers":"show","mainlabel":"","intro":"","outro":"","searchlabel":"\u2026

299

Texas Area | Open Energy Information  

Open Energy Info (EERE)

Area Area Jump to: navigation, search Contents 1 Clean Energy Clusters in the Texas Area 1.1 Products and Services in the Texas Area 1.2 Research and Development Institutions in the Texas Area 1.3 Networking Organizations in the Texas Area 1.4 Investors and Financial Organizations in the Texas Area 1.5 Policy Organizations in the Texas Area Clean Energy Clusters in the Texas Area Products and Services in the Texas Area Loading map... {"format":"googlemaps3","type":"ROADMAP","types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"limit":500,"offset":0,"link":"all","sort":[""],"order":[],"headers":"show","mainlabel":"","intro":"","outro":"","searchlabel":"\u2026

300

Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available

2011-10-01T23:59:59.000Z

Note: This page contains sample records for the topic "area miles mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

Baseline risk assessment for groundwater operable units at the Chemical Plant Area and the Ordnance Works Area, Weldon Spring, Missouri  

Science Conference Proceedings (OSTI)

The U.S. Department of Energy (DOE) and the U.S. Department of the Army (DA) are evaluating conditions in groundwater and springs at the DOE chemical plant area and the DA ordnance works area near Weldon Spring, Missouri. The two areas are located in St. Charles County, about 48 km (30 mi) west of St. Louis. The 88-ha (217-acre) chemical plant area is chemically and radioactively contaminated as a result of uranium-processing activities conducted by the U.S. Atomic Energy Commission in the 1950s and 1960s and explosives-production activities conducted by the U.S. Army (Army) in the 1940s. The 6,974-ha (17,232-acre) ordnance works area is primarily chemically contaminated as a result of trinitrotoluene (TNT) and dinitrotoluene (DNT) manufacturing activities during World War II. This baseline risk assessment (BRA) is being conducted as part of the remedial investigation/feasibility study (RUFS) required under the Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA) of 1980, as amended. The purpose of the BRA is to evaluate potential human health and ecological impacts from contamination associated with the groundwater operable units (GWOUs) of the chemical plant area and ordnance works area. An RI/FS work plan issued jointly in 1995 by the DOE and DA (DOE 1995) analyzed existing conditions at the GWOUs. The work plan included a conceptual hydrogeological model based on data available when the report was prepared; this model indicated that the aquifer of concern is common to both areas. Hence, to optimize further data collection and interpretation efforts, the DOE and DA have decided to conduct a joint RI/BRA. Characterization data obtained from the chemical plant area wells indicate that uranium is present at levels slightly higher than background, with a few concentrations exceeding the proposed U.S. Environmental Protection Agency (EPA) maximum contaminant level (MCL) of 20 {micro}g/L (EPA 1996c). Concentrations of other radionuclides (e.g., radium and thorium) were measured at back-ground levels and were eliminated from further consideration. Chemical contaminants identified in wells at the chemical plant area and ordnance works area include nitroaromatic compounds, metals, and inorganic anions. Trichloroethylene (TCE) and 1,2-dichloroethylene (1,2 -DCE) have been detected recently in a few wells near the raffinate pits at the chemical plant.

NONE

1999-07-14T23:59:59.000Z

302

borrow_area.cdr  

Office of Legacy Management (LM)

information information at Weldon Spring, Missouri. This site is managed by the U.S. Department of Energy Office of Legacy Management. developed by the former WSSRAP Community Relations Department to provide comprehensive descriptions of key activities that took place throughout the cleanup process The Missouri Department of Conservation (MDC) approved a plan on June 9, 1995, allowing the U.S. Department of Energy (DOE) at the Weldon Spring Site Remedial Action Project (WSSRAP) to excavate nearly 2 million cubic yards of clay material from land in the Weldon Spring Conservation Area. Clay soil from a borrow area was used to construct the permanent disposal facility at the Weldon Spring site. Clay soil was chosen to construct the disposal facility because it has low permeability when

303

Focus Area Summary  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

information provided was consolidated from the original five focus areas for the EM information provided was consolidated from the original five focus areas for the EM Corporate QA Board. The status of QAP/QIP approvals etc. was accurate at the time of posting; however, additional approvals may have been achieved since that time. If you have any questions about the information provided, please contact Bob Murray at robert.murray@em.doe.gov Task # Task Description Status 1.1 Develop a brief questionnaire to send out to both commercial and EM contractors to describe their current approach for identifying the applicable QA requirements for subcontractors, tailoring the requirements based upon risk, process for working with procurement to ensure QA requirements are incorporated into subcontracts, and implementing verification of requirement flow-down by their

304

Focus Area 3 Deliverables  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

3 - Commercial Grade item and Services 3 - Commercial Grade item and Services Dedication Implementation and Nuclear Services Office of Environmental Management And Energy Facility Contractors Group Quality Assurance Improvement Project Plan Project Focus Area Task # and Description Deliverable Project Area 3-Commercial Grade Item and Services Dedication 3.1-Complete a survey of selected EM contractors to identify the process and basis for their CGI dedication program including safety classification of items being dedicated for nuclear applications within their facilities Completed Survey Approvals: Yes/No/NA Project Managers: S. Waisley, D. Tuttel Yes Executive Committee: D. Chung, J. Yanek, N. Barker, D. Amerine No EM QA Corporate Board: No Energy Facility Contractors Group

305

Argonne area restaurants  

NLE Websites -- All DOE Office Websites (Extended Search)

area restaurants area restaurants Amber Cafe 13 N. Cass Ave. Westmont, IL 60559 630-515-8080 www.ambercafe.net Argonne Guest House Building 460 Argonne, IL 60439 630-739-6000 www.anlgh.org Ballydoyle Irish Pub & Restaurant 5157 Main Street Downers Grove, IL 60515 630-969-0600 www.ballydoylepub.com Bd's Mongolian Grill The Promenade Shopping Center Boughton Rd. & I-355 Bolingbrook, IL 60440 630-972-0450 www.gomongo.com Branmor's American Grill 300 Veterans Parkway Bolingbrook, IL 60440 630-226-9926 www.branmors.com Buca di Beppo 90 Yorktown Convenience Center Lombard, IL 60148 630-932-7673 www.bucadibeppo.com California Pizza Kitchen 551 Oakbrook Center Oak Brook, IL 60523 630-571-7800 www.cpk.com Capri Ristorante 5101 Main Street Downers Grove, IL 60516 630-241-0695 www.capriristorante.com Carrabba's Italian Grill

306

Geochemical interpretation of Kings Mountain, North Carolina, orientation area  

SciTech Connect

An orientation study has been made of uranium occurrences in the area of Kings Mountain, North Carolina. This is one of the orientation studies of known uranium occurrences that are being conducted in several geologic provinces and under various climatic (weathering) conditions to provide the technical basis for design and interpretation of NURE geochemical reconnaissance programs. The Kings Mountain area was chosen for study primarily because of the reported presence of high-uranium monazite. This 750-mi/sup 2/ area is in the deeply weathered southern Appalachian Piedmont and spans portions of the Inner Piedmont, Kings Mountain, and Charlotte geologic belts. Uranium concentration maps for ground and surface water samples clearly outline the outcrop area of the Cherryville Quartz Monzonite with highs up to 10 ppb uranium near the reported uraninite. Several surface water samples appear to be anomalous because of trace industrial contamination. Uranium concentration maps for -100 to +200 mesh stream sediments indicate the area of monazite abundance. Several samples with >100 ppM uranium content appear to be high in uranium-rich resistate minerals. When the uranium content of sediment samples is ratioed to the sum of Hf, Dy, and Th, the anomaly pattern shifts to coincide with uranium highs in ground and surface water samples. False anomalies from concentrations of monazite (Ce,ThPO/sub 4/), xenotime (Y,DyPO/sub 4/), and zircon (Zr,HfSiO/sub 4/) in stream sediment samples can thus be eliminated. Residual anomalies should be related to unusual uranium enrichment of these common minerals or to the presence of an uncommon uranium-rich mineral. Tantalum, beryllium, and tin in stream sediments correspond to high concentrations of uranium in stream and ground water but not to uranium in sediments. In an initial reconnaissance, several media should be sampled, and it is essential to correct uranium in sediments for the sample mineralogy.

Price, V.; Ferguson, R.B.

1977-01-01T23:59:59.000Z

307

EA-1177: Salvage/Demolition of 200 West Area, 200 East Area, and 300 Area  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

7: Salvage/Demolition of 200 West Area, 200 East Area, and 7: Salvage/Demolition of 200 West Area, 200 East Area, and 300 Area Steam Plants, Richland, Washington EA-1177: Salvage/Demolition of 200 West Area, 200 East Area, and 300 Area Steam Plants, Richland, Washington SUMMARY This EA evaluates the environmental impacts for the proposal to salvage and demolish the 200 West Area, 200 East Area, and 300 Area steam plants and their associated steam distribution piping equipment, and ancillary facilities at the U.S. Department of Energy Hanford Site in Richland, Washington. PUBLIC COMMENT OPPORTUNITIES None available at this time. DOCUMENTS AVAILABLE FOR DOWNLOAD October 21, 1996 EA-1177: Finding of No Significant Impact Salvage/Demolition of 200 West Area, 200 East Area, and 300 Area Steam Plants October 21, 1996 EA-1177: Final Environmental Assessment

308

An aerial radiological survey of the Pilgrim Station Nuclear Power Plant and surrounding area, Plymouth, Massachusetts  

SciTech Connect

Terrestrial radioactivity surrounding the Pilgrim Station Nuclear Power Plant was measured using aerial radiolog- ical survey techniques. The purpose of this survey was to document exposure rates near the plant and to identify unexpected, man-made radiation sources within the survey area. The surveyed area included land areas within a three-mile radius of the plant site. Data were acquired using an airborne detection system that employs sodium iodide, thallium-activated detectors. Exposure rate and photopeak counts were computed from these data and plotted on aerial photographs of the survey area. Several ground-based exposure measurements were made for comparison with the,aerial survey results. Exposure rates in areas surrounding the plant site varied from 6 to 10 microroentgens per hour, with exposure rates below 6 microroentgens per hour occurring over bogs and marshy areas. Man-made radiation was found to be higher than background levels at the plant site. Radation due to nitrogen-1 6, which is produced in the steam cycle of a boiling-water reactor, was the primaty source of activity found at the plant site. Cesium-137 activity at levels slightly above those expected from natural fallout was found at isolated locations inland from the plant site. No other detectable sources of man-made radioactivity were found.

Proctor, A.E.

1997-06-01T23:59:59.000Z

309

Closure Report for Corrective Action Unit 254: Area 25, R-MAD Decontamination Facility, Nevada Test Site, Nevada  

DOE Green Energy (OSTI)

Corrective Action Unit (CAU) 254 is located in Area 25 of the Nevada Test Site (NTS), approximately 100 kilometers (km) (62 miles) northwest of Las Vegas, Nevada. The site is located within the Reactor Maintenance, Assembly and Disassembly (R-MAD) compound and consists of Building 3126, two outdoor decontamination pads, and surrounding areas within an existing fenced area measuring approximately 50 x 37 meters (160 x 120 feet). The site was used from the early 1960s to the early 1970s as part of the Nuclear Rocket Development Station program to decontaminate test-car hardware and tooling. The site was reactivated in the early 1980s to decontaminate a radiologically contaminated military tank. This Closure Report (CR) describes the closure activities performed to allow un-restricted release of the R-MAD Decontamination Facility.

G. N. Doyle

2002-02-01T23:59:59.000Z

310

Large area bulk superconductors  

DOE Patents (OSTI)

A bulk superconductor having a thickness of not less than about 100 microns is carried by a polycrystalline textured substrate having misorientation angles at the surface thereof not greater than about 15.degree.; the bulk superconductor may have a thickness of not less than about 100 microns and a surface area of not less than about 50 cm.sup.2. The textured substrate may have a thickness not less than about 10 microns and misorientation angles at the surface thereof not greater than about 15.degree.. Also disclosed is a process of manufacturing the bulk superconductor and the polycrystalline biaxially textured substrate material.

Miller, Dean J. (Darien, IL); Field, Michael B. (Jersey City, NJ)

2002-01-01T23:59:59.000Z

311

Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.

2006-08-29T23:59:59.000Z

312

Geothermal Areas | Open Energy Information  

Open Energy Info (EERE)

Geothermal Areas Geothermal Areas Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Areas Geothermal Areas are specific locations of geothermal potential (e.g., Coso Geothermal Area). The base set of geothermal areas used in this database came from the 253 geothermal areas identified by the USGS in their 2008 Resource Assessment.[1] Additional geothermal areas were added, as needed, based on a literature search and on projects listed in the GTP's 2011 database of funded projects. Add.png Add a new Geothermal Resource Area Map of Areas List of Areas Loading map... {"format":"googlemaps3","type":"ROADMAP","types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"limit":2500,"offset":0,"link":"all","sort":[""],"order":[],"headers":"show","mainlabel":"","intro":"","outro":"","searchlabel":"\u2026

313

The Transportation Energy and Carbon Footprints of the 100 Largest U.S. Metropolitan Areas  

Science Conference Proceedings (OSTI)

We present estimates of the automobile and truck travel based energy and carbon footprints of the largest 100 U.S. metropolitan areas. The footprints are based on the estimated vehicle miles traveled and the transportation fuels consumed. Results are presented on an annual basis and represent end use emissions only. Total carbon emissions, emissions per capita, and emissions per dollar of gross metropolitan product are reported. Two years of annual data were examined, 2000 and 2005, with most of the in-depth analysis focused on the 2005 results. In section 2 we provide background data on the national picture and derive some carbon and energy consumption figures for the nation as a whole. In section 3 of the paper we examine the metropolitan area-wide results based on the sums and averages across all 100 metro areas, and compare these with the national totals and averages. In section 4 we present metropolitan area specific footprints and examine the considerable variation that is found to exist across individual metro areas. In doing so we pay particular attention to the effects that urban form might have on these differences. Finally, section 5 provides a summary of major findings, and a list of caveats that need to be borne in mind when using the results due to known limitations in the data sources used.

