Powered by Deep Web Technologies
Note: This page contains sample records for the topic "ann arbor mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.


Clean Cities: Ann Arbor Clean Cities coalition  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

Ann Arbor Clean Cities Coalition Ann Arbor Clean Cities Coalition The Ann Arbor Clean Cities coalition works with vehicle fleets, fuel providers, community leaders, and other stakeholders to reduce petroleum use in transportation. Ann Arbor Clean Cities coalition Contact Information Mark Rabinsky 734-585-5720, Ext. 24 mark@cec-mi.org Coalition Website Clean Cities Coordinator Mark Rabinsky Photo of Mark Rabinsky Mark Rabinsky is a project manager and Ann Arbor Clean Cities Coordinator for Clean Energy Coalition. He is working to develop a plug-in electric vehicle charging infrastructure community preparedness plan for the State of Michigan. Prior to joining the Clean Energy Coalition, Rabinsky was the director of sustainability at Jackson Community College (JCC) in Jackson, Mich. where he created a program of study in alternative energy, and oversaw the


RECIPIENT:City of Ann Arbor PROJECT TITLE: Ann Arbor Wind Generator  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Ann Arbor Ann Arbor PROJECT TITLE: Ann Arbor Wind Generator " ) STATE: MI Funding Opportunity Announcement Number ProcurementInstrument Number NEPA Control Number CID Number DE-EE0000447 GFO-0000447-001 0 Based on my review oCthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including, but not limited to, literature surveys, inventories, audits), data analysis (including computer modeling), document preparation (such as conceptual design or feasibility studies, analytical energy supply and demand studies), and dissemination (including, but not limited to, document mailings, publication, and distribution; and


Ann Arbor's New Recycling Trucks Get an 'Assist' from Clean Cities |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Ann Arbor's New Recycling Trucks Get an 'Assist' from Clean Cities Ann Arbor's New Recycling Trucks Get an 'Assist' from Clean Cities Ann Arbor's New Recycling Trucks Get an 'Assist' from Clean Cities August 18, 2010 - 2:22pm Addthis Peterbilt Model 320 Hybrid HLAs are being put to use in Ann Arbor, MI, where they will serve as recycling trucks. | Photo Courtesy of Peterbilt Motors Company Peterbilt Model 320 Hybrid HLAs are being put to use in Ann Arbor, MI, where they will serve as recycling trucks. | Photo Courtesy of Peterbilt Motors Company Joshua DeLung Hydraulics in vehicles - best known for bouncing cars and kneeling buses - are getting a serious look in Ann Arbor, Mich. The reasons - saving fuel and increasing the life of heavy-use vehicles. With the support of a $120,000 Recovery Act grant, Ann Arbor, Mich., deployed four recycling trucks with hydraulic hybrid power systems


Ann Arbor, Michigan: Solar in Action (Brochure)  

DOE Green Energy (OSTI)

This brochure provides an overview of the challenges and successes of Ann Arbor, Michigan, a 2007 Solar America City awardee, on the path toward becoming a solar-powered community. Accomplishments, case studies, key lessons learned, and local resource information are given.

Not Available



City of Ann Arbor - PACE Financing | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

City of Ann Arbor - PACE Financing City of Ann Arbor - PACE Financing City of Ann Arbor - PACE Financing < Back Eligibility Commercial Industrial Multi-Family Residential Savings Category Heating & Cooling Commercial Heating & Cooling Heating Home Weatherization Commercial Weatherization Sealing Your Home Cooling Appliances & Electronics Design & Remodeling Windows, Doors, & Skylights Ventilation Construction Heat Pumps Commercial Lighting Lighting Insulation Water Heating Program Info Start Date 10/04/2011 State Michigan Program Type PACE Financing Provider City of Ann Arbor The City of Ann Arbor offers Property Assessed Clean Energy (PACE) financing for commercial properties located within the city. Projects will undergo a voluntary special assessment and may range in size from $10,000


City of Ann Arbor - Green Power Purchasing | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Ann Arbor - Green Power Purchasing Ann Arbor - Green Power Purchasing City of Ann Arbor - Green Power Purchasing < Back Eligibility Local Government Savings Category Bioenergy Solar Buying & Making Electricity Home Weatherization Water Program Info State Michigan Program Type Green Power Purchasing Provider City of Ann Arbor In May 2006, the Ann Arbor City Council adopted a resolution that established a goal of 30% renewable energy for all municipal operations by 2010, with an associated 20% reduction in greenhouse gases. The resolution also established a goal of 20% renewable energy for the entire Ann Arbor community by 2015. In July 2009, the EPA [http://www.a2gov.org/news/Documents/2009_News_Releases/EPA-On-site_Green... announced] that the city of Ann Arbor was among the top-20 users of on-site


Ann Arbor, Michigan: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Ann Arbor, Michigan: Energy Resources Ann Arbor, Michigan: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 42.2708716°, -83.7263294° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.2708716,"lon":-83.7263294,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


U.S. Environmental Protection Agency's National Vehicle and Fuel Emissions Laboratory, Ann Arbor, Michigan  

DOE Green Energy (OSTI)

This case study was prepared as one in a series for the Laboratories for the 21st Century program, a joint endeavor of the U.S. Environmental Protection Agency and the U.S. Department of Energy's Federal Energy Management Program. The goal of this program is to foster greater energy efficiency in new and retrofit laboratory buildings in both the public and the private sectors. The energy-efficient elements of the laboratory featured in this case study-EPA's National Vehicle and Fuel Emissions Laboratory, Ann Arbor, Michigan-include the addition of digital controls for heating and cooling equipment, variable-air-volume supply and exhaust systems, energy recovery systems, water conservation equipment, and the use of a fuel cell to supplement grid-supplied electricity with a nonpolluting source of power. These features and upgrades were installed as part of an Energy Savings Performance Contract; the result has been a 60% drop in energy costs and a 50% reduction in domestic water use at the laboratory.

Not Available



DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated


Arbor Day  

NLE Websites -- All DOE Office Websites (Extended Search)

Arbor Day Arbor Day Nature Bulletin No. 62 April 20, 1946 Forest Preserve District of Cook County Clayton F. Smith, President Roberts Mann, Superintendent of Conservation ARBOR DAY The oldest living thing on earth is a tree. Some of the giant sequoias in California are more than 3500 years old. One of them, fallen, was proven to be 3210 years old by a count of the annual growth rings. It grew from a tiny seed which sprouted about the time when Joseph, with the coat of many colors, was prime minister of Egypt and the known world was in the middle bronze age. The largest living thing on earth is a tree, the General Sherman, a giant sequoia in Giant Forest, Sequoia National Park. It has a base diameter of 30.7 feet, a diameter of 17 feet at 120 feet above the ground, and a height of 272 feet. Its first large branch, starting at 130 feet above the ground, is 6.8 feet in diameter and 150 feet long, itself larger than the largest of many other tree species, yet an inconspicuous part of this monster. The trunk of the General Sherman, exclusive of the limbs, contains about 50,000 cubic feet wood and probably 250,000 board feet of usable lumber could be obtained -- enough to build 15 five-room all- wood houses. Two other giant sequoias, the General Grant and the Boole, have base diameters of 33.3 and 33.2 feet respectively, but they are not as high and taper more rapidly.


E Pluribus...Separation: Deepening Double Segregation for More Students  

E-Print Network (OSTI)

TX Detroit-Ann Arbor-Flint, MI Philadelphia-Wilmington-TX Detroit-Ann Arbor-Flint, MI Philadelphia-Wilmington-

Orfield, Gary; Kucsera, John; Siegel-Hawley, Genevieve



Energetics of gas-driven limnic and volcanic eruptions Department of Geological Sciences, The University of Michigan, Ann Arbor, MI 48109-1063, USA  

E-Print Network (OSTI)

and when equilibrium is reached between the gas and liquid phases Natural silicate melts often contain two.3. Dynamics of reversible gas-driven eruptions through a fluid medium Because buoyancy plays an important roleEnergetics of gas-driven limnic and volcanic eruptions Y. Zhang* Department of Geological Sciences

Zhang, Youxue


Arbor Fuel | Open Energy Information  

Open Energy Info (EERE)

Name Arbor Fuel Place Connecticut Zip CT 06030 Sector Biomass Product Arbor Fuel is developing micro-organisms to convert biomass into alternative fuels like biobutanol....


The University of Michigan Degrees Conferred by Degree Level and Campus  

E-Print Network (OSTI)

Total Ann Arbor Dearborn Flint Ann Arbor Dearborn Flint Ann Arbor Dearborn Flint Ann Arbor Ann Arbor Ann Total Ann Arbor Dearborn Flint Ann Arbor Dearborn Flint Ann Arbor Dearborn Flint Ann Arbor Ann Arbor Ann

Shyy, Wei


Clean Cities: Ann Arbor Clean Cities coalition  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

Prior to joining the Clean Energy Coalition, Rabinsky was the director of sustainability at Jackson Community College (JCC) in Jackson, Mich. where he created a program of...


Supporting Information Evolution of Dendritic Platinum Nanosheets  

E-Print Network (OSTI)

87131. 3 Toyota Technical Center, Toyota Motor Engineering & Manufacturing North America, Ann Arbor, MI

Shelnutt, John A.


Mark Iadicola  

Science Conference Proceedings (OSTI)

... 2002-2003 Postdoctoral Research Fellow University of Michigan, Ann Arbor, MI. 1996-2002 University of Michigan, Ann ...



Ann Cain  

Science Conference Proceedings (OSTI)

Accounting questions, payable and receivable Ann Cain Contact Information contact contact us Ann Cain Accounting Specialist


The History of Arbor Day  

NLE Websites -- All DOE Office Websites (Extended Search)

Arbor Day Arbor Day Nature Bulletin No. 227-A April 23, 1966 Forest Preserve District of Cook County Seymour Simon, President Roland F. Eisenbeis, Supt. of Conservation THE HISTORY OF ARBOR DAY Most holidays remind us of past events, but Arbor Day, set aside for the planting of trees, looks toward the future. That is truly conservation. Conservation may be defined as the wise use of all our natural resources for the permanent good of all the people . It is a way of living that looks toward the future. The idea of Arbor Day started on January 4, 1872, when J. Sterling Morton, then a member of the Nebraska Board of Agriculture, introduced a resolution that: "Wednesday, the tenth day of April, 1872, be and the same is hereby especially set apart and consecrated for the planting of trees in the State of Nebraska and the State Board of Agriculture hereby name it Arbor Day; and to urge upon the people of the State the vital importance of tree planting .... .

Note: This page contains sample records for the topic "ann arbor mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


The FASEB Journal Research Communication Structure-function analysis of human l-prostaglandin D  

E-Print Network (OSTI)

the commercially available PGD2-MOX ELISA kit (Cay- man Chemicals, Ann Arbor, MI, USA). One unit of enzyme activity

Zhijie, Liu


Project Brief: Michigan Aerospace Corporation  

Science Conference Proceedings (OSTI)

... RECIPIENT: Michigan Aerospace Corporation, Ann Arbor, MI. Project duration: 3 Years; Total NIST Funding: $1,499,463. ...



City of Ann Arbor - PACE Financing | Open Energy Information  

Open Energy Info (EERE)

and the lien to value of the property cannot exceed 99% of twice the State Equalized Value. Property owners may use the financing for energy efficiency andor renewable energy...


Anne Harrington  

Energy.gov (U.S. Department of Energy (DOE))

Anne Harrington was sworn in as Deputy Administrator for Defense Nuclear Nonproliferation for the National Nuclear Security Administration in October 2010. Previously, Ms. Harrington was the...


WSU foUndation/2006-2007 2006-2007 annUaL REPoRt  

E-Print Network (OSTI)

, Loïc, Manu, Marie-Jo, Chantale, Mi chèle, Anastasia, Patrick, Pierre, Anne, Ilizabethe, Eléa, Boris

Collins, Gary S.


--No Title--  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Michigan Total Sum City, County, and SEO Allocations All 76,601,500 MI Michigan State Energy Office 19,599,600 MI Ann Arbor City 1,243,400 MI Battle Creek City 545,100...


Anne Harkavy  

Energy.gov (U.S. Department of Energy (DOE))

Anne Harkavy serves as Deputy General Counsel for Litigation and Enforcement for the U.S. Department of Energy. Prior to joining the Department, she was a partner at the law firm of...


ArborGen | Open Energy Information  

Open Energy Info (EERE)

ArborGen ArborGen Jump to: navigation, search Name ArborGen Place Summerville, South Carolina Product The company is invloved in research, development and commercialization of applications and solutions in tree genetics, including varietal forestry, that improve wood growth and quality for the forest products industry. Coordinates 33.01897°, -80.176014° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":33.01897,"lon":-80.176014,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Preserving research data  

E-Print Network (OSTI)

Consortium for Political and Social Research. Ann Arbor, MI;Access to Publicly Funded Research Data. The Public Domainof the products of scientific research. Meanwhile, research

Jacobs, James A; Humphrey, Charles



James Fekete  

Science Conference Proceedings (OSTI)

... Licensed Professional Engineer State of Michigan. ... Ph.D. Materials Science and Engineering, The University of Michigan, Ann Arbor, MI (1986). ...



On feasibility based bounds tightening0  

E-Print Network (OSTI)

Jan 24, 2012 ... 3 Ind. and Op. Eng. Dept., University of Michigan, Ann Arbor MI, USA. Email: jonxlee@umich.edu. 4 LIX, Ecole Polytechnique, F-91128...


On two relaxations of quadratically-constrained cardinality ...  

E-Print Network (OSTI)

Oct 18, 2012 ... Department of Electrical Engineering and Computer Science, University of Michigan, 1301 Beal Avenue,. Ann Arbor, MI 48109, USA. E-mail:...


Arbor Hills Biomass Facility | Open Energy Information  

Open Energy Info (EERE)

Hills Biomass Facility Hills Biomass Facility Jump to: navigation, search Name Arbor Hills Biomass Facility Facility Arbor Hills Sector Biomass Facility Type Landfill Gas Location Washtenaw County, Michigan Coordinates 42.3076493°, -83.8473015° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.3076493,"lon":-83.8473015,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


The University of Michigan Degrees Conferred by Degree Level and Campus  

E-Print Network (OSTI)

Total Ann Arbor Dearborn Flint Ann Arbor Dearborn Flint Ann Arbor Dearborn Flint Ann Arbor Ann Arbor Ann Professional Doctor Professional Year Total Ann Arbor Dearborn Flint Ann Arbor Dearborn Flint Ann Arbor Dearborn Flint Ann Arbor Ann Arbor Ann Arbor 1974-75 10,636 9,761 442 433 4,677 375 433 2,871 67 0 40 722 1

Shyy, Wei


IEEE TRANSACTIONS ON VEHICULAR TECHNOLOGY 1 Efficient Message Composition and Coding for  

E-Print Network (OSTI)

describe a deployment in several vehicles at the Toyota Technical Center in Ann Arbor, MI. Then, using data. This work has been supported by a Toyota research contract at the University of Illinois at Urbana Champaign. Laberteaux are at the Toyota Technical Center in Ann Arbor, MI. email lorenzo.caminiti--derek.caveney--ken.laberteaux@tema.toyota


Mary Ann Piette  

NLE Websites -- All DOE Office Websites (Extended Search)

A Plan for Research towards Implementation." In 2012 Greenbuild Conference & Expo. San Francisco, CA, 2012. Download: PDF (1.17 MB) Piette, Mary Ann, Jessica Granderson,...



SciTech Connect

At the NRC?s request, ORAU conducted confirmatory surveys of the FNR during the period of December 4 through 6, 2012. The survey activities included visual inspections and measurement and sampling activities. Confirmatory activities also included the review and assessment of UM?s project documentation and methodologies. Surface scans identified elevated activity in two areas. The first area was on a wall outside of Room 3103 and the second area was in the southwest section on the first floor. The first area was remediated to background levels. However, the second area was due to gamma shine from a neighboring source storage area. A retrospective analysis of UM?s FSS data shows that for the SUs investigated by the ORAU survey team, UM met the survey requirements set forth in the FSSP. The total mean surface activity values were directly compared with the mean total surface activity reported by UM. Mean surface activity values determined by UM were within two standard deviations of the mean determined by ORAU. Additionally, all surface activity values were less than the corresponding gross beta DCGL{sub W}. Laboratory analysis of the soil showed that COC concentrations were less than the respective DCGL{sub W} values. For the inter-lab comparison, the DER was above 3 for only one sample. However, since the sum of fractions for each of the soil samples was below 1, thus none of the samples would fail to meet release guidelines. Based on the findings of the side-by-side direct measurements, and after discussion with the NRC and ORAU, UM decided to use a more appropriate source efficiency in their direct measurement calculations and changed their source efficiency from 0.37 to 0.25.





SciTech Connect

At the NRC?s request, ORAU conducted confirmatory surveys of the FNR during the period of December 4 through 6, 2012. The survey activities included visual inspections and measurement and sampling activities. Confirmatory activities also included the review and assessment of UM?s project documentation and methodologies. Surface scans identified elevated activity in two areas. The first area was on a wall outside of Room 3103 and the second area was in the southwest section on the first floor. The first area was remediated to background levels. However, the second area was due to gamma shine from a neighboring source storage area. A retrospective analysis of UM?s FSS data shows that for the SUs investigated by the ORAU survey team, UM met the survey requirements set forth in the FSSP. The total mean surface activity values were directly compared with the mean total surface activity reported by UM. Mean surface activity values determined by UM were within two standard deviations of the mean determined by ORAU. Additionally, all surface activity values were less than the corresponding gross beta DCGLW. Laboratory analysis of the soil showed that COC concentrations were less than the respective DCGLW values. For the inter-lab comparison, the DER was above 3 for only one sample. However, since the sum of fractions for each of the soil samples was below 1, thus none of the samples would fail to meet release guidelines. Based on the findings of the side-by-side direct measurements, and after discussion with the NRC and ORAU, UM decided to use a more appropriate source efficiency in their direct measurement calculations and changed their source efficiency from 0.37 to 0.25.




Effects of the Mount St. Helens Volcanic Cloud on Turbidity at Ann Arbor, Michigan  

Science Conference Proceedings (OSTI)

Measurements of turbidity were made at the University of Michigan irradiance and meteorological measurement facility just prior to, during and after the passage of the volcanic cloud from the 18 May 1980 eruption of Mount St. Helens. They were ...

Edward Ryznar; Michael R. Weber; Thomas S. Hallaron



Mary Ann Dickinson  

NLE Websites -- All DOE Office Websites (Extended Search)

Mary Ann Dickinson Exec. Director California Urban Water Conservation Council (CUWCC) This speaker was a visiting speaker who delivered a talk or talks on the date(s) shown at the...

Note: This page contains sample records for the topic "ann arbor mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Mary Ann Piette  

NLE Websites -- All DOE Office Websites (Extended Search)

Ann Piette Ann Piette Mary Ann Piette Grid Integration Group Demand Response Research Center (DRRC) Commercial Building Systems Group Lawrence Berkeley National Laboratory 1 Cyclotron Road MS 90R3111 Berkeley CA 94720 Office Location: 90-3108 (510) 486-6286 MAPiette@lbl.gov Mary Ann Piette is the Head of the Building Technology and Urban Systems Department and has been at LBNL since 1983. She is also the Director of the Demand Response Research Center (DRRC). The DRRC develops DR technology and the Open Automated Demand Response standard, which is a key element of the NIST Smart Grid standards. OpenADR is being deployed to deliver over 250 MW of DR in California and throughout the US. Ms. Piette develops and evaluates low-energy and demand response technologies for buildings. She specializes in commissioning, energy information systems,


Article original valuation de la biomasse arbore et arbustive  

E-Print Network (OSTI)

Article original ?valuation de la biomasse arborée et arbustive dans une séquence de dégradation de 12 juillet 1999 ; accepté le 16 novembre 1999) Résumé ­ Les biomasses aérienne et souterraine des Kroumirie. Des mesures de biomasse et de paramètres dendrométriques de douze arbres échantillons de chênes

Recanati, Catherine


Automated Vehicle-to-Vehicle Collision Avoidance at Intersections  

E-Print Network (OSTI)

@umich.edu 2. Toyota Technical Center, Toyota Engineering and Manufacturing North America 1555 Woodridge Ave., Ann Arbor, MI 48105 Phone: (617)452-2275, Fax: (734)995-3053, E-mail: lorenzo.caminiti@tema.toyota

Del Vecchio, Domitilla


1 Copyright 2006 by ASME Proceedings of IDETC/CIE 2006  

E-Print Network (OSTI)

of Michigan Ann Arbor, MI, USA nlyu@umich.edu Amane Shimura Production Engineering Development Division Toyota Motor Corporation Toyota, Aichi, Japan amane_shimura@mail.toyota.co.jp Kazuhiro Saitou Dept

Saitou, Kazuhiro "Kazu"


NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Tracking No. 2.10 PVT 2010 Ralph Nine Oct. 1,2010-Dec. 31,2011 Ann Arbor, MI Lithium Ion Cell Development for Photovoltaic Storage Applications The purpose of this project is to...


NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Ann Arbor, MI "Clean Start" - Development of a National Liquid Propane (Autogas) Refueling Network This CX form is for one location in this project selected under Clean Cities FOA...


Michigan | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Efficiency and Renewable Energy, Golden Field Office August 18, 2010 Peterbilt Model 320 Hybrid HLAs are being put to use in Ann Arbor, MI, where they will serve as recycling...



NLE Websites -- All DOE Office Websites (Extended Search)

H. R. Gustafson, K. D. Hanson, L. W. Jones, M. J. Longo*, F. Lopez University of Michigan, Ann Arbor, MI S. Berridge, W. M. Bugg, H. Cohn, Yu. Efremenko, E. L. Hart, Yu....


Supporting Water, Ecological, and Transportation Systems in the Great Lakes Basin Ecosystem  

E-Print Network (OSTI)

8-9, 2004. Ann Arbor, Michigan. Great Lakes InformationKeystone, Colorado. Lake Michigan (MI) Lakewide ManagementOffice (GLNPO) Lake Michigan Lakewide Management Plan (LaMP)

Beck, Judy; Kamke, Sherry; Majerus, Kimberly



Braking system for use with an arbor of a microscope  

DOE Patents (OSTI)

A balanced braking system comprising a plurality of braking assemblies located about a member to be braked. Each of the braking assemblies consists of a spring biased piston of a first material fitted into a body of a different material which has a greater contraction upon cooling than the piston material. The piston is provided with a recessed head portion over which is positioned a diaphragm and forming a space therebetween to which is connected a pressurized fluid supply. The diaphragm is controlled by the fluid in the space to contact or withdraw from the member to be braked. A cooling device causes the body within which the piston is fitted to contract more than the piston, producing a tight shrink fit therebetween. The braking system is particularly applicable for selectively braking an arbor of an electron microscope which immobilizes, for example, a vertically adjustable low temperature specimen holder during observation. The system provides balanced braking forces which can be easily removed and re-established with minimal disturbance to arbor location.

Norgren, Duane U. (Orinda, CA)



Estimate product quality with ANNs  

Science Conference Proceedings (OSTI)

Artificial neural networks (ANNs) have been applied to predict catalytic reformer octane number (ON) and gasoline splitter product qualities. Results show that ANNs are a valuable tool to derive fast and accurate product quality measurements, and offer a low-cost alternative to online analyzers or rigorous mathematical models. The paper describes product quality measurements, artificial neural networks, ANN structure, estimating gasoline octane numbers, and estimating naphtha splitter product qualities.

Brambilla, A. [Univ. of Pisa (Italy); Trivella, F. [Adicon Advanced Distillation Control SrL, Pisa (Italy)



Queen Anne's County- Solar Zoning  

Energy.gov (U.S. Department of Energy (DOE))

Queen Anne's County zoning code allows for ground mounted solar arrays in areas zoned as "open space," "agricultural," and "countryside" districts.


Lori Ann White | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Lori Ann White About Us Lori Ann White - Science Writer, SLAC Office of Communications Most Recent President Obama Honors Sidney Drell with National Medal of Science February...


ANN - based distribution system reconfiguration  

SciTech Connect

This paper describes an Artificial Neural Network (ANN) - based distribution system reconfiguration scheme to reduce system loss. The ANN is trained for different load levels and different network topologies. The proposed scheme has been tested using a 38 - bus distribution system. The results are very promising.

Momoh, J.A.; Wang, Yanchun [Howard Univ., Washington, DC (United States). Electrical Engineering Dept.; Rizy, D.T. [Oak Ridge National Lab., TN (United States)



Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...


US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


Women @ Energy: Anne Ruffing | Department of Energy  

NLE Websites -- All DOE Office Websites (Extended Search)

Anne Ruffing Anne Ruffing Women @ Energy: Anne Ruffing April 19, 2013 - 10:01am Addthis Anne Ruffing works at Sandia National Laboratories as a Senior Member of the Technical Staff in the Department of Bioenergy and Defense Technologies. Photo by Randy Montoya, Sandia National Laboratories. Anne Ruffing works at Sandia National Laboratories as a Senior Member of the Technical Staff in the Department of Bioenergy and Defense Technologies. Photo by Randy Montoya, Sandia National Laboratories. Check out other profiles in the Women @ Energy series and share your favorites on Pinterest. Anne Ruffing recently joined Sandia National Laboratories as a Senior Member of the Technical Staff in the Department of Bioenergy and Defense Technologies. Prior to this, Anne was a Truman Fellow at Sandia, serving as


Women @ Energy: Anne Ruffing | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Anne Ruffing Anne Ruffing Women @ Energy: Anne Ruffing April 19, 2013 - 10:01am Addthis Anne Ruffing works at Sandia National Laboratories as a Senior Member of the Technical Staff in the Department of Bioenergy and Defense Technologies. Photo by Randy Montoya, Sandia National Laboratories. Anne Ruffing works at Sandia National Laboratories as a Senior Member of the Technical Staff in the Department of Bioenergy and Defense Technologies. Photo by Randy Montoya, Sandia National Laboratories. Check out other profiles in the Women @ Energy series and share your favorites on Pinterest. Anne Ruffing recently joined Sandia National Laboratories as a Senior Member of the Technical Staff in the Department of Bioenergy and Defense Technologies. Prior to this, Anne was a Truman Fellow at Sandia, serving as


Anne Harrington | National Nuclear Security Administration  

National Nuclear Security Administration (NNSA)

Anne Harrington | National Nuclear Security Administration Anne Harrington | National Nuclear Security Administration Our Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Continuing Management Reform Countering Nuclear Terrorism About Us Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Media Room Congressional Testimony Fact Sheets Newsletters Press Releases Speeches Events Social Media Video Gallery Photo Gallery NNSA Archive Federal Employment Apply for Our Jobs Our Jobs Working at NNSA Blog Home > About Us > Our Leadership > Anne Harrington Anne Harrington Deputy Administrator for Defense Nuclear Nonproliferation Anne Harrington Anne Harrington was sworn in as Deputy Administrator for Defense Nuclear Nonproliferation for the National Nuclear Security Administration in

Note: This page contains sample records for the topic "ann arbor mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Anne Arundel County - Solar and Geothermal Equipment Property...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Other Agencies You are here Home Savings Anne Arundel County - Solar and Geothermal Equipment Property Tax Credit Anne Arundel County - Solar and Geothermal Equipment...


