Powered by Deep Web Technologies
Note: This page contains sample records for the topic "alpha excluding radon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Radon  

Science Journals Connector (OSTI)

... introduction to the non-specialist; and, with its clear exposition of the history of radon and its applications, it will convey to him something of the care essential in ... The second part of the book is concerned with the details of the process of radon extraction. Separate chapters are devoted to the radium sources used, the extraction and purifying ...

1949-04-30T23:59:59.000Z

2

Incidence characteristics of alpha particles on detectors irradiated in a radon progeny atmosphere  

E-Print Network [OSTI]

regarding short-lived radon prog- eny has attracted much attention in the field of radon dosimetry. Nuclear state nuclear track detectors (SSNTDs). Here, we should mention the double detector method, in which one

Yu, K.N.

3

RADIATIOh RESEARCH 142,61-69 (1995) The Biological Effectiveness of Radon-ProgenyAlpha Particles.  

E-Print Network [OSTI]

for uranium miners or on data derived from A-bomb sur- vivors; comparison of domestic radon risk estimates studied. (d)The conversion from effective dose per unit exposure in a mine to effective dose per unit

Brenner, David Jonathan

4

Radon in Syrian houses  

Science Journals Connector (OSTI)

A nationwide investigation of radon levels in Syrian houses was carried out during the period 1991 - 1993. Passive radon diffusion dosemeters using polycarbonate detectors were distributed in houses all over Syria. Detectors were subjected to electrochemical etching to reveal latent tracks of alpha particles. The mean radon concentration in Syrian houses was found to be with some values several times higher. This investigation indicated that there were a few houses in Syria that require remedial action. Most houses that have high levels of radon were found in the southern area, especially in the Damascus governorate. The study also indicated that radon concentrations were higher in old houses built from mud with no tiling.

I Othman; M Hushari; G Raja; A Alsawaf

1996-01-01T23:59:59.000Z

5

Little danger from radon  

Science Journals Connector (OSTI)

... the potential alpha energy in air from any combination of the short-lived daughters of radon. 1 WL = 1.3 ? 10" MeV nT3). A recent survey ( ... Biol 23, 696-711; 1978) estimated that the average population exposure rate domestically to radon daughters for Great Britain is about 0.15 WLM per year.

K. D. CLIFF; B. L. DAVIES; J. A. REISSLAND

1979-05-03T23:59:59.000Z

6

Safe as houses? The risks of radon  

Science Journals Connector (OSTI)

... general lack of public concern about the health risks caused by the natural radioactive gas radon is one of the odder features of modern life. Whatever the reasons for that ... it deals with other alpha emitters, ingested rather than inhaled, as well as with radon and its short-lived decay products. These other alpha emitters will usually be found ...

John Fremlin

1988-09-08T23:59:59.000Z

7

Radon emissions  

Science Journals Connector (OSTI)

... SIR,-Wendy Barnaby (August 28) writes on the problem of radon emission from the tailings of uranium milling in Sweden. This problem would arise from ... that has to be treated. She describes Professor Robert O. Pohl's report that "radon can escape more easily from the broken ground of a mine than from an undisturbed ...

SVEN-ERIC BRUNNSJO

1975-10-09T23:59:59.000Z

8

Radon activity  

Science Journals Connector (OSTI)

... EXPOSURE to large quantities of radioactive radon gas in the home is associated with a high frequency of mutations in a gene ... controversial idea that leukaemia is more prevalent in countries where the average indoor concentration of radon is high. The blood samples were taken from 20 non-smoking adults from the ...

1991-05-23T23:59:59.000Z

9

E-Print Network 3.0 - alpha-radiation construction calibration...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Alpha Radiation - An alpha particle is identical... of only an inch or so. Naturally occurring radioactive elements such as radon emit alpha radiation... to Construct PE Plant...

10

Radon Training for Professionals  

E-Print Network [OSTI]

's International Radon Project, EPA, states, Canadian provinces, tribal nations, partner Regional Radon Training University. · MURC is widely respected as an international leader in radon training. · Your course is fromRadon Training for Professionals 2008-2009 www.cce.umn.edu/radon Regional Radon Training Center

Netoff, Theoden

11

It's Elemental - Isotopes of the Element Radon  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Astatine Astatine Previous Element (Astatine) The Periodic Table of Elements Next Element (Francium) Francium Isotopes of the Element Radon [Click for Main Data] Most of the isotope data on this site has been obtained from the National Nuclear Data Center. Please visit their site for more information. Naturally Occurring Isotopes Radon has no naturally occurring isotopes. Known Isotopes Mass Number Half-life Decay Mode Branching Percentage 193 1.15 milliseconds Alpha Decay 100.00% 194 0.78 milliseconds Alpha Decay 100.00% 195 6 milliseconds Alpha Decay 100.00% 195m 5 milliseconds Alpha Decay 100.00% 196 4.4 milliseconds Alpha Decay 99.90% Electron Capture ~ 0.10% 197 53 milliseconds Alpha Decay 100.00% 197m 25 milliseconds Alpha Decay 100.00% 198 65 milliseconds Alpha Decay No Data Available

12

Surface Radiography with Alpha Rays  

Science Journals Connector (OSTI)

... , and C are deposited on the surfaces of objects which come in contact with radon. Three of them, namely, radium A, C and C, emit alpha rays ... two hours in a vessel (volume 70 c.c.) containing 1 me. of radon. Afterwards the wing was put for 8 min. on the emulsion of a photographic ...

Č. JECH

1948-02-28T23:59:59.000Z

13

Radon in Homes: Recent Developments  

Science Journals Connector (OSTI)

Radon in Homes: Recent Developments ... This report gives an update on current developments regarding the issue of radon in homes. ...

Charles H. Atwood

2006-10-01T23:59:59.000Z

14

Event counting alpha detector  

DOE Patents [OSTI]

An electrostatic detector is disclosed for atmospheric radon or other weak sources of alpha radiation. In one embodiment, nested enclosures are insulated from one another, open at the top, and have a high voltage pin inside and insulated from the inside enclosure. An electric field is produced between the pin and the inside enclosure. Air ions produced by collision with alpha particles inside the decay volume defined by the inside enclosure are attracted to the pin and the inner enclosure. With low alpha concentrations, individual alpha events can be measured to indicate the presence of radon or other alpha radiation. In another embodiment, an electrical field is produced between parallel plates which are insulated from a single decay cavity enclosure. 6 figs.

Bolton, R.D.; MacArthur, D.W.

1996-08-27T23:59:59.000Z

15

Risk of radon  

Science Journals Connector (OSTI)

... 10"4 per working level month would be an appropriate upper bound for exposure to radon decay products in the home.

M.C. O.'RIORDAN

1981-09-17T23:59:59.000Z

16

Home Safety: Radon Gas  

E-Print Network [OSTI]

Every home should be tested for radon, an invisible, odorless, radioactive gas that occurs naturally. This publication explains the health risks, testing methods, and mitigation and reduction techniques....

Shaw, Bryan W.; Denny, Monica L.

1999-11-12T23:59:59.000Z

17

Leukaemia risks and radon  

Science Journals Connector (OSTI)

... SIR - A correlation has been established between domestic radon exposure and mutation in peripheral T lymphocytes1. Some caution must be exercised, however, ... result

SIMON P. WOLFF

1991-07-25T23:59:59.000Z

18

Radon scare doubted  

Science Journals Connector (OSTI)

... University of Bristol claim, in last week's issue of the Lancet, that radioactive radon gas seeping into buildings may cause leukaemia and several other cancers. The team, led ... other cancers. The team, led by Denis Henshaw, correlated leukaemia records with average indoor radon concentrations across 14 countries. They believe that ...

Peter Aldhous

1990-05-03T23:59:59.000Z

19

Radon risk reassessed  

Science Journals Connector (OSTI)

... UNDERGROUND miners who are heavily exposed to the radioactive decay products of radon gas (see figure) suffer especially high rates of lung cancer. Extrapolation from these ... figure) suffer especially high rates of lung cancer. Extrapolation from these data suggests that radon in people's homes may cause some 2,000 lung cancers each year in Britain1 ...

Julian Peto; Sarah Darby

1994-03-10T23:59:59.000Z

20

Risk of radon  

Science Journals Connector (OSTI)

... 98) considered the individual lung cancer risk to the general population from indoor exposure to radon-222 and concluded that a current upper estimate is 10"4 per lifetime per working ... estimate, a further potentially major consideration was not included. The general background effect of radon was assessed by identifying lung cancer rates before cigarette smoking became popular. Those rates ...

ROBERT L. FLEISCHER

1981-09-17T23:59:59.000Z

Note: This page contains sample records for the topic "alpha excluding radon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

EPA discovers radon  

Science Journals Connector (OSTI)

... when they are of mineral construction such as stone, are also either a source of radon, the radioactive rare gas whose atoms are inescapably intermediates in the radioactive decay of ... it. One consequence is that all creatures on the surface of the Earth take in radon with every breath they breathe. Another is that those who live in houses may ...