Southworth, Frank [ORNL; Sonnenberg, Anthon [Georgia Institute of Technology; Brown, Marilyn A [ORNL

2008-01-01T23:59:59.000Z

314

Western Area Power Administration  

NLE Websites -- All DOE Office Websites (Extended Search)

Western Area Power Administration Customer Meeting The meeting will begin at 12:30 pm MST We have logged on early for connectivity purposes Please stand-by until the meeting begins Please be sure to call into the conference bridge at: 888-989-6414 Conf. Code 60223 If you have connectivity issues, please contact: 866-900-1011 1 Introduction  Welcome  Introductions  Purpose of Meeting ◦ Status of the SLCA/IP Rate ◦ SLCA/IP Marketing Plan ◦ Credit Worthiness Policy ◦ LTEMP EIS update ◦ Access to Capital  Handout Materials http://www.wapa.gov/crsp/ratescrsp/default.htm 2 SLCA/IP Rate 3 1. Status of Repayment 2. Current SLCA/IP Firm Power Rate (SLIP-F9) 3. Revenue Requirements Comparison Table 4.SLCA/IP Rate 5. Next Steps

315

Characterization ReportOperational Closure Covers for the Area 5 Radioactive Waste Management Site at the Nevada Test Site  

SciTech Connect

Bechtel Nevada (BN) manages two low-level Radioactive Waste Management Sites (RWMSs) at the Nevada Test Site (NTS) for the U.S. Department of Energy (DOE) National Nuclear Security Administration Nevada Site Office (NNSA/NSO). The Area 3 RWMS is located in south-central Yucca Flat and the Area 5 RWMS is located about 15 miles south, in north-central Frenchman Flat. Though located in two separate topographically closed basins, they are similar in climate and hydrogeologic setting. The Area 5 RWMS uses engineered shallow-land burial cells to dispose of packaged waste, while the Area 3 RWMS uses subsidence craters formed from underground testing of nuclear weapons for the disposal of packaged and unpackaged bulk waste. Over the next several decades, most waste disposal units at both the Area 3 and Area 5 RWMSs are anticipated to be closed. Closure of the Area 3 and Area 5 RWMSs will proceed through three phases: operational closure, final closure, and institutional control. Many waste disposal units at the Area 5RWMS are operationally closed and final closure has been placed on one unit at the Area 3 RWMS (U-3ax/bl). Because of the similarities between the two sites (e.g., type of wastes, environmental factors, operational closure cover designs, etc.), many characterization studies and data collected at the Area 3 RWMS are relevant and applicable to the Area 5 RWMS. For this reason, data and closure strategies from the Area 3 RWMS are referred to as applicable. This document is an interim Characterization Report Operational Closure Covers, for the Area 5 RWMS. The report briefly describes the Area 5 RWMS and the physical environment where it is located, identifies the regulatory requirements, reviews the approach and schedule for closing, summarizes the monitoring programs, summarizes characterization studies and results, and then presents conclusions and recommendations.

Bechtel Nevada Geotechnical Sciences

2005-06-01T23:59:59.000Z

316

Mitigation Action Implementation Plan To Implement Mitigation Requirements for Cheyenne-Miracle Mile and Ault-Cheyenne Transmission Line Rebuild Project, Carbon, Albany and Laramie Counties, Wyoming, and Weld County, Colorado  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Mitigation Action Plan Mitigation Action Plan To Implement Mitigation Requirements for Cheyenne-Miracle Mile and Ault-Cheyenne Transmission Line Rebuild Project, Carbon, Albany, and Laramie Counties, Wyoming, and Weld County, Colorado September 2006 CH-MM and AU-CH Mitigation Action Plan Sept. 2006 1 Action Plan for Standard Project Practices and Mitigation Mitigation Action Identifier Resources for Which the Mitigation Will Be Implemented Responsible Party for Implementing Mitigation Action Party Responsible for Monitoring and Ensuring Compliance Land use, transportation Construction Contractor Western Maintenance The contractor will limit the movement of crews and equipment to the ROW, including access routes. The contractor will limit movement on the ROW to minimize damage to

317

Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan

2008-01-01T23:59:59.000Z

318

Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-

2009-01-01T23:59:59.000Z

319

An aerial radiological survey of the Robert Emmett Ginna Nuclear Power Plant and surrounding area, Ontario, New York  

SciTech Connect

Terrestrial radioactivity surrounding the Robert Emmett Ginna Nuclear Power Plant was measured using aerial radiological surveying techniques. The purpose of this survey was to document exposure rates near the plant and to identify unexpected, man-made radiation sources within the survey area. The surveyed area included land areas within a three-mile radius of the plant site. Data were acquired using an airborne detection system that employed sodium iodide, thallium-activated detectors. Exposure-rate and photopeak counts were computed from these data and plotted on aerial photographs of the survey area. Several ground-based exposure measurements were made for comparison with the aerial survey results. Exposure rates in the area surrounding the plant site varied from 6 to 10 microroentgens per hour. Man-made radiation (cobalt-60 within the plant site and cesium-1 37 directly over the reactor) was found at the plant site. In addition, small areas of suspected cesium-137 activity were found within the survey areas. Other than these small sites, the survey area was free of man-made radioac- tivity.

Proctor, A.E.

1997-06-01T23:59:59.000Z

320

AREA RADIATION MONITOR  

DOE Patents (OSTI)

S>An improved area radiation dose monitor is designed which is adapted to compensate continuously for background radiation below a threshold dose rate and to give warning when the dose integral of the dose rate of an above-threshold radiation excursion exceeds a selected value. This is accomplished by providing means for continuously charging an ionization chamber. The chamber provides a first current proportional to the incident radiation dose rate. Means are provided for generating a second current including means for nulling out the first current with the second current at all values of the first current corresponding to dose rates below a selected threshold dose rate value. The second current has a maximum value corresponding to that of the first current at the threshold dose rate. The excess of the first current over the second current, which occurs above the threshold, is integrated and an alarm is given at a selected integrated value of the excess corresponding to a selected radiation dose. (AEC)

Manning, F.W.; Groothuis, S.E.; Lykins, J.H.; Papke, D.M.

1962-06-12T23:59:59.000Z

Note: This page contains sample records for the topic "area miles mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI

2012-06-01T23:59:59.000Z

322

Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah

2011-04-21T23:59:59.000Z

323

Program Areas | National Security | ORNL  

NLE Websites -- All DOE Office Websites (Extended Search)

Programs Initiatives Facilities Events and Conferences Supporting Organizations National Security Home | Science & Discovery | National Security | Program Areas SHARE Program...

324

Body Area Networks: A Survey  

Science Conference Proceedings (OSTI)

Advances in wireless communication technologies, such as wearable and implantable biosensors, along with recent developments in the embedded computing area are enabling the design, development, and implementation of body area networks. This class of ... Keywords: body area networks, survey, wireless sensor networks

Min Chen; Sergio Gonzalez; Athanasios Vasilakos; Huasong Cao; Victor C. Leung

2011-04-01T23:59:59.000Z

325

Geothermal resource area 9: Nye County. Area development plan  

DOE Green Energy (OSTI)

Geothermal Resource area 9 encompasses all of Nye County, Nevada. Within this area there are many different known geothermal sites ranging in temperature from 70/sup 0/ to over 265/sup 0/ F. Fifteen of the more major sites have been selected for evaluation in this Area Development Plan. Various potential uses of the energy found at each of the resource sites discussed in this Area Development Plan were determined after evaluating the area's physical characteristics, land ownership and land use patterns, existing population and projected growth rates, and transportation facilities, and comparing those with the site specific resource characteristics. The uses considered were divided into five main categories: electrical generation, space heating, recreation, industrial process heat, and agriculture. Within two of these categories certain subdivisions were considered separately. The findings about each of the 15 geothermal sites considered in this Area Development Plan are summarized.

Pugsley, M.

1981-01-01T23:59:59.000Z

326

Property:AreaGeology | Open Energy Information  

Open Energy Info (EERE)

AreaGeology AreaGeology Jump to: navigation, search Property Name AreaGeology Property Type String Description A description of the area geology This is a property of type String. Subproperties This property has the following 22 subproperties: A Amedee Geothermal Area B Beowawe Hot Springs Geothermal Area Blue Mountain Geothermal Area Brady Hot Springs Geothermal Area C Chena Geothermal Area Coso Geothermal Area D Desert Peak Geothermal Area D cont. Dixie Valley Geothermal Area E East Mesa Geothermal Area G Geysers Geothermal Area K Kilauea East Rift Geothermal Area L Lightning Dock Geothermal Area Long Valley Caldera Geothermal Area R Raft River Geothermal Area Roosevelt Hot Springs Geothermal Area S Salt Wells Geothermal Area Salton Sea Geothermal Area San Emidio Desert Geothermal Area

327

A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.

2008-06-01T23:59:59.000Z

328

Geology of the Desert Hot Springs-Upper Coachella Valley Area, California (with a selected bibliography of the Coachella Valley, Salton Sea, and vicinity)  

DOE Green Energy (OSTI)

The Desert Hot Springs area is in the upper Coachella Valley at the junction of three natural geomorphic provinces of California--the Transverse Ranges, the Peninsular Ranges, and the Colorado Desert. The mapped area is about 100 miles east of Los Angeles and lies principally in north central Riverside County. The oldest rocks in the area are Precambrian(?) amphibolitic and migmatized paragneisses of the San Gorgonio igneous-metamorphic (Chuckwalla) complex. They are intruded by Cretaceous diorite porphyry, Cactus Granite, quartz monzonite, intrusive breccia, and basic plutonic rocks. Of probable late Paleozoic age are the metamorphic rocks of the San Jacinto Mountains which form spurs projecting into San Gorgonio Pass and Coachella Valley.

Proctor, Richard J.

1968-01-01T23:59:59.000Z

329

B I OENV I RONMENTAL FEATURES OF THE OGOTORUK CREEK AREA, CAPE THOMPSON, ALASKA  

Office of Legacy Management (LM)

B I OENV I RONMENTAL FEATURES B I OENV I RONMENTAL FEATURES OF THE OGOTORUK CREEK AREA, CAPE THOMPSON, ALASKA A First Summary by The Committee on Environmental Studies for Project Chariot . . December 1960 r Division of Biology and Medicine, AEC Washington, D. C. IT U S WEGWS LIBIA3"b This page intentionally left blank NUCLEAR EXPLOSIONS -PEACE UL APPLICATIONS . . BIOLOGY AND MEDICINE BIOENVIRONMENTAL FEATURES OF THE OGOTORUK CREEK AREA . . CAPE THOMPSON, ALASKA A F i r s t Sumnary The C o d t t e e on E n v i r o n m e n t a l S t u d i e s for P r o j e c t C h a r i o t PLllWSHARE PROGRAM THE UNITED STATES ATOMIC ENERGY COMMISSION December, 1 9 6 0 MAP OF ALASKA - CHARIOT LOCATION SCALE IN MILES . 111*1.1) , FOREWORD . . This summary is based on the reports on more than 30 bioenvironmental investigations carried out' in the Cape Thompson area in Alaska since

330

Geothermal-resource assessment of the Steamboat-Routt Hot Springs area, Colorado. Resources Series 22  

DOE Green Energy (OSTI)

An assessment of the Steamboat Springs region in northwest Colorado was initiated and carried out in 1980 and 1981. The goal of this program was to delineate the geological features controlling the occurrence of the thermal waters (temperatures in excess of 68/sup 0/F (20/sup 0/C)) in this area at Steamboat Springs and 8 miles (12.8 km) north at Routt Hot Springs. Thermal waters from Heart Spring, the only developed thermal water source in the study area, are used in the municipal swimming pool in Steamboat Springs. The assessment program was a fully integrated program consisting of: dipole-dipole, Audio-magnetotelluric, telluric, self potential and gravity geophysical surveys, soil mercury and soil helium geochemical surveys; shallow temperature measurements; and prepartion of geological maps. The investigation showed that all the thermal springs appear to be fault controlled. Based on the chemical composition of the thermal waters it appears that Heart Spring in Steamboat Springs is hydrologically related to the Routt Hot Springs. This relationship was further confirmed when it was reported that thermal waters were encountered during the construction of the new high school in Strawberry Park on the north side of Steamboat Springs. In addition, residents stated that Strawberry Park appears to be warmer than the surrounding country side. Geological mapping has determined that a major fault extends from the Routt Hot Springs area into Strawberry Park.

Pearl, R.H.; Zacharakis, T.G.; Ringrose, C.D.

1983-01-01T23:59:59.000Z

331

An aerial radiological survey of the Fernald Environmental Management Project and surrounding area, Fernald, Ohio  

SciTech Connect

An aerial radiological survey was conducted from May 17--22, 1994, over a 36 square mile (93 square kilometer) area centered on the Fernald Environmental Management Project located in Fernald, Ohio. The purpose of the survey was to detect anomalous gamma radiation in the environment surrounding the plant. The survey was conducted at a nominal altitude of 150 feet (46 meters) with a line spacing of 250 feet (76 meters). A contour map of the terrestrial gamma exposure rate extrapolated to 1 meter (3.3 feet) above ground was prepared and overlaid on an aerial photograph of the area. Analysis of the data for man made sources showed five sites within the boundaries of the Fernald Environmental Management Project having elevated readings. The exposure rates outside the plant boundary were typical of naturally occurring background radiation. Soil samples and pressurized ion chamber measurements were obtained at four locations within the survey boundaries to supplement the aerial data. It was concluded that although the radionuclides identified in the high-exposure-rate areas are naturally occurring, the levels encountered are greatly enhanced due to industrial activities at the plant.