Anne Arundel County - Solar and Geothermal Equipment Property...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Other Agencies You are here Home Savings Anne Arundel County - Solar and Geothermal Equipment Property Tax Credits Anne Arundel County - Solar and Geothermal Equipment...


DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed


Shirley Ann Jackson | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Shirley Ann Jackson Shirley Ann Jackson About Us Shirley Ann Jackson, Ph.D. - President, Rensselaer Polytechnic Institute and Former Chairman, US Nuclear Regulatory Commission Shirley Ann Jackson The Honorable Shirley Ann Jackson, Ph.D., is the 18th president of Rensselaer Polytechnic Institute of Troy, New York, and Hartford, Connecticut, the oldest technological research university in the United States. She was elected to the Brookings Board of Trustees in 2000. Described by Time Magazine as "perhaps the ultimate role model for women in science," Dr. Jackson, a theoretical physicist, has held senior leadership positions in government, industry, research, and academe. Since 1999, Dr. Jackson has led an extraordinary transformation at Rensselaer Polytechnic Institute. Her tenure has been marked by a tripling



NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)


Millions on the Margins: Music, Ethnicity, and Censorship Among the Oromo of Ethiopia  

E-Print Network (OSTI)

Ann Arbor: University of Michigan Press. Baxter, P.T.W. ,sevices, Ann Arbor Michigan. . 1976. Zemenawi Muzika:History. East Lansing, Michigan: Michigan State University

Mollenhauer, Shawn Michael



DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4


NREL: Biomass Research - Mary Ann Franden  

NLE Websites -- All DOE Office Websites (Extended Search)

Mary Ann Franden Mary Ann Franden Photo of Mary Ann Franden Mary Ann Franden is a senior scientist in the Applied Biology group of the National Bioenergy Center (NBC) at the National Renewable Energy Laboratory in Golden, Colorado. Her latest accomplishments include the development of growth assay and fermentation tools to monitor toxicity of Zymomonas by model compounds and hydrolysates. This allowed for the identification of dominant inhibitors to Zymomonas mobilis that are present in corn stover lignocellulosic hydrolysates generated during dilute acid pretreatment. In addition to working toward meeting U.S. Department of Energy Bioenergy Technologies Office target goals for 2012, she has participated in collaboration with DuPont on the Integrated Corn-Based Biorefinery (ICBR)


Ann (Sweeney) Augustyn | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Ann (Sweeney) Augustyn Ann (Sweeney) Augustyn About Us Ann (Sweeney) Augustyn - Chief of the Personnel Security and Appeals Division Ann (Sweeney) Augustyn Ms. Augustyn is the Chief of the Personnel Security and Appeals Division at the Office of Hearings and Appeals (OHA), U.S. Department of Energy (DOE). In this capacity, she oversees a group of attorneys who perform a variety of legal tasks, including conducting nationwide administrative hearings for the agency and issuing Initial Agency Decisions in cases involving DOE security clearances and contractor whistleblower complaints; processing Freedom of Information and Privacy Act Appeals; and handling requests for exception from appliance efficiency standards. During her tenure with DOE, Ms. Augustyn has been an instructor at George Washington University in


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...


St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...


DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either


Predicting water saturation using artificial neural networks (ANNS)  

Science Conference Proceedings (OSTI)

The application of artificial neural networks (ANNs) in the petroleum industry is widely increasing after major developments in ANN design. In this study, ANNs were used to develop a model for predicting water saturation in shaly formations using wireline ... Keywords: artificial neural networks, petroleum industry, shaly sandstone formation, water saturation

Nabil Al-Bulushi; Mariela Araujo; Martin Kraaijveld



Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...


DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical


Proceedings of ERDA symposium on x- and gamma-ray sources and applications held in Ann Arbor, Michigan, May 19--21, 1976  

SciTech Connect

Papers and abstracts of papers are presented concerning high resolution spectroscopy, life sciences, evironmental studies, and industrial analyses. Sixty-seven of the papers were processed individually. (JRD)



Ann M. Schlenker | Argonne National Laboratory  

NLE Websites -- All DOE Office Websites (Extended Search)

Ann M. Schlenker Director, Center for Transportation Research - Energy Systems Ann Schlenker is the Director of Argonne's Center for Transportation Research. In this role, she leads a team of scientists and engineers conducting research and developing technologies with the goal of reducing the transportation sector's reliance on petroleum and imported oil. Schlenker oversees engineering research to improve engine fuel efficiency and combustion processes, reduce friction losses, evaluate powertrain and vehicle architectures in virtual and experimental contexts and validate interoperability with the smart grid. She also oversees the Department of Energy's Advanced Vehicle Technology Competitions for education of the next generation of automotive engineers.

Note: This page contains sample records for the topic "ann arbor mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Gullu KIZILTAS, Asst. Prof. 1 of 9 May 2010 GULLU KIZILTAS  

E-Print Network (OSTI)

, TURKEY M.Sc. in Mechanical Engineering Sep '95 - May '98 Thesis Co-Supervisors: Professor Tuna Balkan Coordinator University of Michigan, EECS Dept., Radiation Lab. Ann Arbor, MI Post Doctoral Research Fellow May for UHF frequencies · Investigated high-contrast material behavior to improve antenna radiation

Sendur, Gullu Kiziltas


Author's personal copy Neural Networks 21 (2008) 458465  

E-Print Network (OSTI)

Special Issue Toyota Prius HEV neurocontrol and diagnostics$ Danil V. Prokhorov Toyota Technical Center, A division of Toyota Motor Engineering and Manufacturing North America (TEMA), Ann Arbor, MI 48105, United Abstract A neural network controller for improved fuel efficiency of the Toyota Prius hybrid electric

Prokhorov, Danil


1080 IEEE ANTENNAS AND WIRELESS PROPAGATION LETTERS, VOL. 9, 2010 Integrated Wideband 2-D and 3-D Transitions  

E-Print Network (OSTI)

@gatech.edu; simos.nikolaou@gmail.com; etentze@gatech.edu). A. Margomenos was with Toyota Research Institute North-mail: admargomenos@hrl.com). J. S. Lee and P. Schmalenberg are with Toyota Research Institute North America, Ann Arbor, MI 48105 USA (e-mail: jae.lee@tema.toyota.com; paul.schmalenberg@tema.toyota.com). Color versions

Tentzeris, Manos


Safety and Liveness in Intelligent Intersections Hemant Kowshik1  

E-Print Network (OSTI)

, USA. 2 The Toyota Technical Center, 2350 Green Road, Ann Arbor, MI-48105, USA. kowshik2@uiuc.edu,derek.caveney@tema.toyota in the U.S. [3]. Developing This material is based upon work partially supported by the Toyota Technical


Automakers' Short-Run Responses to Changing Gasoline Prices and the Implications for Energy Policy  

E-Print Network (OSTI)

Automakers' Short-Run Responses to Changing Gasoline Prices and the Implications for Energy Policy Policy, 735 S. State St. #5224, Ann Arbor, MI 48109. Miller: Economic Analysis Group, U.S. Department of intervention, the market is likely to produce efficient outcomes.1 We examine the empirical relationship

Edwards, Paul N.


A Practitioners' Review of Industrial Agent Applications  

Science Conference Proceedings (OSTI)

ERIM's1 Center for Electronic Commerce (CEC) hosted a two-day Workshop on Industrial Agents (WINA) in Ann Arbor, MI on Nov. 1213, 1998. Participation in the workshop was by invitation only, and was restricted to companies with whom ... Keywords: industrial applications, methods, software tools, workshop report

H. Van Dyke Parunak



Invited Paper Application of Superresolution Algorithm  

E-Print Network (OSTI)

.R. Kosek, and H.C. Stankwitz Environmental Research Institute of Michigan P.O. Box 134001, Ann Arbor, MI Warfare Center (NAWC) REFERENCES 1 . H.C. Stankwitz and M.R. Kosek, "Super-Resolution for SAR/IESAR RCS

Fienup, James R.


Effect of cycling rate, particle size and transport properties on lithium-ion cathode performance  

E-Print Network (OSTI)

voltage. The extension of such energy sys- tems from portable electronics to hybrid and electric vehicles, University of Michigan, Ann Arbor, MI 48109, USA a r t i c l e i n f o Article history: Received 5 November and electrical conductivity of the solid cathode material, on the specific energy and power have been studied

Shyy, Wei


This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research  

E-Print Network (OSTI)

of Mechanical Engineering, University of Michigan, Ann Arbor, MI 48109, USA a r t i c l e i n f o Article reserved. 1. Introduction Heat transfer materials like water, ethylene glycol, engine oil, alumina, copper, and silver have been widely used in numerous important fields, such as heating, ventilating, air

Violi, Angel


Martin O. Saar CV, Page 1 of 17 10/1/2009 CURRICULUM VITAE  

E-Print Network (OSTI)

: sokar.geo.umn.edu/twiki/bin/view/Geofluids RESEARCH FIELD Geophysical fluid dynamics in multiphase, multi-component, and multi-scale heterogeneous systems such as fluid (groundwater, oil, contaminant, CO2, Minneapolis, MN 09/2003-12/2004 Turner Postdoctoral Fellow, Univ. of Michigan, Ann Arbor, MI TENURE TRACK

Saar, Martin O.


Eur. Phys. J. Special Topics 166, 1114 (2009) c EDP Sciences, Springer-Verlag 2009  

E-Print Network (OSTI)

& Center for the Study of Complex Systems, University of Michigan, Ann Arbor, MI 48109, USA 3 Department on a vertically-vibrated incline can in fact climb up the surface, providing that the acceleration field is large and glycerol on plexiglass and silicon oil on fluorad-coated glass (see Table 1). a e-mail: philippe

Brunet, Philippe


Halloween Storm Simulations with the Space Weather Modeling Framework  

E-Print Network (OSTI)

of Michigan, Ann Arbor, MI 48109, USA In late October and early November 2003 a series of some of the most frequency communications, oil pipelines, and electricity have all become facts of life, however they all Modeling (CSEM) at the University of Michigan and its collaborators have recently built a Space Weather

De Zeeuw, Darren L.


I:\\Applications and Forms\\Rackham\\Flint Rackham Guest Application.doc University of Michigan-Flint  

E-Print Network (OSTI)

I:\\Applications and Forms\\Rackham\\Flint Rackham Guest Application.doc University of Michigan-Flint Office of Graduate Programs 251 Thompson Library Flint, MI 48502-1950 Telephone: (810) 762-3171 Fax: (810) 766-6789 THE UNIVERSITY OF MICHIGAN-FLINT Current Ann Arbor or Dearborn Student Application

Awtar, Shorya


IEEE TRANSACTIONS ON NUCLEAR SCIENCE, VOL. 54, NO. 4, AUGUST 2007 843 A Prototype Three-Dimensional Position Sensitive  

E-Print Network (OSTI)

for homeland security and nuclear non-proliferation applications. Mechanically cooled HPGe detectorsIEEE TRANSACTIONS ON NUCLEAR SCIENCE, VOL. 54, NO. 4, AUGUST 2007 843 A Prototype Three of Nuclear Engineering and Radi- ological Sciences, University of Michigan, Ann Arbor, MI 48109 USA (e

He, Zhong



E-Print Network (OSTI)

WEFTEC 2006, Dallas, Texas FULL SCALE EVALUATION OF THE UPFLOTM FILTER - A CATCHBASIN INSERT *** Hydro International, Portland, ME 04102, USA **** StormTrain, LLC. Ann Arbor MI USA ABSTRACT Stormwater of problem contaminants or heavy equipment. The control of runoff from relatively small critical source areas

Pitt, Robert E.


Graduate Research Assistant Albert J. Shih1  

E-Print Network (OSTI)

heat transfer solution of induction heat flux. Sensitivity to the grid spacing, thermocouple location@umich.edu Department of Mechanical Engineering, University of Michigan, Ann Arbor, MI 48109-2125 Inverse Heat Transfer Solution of the Heat Flux Due to Induction Heating The explicit finite difference formulation of an inverse

Shih, Albert J.


MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab



Women @ Energy: Anne Marie March | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Anne Marie March Anne Marie March Women @ Energy: Anne Marie March March 13, 2013 - 1:56pm Addthis Anne Marie March, Assistant Physicist, Argonne National Laboratory Anne Marie March, Assistant Physicist, Argonne National Laboratory Anne Marie March is part of a team trying to push the limits of ultrafast science at synchrotron light sources. As an assistant physicist in Argonne National Laboratory's Atomic, Molecular and Optical Physics Group, she is developing methods to efficiently use synchrotron x-ray pulses in stroboscopic measurements, capturing atoms and molecules in action after they have been excited with laser light. Anne Marie is implementing laser systems and detection schemes that will be used as part of the Short Pulse X-ray Facility at the lab's Advanced Photon Source.


DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP


Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)


Note: This page contains sample records for the topic "ann arbor mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state


Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mkinen; Jorma Tarhio



Statement of Anne M. Harrington, Deputy Administrator for Defense...  

NLE Websites -- All DOE Office Websites (Extended Search)

Speech Statement of Anne M. Harrington, Deputy Administrator for Defense Nuclear Nonproliferation to the Senate Armed Services Sub Committee On Emerging Threats and Capabilities...


Statement of Anne M. Harrington, Deputy Administrator for Defense...  

NLE Websites -- All DOE Office Websites (Extended Search)

Statement of Anne M. Harrington, Deputy Administrator for Defense Nuclear Nonproliferation to the Senate Armed Services Sub Committee On Emerging Threats and Capabilities...


Deputy Administrator Anne Harrington on Completion of BN-350...  

NLE Websites -- All DOE Office Websites (Extended Search)

Anne Harrington on Completion of BN-350 Fuel Shipments | National Nuclear Security Administration Our Mission Managing the Stockpile Preventing Proliferation Powering...


Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png


Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls


The Estimation of Wind Turbine Pitch Angle Based on ANN  

Science Conference Proceedings (OSTI)

Variable-speed and constant-frequency (VSCF) pitch-controlled wind turbine is believed to be superior to other types of wind turbine due to its features such as high efficiency and ideal starting and braking performance, Artificial Neural Networks (ANN) ... Keywords: VSCF, ANN, pitch angle, Pitch-controlled system

Yanping Liu; Shuhong Liu; Hongmei Guo; Huajun Wang



SCG stability enhancement using STATCOM based-ANN controller  

Science Conference Proceedings (OSTI)

Artificial neural network (ANN) control of static compensator (STATCOM) to improve the damping of power systems is presented. The proposed control strategy is applied on a STATCOM attached to a single machine-infinite bus (SMIB) and a multi-machine power ... Keywords: ANN control, power system control, static compensator, superconducting generator

R. A. Amer; G. A. Morsy; H. A. Yassin



,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


Anne Arundel County - Solar and Geothermal Equipment Property Tax Credits |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Anne Arundel County - Solar and Geothermal Equipment Property Tax Anne Arundel County - Solar and Geothermal Equipment Property Tax Credits Anne Arundel County - Solar and Geothermal Equipment Property Tax Credits < Back Eligibility Residential Savings Category Solar Buying & Making Electricity Heating & Cooling Commercial Heating & Cooling Heating Water Heating Maximum Rebate $2,500 Program Info Start Date 01/01/2007 (solar); 01/01/2009 (geothermal) State Maryland Program Type Property Tax Incentive Rebate Amount 50% of the cost of materials and installation less any federal and state grants and state solar energy tax credits Provider Office of Finance Anne Arundel County offers a one-time credit from county property taxes on residential dwellings that use solar and geothermal energy equipment for heating and cooling, and solar energy equipment for water heating and


Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.


Emerging Steel Technologies, HotEye in Steel Rolling and Process Metrix Mobile Laser Contouring System (LCS) for Converter Lining Thickness Monitoring  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

OG OG (tm) HotEye HotEye ® ® in Steel Rolling in Steel Rolling - - About the HotEye HotEye ® ® RSB System RSB System Presented by OG Technologies, Inc. DOE Web Cast January 29, 2009 OG Technologies, Inc., 4300 Varsity Drive, Suite C, Ann Arbor, MI 48108, 734-973-7500, 734-973-1966(fax) Contact@ogtechnologies.com, www.ogtechnologies.com OG (tm) OG Technologies, Inc. OG Technologies, Inc. Mission: To substantially enhance the productivity of our steel customers by significantly improving process control and quality resulting in dramatic reduction scrap, energy costs and emissions through the application of our patented and proprietary technologies. OG Technologies, Inc., 4300 Varsity Drive, Suite C, Ann Arbor, MI 48108, 734-973-7500, 734-973-1966(fax) Contact@ogtechnologies.com, www.ogtechnologies.com


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:


The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.



ANN-based GA for generating the sizing curve of stand-alone photovoltaic systems  

Science Conference Proceedings (OSTI)

Recent advances in artificial intelligence techniques have allowed the application of such technologies in real engineering problems. In this paper, an artificial neural network-based genetic algorithm (ANN-GA) model was developed for generating the ... Keywords: ANN, ANN-GA, GA, Prediction, Sizing curve, Stand-alone PV system

Adel Mellit



Kinship Theory: A Paradigm Shift  

E-Print Network (OSTI)

148. Ann Arbor: University of Michigan Press. Fine, A. 1994.Arbor: The University of Michigan Press. Gow, P. 1991. OfArbor: The University of Michigan Press. Hritier-Aug, F. ,

Read, Dwight W



DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co


DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP

Note: This page contains sample records for the topic "ann arbor mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;


TheAnne E. Gordon | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

TheAnne E. Gordon TheAnne E. Gordon About Us TheAnne E. Gordon - Associate CIO for Information Technology Planning, Architecture, & E-Government Ms. Gordon serves the Department of Energy as the Associate CIO for IT Planning, Architecture, and E-Government. She is responsible for the Department's IT Capital Planning, Enterprise Architecture, E-Government, Geospatial Sciences, Spectrum Management, and Records Management programs. Her primary responsibilities are to improve oversight and management of IT investments; maximize Departmental productivity through use of E-Government solutions; strengthen IT leadership and governance; and mature the Department's Enterprise Architecture. She serves as Chair on the Department's IT Council which is the primary governance body for IT and


Statement of Anne M. Harrington, Deputy Administrator for Defense Nuclear  

National Nuclear Security Administration (NNSA)

Congressional Testimony > Statement of Anne M. Congressional Testimony > Statement of Anne M. Harrington, Deputy Administrator ... Congressional Testimony Statement of Anne M. Harrington, Deputy Administrator for Defense Nuclear Nonproliferation to the Senate Armed Services Sub Committee On Emerging Threats and Capabilities May 10, 2011 Chairwoman Hagan, Ranking Member Portman, thank you for the opportunity to join you today to discuss the investments the President has requested for the National Nuclear Security Administration's Defense Nuclear Nonproliferation programs. But more importantly, thank you for your continued support of the National Nuclear Security Administration, and the 35,000 men and women working across the enterprise to keep our country safe, protect our allies, and enhance global security. We could not do


Statement of Anne M. Harrington, Deputy Administrator for Defense Nuclear  

National Nuclear Security Administration (NNSA)

Speeches > Statement of Anne M. Harrington, Deputy Speeches > Statement of Anne M. Harrington, Deputy Administrator ... Speech Statement of Anne M. Harrington, Deputy Administrator for Defense Nuclear Nonproliferation to the Senate Armed Services Sub Committee On Emerging Threats and Capabilities May 10, 2011 Chairwoman Hagan, Ranking Member Portman, thank you for the opportunity to join you today to discuss the investments the President has requested for the National Nuclear Security Administration's Defense Nuclear Nonproliferation programs. But more importantly, thank you for your continued support of the National Nuclear Security Administration, and the 35,000 men and women working across the enterprise to keep our country safe, protect our allies, and enhance global security. We could not do this work without strong, bipartisan support and engaged leadership from


Anne Arundel County - High Performance Dwelling Property Tax Credit |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Anne Arundel County - High Performance Dwelling Property Tax Credit Anne Arundel County - High Performance Dwelling Property Tax Credit Anne Arundel County - High Performance Dwelling Property Tax Credit < Back Eligibility Residential Savings Category Heating & Cooling Home Weatherization Construction Commercial Weatherization Commercial Heating & Cooling Design & Remodeling Bioenergy Solar Lighting Windows, Doors, & Skylights Heating Buying & Making Electricity Water Water Heating Wind Maximum Rebate LEED or NGBS Silver: $1,000 LEED or NGBS Gold: $2,000 LEED Platinum or NGBS Emerald: $3,000 Program Info Start Date 07/01/2010 State Maryland Program Type Property Tax Incentive Rebate Amount LEED or NGBS Silver: 40% of property taxes for 5 years LEED or NGBS Gold: 60% of real property taxes for 5 years LEED Platinum or NGBS Emerald: 80% of real property taxes for 5 years


Contesting an Illusion of Equity: A Textual Analysis of Friend of the Court Briefs in the University of Michigans Affirmative Action Cases  

E-Print Network (OSTI)

action at the University of Michigan (pp. 97-188).Ann Arbor: University of Michigan Press. Harris, C. (1995).action at the University of Michigan (pp. 17-59). Ann Arbor,

Ledesma, Mara C.



The Impact of Emergency Physician Turnover on Planning for Prospective Clinical Trials  

E-Print Network (OSTI)

MD* * University of Michigan Medical School, Department ofEmergency Medicine, Ann Arbor, Michigan Universityof Michigan Medical School, Department of Neurology, Ann



FusEdWeb | Fusion Education  

NLE Websites -- All DOE Office Websites (Extended Search)

(UIUC) - Nuclear Engineering University of Maryland, Institute for Plasma Research University of Michigan, Ann Arbor - Nuclear Eng. and Radiological Sciences...


Appendix 53 Status Review for Westslope Cutthroat Trout in the United States  

E-Print Network (OSTI)

, February 1987. [3] Roland W. Jeppson. Analysis of Flow in Pipe Networks. Ann Arbor Science, 1976. [4] Peter


Estimation of global solar radiation using ANN over Turkey  

Science Conference Proceedings (OSTI)

The main objective of the present study is to develop an artificial neural network (ANN) model based on multi-nonlinear regression (MNLR) method for estimating the monthly mean daily sum global solar radiation at any place of Turkey. For this purpose, ... Keywords: Artificial neural networks, Estimation, Global solar radiation, Stepwise multi-nonlinear regression, Turkey

Muammer Ozgoren; Mehmet Bilgili; Besir Sahin



RESUME (updated to Sept. 2010) MARYE ANNE FOX  

E-Print Network (OSTI)

- Splitting System," Marye Anne Fox and James K. Whitesell, Proc. Solar Photochem. Res. Conf. 2010, 32, 132, Conferences on Photochemical Conversion and Storage of Solar Energy 1991: International Scientific Planning Board, "The Molecular World," Educational Film Center, Public Broadcasting System 1989: Panelist

Wang, Deli


Anne universitaire 2013-2014 Soutien linguistique en langue franaise  

E-Print Network (OSTI)

Année universitaire 2013-2014 Soutien linguistique en langue française Stage intensif 2013 Cours du heures. Test linguistique : le 3 octobre 2013 Début des cours : semaine du 7 octobre 2013 Fin des cours mardi ou le mercredi ou le jeudi (selon le niveau) de 18 heures à 20 h 00. Test linguistique : le 6

Herrmann, Samuel


Applying ANNs into constructing the CLV discriminant model  

Science Conference Proceedings (OSTI)

Reviewing the marketing environment, the enterprises had met a competitive pressure due to there are many customers with different characteristics. How to achieve the potential customer retention and maintain their core competition will be an important ... Keywords: artificial neural networks (ANNs), customer lifetime value (CLV), discriminant analysis

Ching-Cheng Shen; Kun-Lin Hsieh



Using GA-ANN algorithm to predicate coal bump energy  

Science Conference Proceedings (OSTI)

A GA-ANN network was constructed for preidcating coal bump energy, based on the 300 training samples form simulated results with PFC2D software for different coal particle stiffness. It was tested that the average relative error of fitted-output value ... Keywords: artificial neural network, coal bump, energy, genetic algorithm, predication

Yunliang Tan; Tongbin Zhao; Zhigang Zhao



DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:


DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on


REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units


Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper



Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani


Note: This page contains sample records for the topic "ann arbor mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel



MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Queen Anne's County, Maryland: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Anne's County, Maryland: Energy Resources Anne's County, Maryland: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 39.0263572°, -76.1319953° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.0263572,"lon":-76.1319953,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Anne Arundel County, Maryland: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Anne Arundel County, Maryland: Energy Resources Anne Arundel County, Maryland: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 38.9530109°, -76.5488232° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":38.9530109,"lon":-76.5488232,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)



A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)



BOOK REVIEWS Firestorm: Dr. James E. McDonald's Fight for UFO Science by Ann Druffel.  

E-Print Network (OSTI)

BOOK REVIEWS Firestorm: Dr. James E. McDonald's Fight for UFO Science by Ann Druffel. Columbus, NC book review: my slowly evolving views on UFOs, if they are of interest, are described in JSE 15, p. 385 Ann Druffel's fine biography. From her book, I have learned for the first time that McDonald's suicide



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

GEORGIA GEORGIA SOUTHEASTERN POWER ADMIN POC Ann Craft Telephone (706) 213-3823 Email annc@sepa.doe.gov ADMINISTATIVE / WASTE / REMEDIATION Office Administrative Services 561110 Facilities Support Services 561210 Security Systems Services (except Locksmiths) 561621 Locksmiths 561622 Exterminating and Pest Control Services 561710 Janitorial Services 561720 Landscaping Services 561730 Other Nonhazardous Waste Treatment and Disposal 562219 Remediation Services 562910 CONSTRUCTION Industrial Building Construction 236210 Commercial and Institutional Building Construction 236220 Water and Sewer Line and Related Structures Construction 237110 Power and Communication Line and Related Structures Construction 237130 Other Heavy and Civil Engineering Construction 237990 Other Foundation, Structure, and Building Exterior Contractors


Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.