1986-08-28T23:59:59.000Z

22

Radon Content of Rainwater  

Science Journals Connector (OSTI)

... mjjic./l. of rainwater and was due primarily to radium B + C. Since radon is present throughout the atmosphere, it continually supplies decay products which become attached to ... continually supplies decay products which become attached to aerosols and condensation droplets. The equilibrium between radon and radium A + B + C being established in about 4 h, the ...

PARTHA BANERJI; S. D. CHATTERJEE

1964-12-19T23:59:59.000Z

23

Ionisation Potential of Radon  

Science Journals Connector (OSTI)

... WE have determined the ionisation potential of radon, using the well-known method,1 due to Hertz, of compensation of the negative ... xenon and krypton: it was found to be 2.6 volts. The quantity of radon used in different experiments was of the order of 300 millicuries. The volume of ...

F. HOLWECK; L. WERTENSTEIN

1930-09-20T23:59:59.000Z

24

Radon to predict earthquakes  

Science Journals Connector (OSTI)

... , at least in the West, is the apparently premonitory change in the emission of radon. In a brief conference abstract King (Eos, 56, 1019; 1975) recently reported ... conference abstract King (Eos, 56, 1019; 1975) recently reported that monitoring of the radon concentration in soil gas was begun in May 1975 at 18 sites along an active ...

Peter J. Smith

1976-05-13T23:59:59.000Z

25

Energy deposition and radiation quality of radon and radon daughters. Final report  

SciTech Connect (OSTI)

This program was aimed at creating a quantitative physical description, at the micrometer and nanometer levels, of the physical interactions of the alpha particles from radon and its daughters with cells at risk in the bronchial epithelium. The authors calculated alpha-particle energy spectra incident upon the cells and also energy deposition spectra in micrometer- and nanometer-sized sites as a function of cell depth, site size, airway diameter, activities of {sup 218}Po and {sup 214}Po, and other parameters. These data are now being applied, using biophysical models of radiation effects, to predict cell killing, mutations, and cell transformation. The model predictions are then compared to experimental biophysical, biochemical, and biological information. These studies contribute to a detailed understanding of the mechanisms of the biological effectiveness of the radiations emitted by radon and its progeny.

Karam, L.R.; Caswell, R.S.

1996-09-09T23:59:59.000Z

26

Countries Diesel Prices Excluding Taxes  

Gasoline and Diesel Fuel Update (EIA)

excluding taxes) excluding taxes) Date Belgium France Germany Italy Netherlands UK US 01/13/14 3.56 3.46 3.55 3.80 3.63 3.57 3.40 01/06/14 3.70 3.49 3.62 3.82 3.63 3.55 3.43 12/30/13 NA NA NA NA NA NA 3.42 12/23/13 NA NA NA NA NA NA 3.39 12/16/13 3.63 3.50 3.71 3.85 3.71 3.56 3.38 12/9/13 3.83 3.53 3.77 3.86 3.72 3.57 3.39 12/2/13 3.70 3.46 3.75 3.80 3.67 3.53 3.40 11/25/13 3.60 3.38 3.74 3.75 3.61 3.48 3.36 11/18/13 3.74 3.36 3.67 3.70 3.55 3.45 3.33 11/11/13 3.57 3.34 3.57 3.66 3.51 3.42 3.34 11/4/13 3.60 3.36 3.65 3.69 3.58 3.43 3.37 10/28/13 3.60 3.48 3.71 3.84 3.67 3.53 3.38 10/21/13 3.64 3.50 3.75 3.84 3.70 3.54 3.40 10/14/13 3.70 3.45 3.74 3.82 3.70 3.51 3.40 10/7/13 3.63 3.46 3.75 3.83 3.70 3.52 3.41

27

Czech primary radon measurement equipment  

Science Journals Connector (OSTI)

......radium needles in a depleted uranium shielding are used...for radon. Environ. Health. Perspect. (1991...exposure to Rn daughters. Health. Phys. (1998) 54...al. Radon and public health, report of the independent......

Ivo Burian; Petr Otahal; Josef Vosahlik; Eliska Pilecka

2011-05-01T23:59:59.000Z

28

ORNL-5489 Radon and Radon Daughter  

Office of Legacy Management (LM)

_._-l"." _._-l"." .-_ "...",.,~~-- ORNL-5489 Radon and Radon Daughter Measurements at and near the Former Middlesex Sampling Plant, Middlesex, New Jersey F. F. Haywood P. T. Perdue D. J . Chris tian R. W . Leggett H. W . Dickson T. E. Myric k ,--___ . . . ^.. Printed in the United States of America. Available from National Technical information Service US. Department of Commerce 5285 Port Royal Road, Springfield, Virginia 22161 NTIS price codes-Printed Copy: A04 Microfiche A01 This report was prepared as an account of work sponsored by an agency of the United StatesGovernment. Neither theU nited States Government nor any agency thereof, nor any of their employees, makes any warranty, express or implied, or assumes any legal liability or responsibility for the accuracy, completeness, or

29

Radon programmes and health marketing  

Science Journals Connector (OSTI)

......possible way is to employ health marketing that draws...INTRODUCTION Being aware of health effects of the exposure...people that radon is dangerous. Generally, people...radon could not be so dangerous. Table-1. Risk perception...stronger evidence of radon health effects(4) WHO draws......

Ivana Fojtikova; Katerina Rovenska

2011-05-01T23:59:59.000Z

30

Radon: a bibliography  

SciTech Connect (OSTI)

The Lawrence Berkeley Laboratory, with the support of the Department of Energy, has developed a computerized database to manage research information in the area of building ventilation and indoor air quality. This literature survey contains references pertaining to the physical properties of radon and its daughters, instrumentation for their measurement, health effects, surveys and measurements, and regulatory information. The references in the bibliography are sequenced in alphabetical order and abstracts are included when supplied by the author. The objective of this report is to disseminate the bibliographic references compiled at the laboratory relating to radon research portion of the program. Interested database users are encouraged to contact the laboratory to receive instructions for direct database acess. A flyer describing the database is supplied at the end of the bibliography and a brief overview of the Radon Research porgram is given.

Lepman, S.R.; Boegel, M.L.; Hollowell, C.D.

1981-01-01T23:59:59.000Z

31

Beta/alpha continuous air monitor  

DOE Patents [OSTI]

A single deep layer silicon detector in combination with a microcomputer, recording both alpha and beta activity and the energy of each pulse, distinquishing energy peaks using a novel curve fitting technique to reduce the natural alpha counts in the energy region where plutonium and other transuranic alpha emitters are present, and using a novel algorithm to strip out radon daughter contribution to actual beta counts. 7 figs.

Becker, G.K.; Martz, D.E.

1988-06-27T23:59:59.000Z

32

Construction and measurements of a vacuum-swing-adsorption radon-mitigation system  

E-Print Network [OSTI]

Long-lived alpha and beta emitters in the $^{222}$Rn decay chain on (and near) detector surfaces may be the limiting background in many experiments attempting to detect dark matter or neutrinoless double-beta decay, and in screening detectors. In order to reduce backgrounds from radon-daughter plate-out onto the wires of the BetaCage during its assembly, an ultra-low-radon cleanroom is being commissioned at Syracuse University using a vacuum-swing-adsorption radon-mitigation system. The radon filter shows ~20$\\times$ reduction at its output, from 7.47$\\pm$0.56 to 0.37$\\pm$0.12 Bq/m$^3$, and the cleanroom radon activity meets project requirements, with a lowest achieved value consistent with that of the filter, and levels consistently < 2 Bq/m$^3$.

R. W. Schnee; R. Bunker; G. Ghulam; D. Jardin; M. Kos; A. S. Tenney

2014-04-23T23:59:59.000Z

33

Radon-222 Emanation and the High Apparent Lead Isotope Ages in Lunar Dust  

Science Journals Connector (OSTI)

... 232Th decay chains may be a significant mechanism for a partial redistribution of the post-radon lead daughters. Kraner2 suggested that there may be an alpha-emitting radioactive deposit on ... radioactive deposit on the lunar surface as a result of the decay in space of radon isotopes which might diffuse out of lunar surface material. Turkevich3 reported evidence for such ...

J. A. S. ADAMS; PAULO M. BARRETTO; RONALD B. CLARK; JOE S. DUVAL

1971-05-21T23:59:59.000Z

34

EPA urges testing of homes for radon  

Science Journals Connector (OSTI)

EPA urges testing of homes for radon ... The action was based on cooperative surveys of home radon levels conducted by EPA and 17 states. ...