Phoenix, K.A.

1997-04-01T23:59:59.000Z

332

An Aerial Radiological Survey of the Portsmouth Gaseous Diffusion Plant and Surrounding Area, Portsmouth, Ohio  

SciTech Connect

An aerial radiological survey was conducted over the 16 square-mile (~41 square-kilometer) area surrounding the Portsmouth Gaseous Diffusion Plant. The survey was performed in August 2007 utilizing a large array of helicopter mounted sodium iodide detectors. The purpose of the survey was to update the previous radiological survey levels of the environment and surrounding areas of the plant. A search for a missing radium-226 source was also performed. Implied exposure rates, man-made activity, and excess bismuth-214 activity, as calculated from the aerial data are presented in the form of isopleth maps superimposed on imagery of the surveyed area. Ground level and implied aerial exposure rates for nine specific locations are compared. Detected radioisotopes and their associated gamma ray exposure rates were consistent with those expected from normal background emitters. At specific plant locations described in the report, man-made activity was consistent with the operational histories of the location. There was no spectral activity that would indicate the presence of the lost source.

Namdoo Moon

2007-12-01T23:59:59.000Z

333

PREFERRED WATERFLOOD MANAGEMENT PRACTICES FOR THE SPRABERRY TREND AREA  

Science Conference Proceedings (OSTI)

This report describes the work performed during the second year of the project, ''Preferred Waterflood Management Practices for the Spraberry Trend Area''. The objective of this project is to significantly increase field-wide production in the Spraberry Trend in a short time frame through the application of preferred practices for managing and optimizing water injection. Our goal is to dispel negative attitudes and lack of confidence in water injection and to document the methodology and results for public dissemination to motivate waterflood expansion in the Spraberry Trend. To achieve this objective, in this period we concentrated our effort on characterization of Germania Unit using an analog field ET ODaniel unit and old cased hole neutron. Petrophysical Characterization of the Germania Spraberry units requires a unique approach for a number of reasons--limited core data, lack of modern log data and absence of directed studies within the unit. The need for characterization of the Germania unit has emerged as a first step in the review, understanding and enhancement of the production practices applicable within the unit and the trend area in general. In the absence or lack of the afore mentioned resources, an approach that will rely heavily on previous petrophysical work carried out in the neighboring ET O'Daniel unit (6.2 miles away), and normalization of the old log data prior to conventional interpretation techniques will be used. A log-based rock model has been able to guide successfully the prediction of pay and non-pay intervals within the ET O'Daniel unit, and will be useful if found applicable within the Germania unit. A novel multiple regression technique utilizing non-parametric transformations to achieve better correlations in predicting a dependent variable (permeability) from multiple independent variables (rock type, shale volume and porosity) will also be investigated in this study. A log data base includes digitized formats of Gamma Ray, Cased Hole Neutron, limited Resistivity and Neutron/Density/Sonic porosity logs over a considerable wide area. In addition, a progress report on GSU waterflood pilot is reported for this period. We have seen positive response of water injection on new wells. We believe by proper data acquisition and precise reservoir engineering techniques, any lack of confidence in waterflooding can be overcome. Therefore, we develop field management software to control a vast data from the pilot and to perform precise reservoir engineering techniques such as decline curve analysis, gas and oil material balances, bubble map plot and PVT analysis. The manual for this software is listed in the Appendix-A.

C. M. Sizemore; David S. Schechter

2003-08-13T23:59:59.000Z

334

Transforming Parks and Protected Areas  

E-Print Network (OSTI)

areas Lisa M. Campbell, Noella J. Gray; and Zoe A. Meletis In many countries, parks and protected areas construction of nature, conservation and development narratives, and alternative consumption - and what World' or 'developing' countries. One feature of political ecology has been an overriding emphasis

Bolch, Tobias

335

Data Administration Area: Date Issued  

E-Print Network (OSTI)

Policy Data Administration Policy Area: Date Issued: April, 1994 Title: Data Administration Last. INTRODUCTION The President established the Committee on Data Administration (CODA) in May, 1992, to advise him on policies in the area of data administration (attached as references Policy ADC 011 and TOR for CODA

Brownstone, Rob

336

Area 410 status and capabilities  

SciTech Connect

This memo is distributed to acquaint personnel with (a) the status of the various 410 areas, (b) time and personnel required to do optic experiments in the ``Dog`` area, and (c) status of the timing and firing system and conditions of cables from Able to Dog.

Bennett, W. P.

1962-10-01T23:59:59.000Z

337

Chrysler RAM PHEV Fleet Results Report  

NLE Websites -- All DOE Office Websites (Extended Search)

istance (mi) 4 45 Trips in Charge Depleting (CD) mode City Highway Gasoline fuel economy (mpg) DC electrical energy consumption (DC Whmi) Percent of miles with internal combustion...

338

Evaluation of I-15 Devore (08-0A4224) Long-Life Pavement Rehabilitation Costs  

E-Print Network (OSTI)

Cost Indirect Costs Engineer's Estimate Category Amount2 lane-mi. Administrative Costs Engineer's Estimate CategoryMiles) Total (All Costs) Engineer's Estimate Amount Original

Fermo, Mary G; Santero, Nicholas J; Nokes, William; Harvey, John T

2005-01-01T23:59:59.000Z

339

Relocation Request Form The Ohio State University Page 1 of 1  

E-Print Network (OSTI)

____________________________________________ to ______________________________ , Ohio Expenses Mileage or For 1/1/12-12/31/12 _________ miles @ $ .23/mi = Gasoline For 1/1/13-12/31/13

340

Report Wildland Fire Area Hazard  

NLE Websites -- All DOE Office Websites (Extended Search)

Report Wildland Fire Area Hazard Report Wildland Fire Area Hazard Report Wildland Fire Area Hazard Report wildland fire area hazards or incidents that are non-life threatening only. Call 911 for all emergencies that require immediate assistance. How to report wildland fire hazard Use the following form to report any wildland fire area hazards or incidents that are non-life threatening only. Call 911 for all emergencies that require immediate assistance. Fill out this form as completely as possible so we can better assess the hazard. All submissions will be assessed as promptly as possible. For assistance with a non-emergency situation, contact the Operations Support Center at 667-6211. Name (optional): Hazard Type (check one): Wildlife Sighting (check box if animal poses serious threat) Trails (access/egress)

Note: This page contains sample records for the topic "area miles mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Tech Area II: A History  

E-Print Network (OSTI)

This report documents the history of the major buildings in Sandia National Laboratories' Technical Area II. It was prepared in support of the Department of Energy's compliance with Section 106 of the National Historic Preservation Act. Technical Area II was designed and constructed in 1948 specifically for the final assembly of the non-nuclear components of nuclear weapons, and was the primary site conducting such assembly until 1952. Both the architecture and location of the oldest buildings in the area reflect their original purpose. Assembly activities continued in Area II from 1952 to 1957, but the major responsibility for this work shifted to other sites in the Atomic Energy Commission's integrated contractor complex. Gradually, additional buildings were constructed and the original buildings were modified. After 1960, the Area's primary purpose was the research and testing of high-explosive components for nuclear weapons. In 1994, Sandia constructed new facilities for work on hi...

Rebecca Ullrich; Rebecca Ullrich

1998-01-01T23:59:59.000Z

342

Uranium favorability of the San Rafael Swell area, east-central Utah  

SciTech Connect

The San Rafael Swell project area in east-central Utah is approximately 3,000 sq mi and includes the San Rafael Swell anticline and the northern part of the Waterpocket Fold monocline at Capitol Reef. Rocks in the area are predominantly sedimentary rocks of Pennsylvanian through Cretaceous age. Important deposits of uranium in the project area are restricted to two formations, the Chinle (Triassic) and Morrison (Jurassic) Formations. A third formation, the White Rim Sandstone (Permian), was also studied because of reported exploration activity. The White Rim Sandstone is considered generally unfavorable on the basis of lithologic characteristics, distance from a possible source of uranium, lack of apparent mineralization, and the scarcity of anomalies on gamma-ray logs or in rock, water, and stream-sediment samples. The lower Chinle from the Moss Back Member down to the base of the formation is favorable because it is a known producer. New areas for exploration are all subsurface. Both Salt Wash and Brushy Basin Members of the Morrison Formation are favorable. The Salt Wash Member is favorable because it is a known producer. The Brushy Basin Member is favorable as a low-grade resource.

Mickle, D G; Jones, C A; Gallagher, G L; Young, P; Dubyk, W S

1977-10-01T23:59:59.000Z

343

6 - Appendix B - Miles Data.xls  

NLE Websites -- All DOE Office Websites (Extended Search)

0 34 2.4 12 20 480 48 432 0 2909 6.7 13 20 460 0 460 0 4820 10.5 2002 01 20 480 0 480 0 4560 9.5 02 20 460 0 460 0 4462 9.7 03 20 440 60 380 0 4059 10.7 04 20 460 60 400 0 5045...

344

Per-Mile Premiums for Auto Insurance  

E-Print Network (OSTI)

Social Cost of Motor-vehicle Use In the United States, Based on 1990-1991, June 1997, Institute of Transportation

Edlin, Aaron S.

2002-01-01T23:59:59.000Z

345

Vehicle-Miles Traveled - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Return to: Transportation Channel . NOTE: To view and/or print files in PDF format, Adobe Acrobat Reader is required.

346

A GEM Award (Going the Extra Mile)  

Energy.gov (U.S. Department of Energy (DOE))

All Headquarters Department of Energy Employees except Political Appointees (including Schedule C and non-career members of the SES). Any Employee may nominate another employee for this award.

347

0 10 Miles5 10 Kilometers5  

E-Print Network (OSTI)

Flathead River Fish Creek McGee Creek Dutch Creek Anaconda Creek Mineral Creek McDonald Creek Sprague Creek

348

0 1 2 Miles 2 Kilometers  

E-Print Network (OSTI)

VALLEY FLINT RIDGE East Entranc e Road M AM M O TH CAVE RIDGE Flint Ridge Road ParkRi dge Road R Hunter

349

HISTORICAL AMERICAN ENGINEERING RECORD - IDAHO NATIONAL ENGINEERING AND ENVIRONMENTAL LABORATORY, TEST AREA NORTH, HAER NO. ID-33-E  

SciTech Connect

Test Area North (TAN) was a site of the Aircraft Nuclear Propulsion (ANP) Project of the U.S. Air Force and the Atomic Energy Commission. Its Cold War mission was to develop a turbojet bomber propelled by nuclear power. The project was part of an arms race. Test activities took place in five areas at TAN. The Assembly & Maintenance area was a shop and hot cell complex. Nuclear tests ran at the Initial Engine Test area. Low-power test reactors operated at a third cluster. The fourth area was for Administration. A Flight Engine Test facility (hangar) was built to house the anticipated nuclear-powered aircraft. Experiments between 1955-1961 proved that a nuclear reactor could power a jet engine, but President John F. Kennedy canceled the project in March 1961. ANP facilities were adapted for new reactor projects, the most important of which were Loss of Fluid Tests (LOFT), part of an international safety program for commercial power reactors. Other projects included NASA's Systems for Nuclear Auxiliary Power and storage of Three Mile Island meltdown debris. National missions for TAN in reactor research and safety research have expired; demolition of historic TAN buildings is underway.

Susan Stacy; Hollie K. Gilbert

2005-02-01T23:59:59.000Z

350

Multielement geochemical exploration data for the Cove Fort-Sulphurdale Known Geothermal Resource Area, Beaver and Millard counties, Utah  

DOE Green Energy (OSTI)

Multielement geochemical exploration data have been acquired for the Cove Fort-Sulphurdale Known Geothermal Resource Area (KGRA). This was accomplished by analysis of both whole rock and +3.3 specific gravity concentrate samples from cuttings composites collected from shallow rotary drill holes. Areal distributions are reported for arsenic, mercury, lead and zinc. These are elements indicated by previous studies to be broadly zoned around thermal centers in geothermal systems and thus to be useful for selecting and prioritizing drilling targets. Results from this work suggest that reservoir temperature and/or reservoir to surface permeability, and thus possibly overall potential for a geothermal resource, increase northward beneath the approximately 18 square mile area containing shallow drill holes, possibly to beyond the northern limits of the area. The data provide a basis for development of three principal target models for the geothermal system but do not permit prioritization of these models. It is recommended that geochemical, geological, and temperature gradient surveys be expanded northward from the present survey area to more fully define the area which appears to have the best resource potential and to aid prioritization of the target models.

Bamford, R.W.; Christensen, O.D.

1979-09-01T23:59:59.000Z

351

The results of an ecological risk assessment screening at the Idaho National Engineering`s waste area group 2  

SciTech Connect

The Idaho National Engineering Laboratory (INEL) is a Department of Energy (DOE) facility located in southeastern Idaho and occupies approximately 890 square miles on the northwestern portion of the eastern Snake River Plain. INEL has been devoted to nuclear energy research and related activities since its establishment in 1949. In the process of fulfilling this mission, wastes were generated, including radioactive and hazardous materials. Most materials were effectively stored or disposed of, however, some release of contaminants to the environment has occurred. For this reason, the INEL was listed by the US environmental Protection Agency on the National Priorities List (NPL), in November, 1989. This report describes the results of an ecological risk assessment performed for the Waste Area Groups 2 (WAG 2) at the INEL. It also summarizes the performance of screening level ecological risk assessments (SLERA).

VanHorn, R.

1995-11-01T23:59:59.000Z

352

Thermal energy storage application areas  

DOE Green Energy (OSTI)

The use of thermal energy storage in the areas of building heating and cooling, recovery of industrial process and waste heat, solar power generation, and off-peak energy storage and load management in electric utilities is reviewed. (TFD)

Not Available

1979-03-01T23:59:59.000Z

353

Accelerating Observers, Area and Entropy  

E-Print Network (OSTI)

We consider an explicit example of a process, where the entropy carried by radiation through an accelerating two-plane is proportional to the decrease in the area of that two-plane even when the two-plane is not a part of any horizon of spacetime. Our results seem to support the view that entropy proportional to area is possessed not only by horizons but by all spacelike two-surfaces of spacetime.