FIA-12-0069 - In the Matter of Mary Ann Parker | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

69 - In the Matter of Mary Ann Parker 69 - In the Matter of Mary Ann Parker FIA-12-0069 - In the Matter of Mary Ann Parker On November 16, 2012, the Office of Hearings and Appeals (OHA) issued a decision denying an appeal (Appeal) from a Privacy Act determination issued by the Department of Energy's Oak Ridge Office (ORO). Specifically, the Appellant, Mary Ann Parker, contested the adequacy of the ORO's search in response to her Privacy Act request, contending that additional records should have been provided and that records from a plant that she previously worked at, the Pinellas Plant, should have been sent to the Albuquerque Office. The OHA reviewed the ORO's description of its search and determined that the ORO conducted an adequate search for responsive documents. Moreover, the OHA informed the Appellant that her records that


Cours de premire anne de Psychologie dans le cadre du BA pluridisciplinaire Linguistique-Psychologie  

E-Print Network (OSTI)

Cours de première année de Psychologie dans le cadre du BA pluridisciplinaire Linguistique-Psychologie 2012-2013 Les étudiants de linguistique (branche A) choisissant comme branche B Psychologie ­ option

Loewith, Robbie


CONTACT: Ann Guy, Energy Solutions FOR IMMEDIATE RELEASE Tel. 510/4824420  

E-Print Network (OSTI)

CONTACT: Ann Guy, Energy Solutions FOR IMMEDIATE RELEASE Tel. 510/4824420 Email: aguy@energysolution.com Energy Technology Assistance Program Exceeds ARRA Goals Oakland, CA September 18, 2012. The California Energy Commission's statewide municipal energy efficiency program


In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma



OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown



NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk


Microsoft Word - AnnOpsSumTM2008.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

21-DO 21-DO October 2008 Accelerator/Experiment Operations - FY 2008 S. Brice, M. Buehler, M. Casarsa, R. Coleman, D. Denisov, G. Ginther, S. Grinstein, A. Habig, S. Holmes, J. Hylen, W. Kissel, W. Lee, T. Nakaya, R. Plunkett, E. Ramberg, P. Schlabach, R. Van de Water, M. O. Wascko, D. Wood Edited by J. A. Appel This Technical Memorandum (TM) summarizes the Fermilab accelerator and accelerator experiment operations for FY 2008. It is one of a series of annual publications intended to gather information in one place. In this case, the information concerns the FY 2008 Run II at the Tevatron Collider, MINOS using the Main Injector Neutrino Beam (NuMI), the MiniBooNE and SciBooNE experiments running in the Booster Neutrino Beam (BNB), and the Meson Test Beam



NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....


miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA


Vessel Design and Fabrication Technology for Stationary High-Pressure Hydrogen Storage - DOE Hydrogen and Fuel Cells Program FY 2012 Annual Progress Report  

NLE Websites -- All DOE Office Websites (Extended Search)

7 7 FY 2012 Annual Progress Report DOE Hydrogen and Fuel Cells Program Zhili Feng (Primary Contact), Wei Zhang, John Wang and Fei Ren Oak Ridge National Laboratory (ORNL) 1 Bethel Valley Rd, PO Box 2008, MS 6095 Oak Ridge, TN 37831 Phone: (865) 576-3797 Email: fengz@ornl.gov DOE Manager HQ: Sara Dillich Phone: (202) 586-7925 Email: Sara.Dillich@ee.doe.gov Subcontractors: * Global Engineering and Technology LLC, Camas, WA * Ben C. Gerwick Inc., Oakland, CA * MegaStir Technologies LLC, Provo, UT * University of Michigan, Ann Arbor, MI Project Start Date: October 1, 2010 Project End Date: Project continuation and direction

Note: This page contains sample records for the topic "ann arbor mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Applying Multi-temporal Satellite Imageries to Estimate Chlorophyll-a Concentration in Feitsui Reservoir Using ANNs  

Science Conference Proceedings (OSTI)

The artificial neural networks (ANNs) were adopted to improve the monitoring capability of water quality in a reservoir using multi-temporal satellite imageries. Simultaneous measurement of chlorophyll-a (Chl-a) concentration along the Feitsui Reservoir, ... Keywords: Feitsui Reservoir, artificial neural networks (ANNs), chlorophyll-a (Chl-a), multi-temporal satellite imagery

Hsun-Hsin Hsu; Li Chen; Chang-Huan Kou; Hui-Chung Yeh; Tai-Sheng Wang



VBB-0038 - In the Matter of Ann Johndro-Collins | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

8 - In the Matter of Ann Johndro-Collins 8 - In the Matter of Ann Johndro-Collins VBB-0038 - In the Matter of Ann Johndro-Collins This letter concerns the complaint of reprisal that you submitted to the Department of Energy under 10 C.F.R. Part 708. You have filed a petition for Secretarial review of the appeal decision issued to you on March 28, 2000. The Part 708 regulations applicable to the petition provide that the Secretary will reverse or revise an appeal decision by the Director of the Office of Hearings and Appeals only under extraordinary circumstances. 10 C.F.R. § 708.35(d). After fully evaluating all the issues that you raised in your filing dated May 16, 2000, I have determined that you have not shown that extraordinary circumstances warranting Secretarial review exist in this case. No modification to the appeal decision by the OHA Director is


ANN-Based Short-Term Load Forecasting in Electricity Markets  

E-Print Network (OSTI)

AbstractThis paper proposes an Artificial Neural Network (ANN)-based short-term load forecasting technique that considers electricity price as one of the main characteristics of the system load, demonstrating the importance of considering pricing when predicting loading in todays electricity markets. Historical load data from the Ontario Hydro system as well as pricing information from the neighboring system are used for testing, showing the good performance of the proposed method. Keywords: Short-term load forecasting, electricity markets, spot prices, Artificial Neural Networks (ANN)

Hong Chen; Claudio A. Caizares; Ajit Singh



Research on Fault Detection and Diagnosis of Scrolling Chiller with ANN  

E-Print Network (OSTI)

At first the basic research about FDD is summarized, and a detection model based on ANN is initially set up. The paper presents experiments that simulate seven faults, including change flow rate of chilled water, cooling water and refrigerant, charge non-condense gas, shift temperature of cooling water and alter outside cold load. A set of characteristic parameters are defined in order to differentiate these faults and clarify the reasons. Finally, an FDD tool is programmed based on ANN with experimental results which form a training stylebook and test stylebook.

Zhou, Y.; Zheng, J.; Liu, Z.; Yang, C.; Peng, P.



Cobalt-Free Nickel-Base Wrought Superalloys - TMS  

Science Conference Proceedings (OSTI)

COBALT-FREE NICKEL-BASE WROUGHT SUPERALLOYS. E. P. Whelan. Climax Molybdenum Company of. Ann Arbor, Michigan. Michigan. A study has been...


Fermi National Accelerator Laboratory FY 2008  

NLE Websites -- All DOE Office Websites (Extended Search)

University, East Lansing University of Michigan, Ann Arbor Wayne State University, Detroit Minnesota Saint Mary's University of Minnesota University of Minnesota, Minneapolis...


Ultimate Biofuels LLC | Open Energy Information  

Open Energy Info (EERE)

Ultimate Biofuels LLC Jump to: navigation, search Name Ultimate Biofuels LLC Place Ann Arbor, Michigan Zip 48108 Product Plans to develop sweet sorghum based ethanol plants....


Energy Options Solutions | Open Energy Information  

Open Energy Info (EERE)

Energy Options & Solutions Place Ann Arbor, Michigan Zip 48103 Product Michigan-based alternative energy consultant. References Energy Options & Solutions1 LinkedIn...


CX-000204: Categorical Exclusion Determination | Department of...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Categorical Exclusion Determination Manufacturing Industrial Development for the Alternative Energy Systems CX(s) Applied: A9, A11 Date: 11232009 Location(s): Ann Arbor,...


Convergence of the restricted NelderMead algorithm in two ...  

E-Print Network (OSTI)

Apr 2, 2011 ... ?Department of Mathematics, University of Michigan, Ann Arbor, Michigan 48109 (lagarias@umich.edu). The work of this author is partially...


Your Project Title Here: Summary  

NLE Websites -- All DOE Office Websites (Extended Search)

are participating in this project:. Lawton Elementary, a public school in Ann Arbor, Michigan. Mr. Schad's self-contained class of 25 fifth graders will participate. This project...


1994 - CECM - Simon Fraser University  

E-Print Network (OSTI)

Jan 18, 2001 ... August 16th ``Ways of thinking about duality,'' Student Session, XV International Mathematical Programming Symposium, Ann Arbor, Michigan.


A Tabu Search Algorithm for Partitioning  

E-Print Network (OSTI)

versity of Michigan Press, Ann Arbor. JUNG, J. S. and YUM, B. J. (1996) Construction of exact D-optimal designs by tabu search, Computational Statistics ...


The Radius of Metric Regularity - CECM  

E-Print Network (OSTI)

Ann Arbor, Michigan 48107-8604,. ald@ams.org. A. S. Lewis. Department of Combinatorics and Optimization. University of Waterloo, Waterloo, Ontario, Canada...



E-Print Network (OSTI)

Mathematical Programming, State of the Art 1994, pages 93{101, Ann Arbor, 1994. University. of Michigan. [10] C. Helmberg, F. Rendl, R.J. Vanderbei, and H.


University of Michigan | Open Energy Information  

Open Energy Info (EERE)

University of Michigan Jump to: navigation, search Name University of Michigan Place Ann Arbor, Michigan Zip 48109 Product Offers research across all disciplines. References...


TMS Board of Directors: Tresa Pollock  

Science Conference Proceedings (OSTI)

Tresa M. Pollock is professor of Materials Science and Engineering at the University of Michigan in Ann Arbor, Michigan. She graduated with a B.S. in...



Science Conference Proceedings (OSTI)

August 19-22, 2007. University of Michigan. Ann Arbor, Michigan USA. CALL FOR PAPERS. Abstract Deadline: October 2, 2006. Sponsored by. Hosted by.


Three Programs of Choral Music.  

E-Print Network (OSTI)

??The dissertation consisted of three conducting recitals. Recital 1: November 20th, 2012, Stamps Auditorium, Ann Arbor, Michigan. Ensemble: University of Michigan Arts Chorale. Program: To (more)

Case, IV, George Edward



The mechanics of race : the discursive production of Detroit's landscape of difference  

E-Print Network (OSTI)

Library, University of Michigan. George Edwards Papers,Library, University of Michigan. Mayors Papers, BurtonAnn Arbor: University of Michigan Press. Duggan, Lisa. 2003.

Kinney, Rebecca J.


Note: This page contains sample records for the topic "ann arbor mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Elephantiasis Nostras Verrucosa on the buttocks and sacrum of two immobile men  

E-Print Network (OSTI)

Dermatology, Henry Ford Health System, Detroit, Michigan 2.University of Michigan Medical School,University of Michigan Health System, Ann Arbor, Michigan 3.

Setyadi, Hedy G; Iacco, Megan R; Shwayder, Tor A; Ormsby, Adrian



Nobel Prize in Physics 1960  

NLE Websites -- All DOE Office Websites (Extended Search)

of California at Berkeley, Berkeley, California, USA Button AA - University of Michigan, Ann Arbor, Michigan, USA Button WA - University of Michigan & Brookhaven National...


Selling Random Energy  

E-Print Network (OSTI)

1.1 Renewable Power Generation . . . . . . . . . . . . . . .with significant wind power generation, IEEE Trans. Powerstorage for electric power generation, Ann Arbor, Michigan:

Bitar, Eilyan Yamen



Nonproliferation through delegation  

E-Print Network (OSTI)

C. Frank. 1969. Nonproliferation Negotiations, 1961-1968. InCooperation on Nonproliferation Export Controls. Ann Arbor,to the nuclear nonproliferation regime. International

Brown, Robert Louis




NLE Websites -- All DOE Office Websites (Extended Search)

Space Sciences University of Michigan Ann Arbor, Michigan Introduction Carbonaceous aerosols can act as cloud condensation nuclei and thereby change the optical properties of...


Solar | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Home Certification* (100) * Energy Star Rating (100) * Geothermal heat pumps (50) * Solar-energy systems (50) * Wind turbines (50) July 12, 2013 City of Ann Arbor - Green...


ANN and ANFIS models for performance evaluation of a vertical ground source heat pump system  

Science Conference Proceedings (OSTI)

The aim of this study is to demonstrate the comparison of an artificial neural network (ANN) and an adaptive neuro-fuzzy inference system (ANFIS) for the prediction performance of a vertical ground source heat pump (VGSHP) system. The VGSHP system using ... Keywords: Adaptive neuro-fuzzy inference system, Coefficient of performance, Ground source heat pump, Membership functions, Vertical heat exchanger

Hikmet Esen; Mustafa Inalli



ANN-based Short-Term Load Forecasting in Electricity Markets  

E-Print Network (OSTI)

ANN-based Short-Term Load Forecasting in Electricity Markets Hong Chen Claudio A. Ca~nizares Ajit forecasting technique that considers electricity price as one of the main characteristics of the system load. B. Makram, "A Hybrid Wavelet- Kalman Filter Method for Load Forecasting," Electric Power Systems

Cañizares, Claudio A.


Combining stochastic dynamic programming (SDP) and artificial neural networks (ANN) in optimal reservoir operation  

Science Conference Proceedings (OSTI)

After development of any optimization model a post-optimization simulation is needed for two purposes: 1) Checking and evaluating of system performance and 2) Computing performance criteria. The common rule is developing a simulation model in the form ... Keywords: ANN, SDP, optimal reservoir operation

Omid Bozorg Haddad; Saeed Alimohammadi



845Ann. For. Sci. 62 (2005) 845851 INRA, EDP Sciences, 2005  

E-Print Network (OSTI)

article Estimation of the biomass stock of trees in Sweden: comparison of biomass equations and age-dependent biomass expansion factors Anneli JALKANENa, Raisa M?KIP??b*, Göran ST?HLc, Aleksi LEHTONENb, Hans of biomass in national greenhouse gas inventories are evaluated. The alternative methods employed to obtain

Recanati, Catherine


miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li



Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)



Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)




E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.


Paraffin Polydispersity Facilitates Mechanical Gelation Kristofer Paso,  

E-Print Network (OSTI)

climates or subsea producing fields. When the temperature of a crude oil or gas condensate fluid drops. Sastry, and H. Scott Fogler*, Department of Chemical Engineering, University of Michigan, Ann Arbor, Michigan 48109, and Department of Mechanical Engineering, University of Michigan, Ann Arbor, Michigan 48109

Sastry, Ann Marie


User:NCSCJustin | Open Energy Information  

Open Energy Info (EERE)

NCSCJustin NCSCJustin Jump to: navigation, search Name Justin Barnes Edits 923 Justin Barnes is a Policy Analyst at the North Carolina Solar Center (NCSC), where he works on the Database of State Incentives for Renewables and Efficiency (DSIRE) and leads the NCSC's efforts under the Solar America Communities Outreach Partnership. Justin has a B.S. in Geography from the University of Oklahoma and an M.S. in Environmental Policy from Michigan Technological University in Houghton, MI. Justin's past research has focused on local opposition to wind energy facilities and barriers to the commercialization of lignocellulosic ethanol. Upon completing his graduate education, he worked briefly for Environment Michigan and Clean Water Action in Ann Arbor, MI. He joined the NCSC in September 2007.


Ford/BASF SE/UM Activities in Support of the Hydrogen Storage Engineering Center of Excellence - DOE Hydrogen and Fuel Cells Program FY 2012 Annual Progress Report  

NLE Websites -- All DOE Office Websites (Extended Search)

51 51 FY 2012 Annual Progress Report DOE Hydrogen and Fuel Cells Program Michael Veenstra (Primary Contact, Ford), Andrea Sudik (Ford), Donald Siegel (UM), Justin Purewal (UM), Chunchuan Xu (UM), Yang Ming (UM), Manuela Gaab (BASF SE), Stefan Maurer (BASF SE), Ulrich Müller (BASF SE), Jun Yang (Ford) Ford Motor Company 2101 Village Road Dearborn, MI 48121 Phone: (313) 322-3148 Email: mveenstr@ford.com DOE Managers HQ: Ned Stetson Phone: (202) 586-9995 Email: Ned.Stetson@ee.doe.gov GO: Jesse Adams Phone: (720) 356-1421 Email: Jesse.Adams@go.doe.gov Contract Number: DE-FC36-GO19002 Subcontractors: * University of Michigan, Ann Arbor, MI * BASF SE, Ludwigshafen, Germany Project Start Date: February 1, 2009


Categorical Exclusion Determination Form Proposed Action Title: (0675-1534) GE Global Research -  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

34) GE Global Research - 34) GE Global Research - Control Enabling Solutions with Ultrathin Strain and Temperature Sensor System for Reduced Battery Life Cycle Cost Program or Field Office: Advanced Research Projects Agency - Energy LocationCs) CCity/County/State): Niskayuna, NY; Ann Arbor, MI; Dearborn, MI Proposed Action Description: Funding will support efforts to develop a a novel sensor system with supporting multi-physics models to increase battery cell lifetime and extend battery range for electric vehicle applications. Proposed work will consist of: (1) development and fabrication a novel multi-measurand sensor capable of measuring strain and temperature across multiple battery cells; (2) performance of strain and temperature testing and development and validation of multi-physics models; (3)


File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload


MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.


Note: This page contains sample records for the topic "ann arbor mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)


H. KAYSER. -Ueber den Einfluss der Temperatur auf Stimmgabeln (Influence de la temprature sur les diapasons); Ann. der Physik und Chemie, nouvelle srie,  

E-Print Network (OSTI)

les diapasons); Ann. der Physik und Chemie, nouvelle série, t. VIII, p. 444; I879. Le nombre des'oxygène liquéfié, p. 27 1 . Annalen der Physik und Chemie. Nouvelle série. - Tome IX. - N° 2. - Année 1880. W

Paris-Sud XI, Université de


Books and book chapters (last 10 years only) 16. Clark, E. Ann. 2009. Ch. 5 (invited). Forages in Organic Crop-Livestock Systems. pp. 85-  

E-Print Network (OSTI)

Books and book chapters (last 10 years only) 16. Clark, E. Ann. 2009. Ch. 5 (invited). Forages, Agriculture, and Engineering Service, Cooperative Extension, Ithaca, N.Y. (Peer-reviewed book chapter) 12 Service, Cooperative Extension, Ithaca, N.Y. (Peer-reviewed book chapter) 11. Clark, E. Ann. 2004 . GM

Clark, E. Ann


Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab



Case Study of Building-Integrated Photovoltaic Systems at University of Wisconsin's Mary Ann Cofrin Hall  

Science Conference Proceedings (OSTI)

This report is a case study of two state-of-the-art building-integrated photovoltaic (BIPV) systems located at Mary Ann Cofrin Hall on the campus of the University of Wisconsin in Green Bay, Wisconsin. With a combined capacity of roughly 18.2 kWac, the two systems produce renewable pollution-free energy, help to support the building's electrical load, and reduce loading on the Wisconsin Public Service (WPS) distribution system serving the campus. The photovoltaic (PV) installation was a joint effort of W...



A woman's voice experiments of genre in the poetry of Anne Killigrew  

E-Print Network (OSTI)

This thesis deals with the poetry of Anne Killigrew. It also discusses her literary reputation, both historical and current. Killigrew poetry is examined in four different areas, showing her experiments in genre, form, and voice. pessimistic poetry. This thesis also shows how Killigrew used the literary conventions of her period. The argument is based both on new historicism and close readings of the individual poems. The literary milieu is established by discussions of both traditional literary interpretation, specifically those of John Dryden, and the act of manuscript circulation.

Rex, Michael Charles



Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A



Improvement of Auto-Regressive Integrated Moving Average models using Fuzzy logic and Artificial Neural Networks (ANNs)  

Science Conference Proceedings (OSTI)

Time series forecasting is an active research area that has drawn considerable attention for applications in a variety of areas. Auto-Regressive Integrated Moving Average (ARIMA) models are one of the most important time series models used in financial ... Keywords: Artificial Neural Networks (ANNs), Auto-Regressive Integrated Moving Average (ARIMA), Exchange rate, Financial markets, Fuzzy logic, Time series forecasting

Mehdi Khashei; Mehdi Bijari; Gholam Ali Raissi Ardali



Real-time estimation of olive oil quality parameters: a combined approach based on ANNs and machine vision  

Science Conference Proceedings (OSTI)

The present work describes a combined approach based on Artificial Neural Networks and Machine Vision for the real-time estimation of some qualitative olive oil parameters. The proposed methodology proves to be a useful tool for the real-time estimation ... Keywords: ANNs, acidity, machine vision, olive oil, peroxides, ripeness, sanitation condition

Monica Carfagni; Marco Daou; Rocco Furferi



Introducing ROC curves as error measure functions: a new approach to train ANN-based biomedical data classifiers  

Science Conference Proceedings (OSTI)

This paper explores the usage of the area (Az) under the Receiver Operating Characteristic (ROC) curve as error measure to guide the training process to build machine learning ANN-based classifiers for biomedical data analysis. Error measures (like root ... Keywords: ROC curves, artificial neural networks, biomedical data, machine learning classifiers

Ral Ramos-Polln; Miguel ngel Guevara-Lpez; Eugnio Oliveira



Degradation of monoethanolamine in soil Anne W. Ndegwa, Ron C.K. Wong, Angus Chu, Laurence R. Bentley, and  

E-Print Network (OSTI)

of Geology and Geophysics, The University of Calgary, Al- berta, AB T2N 1N4, Canada. S.R.D. Lunn. Imperial137 Degradation of monoethanolamine in soil Anne W. Ndegwa, Ron C.K. Wong, Angus Chu, Laurence R. Bentley, and Stuart R.D. Lunn Abstract: Monoethanolamines (MEA) are commonly used by the natural gas


Anne Chaka  

Science Conference Proceedings (OSTI)

... normally accessible to first-principles quantum mechanics alone. ... Chair, Division of Computational Physics of the American Physical Society, the ...



Ann Virts  

Science Conference Proceedings (OSTI)

... System (NIMS) IS-00800.b An Introduction National Response Framework IS ... Present Started in the Masters program for Emergency Operations and ...



Sallaska, Anne  

Science Conference Proceedings (OSTI)

... Commission Joint Research Center and the International Atomic Energy Agency to ... BA Physics, University of California, Berkeley, 2002. Contact. ...



Anne Pellegrino  

NLE Websites -- All DOE Office Websites (Extended Search)

Pellegrino Mgr., Energy Efficiency Policy Section Dept. of Industry, Tourism & Resources (DITR) Australian Government This speaker was a visiting speaker who delivered a talk or...


Powering Up the Women's Procurement Program Presenters: Ann Sullivan Denise Farris  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Powering Up the Women's Powering Up the Women's Procurement Program Presenters: Ann Sullivan Denise Farris Madison Services Group, Inc. Farris Law Firm LLC WIPP Government Relations WIPP Member 1156 15 th Street, NW, Suite 1100 1600 Genessee, Suite 433 Washington, DC 20005 Kansas City, MO 64106 Tel: 202 626 8528 Tel: 816 842 0800 Fax: 202 872 8543 Fax: 816 842 0877 Email: asullivan@madisonservicesgroup.com Email: dfarris@farrislawfirm.com 1 A Brief History of the WOSB Program « In 2000, Public Law 106-554 established a women's procurement program to assist the government in meeting its 5% women-owned small business (WOSB) contracting goal. « In 2007, a rule was proposed by the administration which included


Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester



T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab



LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance


PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos


Note: This page contains sample records for the topic "ann arbor mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Linguistique et volution Anne Reboul, L2C2, CNRS UMR-5230, Institut des Sciences Cognitives, 67 bd Pinel,  

E-Print Network (OSTI)

Linguistique et évolution Anne Reboul, L2C2, CNRS UMR-5230, Institut des Sciences Cognitives, 67 bd Pinel, 69675 Bron cedex 1. Introduction En linguistique, la question de lévolution est, bien évidemment responsabilité des éventuelles erreurs restantes. 1 Le 8 mars 1868, la Société de Linguistique de Paris interdit

Institut des Sciences Cognitives, CNRS


Microsoft Word - AnnOpsSumTM2012_FINAL.docx  

NLE Websites -- All DOE Office Websites (Extended Search)

51-DI 51-DI December 2012 Accelerator/Experiment Operations - FY 2012 R. Dixon, M. Geelhoed, S. Hahn, D. Harris, S. Henderson, K. McFarland, C. Moore, B. Pahlka, R. Plunkett, A. K. Soha, R. Van de Water Edited by S. Geer and H. Ramamoorthi This Technical Memorandum (TM) summarizes the Fermilab accelerator and accelerator experiment operations for FY 2012. It is one of a series of annual publications intended to gather information in one place. In this case, the information concerns the FY 2012 MINOS and MINERνA experiments using the Main Injector Neutrino Beam (NuMI), the MiniBooNE experiment running in the Booster Neutrino Beam (BNB), and the Meson Test Beam (MTest) activities in the 120 GeV external Switchyard beam (SY120). Each section was prepared by the relevant authors, and was somewhat edited for


Improving Posterior Based Confidence Measures in Hybrid HMM/ANN Speech Recognition Systems  

E-Print Network (OSTI)

. In this paper, building upon previous work by others [7], we define and investigate a set of confidence measures based on hybrid Hidden Markov Model/Artificial Neural Network (HMM/ANN) acoustic models. All these measures are using the neural network to estimate the local phone posterior probabilities, which are then combined and normalized in different ways. Experimental results will indeed show that the use of an appropriate duration normalization is very important to obtain good estimates of the phone and word confidences. The different measures are evaluated at the phone and word levels on both an isolated word task (PHONEBOOK) and a continuous speech recognition task (BREF). It will be shown that one of those confidence measures is well suited for utterance verification, and that (as one could expect) confidence measures at the word level perform better than those at the phone level. Finally, using the resulting approach on PHONEBOOK to rescore the N-best list is shown to yield a...

Martigny Valais Suisse; Giulia Bernardis; Herve Bourlard



Microsoft Word - 2007hsn-infocom-paper-lehman-etal.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

2 2 Control Plane Architecture and Design Considerations for Multi-Service, Multi-Layer, Multi- Domain Hybrid Networks Tom Lehman 1 , Xi Yang 1 , Chin P. Guok 2 , Nageswara S. V. Rao 3 , Andy Lake 4 , John Vollbrecht 4 , Nasir Ghani 5 1 Information Sciences Institute East, University of Southern California, Arlington, VA 22203, USA, Email: {tlehman,xyang}@isi.edu 2 Network Engineering Services Group, ESnet, Berkeley, CA 94720, USA, Email: chin@es.net 3 Computer Science and Mathematics Division, Oak Ridge National Laboratory, Oak Ridge, TN 37831, USA, Email: raons@ornl.edu 4 University Corporation for Advanced Internet Development, Internet2, Ann Arbor, MI 48104, USA, Email: {jrv,alake}@internet2.edu 5 Department of Electrical and Computer Engineering, Tennessee Technological University, Cookville, TN 38505, USA,



NLE Websites -- All DOE Office Websites (Extended Search)

Design of Metal Organic Design of Metal Organic Frameworks for the Separation of Carbon Dioxide From Flue Gas and Gasification Streams John J. Low UOP LLC, 50 E. Algonquin Rd, Des Plaines, IL 60017-5016, (847) 391-3046, John.Low@uop.com Randall Q. Snurr Northwestern University, Department of Chemical & Biological Engineering, Evanston, IL 60208 (847) 467-2977, snurr@northwestern.edu Omar Yaghi and Adam Matzger University of Michigan, 2815 DOW Laboratory, Department of Chemistry, Ann Arbor, MI 48109-1055, (734) 615-2146, oyaghi@umich.edu Project Objectives Develop a low cost novel adsorbent to remove CO 2 from flue gas and gasification streams -High selectivity -High adsorption capacity -Good adsorption/desorption rates -Adsorbent has low enough binding energy for regenerability Scope of Work


On-board Diagnostics  

NLE Websites -- All DOE Office Websites (Extended Search)

On-board On-board Diagnostics for Big Data J. Zurawski ⇤ , S. Balasubramanian ⇤ , A. Brown ‡ , E. Kissel † , A. Lake ⇤ , M. Swany † , B. Tierney ⇤ and M. Zekauskas ‡ ⇤ Energy Sciences Network (ESnet) Lawrence Berkeley National Laboratory, Berkeley, CA, USA Email: {zurawski, sowmya, andy, bltierney}@es.net † Indiana University School of Informatics and Computing, Bloomington, IN, USA Email: {ezkissel, swany}@indiana.edu ‡ Internet2 Ann Arbor, MI, USA Email: {aaron, matt}@internet2.edu Abstract-Big science data necessitates the requirement to incorporate state-of-the-art technologies and processes into science workflows. When transferring "big data", the network infrastructure connects sites for storage, analysis and data transfer. A component that is often overlooked within the network is a robust measurement and testing infrastructure that



Office of Scientific and Technical Information (OSTI)

AIR SEPARATION BY PRESSURE SWING ADSORPTION USING AIR SEPARATION BY PRESSURE SWING ADSORPTION USING SUPERIOR ADSORBENTS DE-FG26-98FT40115 FINAL TECHNICAL REPORT September 1, 1998 - August 31, 2001 Submitted to Dr. Kamalendu Das U.S. Department of Energy Federal Energy Technology Center 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507-0880 And FETC AAD Document Center Federal Energy Technology Center U.S. Department of Energy P. O. Box 10940 Pittsburgh, PA 15236-0940 By Ralph T. Yang Authors: Nick D. Hutson, Stefan C. Zajic, Salil U. Rege and Ralph T. Yang Department of Chemical Engineering University of Michigan Ann Arbor, MI 48109-2136 2 Table of Contents Page Disclaimer 3 Executive Summary 4 Chapter 1. Adsorption Properties and Structures of Pure Ag-Faujasites 7 Chapter 2. Mixed Ag-Li-X Zeolites and Their PSA Air Separation 48


Ray Osborn - Argonne National Laboratories, Materials Sicence Division  

NLE Websites -- All DOE Office Websites (Extended Search)

NXRS > Ray Osborn NXRS > Ray Osborn Ray Osborn Raymond Osborn Bldg. 223, D-209 Phone: 630-252-9011 This e-mail address is being protected from spambots. You need JavaScript enabled to view it. Education Ph.D., Solid State Physics, University of Southampton, UK B.Sc (1st class honours), Physics, Imperial College of Science and Technology, London, UK. Honors Fellow of the American Physical Society University of Chicago Distinguished Performance Award (2006) Professional Service Scientific Director, National School of Neutron and X-ray Scattering (2001-2007). Chair, Publication Committee, International Conference on Strongly Correlated Electron Systems, Ann Arbor, MI (2001). Member, International Advisory Board, International Conference on Strongly Correlated Electron Systems, Vienna (2005).