DAVID HANSON

1988-09-19T23:59:59.000Z

35

Problems Found Using a Radon Stripping Algorithm for Retrospective Assessment of Air Filter Samples  

SciTech Connect (OSTI)

An evaluation of a large number of air sample filters was undertaken using a commercial alpha and beta spectroscopy system employing a passive implanted planar silicon (PIPS) detector. Samples were only measured after air flow through the filters had ceased. Use of a commercial radon stripping algorithm was implemented to discriminate anthropogenic alpha activity on the filters from the radon progeny. When uncontaminated air filters were evaluated, the results showed that there was a time-dependent bias in both average estimates and measurement dispersion of anthropogenic activity estimates with the relative bias being small compared to the dispersion, indicating that the system would not give false positive indications for an appropriately set decision level. By also measuring environmental air sample filters simultaneously with electroplated alpha filters, use of the radon stripping algorithm demonstrated a number of substantial unexpected deviations from calibrated values indicating that the system would give false negative indications. Use of the current algorithm is, therefore, not recommended for general assay applications. Use of the PIPS detector should only be utilized for gross counting without appropriate modifications to the curve-fitting algorithm. As a screening method, the radon stripping algorithm might be expected to see elevated alpha activities on air sample filters (not due to radon progeny) around the 200 disintegrations per minute level.

Robert Hayes

2008-04-01T23:59:59.000Z

36

Use of a Radon Stripping Algorithm for Retrospective Assessment of Air Filter Samples  

SciTech Connect (OSTI)

An evaluation of a large number of air sample filters was undertaken using a commercial alpha and beta spectroscopy system employing a passive implanted planar silicon (PIPS) detector. Samples were only measured after air flow through the filters had ceased. Use of a commercial radon stripping algorithm was implemented to discriminate anthropogenic alpha and beta activity on the filters from the radon progeny. When uncontaminated air filters were evaluated, the results showed that there was a time-dependent bias in both average estimates and measurement dispersion with the relative bias being small compared to the dispersion. By also measuring environmental air sample filters simultaneously with electroplated alpha and beta sources, use of the radon stripping algorithm demonstrated a number of substantial unexpected deviations. Use of the current algorithm is therefore not recommended for assay applications and so use of the PIPS detector should only be utilized for gross counting without appropriate modifications to the curve fitting algorithm. As a screening method, the radon stripping algorithm might be expected to see elevated alpha and beta activities on air sample filters (not due to radon progeny) around the 200 dpm level.

Robert Hayes

2009-01-23T23:59:59.000Z

37

How to live with radon  

Science Journals Connector (OSTI)

... hundred is from fumes, falls or fires. If potential deaths from indoor exposure to radon are included, home seems even less a haven. Participants at a recent meeting* ... included, home seems even less a haven. Participants at a recent meeting* agreed that radon is the most serious cause of human irradiation, attempted to quantify the consequences for ...

Michael O'Riordan

1988-01-28T23:59:59.000Z

38

Do radon anomalies predict earthquakes?  

Science Journals Connector (OSTI)

... THE discovery that the radon content of groundwater in a deep well increased significantly before the magnitude 5.3 Tashkent ... prompted many research groups in the USSR, China, Japan and the US to monitor radon levels in wells and springs in earthquake-prone zones. Many ...

Chi-Yu King

1981-09-24T23:59:59.000Z

39

Carrying the Ball on Radon  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

4 4 Carrying the Ball on Radon Part one of two parts Radon gas was "discovered" as an important environmental issue in the mid-1980s, when levels 1,000 times the average of about 1.5 picocuries/liter (pCi/l) were found in homes in the eastern United States. Radon is present in all homes, and even in outdoor air, because it is a gaseous decay product of radium naturally present in the soil. Since even an average indoor exposure to radon's own decay products-isotopes of polonium, bismuth, and lead-was estimated to cause a 0.1 to 1% risk of lung cancer, depending on whether one smoked, these high levels sounded an immediate alarm. By the mid-1980s, scientists had already proven that indoor radon levels 10 to 100 times the average-an unacceptable amount-occurred in homes in

40

Thoron detection with an active Radon exposure meterFirst results  

SciTech Connect (OSTI)

For state-of-the-art discrimination of Radon and Thoron several measurement techniques can be used, such as active sampling, electrostatic collection, delayed coincidence method, and alpha-particle-spectroscopy. However, most of the devices available are bulky and show high power consumption, rendering them unfeasible for personal exposition monitoring. Based on a Radon exposure meter previously realized at the Helmholtz Center Munich (HMGU), a new electronic prototype for Radon/Thoron monitoring is currently being developed, which features small size and weight. Operating with pin-diode detectors, the low-power passive-sampling device can be used for continuous concentration measurements, employing alpha-particle-spectroscopy and coincidence event registration to distinguish decays originating either from Radon or Thoron isotopes and their decay products. In open geometry, preliminary calibration measurements suggest that one count per hour is produced by a 11?Bq?m{sup ?3} Radon atmosphere or by a 15?Bq?m{sup ?3} Thoron atmosphere. Future efforts will concentrate on measurements in mixed Radon/Thoron atmospheres.

Irlinger, J., E-mail: josef.irlinger@helmholtz-muenchen.de; Wielunski, M.; Rhm, W. [ISS, Helmholtz Center Munich, Research Center for Environment and Health, 85764 Neuherberg (Germany)] [ISS, Helmholtz Center Munich, Research Center for Environment and Health, 85764 Neuherberg (Germany)

2014-02-15T23:59:59.000Z

Note: This page contains sample records for the topic "alpha excluding radon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

Estimation of mean annual effective dose through radon concentration in the water and indoor air of Islamabad and Murree  

Science Journals Connector (OSTI)

......strength to the energy of alpha particle...particles of different energies. Different isotopes...different alpha energies and produce different...about 30 min, the average radon content is...estimate of water consumption (60 la1), respectively...having ventilated homes structure, though......

N. Ali; E. U. Khan; P. Akhter; F. Khan; A. Waheed

2010-09-01T23:59:59.000Z

42

Ground radon survey of a geothermal area in Hawaii | Open Energy  

Open Energy Info (EERE)

radon survey of a geothermal area in Hawaii radon survey of a geothermal area in Hawaii Jump to: navigation, search OpenEI Reference LibraryAdd to library Journal Article: Ground radon survey of a geothermal area in Hawaii Abstract Rates of ground radon emanation, inthe Puna geothermal area on the lower east riftof Kilauea volcano, were measured by alpha particle sensitive cellulose nitrate films. The survey successfully defined an area of thermal significance associated with the rift structure,and suggests that a thermally driven ground gas convection system exists within, and peripheralto, the rift. This type of survey was found suitable for the basaltic island environment characteristic of Hawaii and is now used in Hawaii as a routine geothermal exploration technique. Author Malcolm E. Cox Published Journal

43

Radon: An Overview of Health Effects  

Science Journals Connector (OSTI)

Radon is one of the most comprehensively studied human carcinogens. It is a naturally occurring noble gas, and due to current construction methods, radon concentrations often become enhanced indoors. Radon is the largest single contributor to the natural radiation exposure to the general public. Two of its radioactive decay products, polonium-218 and polonium-214, impart the majority of radiation dose to the lungs, rather than the radon gas itself. In fact, protracted exposure to radon and its decay products is one of the greatest environmental health threats. Radon is the second leading cause of lung cancer in North America and the leading cause of lung cancer for individuals who have never smoked. Overall, radon is also the leading environmental cause of cancer mortality in North America. In vitro studies, controlled studies of radon-exposed animals, a variety of radiobiological analyses, 15 retrospective cohort studies of radon-exposed underground miners, and analyses of 22 pooled residential epidemiologic studies from North America, China, and Europe convincingly demonstrate that radon is a human lung carcinogen even at concentrations commonly encountered in the residential setting. Because of the significant health risks related to residential radon exposure, the World Health Organization (WHO) instituted an international initiative in 2005, the International Radon Project, to reduce indoor radon risks. This article and the following articles on radon provide a general overview of its characteristics, sources, occurrence, and health effects, as well as guidance on both radon measurement and mitigation.

R.W. Field

2011-01-01T23:59:59.000Z

44

Automatic alpha-track counting with image analysis systems  

E-Print Network [OSTI]

of Advisory Committee: Dr. Milton E. McLain Integrated measurements of radon gas concentrations in the air environment have been performed in recent years due to dosimetric concerns of the radioactive substance. Proper evaluation of the dose received from... radon, primarily to the lung of the exposed individual, requires accurate measurement of concentrations present in the atmosphere. In response, this project was undertaken to further improve alpha track measurement techniques currently in place...

Shymanski, Michael Joseph

2012-06-07T23:59:59.000Z

45

E-Print Network 3.0 - alpha radioactivity measurement Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

SITE ENVIRONMENTAL REPORT4-1 Summary: a range in air of only an inch or so. Naturally occurring radioactive elements such as radon emit alpha... . This is a measure of the rate at...

46

Various factors affecting the calibration of alpha track detectors: a Monte Carlo study  

E-Print Network [OSTI]

Low levels of indoor radon are frequently monitored using alpha track detectors (ATD). A common detector configuration consists of cellulose nitrate film (Kodak LR-115 II(TM)) enclosed in a cylindrical metallic canister. The ATD system must...