Makela, J

2005-01-01T23:59:59.000Z

354

Accelerating Observers, Area and Entropy  

E-Print Network (OSTI)

We consider an explicit example of a process, where the entropy carried by radiation through an accelerating two-plane is proportional to the decrease in the area of that two-plane even when the two-plane is not a part of any horizon of spacetime. Our results seem to support the view that entropy proportional to area is possessed not only by horizons but by all spacelike two-surfaces of spacetime.

Jarmo Makela

2005-06-16T23:59:59.000Z

355

Variable area fuel cell cooling  

DOE Patents (OSTI)

A fuel cell arrangement having cooling fluid flow passages which vary in surface area from the inlet to the outlet of the passages. A smaller surface area is provided at the passage inlet, which increases toward the passage outlet, so as to provide more uniform cooling of the entire fuel cell. The cooling passages can also be spaced from one another in an uneven fashion.

Kothmann, Richard E. (Churchill Borough, PA)

1982-01-01T23:59:59.000Z

356

Geothermal resource area 3: Elko County. Area development plan  

DOE Green Energy (OSTI)

Geothermal Resource Area 3 includes all of the land in Elko County, Nevada. There are in excess of 50 known thermal anomalies in this area. Several of the more major resources have been selected for detailed description and evaluation in this Area Development Plan. The other resources are considered too small, too low in temperature, or too remote to be considered for development in the near future. Various potential uses of the energy found at each of the studied resource sites in Elko County were determined after evaluating the area's physical characteristics; the land ownership and land use patterns; existing population and projected growth rates; transportation facilities and energy requirements. These factors were then compared with resource site specific data to determine the most likely uses of the resource. The uses considered in this evaluation were divided into five main categories: electrical generation, space heating, recreation, industrial process heat, and agriculture. Within two of these categories several subdivisions were considered separately. It was determined that several of the geothermal resources evaluated in the Area Development Plan could be commercially developed. The potential for development for the seven sites considered in this study is summarized.

Pugsley, M.

1981-01-01T23:59:59.000Z

357

Geothermal resource area 11, Clark County area development plan  

DOE Green Energy (OSTI)

Geothermal Resource Area 11 includes all of the land in Clark County, Nevada. Within this area are nine geothermal anomalies: Moapa Area, Las Vegas Valley, Black Canyon, Virgin River Narrows, Roger's Springs, Indian Springs, White Rock Springs, Brown's Spring, and Ash Creek Spring. All of the geothermal resources in Clark County have relatively low temperatures. The highest recorded temperature is 145{sup 0}F at Black Canyon. The temperatures of the other resources range from 70 to 90{sup 0}F. Because of the low temperature of the resources and, for the most part, the distance of the resources from any population base, the potential for the development of the resources are considered to be somewhat limited.

Pugsley, M.

1981-01-01T23:59:59.000Z

358

Feasibility study 100 K East Area water purification pools fish-rearing program  

Science Conference Proceedings (OSTI)

As part of the feasibility study, a design analysis was conducted to determine the usefulness of the existing sand filters and associated media for reuse. The sand filters which were studied for potential reuse are located on the northern end of the 100-K East Area water filtration plant on the Hanford Site. This plant is located about one- half mile from the Columbia River. The sand filters were originally part of a system which was used to provide cooling water to the nearby plutonium production K Reactors. This Cold War operation took place until 1971, at which time the K Reactors were closed for eventual decontamination and decommissioning. Recently, it was decided to study the concept of putting the sand filter structures back into use for fish-rearing purposes. Because the water that circulated through the water purification pools (K Pools) and associated sand filters was clean river water, there is little chance of the structures being radioactively contaminated. To date, separate K Pools have been used for raising a variety of cold water fish species, including white sturgeon and fall chinook salmon, as well as for providing potable water to the 100 K Area of the Hanford Site for fire and service water purposes.

Betsch, M.D., Westinghouse Hanford

1996-07-03T23:59:59.000Z

359

Geology and surface geochemistry of the Roosevelt Springs Known Geothermal Resource Area, Utah  

DOE Green Energy (OSTI)

Available data on the Roosevelt area were synthesized to determine the spatial arrangement of the rocks, and the patterns of mass and energy flow within them. The resulting model lead to a new interpretation of the geothermal system, and provided ground truth for evaluating the application of soil geochemistry to exploration for concealed geothermal fields. Preliminary geochemical studies comparing the surface microlayer to conventional soil sampling methods indicated both practical and chemical advantages for the surface microlayer technique, which was particularly evident in the case of As, Sb and Cs. Subsequent multi-element analyses of surface microlayer samples collected over an area of 100 square miles were processed to produce single element contour maps for 41 chemical parameters. Computer manipulation of the multi-element data using R-mode factor analysis provided the optimum method of interpretation of the surface microlayer data. A trace element association of As, Sb and Cs in the surface microlayer provided the best indication of the leakage of geothermal solutions to the surface, while regional mercury trends may reflect the presence of a mercury vapour anomaly above a concealed heat source.

Lovell, J.S.; Meyer, W.T.; Atkinson, D.J.

1980-01-01T23:59:59.000Z

360

An Aerial Radiological Survey of the Yucca Mountain Project Proposed Land Withdrawal and Adjacent Areas  

SciTech Connect

An aerial radiological survey of the Yucca Mountain Project (YMP) proposed land withdrawal was conducted from January to April 2006, and encompassed a total area of approximately 284 square miles (73,556 hectares). The aerial radiological survey was conducted to provide a sound technical basis and rigorous statistical approach for determining the potential presence of radiological contaminants in the Yucca Mountain proposed Land withdrawal area. The survey site included land areas currently managed by the Bureau of Land Management, the U.S. Air Force as part of the Nevada Test and Training Range or the U.S. Department of Energy (DOE), National Nuclear Security Administration Nevada Site Office (NNSA/NSO) as part of the Nevada Test Site (NTS). The survey was flown at an approximate ground speed of 70 knots (36 meters per second), at a nominal altitude of 150 ft (46 m) above ground level, along a set of parallel flight lines spaced 250 ft (76 m) apart. The flight lines were oriented in a north-south trajectory. The survey was conducted by the DOE NNSA/NSO Remote Sensing Laboratory-Nellis, which is located in Las Vegas, Nevada. The aerial survey was conducted at the request of the DOE Office of Civilian Radioactive Waste Management. The primary contaminant of concern was identified by YMP personnel as cesium-137 ({sup 137}Cs). Due to the proposed land withdrawal area's proximity to the historical Nuclear Rocket Development Station (NRDS) facilities located on the NTS, the aerial survey system required sufficient sensitivity to discriminate between dispersed but elevated {sup 137}Cs levels from those normally encountered from worldwide fallout. As part of that process, the survey also measured and mapped the exposure-rate levels that currently existed within the survey area. The inferred aerial exposure rates of the natural terrestrial background radiation varied from less than 3 to 22 microroentgens per hour. This range of exposure rates was primarily due to the surface geological features within the survey area. The survey area has extensive areas of desert valleys, mountain ranges, extinct volcanic cones, and old lava flows. With the exception of five areas identified within the NRDS boundaries (discussed later in this report), there were no areas within the survey that exceeded aerial survey minimum detectable concentration levels of 0.4 through 0.7 picocuries per gram (pCi/g). The {sup 137}Cs levels do not exceed typical worldwide fallout levels for the continental United States.

Craig Lyons, Thane Hendricks

2006-07-01T23:59:59.000Z

Note: This page contains sample records for the topic "area miles mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Evaluation of low-temperature geothermal potential in Utah and Goshen Valleys and adjacent areas, Utah. Part II. Water temperature and chemistry  

DOE Green Energy (OSTI)

Geothermal reconnaissance techniques have identified five areas in Utah County warranting further investigation for low-temperature geothermal resources. One area in northern Utah Valley is along Utah Lake fault zone and includes Saratoga Hot Springs. Water temperatures within this area range from 21 to 43/sup 0/C. Common ion analyses as well as B and Li concentrations indicate waters sampled in this area are anomalous when compared to other samples from the same aquifer. Two other areas in southern Utah Valley also coincide with the Utah Lake fault zone. Common ion analyses, trace element concentrations, and C1/HCO/sub 3/ ratios distinguish these areas from all other waters in this valley. Temperatures within these southern areas range from 21 to 32/sup 0/C. All three thermal areas are possibly the result of deep circulation of meteoric water being warmed and subsequently migrating upward within the Utah Lake fault zone. The Castilla Hot Springs area has been expanded by this study to include a spring located 3 mi further up Spanish Fork Canyon near the Thistle earthflow. A temperature of 50/sup 0/C was recorded for this spring and chemistry is similar to Castilla. In Goshen Valley, the fifth geothermal area identified, measured temperatures range from 20 to 27/sup 0/C for some wells and springs. Chemical analyses, however, do not discern the location of low-temperature geothermal reservoirs. 18 refs., 7 figs., 5 tabs.

Klauk, R.H.; Davis, D.A.

1984-12-01T23:59:59.000Z

362

Hydrogeology of Ambrosia Lake-San Mateo area, McKinley and Cibola counties, New Mexico  

SciTech Connect

The Ambrosia Lake-San Mateo area is located about 10 mi north of Grants, New Mexico, in the heart of the Grants uranium region, which spans the southern edge of the San Juan Basin. The climate is semiarid and local streams are ephemeral, except where discharge from mines or tailings ponds has made them perennial. Ground water is thus the main source of water in the area. Major aquifers include alluvium, sandstones of the Mesaverde Group, sandstones of the Mancos Shale, Dakota Sandstone, Morrison Formation, Bluff Sandstone, Todilto Limestone, Chinle Formation, San Andres Limestone, and Glorieta Sandstone. Although shallow unconfined ground water flows southwesterly, deeper, confined ground water flows toward the northeast and east. Ground water in the area generally has a total-dissolved-solids content of 400 to 2000 mg/L; waters in the notheast are more saline (2000 to 5000 mg/L). Because the uranium occurs in a regional artesian aquifer (Westwater Canyon Member of the Morrison Formation), extensive dewatering is required: approximately 164 mgd. A new state law brings mine dewatering under the jurisdiction of the State Engineer and permits use of excess uranium-mine water. Private or municipal wells presently provide adequate supplies of water for most domestic and stock purposes.

Brod, R.C.; Stone, W.J.

1981-11-06T23:59:59.000Z

363

Focus Areas | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Mission » Focus Areas Mission » Focus Areas Focus Areas Safety With this focus on cleanup completion and risk reducing results, safety still remains the utmost priority. EM will continue to maintain and demand the highest safety performance. All workers deserve to go home as healthy as they were when they came to the job in the morning. There is no schedule or milestone worth any injury to the work force. Project Management EM is increasing its concentration on project management to improve its overall performance toward cost-effective risk reduction. This will involve review of validated project baselines, schedules, and assumptions about effective identification and management of risks. Instrumental in refining the technical and business approaches to project management are the senior

364

100 Areas CERCLA ecological investigations  

SciTech Connect

This document reports the results of the field terrestrial ecological investigations conducted by Westinghouse Hanford Company during fiscal years 1991 and 1992 at operable units 100-FR-3, 100-HR-3, 100-NR-2, 100-KR-4, and 100-BC-5. The tasks reported here are part of the Remedial Investigations conducted in support of the Comprehensive Environmental Response, compensation, and Liability Act of 1980 studies for the 100 Areas. These ecological investigations provide (1) a description of the flora and fauna associated with the 100 Areas operable units, emphasizing potential pathways for contaminants and species that have been given special status under existing state and/or federal laws, and (2) an evaluation of existing concentrations of heavy metals and radionuclides in biota associated with the 100 Areas operable units.

Landeen, D.S.; Sackschewsky, M.R.; Weiss, S.

1993-09-01T23:59:59.000Z

365

Facility Closure Report for T-Tunnel (U12t), Area 12, Nevada Test Site, Nevada  

Science Conference Proceedings (OSTI)

This Facility Closure Report (FCR) has been prepared to document the actions taken to permanently close the remaining accessible areas of U12t-Tunnel (T-Tunnel) in Area 12 of the Nevada Test Site (NTS). The closure of T-Tunnel was a prerequisite to transfer facility ownership from the Defense Threat Reduction Agency (DTRA) to the U.S. Department of Energy, National Nuclear Security Administration Nevada Site Office (NNSA/NSO). Closure of the facility was accomplished with the cooperation and concurrence of both NNSA/NSO and the Nevada Division of Environmental Protection (NDEP). The purpose of this FCR is to document that the closure of T-Tunnel complied with the closure requirements specified in the Facility Closure Plan for N- and T-Tunnels Area 12, Nevada Test Site (Appendix D) and that the facility is ready for transfer to NNSA/NSO. The Facility Closure Plan (FCP) is provided in Appendix D. T-Tunnel is located approximately 42 miles north of Mercury in Area 12 of the NTS (Figure 1). Between 1970 and 1987, T-Tunnel was used for six Nuclear Weapons Effects Tests (NWETs). The tunnel was excavated horizontally into the volcanic tuffs of Rainier Mesa. The T-Tunnel complex consists of a main access drift with two NWET containment structures, a Gas Seal Plug (GSP), and a Gas Seal Door (GSD) (Figure 2). The T-Tunnel complex was mothballed in 1993 to preserve the tunnel for resumption of testing, should it happen in the future, to stop the discharge of tunnel effluent, and to prevent unauthorized access. This was accomplished by sealing the main drift GSD.