Low-Dose Ionizing Radiation Alters the Epigenome of the Avy Mouse  

NLE Websites -- All DOE Office Websites (Extended Search)

Ionizing Radiation Alters the Epigenome of the A Ionizing Radiation Alters the Epigenome of the A vy Mouse Autumn Bernal 1,2,3 , Dale Huang 1 , Yue Li 4 , Dana Dolinoy 5 , and Randy Jirtle 1 Department of Radiation Oncology 1 , University Program in Genetics and Genomic 2 , Integrated Toxicology & Environmental Health Program 3 , Department of Community and Family Medicine 4 , Duke University Medical Center, Durham, NC, USA, Department of Environmental and Health Sciences, University of Michigan, Ann Arbor, MI, USA 4 Background: Humans have evolved and thrived amidst constant low-dose (0-10 cGy) background radiation exposure from natural sources. Currently, however, the frequency of exposures to low doses of radiation is increasing due to man-made sources such as diagnostic imaging and nuclear power. This increased exposure has led to concerns amongst the general public and the government about the


The family of terpene synthases in plants: a midsize family of genes for specialized metabolism that is highly diversified throughout the kingdom  

NLE Websites -- All DOE Office Websites (Extended Search)

PLANT PLANT GENOME: AN EVOLUTIONARY VIEW ON STRUCTURE AND FUNCTION The family of terpene synthases in plants: a mid-size family of genes for specialized metabolism that is highly diversified throughout the kingdom Feng Chen 1,* , Dorothea Tholl 2 , Jo ¨ rg Bohlmann 3 and Eran Pichersky 4 1 Department of Plant Sciences, University of Tennessee, Knoxville, TN 37996, USA, 2 Department of Biological Sciences, 408 Latham Hall, Virginia Polytechnic Institute and State University, Blacksburg, VA 24061, USA, 3 Michael Smith Laboratories, 2185 East Mall, University of British Columbia, Vancouver, BC V6T 1Z4, Canada, and 4 Department of Molecular, Cellular and Developmental Biology, University of Michigan, Ann Arbor, MI 48109, USA Received 14 October 2010; revised 19 January 2011; accepted 31 January 2011. * For correspondence (fax +1 865 974 1947; e-mail fengc@utk.edu). SUMMARY Some plant



Office of Scientific and Technical Information (OSTI)

Project Report Project Report INERT-MATRIX FUEL: ACTINIDE "BURNING" AND DIRECT DISPOSAL Nuclear Engineering Education Research Program (grant # DE-FG07-99ID13767) Rodney C. Ewing (co-PI) Lumin Wang (co-PI) October 30,2002 For the Period of 07/01/1999 to 06/30/2002 Department of Nuclear Engineering and Radiological Sciences University of Michigan Ann Arbor, MI 48109 1 1. Background Excess actinides result from the dismantlement of nuclear weapons (239Pu) and the reprocessing of commercial spent nuclear fuel (mainly 241Am, Cm and 237Np). In Europe, Canada and Japan studies have determined much improved efficiencies for burn- up of actinides using inert-matrix fuels. This innovative approach also considers the properties of the inert-matrix fuel as a nuclear waste form for direct disposal after one-


NETL: NEPA Categorical Exclusions - January 2012 to March 2012  

NLE Websites -- All DOE Office Websites (Extended Search)

2 to March 2012 2 to March 2012 Archive (November 2009 - December 2011) ARRA Date Title Recipient Name Location DOE/NETL Sponsors N 3/29/2012 High Efficiency Colloidal Quantum Dot Phosphors (New Location) University of Buffalo Amherst, NY EE/PMC/BETD Y 3/29/2012 Recovery Act - Clean Energy Coalition Michigan Green Fleets (Summary CX) Prime: Clean Energy Coalition Sub: Multiple Ann Arbor, MI EE/PMC/PVT Y 3/29/2012 New York State Alternative Fuel Vehicle & Infrastructure Deployment Prime: NYSERDA Sub: Village of Minoa Minoa, NY EE/PMC/PVT Y 3/29/2012 New York State Alternative Fuel Vehicle & Infrastructure Deployment Prime: NYSERDA Sub: Roosevelt Island Roosevelt Island, NY EE/PMC/PVT Y 3/29/2012 JDC Phosphate Prime: State of Florida


DOE to Provide Nearly $20 Million to Further Development of Advanced  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

20 Million to Further Development of 20 Million to Further Development of Advanced Batteries for Plug-in Hybrid Electric Vehicles DOE to Provide Nearly $20 Million to Further Development of Advanced Batteries for Plug-in Hybrid Electric Vehicles September 25, 2007 - 2:49pm Addthis ANN ARBOR, MI - U.S. Department of Energy (DOE) Assistant Secretary for Electricity Delivery and Energy Reliability Kevin M. Kolevar today announced DOE will invest nearly $20 million in plug-in hybrid vehicle (PHEV) research. Five projects have been selected for negotiation of awards under DOE's collaboration with the United States Advanced Battery Consortium (USABC) for $17.2 million in DOE funding for PHEV battery development projects and; DOE will provide nearly $2 million to the University of Michigan (U-M) to spearhead a study exploring the future of


L B L  

NLE Websites -- All DOE Office Websites (Extended Search)

B B L - - 1 8 4 0 2 DE85 0 0 3 4 7 0 REPORT OF THE WORKING GROUP ON CP VIOLATION AND RARE DBCAYS I.W. Cronin ^ " 0 Department of J-hysics, University of Chicago, Chicago, IL 60637 ' '° N.G. Deshpande - s i** 0 Department of Physics, University of Oregon, Eugene, OR 97*03 " G.L.Kane 3 $>>> Department of Physics, University of Michigan, Ann Arbor, MI 48109 ' V.C. Lnth and A.C. Odian 0 e Stanford Linear Accelerator Center, P.O. Box 4349, Stanford, CA 94305 51' * M.E. Machacek ^ ^ ^ Department of Physics, Northeastern University, Boston, MA 02115 F - P 4 i f . e . . . . . . _ .ax l»' Brookhaven National Laboratory, Upton, Long Island, NY 11973 0 a i ci> M.P. Schmidt and J. Slaughter ,, 9^" c Department of Physics, Yale University, New Haven, CT 06511 ^


Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.



Data:E8b95f71-753b-4c27-b971-eb7634e8e13b | Open Energy Information  

Open Energy Info (EERE)

-80-800498448.us-east-1.elb.amazonaws.comwimages448UtilityRateAnnArborCompleteBookdetroitEdisonTariff.pdf Assume net metering (buy sell): Yes Flat rate buy (kWh):...


Browse wiki | Open Energy Information  

Open Energy Info (EERE)

-80-800498448.us-east-1.elb.amazonaws.comwimages448UtilityRateAnnArborCompleteBookdetroitEdisonTariff.pdf OpenEIUtilityRateStartDate 21 December 2011 + OpenEI...


Browse wiki | Open Energy Information  

Open Energy Info (EERE)

-80-800498448.us-east-1.elb.amazonaws.comwimages448UtilityRateAnnArborCompleteBookdetroitEdisonTariff.pdf OpenEIUtilityRateStartDate 14 January 2009 + OpenEI...


Data:C374b639-5d61-4c79-8885-e1f75842e620 | Open Energy Information  

Open Energy Info (EERE)

-80-800498448.us-east-1.elb.amazonaws.comwimages448UtilityRateAnnArborCompleteBookdetroitEdisonTariff.pdf Assume net metering (buy sell): Yes Flat rate buy (kWh):...


Hearing the Highest Pitches | Advanced Photon Source  

NLE Websites -- All DOE Office Websites (Extended Search)

them directly or control them very precisely. To create short-wavelength phonons, Mariano Trigo of the University of Michigan in Ann Arbor and his colleagues began with a...

Note: This page contains sample records for the topic "ann arbor mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



E-Print Network (OSTI)

63, 151 T. Kaimcash. Fusion Reactor Physics (Ann ArborTritium Technology For Fusion Reactors. C0NF-750989 (OakA. Impurity Effects in Fusion Reactor Operations B.

Law, P.K.



Deepak Sivaraman  

NLE Websites -- All DOE Office Websites (Extended Search)

from University of Michigan, Ann Arbor in 2009. His focus was in the fields of applied life cycle engineering and industrial ecology, and he received the "3M Outstanding...


A Paean to the WZ-Method. - CECM  

E-Print Network (OSTI)

The WZ method has successfully found a recurrence for the appearing in (8.1) of [ 2]. This identity was posed as a conjecture at the Ann Arbor Conference on...


CX-005233: Categorical Exclusion Determination  

Energy.gov (U.S. Department of Energy (DOE))

Recovery Act - Clean Energy Coalition Michigan Green FleetsCX(s) Applied: B5.1Date: 02/11/2011Location(s): Ann Arbor, MichiganOffice(s): Energy Efficiency and Renewable Energy, National Energy Technology Laboratory


Cross-avenue politics : the case of Colombia and Brazil  

E-Print Network (OSTI)

the Pragmatic Vote in Brazils 2006 Presidential Election,Deadlock of Democracy in Brazil. Ann Arbor: University of2003. Agenda Power in Brazils Cmara dos Deputados, 1989

Pachon Buitrago, Monica



From International Idea to Domestic Policy: Explaining the Emergence of Same-Sex Partnership Recognition in Argentina and Brazil  

E-Print Network (OSTI)

Deadlock of Democracy in Brazil. Ann Arbor: University ofParties and Governability in Brazil," in Party Politics in2008. "The Pope's Visit to Brazil: Context and Effects," SPW

Schulenberg, Shawn Richard



Accio Energy Inc | Open Energy Information  

Open Energy Info (EERE)

Energy Inc Place Ann Arbor, Michigan Zip 48105 Sector Wind energy Product Michigan-based distributed wind energy systems maker. References Accio Energy Inc1 LinkedIn Connections...


The foundation of the department  

E-Print Network (OSTI)

appointments Knowledge of chemical engineering not essential Ann Arbor Wilkes 1957 Keele. Exeter. Selwyn Harrison McGill Ratcliff 1956 Exeter Turner Birmingham Davies Hutchison 1955 Davidson Armstrong 1952 Leeds. Gonville & Caius Gray 1951 UKAEA. Imperial...

Davidson, John



Section 2: Landscapes of Capital - On Big Beaver Road: Detroit and the Diversity of American Metropolitan Landscapes  

E-Print Network (OSTI)

Center near Ann Arbor, Detroit News, April 12, 2005, p. 8.on Southern Plant, Detroit News, October 28, 2006, p. 3.Pro?le: Michigan 2005 (Detroit: Southeast Michigan Council

Fishman, Robert



CX-004506: Categorical Exclusion Determination | Department of...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

CX-004506: Categorical Exclusion Determination Recovery Act ? Clean Energy Coalition Michigan Green Fleets CX(s) Applied: B5.1 Date: 11192010 Location(s): Ann Arbor, Michigan...


Categorical Exclusion Determinations: Office of Energy Efficiency...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Generator CX(s) Applied: A9 Date: 04122011 Location(s): Ann Arbor, Michigan Office(s): Energy Efficiency and Renewable Energy, Golden Field Office April 12, 2011 CX-005693:...


A Power-Law Formulation of Laminar Flow in Short Pipes Max Sherman  

E-Print Network (OSTI)

by the same approaches that Jeppson 1 uses for turbulent ones. Other similarities are suggested, but have;10 REFERENCES 1. J.W. Jeppson, "Analysis of Flow in Pipe Networks," Ann Arbor Science, pp. 53-69, (1977). 2. H


CX-006492: Categorical Exclusion Determination  

Energy.gov (U.S. Department of Energy (DOE))

Dry Process Electrode FabricationCX(s) Applied: B3.6Date: 09/06/2011Location(s): Ann Arbor, MichiganOffice(s): Energy Efficiency and Renewable Energy, National Energy Technology Laboratory



NLE Websites -- All DOE Office Websites (Extended Search)

Examination of the Effects of Aerosols on the Reflected Radiation by Clouds J. E. Penner and C. Jablonowski University of Michigan Ann Arbor, Michigan K. E. Grant and C. C. Chuang...


The potential of different artificial neural network (ANN) techniques in daily global solar radiation modeling based on meteorological data  

Science Conference Proceedings (OSTI)

The main objective of present study is to predict daily global solar radiation (GSR) on a horizontal surface, based on meteorological variables, using different artificial neural network (ANN) techniques. Daily mean air temperature, relative humidity, sunshine hours, evaporation, and wind speed values between 2002 and 2006 for Dezful city in Iran (32 16'N, 48 25'E), are used in this study. In order to consider the effect of each meteorological variable on daily GSR prediction, six following combinations of input variables are considered: (I)Day of the year, daily mean air temperature and relative humidity as inputs and daily GSR as output. (II)Day of the year, daily mean air temperature and sunshine hours as inputs and daily GSR as output. (III)Day of the year, daily mean air temperature, relative humidity and sunshine hours as inputs and daily GSR as output. (IV)Day of the year, daily mean air temperature, relative humidity, sunshine hours and evaporation as inputs and daily GSR as output. (V)Day of the year, daily mean air temperature, relative humidity, sunshine hours and wind speed as inputs and daily GSR as output. (VI)Day of the year, daily mean air temperature, relative humidity, sunshine hours, evaporation and wind speed as inputs and daily GSR as output. Multi-layer perceptron (MLP) and radial basis function (RBF) neural networks are applied for daily GSR modeling based on six proposed combinations. The measured data between 2002 and 2005 are used to train the neural networks while the data for 214 days from 2006 are used as testing data. The comparison of obtained results from ANNs and different conventional GSR prediction (CGSRP) models shows very good improvements (i.e. the predicted values of best ANN model (MLP-V) has a mean absolute percentage error (MAPE) about 5.21% versus 10.02% for best CGSRP model (CGSRP 5)). (author)

Behrang, M.A.; Assareh, E. [Department of Mechanical Engineering, Young Researchers Club, Islamic Azad University, Dezful Branch (Iran); Ghanbarzadeh, A.; Noghrehabadi, A.R. [Department of Mechanical Engineering, Engineering Faculty, Shahid Chamran University, Ahvaz (Iran)



Use of BDST and an ANN model for prediction of dye adsorption efficiency of Eucalyptus camaldulensis barks in fixed-bed system  

Science Conference Proceedings (OSTI)

In this study, the Bohart and Adams' model taking into account bed depth, and influent dye concentration was studied to exhibit adsorption process of textile dyes (Basic Blue 41 - BB41 and Reactive Black 5 - RB5) in glass columns using tree barks (Eucalyptus ... Keywords: ANN, Adsorption columns, BB41, BDST, BDST model, neural networks, Dyes, Eucalyptus camaldulensis, MLP, RB5, Tree barks

Behzat Balci; Olcayto Keskinkan; Mutlu Avci



Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available



Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-



Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan


Note: This page contains sample records for the topic "ann arbor mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah



Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI



Black carbon aerosols and the third polar ice cap  

E-Print Network (OSTI)

estimations in global aerosol models, Atmos. Chem. Phys. ,Cloud mi- crophysics and aerosol indirect efefcts in theuncertainties in assessing aerosol effects on climate, Ann.

Menon, Surabi



A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.



NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Stanford University Stanford University EE Multiple (see NCO comment) PMC/PVTD FY13-16/ 5/1/13 - 4/30/16 Nicholas D'Amico Multiple (3) sites, CA and MI Development of a Dynamic Wall Layer Model for LES of Internal Combustion Engines (SUMMARY CX) Detailed numerical simulations, high-speed laser imaging experiments, and validation studies in optical engines will be performed under this project. Nicholas D'Amico Digitally signed by Nicholas D'Amico DN: cn=Nicholas D'Amico, o=NETL, ou=BETD, email=nicholas.damico@netl.doe.gov, c=US Date: 2013.04.19 14:11:39 -04'00' 04 19 2013 John Ganz Digitally signed by John Ganz DN: cn=John Ganz, o=NETL, ou=ECD, email=john.ganz@netl.doe.gov, c=US Date: 2013.05.03 15:53:40 -04'00' 5 3 2013 Part of NSF/DOE Partnership on Advanced Combustion Engines. Lab-scale work at Ann Arbor, MI (Univ. of


Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan



Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

61 - 22970 of 26,764 results. 61 - 22970 of 26,764 results. Rebate Pacific Power- Energy Star New Homes Program For Builders Pacific Power provides an incentive for home builders in Washington to build energy efficient houses through the Energy Star New Homes Program. Rebates are available through this program for... http://energy.gov/savings/pacific-power-energy-star-new-homes-program-builders-0 Rebate City of Ann Arbor- Green Power Purchasing In May 2006, the Ann Arbor City Council adopted a resolution that established a goal of 30% renewable energy for all municipal operations by 2010, with an associated 20% reduction in greenhouse... http://energy.gov/savings/city-ann-arbor-green-power-purchasing Rebate City of Tallahassee Utilities- Solar Loans The City of Tallahassee Utilities offers loans with an interest rate of 5%


Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

51 - 6760 of 26,764 results. 51 - 6760 of 26,764 results. Download 2014 Site Sustainability Plan 2014 Site Sustainability Plan U.S. Department of Energy Office of Legacy Management December 2013 http://energy.gov/lm/downloads/2014-site-sustainability-plan Rebate City of Ann Arbor- PACE Financing The City of Ann Arbor offers Property Assessed Clean Energy (PACE) financing for commercial properties located within the city. Projects will undergo a voluntary special assessment and may range in... http://energy.gov/savings/city-ann-arbor-pace-financing Rebate Green Energy Ohio- GEO Solar Thermal Rebate Program With funding from The Sierra Club, Green Energy Ohio (GEO) is offering rebates on residential properties in Ohio for solar water heating systems purchased after April 1, 2009. The rebates are...


CX-005695: Categorical Exclusion Determination | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

95: Categorical Exclusion Determination 95: Categorical Exclusion Determination CX-005695: Categorical Exclusion Determination Ann Arbor Wind Generator CX(s) Applied: A9 Date: 04/12/2011 Location(s): Ann Arbor, Michigan Office(s): Energy Efficiency and Renewable Energy, Golden Field Office The City of Ann Arbor is proposing to use federal funding to select, purchase and construct one or more wind generators (wind turbines). The proposed project would also include public outreach and education to raise awareness about wind energy. Finally, the installed generator(s} would be used as a research platform on which to test new wind technologies, such as new blade designs and materials or gearboxes, among other potential innovations. DOCUMENT(S) AVAILABLE FOR DOWNLOAD CX-005695.pdf More Documents & Publications



E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor


Ingrid Ann Christner Kolb  

Energy.gov (U.S. Department of Energy (DOE))

Ingrid Kolb was appointed Director of the Office of Management on December 1, 2005. As the Director she leads an organization comprised of nearly 260 employees with a budget of $55 million. The...


Dr. Anne L. Plant  

Science Conference Proceedings (OSTI)

... knowledge from complex data; enhancing the use of data between laboratories by the development of semantic web based search tools, ontologies ...



Li-Anne Liew  

Science Conference Proceedings (OSTI)

... Society's MEMS workshop (2010) Consultant, PDC Energy LLC (2009). Awards and Honors: NIST EEEL Directors Reserve Competitive Funding ...



Farewell Betty Ann Sandoval  

Science Conference Proceedings (OSTI)

... wrote rules and regulations for the safe use of nuclear materials and ... of Standards and Technology (NIST), and the National Security Agency (NSA ...



Interview of Anne Lonsdale  

E-Print Network (OSTI)

not; aware of strained relations from early on; I was much closer to my father; my mother was uncertain of life which made her dictatorial; she had come from a simple background and had gone to Leeds University; her older sister had been to Newnham... which made her feel inadequate; she then married her professor at Leeds; father went from there to found physics department at Leicester; brought my mother into a social world where she felt out of her depth; she remained so all her life but was always...

Lonsdale, Anne



Ann Chiaramonti Debay  

Science Conference Proceedings (OSTI)

... Effect of annealing on local composition and electrical transport correlations in MgO-based magnetic tunnel junctions. ... General Motors Corporation. ...



Iii;.} An Ann  

NLE Websites -- All DOE Office Websites (Extended Search)

of Subject Categories used in Bibl iography Bibliography Addendum 2 3 10 11 14 241 Introduction Sources.- In the course of preparing this bibliography, several approaches...


Ann M. Schlenker resume  

NLE Websites -- All DOE Office Websites (Extended Search)

product engineers and direct staff of 140 Project development for diesel, advance gasoline engines, HEV, transmissions, axles, torque converters and emission...


Anne Van Arsdall  

NLE Websites -- All DOE Office Websites (Extended Search)

(ERDA) and the Nuclear Regulatory Commission take over its functions. The Nuclear Regulatory Commission assumes responsibility for commer- cial reactor safety (and for...


Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production  

NLE Websites -- All DOE Office Websites (Extended Search)

miR156 miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production Chunxiang Fu 1 , Ramanjulu Sunkar 2 , Chuanen Zhou 1 , Hui Shen 3,4 , Ji-Yi Zhang 3,4 , Jessica Matts 2 , Jennifer Wolf 1 , David G. J. Mann 4,5 , C. Neal Stewart Jr 4,5 , Yuhong Tang 3,4 and Zeng-Yu Wang 1,4, * 1 Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 2 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USA 3 Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 4 BioEnergy Science Center, Oak Ridge, TN, USA 5 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 10 October 2011; revised 8 December 2011; accepted 12 December 2011. *Correspondence (Tel 1-580-224 6830; fax 1-580-224 6802; email zywang@noble.org) Re-use

Note: This page contains sample records for the topic "ann arbor mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Putative role of innexins in neuronal arbor formation  

E-Print Network (OSTI)

cold Helobdella medium. The embryo was opened by longitudinally tearing the cryptolarval membrane, or the dorsal fusion

Natan, Ryan Gregory



Event Images from ArgoNeuT: Mini LArTPC Exposure to Fermilab's NuMI Beam Project  

DOE Data Explorer (OSTI)

ArgoNeuT is a joint NSF/DOE R&D project at Fermilab to expose a small-scale liquid argon time projection chamber (LArTPC) to the NuMI neutrino beam. Liquid argon detectors are an exciting class of neutrino experiments because they can provide bubble chamber quality images and excellent background rejection. In these detectors, neutrinos passing through a large volume of argon interact with an argon atom, producing light and ionization particles. An electric field within the detector causes these charged particles to drift through the volume of argon, leaving a path of ionization electrons. As they drift, the ionization electrons induce current in two wire planes and are collected at a third plane. Measurement of the signals created within the wires, the position of the wires within the planes, the drift velocity of the ionization particles, and time of drift (from scintillation light or elsewhere) provides all the information needed for 3D reconstruction of the event. ArgoNeuT's neutrino source is the NuMI (Neutrinos at the Main Injector) beam. The beam passes through the MINOS (Main Injector Neutrino Oscillation search) near and far detectors, positioned at 1 km and 735 km from the target at Fermilab. ArgoNeuT is located at Fermilab upstream of the MINOS near detector, and is calibrated using muons that traverse the chamber and penetrate several layers into MINOS[Copied with editing from http://t962.fnal.gov/index.html]. A small selection of event images are made available.


PerfSONAR: A Service Oriented Architecture  

NLE Websites -- All DOE Office Websites (Extended Search)

PerfSONAR: PerfSONAR: A Service Oriented Architecture for Multi-domain Network Monitoring Andreas Hanemann 1 , Jeff W. Boote 2 , Eric L. Boyd 2 , Jérôme Durand 3 , Loukik Kudarimoti 4 , Roman Łapacz 5 , D. Martin Swany 6 , Szymon Trocha 5 , and Jason Zurawski 6 1 German Research Network (DFN), c/o Leibniz Supercomputing Center, Barer Str. 21, D-80333 Munich, Germany hanemann@lrz.de 2 Internet2, 1000 Oakbrook Drive, Suite 300, Ann Arbor, MI 48104, USA {boote,eboyd}@internet2.edu 3 GIP Renater, 151 Boulevard de l' Hôpital, 75013 Paris, France Jerome.durand@renater.fr 4 DANTE, 126-130 Hills Road, Cambridge CB2 1PG, UK loukik.kudarimoti@dante.org.uk 5 Poznan Supercomputing and Networking Center, Noskowskiego 12/14, 61-704 Poznan, Poland {romradz,szymon.trocha}@man.poznan.pl 6 Department of Computer and Information Sciences, University of Delaware, Newark, DE 19716, USA swany@cis.udel.edu,zurawski@eecis.udel.edu


School of Applied & Engineering Physics -Undergraduate Post Graduate Activities Detail & History  

E-Print Network (OSTI)

undergraduate students from the Class of 2010. Historical data is provided to allow for comparison of activity and salary trends. Number Graduated: 45 Number Responded: 34 Response Rate: 76% 2010 Graduate University of Michigan-Ann Arbor PhD Electrical Engineering Yale University PhD Applied Physics Institution

Lipson, Michal


Proceedings of the Ninth Conference on Computational Natural Language Learning  

Science Conference Proceedings (OSTI)

The 2005 Conference on Computational Natural Language Learning (CoNLL-2005) is the ninth in a series of meetings organized by SIGNLL, the ACL special interest group on natural language learning. This year's CoNLL will be held in Ann Arbor, Michigan, ...