McCullough, Steven Patrick

2012-06-07T23:59:59.000Z

47

Clean Water Act (excluding Section 404)  

SciTech Connect (OSTI)

This Reference Book contains a current copy of the Clean Water Act (excluding Section 404) and those regulations that implement the statutes and appear to be most relevant to US Department of Energy (DOE) activities. The document is provided to DOE and contractor staff for informational purposes only and should not be interpreted as legal guidance. Updates that include important new requirements will be provided periodically. Questions concerning this Reference Book may be directed to Mark Petts, EH-231 (202/586-2609).

Not Available

1993-01-15T23:59:59.000Z

48

Chemical Methods for Removing Radon and Radon Daughters from Air  

Science Journals Connector (OSTI)

...OF LUNG CANCER AMONG URANIUM MINERS, HEALTH PHYSICS 16 : 563 ( 1969...OF MINERS TO RADON, HEALTH PHYSICS 16 : 547 ( 1969...E., MORTALITY OF URANIUM MINERS IN RELATION TO...THROUGH SEPTEMBER 1967, HEALTH PHYSICS 16 : 571 ( 1969...

Lawrence Stein

1972-03-31T23:59:59.000Z

49

Radon - HPMC Occupational Health Services  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Awareness Cold and Flu Prevention Hand Washing Healthy Sleep Heat Stress Radon Signs of a Heart Attack Signs of a Stroke Distracted Driving Coping with Stress & Change Skin Cancer...

50

Radon Content of the Atmosphere  

Science Journals Connector (OSTI)

... preliminary work. The absence of levels of a higher order suggests that the contribution of radon from this source does not represent a significant addition to the total atmospheric level. ... Domestic 0.70

W. ANDERSON; R. C. TURNER

1956-07-28T23:59:59.000Z

51

Radon programmes and health marketing  

Science Journals Connector (OSTI)

......programmes and projects Radon programmes and health marketing Ivana Fojtikova * Katerina Rovenska * Corresponding...basis? One possible way is to employ health marketing that draws together traditional marketing theories and science-based strategies to......

Ivana Fojtikova; Katerina Rovenska

2011-05-01T23:59:59.000Z

52

Radon Content of the Air  

Science Journals Connector (OSTI)

... namely, 0.009 and 0.018 micron. Hence it is not surprising that the radon values for the atmosphere as deduced from the filter paper method are too low. ... Bartholomew s Hospital in London a mean value of 0.94 x 10-16 curie radon/ml., and for May of the same year 0.28 x 10-16 curie ...

F. B?HOUNEK; M. MAJEROV

1956-12-29T23:59:59.000Z

53

Radon lung dosimetry models  

Science Journals Connector (OSTI)

......Comparison of average bronchial doses...Eisfeld(5) 4.2 Average value 7.9 aBased...potential alpha energy concentration...insensitive to F). Homes: breathing conditions...bronchial region. Average doses over all bronchial...due to cigarette consumption have been reported......

W. Hofmann; R. Winkler-Heil

2011-05-01T23:59:59.000Z

54

Simulation of Radon Transport in Geothermal Reservoirs  

SciTech Connect (OSTI)

Numerical simulation of radon transport is a useful adjunct in the study of radon as an in situ tracer of hydrodynamic and thermodynamic numerical model has been developed to assist in the interpretation of field experiments. The model simulates transient response of radon concentration in wellhead geofluid as a function of prevailing reservoir conditions. The radon simulation model has been used to simulate radon concentration response during production drawdown and two flowrate transient tests in vapor-dominated systems. Comparison of model simulation with experimental data from field tests provides insight in the analysis of reservoir phenomena such as propagation of boiling fronts, and estimates of reservoir properties of porosity and permeability thickness.

Semprini, Lewis; Kruger, Paul

1983-12-15T23:59:59.000Z

55

Characterizing the source of radon indoors  

SciTech Connect (OSTI)

Average indoor radon concentrations range over more than two orders of magnitude, largely because of variability in the rate at which radon enters from building materials, soil, and water supplies. Determining the indoor source magnitude requires knowledge of the generation of radon in source materials, its movement within materials by diffusion and convection, and the means of its entry into buildings. This paper reviews the state of understanding of indoor radon sources and transport. Our understanding of generation rates in and movement through building materials is relatively complete and indicates that, except for materials with unusually high radionuclide contents, these sources can account for observed indoor radon concentrations only at the low end of the range observed. Our understanding of how radon enters buildings from surrounding soil is poorer, however recent experimental and theoretical studies suggest that soil may be the predominant source in many cases where the indoor radon concentration is high. 73 references, 3 figures, 1 table.

Nero, A.V.; Nazaroff, W.W.

1983-09-01T23:59:59.000Z

56

Radon reduction and radon monitoring in the NEMO experiment  

E-Print Network [OSTI]

) Abstract: The first data of the NEMO 3 neutrinoless double beta decay experiment have shown that the radon in the LSM (Laboratoire Souterrain de Modane, depth of 4800 m w.e.), investigates the neutrinoless double beta decay (20) of various nuclei [1]. The observation of such a process will give us fundamental

Paris-Sud XI, Université de

57

Radon programme: presence and future  

Science Journals Connector (OSTI)

......basement and ground floor, one-third...house, subsoil water level, construction...provide subsidy for remediation. The radon issue...protection) and remediation of existing exposure...providers of water are enforced...material and water at the market...to 4000) for remediation. The system......

J. Hulka

2008-06-01T23:59:59.000Z

58

Indoor radon: the deadliest pollutant  

Science Journals Connector (OSTI)

...chance to seep from the ground into homes in lethal...outdoor air, drinking water, and food (hatched...The most effective remediation approach is to reverse...a prominent radon remediation con-sultant in Mississauga...operator graded the ground before the basement...

RA Kerr

1988-04-29T23:59:59.000Z

59

Radon remediation and prevention status in 23 European countries  

Science Journals Connector (OSTI)

......mostly occurs at home. Existing...moreover, the average radon concentration...potential impact on energy consumption (qualitative...potential impact on energy consumption are not addressed...the national average radon concentration...Radon in homes and risk of......

O. Holmgren; H. Arvela; B. Collignan; M. Jirnek; W. Ringer

2013-12-01T23:59:59.000Z

60

Radon and Lung Cancer in the American Cancer Society Cohort  

Science Journals Connector (OSTI)

...Porstendorfer J , Reineking A.Radon: characteristics in...conversion coefficients for radon progeny for different...Epidemiology Reanalysis Project.Cambridge, MA:Health...Health Organization.International classification of diseases...gov/IEP/high-radon/files.html . 24...

Michelle C. Turner; Daniel Krewski; Yue Chen; C. Arden Pope III; Susan Gapstur; and Michael J. Thun

2011-03-01T23:59:59.000Z

Note: This page contains sample records for the topic "alpha excluding radon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

Radon Concern in the Hickory Aquifer  

E-Print Network [OSTI]

Radon ConcernStory by Amanda Crawford tx H2O | pg. 20 As the primary water source for Mason,Concho, McCulloch, San Saba, Menard, Kimble, and Gillespie counties in Central Texas, the threat of elevated radionuclide concentra- tions... in the Hickory Aquifer's groundwater poses health risks for residents in the area. Radon is a natural, radioactive gas that may be found indoors in air or drinking water. Radon is the decay product of radium, so radon indi- rectly reflects the presence...

Crawford, Amanda

2005-01-01T23:59:59.000Z

62

Nucleosome positioning by genomic excluding-energy barriers  

Science Journals Connector (OSTI)

...genomic excluding-energy barriers 10.1073...Vaillant Benjamin Audit Zofia Haftek-Terreau...Sequence motifs and free energies of selected natural and non-natural...174 . 14 Vaillant C Audit B Arneodo A ( 2007...excluding genomic energy barriers Pascale Milani...Vaillant, Benjamin Audit, Zofia Haftek-Terreau...

Pascale Milani; Guillaume Chevereau; Cdric Vaillant; Benjamin Audit; Zofia Haftek-Terreau; Monique Marilley; Philippe Bouvet; Franoise Argoul; Alain Arneodo

2009-01-01T23:59:59.000Z

63

Alpha Radiation  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Basics of Radiation Basics of Radiation Gamma Radiation and X-Rays Beta Radiation Alpha Radiation Irradiation Radioactive Contamination Definitions Detection Measurement Safety Around Radiation Sources Types of Radiation Exposure Managing Radiation Emergencies Basics of Radiation Characteristics of Alpha Radiation 1. Alpha radiation is not able to penetrate skin. 2. Alpha-emitting materials can be harmful to humans if the materials are inhaled, swallowed, or absorbed through open wounds. 3. A variety of instruments have been designed to measure alpha radiation. Special training in use of these instruments is essential for making accurate measurements. 4. A civil defense instrument (CD V-700) cannot detect the presence of radioactive materials that produce alpha radiation unless the radioactive materials also produce beta and/or gamma radiation.