NSTec Environmental Restoration

2008-08-01T23:59:59.000Z

366

NONPROFIT ORG DETROIT, MI  

E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor

367

Manhattan Project: Tech Area Gallery  

Office of Scientific and Technical Information (OSTI)

TECH AREA GALLERY (LARGE) TECH AREA GALLERY (LARGE) Los Alamos: The Laboratory Resources > Photo Gallery All of the photographs below are of the "Tech Area" at Los Alamos during or shortly after the wartime years. If this page is taking a long time to load, click here for a photo gallery with smaller versions of the same images. There is a map of the Tech Area at the top and again at the bottom. The first image below is courtesy the Los Alamos National Laboratory. All of the other photographs are reproduced from Edith C. Truslow, with Kasha V. Thayer, ed., Manhattan Engineer District: Nonscientific Aspects of Los Alamos Project Y, 1942 through 1946 (Los Alamos, NM: Manhattan Engineer District, ca. 1946; first printed by Los Alamos Scientific Laboratory as LA-5200, March 1973; reprinted in 1997 by the Los Alamos Historical Society). This is a reprint of an unpublished volume originally written in 1946 by 2nd Lieutenant Edith C. Truslow, a member of the Women's Army Corps, as a contribution to the Manhattan Engineer District History.

368

CENTRAL NEVPJJA SUPPLEMENTAL TEST AREA  

NLE Websites -- All DOE Office Websites (Extended Search)

r r r r r t r r t r r r * r r r r r r CENTRAL NEVPJJA SUPPLEMENTAL TEST AREA ,FACILITY RECORDS 1970 UNITED STATES ATOMIC ENERGY COMMlSSION NEVADA OPERATIONS OFFICE LAS VEGAS, NEVADA September 1970 Prepared By Holmes & Narver. Inc. On-Continent Test Division P.O. Box 14340 Las Vegas, Nevada 338592 ...._- _._--_ .. -- - - - - - - .. .. - .. - - .. - - - CENTRAL NEVPJJA SUPPLEMENTAL TEST AREA FACILITY RECORDS 1970 This page intentionally left blank - - .. - - - PURPOSE This facility study has been prepared in response to a request of the AEC/NVOO Property Management Division and confirmed by letter, W. D. Smith to L. E. Rickey, dated April 14, 1970, STS Program Administrative Matters. The purpose is to identify each facility, including a brief description, the acquisition cost either purchase and/or construction, and the AE costs if identi- fiable. A narrative review of the history of the subcontracts

369

Carlsbad Area Office Executive Summary  

NLE Websites -- All DOE Office Websites (Extended Search)

June 1998 June 1998 Carlsbad Area Office Executive Summary The mission of the Carlsbad Area Office (CAO) is to protect human health and the environment by opening and operating the Waste Isolation Pilot Plant (WIPP) for safe disposal of transuranic (TRU) waste and by establishing an effective system for management of TRU waste from generation to disposal. It includes personnel assigned to CAO, WIPP site operations, transportation, and other activities associated with the National TRU Program (NTP). The CAO develops and directs implementation of the TRU waste program, and assesses compliance with the program guidance, as well as the commonality of activities and assumptions among all TRU waste sites. A cornerstone of the Department of Energy's (DOE) national cleanup strategy, WIPP is

370

RHIC | New Areas of Physics  

NLE Websites -- All DOE Office Websites (Extended Search)

A New Area of Physics A New Area of Physics RHIC has created a new state of hot, dense matter out of the quarks and gluons that are the basic particles of atomic nuclei, but it is a state quite different and even more remarkable than had been predicted. Instead of behaving like a gas of free quarks and gluons, as was expected, the matter created in RHIC's heavy ion collisions is more like a liquid. Quarks Gluons and quarks Ions Ions about to collide Impact Just after collision Perfect Liquid The "perfect" liquid hot matter Hot Nuclear Matter A review article in the journal Science describes groundbreaking discoveries that have emerged from RHIC, synergies with the heavy-ion program at the Large Hadron Collider, and the compelling questions that will drive this research forward on both sides of the Atlantic.

371

Variable area light reflecting assembly  

DOE Patents (OSTI)

Device is described for tracking daylight and projecting it into a building. The device tracks the sun and automatically adjusts both the orientation and area of the reflecting surface. The device may be mounted in either a wall or roof of a building. Additionally, multiple devices may be employed in a light shaft in a building, providing daylight to several different floors. The preferred embodiment employs a thin reflective film as the reflecting device. One edge of the reflective film is fixed, and the opposite end is attached to a spring-loaded take-up roller. As the sun moves across the sky, the take-up roller automatically adjusts the angle and surface area of the film. Additionally, louvers may be mounted at the light entrance to the device to reflect incoming daylight in an angle perpendicular to the device to provide maximum reflective capability when daylight enters the device at non-perpendicular angles. 9 figs.

Howard, T.C.

1986-12-23T23:59:59.000Z

372

Variable area light reflecting assembly  

DOE Patents (OSTI)

Device for tracking daylight and projecting it into a building. The device tracks the sun and automatically adjusts both the orientation and area of the reflecting surface. The device may be mounted in either a wall or roof of a building. Additionally, multiple devices may be employed in a light shaft in a building, providing daylight to several different floors. The preferred embodiment employs a thin reflective film as the reflecting device. One edge of the reflective film is fixed, and the opposite end is attached to a spring-loaded take-up roller. As the sun moves across the sky, the take-up roller automatically adjusts the angle and surface area of the film. Additionally, louvers may be mounted at the light entrance to the device to reflect incoming daylight in an angle perpendicular to the device to provide maximum reflective capability when daylight enters the device at non-perpendicular angles.

Howard, Thomas C. (Raleigh, NC)

1986-01-01T23:59:59.000Z

373

Kilauea Summit Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Kilauea Summit Geothermal Area Kilauea Summit Geothermal Area (Redirected from Kilauea Summit Area) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Kilauea Summit Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (12) 10 References Area Overview Geothermal Area Profile Location: Hawaii Exploration Region: Hawaii Geothermal Region GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content History and Infrastructure Operating Power Plants: 0 No geothermal plants listed.

374

Flint Geothermal Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Flint Geothermal Geothermal Area Flint Geothermal Geothermal Area (Redirected from Flint Geothermal Area) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Flint Geothermal Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (9) 10 References Area Overview Geothermal Area Profile Location: Colorado Exploration Region: Rio Grande Rift GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content History and Infrastructure Operating Power Plants: 0 No geothermal plants listed.

375

Blackfoot Reservoir Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Blackfoot Reservoir Geothermal Area Blackfoot Reservoir Geothermal Area (Redirected from Blackfoot Reservoir Area) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Blackfoot Reservoir Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (3) 10 References Area Overview Geothermal Area Profile Location: Idaho Exploration Region: Northern Basin and Range Geothermal Region GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content History and Infrastructure Operating Power Plants: 0

376

Wister Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Wister Geothermal Area Wister Geothermal Area (Redirected from Wister Area) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Wister Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (9) 10 References Area Overview Geothermal Area Profile Location: California Exploration Region: Gulf of California Rift Zone GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content History and Infrastructure Operating Power Plants: 0 No geothermal plants listed.

377

Teels Marsh Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Teels Marsh Geothermal Area Teels Marsh Geothermal Area (Redirected from Teels Marsh Area) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Teels Marsh Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (8) 10 References Area Overview Geothermal Area Profile Location: Nevada Exploration Region: Walker-Lane Transition Zone Geothermal Region GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content History and Infrastructure Operating Power Plants: 0

378

Truckhaven Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Truckhaven Geothermal Area Truckhaven Geothermal Area (Redirected from Truckhaven Area) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Truckhaven Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (1) 9 Exploration Activities (8) 10 References Area Overview Geothermal Area Profile Location: California Exploration Region: Gulf of California Rift Zone GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content History and Infrastructure Operating Power Plants: 0 No geothermal plants listed.

379

Mokapu Penninsula Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Mokapu Penninsula Geothermal Area Mokapu Penninsula Geothermal Area (Redirected from Mokapu Penninsula Area) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Mokapu Penninsula Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (8) 10 References Area Overview Geothermal Area Profile Location: Hawaii Exploration Region: Hawaii Geothermal Region GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content History and Infrastructure Operating Power Plants: 0 No geothermal plants listed.

380

USGS National Oil and Gas Assessment: GIS Data | OpenEI  

Open Energy Info (EERE)

National Oil and Gas Assessment: GIS Data National Oil and Gas Assessment: GIS Data Dataset Summary Description The USGS Central Region Energy Team assessed the oil and gas resources of the United States. Cell maps for each oil and gas production area were created by the USGS as a method for illustrating the degree of exploration, type of production, and distribution of production in a play. Each cell represents a one-mile (or a one-quarter mile) square of the land surface, and the cells are coded to represent whether the wells included with the cell are predominantly oil-producing, gas-producing, or dry. The data used are current as of December, 1990. Source USGS Date Released March 26th, 1996 (18 years ago) Date Updated Unknown Keywords gas oil Data application/zip icon 1/4 mile cells (well information); plus metadata (zip, 41.8 MiB)

Note: This page contains sample records for the topic "area miles mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

Resource investigation of low- and moderate-temperature geothermal areas in San Bernardino, California. Part of the third year report, 1980-81, of the US Department of Energy-California State-Coupled Program for Reservoir Assessment and Confirmation  

SciTech Connect

Ninety-seven geothermal wells and springs were identified and plotted on a compiled geologic map of the 40-square-mile study area. These wells and springs were concentrated in three distinguishable resource areas: Arrowhead Hot Springs; South San Bernardino; and Harlem Hot Springs - in each of which detailed geophysical, geochemical, and geological surveys were conducted. The Arrowhead Hot Springs geothermal area lies just north of the City of San Bernardino in the San Bernardino Mountains astride a shear zone (offshoot of the San Andreas fault) in pre-Cambrian gneiss and schist. The Harlem Hot Springs geothermal area, on the east side of the City, and the south San Bernardino geothermal area, on the south side, have geothermal reservoirs in Quaternary alluvial material which overlies a moderately deep sedimentary basin bound on the southwest by the San Jacinto fault (a ground water barrier). Geothermometry calculations suggest that the Arrowhead Hot Springs geothermal area, with a maximum reservoir temperature of 142/sup 0/C, may have the highest maximum reservoir temperature of the three geothermal areas. The maximum temperature recorded by CDMG in the south San Bernardino geothermal area was 56/sup 0/C from an artesian well, while the maximum temperature recorded in the Harlem Hot Springs geothermal area was 49.5/sup 0/C at 174 meters (570 feet) in an abandoned water well. The geophysical and geological surveys delineated fault traces in association with all three of the designated geothermal areas.

Youngs, L.G.; Bezore, S.P.; Chapman, R.H.; Chase, G.W.

1981-08-01T23:59:59.000Z

382

Innovation investment area: Technology summary  

Science Conference Proceedings (OSTI)

The mission of Environmental Management`s (EM) Office of Technology Development (OTD) Innovation Investment Area is to identify and provide development support for two types of technologies that are developed to characterize, treat and dispose of DOE waste, and to remediate contaminated sites. They are: technologies that show promise to address specific EM needs, but require proof-of-principle experimentation; and (2) already proven technologies in other fields that require critical path experimentation to demonstrate feasibility for adaptation to specific EM needs. The underlying strategy is to ensure that private industry, other Federal Agencies, universities, and DOE National Laboratories are major participants in developing and deploying new and emerging technologies. To this end, about 125 different new and emerging technologies are being developed through Innovation Investment Area`s (IIA) two program elements: RDDT&E New Initiatives (RD01) and Interagency Agreements (RD02). Both of these activities are intended to foster research and development partnerships so as to introduce innovative technologies into other OTD program elements for expedited evaluation.

Not Available

1994-03-01T23:59:59.000Z

383

Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production  

NLE Websites -- All DOE Office Websites (Extended Search)

miR156 miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production Chunxiang Fu 1 , Ramanjulu Sunkar 2 , Chuanen Zhou 1 , Hui Shen 3,4 , Ji-Yi Zhang 3,4 , Jessica Matts 2 , Jennifer Wolf 1 , David G. J. Mann 4,5 , C. Neal Stewart Jr 4,5 , Yuhong Tang 3,4 and Zeng-Yu Wang 1,4, * 1 Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 2 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USA 3 Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 4 BioEnergy Science Center, Oak Ridge, TN, USA 5 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 10 October 2011; revised 8 December 2011; accepted 12 December 2011. *Correspondence (Tel 1-580-224 6830; fax 1-580-224 6802; email zywang@noble.org) Re-use

384

An aerial radiological survey of the Ames Laboratory and surrounding area, Ames, Iowa. Date of survey: July 1991  

Science Conference Proceedings (OSTI)

An aerial radiological survey of the Ames Laboratory and surrounding area in Ames, Iowa, was conducted during the period July 15--25, 1991. The purpose of the survey was to measure and document the terrestrial radiological environment at the Ames Laboratory and the surrounding area for use in effective environmental management and emergency response planning. The aerial survey was flown at an altitude of 200 feet (61 meters) along a series of parallel lines 350 feet (107 meters) apart. The survey encompassed an area of 36 square miles (93 square kilometers) and included the city of Ames, Iowa, and the Iowa State University. The results are reported as exposure rates at 1 meter above ground level (inferred from the aerial data) in the form of a gamma radiation contour map. Typical background exposure rates were found to vary from 7 to 9 microroentgens per hour ({mu}R/h). No anomalous radiation levels were detected at the Ames Laboratory. However, one anomalous radiation source was detected at an industrial storage yard in the city of Ames. In support of the aerial survey, ground-based exposure rate and soil sample measurements were obtained at several sites within the survey perimeter. The results of the aerial and ground-based measurements were found to agree within the expected uncertainty of {+-}15%.

Maurer, R.J.