Ido Dagan; Daniel Gildea



c a m p u s Founded in 1817 as the "Catholepistemiad of  

E-Print Network (OSTI)

of Michigan has over 460,000 living alumni! Burton Memorial Tower and Baird Carillon (1936) In 1935, Charles M to be cast in England. The University of Michigan Club of Ann Arbor undertook raising money for a tower as a memorial to President Marion Burton. The 212-foot tower R MichiganStadium YostArena Biomedical

Michigan, University of


Online Learning in Opportunistic Spectrum Access: A Restless Bandit Approach  

E-Print Network (OSTI)

Department of Electrical Engineering and Computer Science University of Michigan, Ann Arbor, Michigan, 48109 as it goes and maximizes its usage of the best channel. The objective is to construct a good online learning result in higher data rates or lower power for the user and so on. This is modeled as a reward collected

Liu, Mingyan


Department of Civil & Environmental Engineering Geotechnical Group Seminar Series  

E-Print Network (OSTI)

, in terms of rate and composition of landfill gas (LFG) generation, leachate composition and waste this septage bioreactor landfill cell, the overall gas collection rate at this landfill has increased by 60 of Michigan, Ann Arbor Septage Bioreactor Landfill by Xianda Zhao, Ph.D., P.E., Te-Yang Soong, Ph.D., P

Kamat, Vineet R.



E-Print Network (OSTI)

-2005, University of Michigan, Ann Arbor. Honors in Biopsychology and Cognitive Science. Minor: Biology. Advisor. CURRENT RESEARCH · Response of seaside sparrows (Ammodramus maritimus) to the BP Deepwater Horizon oil Butterfield, T Burkhard, L Southcott, and J Welklin (field) 2012 B Duncan (NSF REU, lab; assistant mentor


MATHEMATICS OF OPERATIONS RESEARCH Vol. 32, No. 2, May 2007, pp. 345364  

E-Print Network (OSTI)

://www.tepper.cmu.edu/andrew/ravi Amitabh Sinha Ross School of Business, University of Michigan, Ann Arbor, Michigan 48109, amitabh: Cable companies have to plan their network to serve future population and business needs, oil companies. The field of stochastic optimization, in contrast, adopts the (arguably more realistic) view that partial

Ravi, R.


Flow regime transition at high capillary numbers in a microfluidic T-junction: Viscosity contrast and geometry effect  

E-Print Network (OSTI)

of Michigan, Ann Arbor, Michigan 48109, USA 2 Department of Mechanical, Materials and Aerospace Engineering few years, numerous experiments have high- lighted the advances being made in the field of droplet gen of the two liquids,8 namely, oil and water. A similar design has been shown to yield equal and periodic

Gupta, Amit


Starting laminar plumes: Comparison of laboratory and numerical modeling  

E-Print Network (OSTI)

, F-91405 Orsay, France Peter E. van Keken Department of Geological Sciences, University of Michigan, Ann Arbor, Michigan 48109-1005, USA (keken@umich.edu) Angela Limare Institut de Physique du Globe, UMR. In the laboratory experiments the plumes are started in a nearly isoviscous silicone oil with heat supplied through

van Keken, Peter


3/14/08 5:40 PMGeotimes -March 2008 -Dunes: they're electric Page 1 of 2http://www.geotimes.org/mar08/article.html?id=nn_dunes.html  

E-Print Network (OSTI)

the strategic petroleum reserve right now, considering oil prices are at historic highs? Yes No Don't know of the particles never get more than a few centimeters off the ground. Now, new research shows that electric fields at the University of Michigan in Ann Arbor, and doctoral student Jasper Kok speculate that all the wind

Michigan, University of


VHF Free-Free Beam High-Q Micromechanical Resonators Kun Wang, Yinglei Yu, Ark-Chew Wong, and Clark T.-C. Nguyen  

E-Print Network (OSTI)

VHF Free-Free Beam High-Q Micromechanical Resonators Kun Wang, Yinglei Yu, Ark-Chew Wong, and Clark Science University of Michigan Ann Arbor, Michigan 48109-2122 ABSTRACT Free-free beam, flexural and their associated losses are virtually eliminated from the design. Using this approach, free-free beam µmechanical

Nguyen, Clark T.-C.



E-Print Network (OSTI)

Military College of Canada, CDN · A.A. KHAN, University of Wisconsin, USA · S. KOIKE, Saitama University, Mathematical Reviews, Ann Arbor, USA · A. CELLINA, University of Milan ­ Bicocca, I · M.G. COJOCARU, University, Philadelphia, USA · G. IDONE, University of Reggio Calabria, I · A.D. IOFFE, Technion Haifa,IL · G. ISAC, Royal

Nagurney, Anna


CX-005994: Categorical Exclusion Determination | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

994: Categorical Exclusion Determination 994: Categorical Exclusion Determination CX-005994: Categorical Exclusion Determination Clean Energy Advanced Manufacturing Loan Program - ArborWind LLC CX(s) Applied: B5.1 Date: 05/26/2011 Location(s): Ann Arbor, Michigan Office(s): Energy Efficiency and Renewable Energy, Golden Field Office The Michigan Department of Energy, Labor and Economic Growth intends to award a portion of its State Energy Program - Clean Energy Advanced Manufacturing Revolving Loan Fund allocation to ArborWind LLC. This award will enable ArborWind to incorporate innovative design changes into their PT100 (platinum resistance thermometer) vertical axis wind turbines. DOCUMENT(S) AVAILABLE FOR DOWNLOAD CX-005994.pdf More Documents & Publications CX-005986: Categorical Exclusion Determination


A large liquid argon time projection chamber for long-baseline, off-axis neutrino oscillation physics with the NuMI beam  

Science Conference Proceedings (OSTI)

Results from neutrino oscillation experiments in the last ten years have revolutionized the field of neutrino physics. While the overall oscillation picture for three neutrinos is now well established and precision measurements of the oscillation parameters are underway, crucial issues remain. In particular, the hierarchy of the neutrino masses, the structure of the neutrino mixing matrix, and, above all, CP violation in the neutrino sector are the primary experimental challenges in upcoming years. A program that utilizes the newly commissioned NuMI neutrino beamline, and its planned upgrades, together with a high-performance, large-mass detector will be in an excellent position to provide decisive answers to these key neutrino physics questions. A Liquid Argon time projection chamber (LArTPC) [2], which combines fine-grained tracking, total absorption calorimetry, and scalability, is well matched for this physics program. The few-millimeter-scale spatial granularity of a LArTPC combined with dE/dx measurements make it a powerful detector for neutrino oscillation physics. Scans of simulated event samples, both directed and blind, have shown that electron identification in {nu}{sub e} charged current interactions can be maintained at an efficiency of 80%. Backgrounds for {nu}{sub e} appearance searches from neutral current events with a {pi}{sup 0} are reduced well below the {approx} 0.5-1.0% {nu}{sub e} contamination of the {nu}{sub {mu}} beam [3]. While the ICARUS collaboration has pioneered this technology and shown its feasibility with successful operation of the T600 (600-ton) LArTPC [4], a detector for off-axis, long-baseline neutrino physics must be many times more massive to compensate for the low event rates. We have a baseline concept [5] based on the ICARUS wire plane structure and commercial methods of argon purification and housed in an industrial liquefied-natural-gas tank. Fifteen to fifty kton liquid argon capacity tanks have been considered. A very preliminary cost estimate for a 50-kton detector is $100M (unloaded) [6]. Continuing R&D will emphasize those issues pertaining to implementation of this very large scale liquid argon detector concept. Key hardware issues are achievement and maintenance of argon purity in the environment of an industrial tank, the assembly of very large electrode planes, and the signal quality obtained from readout electrodes with very long wires. Key data processing issues include an initial focus on rejection of cosmic rays for a surface experiment. Efforts are underway at Fermilab and a small number of universities in the US and Canada to address these issues with the goal of embarking on the construction of industrial-scale prototypes within one year. One such prototype could be deployed in the MiniBooNE beamline or in the NuMI surface building where neutrino interactions could be observed. These efforts are complementary to efforts around the world that include US participation, such as the construction of a LArTPC for the 2-km detector location at T2K [7]. The 2005 APS neutrino study [1] recommendations recognize that ''The development of new technologies will be essential for further advances in neutrino physics''. In a recent talk to EPP2010, Fermilab director P. Oddone, discussing the Fermilab program, states on his slides: ''We want to start a long term R&D program towards massive totally active liquid Argon detectors for extensions of NOvA''. [8]. As such, we are poised to enlarge our R&D efforts to realize the promise of a large liquid argon detector for neutrino physics.

Finley, D.; Jensen, D.; Jostlein, H.; Marchionni, A.; Pordes, S.; Rapidis, P.A.; /Fermilab; Bromberg, C.; /Michigan State U.; Lu, C.; McDonald, T.; /Princeton U.; Gallagher, H.; Mann, A.; Schneps, J.; /Tufts U.; Cline, D.; Sergiampietri, F.; Wang, H.; /UCLA; Curioni, A.; Fleming, B.T.; /Yale U.; Menary, S.; /York U., Canada



Argonne Transportation Technology R&D Center - Experts - Vehicle Systems  

NLE Websites -- All DOE Office Websites (Extended Search)

Vehicle Systems Experts Vehicle Systems Experts Click on a highlighted name for a full résumé. Ann Schlenker, Section Leader e-mail: aschlenker@anl.gov MS, Environmental/Civil Engineering, University of Michigan-Ann Arbor BS, Environmental/Civil Engineering, University of Michigan-Ann Arbor 30+ years comprehensive engineering expertise in the automobile industry including research, product development, program management, quality, regulatory and policy development 1 patent Glenn Keller, Vehicle Testing Activities Manager e-mail: gkeller@anl.gov MBA, Finance and Marketing, University of Michigan BS, Mechanical Engineering, Illinois Institute of Technology 30+ years' experience in automotive engine design & development, carline product planning, and technical consulting management


Off-Campus Travel BookFor University oF Michigan FacUlty, staFF, and stUdents Benefits Information  

E-Print Network (OSTI)

Arbor, MI 48109-1278 734-763-0363, fax Monday - Friday, 8 a.m. ­ 5 p.m. U-M Flint UHR-Flint 213 University Pavilion 303 East Kearsley Flint, MI 48502-1950 Call 810-762-3150 810-766-6711, fax Monday-764-1817 U-M Dearborn 313-593-5000 U-M Flint 810-762-3000 Benefits Office Fax 734-763-0363 Web site benefits

Shyy, Wei


Anne Collin Delavaud octobre 2002  

E-Print Network (OSTI)

Banco Bradesco 302 1 564 60 Osasco (Sao Paolo) Mexique Pemex 144 25 783 1906 Mexico Telefonos de Mexico atteindra, en 2003, 55 étages et 285 mètres de haut. Ce projet de 230 millions $ dépassera la tour Pemex

Paris-Sud XI, Université de

Note: This page contains sample records for the topic "ann arbor mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Danotek Motion Technologies | Open Energy Information  

Open Energy Info (EERE)

Danotek Motion Technologies Danotek Motion Technologies Jump to: navigation, search Name Danotek Motion Technologies Place Ann Arbor, Michigan Zip 48103 Sector Wind energy Product Founded in 2001, Danotek develops electrical conversion systems, including generators, brushless motors, and electronics controls, for the wind power, fuel cell, and power storage markets. References Danotek Motion Technologies[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Danotek Motion Technologies is a company located in Ann Arbor, Michigan . References ↑ "Danotek Motion Technologies" Retrieved from "http://en.openei.org/w/index.php?title=Danotek_Motion_Technologies&oldid=344069"


Categorical Exclusion (CX) Determinations By Date | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

2, 2011 2, 2011 CX-005695: Categorical Exclusion Determination Ann Arbor Wind Generator CX(s) Applied: A9 Date: 04/12/2011 Location(s): Ann Arbor, Michigan Office(s): Energy Efficiency and Renewable Energy, Golden Field Office April 12, 2011 CX-005693: Categorical Exclusion Determination Solazyme Integrated Biorefinery (SzIBR): Diesel Fuels from Heterotrophic Algae CX(s) Applied: A9, B3.6 Date: 04/12/2011 Location(s): Peoria, Illinois Office(s): Energy Efficiency and Renewable Energy, Golden Field Office April 12, 2011 CX-005692: Categorical Exclusion Determination State Energy Program Illinois Green Industry Business Development and Large Customer Energy Efficiency Program CX(s) Applied: A9, A11, B5.1 Date: 04/12/2011 Location(s): Peoria, Illinois Office(s): Energy Efficiency and Renewable Energy, Golden Field Office


AEE Renewables | Open Energy Information  

Open Energy Info (EERE)

Logo: AEE Renewables Name AEE Renewables Place Ann Arbor, Michigan Sector Solar Year founded 1994 Number of employees 11-50 Company Type For Profit Phone number 2027166664 Website http://aee-renewables.com References AEE Renewables[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. AEE Renewables is a company based in Ann Arbor, Michigan. References ↑ "AEE Renewables" Retrieved from "http://en.openei.org/w/index.php?title=AEE_Renewables&oldid=581441" Categories: Energy Generation Organizations Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties 429 Throttled (bot load)


Categorical Exclusion Determinations: Office of Energy Efficiency and  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

12, 2011 12, 2011 CX-005695: Categorical Exclusion Determination Ann Arbor Wind Generator CX(s) Applied: A9 Date: 04/12/2011 Location(s): Ann Arbor, Michigan Office(s): Energy Efficiency and Renewable Energy, Golden Field Office April 12, 2011 CX-005693: Categorical Exclusion Determination Solazyme Integrated Biorefinery (SzIBR): Diesel Fuels from Heterotrophic Algae CX(s) Applied: A9, B3.6 Date: 04/12/2011 Location(s): Peoria, Illinois Office(s): Energy Efficiency and Renewable Energy, Golden Field Office April 12, 2011 CX-005692: Categorical Exclusion Determination State Energy Program Illinois Green Industry Business Development and Large Customer Energy Efficiency Program CX(s) Applied: A9, A11, B5.1 Date: 04/12/2011 Location(s): Peoria, Illinois Office(s): Energy Efficiency and Renewable Energy, Golden Field Office


Students Drive Home Innovative Engineering in the EcoCAR2 Competition |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Students Drive Home Innovative Engineering in the EcoCAR2 Students Drive Home Innovative Engineering in the EcoCAR2 Competition Students Drive Home Innovative Engineering in the EcoCAR2 Competition April 18, 2011 - 1:52pm Addthis Participants in the EcoCar2 challenge gather for the spring workshop in Ann Arbor, Michigan. Participants in the EcoCar2 challenge gather for the spring workshop in Ann Arbor, Michigan. Patrick B. Davis Patrick B. Davis Vehicle Technologies Program Manager What does this project do? Engineering students work to re-engineer a standard vehicle, minimizing fuel consumption and emissions while retaining its original level of performance, safety and consumer appeal. The wait is over. After enduring a rigorous selection process, 16 teams have been chosen to compete in EcoCAR2: Plugging into the Future- a


9. international mouse genome conference  

SciTech Connect

This conference was held November 12--16, 1995 in Ann Arbor, Michigan. The purpose of this conference was to provide a multidisciplinary forum for exchange of state-of-the-art information on genetic mapping in mice. This report contains abstracts of presentations, focusing on the following areas: mutation identification; comparative mapping; informatics and complex traits; mutagenesis; gene identification and new technology; and genetic and physical mapping.





NLE Websites -- All DOE Office Websites (Extended Search)

Adrian, Michigan, Site (formerly the General Adrian, Michigan, Site (formerly the General Motors Site) is located at 1450 E. Beecher Street, on the eastern side of Route 52 in Adrian, Michigan. The town of Adrian is approximately 20 miles southwest of Ann Arbor and 30 miles northwest of Toledo, Ohio. The site comprises the General Motors (GM) plant, a large complex covering approximately 17 acres. During the 1950s, the previous owner of the site, the


Microsoft Word - MI.01-8.doc  

Office of Legacy Management (LM)

ORNL/RASA-96/7 ORNL/RASA-96/7 Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray S. P. McKenzie R. F. Carrier C. A. Johnson ORNL/RASA-96/7 LIFE SCIENCES DIVISION Environmental Restoration and Waste Management Non-Defense Programs (Certification Documentation Review, Investigation, and Completion: Internal Activity No. 14B477101) Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray, S. P. McKenzie, R. F. Carrier and C. A. Johnson Date Final issued - August 2002 Date Draft issued - July 1997



POTENTIAL APPLI ATIONS Agribusiness: Crop Testing & Verification Bio-fuels: Plants/Algae Lipid Content Homeland & International Security: Bio-Agent ...


MI 3 --Seite 1 Pinkal / Siekmann / Benzmuller  

E-Print Network (OSTI)

Differentialgleichungen (bis 2/2000), Dozentur f¨ur Wissenschaftliches Rechnen, Institut f¨ur Wissenschaftliches Rechnen, Grundausstattung Dr. Gerd Kunert, Professur Wissenschaftliches Rechnen, Grundausstattung Dr. Michael The?¨ur Modellprobleme in Gebieten mit Kanten, betrachtet. #12;A3 Meyer/Jung 7 Im Arbeits- und Ergebnisbericht 1996

Benzmüller, Christoph - FR 6.2


Detroit, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

6 2007 2008 2009 2010 2011 View History Pipeline Volumes 0 81 753 21 79 19 1996-2011 Pipeline Prices -- 8.28 6.58 4.53 8.37 5.17 1996-2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

9,158 8,756 14,925 22,198 41,964 42,866 1996-2012 Pipeline Prices 7.77 7.48 4.85 4.87 4.48 3.18 1996...


Detroit, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

22,904 27,220 43,980 44,275 43,690 50,347 1996-2012 Pipeline Prices 6.88 8.37 4.01 4.69 4.26 3.10...



NLE Websites -- All DOE Office Websites (Extended Search)

be fully operational by 2009. Phase 1 of TCR will revitalize the Aerial Cable Facility (ACF) and construct a state- of-the-art Thermal Test Complex (TTC). The TTC will support...


Evaluation of arresters' failure probability using ANN  

Science Conference Proceedings (OSTI)

Lightning is a major cause of faults on overhead transmission high voltage lines. In order to improve the lightning performance of the lines and to reduce the failure rate, surge arresters are installed between each phase and earth. The failure probability ... Keywords: Simulink7.1 package, artificial neural networks, surge arresters, transmission lines

C. A. Christodoulou; I. A. Stathopulos



Troisime anne Adresse : 34 Avenue Carnot  

E-Print Network (OSTI)

-2013 Serge Botet, Professeur. Linguistique textuelle étude du discours, étude du discours philosophique.Botet@univ-bpclermont.fr Friederike Spitzl-Dupic, Professeure. Linguistique / Historiographie de la linguistique et histoire des idées à une mise en relation de la linguistique sensibilisé de façon différente aux difficultés de la

Sart, Remi


NREL: Energy Analysis - Ann Herlevich Brennan  

NLE Websites -- All DOE Office Websites (Extended Search)

REEE market Communications strategy, technical writing, and outreach Techno-economic analysis of renewable energy technologies Experimental research on biofuels technologies...


NREL: Energy Sciences - Anne C. Dillon  

NLE Websites -- All DOE Office Websites (Extended Search)

and characterization of nanostructured materials including single- and multi-wall carbon nanotubes as well as metal oxide nanoparticles and, recently, silicon...


02 MTG-089 Ann Mtg Final  

Science Conference Proceedings (OSTI)

Mar 5, 2003 ... Employment Referral Board . .... Finding a Job in a Tough Economy. .... funded by the Department of EnergyOffice of Information Technology ...... leads to consilience; whereas failure leads to creation of new paradigms or.

Note: This page contains sample records for the topic "ann arbor mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



NLE Websites -- All DOE Office Websites (Extended Search)

Project Report 122008 to 42013 Principal Investigator: Guang Zhang Division of Climate, Atmospheric Science and Physical Oceanography Scripps Institution of Oceanography La...



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

State, tribal, and local jurisdictions have the responsibility of responding to a radiological transportation incident. In FY 2012, the Office of Environmental Management completed about 10,000 radioactive and hazardous material and waste shipments. To address the concerns expressed by corridor states and tribes about preparedness, the Transportation Emergency Preparedness Program (TEPP) ensures federal, state, tribal, and local responders have access to the plans, training, and technical assistance necessary to safely, efficiently, and effectively respond to radiological transportation accidents. TEPP has formed strong partnerships over the past 16 years with state, tribal and local response organizations, Federal agencies and other national programs integrating TEPP planning tools and training into a variety of hazardous materials


Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

41 - 6150 of 31,917 results. 41 - 6150 of 31,917 results. Download CX-005990: Categorical Exclusion Determination Biomass to Gasoline and Diesel Using Integrated Hydropyrolysis Plus Hydroconversion CX(s) Applied: A9, B3.6 Date: 05/26/2011 Location(s): Illinois Office(s): Energy Efficiency and Renewable Energy, Golden Field Office http://energy.gov/nepa/downloads/cx-005990-categorical-exclusion-determination Download CX-005994: Categorical Exclusion Determination Clean Energy Advanced Manufacturing Loan Program - ArborWind LLC CX(s) Applied: B5.1 Date: 05/26/2011 Location(s): Ann Arbor, Michigan Office(s): Energy Efficiency and Renewable Energy, Golden Field Office http://energy.gov/nepa/downloads/cx-005994-categorical-exclusion-determination Download CX-005995: Categorical Exclusion Determination


Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

11 - 17920 of 26,764 results. 11 - 17920 of 26,764 results. Download CX-005994: Categorical Exclusion Determination Clean Energy Advanced Manufacturing Loan Program - ArborWind LLC CX(s) Applied: B5.1 Date: 05/26/2011 Location(s): Ann Arbor, Michigan Office(s): Energy Efficiency and Renewable Energy, Golden Field Office http://energy.gov/nepa/downloads/cx-005994-categorical-exclusion-determination Download CX-005995: Categorical Exclusion Determination Energize Missouri Homes - Sidden and Neier CX(s) Applied: B5.1 Date: 05/26/2011 Location(s): Linn, Missouri Office(s): Energy Efficiency and Renewable Energy, Golden Field Office http://energy.gov/nepa/downloads/cx-005995-categorical-exclusion-determination Download CX-005996: Categorical Exclusion Determination Energize Missouri Homes - Wilson and Troiani


Ann. Geophys., 24, 427441, 2006 www.ann-geophys.net/24/427/2006/  

E-Print Network (OSTI)

producers and exporters of oil and natural gas, and offer a range of opportunities: Russia; Saudi Arabia conducted outside in all weathers. Some jobs may be offshore in remote and isolated locations. Salaries, such as wind, solar, tidal and geothermal power. Local governments, public bodies and charities are concerned

Paris-Sud XI, Université de


Ann. Geophys., 24, 17251735, 2006 www.ann-geophys.net/24/1725/2006/  

E-Print Network (OSTI)

2006 Annales Geophysicae Electron velocity distribution and lion roars in the magnetosheath W. Masood1Mullard Space Science Laboratory, University College London, UK Received: 10 October 2005 ­ Revised: 15 "lion roars" in the magnetosheath are studied using data obtained by the Spectrum Analyser (SA

Paris-Sud XI, Université de


Ann. Geophys., 25, 303315, 2007 www.ann-geophys.net/25/303/2007/  

E-Print Network (OSTI)

College, London, UK 7Mullard Space Sci.Lab. Surey, UK 8Swedish Institute of Space Physics, Uppsalla to study the main properties of magnetospheric lion roars: sporadic bursts of whistler emissions at f 0.1-0.2fe where fe is the electron gyrofrequency. Magnetospheric lion roars are shown to be similar

Paris-Sud XI, Université de


Ann. Geophys., 24, 33833389, 2006 www.ann-geophys.net/24/3383/2006/  

E-Print Network (OSTI)

solar wind energy trans- port into the Earth's magnetosphere (e.g. Tsurutani et al., 1988; Gonzalez et.: Energy coupling functions and solar wind magnetosphere dynamo, Geophys. Res. Lett., 6, 577­580, 1979 2006 Annales Geophysicae Solar cycle effect on geomagnetic storms caused by interplanetary magnetic

Paris-Sud XI, Université de


Ann. Geophys., 24, 769778, 2006 www.ann-geophys.net/24/769/2006/  

E-Print Network (OSTI)

distribution grids and ter- restrial communications, as well. To mitigate the effects on long-term scales, but terrestrial Correspondence to: H. Lundstedt (henrik@lund.irf.se) systems, such as electrical power Indicators of long-term solar activity ­ Data To study the solar activity changes over a period of 11 500

Paris-Sud XI, Université de


CX-002738: Categorical Exclusion Determination | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

38: Categorical Exclusion Determination 38: Categorical Exclusion Determination CX-002738: Categorical Exclusion Determination Delivering Advanced Modeling and Simulation Capabilities to United States Manufacturers CX(s) Applied: A9, A11 Date: 06/17/2010 Location(s): Ann Arbor, Michigan Office(s): Energy Efficiency and Renewable Energy, National Energy Technology Laboratory National Center for Manufacturing Sciences is leading this Congressionally Directed Project (CDP) effort by providing project management, technical support and training. The objective is to develop, validate and implement modeling and simulation tools to support auto industry. DOCUMENT(S) AVAILABLE FOR DOWNLOAD CX-002738.pdf More Documents & Publications CX-004505: Categorical Exclusion Determination CX-001161: Categorical Exclusion Determination


Michigan Gasoline Price Data  

NLE Websites -- All DOE Office Websites (Extended Search)

Michigan Michigan Exit Fueleconomy.gov The links below are to pages that are not part of the fueleconomy.gov. We offer these external links for your convenience in accessing additional information that may be useful or interesting to you. Selected Cities Ann Arbor AnnArborGasPrices.com Automotive.com MapQuest.com Battle Creek BattleCreekGasPrices.com Automotive.com MapQuest.com Detroit DetroitGasPrices.com Automotive.com MapQuest.com Flint FlintGasPrices.com Automotive.com MapQuest.com Grand Rapids GrandRapidsGasPrices.com Automotive.com MapQuest.com Kalamazoo KalamazooGasPrices.com Automotive.com MapQuest.com Lansing LansingGasPrices.com Automotive.com MapQuest.com Sterling Heights SterlingHeightsGasPrices.com Automotive.com MapQuest.com Other Michigan Cities MichiganGasPrices.com (search by city or ZIP code) - GasBuddy.com



Remote sensing Gas chromatography Chemical sensing TE HNOLOGI AL ENEFITS Small and portable No monitoring needed High accuracy with as low as



Remote sensing Gas chromatography ... remote sensors. The Field Calibration Assembly is designed at a small scale for incorporation into the intake



E-Print Network (OSTI)

gold mines in the United States. Five new mines came into production in 1997: Placer Dome's Pipeline and South Pipeline deposits in Crescent Valley in Lander County (part of the Cortez Mines complex Mountain Mine, 484,430 oz; Placer Dome's Cortez Gold Mines (including Pipeline), 407,973 oz; Independence

Tingley, Joseph V.