64

SWOT analysis of the Czech Radon programme  

Science Journals Connector (OSTI)

......raising radon awareness and risk perception among the...3). To avoid this risk, new solutions and new...government departments (political subsidy), cooperation...underestimate the radon risk The positive influence...Low concern of banks, insurance companies and real estate......

I. Fojtkov

2014-07-01T23:59:59.000Z

65

An overview of Ireland's National Radon Policy  

Science Journals Connector (OSTI)

......for radon in drinking water of 500 Bq m3 and 1000 Bq m3 for public and private water supplies, respectively...the duty of care that a water supplier has towards...carried out in 38 531 ground floor classrooms and...extensive and successful remediation programme to reduce radon......

S. Long; D. Fenton

2011-05-01T23:59:59.000Z

66

Measurement of Radon in Soil Gas  

Science Journals Connector (OSTI)

... CONCENTRATIONS of the order of 100,000-1,000,000 pc. radon/m3 are found in the gases trapped in common soils and rock1. The estimation ... m3 are found in the gases trapped in common soils and rock1. The estimation of radon in the soil gas and the free atmosphere has been suggested as a tool for ...

K. G. VOHRA; M. C. SUBBARAMU; A. M. MOHAN RAO

1964-01-04T23:59:59.000Z

67

Concentration of Atmospheric Radon and Wind Direction  

Science Journals Connector (OSTI)

... in Lisbon, near the sea, is therefore excellent to test any probable relationship between radon concentration and wind directions since only half the possible wind directions are continental ones, ... since only half the possible wind directions are continental ones, therefore corresponding probably to higher radon concentrations. In order to study any correlation, the concentration of ...

F. BARREIRA

1961-06-17T23:59:59.000Z

68

Retrospective determination of radon in houses  

Science Journals Connector (OSTI)

... Indoor exposure to decay products of radon (222Rn) contributes the largest fraction of natural radiation dose to people living in subarctic ... of natural radiation dose to people living in subarctic or temperate regions of the world. Radon is an inert and radioactive gas in the natural decay series that commences with 238U ...

Christer Samuelsson

1988-07-28T23:59:59.000Z

69

The Radon Content of the Atmosphere  

Science Journals Connector (OSTI)

... MEASUREMENTS of the radon content of the atmosphere were made so long ago as 1905 by Eve1-2 in ... whole seemed to support the original suggestion of Elster and Geitel6 in 1903 that the radon in the atmosphere arises mainly from the soil. These workers noted that the highest ...

W. ANDERSON; W. V. MAYNEORD; R. C. TURNER

1954-09-04T23:59:59.000Z

70

Radon emanation on San Andreas Fault  

Science Journals Connector (OSTI)

... RADON is constantly emanated from the Earth into its atmosphere, normally in minute amounts. ... is constantly emanated from the Earth into its atmosphere, normally in minute amounts. Radon emanation is known to be anomalously large on active faults and to show temporal variations ...

Chi-Yu King

1978-02-09T23:59:59.000Z

71

Earth science: Radon and rock deformation  

Science Journals Connector (OSTI)

... crustal deformation. This unproven category includes the well-documented precursory decrease and increase of radon concentration before the 1978 Izu-Oshima earthquake in Japan (Fig. 1), as well ... local electric field. Trique et al. now report that various phenomena bursts of radon gas, changes of electric potential, and departures of ground tilt from that predicted on ...

Evelyn Roeloffs

1999-05-13T23:59:59.000Z

72

Determination of Radon and Thoron in Air  

Science Journals Connector (OSTI)

... A method for determination of radon favoured by the later investigators has been filtration of about 1 cubic metre of air ... of the activity found on the filter using a particle counter or ionization chamber ; radon passes through the filter and the short-lived activity observed is that of the four ...

G. B. COURTIER

1957-08-24T23:59:59.000Z

73

Radon and the risks of cancer  

Science Journals Connector (OSTI)

... of April, Denis Henshaw and colleagues1 published their finding of significant correlations between average indoor radon levels in different countries and the incidence of leukaemia and other cancers in children, ... a similar correlation for prostatic cancer2. Significant regional correlations have also been reported between indoor radon and acute myeloid leukaemia in Britain3 and Canada1.

Julian Peto

1990-05-31T23:59:59.000Z

74

Variation of calibration constant of alpha track detectors with respect to altitude  

E-Print Network [OSTI]

) Latha Vasudevan, B. S. ; M. S. , Kerala University, India Chair of Advisory Committee: Dr. Milton E. McLain Improved alpha track etch detectors have been widely used to monitor low levels of radon in the indoor environment over long integrating times.... Cellulose nitrate LR 115 II alpha track detectors were exposed in two different configurations (open and closed) in a known radon atmosphere to obtain an appropriate calibration constant (tracks cm '/kBq-h-m') for the LR 115 II film. The establishment...

Vasudevan, Latha

2012-06-07T23:59:59.000Z

75

National Radon Contractor Proficiency (RCP) Program. Proficiency report, June 1991  

SciTech Connect (OSTI)

The primary objective of the U.S. Environmental Protection Agency's (EPA) efforts to address the indoor radon problem is to reduce radon levels in buildings throughout the country. Achieving the objective requires a nationwide supply of capable radon mitigation contractors. In the Indoor Radon Abatement Act of 1988, Congress authorized EPA to establish a program to evaluate radon mitigation contractors and to provide the information to the public in cooperation with the States. The Radon Contractor Proficiency (RCP) Program was developed to assist States, EPA Regions, local government officials, and the public in selecting contractors who have demonstrated their proficiency in reducing indoor radon levels. The program is managed by the EPA Office of Radiation Programs' Radon Division. Under the voluntary program, radon contractors demonstrate their proficiency by meeting specific Program requirements. Individual contractors who meet these requirements are then listed in periodic RCP Proficiency Reports.

Not Available

1991-06-01T23:59:59.000Z

76

Thermodynamical Consistency of Excluded Volume Hadron Gas Models  

E-Print Network [OSTI]

The new excluded volume hadron gas model by Singh et al. [1-7] is critically discussed. We demonstrate that in this model the results obtained from relations between thermodynamical quantities disagree with the corresponding results obtained by statistical ensemble averaging. Thus, the model does not satisfy the requirements of thermodynamical consistency.

M. I. Gorenstein

2012-05-08T23:59:59.000Z

77

Ris-R-1201(EN) Radon Transport Modelling  

E-Print Network [OSTI]

in atmospheric pressure. It can also be used for flux calculations of radon from the soil surface or to model of soil gas and combined generation, radioactive decay, diffusion and advection of radon can be solved. Moisture is included in the model, and partitioning of radon between air, water and soil grains (adsorption

78

Generalised finite radon transform for N x N images  

Science Journals Connector (OSTI)

This paper extends the domain of the finite radon transform (FRT) to apply to square arrays of arbitrary size. The FRT is a discrete formalism of the Radon transform that assumes the image is periodic over the finite array Z"N^2 and requires only arithmetic ... Keywords: Discrete projection, Discrete radon transform, Fourier slice theorem, Image representation

Andrew Kingston; Imants Svalbe

2007-10-01T23:59:59.000Z

79

National Environmental Policy Act (NEPA) Categorically Excluded Actions |  

Broader source: Energy.gov (indexed) [DOE]

NEPA » National NEPA » National Environmental Policy Act (NEPA) Categorically Excluded Actions National Environmental Policy Act (NEPA) Categorically Excluded Actions Categorical Exclusions (CX) - Categorical exclusions are categories of actions that DOE has determined, by regulation, do not individually or cumulatively have a significant effect on the human environment and for which neither an environmental assessment nor an environmental impact statement is typically required. Title 10 Code of Federal Regulations Part 1021, National Environmental Policy Act Implementing Procedures, Appendices A and B to Subpart D, list DOE's categorical exclusions. Appendix A classes of actions are those actions considered to be general agency actions, such as awarding a contract or hiring personnel. Appendix B classes of actions

80

URANIUM MILL TAILINGS RADON FLUX CALCULATIONS  

E-Print Network [OSTI]

at the Piñon Ridge Property in western Montrose County, Colorado. The Piñon Ridge Mill includesURANIUM MILL TAILINGS RADON FLUX CALCULATIONS PI?ON RIDGE PROJECT MONTROSE COUNTY, COLORADO Submitted To: Energy Fuels Resources Corporation 44 Union Boulevard, Suite 600 Lakewood, Colorado 80228

Note: This page contains sample records for the topic "alpha excluding radon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

SWOT analysis of the Czech Radon programme  

Science Journals Connector (OSTI)

......the population in healthy housing Aggressive sales campaigns...Czech men in having their new house in good shape Builders underestimate...Davies M., Wilkinson P. Home energy efficiency and radon related risk of...in low energy and passive houses in Austria. (2012) RADPAR......

I. Fojtkov

2014-07-01T23:59:59.000Z

82

Residential radon remediation: performance over 17 years  

Science Journals Connector (OSTI)

......covering about 1000 m2. Water drains into the basin...sub-slab ventilation remediation system installed, i...sub-slab ventilation remediation (Bq mSE). Measured...concentration with height above ground level. For example...had a sub-slab radon remediation system installed that......