1993-04-01T23:59:59.000Z

385

Tanks focus area. Annual report  

SciTech Connect

The U.S. Department of Energy Office of Environmental Management is tasked with a major remediation project to treat and dispose of radioactive waste in hundreds of underground storage tanks. These tanks contain about 90,000,000 gallons of high-level and transuranic wastes. We have 68 known or assumed leaking tanks, that have allowed waste to migrate into the soil surrounding the tank. In some cases, the tank contents have reacted to form flammable gases, introducing additional safety risks. These tanks must be maintained in the safest possible condition until their eventual remediation to reduce the risk of waste migration and exposure to workers, the public, and the environment. Science and technology development for safer, more efficient, and cost-effective waste treatment methods will speed up progress toward the final remediation of these tanks. The DOE Office of Environmental Management established the Tanks Focus Area to serve as the DOE-EM`s technology development program for radioactive waste tank remediation in partnership with the Offices of Waste Management and Environmental Restoration. The Tanks Focus Area is responsible for leading, coordinating, and facilitating science and technology development to support remediation at DOE`s four major tank sites: the Hanford Site in Washington State, Idaho National Engineering and Environmental Laboratory in Idaho, Oak Ridge Reservation in Tennessee, and the Savannah River Site in South Carolina. The technical scope covers the major functions that comprise a complete tank remediation system: waste retrieval, waste pretreatment, waste immobilization, tank closure, and characterization of both the waste and tank. Safety is integrated across all the functions and is a key component of the Tanks Focus Area program.

Frey, J.

1997-12-31T23:59:59.000Z

386

Blackfoot Reservoir Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Blackfoot Reservoir Geothermal Area Blackfoot Reservoir Geothermal Area Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Blackfoot Reservoir Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (3) 10 References Area Overview Geothermal Area Profile Location: Idaho Exploration Region: Northern Basin and Range Geothermal Region GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content History and Infrastructure Operating Power Plants: 0 No geothermal plants listed.

387

Wister Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Wister Geothermal Area Wister Geothermal Area Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Wister Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (9) 10 References Area Overview Geothermal Area Profile Location: California Exploration Region: Gulf of California Rift Zone GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content History and Infrastructure Operating Power Plants: 0 No geothermal plants listed. Add a new Operating Power Plant

388

Area Science Park | Open Energy Information  

Open Energy Info (EERE)

Area Science Park Jump to: navigation, search Name Area Science Park Place Italy Sector Services Product General Financial & Legal Services ( Government Public sector )...

389

Southwest Area Corridor Map | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Map DOE Designates Southwest Area and Mid-Atlantic Area National Interest Electric Transmission Corridors October 2, 2007 FACT SHEET: Designation of National Interest Electric...

390

Southwest Area Corridor Map | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Map DOE Designates Southwest Area and Mid-Atlantic Area National Interest Electric Transmission Corridors October 2, 2007 Proposed Energy Transport Corridors: West-wide energy...

391

Lualualei Valley Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Page Page Edit with form History Facebook icon Twitter icon » Lualualei Valley Geothermal Area (Redirected from Lualualei Valley Area) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Lualualei Valley Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (7) 10 References Area Overview Geothermal Area Profile Location: Hawaii Exploration Region: Hawaii Geothermal Region GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content

392

White Mountains Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

White Mountains Geothermal Area White Mountains Geothermal Area Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: White Mountains Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (2) 10 References Area Overview Geothermal Area Profile Location: New Hampshire Exploration Region: Other GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content History and Infrastructure Operating Power Plants: 0 No geothermal plants listed. Add a new Operating Power Plant

393

Truckhaven Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Truckhaven Geothermal Area Truckhaven Geothermal Area Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Truckhaven Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (1) 9 Exploration Activities (8) 10 References Area Overview Geothermal Area Profile Location: California Exploration Region: Gulf of California Rift Zone GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content History and Infrastructure Operating Power Plants: 0 No geothermal plants listed. Add a new Operating Power Plant

394

Honokowai Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Honokowai Geothermal Area Honokowai Geothermal Area Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Honokowai Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (3) 10 References Area Overview Geothermal Area Profile Location: Hawaii Exploration Region: Hawaii Geothermal Region GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content History and Infrastructure Operating Power Plants: 0 No geothermal plants listed. Add a new Operating Power Plant

395

Redevelopment of Areas Needing Redevelopment Generally (Indiana)  

Energy.gov (U.S. Department of Energy (DOE))

Local redevelopment commissions may be established to oversee areas needing redevelopment (previously known as blighted, deteriorated, or deteriorating areas). The clearance, replanning, and...

396

Hydrogen, Fuel Cells, & Infrastructure - Program Areas - Energy...  

NLE Websites -- All DOE Office Websites (Extended Search)

fuel cell Welcome> Program Areas> Program Areas Hydrogen, Fuel Cells & Infrastructure Production & Delivery | Storage | Fuel Cell R&D | Systems Integration & Analysis | Safety...

397

Aquifer Protection Area Land Use Regulations (Connecticut)  

Energy.gov (U.S. Department of Energy (DOE))

These regulations describe allowable activities within aquifer protection areas, the procedure by which such areas are delineated, and relevant permit requirements. The regulations also describe...

398

Geothermal Literature Review At International Geothermal Area...  

Open Energy Info (EERE)

Latera area, Tuscany, re: Heat Flow References G. Ranalli, L. Rybach (2005) Heat Flow, Heat Transfer And Lithosphere Rheology In Geothermal Areas- Features And Examples...

399

Geothermal Literature Review At International Geothermal Area...  

Open Energy Info (EERE)

Hvalfjordur Fjord area, re: Heat flow References G. Ranalli, L. Rybach (2005) Heat Flow, Heat Transfer And Lithosphere Rheology In Geothermal Areas- Features And Examples...

400

History of 100-B Area  

SciTech Connect

The initial three production reactors and their support facilities were designated as the 100-B, 100-D, and 100-F areas. In subsequent years, six additional plutonium-producing reactors were constructed and operated at the Hanford Site. Among them was one dual-purpose reactor (100-N) designed to supply steam for the production of electricity as a by-product. Figure 1 pinpoints the location of each of the nine Hanford Site reactors along the Columbia River. This report documents a brief description of the 105-B reactor, support facilities, and significant events that are considered to be of historical interest. 21 figs.

Wahlen, R.K.

1989-10-01T23:59:59.000Z

Note: This page contains sample records for the topic "area miles mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Carlsbad Area Office strategic plan  

SciTech Connect

This edition of the Carlsbad Area Office Strategic Plan captures the U.S. Department of Energy`s new focus, and supercedes the edition issued previously in 1995. This revision reflects a revised strategy designed to demonstrate compliance with environmental regulations earlier than the previous course of action; and a focus on the selected combination of scientific investigations, engineered alternatives, and waste acceptance criteria for supporting the compliance applications. An overview of operations and historical aspects of the Waste Isolation Pilot Plant near Carlsbad, New Mexico is presented.

1995-10-01T23:59:59.000Z

402

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

0 0 Number of trips 1,610 Distance traveled (mi) 372 Percent of total distance traveled (%) 72% Average Trip Distance (mi) 0.2 Average Driving Speed (mph) 5.2 Average Stops per mile 32.1 Percent of Regen Braking Energy Recovery (%) 13% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 383 Number of trips 114 Distance traveled (mi) 144 Percent of total distance traveled (%) 28% Average Trip Distance (mi) 1.3 Average Driving Speed (mph) 18.3 Average Stops per mile 3.8 Percent of Regen Braking Energy Recovery (%) 16% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 549 Number of trips 5 Distance traveled (mi) 2 Percent of total distance traveled (%) 0% Average Trip Distance (mi) 0.4 Average Driving Speed (mph)

403

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

530 530 Number of trips 1,308 Distance traveled (mi) 495 Percent of total distance traveled (%) 69% Average Trip Distance (mi) 0.4 Average Driving Speed (mph) 5.6 Average Stops per mile 31.4 Percent of Regen Braking Energy Recovery (%) 15% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 471 Number of trips 91 Distance traveled (mi) 175 Percent of total distance traveled (%) 24% Average Trip Distance (mi) 1.9 Average Driving Speed (mph) 16.6 Average Stops per mile 3.8 Percent of Regen Braking Energy Recovery (%) 13% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 357 Number of trips 2 Distance traveled (mi) 49 Percent of total distance traveled (%) 7% Average Trip Distance (mi) 24.7 Average Driving Speed (mph)

404

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

74 74 Number of trips 399 Distance traveled (mi) 148 Percent of total distance traveled (%) 73% Average Trip Distance (mi) 0.4 Average Driving Speed (mph) 6.3 Average Stops per mile 35.5 Percent of Regen Braking Energy Recovery (%) 11% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 423 Number of trips 27 Distance traveled (mi) 54 Percent of total distance traveled (%) 27% Average Trip Distance (mi) 2.0 Average Driving Speed (mph) 20.7 Average Stops per mile 3.5 Percent of Regen Braking Energy Recovery (%) 15% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 0 Number of trips 0 Distance traveled (mi) 0 Percent of total distance traveled (%) 0% Average Trip Distance (mi) 0.0 Average Driving Speed (mph)

405

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

0 0 Number of trips 493 Distance traveled (mi) 189 Percent of total distance traveled (%) 38% Average Trip Distance (mi) 0.4 Average Driving Speed (mph) 4.9 Average Stops per mile 28.7 Percent of Regen Braking Energy Recovery (%) 15% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 377 Number of trips 67 Distance traveled (mi) 275 Percent of total distance traveled (%) 56% Average Trip Distance (mi) 4.1 Average Driving Speed (mph) 17.9 Average Stops per mile 3.7 Percent of Regen Braking Energy Recovery (%) 13% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 438 Number of trips 1 Distance traveled (mi) 29 Percent of total distance traveled (%) 6% Average Trip Distance (mi) 28.7 Average Driving Speed (mph)

406

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

505 505 Number of trips 601 Distance traveled (mi) 245 Percent of total distance traveled (%) 62% Average Trip Distance (mi) 0.4 Average Driving Speed (mph) 5.4 Average Stops per mile 34.8 Percent of Regen Braking Energy Recovery (%) 15% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 373 Number of trips 35 Distance traveled (mi) 124 Percent of total distance traveled (%) 31% Average Trip Distance (mi) 3.5 Average Driving Speed (mph) 23.0 Average Stops per mile 3.7 Percent of Regen Braking Energy Recovery (%) 13% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 319 Number of trips 3 Distance traveled (mi) 25 Percent of total distance traveled (%) 6% Average Trip Distance (mi) 8.5 Average Driving Speed (mph)

407

MonthlyReport  

NLE Websites -- All DOE Office Websites (Extended Search)

613 613 Number of trips 89 Distance traveled (mi) 9 Percent of total distance traveled (%) 30% Average Trip Distance (mi) 0.1 Average Driving Speed (mph) 7.0 Average Stops per mile 44.5 Percent of Regen Braking Energy Recovery (%) 9% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 487 Number of trips 8 Distance traveled (mi) 5 Percent of total distance traveled (%) 16% Average Trip Distance (mi) 0.6 Average Driving Speed (mph) 25.0 Average Stops per mile 3.8 Percent of Regen Braking Energy Recovery (%) 6% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 487 Number of trips 7 Distance traveled (mi) 16 Percent of total distance traveled (%) 54% Average Trip Distance (mi) 2.3 Average Driving Speed (mph)

408

Manhattan Project: Tech Area Gallery  

Office of Scientific and Technical Information (OSTI)

SMALL) SMALL) Los Alamos: The Laboratory Resources > Photo Gallery All of the photographs below are of the "Tech Area" at Los Alamos during or shortly after the wartime years. If you have a fast internet connection, you may wish to click here for a photo gallery with larger versions of the same images. There is a map of the Tech Area at the top and again at the bottom. The first image below is courtesy the Los Alamos National Laboratory. All of the other photographs are reproduced from Edith C. Truslow, with Kasha V. Thayer, ed., Manhattan Engineer District: Nonscientific Aspects of Los Alamos Project Y, 1942 through 1946 (Los Alamos, NM: Manhattan Engineer District, ca. 1946; first printed by Los Alamos Scientific Laboratory as LA-5200, March 1973; reprinted in 1997 by the Los Alamos Historical Society). This is a reprint of an unpublished volume originally written in 1946 by 2nd Lieutenant Edith C. Truslow, a member of the Women's Army Corps, as a contribution to the Manhattan Engineer District History.

409

Chena Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Chena Geothermal Area Chena Geothermal Area (Redirected from Chena Area) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Chena Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Future Plans 5 Exploration History 6 Well Field Description 7 Technical Problems and Solutions 8 Geology of the Area 9 Heat Source 10 Geofluid Geochemistry 11 NEPA-Related Analyses (1) 12 Exploration Activities (9) 13 References Map: Chena Geothermal Area Chena Geothermal Area Location Map Area Overview Geothermal Area Profile Location: Fairbanks, Alaska Exploration Region: Alaska Geothermal Region GEA Development Phase: Operational"Operational" is not in the list of possible values (Phase I - Resource Procurement and Identification, Phase II - Resource Exploration and Confirmation, Phase III - Permitting and Initial Development, Phase IV - Resource Production and Power Plant Construction) for this property.