E-Print Network (OSTI)

Laboratory System, Accession Summary Report T0701789, 2007. [14] B. Stager, A. Ruegamer, Tonopah Test Ranges a herd of 250 were found dead in the northwestern Nevada Test and Training Range (NTTR) in southern collected in February 2008 at the Nevada Testing and Training Range. Units in per mil (%). Sample d15 N NO3

Tingley, Joseph V.


Construction of the NuMI underground laboratory facilities  

SciTech Connect

At Fermilab, a 4000-ft long underground complex has recently been constructed for a high-energy physics experiment. The complex is sited up to 350 ft, below grade principally in bedrock. The rock excavations were mined by TBM and drill and blast methods and supported by a combination of rock bolts, dowels and shotcrete. Water control was achieved using a combination of pre- and post-excavation grouting, drainage systems, drip shielding and air desiccation measures.

Laughton, Christopher; Bruen, Michael P



St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

59,044 56,015 56,094 66,775 52,380 65,815 66,723 2012 62,390 62,442 72,035 61,364 66,456 54,973 52,240 66,101 67,443 61,205 62,762 65,084 2013 56,510 52,567 58,126 43,917...


Fuel Economy of the 2013 Mitsubishi i-MiEV  

NLE Websites -- All DOE Office Websites (Extended Search)

the Mobile Version of This Page Automatic (A1) Electricity Compare Side-by-Side EV EPA Fuel Economy Miles per Gallon Personalize Electricity* 112 Combined 126 City 99 Highway...



owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2011-4637P ONTA T INFORMATION


Marysville, MI Natural Gas Imports by Pipeline from Canada  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Imports by Point of Entry (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet)

Note: This page contains sample records for the topic "ann arbor mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Alternative Uses for Vacant Land in Detroit, MI.  

E-Print Network (OSTI)

??Detroit is situated in a historically productive lake plain in the Great Lakes region of the Midwestern United States. Geographic centrality, access to rail and (more)

Yun, Michael



Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4,338 5,323 4,952 3,361 3,295 2,761 2,838 2,182 2,061 2,644 3,085 5,122 2012 6,067 6,721 3,354 3,404 2,923 1,986 2,475...


Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.85 4.76 4.36 4.62 4.73 4.70 4.74 4.75 4.21 3.83 3.85 3.79 2012 3.29 3.05 2.61 2.35 2.68 2.64 3.07 3.16 3.14 3.60 3.93...


Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 1,408 2,674 212 579 179 606 34 642 270 1,367 826 1,150 2012 326 264 147 899 1,654 1,086 217 801 1,053 1,472 121 61 2013...


Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.95 5.33 2013 3.80 4.50 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure...


Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.36 2.55 2.26 2.30 2000's 3.74 4.57 3.03 5.47 6.47 8.12 7.61 6.88 8.37 4.01 2010's 4.69 4.26...


Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 3,465 2,693 3,676 3,988 3,357 3,437 765 3,916 4,318 4,473 4,851 4,752 2012 5,562 5,372 5,253 3,745 3,354 2,811 2,935 3,822...


Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 14,901 11,501 10,925 7,671 2000's 6,171 405 1,948 2,514 1,117 0 0 81 753 21 2010's 79 19 - No...


Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.75 2.51 2.43 2.51 2000's 3.82 9.34 3.56 5.96 6.27 -- -- 8.28 6.58 4.53 2010's 8.37 5.17 - No...


Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.71 4.55 4.42 4.87 4.86 4.93 4.77 4.76 4.38 4.25 3.90 3.76 2012 3.32 2.95 2.71 2.49 2.42 2.74 3.14 3.24 3.03 3.42 3.93...


Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 638 5,286 3,377 691 2000's 5,320 3,651 NA 811 4,455 5,222 3,483 9,158 8,756 14,925 2010's 22,198...


St. Clair, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.04 3.16 2.07 2.62 2000's 4.45 4.54 3.19 5.84 6.50 9.93 7.44 6.97 10.03 5.10 2010's 4.97 4.29...


Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.72 4.58 4.22 4.51 4.66 4.73 4.55 4.45 4.19 3.92 3.79 3.60 2012 3.14 2.95 2.61 2.33 2.50 2.62 3.08 3.12 2.99 3.41 4.13...


Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 30,410 31,080 24,908 25,049 2000's 36,007 35,644 7,431 19,737 40,030 40,255 22,156 22,904 27,220...


St. Clair, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

7 2008 2009 2010 2011 2012 View History Pipeline Volumes 9,633 9,104 6,544 5,591 5,228 3,531 1996-2012 Pipeline Prices 6.97 10.03 5.10 4.97 4.29 2.63 1996-2012...


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec; 2011: 123: 237: 33: 91: 238: 1,469: 571: 38: 1,605: 552: 270: 2012: 51: 42: 2,029: 475: 370: 52: 45: 69: 221 ...


Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.97 2.36 2.17 2.47 2000's 2.91 3.92 NA 5.06 6.83 7.92 7.36 7.77 7.48 4.85 2010's 4.87 4.48 3.18...


Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.48 2.17 2.06 2000's NA NA 3.95 -- 7.80 -- 7.07 7.59 8.59 3.80 2010's 4.44 4.42 2.99...


Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 10 1,827 135 2000's NA NA 74 0 303 0 24 876 2,252 5,651 2010's 5,694 9,946 8,099...


Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 8 11 2013 16 140 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure of...

Note: This page contains sample records for the topic "ann arbor mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


ENERGY SURETY MI ROGRID - Home - Energy Innovation Portal  

Emergency Response Alternate Energy and Power Supply TE HNOLOGI AL ENEFITS Risk Assessment assists in planning and analysis of potential risks


miR290-5p and miR292-5p Activate the Immunoglobulin kappa Locus  

E-Print Network (OSTI)

empty vector control or Doxycycline-inducible Blimp1 cDNA,presence of ethanol or Doxycycline (1:5000, 16hr). Data wasCCA CCT GGT ACT GCG ACT C Doxycycline Experiments pFG12-TRE-

Garcia, Patty Bertha



Molecular Cell STAT3 Activation of miR-21 and miR-181b-1  

E-Print Network (OSTI)

cells via a positive feedback loop involving NF-kB, Lin28, let-7, and IL-6. We identify differentially, respectively, inhibit PTEN and CYLD tumor suppressors, leading to increased NF-kB activity required to maintain

Bulyk, Martha L.


Microsoft Word - S06815_2010 Ann Rpt  

Office of Legacy Management (LM)

1-1 1-1 1.0 Introduction This report evaluates the performance of the groundwater remediation system at the Shiprock, New Mexico, Disposal and Processing Site for the period April 2009 through March 2010. The Shiprock site, a former uranium-ore processing facility under the Uranium Mill Tailings Radiation Control Act (UMTRCA), is managed by the U.S. Department of Energy (DOE) Office of Legacy Management. The mill operated from 1954 to 1968; mill tailings were contained in an engineered disposal cell in 1986. As a result of milling operations, groundwater in the mill site area was contaminated with uranium, nitrate, sulfate, and associated constituents. In March 2003, DOE initiated active remediation of the groundwater using extraction wells and interceptor drains. At that time, a


Microsoft Word - S04378_AnnRep.doc  

Office of Legacy Management (LM)

7 Through March 2008 7 Through March 2008 for the Shiprock, New Mexico, Site September 2008 Office of Legacy Management LMS/SHP/S04378 Work Performed Under DOE Contract No. for the U.S. Department of Energy Office of Legacy Management. DE-AM01-07LM00060 Approved for public release; distribution is unlimited. Office of Legacy Management Office of Legacy Management Office of Legacy Management U.S. Department of Energy This page intentionally left blank LMS/SHP/S04378 Annual Performance Report April 2007 Through March 2008 for the Shiprock, New Mexico, Site September 2008 This page intentionally left blank U.S. Department of Energy Annual Performance Report, Shiprock, New Mexico September 2008 Doc. No. S0437800 Page i Contents 1.0 Introduction.........................................................................................................................1-1


Microsoft Word - S06815_2010 Ann Rpt  

Office of Legacy Management (LM)

5-1 5-1 5.0 Recommendations The following recommendations are provided to help improve the performance and evaluation of the Shiprock remediation system: * The floodplain extraction system appears to be functioning as expected. The addition of the two trenches at the base of the escarpment enhances the removal of contaminant mass from groundwater in the alluvium. However, given the success demonstrated in the previous evaluation of Trench 2 (DOE 2009b), DOE is proposing similar instrumentation and investigation for the Trench 1 area and the floodplain as a whole. These proposals are outlined below. ⎯ Alluvial wells near the river in the vicinity of well 1089 will be monitored (time frame and frequency to be determined) to demonstrate that groundwater pumping in this locale


Microsoft Word - S06815_2010 Ann Rpt  

Office of Legacy Management (LM)

9 Through March 2010 9 Through March 2010 for the Shiprock, New Mexico, Site December 2010 LMS/SHP/S06815 This page intentionally left blank LMS/SHP/S06815 Annual Performance Report April 2009 Through March 2010 for the Shiprock, New Mexico, Site December 2010 This page intentionally left blank U.S. Department of Energy Annual Performance Report, Shiprock, New Mexico December 2010 Doc. No. S06815 Page i Contents Abbreviations ...................................................................................................................................v 1.0 Introduction .........................................................................................................................1-1 1.1 Remediation System Performance Standards ...........................................................1-1


Microsoft Word - S06815_2010 Ann Rpt  

Office of Legacy Management (LM)

Doc. No. S06815 Doc. No. S06815 Page 3-1 3.0 Remediation System Performance This section describes the key components of the floodplain and terrace groundwater remediation systems and summarizes their performance for the 2009-2010 reporting period. 3.1 Floodplain Remediation System The floodplain remediation system consists of the three major components shown in Figure 1-1: two extraction wells (wells 1089 and 1104); two drainage trenches (horizontal wells), Trench 1 and Trench 2; and a sump (collection drain) used to collect discharges from seeps 0425 and 0426 on the escarpment. The objective of the floodplain groundwater extraction system is to reduce the mass of COCs in alluvial groundwater near the San Juan River and to lessen exposure and potential risks to aquatic life. All groundwater collected from the floodplain extraction wells and


Remarks by Deputy Administrator Anne M. Harrington at the Fourth...  

NLE Websites -- All DOE Office Websites (Extended Search)

on hands-on training in the core set of experimental disciplines that support the non-proliferation and nuclear security mission: nuclear physics, nuclear chemistry, nuclear...


Jo Ann Baumgartner and Sam Earnshaw: Organizers and Farmers  

E-Print Network (OSTI)

still farming. Some of these people were from Vermont, too.We had a bunch of people from Vermont. Isome of them went back to Vermont and were farming there.

Rabkin, Sarah



DOC Ann T2 Report_FY 2003_Jan04  

Science Conference Proceedings (OSTI)

... way to measure the amount of light delivered by these glass wires at ... on protected species, air quality, state of the coasts, beach temperatures, and ...



d'ordre : ANNE 2012 THSE / UNIVERSIT DE RENNES 1  

E-Print Network (OSTI)

BG/P su- percomputer at Argonne Leadership Computing Facility (ALCF) is enabling scientists to better of FLASH using GLEAN to compute the fractal dimension. These evaluations were per- formed on the ALCF, Susan Coghlan, Andrew Cherry, and the ALCF team for discussions and help re- lated to the paper


RESUME (updated to July 1, 2011) MARYE ANNE FOX  

E-Print Network (OSTI)

, Assessment and Rating System Award of the Association for the Advancement of Sustainability in Higher, Conferences on Photochemical Conversion and Storage of Solar Energy 1991: International Scientific Planning Broadcasting System 1989: Panelist, Workshop on Emerging Laser Technologies, National Institutes of Health 1989

Wang, Deli



E-Print Network (OSTI)

of Mexico have been excluded. cies (Frack, 1982; Nielsen, 1982; Pellmyr & Bal- ca´zar-Lara, in prep larvae that feed inside host tissue until feed- ing is complete (Davis, 1967; Frack, 1982). Mese- piola, the peduncles of at least six Agave species are used (Frack, 1982) by some Prodoxus species. I will not deal

Pellmyr, Olle



E-Print Network (OSTI)

) Introduction Peut-on dire n'importe quoi ? ? cette question la linguistique n'a pas de réponse homogène : tout éthique, la linguistique répondra que ce n'est pas son domaine. Il me semble cependant que les sciences du théoriques et épistémologiques de l'intégration de la dimension morale à l'analyse linguistique des discours


Ann.rep. 03.cra - CECM - Simon Fraser University  

E-Print Network (OSTI)

artificial intelligence. But he was out of luck. There were no such facilities available in Canada. Almost a decade later, the supercomputing landscape in Canada.


ordre:287-2008 Anne :2008 prsente devant  

E-Print Network (OSTI)

grease and jatropa oil via transesterification process; catalytic reforming of greenhouse gases, oil

Paris-Sud XI, Université de


Alumni Scholarship Recipients 1936 -2006 Barbara Ann Hull Harris  

E-Print Network (OSTI)

endonuclease I-DmoI. Nucleic Acids Res 25:1523­1530 Adams PL, Stahley MR, Kosek AB, Wang J, Strobel SA (2004

Grether, Gregory


Anne Arundel County - Solar and Geothermal Equipment Property...  

Open Energy Info (EERE)

for heating and cooling and solar energy equipment for water heating and electricity generation. The credit is calculated as the lesser of the following: (1) 50% of the total cost...



E-Print Network (OSTI)

reduce envi- ronmentalrisk.ForsmallfarmsoftypeI,equipmentwith a storage pit for biogas wastewater seems of filtration/impreg- nation over straw at the outlet of the biogas digester could be imagined in order to reach this value with dry straw. The case of large pig farms Anaerobic digestion in biogas systems

Paris-Sud XI, Université de

Note: This page contains sample records for the topic "ann arbor mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Microsoft Word - S06815_2010 Ann Rpt  

Office of Legacy Management (LM)

- 0 3 A p r - 0 4 A u g - 0 4 D e c - 0 4 A p r - 0 5 A u g - 0 5 D e c - 0 5 A p r - 0 6 A u g - 0 6 D e c - 0 6 A p r - 0 7 A u g - 0 7 D e c - 0 7 A p r - 0 8 A u g - 0 8 N o v...


http://ann.sagepub.com Academy of Political and Social  

E-Print Network (OSTI)

was strengthened by confidence-building measures (e.g., the Nuclear Non-Proliferation Treaty, the United States defense." The Non-Proliferation Treaty (NPT) (http://www.un.org/ Depts/dda/WMD/treaty/), which limits agreement. The result might be embodied in a formal treaty or a less formal understanding, like

Andrews, Peter B.


Anne de Guibert, SAFT, Critical Materials and Alternatives for...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Distribution and Use George Hadjipanayis, Chairman, Department of Physics and Astronomy, University of Delaware, Moving Beyond Neodymium-Iron Permanent Magnets for EV Motors...


Jo Ann Baumgartner and Sam Earnshaw: Organizers and Farmers  

E-Print Network (OSTI)

some of these folks been apprentices at the UCSC Farm andGarden? Earnshaw: Im not sure they were apprentices.t remember having any apprentices. It was more just people

Rabkin, Sarah



Real-Time Constraints Pao-Ann Hsiung  

E-Print Network (OSTI)

it to .Mfc When both parents guard the eggs simultaneously, mor- tality is reduced to a fraction equal and guard broods "sequentially"). However, in most fish and certain insects, males can keep mating and collecting additional eggs while continuing to guard broods obtained earlier (i.e., males guard "overlapping

Hsiung, Pao-Ann


Nod'ordre 93-41 Anne 199; prsente devant  

E-Print Network (OSTI)

model-based estimates of the value of oil in Alaska's Arctic National Wildlife Refuge (ANWR). The best estimate of economically recoverable oil in the federal portion of ANWR is 7.06 billion barrels of oil in ANWR would also bring about environmental costs. These costs would consist largely of lost nonuse

Paris-Sud XI, Université de


N ordre 2012ISAL0052 Anne 2012 Fabrication et usage  

E-Print Network (OSTI)

. .................................................42 2. Changements et dérèglements climatiques, héritage d'un mode de vie. ........................44... ........................................................................................44 2.1.1. Le PRG et la transposition en équivalent CO2..................................................................................................109 4.4. Des conséquences prévisibles sur la facture des ménages


Fusion Energy Sciences Advisory Committee Dr. N. Anne Davies  

E-Print Network (OSTI)

of Energy's Office of Science #12;Fusion is part of SC's part of the American Competitiveness Initiative is improved." - Energy Policy Act of 2005, Sec. 972(b)(1)(E) Outreach to S&T Communities #12;Outreach to S of science and technology ­ No direct incentive for broader communities to initiate ­ Energy Policy Act


Microsoft Word - AnnOpsSumTM2008.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

T-976 CsI Timing Experiment T-971 LHCb Silicon Detector Upgrade T-953 U. Iowa Cerenkov Light Tests Two of these experiments, CALICE and MINERA, involved very significant...


Microsoft Word - S04877_AnnInspRpt2008.doc  

Office of Legacy Management (LM)

Properties Sites December 2008 This page intentionally left blank U.S. Department of Energy 2008 Annual Inspection-Monticello, Utah December 2008 Doc. No. S487700 Page i Contents...


Anne Harrington at Sandia National Labs | National Nuclear Security...  

National Nuclear Security Administration (NNSA)

Nuclear Security Administration Our Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure...


Deputy Administrator Anne Harrington on Completion of BN-350...  

National Nuclear Security Administration (NNSA)

including Deputy Foreign Minister Umarov, First Deputy Minister of Industry and New Technologies Rau, and the Kazakhstan Atomic Energy Committee Chairman Zhantikin. I would...


N d'ordre: *** Anne 2010 HABILITATION A DIRIGER  

E-Print Network (OSTI)

by 1 #12; Grenier [5], Brenier-Grenier [4] and, also by Bouchut-James who used in [3] the notion, World Scienti#12;c, Singapore 1994, 171-190. [2] F. Bouchut and F. James, One dimensional transport, (1998) 1073-1078. [4] Y. Brenier and E. Grenier, Sticky particles and scalar conservation laws, SIAM J

Paris-Sud XI, Université de


Powering Up the Women's Procurement Program Presenters: Ann Sullivan...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Articles of Organization and Amendments Operating Agreement, By-Laws, Stock Certificates, Stock Ledger and Voting Agreements Partnership Agreement and...


Adam Kochanski Mary Ann Jenkins Steve Krueger Adam ...  

Science Conference Proceedings (OSTI)

... Rawisond data (temperature humidity) Tower wind profile data (up to 30 m) The was initialized using: Tower wind profile data (up to 30 m) ...



College Of Visual And Performing Arts Ann Clark, Dean  

E-Print Network (OSTI)

and skin are made of a laminateconsisting of several brous layers. Layup details may in uence the adhesive

McConnell, Terry



E-Print Network (OSTI)

Indonesia: Sumatra 3301 suturalis Indonesia: Sumatra 1259 suturalis Uzbekistan 148 suturalis Czech Republic. 1016/j.tree.2008.05.001) Boer, A. J. & Duffels, J. P. 1996 Historical biogeography of the cicadas

Paris-Sud XI, Université de


AnnUAl reporT DTU in profile 2010  

E-Print Network (OSTI)

to electricity in the kW-range Indirect firing with Stirling engine or hot air turbines Gasification technology

Mosegaard, Klaus


Anne Harrington Announces $25 million for NSSC | National Nuclear...  

National Nuclear Security Administration (NNSA)

Nuclear Nonproliferation announces an award of 25 million to the University of California, Berkeley, to lead a multi-institution consortium that will support the nation's...


Thermal Conductivity Prediction of Nano Fluid Using ANN/GA  

Science Conference Proceedings (OSTI)

Abstract Scope, Thermal conductivities of nano fluid in a two-phase having different compositions of both base fluid as well as nano particles in a closed...

Note: This page contains sample records for the topic "ann arbor mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Microsoft Word - S06815_2010 Ann Rpt  

Office of Legacy Management (LM)

to stakeholder concerns that large storms could generate runoff from Many Devils Wash, causing contaminants to flush into the San Juan River, DOE installed an automated...


Anne Arundel County- Solar and Geothermal Equipment Property Tax Credit  

Energy.gov (U.S. Department of Energy (DOE))

This is a one-time credit from county property taxes on residential structures that use solar and geothermal energy equipment for heating and cooling and solar energy equipment for water heating...


Remarks by Deputy Administrator Anne M. Harrington at the Fourth...  

National Nuclear Security Administration (NNSA)

This will enable collaborative efforts with our world class researchers at our national labs. To attract the best and the brightest students, we plan to couple basic...


Microsoft Word - S08711_2011AnnRpt  

Office of Legacy Management (LM)

Office of Legacy Management, Grand Junction, Colorado, March. DOE (U.S. Department of Energy), 2012. Data Validation Package April 2011 Groundwater and Surface Water Sampling...


Gaurang Sethi, Lindsay Sharpe, Anne Shishkovsky, Tyson Timmer,  

E-Print Network (OSTI)

from US EPA's Emissions and Generation Resource Integrated Database (eGRID). Forecasted marginal carbon

Edwards, Paul N.


Anne B. Abell,1 and John M. Nichols2  

E-Print Network (OSTI)

of North Louisiana's tight- gas sand. Table 5 summarizes the petrophysical properties assumed-filtrate invasion on the simulated nuclear logs. The first field example is a tight-gas sand zone, which was drilled is another tight-gas sand zone, which was drilled with WBM. In this field example, it is not possible

Lange, David A.


Jill Ann Marshall The University of Texas, Austin  

E-Print Network (OSTI)

, R., Weaver, E.C. & Gans, D.M. (2010). Women and men of the Manhattan Project. The Physics Teacher, A.J. & Martin, H.T. (2010). Pre-service teachers' conceptions and enactments of Project Based Journal, 19(1), 45-76. Marshall, J.A., Pine, B. & Taylor, W.W.L (2007). INSPIRE: A VLF radio project

Lightsey, Glenn


Jo Ann Baumgartner and Sam Earnshaw: Organizers and Farmers  

E-Print Network (OSTI)

Janet Brians chaired and Dale Coke was there, and maybe Kenwith Janet Brians, Dale Coke, Ken Kimes, and Barney Bricmont

Rabkin, Sarah



v7DOE OIG SemiAnn RPT.qxd  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Cover Cover From left to right: A barge shown docked at Phillips Terminal at the Strategic Petroleum Reserve in Bryan Mound, Texas. Wind turbines at Storm Lake, Iowa. High pressure water being used to blast salt cake into manageable fragments in a waste tank mockup at the Hanford Site. The McNary Dam, which is one entity of the Bonneville Power Administration's responsibility for transmission and wholesale marketing of power generated at dams in the Federal River Power System. A sodium cooled reactor for testing fuels and materials under normal operating conditions at the Fast Flux Test Facility. Table of Contents Inspector General's Message . . . . . . . . . . . . . . . . . . . . . . . . . . . .1 Management Challenges . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .3


DOE OIG SemiAnn RPT 10-06.qxd  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

clockwise from top left) clockwise from top left) Wind power turbine located at Altamont Pass near Livermore, California The Gammasphere, designed to detect and analyze gamma rays, in the final assembly phase at Lawrence Berkeley National Laboratory Helicopter transporting power line equipment for the development of the Snettisham Project in Alaska Welding on a low beta quadropole magnet at Fermilab Dish solar power system at the Arizona Public Service Solar Test and Research Center Office of Inspector General Gregory H. Friedman Inspector General This report is also available on the Department of Energy/Office of Inspector General Website at http:/ /www.ig.energy.gov Department of Energy Washington, DC 20585 October 31, 2006 Tlie Honorable Samuel W. Bodnian Secretary U.S. Department of Energy


DOE Ann Perf Rpt 12-06.qxd  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

ANNUAL PERFORMANCE REPORT ANNUAL PERFORMANCE REPORT FY 2006 ANNUAL PERFORMANCE PLAN FY 2007 U.S. DEPARTMENT OF ENERGY OFFICE OF INSPECTOR GENERAL THIS PAGE INTENTIONALLY LEFT BLANK Message from the Inspector General I am pleased to present the Office of Inspector General's (OIG's) combined Fiscal Year 2006 Annual Performance Report and Fiscal Year 2007 Annual Performance Plan. During Fiscal Year (FY) 2006, we examined a variety of issues of vital importance to the Department of Energy and the Nation. Our efforts identified the need for corrective action on an array of issues ranging from systemic and situational vulnerabilities in Department security to cost and performance irregularities associated with the Nation's nuclear weapons stockpile to the need for improved management oversight in the administration of


DOE Ann Perf Rpt 11-08.qxd  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

PERFORMANCE REPORT PERFORMANCE REPORT FY 2008 ANNUAL PERFORMANCE PLAN FY 2009 U.S. DEPARTMENT OF ENERGY OFFICE OF INSPECTOR GENERAL THIS PAGE INTENTIONALLY LEFT BLANK Message from the Inspector General I am pleased to present the Office of Inspector General's (OIG) combined Fiscal Year 2008 Annual Performance Report and Fiscal Year 2009 Annual Performance Plan. During Fiscal Year (FY) 2008, we reviewed a variety of critical areas relevant to the Department's mission priorities. One of our goals, for example, was to examine possible programmatic improvements in Department operations relating to cyber security and contract management. Overall, our efforts resulted in the issuance of over 70 audit and inspection reports containing recommendations for enhancing Departmental operations,


DOE OIG SemiAnn RPT 10-07.qxd  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

General General Semiannual Report to Congress April 1, 2007 - September 30, 2007 U.S. DEPARTMENT OF ENERGY OFFICE OF INSPECTOR GENERAL DOE/IG-0053 Front Cover Photographs (Clockwise) Heliostats and Solar Two's tower collect and store enough thermal energy to produce electricity to power 10,000 homes. Construction of turbine/generator for hydroelectric plant. Drilling rig used in Department's Geothermal Geopressured Extraction Project to extract heated pressurized water and natural gas trapped below ground. The Mighty Mouse Robot at Sandia National Laboratory capable of withstanding intense radiation, maneuvering around obstacles, reaching into awkward places, and drilling into the ground. Biochip slide research conducted at Argonne National Laboratory to identify human and veterinary


Microsoft Word - S06815_2010 Ann Rpt  

Office of Legacy Management (LM)

6-1 6-1 6.0 References ATSDR (Agency for Toxic Substances and Disease Registry), 2004. Toxicological Profile for Strontium, U.S. Department Of Health And Human Services, Public Health Service, April. DOE (U.S. Department of Energy), 1994. Baseline Risk Assessment of Ground Water Contamination at the Uranium Mill Tailings Site at Shiprock, New Mexico, DOE/AL/62350-48F, Rev. 1, April. DOE (U.S. Department of Energy), 2000. Final Site Observational Work Plan for the Shiprock, New Mexico, UMTRA Project Site, GJO-2000-169-TAR, Rev. 2, Grand Junction Office, Grand Junction, Colorado, November. DOE (U.S. Department of Energy), 2002. Final Groundwater Compliance Action Plan for Remediation at the Shiprock, New Mexico, UMTRA Project Site, GJO-2001-297-TAR, Grand