Naomi H. Harley; Passaporn Chittaporn; Anthony Marsicano

2011-05-01T23:59:59.000Z

83

Radon in atmospheric studies: a review  

SciTech Connect (OSTI)

The distribution of the isotopes of radon in space and time, their physical characteristics, and their behavior in the dynamics of the atmosphere have presented challenges for many decades. /sup 220/Rn, /sup 222/Rn and their daughters furnish a unique set of tracers for the study of transport and mixing processes in the atmosphere. Appropriate applications of turbulent diffusion theory yield general agreement with measured profiles. Diurnal and seasonal variations follow patterns set by consideration of atmospheric stability. /sup 222/Rn has been used successfully in recent studies of nocturnal drainage winds and cumulus convection. Good results have been obtained using /sup 222/Rn and its long-lived /sup 210/Pb daughter as tracers in the study of continent-to-ocean and ocean-to-continent air mass trajectories, /sup 220/Rn (thoron) because of its short half-life of only 55 seconds has been used to measure turbulent diffusion within the first few meters of the earth's surface and to study the influence of meteorological variables on the rate of exhalation from the ground. Radon daughters attach readily to atmospheric particulate matter which makes it possible to study these aerosols with respect to size spectra, attachment characteristics, removal by gravitation and precipitation, and residence times in the troposphere. The importance of ionization by radon and its daughters in the lower atmosphere and its effect on atmospheric electrical parameters is well known. Knowledge of the mobility and other characteristics of radon daughter ions has led to applications in the study of atmospheric electrical environments under fair weather and thunderstorm conditions and in the formation of condensation nuclei. The availability of increasingly sophisticated analytical tools and atmospheric measurement systems can be expected to add much to our understanding of radon and its daughters as trace components of the atmospheric environment in the years ahead.

Wilkening, M.

1981-01-01T23:59:59.000Z

84

An investigation into the knowledge and attitudes towards radon testing among residents in a high radon area  

Science Journals Connector (OSTI)

The aim of this study was to investigate the knowledge and attitudes of residents in the Castleisland area to radon. Castleisland in Co. Kerry was described as a high radon area following the discovery of a house in the area with radon levels 245 times that of the national reference level. Residents in this area were then asked to measure their homes for radon in the Castleisland radon survey. The uptake of this measurement was 17%. In order to investigate this response rate further, a questionnaire was designed and distributed to residents in the Castleisland area. This questionnaire measured the testing history of the participants, the reasons for testing/not testing, the factors important to them when considering having their home tested, radon knowledge and finally intentions to measure their home for radon. It was found that the main reason people do not test their home for radon is that they believe their home does not have a problem. Optimistic bias was thought to play a role here. The subjective norm component of the theory of planned behaviour was found to have a significant independent contribution in the variation in intentions to measure one's home for radon and this in turn could be targeted to increase uptake of radon measurement in the future.

Susan Clifford; David Hevey; Gerard Menezes

2012-01-01T23:59:59.000Z

85

Reassessing Radon in Drinking Water: Searching for Perspective on Radiation  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Reassessing Radon in Drinking Water: Searching for Perspective on Radiation Reassessing Radon in Drinking Water: Searching for Perspective on Radiation Risks Speaker(s): Richard Sextro Date: October 27, 1998 - 12:00pm Location: 90-3148 Although most of the exposures to radon and its radioactive decay products arise from indoor airborne radon originating in the soil adjacent to buildings, some contact with radon can occur due to its presence in drinking water. The exposures and health risks associated with radon dissolved in drinking water are typically much smaller, although the magnitude of the exposures and risks have been uncertain and the subject of some controversy. The 1996 Amendments to the (U.S.) Safe Drinking Water Act required the U.S. Environmental Protection Agency to contract with the U.S. National Academy of Sciences (NAS) to re-evaluate the risks associated with

86

Ambient Radon-222 Monitoring in Amargosa Valley, Nevada  

SciTech Connect (OSTI)

As part of a program to characterize and baseline selected environmental parameters in the region around the proposed repository at Yucca Mountain, Nevada, ambient radon-222 monitoring was conducted in the rural community of Amargosa Valley, the community closest to the proposed repository site. Passive integrating radon monitors and a continuous radon monitoring instrument were deployed adjacent to the Community Environmental Monitoring Program (CEMP) (http://www.cemp.dri.edu/index.html) station located in the Amargosa Valley Community Center near the library. The CEMP station provided real-time ambient gamma exposure and meteorological data used to correct the integrated radon measurements as well as verify meteorological data collected by the continuous radon monitoring instrument. Additionally, different types of environmental enclosures that housed the monitors and instrument were used to determine if particular designs influenced the ambient radon measurements.

L.H. Karr; J.J. Tappen; D. Shafer; K.J. Gray

2008-06-05T23:59:59.000Z

87

"ENDING STOCKS OF CRUDE OIL (excluding SPR)"  

U.S. Energy Information Administration (EIA) Indexed Site

ENDING STOCKS OF CRUDE OIL (excluding SPR)" ENDING STOCKS OF CRUDE OIL (excluding SPR)" "Sourcekey","WCESTP11","WCESTP11","WCESTP21","WCESTP21","WCESTP31","WCESTP31","WCESTP41","WCESTP41","WCESTP51","WCESTP51","WCESTUS1","WCESTUS1" "Date","Weekly East Coast (PADD 1) Ending Stocks excluding SPR of Crude Oil (Thousand Barrels)","Weekly East Coast (PADD 1) Ending Stocks excluding SPR of Crude Oil (Thousand Barrels)","Weekly Midwest (PADD 2) Ending Stocks excluding SPR of Crude Oil (Thousand Barrels)","Weekly Midwest (PADD 2) Ending Stocks excluding SPR of Crude Oil (Thousand Barrels)","Weekly Gulf Coast (PADD 3) Ending Stocks excluding SPR of Crude Oil (Thousand Barrels)","Weekly Gulf Coast (PADD 3) Ending Stocks excluding SPR of Crude Oil (Thousand Barrels)","Weekly Rocky Mountain (PADD 4) Ending Stocks excluding SPR of Crude Oil (Thousand Barrels)","Weekly Rocky Mountain (PADD 4) Ending Stocks excluding SPR of Crude Oil (Thousand Barrels)","Weekly West Coast (PADD 5) Ending Stocks excluding SPR of Crude Oil (Thousand Barrels)","Weekly West Coast (PADD 5) Ending Stocks excluding SPR of Crude Oil (Thousand Barrels)","Weekly U.S. Ending Stocks excluding SPR of Crude Oil (Thousand Barrels)","Weekly U.S. Ending Stocks excluding SPR of Crude Oil (Thousand Barrels)"

88

High Radon Levels in Homes Spark Moves To Combat Pollutant  

Science Journals Connector (OSTI)

High Radon Levels in Homes Spark Moves To Combat Pollutant ... Federal, state agencies have initiated programs to monitor levels of this inert radioactive gas in homes in certain areas and work out control strategy ... Health care officials have been concerned about radon for more than 20 years, but public attention reached a new high recently with the discovery of high levels of radon inside homes in the New Jersey- Pennsylvania-New York area. ...

DAVID J. HANSON

1985-11-18T23:59:59.000Z

89

WHO network and international collaborative project on residential radon risk  

Science Journals Connector (OSTI)

This paper describes WHO's project on assessment of health risks from residential radon exposure and development of an evidence base for guidelines and policies for Member States. The project will assess global burden of disease associated with in-door radon exposure and provide tools for risk communication on radon risks and mitigation procedures. The purpose of the paper is to draw attention and encourage participation of the international scientific community and national authorities to the new initiative of WHO.

Zhanat Carr; Michael Repacholi

2005-01-01T23:59:59.000Z

90

Applications of radon distribution and radon flux for the determination of oceanic mixing and air-sea gas exchange  

E-Print Network [OSTI]

APPLICATIONS OF RADON DISTRIBUTION AND RADON FLUX FOR THE DETERS 1INATION Ol OCEANIC IvfIXING AND AIR -SEA GAS EXCHA NGE A Thesis by ROBERT I. EWIS BREWER Submitted to the Graduate College oi T e xa s A '4 I'. 1 Univ c r s i ty in partial... luiiillment of the requirement for the degree of KIASTER OF SCIENCE May 1977 Major Subject: Oceanography APPLICATIONS OF RADON DIS TBIBUTION AND RADON FLUX FOR THE DETERMINATION OF OCEANIC MIXING A ND AIR ? SEA GAS EXCIdA NGE A Thesis by ROBERT LEWIS...