410

Low-to-moderate temperature geothermal resource assessment for Nevada, area specific studies. Final report, June 1, 1980-August 30, 1981  

Science Conference Proceedings (OSTI)

The Hawthorne study area is located in Mineral County, Nevada and surrounds the municipality of the same name. It encompasses an area of approximately 310 sq. km (120 sq. mi), and most of the land belongs to the US Army Ammunition Plant. The energy needs of the military combined with those of the area population (over 5,000 residents) are substantial. The area is classified as having a high potential for direct applications using the evaluation scheme described in Texler and others (1979). A variety of scientific techniques was employed during area-wide resource assessment. General geologic studies demonstrate the lithologic diversity in the area; these studies also indicate possible sources for dissolved fluid constituents. Geophysical investigations include aero-magnetic and gravity surveys which aid in defining the nature of regional, and to a lesser extent, local variations in subsurface configurations. Surface and near-surface structural features are determined using various types of photo imagery including low sun-angle photography. An extensive shallow depth temperature probe survey indicates two zones of elevated temperature on opposite sides of the Walker Lake basin. Temperature-depth profiles from several wells in the study area indicate significant thermal fluid-bearing aquifers. Fluid chemical studies suggest a wide spatial distribution for the resource, and also suggest a meteoric recharge source in the Wassuk Range. Finally, a soil-mercury survey was not a useful technique in this study area. Two test holes were drilled to conclude the area resource assessment, and thermal fluids were encountered in both wells. The western well has measured temperatures as high as 90 C (194 F) within 150 meters (500 ft) of the surface. Temperature profiles in this well indicate a negative temperature gradient below 180 meters (590 ft). The eastern hole had a bottom hole temperature of 61 C (142 F) at a depth of only 120 meters (395 ft). A positive gradient is observed to a total depth in the well. Several conclusions are drawn from this study: the resource is distributed over a relatively large area; resource fluid temperatures can exceed 90 C (194 F), but are probably limited to a maximum of 125 C (257 F); recharge to the thermal system is meteoric, and flow of the fluids in the near surface (< 500 m) is not controlled by faults; heat supplied to the system may be related to a zone of partially melted crustal rocks in the area 25 km (15 mi) south of Hawthorne. Four papers and an introduction are included. A separate abstract was prepared for each paper. (MHR)

Trexler, D.T.; Koenig, B.A.; Flynn, T.; Bruce, J.L.; Ghusn, G. Jr.

1981-01-01T23:59:59.000Z

411

Property:Volume | Open Energy Information  

Open Energy Info (EERE)

Volume Volume Jump to: navigation, search Property Name Volume Property Type Quantity Description Any unit of volume. For example, the mean estimated reservoir volume at location based on the USGS 2008 Geothermal Resource Assessment if the United States. Use this type to express a quantity of three-dimensional space. The default unit is the cubic meter (m³). Acceptable units (and their conversions) are: Cubic Meters - 1 m³,m3,m^3,cubic meter,cubic meters,Cubic Meter,Cubic Meters,CUBIC METERS Cubic Kilometers - 0.000000001 km³,km3,km^3,cubic kilometer,cubic kilometers,cubic km,Cubic Kilometers,CUBIC KILOMETERS Cubic Miles - 0.000000000239912759 mi³,mi3,mi^3,mile³,cubic mile,cubic miles,cubic mi,Cubic Miles,CUBIC MILES Cubic Feet - 35.314666721 ft³,ft3,ft^3,cubic feet,cubic

412

Environmental analysis of geopressured-geothermal prospect areas, De Witt and Colorado counties, Texas. Final report, March 1 - August 31, 1979  

DOE Green Energy (OSTI)

Information collected and analyzed for a preliminary environmental analysis of geopressured geothermal prospect areas in Colorado and DeWitt Counties, Texas is presented. Specific environmental concerns for each geopressured geothermal prospect area are identified and discussed. Approximately 218 km/sup 2/(85 mi/sup 2/) were studied in the vicinity of each prospect area to: (1) conduct an environmental analysis to identify more and less suited areas for geopressured test wells; and (2) provide an environmental data base for future development of geopressured geothermal energy resources. A series of maps and tables are included to illustrate environmental characteristics including: geology, water resources, soils, current land use, vegetation, wildlife, and meteorological characteristics, and additional relevant information on cultural resources, power- and pipelines, and regulatory agencies. A series of transparent overlays at the scale of the original mapping has also been produced for the purposes of identifying and ranking areas of potential conflict between geopressured geothermal development and environmental characteristics. The methodology for ranking suitability of areas within the two prospect areas is discussed in the appendix. (MHR)

Gustavson, T.C.; Reeder, F.S.; Badger, E.A.

1980-02-01T23:59:59.000Z

413

Mapping Population onto Priority Conservation Areas  

E-Print Network (OSTI)

areas and (in every case except Mesoamerican Reef and Namib-Karoo) are higher in areas within aggregated. Rural areas in Namib-Karoo have the highest total fertility rates (mean rate of 6.2). Areas inside / Namib Karoo (p

Lopez-Carr, David

414

Boulder Area Directions and Transportation Information  

Science Conference Proceedings (OSTI)

Boulder Area Directions and Transportation Information. NIST Boulder Visitor Check-In & Parking. Transportation. ...

2013-02-27T23:59:59.000Z

415

Geothermal resource evaluation of the Yuma area  

DOE Green Energy (OSTI)

This report presents an evaluation of the geothermal potential of the Yuma, Arizona area. A description of the study area and the Salton Trough area is followed by a geothermal analysis of the area, a discussion of the economics of geothermal exploration and exploitation, and recommendations for further testing. It was concluded economic considerations do not favor geothermal development at this time. (ACR)

Poluianov, E.W.; Mancini, F.P.

1985-11-29T23:59:59.000Z

416

Investigation of Low-Temperature Geothermal Resources in the Sonoma Valley Area, California  

DOE Green Energy (OSTI)

The Sonoma Valley area contains low-temperature geothermal resources (20 C {le} T {le} 90 C) having the potential for useful development. Sonoma Valley residents, local governments and institutions, private developers, and manufacturers may be able to utilize the geothermal resources as an alternate energy source. Historically, there have been at least six geothermal spring areas developed in the Sonoma Valley. Four of these (Boyes Hot Springs, Fetter's Hot Springs, Agua Caliente Springs, and the Sonoma State Hospital warm spring) lie on a linear trend extending northwestward from the City of Sonoma. Detailed geophysical surveys delineated a major fault trace along the east side of the Sonoma Valley in association with the historic geothermal areas. Other fault traces were also delineated revealing a general northwest-trending structural faulting fabric underlying the valley. Water wells located near the ''east side'' fault have relatively high boron concentrations. Geochemical evidence may suggest the ''east side'' fault presents a barrier to lateral fluid migration but is a conduit for ascending fluids. Fifteen of the twenty-nine geothermal wells or springs located from literature research or field surveys are located along or east of this major fault in a 10 km (6.2 miles) long, narrow zone. The highest recorded water temperature in the valley appears to be 62.7 C (145 F) at 137.2 meters (450 feet) in a well at Boyes Hot Springs. This is consistent with the geothermal reservoir temperature range of 52-77 C (126-171 F) indicated by geothermometry calculations performed on data from wells in the area. Interpretation of data indicates a low-temperature geothermal fluid upwelling or ''plume'', along the ''east side'' fault with subsequent migration into permeable aquifers predominantly within volcanic strata. It is quite likely other geothermal fluid ''plumes'' in association with faulting are present within the Sonoma Valley area. A 5.8 km{sup 2} geothermal zone, that parallels the fault trace, is delineated and is perhaps the most favorable area for further investigation and possible geothermal production.

Youngs, Leslie G.; Chapman, Rodger H.; Chase, Gordon W.; Bezore, Stephen P.; Majmundar, Hasu H.

1983-01-01T23:59:59.000Z

417

Explanation of Significant Difference (ESD) for the A-Area Burning/Rubble Pits (731-A/1A) and Rubble Pit (731-2A) (U)  

DOE Green Energy (OSTI)

The A-Area Burning/Rubble Pits (731-A/1A) and Rubble Pit (731-2A) (ABRP) operable unit (OU) is located in the northwest portion of Savannah River Site (SRS), approximately 2.4 kilometers (1.5 miles) south of the A/M Area operations. Between 1951 and 1973, Pits 731-A and 731-1A were used to burn paper, plastics, wood, rubber, rags, cardboard, oil, degreasers, and solvents. Combustible materials were burned monthly. After burning was discontinued in 1973, Pits 731-A and 731-1A were also converted to rubble pits and used to dispose of concrete rubble, bricks, tile, asphalt, plastics, metal, wood products, and rubber until about 1978. When the pits were filled to capacity, there were covered with compacted clay-rich native soils and vegetation was established. Pit 731-2A was only used as a rubble pit until 1983 after which the area was backfilled and seeded. Two other potential source areas within the OU were investigated and found to be clean. The water table aquifer (M-Area aquifer) was also investigated.

Morgan, Randall

2000-11-17T23:59:59.000Z

418

Ashland Area Support Substation Project  

Science Conference Proceedings (OSTI)

The Bonneville Power Administration (BPA) provides wholesale electric service to the City of Ashland (the City) by transferring power over Pacific Power Light Company's (PP L) 115-kilovolt (kV) transmission lines and through PP L's Ashland and Oak Knoll Substations. The City distributes power over a 12.5-kV system which is heavily loaded during winter peak periods and which has reached the limit of its ability to serve peak loads in a reliable manner. Peak loads under normal winter conditions have exceeded the ratings of the transformers at both the Ashland and Oak Knoll Substations. In 1989, the City modified its distribution system at the request of PP L to allow transfer of three megawatts (MW's) of electric power from the overloaded Ashland Substation to the Oak Knoll Substation. In cooperation with PP L, BPA installed a temporary 6-8 megavolt-amp (MVA) 115-12.5-kV transformer for this purpose. This additional transformer, however, is only a temporary remedy. BPA needs to provide additional, reliable long-term service to the Ashland area through additional transformation in order to keep similar power failures from occurring during upcoming winters in the Ashland area. The temporary installation of another 20-MVA mobile transformer at the Ashland Substation and additional load curtailment are currently being studied to provide for sustained electrical service by the peak winter period 1992. Two overall electrical plans-of-service are described and evaluated in this report. One of them is proposed for action. Within that proposed plan-of-service are location options for the substation. Note that descriptions of actions that may be taken by the City of Ashland are based on information provided by them.

Not Available

1992-06-01T23:59:59.000Z

419

Obsidian Cliff Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Page Page Edit with form History Facebook icon Twitter icon » Obsidian Cliff Geothermal Area Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Obsidian Cliff Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (2) 10 References Area Overview Geothermal Area Profile Location: California Exploration Region: Gulf of California Rift Zone GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content History and Infrastructure Operating Power Plants: 0

420

Chena Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Chena Geothermal Area Chena Geothermal Area Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Chena Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Future Plans 5 Exploration History 6 Well Field Description 7 Technical Problems and Solutions 8 Geology of the Area 9 Heat Source 10 Geofluid Geochemistry 11 NEPA-Related Analyses (1) 12 Exploration Activities (9) 13 References Map: Chena Geothermal Area Chena Geothermal Area Location Map Area Overview Geothermal Area Profile Location: Fairbanks, Alaska Exploration Region: Alaska Geothermal Region GEA Development Phase: Operational"Operational" is not in the list of possible values (Phase I - Resource Procurement and Identification, Phase II - Resource Exploration and Confirmation, Phase III - Permitting and Initial Development, Phase IV - Resource Production and Power Plant Construction) for this property.

Note: This page contains sample records for the topic "area miles mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

Greater Boston Area | Open Energy Information  

Open Energy Info (EERE)

Greater Boston Area Greater Boston Area Jump to: navigation, search Contents 1 Clean Energy Clusters in the Greater Boston Area 1.1 Products and Services in the Greater Boston Area 1.2 Research and Development Institutions in the Greater Boston Area 1.3 Networking Organizations in the Greater Boston Area 1.4 Investors and Financial Organizations in the Greater Boston Area 1.5 Policy Organizations in the Greater Boston Area Clean Energy Clusters in the Greater Boston Area Products and Services in the Greater Boston Area Loading map... {"format":"googlemaps3","type":"ROADMAP","types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"limit":500,"offset":0,"link":"all","sort":[""],"order":[],"headers":"show","mainlabel":"","intro":"","outro":"","searchlabel":"\u2026

422

Southern CA Area | Open Energy Information  

Open Energy Info (EERE)

Southern CA Area Southern CA Area Jump to: navigation, search Contents 1 Clean Energy Clusters in the Southern CA Area 1.1 Products and Services in the Southern CA Area 1.2 Research and Development Institutions in the Southern CA Area 1.3 Networking Organizations in the Southern CA Area 1.4 Investors and Financial Organizations in the Southern CA Area 1.5 Policy Organizations in the Southern CA Area Clean Energy Clusters in the Southern CA Area Products and Services in the Southern CA Area Loading map... {"format":"googlemaps3","type":"ROADMAP","types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"limit":500,"offset":0,"link":"all","sort":[""],"order":[],"headers":"show","mainlabel":"","intro":"","outro":"","searchlabel":"\u2026

423

Pumpernickel Valley Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Pumpernickel Valley Geothermal Area Pumpernickel Valley Geothermal Area Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Pumpernickel Valley Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (1) 9 Exploration Activities (0) 10 References Map: Pumpernickel Valley Geothermal Area Pumpernickel Valley Geothermal Area Location Map Area Overview Geothermal Area Profile Location: Nevada Exploration Region: Northwest Basin and Range Geothermal Region GEA Development Phase: none"None" is not in the list of possible values (Phase I - Resource Procurement and Identification, Phase II - Resource Exploration and Confirmation, Phase III - Permitting and Initial Development, Phase IV - Resource Production and Power Plant Construction) for this property.

424

Whiskey Flats Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Whiskey Flats Geothermal Area Whiskey Flats Geothermal Area Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Whiskey Flats Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (1) 9 Exploration Activities (0) 10 References Map: Whiskey Flats Geothermal Area Whiskey Flats Geothermal Area Location Map Area Overview Geothermal Area Profile Location: Nevada Exploration Region: Walker-Lane Transition Zone Geothermal Region GEA Development Phase: none"None" is not in the list of possible values (Phase I - Resource Procurement and Identification, Phase II - Resource Exploration and Confirmation, Phase III - Permitting and Initial Development, Phase IV - Resource Production and Power Plant Construction) for this property.