NLE Websites -- All DOE Office Websites (Extended Search)

Role of Entrainment and Mixing in Altering the Role of Entrainment and Mixing in Altering the Relationship Between Aerosol Concentration and Cloud Drop Number Concentration J. E. Penner University of Michigan Ann Arbor, Michigan C. C. Chuang Lawrence Livermore National Laboratory Livermore, California Introduction Two basic methods have been used to relate the change in droplet number concentration to aerosol number concentration. The first method uses empirically derived relationships based on either observed aerosol number concentrations and droplet concentrations or observed aerosol sulfate or droplet mass concentrations and droplet number concentrations. This method was followed by Jones et al. (1994) and Boucher and Lohmann (1995). Jones et al. (1994) linked aerosol mass and droplet number concentration, while Boucher and Lohmann (1995) linked sulfate mass to droplet concentrations. The


Categorical Exclusion (CX) Determinations By Date | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

September 6, 2011 September 6, 2011 CX-006492: Categorical Exclusion Determination Dry Process Electrode Fabrication CX(s) Applied: B3.6 Date: 09/06/2011 Location(s): Ann Arbor, Michigan Office(s): Energy Efficiency and Renewable Energy, National Energy Technology Laboratory September 6, 2011 CX-006488: Categorical Exclusion Determination Chrysler Group LLC, Revised Specific Project Application 2, Retooling, Reequipping and Engineering CX(s) Applied: B1.31, B5.1 Date: 09/06/2011 Location(s): Auburn Hills, Michigan Office(s): Advanced Technology Vehicles Manufacturing Loan Program, Loan Guarantee Program Office September 6, 2011 CX-006501: Categorical Exclusion Determination Interstate 55 Corridor and City of Springfield Electric Vehicle Project CX(s) Applied: B5.1 Date: 09/06/2011



NLE Websites -- All DOE Office Websites (Extended Search)

Investigation of the Impact of Aerosols on Clouds During Investigation of the Impact of Aerosols on Clouds During the May 2003 Intensive Operational Period at the Southern Great Plains H. Guo, J.E. Penner, and M. Herzog Department of Atmospheric, Oceanic and Space Sciences University of Michigan Ann Arbor, Michigan Introduction The effect of aerosols on the clouds, or the so-called aerosol indirect effect (AIE), is highly uncertain (Penner et al. 2001). The estimation of the AIE can vary from 0.0 to -4.8 W/m 2 in global climate models (GCM). Therefore, it is very important to investigate these interactions and cloud-related physical processes further. The Aerosol Intensive Operational Period (AIOP) at the Southern Great Plains (SGP) site in May 2003 dedicated some effort towards the measurement of the Cloud Condensation Nucleus concentration (CCN)


Thordur Runolfsson  

NLE Websites -- All DOE Office Websites (Extended Search)

Thordur Runolfsson Thordur Runolfsson Electrical and Computer Engineering University of Oklahoma This speaker was a visiting speaker who delivered a talk or talks on the date(s) shown at the links below. This speaker is not otherwise associated with Lawrence Berkeley National Laboratory, unless specifically identified as a Berkeley Lab staff member. Thordur Runolfsson received the Bachelor of Science in Electrical and Computer Engineering and Mathematics at the University of Wisconsin in 1983 and Ph.D. in EE-Systems from The University of Michigan, Ann Arbor in 1988. He was a tenure track faculty (Assistant and Associate Professor) in Electrical and Computer Engineering at The Johns Hopkins University from 1989-1997, was a Research Professor at the University of Iceland, worked in


11Fermi 2/19/99  

NLE Websites -- All DOE Office Websites (Extended Search)

FERMINEWS FERMINEWS February 19, 1999 Sonal Saghani of Chicago envisioned a concert series demonstrating the relationship of music to science, focusing on the physics of sound, including physicists as guest lecturers explaining the connections. She chose a music magazine, The Strad, whose readers are mostly female, in their 20s and 30s. Take a fresh look at PA RT I C L E P H Y S I C S. FERMINEWS February 19, 1999 9 Ling Yang of Ann Arbor, Michigan, incorporated the sculpture and unusual structures of the Lab into a feature article for Architectural Digest. The magazineÕs readers (median age 43, with 54% college graduates) are not primarily architects, she noted, but they do have a pronounced appreciation for design, color and aesthetics. by Mike Perricone When itÕs fully operational, the upgraded control room of FermilabÕs Central


Categorical Exclusion (CX) Determinations By Date | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

September 29, 2011 September 29, 2011 CX-006906: Categorical Exclusion Determination Electricity Delivery and Energy Reliability Assistance to State Regulatory Utility Commissioners CX(s) Applied: A9, A11, A12 Date: 09/29/2011 Location(s): District of Columbia Office(s): Electricity Delivery and Energy Reliability, National Energy Technology Laboratory September 29, 2011 CX-006904: Categorical Exclusion Determination Look-Ahead Driver Feedback and Powertrain Management CX(s) Applied: B3.6 Date: 09/29/2011 Location(s): Oak Ridge, Tennessee Office(s): Energy Efficiency and Renewable Energy September 29, 2011 CX-006903: Categorical Exclusion Determination Look-Ahead Driver Feedback and Powertrain Management CX(s) Applied: B3.6 Date: 09/29/2011 Location(s): Ann Arbor, Michigan Office(s): Energy Efficiency and Renewable Energy, National Energy

Note: This page contains sample records for the topic "ann arbor mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


CX-008901: Categorical Exclusion Determination | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

901: Categorical Exclusion Determination 901: Categorical Exclusion Determination CX-008901: Categorical Exclusion Determination Michigan-City-Ann Arbor CX(s) Applied: A1, A9, A11, B1.32, B5.1, B5.17 Date: 08/23/2012 Location(s): Michigan Offices(s): Energy Efficiency and Renewable Energy 1) Financial incentive program-Property Assessed Clean Energy (PACE) Program to offer low-interest financing to property owners (residential and small businesses) for renewable energy and/or energy savings improvements; commercial energy revolving loan program; energy audits of small commercial buildings and provide matching funds to implement efficiency upgrades; and community awareness and education, 2) Light-emitting diode (LED) streetlight retrofits, and 3) solar hot water and install an approximately 8 kilowatt solar photovoltaic system on the roof of Fire Station #6.


Calendar of Events | Advanced Photon Source  

NLE Websites -- All DOE Office Websites (Extended Search)

Calendar of Events beta Calendar of Events beta January 2014 Sun Mon Tue Wed Thu Fri Sat 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 [ Previous Events ] RSS iCalendar hcalendar supported Also available in RSS and iCalendar formats. To report an event that is not listed, contact webmaster. Upcoming Jan 13 Monday Engineering the Elasticity of Soft Colloidal Materials Through Surface Modification and Shape Anisotropy Speaker: Lillian C. Hsiao, University of Michigan, Ann Arbor XSD Presentation 401/A1100 @ 11:00 AM View Description Designing complex fluids has always involved the arduous manipulation of system-specific parameters. Recently, we developed a general correlation to predict the flow behavior of a range of soft matter based on their microstructure. By applying the framework of structural rigidity at the


Solarization/conservation technology development for existing housing. Progress report  

DOE Green Energy (OSTI)

The project objectives are: to develop a method for evaluationg existing residences for their energy solarization/conservation potential as well as carrying out the solarization/conservation work within context of the Community Development program; and to demonstrate appropriate methods of utilizing solar energy in existing Ann Arbor residences beyond that obtainable in a good conservation program. A general progress update is presented covering tasks related to community solarization/conservation characteristics and community system analysis and development. The process of selection and technical evaluation of houses for solarization/conservation project directed retrofit is described. A detailed report on the survey of utility data and a report on the solarization/conservation site audits are included. A detailed comparison of the audit data for both the audit and control group are appended. (LEW)

Oberdick, W.



Solarization/conservation technology development program for existing housing. Progress report  

DOE Green Energy (OSTI)

A four month period of project organization, data file examination, development of concepts and technical study of S/C components is covered. At the start of the project 188 residences were considered appropriate for study in this program. All of these houses in the course of three years have had code update assistance. This has included some conservation retrofit. The City of Ann Arbor has been selected for a pilot study of the RCS Audit program. As of this date an initial 200 audits have been completed. Also, the C D office is presently undertaking the conservation retrofit of several residences in accordance with RCS recommendations. Available aerial photographs have proved to be inadequate for solar-site evaluation. The conservation updates and the RCS audits present an opportunity for evaluation and comparisons.

Oberdick, W.



A valiant little terminal: A VLT user's manual  

Science Conference Proceedings (OSTI)

VLT came to be used at SLAC (Stanford Linear Accelerator Center), because SLAC wanted to assess the Amiga's usefulness as a color graphics terminal and T{sub E}X workstation. Before the project could really begin, the people at SLAC needed a terminal emulator which could successfully talk to the IBM 3081 (now the IBM ES9000-580) and all the VAXes on the site. Moreover, it had to compete in quality with the Ann Arbor Ambassador GXL terminals which were already in use at the laboratory. Unfortunately, at the time there was no commercial program which fit the bill. Luckily, Willy Langeveld had been independently hacking up a public domain VT100 emulator written by Dave Wecker et al. and the result, VLT, suited SLAC's purpose. Over the years, as the program was debugged and rewritten, the original code disappeared, so that now, in the present version of VLT, none of the original VT100 code remains.

Weinstein, A.




NLE Websites -- All DOE Office Websites (Extended Search)

the Aerosol Indirect Effect During the the Aerosol Indirect Effect During the Atmospheric Radiation Measurement Program's March 2003 Aerosol Intensive Operational Period at the Southern Great Plains: Sensitivity Tests H. Guo and JE Penner Department of Atmospheric, Oceanic, and Space Sciences University of Michigan Ann Arbor, Michigan Introduction Clouds and their related physical processes present perhaps the most complicated and perplexing problems in the study of climate change and weather forecasting (Stephens 2005). One important cloud- related process is the aerosol-cloud-radiation interaction, or the so-called aerosol indirect effect (AIE). The AIE is estimated to vary from 0.0 to -4.8 W/m 2 in state-of-the-art global climate models (Penner et al. 2001). The uncertainty in this estimation has stimulated substantial research in recent years. Most


Categorical Exclusion Determinations: Golden Field Office | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

September 15, 2011 September 15, 2011 CX-006800: Categorical Exclusion Determination Solar Grade Silicon from Agricultural Byproducts CX(s) Applied: B3.6 Date: 09/15/2011 Location(s): Ann Arbor, Michigan Office(s): Energy Efficiency and Renewable Energy, Golden Field Office September 13, 2011 CX-006798: Categorical Exclusion Determination Energy Efficiency and Conservation Block Grant Program: Activity 4 - Government Building Demonstration Projects CX(s) Applied: B5.1 Date: 09/13/2011 Location(s): Louisville, Kentucky Office(s): Energy Efficiency and Renewable Energy, Golden Field Office September 9, 2011 CX-006807: Categorical Exclusion Determination Energy Production with Innovative Methods of Geothermal Heat Recovery CX(s) Applied: A9 Date: 09/09/2011 Location(s): Texas Office(s): Energy Efficiency and Renewable Energy, Golden Field Office


Argonne, Evigia finalize licensing agreement for next-gen RFID sensor  

NLE Websites -- All DOE Office Websites (Extended Search)

See related See related New RFID technology tracks and monitors nuclear materials Argonne, Evigia finalize licensing agreement for next-gen RFID sensor technology By Angela Hardin * July 16, 2012 Tweet EmailPrint System enables monitoring, tracking and securing of nuclear material ANN ARBOR, Mich. and ARGONNE, Ill. (July 16, 2012)-Evigia Systems and the U.S. Department of Energy's (DOE) Argonne National Laboratory announced today that they have finalized a licensing agreement under which Argonne's patented, application-specific radio-frequency identification (RFID) sensor/seal technology and its custom-developed ARG-US software suite will be further developed and marketed by Evigia as a comprehensive nuclear and hazardous material handling solution. The system, jointly developed by Evigia and Argonne, adds sophisticated


Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

91 - 5900 of 28,905 results. 91 - 5900 of 28,905 results. Download CX-005232: Categorical Exclusion Determination Recovery Act - Clean Energy Coalition Michigan Green Fleets CX(s) Applied: B5.1 Date: 02/11/2011 Location(s): Ypsilanti, Michigan Office(s): Energy Efficiency and Renewable Energy, National Energy Technology Laboratory http://energy.gov/nepa/downloads/cx-005232-categorical-exclusion-determination Download CX-005233: Categorical Exclusion Determination Recovery Act - Clean Energy Coalition Michigan Green Fleets CX(s) Applied: B5.1 Date: 02/11/2011 Location(s): Ann Arbor, Michigan Office(s): Energy Efficiency and Renewable Energy, National Energy Technology Laboratory http://energy.gov/nepa/downloads/cx-005233-categorical-exclusion-determination Download CX-005234: Categorical Exclusion Determination


Comparison of the Vertical Velocity Used to Calculate the Cloud Droplet Number Concentration in a Cloud Resolving and a Global Climate Model  

NLE Websites -- All DOE Office Websites (Extended Search)

Comparison of the Vertical Velocity Comparison of the Vertical Velocity used to Calculate the Cloud Droplet Number Concentration in a Cloud-Resolving and a Global Climate Model H. Guo, J. E. Penner, M. Herzog, and X. Liu Department of Atmospheric, Oceanic and Space Sciences University of Michigan Ann Arbor, Michigan Introduction Anthropogenic aerosols are effective cloud condensation nuclei (CCN). The availability of CCN affects the initial cloud droplet number concentration (CDNC) and droplet size; therefore, cloud optical properties (the so-called first aerosol indirect effect). However, the estimate of CDNC from a mechanistic treatment shows significant differences from the empirical schemes mainly due to the large bias of the large-scale vertical velocity (w) (Ghan et al. 1993, 1995; Boucher and Lohmann 1995;


Categorical Exclusion (CX) Determinations By Date | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

23, 2009 23, 2009 CX-000204: Categorical Exclusion Determination Manufacturing Industrial Development for the Alternative Energy Systems CX(s) Applied: A9, A11 Date: 11/23/2009 Location(s): Ann Arbor, Michigan Office(s): Energy Efficiency and Renewable Energy, Golden Field Office November 23, 2009 CX-000203: Categorical Exclusion Determination Health Lab Heat Recovery CX(s) Applied: B5.1 Date: 11/23/2009 Location(s): South Dakota Office(s): Energy Efficiency and Renewable Energy, Golden Field Office November 23, 2009 CX-000202: Categorical Exclusion Determination Energy Efficiency and Renewable Energy in Schools CX(s) Applied: B5.1 Date: 11/23/2009 Location(s): Arizona Office(s): Energy Efficiency and Renewable Energy, Golden Field Office November 23, 2009 CX-000201: Categorical Exclusion Determination


Argonne TTRDC - News Story - Lohse-Busch named Outstanding Researcher by  

NLE Websites -- All DOE Office Websites (Extended Search)

Lohse-Busch named Outstanding Researcher by EPA Lohse-Busch named Outstanding Researcher by EPA Henning Lohse-Busch Lohse-Busch Argonne researcher Henning Lohse-Busch was given an Outstanding Researcher Award by the US Environmental Protection Agency (EPA) for his work supporting the 2011 EcoCAR Challenge collegiate competition. Lohse-Busch provides technical guidance on hybrid electric vehicle (HEV) dynamometer testing to the EcoCAR organizing committee. Sharing this technical expertise was especially relevant to the EPA, which is testing the student competition vehicles during EcoCAR's Spring Workshop in Ann Arbor, Mich. in March. The award recognizes Lohse-Busch's assistance and reads: "Outstanding Researcher Award: The US Environmental Protection Agency recognizes Henning Lohse-Busch for outstanding contributions in PHEV


Beyond Laboratories, Beyond Being Green  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Beyond Laboratories Beyond Laboratories Beyond Being Green The International Institute for Sustainable Laboratories Laboratories for the 21 st Century (Labs21 ® ) A U.S. Environmental Protection Agency and U.S. Department of Energy Co-Sponsored Program Promoting the Design, Engineering and Construction of High Performance, Low Energy Laboratories What is Labs21? * Genesis: Ann Arbor, Michigan ESPC * A joint EPA/DOE partnership program to improve the energy and environmental performance of U.S. laboratories. * Encourages the design, construction, and operation of sustainable, high- performance, high-tech facilities that will: - Minimize overall environmental impacts. - Protect occupant safety. - Optimize whole building efficiency on a lifecycle basis. Purpose of I 2 SL I 2 SL's Role in Labs21



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

FUTURE of UNVERSITY NUCLEAR ENGINEERING PROGRAMS FUTURE of UNVERSITY NUCLEAR ENGINEERING PROGRAMS and UNIVERSITY RESEARCH & TRAINING REACTORS Michael L.Corradini, Chair Associate Dean, College of Engineering University of Wiscsonsin, Madison Marvin L. Adams, Professor Nuclear Engineering Department Texas A&M University Donald E. Dei, Chief Physicist United States Naval Nuclear Propulsion Program Tom Isaacs, Senior Scientist Lawrence Livermore National Laboratory Glenn Knoll, Professor Department of Nuclear Engineering and Radiological Sciences University of Michgan, Ann Arbor Warren F. Miller Senior Advisor to the Laboratory Director Los Alamos National Laboratory Kenneth C. Rogers, Commissioner (Retired) United States Nuclear Regulatory Commission 2 2 3 3 EXECUTIVE SUMMARY Nuclear engineering programs and departments with an initial emphasis in fission were formed in the late


Alternative Fuels Data Center: Michigan Fleet Reduces Gasoline and Diesel  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

Michigan Fleet Reduces Michigan Fleet Reduces Gasoline and Diesel Use to someone by E-mail Share Alternative Fuels Data Center: Michigan Fleet Reduces Gasoline and Diesel Use on Facebook Tweet about Alternative Fuels Data Center: Michigan Fleet Reduces Gasoline and Diesel Use on Twitter Bookmark Alternative Fuels Data Center: Michigan Fleet Reduces Gasoline and Diesel Use on Google Bookmark Alternative Fuels Data Center: Michigan Fleet Reduces Gasoline and Diesel Use on Delicious Rank Alternative Fuels Data Center: Michigan Fleet Reduces Gasoline and Diesel Use on Digg Find More places to share Alternative Fuels Data Center: Michigan Fleet Reduces Gasoline and Diesel Use on AddThis.com... Feb. 11, 2010 Michigan Fleet Reduces Gasoline and Diesel Use D iscover how the City of Ann Arbor reduced municipal fleet gas and diesel


University of Michigan Hydrodynamics | Open Energy Information  

Open Energy Info (EERE)

Hydrodynamics Hydrodynamics Jump to: navigation, search Hydro | Hydrodynamic Testing Facilities Name University of Michigan Address 1085 South University Avenue Place Ann Arbor, Michigan Zip 48109 Sector Hydro Phone number (734) 764-9432 Website http://www.engin.umich.edu/dep Coordinates 42.2757556°, -83.7362041° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.2757556,"lon":-83.7362041,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Download Fuel Economy Data  

NLE Websites -- All DOE Office Websites (Extended Search)

Download Fuel Economy Data Download Fuel Economy Data Fuel economy data are the result of vehicle testing done at the Environmental Protection Agency's National Vehicle and Fuel Emissions Laboratory in Ann Arbor, Michigan, and by vehicle manufacturers with oversight by EPA. 2013 Ford C-MAX Hybrid Data Revised (August 15, 2013) 2011-2013 Hyundai and Kia data revised (November 2, 2012) Downloadable Fuel Economy Data Find and Compare Cars data - MPG data for all 1984-2014 vehicles (Updated: Friday December 20 2013) For Developers: Fueleconomy.gov Web Services CSV: /feg/epadata/vehicles.csv.zip (Documentation) XML: /feg/epadata/vehicles.xml.zip (Documentation) Fuel Economy Datafile* Fuel Economy Guide Adobe Acrobat Icon Green Vehicle Guide Datafile Green Vehicle Guide Adobe Acrobat Icon


Categorical Exclusion Determinations: Michigan | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

15, 2011 15, 2011 CX-006800: Categorical Exclusion Determination Solar Grade Silicon from Agricultural Byproducts CX(s) Applied: B3.6 Date: 09/15/2011 Location(s): Ann Arbor, Michigan Office(s): Energy Efficiency and Renewable Energy, Golden Field Office September 13, 2011 CX-006761: Categorical Exclusion Determination Graduate Automotive Technology Education Center for Electric Drive Transportation CX(s) Applied: A9, A11, B3.6 Date: 09/13/2011 Location(s): Dearborn, Michigan Office(s): Energy Efficiency and Renewable Energy, National Energy Technology Laboratory September 9, 2011 CX-006799: Categorical Exclusion Determination Energy Efficiency and Renewable Energy Loan/Tech Demo Program - Delphi CX(s) Applied: B5.1 Date: 09/09/2011 Location(s): Auburn Hills, Michigan Office(s): Energy Efficiency and Renewable Energy, Golden Field Office


X-ray Science Division Seminars and Presentations | Advanced Photon Source  

NLE Websites -- All DOE Office Websites (Extended Search)

XSD Seminars XSD Seminars XSD Seminars are an open forum where speakers from the U.S. and abroad, as well as XSD, present their latest research. All are cordially invited to attend. Also available in iCalendar formats. To report an event that is not listed, contact webmaster. Upcoming Jan 13 Monday Engineering the Elasticity of Soft Colloidal Materials Through Surface Modification and Shape Anisotropy Speaker: Lillian C. Hsiao, University of Michigan, Ann Arbor XSD Presentation 401/A1100 @ 11:00 AM View Description Designing complex fluids has always involved the arduous manipulation of system-specific parameters. Recently, we developed a general correlation to predict the flow behavior of a range of soft matter based on their microstructure. By applying the framework of structural rigidity at the


Microsoft Word - Chuang-CC.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

Model Simulations of the First Aerosol Indirect Effect Model Simulations of the First Aerosol Indirect Effect and Comparison of Cloud Susceptibility to Satellite Measurements C. C. Chuang Lawrence Livermore National Laboratory Livermore, California J. E. Penner University of Michigan Ann Arbor, Michigan K. Kawamoto National Aeronautics and Space Administration Langley Research Center Hampton, Virginia Introduction Present-day global anthropogenic emissions contribute more than half of the mass in sub-micron particles primarily due to sulfate and carbonaceous aerosol components derived from fossil fuel combustion and biomass burning. These anthropogenic aerosols modify the microphysics of clouds by serving as cloud condensation nuclei and enhance the reflectivity of low-level water clouds, leading to a

Note: This page contains sample records for the topic "ann arbor mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



NLE Websites -- All DOE Office Websites (Extended Search)

ARM Data to Verify the Modification ARM Data to Verify the Modification of Clouds by Aerosols J. E. Penner Department of Atmospheric Oceanic and Space Sciences University of Michigan Ann Arbor, Michigan K. E. Grant and C. C. Chuang Lawrence Livermore National Laboratory Livermore, California Introduction The goal of our project is to use the Atmospheric Radiation Measurement (ARM) data to examine how aerosols alter the reflection of sunlight by clouds. In order to carry through with this goal, we have selected data from the Southern Great Plains (SGP) ARM site. The data include total liquid water path (from the Microwave Radiometer), temperature, pressure, and relative humidity profiles (from the atmospheric sonde data), surface aerosol concentration (from the optical particle counter [OPC]


TTRDC - Publications - TransForum Volume 11 Number 1  

NLE Websites -- All DOE Office Websites (Extended Search)

EcoCAR Tackles Dynamometer Testing at the Year Three Spring Workshop EcoCAR Tackles Dynamometer Testing at the Year Three Spring Workshop By Dana Bubonovich, Assistant Communications Specialist, EcoCAR, Argonne National Laboratory ecocar teams Participants from the sixteen EcoCAR teams at the 2011 Spring Workshop. Larger image. In March, sixteen EcoCAR teams from various universities traveled to Ann Arbor, Mich., to attend the two-week Spring Workshop hosted by the U.S. Environmental Protection Agency (EPA) at its National Vehicle and Fuel Emissions Laboratory (NVFEL). During this time, each EcoCAR team tested its vehicle on a chassis dynamometer. Prior to the start of the workshop, each team put together a test plan describing the drive cycles on which its vehicle would be tested. Possible drive cycles included EPA certification-type cycles, such as


Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

71 - 17680 of 31,917 results. 71 - 17680 of 31,917 results. Download CX-002738: Categorical Exclusion Determination Delivering Advanced Modeling and Simulation Capabilities to United States Manufacturers CX(s) Applied: A9, A11 Date: 06/17/2010 Location(s): Ann Arbor, Michigan Office(s): Energy Efficiency and Renewable Energy, National Energy Technology Laboratory http://energy.gov/nepa/downloads/cx-002738-categorical-exclusion-determination Download CX-002740: Categorical Exclusion Determination Coal Use By-Product Characterization Lab Decommissioning CX(s) Applied: B3.6 Date: 06/17/2010 Location(s): Morgantown, West Virginia Office(s): Fossil Energy, National Energy Technology Laboratory http://energy.gov/nepa/downloads/cx-002740-categorical-exclusion-determination Download CX-002743: Categorical Exclusion Determination


Ardesta | Open Energy Information  

Open Energy Info (EERE)

Ardesta Ardesta Jump to: navigation, search Logo: Ardesta Name Ardesta Address 201 South Main Street, 10th Floor Place Ann Arbor, Michigan Zip 48104 Product Venture capital. Number of employees 1-10 Year founded 2000 Phone number (734) 994-7000 Website http://www.ardesta.com/ Coordinates 42.280119°, -83.748393° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.280119,"lon":-83.748393,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


DTE Energy Ventures | Open Energy Information  

Open Energy Info (EERE)

DTE Energy Ventures DTE Energy Ventures Name DTE Energy Ventures Address 414 S.Main Street, Suite 600 Place Ann Arbor, Michigan Zip 48104 Product Venture capital Phone number (734) 302-5309 Website http://www.dteenergyventures.c Coordinates 42.277198°, -83.749123° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.277198,"lon":-83.749123,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}



Office of Legacy Management (LM)

Adrian, Michigan, Site (formerly the General Adrian, Michigan, Site (formerly the General Motors Site) is located at 1450 E. Beecher Street, on the eastern side of Route 52 in Adrian, Michigan. The town of Adrian is approximately 20 miles southwest of Ann Arbor and 30 miles northwest of Toledo, Ohio. The site encompasses the former General Motors (GM) plant, a large complex covering approximately 17 acres. During the 1950s, the previous owner of the site, the Bridgeport Brass Company, machined and shaped uranium metal under contract with the U.S. Atomic Energy Commission (AEC) for the fabrication of reactor fuel elements in the Hanford, Washington, and Savannah River, South Carolina, nuclear reactors. (The site was sold to Martin Marietta in the early 1960s and then to GM in 1974). At the end of the contract, the



NLE Websites -- All DOE Office Websites (Extended Search)

11, 2008 11, 2008 Steven Woodruff, a research chemist at the U.S. Department of Energy's National Energy Technology Laboratory (NETL), is one of the inventors of a laser spark distribution and ignition system developed at NETL which has recently been issued a patent. Woodruff, a resident of Morgantown, WV, received his BS from the University of Michigan, Dearborn Campus, and MS and PhD in chemistry from the University of Michigan, Ann Arbor. NETL has previously demonstrated that laser spark ignition can be used to reduce Nitrogen Oxide emissions and improve performance of Natural Gas Fired engines. Laser sparks provide more spark energy than conventional electric spark systems which enables engine operation at leaner conditions resulting in lower emissions. The missing component


Qu gusto me da sentir tu voz: Restarting the Dialog that Diaspora Interrupted  

E-Print Network (OSTI)

Arbor: The University of Michigan Press, 1995), pp 44- 10.University Press of Michigan Press. Hedges, Christopher.Arbor: The University of Michigan Press. Braidotti, Rosi.