Brewer, Robert Lewis

2012-06-07T23:59:59.000Z

91

Radon release and dispersion from an open pit uranium mine  

SciTech Connect (OSTI)

Radon-222 flux from representative sections of the United Nuclear St. Anthony open-pit mine complex was measured. The collected radon was adsorbed on activated charcoal and the radon activity was measured by gamma spectroscopy. System design, calibration, and the procedure to determine radon flux density (pCi/m/sup 2/.s) are described. A continuous series of radon flux densities were measured over a 5-month period at a control point in the mine. The average flux density at the control point was 1.9 pCi/m/sup 2/.s. A close correlation between radon flux density variations and changes in barometric pressure was observed by a comparison of meteorological data and average daily radon flux density measured at the control point. The release rate from each section of the mine was calculated from the average radon flux density and the area of the section, as determined from enlarged aerial photographs. The average radon flux density for eight locations over the ore-bearing section was 7.3 pCi/m/sup 2/.s. The average flux density for four locations over undisturbed topsoil was 0.17 pCi/m/sup 2/.s. The average Ra-226 content of ten samples taken from the ore-bearing region was 102 pCi/g ore. The ratio of radon flux density to radium content (specific flux) was 0.072. The release rate from the entire St. Anthony open pit was determined to be 3.5 x 10/sup 5/ pCi/s. This rate is comparable to the natural release of radon from one square mile of undisturbed topsoil. 16 refs., 31 figs., 11 tabs.

Kisieleski, W.E.

1980-06-01T23:59:59.000Z

92

Radon control systems in existing and new construction: a review  

Science Journals Connector (OSTI)

......home. In crawl spaces, the sheeting is...infiltration after construction. The results of...techniques in new construction are presented in...radon levels Crawl space Minimal Moderate...Modifications to heating, ventilation and...public and private sector radon mitigation......

Naureen Mahbub Rahman; Bliss L. Tracy

2009-08-01T23:59:59.000Z

93

Indoor radon problem in energy efficient multi-storey buildings  

Science Journals Connector (OSTI)

......Against Radon at Home and at Work Indoor radon problem in energy efficient multi-storey...amount of the total energy consumption in developed countries...approaches for designing energy-efficient buildings...registration of 1 h average value. Dwellers......

I. V. Yarmoshenko; A. V. Vasilyev; A. D. Onishchenko; S. M. Kiselev; M. V. Zhukovsky

2014-07-01T23:59:59.000Z

94

Follow-up study of indoor radon in Greek buildings  

Science Journals Connector (OSTI)

......Greece 3 Greek Atomic Energy Commission, Agia...the Greek Atomic Energy Commission (GAEC...exposure to radon in the home and workplace. It...m3 increase in the average radon concentration...the Greek Atomic Energy Commission (GAEC...increase in energy consumption from wood products......

A. Clouvas; S. Xanthos; M. Kolovou; C. Potiriadis; G. Takoudis; J. Guilhot

2013-12-01T23:59:59.000Z

95

Radon control systems in existing and new construction: a review  

Science Journals Connector (OSTI)

......intervals after remediation, perhaps once...radon in the ground can penetrate...buildings from ground water and from building...holes around the water or electricity...Another option for remediation in existing homes...drawn from the ground by thermal convection...non-pressurised ground water solved the radon......

Naureen Mahbub Rahman; Bliss L. Tracy

2009-08-01T23:59:59.000Z

96

Radiation and Radon from Natural Stone May 7, 2008  

E-Print Network [OSTI]

Radiation and Radon from Natural Stone May 7, 2008 W.J. Llope Rice University, Houston, TX 77005 is "radiation" and the other is "radon." Radioactive elements, by their very nature, seek stability by decaying the outside and cause damage to cells and DNA, potentially causing cancer. Also, naturally occurring Uranium

Llope, William J.

97

Indoor Dose Conversion Coefficients for Radon Progeny for Different  

E-Print Network [OSTI]

Indoor Dose Conversion Coefficients for Radon Progeny for Different Ambient Environments K . N . Y ambient environments on the indoor radon dose (in terms of the dose conversion coefficient or DCC of the human respiratory tract. Epidemiological studies of under- ground miners of uranium and other minerals

Yu, K.N.

98

Relation of Radon to Non-active Air Contamination  

Science Journals Connector (OSTI)

... Identification of the activity as radon products was obtained by tracing the decay through periods longer than two hours, and ... transmitted to that of a clean filter paper by a photoelectric densitometer. Although variations in radon over this period were considerably less (under a 20 to 1 maximum) than instances ...

C. D. THOMAS; M. K. GAINER; T. W. BALL

1955-04-23T23:59:59.000Z

99

Radon-222 Daughter Concentrations in Uranium Mine Atmospheres  

Science Journals Connector (OSTI)

... undertaken to measure the concentrations of 210Pb and 210Po in uranium mine atmospheres at various radon daughter concentration levels, and to determine the amount of 210Pb in the mine atmosphere ... atmosphere relative to that which would be produced from the decay of the short-lived radon daughters deposited in the lungs. Radium-226 was also measured in air so as ...

RICHARD L. BLANCHARD

1969-07-19T23:59:59.000Z

100

Determination of radon concentrations of the Dikili geothermal area in western turkey  

Science Journals Connector (OSTI)

......Figure 3 shows the average indoor radon concentrations...the Turkish Atomic Energy Commission for indoor...distribution of average indoor radon concentrations...Variation of the average indoor radon concentrations...and bottling, the consumption of interest in the...against radon-222 at home and at work, ICRP......

Y. Yarar; T. Gnaydi; N. elebi

2006-04-01T23:59:59.000Z

Note: This page contains sample records for the topic "alpha excluding radon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

The Austrian radon activities on the way to the national radon action plan  

Science Journals Connector (OSTI)

......radon concentration in water or air)-is listed...well as workplace on ground floor and basement level...building materials, water). A list of issues...type, measurement, remediation and prevention measures...situation (annual mean, ground floor, no basement......

V. Gruber; W. Ringer; G. Wurm; W. Haider

2014-07-01T23:59:59.000Z

102

The Austrian radon activities on the way to the national radon action plan  

Science Journals Connector (OSTI)

......AGES - Austrian Agency for Health and Food Safety, National...the OIB-3 guideline under dangerous immissions and refers to the...radon exposure and associated health risks(4), which is covered...within the Austrian Agency for Health and Food Safety (AGES......

V. Gruber; W. Ringer; G. Wurm; W. Haider

2014-07-01T23:59:59.000Z

103

Technical aspects of the sigma factor alarm method in alpha CAMs  

SciTech Connect (OSTI)

Some test must be applied to the low-level count data from alpha continuous air monitors (CAMs) to determine if the count is statistically significant (i.e., different from background). The test should also automatically account for different levels of background (i.e., ambient radon progeny concentrations). The method should, in other words, be as sensitive as possible, automatically desensitize when required, but in such a manner as to not exceed a previously-chosen acceptable false-alarm rate.

Justus, Alan Lawrence [Los Alamos National Laboratory

2009-01-01T23:59:59.000Z

104

National radon database documentation. Volume 5. The EPA/state residential radon surveys: Years 5 and 6. Final report 1986-1992  

SciTech Connect (OSTI)

The National Radon Database has been developed by the U.S. Environmental Protection Agency (EPA) to distribute information collected in two recently completed radon surveys: the EPA/State Residential Radon Surveys, Years 1 to 6; and The National Residential Radon Survey. The goals of the state radon surveys were twofold. Some measure of the distribution of radon levels among residences was desired for major geographic areas within each state and for each state as a whole. In addition, it was desired that each state survey would be able to identify areas of potentially high residential radon concentrations (hot spots) in the state, enabling the state to focus its attention on areas where indoor radon concentrations might pose a greater health threat. The document discusses year 5, 1990-91. The areas surveyed are: Arkansas; Illinois; Maryland; Eastern Cherokee Nation; Mississippi; Texas; and Washington.

Not Available

1993-01-01T23:59:59.000Z

105

E-Print Network 3.0 - advanced cancer excluding Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Powered by Explorit Topic List Advanced Search Sample search results for: advanced cancer excluding Page: << < 1 2 3 4 5 > >> 1 Eur J Cancer. Author manuscript Social...

106

Radon in homes and other technologically enhanced radioactivity  

SciTech Connect (OSTI)

The results are described of recent observations at Argonne National Laboratory, contributing to our knowledge of such factors as the origin of high levels of radon in houses, its variability with time or otherwise, its uniformity throughout the house or otherwise, and the behavior and fate of the short-lived daughter-products. In a sample of 110 houses, mostly in the west suburban area of Chicago, 15% had radon concentrations in excess of 6 pCi litre/sup -1/ and 96% greater than 10 pCi litre /sup -1/. If this distribution is representative of all houses in the USA, the population being exposed to such high concentrations of radon is far greater than the number of people in Grand Junction being exposed to quite similar concentrations from technologically enhanced radioactivity. There is a great need for far more extensive data on radon in houses.

Rundo, J.; Toohey, R.E.

1983-01-01T23:59:59.000Z

107

Exposure to radon in dwellings in the Sharri community, Kosovo  

Science Journals Connector (OSTI)

......major cause of lung cancer, second only to cigarette...course of prospecting for uranium between 1983 and 1989...because they were hit by depleted uranium projectiles during the...although no impact of depleted uranium on radon levels was......