425

Pacific Northwest Area | Open Energy Information  

Open Energy Info (EERE)

Pacific Northwest Area Pacific Northwest Area Jump to: navigation, search Contents 1 Clean Energy Clusters in the Pacific Northwest Area 1.1 Products and Services in the Pacific Northwest Area 1.2 Research and Development Institutions in the Pacific Northwest Area 1.3 Networking Organizations in the Pacific Northwest Area 1.4 Investors and Financial Organizations in the Pacific Northwest Area 1.5 Policy Organizations in the Pacific Northwest Area Clean Energy Clusters in the Pacific Northwest Area Products and Services in the Pacific Northwest Area Loading map... {"format":"googlemaps3","type":"ROADMAP","types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"limit":500,"offset":0,"link":"all","sort":[""],"order":[],"headers":"show","mainlabel":"","intro":"","outro":"","searchlabel":"\u2026

426

Corrective Action Decision Document for Corrective Action Unit 407: Roller Coaster RADSAFE Area, Tonopah Test Range, Nevada  

SciTech Connect

This Corrective Action Decision Document identifies and rationalizes the U.S. Department of Energy, Nevada Operations Office's selection of a recommended corrective action alternative (CAA) appropriate to facilitate the closure of Corrective Action Unit (CAU) 407, Roller Coaster RADSAFE Area (RCRSA), under the Federal Facility Agreement and Consent Order. Located on Tonopah Test Range (TTR), CAU 407 is located approximately 140 miles northwest of Las Vegas, Nevada, and five miles south of Area 3. The RCRSA was used during May and June of 1963 to decontaminate vehicles, equipment, and personnel from the Clean Slate tests. As a result of these operations, the surface and subsurface soils in the area have been impacted by plutonium and other contaminants of potential concern associated with decontamination activities. In June and July 1998, corrective action investigation activities were performed at CAU 407 (as outlined in the related Corrective Action Investigation Plan [CAIP]). The purpose of this investigation was to determine if any analytes were present at the site in concentrations above the preliminary action levels (PALs). The results indicated in the detection of plutonium above the PAL in samples taken from surface and subsurface soil within the exclusion zone, and uranium and americium detected above the PAL in samples taken from surface soil within the exclusion zone. No other COCs were identified above PALs specified in the CAIP. Based on this data, two corrective action objectives (CAOs) were defined: (1) to prevent or mitigate human exposure to surface and subsurface soil containing COCs, and (2) to prevent adverse impacts to groundwater quality. To accomplish these objectives, five CAAs were developed and evaluated. Based on the results of the detailed and comparative analysis of these alternatives, Alternative 3 (Partial Excavation, Disposal, and Administrative Controls With a Surface Cap) was chosen as the preferred alternative. This alternative was judged to meet all requirements for the technical components evaluated, the applicable state and federal regulations for closure of the site, the CAOs under DOE Order 5400.5 and 10 Code of Federal Regulations 20, and the reduction of potential future exposure pathways to subsurface contaminated soil.

U.S. Department of Energy, Nevada Operations Office

1999-09-24T23:59:59.000Z

427

Safety analysis, 200 Area, Savannah River Plant: Separations area operations  

Science Conference Proceedings (OSTI)

The nev HB-Line, located on the fifth and sixth levels of Building 221-H, is designed to replace the aging existing HB-Line production facility. The nev HB-Line consists of three separate facilities: the Scrap Recovery Facility, the Neptunium Oxide Facility, and the Plutonium Oxide Facility. There are three separate safety analyses for the nev HB-Line, one for each of the three facilities. These are issued as supplements to the 200-Area Safety Analysis (DPSTSA-200-10). These supplements are numbered as Sup 2A, Scrap Recovery Facility, Sup 2B, Neptunium Oxide Facility, Sup 2C, Plutonium Oxide Facility. The subject of this safety analysis, the, Plutonium Oxide Facility, will convert nitrate solutions of {sup 238}Pu to plutonium oxide (PuO{sub 2}) powder. All these new facilities incorporate improvements in: (1) engineered barriers to contain contamination, (2) barriers to minimize personnel exposure to airborne contamination, (3) shielding and remote operations to decrease radiation exposure, and (4) equipment and ventilation design to provide flexibility and improved process performance.

Perkins, W.C.; Lee, R.; Allen, P.M.; Gouge, A.P.

1991-07-01T23:59:59.000Z

428

Geothermal investigations in Idaho. Part 2. An evaluation of thermal water in the Bruneau-Grand View area, southwest Idaho  

DOE Green Energy (OSTI)

The Bruneau-Grand View area occupies about 1,100 square miles in southwest Idaho and is on the southern flank of the large depression in which lies the western Snake River Plain. The igneous and sedimentary rocks in the area range in age from Late Cretaceous to Holocene. The aquifers in the area have been separated into two broad units: (1) the volcanic-rock aquifers, and (2) the overlying sedimentary-rock aquifers. The Idavada Volcanics or underlying rock units probably constitute the reservoir that contains thermal water. An audio-magnetotelluric survey indicates that a large conductive zone having apparent resistivities approaching 2 ohm-meters underlies a part of the area at a relatively shallow depth. Chemical analysis of 94 water samples collected in 1973 show that the thermal waters in the area are of a sodium bicarbonate type. Although dissolved-solids concentrations of water ranged from 181 to 1,100 milligrams per litre (mg/1) in the volcanic-rock aquifers, they were generally less than 500 mg/1. Measured chloride concentrations of water in the volcanic-rock aquifers were less than 20 mg/1. Temperatures of water from wells and springs ranged from 9.5/sup 0/ to 83.0/sup 0/C. Temperatures of water from the volcanic-rock aquifers ranged from 40.0/sup 0/ to 83.0/sup 0/C, whereas temperatures of water from the sedimentary-rock aquifers seldom exceeded 35/sup 0/C. Aquifer temperatures at depth, as estimated by silica and sodium-potassium-calcium geochemical thermometers, probably do not exceed 150/sup 0/C. The gas in water from the volcanic-rock aquifers is composed chiefly of atmospheric oxygen and nitrogen. Methane gas (probably derived from organic material) was also found in some water from the sedimentary-rock aquifers.

Young, H.W.; Whitehead, R.L.; Hoover, D.B.; Tippens, C.L.

1975-07-01T23:59:59.000Z

429

Corrective Action Plan for Corrective Action Unit 417: Central Nevada Test Area Surface, Nevada  

Science Conference Proceedings (OSTI)

This Corrective Action Plan provides methods for implementing the approved corrective action alternative as provided in the Corrective Action Decision Document for the Central Nevada Test Area (CNTA), Corrective Action Unit (CAU) 417 (DOE/NV, 1999). The CNTA is located in the Hot Creek Valley in Nye County, Nevada, approximately 137 kilometers (85 miles) northeast of Tonopah, Nevada. The CNTA consists of three separate land withdrawal areas commonly referred to as UC-1, UC-3, and UC-4, all of which are accessible to the public. CAU 417 consists of 34 Corrective Action Sites (CASs). Results of the investigation activities completed in 1998 are presented in Appendix D of the Corrective Action Decision Document (DOE/NV, 1999). According to the results, the only Constituent of Concern at the CNTA is total petroleum hydrocarbons (TPH). Of the 34 CASs, corrective action was proposed for 16 sites in 13 CASs. In fiscal year 1999, a Phase I Work Plan was prepared for the construction of a cover on the UC-4 Mud Pit C to gather information on cover constructibility and to perform site management activities. With Nevada Division of Environmental Protection concurrence, the Phase I field activities began in August 1999. A multi-layered cover using a Geosynthetic Clay Liner as an infiltration barrier was constructed over the UC-4 Mud Pit. Some TPH impacted material was relocated, concrete monuments were installed at nine sites, signs warning of site conditions were posted at seven sites, and subsidence markers were installed on the UC-4 Mud Pit C cover. Results from the field activities indicated that the UC-4 Mud Pit C cover design was constructable and could be used at the UC-1 Central Mud Pit (CMP). However, because of the size of the UC-1 CMP this design would be extremely costly. An alternative cover design, a vegetated cover, is proposed for the UC-1 CMP.

K. Campbell

2000-04-01T23:59:59.000Z

430

Closure Report for Corrective Action Unit 151: Septic Systems and Discharge Area, Nevada Test Site, Nevada  

SciTech Connect

Corrective Action Unit (CAU) 151 is identified in the Federal Facility Agreement and Consent Order (FFACO) as Septic Systems and Discharge Area. CAU 151 consists of the following eight Corrective Action Sites (CASs), located in Areas 2, 12, and 18 of the Nevada Test Site, approximately 65 miles northwest of Las Vegas, Nevada: (1) CAS 02-05-01, UE-2ce Pond; (2) CAS 12-03-01, Sewage Lagoons (6); (3) CAS 12-04-01, Septic Tanks; (4) CAS 12-04-02, Septic Tanks; (5) CAS 12-04-03, Septic Tank; (6) CAS 12-47-01, Wastewater Pond; (7) CAS 18-03-01, Sewage Lagoon; and (8) CAS 18-99-09, Sewer Line (Exposed). CAU 151 closure activities were conducted according to the FFACO (FFACO, 1996; as amended February 2008) and the Corrective Action Plan for CAU 151 (U.S. Department of Energy, National Nuclear Security Administration Nevada Site Office, 2007) from October 2007 to January 2008. The corrective action alternatives included no further action, clean closure, and closure in place with administrative controls. CAU 151 closure activities are summarized in Table 1. Closure activities generated liquid remediation waste, sanitary waste, hydrocarbon waste, and mixed waste. Waste generated was appropriately managed and disposed. Waste that is currently staged onsite is being appropriately managed and will be disposed under approved waste profiles in permitted landfills. Waste minimization activities included waste characterization sampling and segregation of waste streams. Some waste exceeded land disposal restriction limits and required offsite treatment prior to disposal. Other waste meeting land disposal restrictions was disposed of in appropriate onsite or offsite landfills. Waste disposition documentation is included as Appendix C.

NSTec Environmental Restoration

2008-04-01T23:59:59.000Z

431

Event Images from ArgoNeuT: Mini LArTPC Exposure to Fermilab's NuMI Beam Project  

DOE Data Explorer (OSTI)

ArgoNeuT is a joint NSF/DOE R&D project at Fermilab to expose a small-scale liquid argon time projection chamber (LArTPC) to the NuMI neutrino beam. Liquid argon detectors are an exciting class of neutrino experiments because they can provide bubble chamber quality images and excellent background rejection. In these detectors, neutrinos passing through a large volume of argon interact with an argon atom, producing light and ionization particles. An electric field within the detector causes these charged particles to drift through the volume of argon, leaving a path of ionization electrons. As they drift, the ionization electrons induce current in two wire planes and are collected at a third plane. Measurement of the signals created within the wires, the position of the wires within the planes, the drift velocity of the ionization particles, and time of drift (from scintillation light or elsewhere) provides all the information needed for 3D reconstruction of the event. ArgoNeuT's neutrino source is the NuMI (Neutrinos at the Main Injector) beam. The beam passes through the MINOS (Main Injector Neutrino Oscillation search) near and far detectors, positioned at 1 km and 735 km from the target at Fermilab. ArgoNeuT is located at Fermilab upstream of the MINOS near detector, and is calibrated using muons that traverse the chamber and penetrate several layers into MINOS[Copied with editing from http://t962.fnal.gov/index.html]. A small selection of event images are made available.

432

Maui Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Maui Geothermal Area Maui Geothermal Area (Redirected from Maui Area) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Maui Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (13) 10 References Area Overview Geothermal Area Profile Location: Hawaii Exploration Region: Hawaii Geothermal Region GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content History and Infrastructure Operating Power Plants: 0 No geothermal plants listed. Add a new Operating Power Plant

433

Glass Buttes Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Glass Buttes Geothermal Area Glass Buttes Geothermal Area (Redirected from Glass Buttes Area) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Glass Buttes Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (1) 9 Exploration Activities (14) 10 References Area Overview Geothermal Area Profile Location: Oregon Exploration Region: Cascades GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content History and Infrastructure Operating Power Plants: 0 No geothermal plants listed. Add a new Operating Power Plant

434

Obsidian Cliff Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Obsidian Cliff Geothermal Area Obsidian Cliff Geothermal Area (Redirected from Obsidian Cliff Area) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Obsidian Cliff Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (2) 10 References Area Overview Geothermal Area Profile Location: California Exploration Region: Gulf of California Rift Zone GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content History and Infrastructure Operating Power Plants: 0 No geothermal plants listed.

435

Jemez Pueblo Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Jemez Pueblo Geothermal Area Jemez Pueblo Geothermal Area (Redirected from Jemez Pueblo Area) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Jemez Pueblo Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (9) 10 References Area Overview Geothermal Area Profile Location: New Mexico Exploration Region: Rio Grande Rift GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content History and Infrastructure Operating Power Plants: 0 No geothermal plants listed.

436

Socorro Mountain Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Socorro Mountain Geothermal Area Socorro Mountain Geothermal Area (Redirected from Socorro Mountain Area) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Socorro Mountain Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (10) 10 References Area Overview Geothermal Area Profile Location: New Mexico Exploration Region: Rio Grande Rift GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content History and Infrastructure Operating Power Plants: 0 No geothermal plants listed.

437

Kauai Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Kauai Geothermal Area Kauai Geothermal Area (Redirected from Kauai Area) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Kauai Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (1) 10 References Area Overview Geothermal Area Profile Location: Hawaii Exploration Region: Hawaii Geothermal Region GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content History and Infrastructure Operating Power Plants: 0 No geothermal plants listed. Add a new Operating Power Plant

438

Dixie Meadows Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Dixie Meadows Geothermal Area Dixie Meadows Geothermal Area (Redirected from Dixie Meadows Area) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Dixie Meadows Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (6) 9 Exploration Activities (2) 10 References Area Overview Geothermal Area Profile Location: Nevada Exploration Region: Central Nevada Seismic Zone GEA Development Phase: None"None" is not in the list of possible values (Phase I - Resource Procurement and Identification, Phase II - Resource Exploration and Confirmation, Phase III - Permitting and Initial Development, Phase IV - Resource Production and Power Plant Construction) for this property.