Cardenas, Yvonne



Issue 225 29 October 2010 SharingstoriesofImperial'scommunity Recognising  

E-Print Network (OSTI)

Luening, Dorothy Hodgskiss Mac Gregor, Susan Ann Makela, Carole June Mezera, Margaret Anne Muehr, June N


The Developmental Significance of Adolescent Romantic Relationships: Parent and Peer Predictors of Engagement and Quality at Age 15  

E-Print Network (OSTI)

Madison), A. Vijaya Rao (RTI International), Glenn I.Arbor), Bonnie Knoke (RTI International), Tama Leventhal (

Roisman, Glenn I.; Booth-LaForce, Cathryn; Cauffman, Elizabeth; Spieker, Susan



Hydrogen Storage in Metal-Organic Frameworks - DOE Hydrogen and Fuel Cells Program FY 2012 Annual Progress Report  

NLE Websites -- All DOE Office Websites (Extended Search)

7 7 FY 2012 Annual Progress Report DOE Hydrogen and Fuel Cells Program Jeffrey Long (Primary Contact), Martin Head-Gordon Lawrence Berkeley National Laboratory 1 Cyclotron Road Berkeley, CA 95720 Phone: (510) 642-0860 Email: jrlong@berkeley.edu DOE Managers HQ: Ned Stetson Phone: (202) 586-9995 Email: Ned.Stetson@ee.doe.gov GO: Jesse Adams Phone: (720) 356-1421 Email: Jesse.Adams@go.doe.gov Subcontractors: * National Institute of Standards and Technology, Gaithersburg, MD (Craig Brown) * General Motors Corporation, Warren, MI (Anne Dailly) Project Start Date: April 1, 2012 Project End Date: March 31, 2015 Fiscal Year (FY) 2012 Objectives


May All Good Things Gather Here: Life, Religion and Marriage in a Mi nyag Tibetan Village  

E-Print Network (OSTI)

;#15; #29;#31;#3;#14;#12; 3 #11;#5;#12;#6;#3;#20; #8;#20; #31;#6;#7; #29;#7;#5;8#16;#11;#3; #14; #15;#7;#5;#14;#3;#19;#5;#17;.#7;#5; #5;#14; #14;#5;#7;#8; #5;#7;#8;#11;#12; #6;#5;#20;#5;9 : ?@AB@A : >C?DEFGH@AB@A : CIH@AB@A : EKDLMAB@A : N...

Bkra shis bzang po



Ruofan Wu, Hieu Pham Trung Nguyen and Zetian Mi INTRODUCTION TO LEDs  

E-Print Network (OSTI)

-in-a-Wire Light Emitting Diodes and Prevention Method Nano-electronic Devices and Materials, Electrical Computer., Efficiency droop in nitride-based light-emitting diodes. Physica Status Solidi a-Applications and Materials history. Nature Photonics 2007, 1 (4), 189-192. [4] Holonyak, N., Is the light emitting diode (LED

Barthelat, Francois


"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn  

E-Print Network (OSTI)

May ________. A vistas la pornografa. Primera Hora, 22la medida contra la pornografa. El Nuevo Da, 13 Junecomunicacin contra la pornografa. El Nuevo Da, 16 May

Rivera, Petra Raquel



Classes Are Starting Soon! Prof"..roMI Photography G,aph~ o..,rgn  

E-Print Network (OSTI)

Simone Gori and Val HamburQer, then atthe UnOiersily of FreiburQ in Germany, is a noyel Yariation ofthe .... S~deshows > Mind~Br'" Combiml1iOll of the RO'il1illU_liKed_lilies ""d Enigma Gori and HamburQer


Superfund Record of Decision (EPA Region 5): Wash King Laundry, Baldwin, MI, March 1993  

SciTech Connect

This decision document presents the selected remedial action for the Wash King Laundry Superfund site in Baldwin, Pleasant Plains Township, Michigan. The groundwater remedial action consists of the following: groundwater monitoring; deed restrictions; and groundwater extraction with physical/chemical treatment. The lagoon remedial action consists of the following: excavation of contaminated sediments and soils and off-site disposal.



Characterization of UNUSUAL LATERAL ORGANS : a miRNA regulated F-Box protein  

E-Print Network (OSTI)

between ULO and the HD-ZIP proteins in planta. Anotherof homodomain-leucine zipper (HD-Zip) proteins. Plant SignalKANADI and class III HD-Zip gene families regulate embryo

Smith, Peter Thomas



Integrated modeling within a Hydrologic Information System: An OpenMI based approach  

Science Conference Proceedings (OSTI)

This paper presents a prototype software system for integrated environmental modeling that provides interoperability between the Consortium of Universities for the Advancement of Hydrologic Science, Inc. (CUAHSI) Hydrologic Information System (HIS) and ... Keywords: Data management, Environmental management, Integrated modeling, Systems analysis

Anthony M. Castronova; Jonathan L. Goodall; Mehmet B. Ercan




co-fabricated filtration system for enhancement of ... increases functionality and integration of micro ... for the U.S. Department of Energys National Nuclear ...


Informa(on and Resources Water Quality and Mi/ga/on: Bifenthrin and Fipronil  

E-Print Network (OSTI)

strategy, Pesticides fluxes, Surface water, Vineyard Introduction The intensive use of pesticides for crop on the mobilisation of pesticides and total fluxes in surface water. Moreover, the effect of the sampling strategy ranged from 1.0 to 60 g. Effect of sampling strategy on the estimation of pesticides fluxes in the river

Hammock, Bruce D.

Note: This page contains sample records for the topic "ann arbor mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Nitrate-responsive miR393/AFB3 regulatory module controls root system architecture in  

E-Print Network (OSTI)

Universidad Católica de Chile, Santiago 8331010, Chile; b Department of Plant and Soil Sciences, Delaware activated cell sorter (FACS) and extracted total RNA as described previously (9). KNO3 treat- ment induced

Green, Pamela


UCRL-MI-224010 ARM-06-012 ARM's Support for GCM Improvement:...  

NLE Websites -- All DOE Office Websites (Extended Search)

updrafts. Because the total mass of water condensed into clouds is controlled by thermodynamics, a greater number of droplets for the same mass of cloud water means that the...


"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn  

E-Print Network (OSTI)

Puertorriquea. Humacao, Puerto Rico: Editorial Furidi,and Colonization of Puerto Rico, 1493-1599. San Juan: Centroand U.S. Imperialism in Puerto Rico. Berkeley: University of

Rivera, Petra Raquel



"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn.  

E-Print Network (OSTI)

??My dissertation examines entanglements of race, place, gender, and class in Puerto Rican reggaetn. Based on ethnographic and archival research in San Juan, Puerto Rico, (more)

Rivera, Petra Raquel



Technical Section: CHuMI viewer: Compressive huge mesh interactive viewer  

Science Conference Proceedings (OSTI)

The preprocessing of large meshes to provide and optimize interactive visualization implies a complete reorganization that often introduces significant data growth. This is detrimental to storage and network transmission, but in the near future could ... Keywords: Interactive visualization, Large meshes, Lossless compression, Out-of-core

Clment Jamin; Pierre-Marie Gandoin; Samir Akkouche



LAT HING MI RO OPTI AL SWIT H - Home - Energy Innovation ...  

owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2013-10084P


Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

DOE Green Energy (OSTI)

gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



ANRV286-MI60-17 ARI 25 May 2006 23:56 The Bacterial  

E-Print Network (OSTI)

Molecular Genetics and Microbiology, University of Texas, Austin, Texas 78712-0231; email: philipl energy-transducing membranes (133). It is widespread within the microbial world and in plants. Homologs

Georgiou, George


Microsoft Word - S03623_2007AnnRep_091007.doc  

Office of Legacy Management (LM)

______________________________________________________________________________________________________ Well Id Collect Depth to Water Well Id Collect Depth to Water Date Water Elevation Date Water Elevation ______________________________________________________________________________________________________ 0200 10/05/04 7.27 6755.42 31SW93-197-5 04/24/00 43.16 6866.08 04/07/05 5.22 6757.47 07/26/00 43.59 6865.65 10/04/05 5.26 6757.43 04/10/01 43.39 6865.85 04/05/06 6.90 6755.79 07/09/01 43.53 6865.71


Microsoft Word - S07834_2011 Ann Rpt_ag comment revs  

Office of Legacy Management (LM)

Doc. No. S07834 Doc. No. S07834 Page 57 3.0 Remediation System Performance This section describes the key components of the floodplain and terrace groundwater remediation systems and summarizes their performance for the 2010-2011 reporting period. 3.1 Floodplain Remediation System The floodplain remediation system consists of the three major components shown in Figure 1: two extraction wells (wells 1089 and 1104); two drainage trenches (horizontal wells), Trench 1 and Trench 2; and a sump (collection drain) used to collect discharges from seeps 0425 and 0426 on the escarpment. The objective of the floodplain groundwater extraction system is to reduce the mass of COCs in alluvial groundwater near the San Juan River and to lessen exposure and potential risks to aquatic life. All groundwater collected from the floodplain extraction wells and


Microsoft Word - S07834_2011 Ann Rpt_ag comment revs  

Office of Legacy Management (LM)

3 3 4.0 Performance Summary This section summarizes the findings of the most recent (April 2010 through March 2011) assessment of the floodplain and terrace groundwater remediation systems at the Shiprock site, marking the end of the eighth year of active groundwater remediation. * Groundwater in the floodplain system is currently being extracted from two wells (wells 1089 and 1104) adjacent to the San Juan River north of the disposal cell, two collection trenches (Trench 1 and Trench 2), and a seep collection sump. Approximately 8.6 million gallons of groundwater were extracted from the floodplain aquifer system during this performance period, yielding a cumulative total of about 74 million gallons extracted from the floodplain since March 2003.


Microsoft Word - S03623_2007AnnRep_091007.doc  

Office of Legacy Management (LM)

OU III Ground Water Model-Predicted OU III Ground Water Model-Predicted Uranium Concentrations This page intentionally left blank Page H-3 Table H-1. Uranium Concentration Variation: Background Locations Observations Loc 92-01 Loc 92-03 Loc 92-05 Loc MW00-01 Loc MW00-02 Date Sampled Uranium (mg/L) Uranium (mg/L) Uranium (mg/L) Uranium (mg/L) Uranium (mg/L) 11/12/1992 0.0058 0.0048 03/08/1993 0.0049 04/22/1993 0.0062 07/20/1993 0.0046 07/22/1993 0.0031 10/26/1993 0.0063 0.0053 10/27/1993 0.0028 05/02/1994 0.0053 0.0057 10/04/1994 0.006 0.0033 10/05/1994 0.0058 04/18/1995 0.0039 04/19/1995 0.005 0.0025 04/08/1996 07/23/1996 10/13/1997 0.0061 10/14/1997 04/21/1998


Microsoft Word - S07834_2011 Ann Rpt_ag comment revs  

Office of Legacy Management (LM)

1 1 1.0 Introduction This report evaluates the performance of the groundwater remediation system at the Shiprock, New Mexico, Disposal and Processing Site for the period April 2010 through March 2011. The Shiprock site, a former uranium-ore processing facility under the Uranium Mill Tailings Radiation Control Act (UMTRCA), is managed by the U.S. Department of Energy (DOE) Office of Legacy Management (LM). The mill operated from 1954 to 1968; mill tailings were contained in an engineered disposal cell in 1986. As a result of milling operations, groundwater in the mill site area was contaminated with uranium, nitrate, sulfate, and associated constituents. In March 2003, DOE initiated active remediation of the groundwater using extraction wells and interceptor drains. At that time, a


Microsoft Word - S03623_2007AnnRep_091007.doc  

Office of Legacy Management (LM)

Bedrock Groundwaters -- Upgradient -- 92-06 Bedrock Groundwaters -- Upgradient -- 92-06 a,b ____________________________________________ Analyte Unit 10/30/00 10/10/01 ____________________________________________ Field Measurements Alkalinity mg/L 189 182 Conductivity c μmhos/cm 560 560 DO c mg/L 1.4 -- ORP c mV -51 -46 pH c s.u. 7.24 7.52 Temperature c C 11.3 11.6 Turbidity c NTU 0.84 4.3 Common Ions Ca mg/L 72.8 69.3 Chloride mg/L 2.15 2.44 Fluoride μg/L 124 242 Hardness mg/L 225 214 K mg/L 1.98 1.81 Mg mg/L 10.5 9.99


Microsoft Word - S07834_2011 Ann Rpt_ag comment revs  

Office of Legacy Management (LM)

Supplementary Time-Trend Sparkline Plots Supplementary Time-Trend Sparkline Plots This page intentionally left blank U.S. Department of Energy Annual Performance Report, Shiprock, New Mexico January 2012 Doc. No. S07834 Page A-1 Legend In these sparkline diagrams, red markers denote maximum (max) concentrations and green markers denote minima (min); black markers denote the most recent (current) March 2011 measurement. The x-axis is hidden but corresponds to the Feb-00 to Mar-11 date range noted above each plot. Vertical (y-) axis scales are automatic for each individual well, so magnitudes should not be compared across wells (instead refer to summary statistics). Floodplain Well 1089 Area: Ammonia (mg/L) Well ID Period: Feb-00 to Mar-11 Max


Microsoft Word - S07834_2011 Ann Rpt_ag comment revs  

Office of Legacy Management (LM)

39 39 2.0 Subsurface Conditions This section summarizes hydraulic and water-quality characteristics of the floodplain and terrace groundwater systems for the April 2010 through March 2011 reporting period, approximately 8 years after the startup of the treatment system. 2.1 Floodplain Subsurface Conditions The following discussion of current subsurface conditions in the floodplain is based on the collection and analysis of groundwater samples and groundwater level data through March 2011. Analyses of groundwater level trends, groundwater flow directions, and contaminant distributions in the floodplain are presented below. Results are compared to baseline conditions established in the Baseline Performance Report (DOE 2003) to evaluate the effectiveness of the


Microsoft Word - S03623_2007AnnRep_091007.doc  

Office of Legacy Management (LM)

Monitor Wells Monitor Wells Abandoned in 2005-2006 This page intentionally left blank LOCATION CODE BOREHOLE DEPTH SCREEN DEPTH SCREEN LENGTH ZONE_OF COMPLETION DECOMMISSIONED DATE ORIGINAL EASTING ORIGINAL NORTHING WELL DEPTH 31SW93-197-2 208.8 KB 21-Apr-06 23345.4 9691.6 207.85 31SW93-197-3 159 KD 21-Apr-06 23351.9 9713.9 159 31SW93-197-4 69 KM 21-Apr-06 23368.4 9671.3 69 31SW93-197-5 45 KM 21-Apr-06 23395.3 9731.8 44.3 31SW93-200-1 170 KB 18-Apr-06 20865.4 10218.9 170 31SW93-200-2 122 111.6 10 KD 18-Apr-06 20881.2 10243.3 122 31SW93-200-3 35 24.65 10 KM 18-Apr-06 20855.2 10234.9 35 31SW93-200-4 24.5 KM 07-Sep-05 20889.5 10228.3 24.5 82-07 20 9.5 3 QA 14-Sep-05 24669.3 10006 13 82-20 22.5 15.4 4 QA 07-Sep-05 20418.6 10089.6 21 92-01 24.25 21.4 2.5 QA 19-Apr-06 16615.2 9169 24.25


Microsoft Word - S07834_2011 Ann Rpt_ag comment revs  

Office of Legacy Management (LM)

7 7 6.0 References ATSDR (Agency for Toxic Substances and Disease Registry), 2004. Toxicological Profile for Strontium, U.S. Department of Health and Human Services, Public Health Service, April. DOE (U.S. Department of Energy), 1994. Baseline Risk Assessment of Ground Water Contamination at the Uranium Mill Tailings Site at Shiprock, New Mexico, DOE/AL/62350-48F, Rev. 1, Albuquerque Operations Office, Albuquerque, New Mexico, April. DOE (U.S. Department of Energy), 2000. Final Site Observational Work Plan for the Shiprock, New Mexico, UMTRA Project Site, GJO-2000-169-TAR, Rev. 2, Grand Junction Office, Grand Junction, Colorado, November. DOE (U.S. Department of Energy), 2002. Final Groundwater Compliance Action Plan for Remediation at the Shiprock, New Mexico, UMTRA Project Site, GJO-2001-297-TAR, Grand


Microsoft Word - S03623_2007AnnRep_091007.doc  

Office of Legacy Management (LM)

Precipitation and Snowpack Data Precipitation and Snowpack Data This page intentionally left blank Page G-3 Table G-1. Precipitation in Inches; National Weather Service, Monticello Station Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Calendar Year Total Calendar Year Water Year Water Year Total 1977 0.88 0.21 0.47 0.12 1.02 0.08 2.99 2.53 0.77 0.81 0.53 0.43 10.84 1977 1978 13 1978 3.73 2.22 1.91 1.38 0.84 0.13 0.38 0.2 0.44 1.04 4.32 4.79 21.38 1978 1979 24.32 1979 4.52 2.18 2.23 0.31 2.96 0.94 0.31 0.66 0.06 0.63 1.55 1.75 18.1 1979 1980 20.91 1980 6.25 3.07 1.33 1.42 1.57 0 0.6 0.69 2.05 1.28 0.49 0.32 19.07 1980 1981 15.71 1981 0.03 0.34 2.44 1.43 1.01 0.87 3.98 1.87 1.65 3.17 1.14 0.29 18.22 1981 1982 18.34 1982 1.76 0.52 1.66 0.08 0.88 0.08 0.84 4.26 3.66 1.55 3.66 2.49 21.44 1982 1983 23.06


Microsoft Word - S07834_2011 Ann Rpt_ag comment revs  

Office of Legacy Management (LM)

10 Through March 2011 10 Through March 2011 for the Shiprock, New Mexico, Site January 2012 LMS/SHP/S07834 This page intentionally left blank LMS/SHP/S07834 Annual Performance Report April 2010 Through March 2011 for the Shiprock, New Mexico, Site January 2012 This page intentionally left blank U.S. Department of Energy Annual Performance Report, Shiprock, New Mexico January 2012 Doc. No. S07834 Page i Contents Abbreviations ...................................................................................................................................v Executive Summary ...................................................................................................................... vii 1.0 Introduction ............................................................................................................................1

Note: This page contains sample records for the topic "ann arbor mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


N d'ordre 58-2010 Anne 2010 THESE DE L`UNIVERSITE DE LYON  

E-Print Network (OSTI)

. to develop and optimize a sparkignited CNG Powered Refuse Truck Photo Credit: Cummings Westport, Inc. 11.9 liter CNG engine suitable for refuse and other vocational Class 8 applications. The engine conventional CNG engine to a more efficient and higher performance engine, and integrate it into a refuse


N d'ordre : 173 -2007 Anne 2007 devant l'UNIVERSITE CLAUDE BERNARD -LYON 1  

E-Print Network (OSTI)

(BASF) 39,42,43 PES 5200P (Vitrex®) S O O O n SPES39,42,43 n SO3H S O O O PEES44 O OS S O SO2 O O O O O (moteurs à explo- sion/supercapacités/batteries/piles à combustible/etc.) pour fournir à tout moment la

Paris-Sud XI, Université de


Convective patterns under the Indo-Atlantic T box r Anne Davaille a,*, Eleonore Stutzmann a  

E-Print Network (OSTI)

of the PTB requires other stratigraphic indica- tors. In the Karoo Basin (South Africa), the last occurrence by carbon isotope stratigraphy. Both, the last occurrence of Dicynodon (Karoo Fig. 9. Comparison, this study; with conchos- tracan biostratigraphy after Bachmann and Kozur, 2004) with records from the Karoo

Stutzmann, Eléonore


N d'ordre : 4168 ANNE 2010 THSE / UNIVERSIT DE RENNES 1  

E-Print Network (OSTI)

............................................................................................ 100 II.2.10­ La Séquence du Karoo................................................................................................................. 100 II.2.11­ Le Complexe Post-Karoo

Paris-Sud XI, Université de


N d'ordre : 18 -2010 Anne 2010 THESE DE L`UNIVERSITE DE LYON  

E-Print Network (OSTI)

worldwide, for ex- ample the Vøring and Møre basins offshore mid-Nor- way, the Karoo basin (South Africa intru- sive complexes in the Karoo basin. The Karoo ba- sin is very well suited for detailed fieldwork in the Karoo, South Africa, is done via spring devel- opment or few shallow and low yielding boreholes


UNIVERSITE D'ANGERS Anne 2010 Cellules stromales msenchymateuses comme vecteurs  

E-Print Network (OSTI)

m'avoir initiée à la technique FISH et au Dr Jacob, pour les prélèvements de cellules MIAMI. Merci à CHAPITRE 1 : Etude de l'incorporation de systèmes nanoparticulaires par les cellules MIAMI et suivi des actif encapsulé dans des nanocapsules lipidiques et délivré par des cellules MIAMI au sein d'une tumeur

Paris-Sud XI, Université de


Ann. For. Sci. 63 (2006) 537546 537 c INRA, EDP Sciences, 2006  

E-Print Network (OSTI)

Okinawa Prefecture Forestry Experiment Station, Nago, Okinawa 905-0017, Japan j Hiroshima University, Higashi Hiroshima, Hiroshima 739-8521, Japan (Received 8 December 2005; accepted 22 February 2006

Recanati, Catherine


Abstract, 2012 Joint Ann. Mtg, Geol. Ass. Canada & Mineral. Ass. Canada. Alterationmineralsandelementalassemblagesaroundthe  

E-Print Network (OSTI)

Property, host of Denison Mine's Phoenix Uranium Deposit, is situated near the southeastern rim. Earth Sciences, University of Ottawa, Ottawa, ON, K1N 6N5 2 Denison Mines Corp., 200-230 22nd St East


Nyx: A Massively Parallel AMR Code for Computational Ann S. Almgren1  

E-Print Network (OSTI)

Computing Facility, "Titan Web Page," 2011, http://www.olcf.ornl.gov/titan/. [15] J. Vetter, R. Glassbrook

Bell, John B.


No d'ordre : 4139 ANNE 2010 THSE / UNIVERSIT DE RENNES 1  

E-Print Network (OSTI)

Hulin-Hubard and Daniel Lemoal. Finally my warmest gratitude goes to those whose presence in my life

Paris-Sud XI, Université de


Rules of Engagement: Moving Beyond Combat-Based Anne Sullivan Michael Mateas Noah Wardrip-Fruin  

E-Print Network (OSTI)

,28] such as Planescape: Torment [13] and Fallout 3 [5], which integrates non-combat solutions to a selection of its STUDIOS. Fallout 3. Bethesda Softworks. 2008. 6 BETHESDA SOFTWORKS. Elder Scrolls IV: Oblivion. 2006. 7

California at Santa Cruz, University of


ANN Models for Steam Turbine Power Output Toward Condenser Circulating Water Flux  

Science Conference Proceedings (OSTI)

Aimed the costliness and the complex process of performance test for steam turbine power output toward circulating water flux and in view of the nonlinear advantage about neural network, it brings forward predicting the performance using artificial ... Keywords: Artificial neural network, steam turbine power output, performance prediction

Jia Ruixuan; Xu Hong



d'ordre : 259-2009 Anne 2009 Influence des dfauts sur les proprits  

E-Print Network (OSTI)

LYON Discipline : Physique préparée au laboratoire de Physique dans le cadre de l'?cole Doctorale PHAST


Universit Blaise Pascal Universit d'Auvergne Anne 2009 N d'ordre  

E-Print Network (OSTI)

at the Hanford nuclear waste site under stochastic hydraulic conductivity conditions. Finally, we compare in recent works in analyzing the error bounds of sparse grid stochas- tic collocation. In 2005, Xiu prohibitively costly. Therefore, in this work we combine a cut-HDMR type ANOVA approach (analagous to the sparse


ANN based tools in Astrophysics. Prospects and first results for GOA and the AVO  

Science Conference Proceedings (OSTI)

In this paper I review Artificial Neural Network based solutions to common problems in Astrophysics in order to define generic tasks suitable for a connectionist approach. Also, a new contribution is presented in collaboration with the Group of Operations ...

Luis M. Sarro



Ann. For. Sci. 63 (2006) 653660 653 c INRA, EDP Sciences, 2006  

E-Print Network (OSTI)

to the roots. The kinetic model for tensile water turnover [27] describes the water-tree system under solar Original article Infrared images of heat fields around a linear heater in tree trunks: what can be learned-Meither Institute, Dept. Solare Energetik, 14109 Berlin, Germany b Institute of Forest Ecology, Mendel University

Recanati, Catherine


1Ann. For. Sci. 62 (2005) 18 INRA, EDP Sciences, 2005  

E-Print Network (OSTI)

of Western Australia, Crawley WA 6009, Australia b Forest Science Centre, The University of Melbourne/Natural, as indicated by carbon isotope composition), and (2) greater concentrations of N and Rubisco explain fertiliser on current Amax and 13C of P. pinaster, and thus the previously reported effects of fertiliser on gas

Recanati, Catherine


Master Langues et Cultures trangres (LCE) 1re et 2me annes  

E-Print Network (OSTI)

langue ainsi qu'une formation pluridisciplinaire dans le champ d'une aire linguistique et culturelle dans l'un des trois parcours qui sont : la linguistique, la littérature ou la civilisation. Il s de voyage, ?crivains multilingues. GR?GOIRE Michael, Maître de Conférences, LRL. Linguistique

Sart, Remi


Planning des cours du Dpartement d'etudes cognitives Anne universitaire 2012-2013  

E-Print Network (OSTI)

3 Introduction à la linguistique Homer 6 Je 17-19 Salle 236 DEC-C02-S1 Introduction à la linguistique - TD Jeremy Zehr 4 Lu 15-17 235B DEC-CO3-S1 Introduction à la psychologie cognitive J.Sackur /T incluse). COURS DU MASTER DE LINGUISTIQUE à l'ENS DEC-B17-S2 Sémantique Intensive approches

Gutkin, Boris


N d'ordre : 231-2012 Anne 2012 THESE DE L'UNIVERSITE DE LYON  

E-Print Network (OSTI)

CONTROL-RELEVANT SOFC MODELING AND MODEL EVALUATION Rambabu Kandepu, Lars Imsland, Bjarne A. Foss, a dynamic, lumped model of a Solide Oxide Fuel Cell (SOFC) is described, as a step towards developing control relevant models for a SOFC integrated in a gas turbine process. Several such lumped models can