M. Bahtijari; J. Vaupotic; A. Gregoric; P. Stegnar; I. Kobal

2008-06-01T23:59:59.000Z

108

History of the measurement of radon in central Bohemia  

Science Journals Connector (OSTI)

......is radium needles in depleted uranium shielding. The chamber's...Jerabek J. Lung cancer risk in relation to long-term...radiation exposure in uranium mines. Trnovec T...Holecek J. Study of lung cancer and residential radon......

Ivo Burian; Petr Otahal

2008-06-01T23:59:59.000Z

109

Measurement of indoor radon concentration in kindergartens in Sofia, Bulgaria  

Science Journals Connector (OSTI)

......significance of the overall factors for indoor radon concentration was tested by analysis of variance (ANOVA) and Kruskal-Wallis non-parametric test at a significance level of 95 %. Number of measurements, minimum, median, maximum, GM......

Kremena Ivanova; Zdenka Stojanovska; Martina Tsenova; Viktor Badulin; Bistra Kunovska

2014-11-01T23:59:59.000Z

110

Radon in context of natural radiation exposure: the Czech experience  

Science Journals Connector (OSTI)

......doses from ingestion of water are reasonably avertable...and intervention (remediation of existing exposure...effective dose caused by water containing 1000 Bq l1...radon concentrations in ground water vary from some Becquerel......

J. Hulka

2008-06-01T23:59:59.000Z

111

Some aspects of the radon problem in Kazakhstan  

Science Journals Connector (OSTI)

Publisher Summary Preliminary analysis shows that the population of Kazakhstan lives primarily in potentially dangerous areas from the radioactivity exposure point of view. According to selected studies, radon isotope PAEC values in premises where people stay for long times may exceed allowable levels by several times. At the same time, on account of insufficient organization of work on a national scale, lack of funds, standard methods and metrology equipment, no radon studies are actually performed even in those regions where geological rock structure and availability of tectonic faults suggest that an excess radon concentration in residential and public buildings may be anticipated. Preliminary recorded data from independent studies show that increased radon concentrations in living premises are typical of the Republic. The survey of population exposure from natural sources of ionizing radiation in Akchatau village in Zhezkazgan oblast and the survey done in Almaty are insufficient to understand and solve the problem in Kazakhstan in general.

V.N. Sevostyanov

2005-01-01T23:59:59.000Z

112

Effect of Irradiating the Tubercle Bacillus with Radon  

Science Journals Connector (OSTI)

... tubercle bacillus (1 mgm./c.c.) using the whole of the radiation of radon dissolved in the culture. The teclinique we have elaborated enables us to obtain reproducible ... -radiations aro negligible.) The following results are observed.

P. BONET-MAURY; H. R. OLIVIER

1939-11-11T23:59:59.000Z

113

Radon attenuation handbook for uranium mill tailings cover design  

SciTech Connect (OSTI)

This handbook has been prepared to facilitate the design of earthen covers to control radon emission from uranium mill tailings. Radon emissions from bare and covered uranium mill tailings can be estimated from equations based on diffusion theory. Basic equations are presented for calculating surface radon fluxes from covered tailings, or alternately, the cover thicknesses required to satisfy a given radon flux criterion. Also described is a computer code, RAECOM, for calculating cover thicknesses and surface fluxes. Methods are also described for measuring diffusion coefficients for radon, or for estimating them from empirical correlations. Since long-term soil moisture content is a critical parameter in determining the value of the diffusion coefficient, methods are given for estimating the long-term moisture contents of soils. The effects of cover defects or advection are also discussed and guidelines are given for determining if they are significant. For most practical cases, advection and cover defect effects on radon flux can be neglected. Several examples are given to demonstrate cover design calculations, and an extensive list of references is included. 63 references, 18 figures, 6 tables.

Rogers, V.C.; Nielson, K.K.; Kalkwarf, D.R.

1984-04-01T23:59:59.000Z

114

Indoor and soil gas radon simultaneous measurements for the purpose of detail analysis of radon entry pathways into houses  

Science Journals Connector (OSTI)

......on the modification of the standard BD method described in detail...concentration is variable during the standard indoor measurement campaign...symmetric against each other and standard indoor radon measurement...householder activities, including HVAC (heating, ventilation and......

A. Fronka

2011-05-01T23:59:59.000Z

115

Indoor Radon and Its Decay Products: Concentrations, Causes, and Control Strategies  

E-Print Network [OSTI]

Radon and Its Decay Products in Indoor Air, Wiley, New York.radon daughter products in indoor air, Radiat. Prot. Dosim..and their decay products in indoor air, Health Phys. , 34,

Nero, A.V.

2008-01-01T23:59:59.000Z

116

Protection from radon exposure at home and at work in the directive 2013/59/Euratom  

Science Journals Connector (OSTI)

......RL for (annual average) radon concentration...as an annual average) exceeding the...as programmes on energy saving and indoor...due to tobacco consumption, energy saving and other...et al. Radon in homes and lung cancer......

F. Bochicchio

2014-07-01T23:59:59.000Z

117

Indoor radon in rural dwellings of the South-Pannonian region  

Science Journals Connector (OSTI)

......are possibly due to the uranium content of deep underground...Lj. Simple method for depleted uranium determination. Jpn J...underestimate the radon-related health risk. The elevated radon...explained by elevated uranium levels of surface soil......

S. Forkapic; I. Bikit; J. Slivka; Lj. Conkic; M. Veskovic; N. Todorovic; E. Varga; D. Mrda; E. Hulber

2007-02-01T23:59:59.000Z

118

An alpha scintillation spectrometer  

E-Print Network [OSTI]

investi- gation of the properties of alpha radiation. In his work, the scin- tillations produced by alpha particles impinging on a zinc-sulphide screen were observed and counted visually with the aid of a low power microscope. The scintillations..., the source changing in the proportional counter is inconvenient, requiring a fairly elaborate gas handling and purifying system. Alpha particl s, when passing through a photographic emulsion, ionize the silver halide crystals with which they come...

Yates, Ralph Aaron

1952-01-01T23:59:59.000Z

119

THE EFFECT OF RADON TRANSPORT IN GROUNDWATER UPON GAMMA-RAY BOREHOLE LOGS  

E-Print Network [OSTI]

Estimation of the Lung Tissue Dose from Inhalation of Radon and Daughters," Health Physics 10, 1137 Federal Radiation

Nelson, P.H.

2010-01-01T23:59:59.000Z

120

Rectangular discrete radon transform for buildings extraction from high resolution satellite images  

Science Journals Connector (OSTI)

This paper presents a new approach titled Rectangular Discrete Radon Transform (RDRT) which is based on the generalization of the classical Radon transform to project the images with rectangular objects instead of straight lines. The RDRT was conceived ... Keywords: high resolution satellite image, rectangular buildings, rectangular discrete radon transform

Elouedi Ines; Hamouda Atef; Rojbani Hmida

2012-06-01T23:59:59.000Z

Note: This page contains sample records for the topic "alpha excluding radon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

1) Title of the paper: Lossless Compression Based on a Discrete and Exact Radon Transform: A  

E-Print Network [OSTI]

the difference between several sim- ilar finite Radon projections. Two differential encoding tech- niques are needed to efficiently encode the Radon trans- formed data. An intra-projection encoding technique in such projections. The second step consists in encoding the similarities between Radon projections

Autrusseau, Florent

122

DTW for Matching Radon Features: A Pattern Recognition and Retrieval Method  

E-Print Network [OSTI]

. This allows to exploit the Radon property to include both boundary as internal structure of shapes, whileDTW for Matching Radon Features: A Pattern Recognition and Retrieval Method Santosh K.C.1 , Bart. It is basically based on dynamic programming for matching the Radon features. The key char- acteristic

Boyer, Edmond

123

Seasonal variation of radon concentrations in UK homes  

Science Journals Connector (OSTI)

The patterns of seasonal variation of radon concentrations were measured in 91 homes in five regions of the UK over a period of two years. The results showed that there was no significant difference between the regions in the pattern or magnitude of seasonal variation in radon concentrations. The arithmetic mean variation was found to be close to that found previously in the UK national survey. Differences in the pattern between the two years of the study were not significant. Two-thirds of homes in the study followed the expected pattern of high radon in the winter and low radon in the summer. Most of the rest showed little seasonal variation, and a few showed a reversed seasonal pattern. The study does not provide any clear evidence for the recorded house characteristics having an effect on the seasonal variation in radon concentrations in UK homes, though the statistical power for determining such effects is limited in this study. The magnitude of the seasonal variation varied widely between homes. Analysis of the individual results from the homes showed that because of the wide variation in the amount of seasonal variation, applying seasonal correction factors to the results of three-month measurements can yield only relatively small improvements in the accuracy of estimates of annual mean concentrations.

J C H Miles; C B Howarth; N Hunter

2012-01-01T23:59:59.000Z

124

Imaging alpha particle detector  

DOE Patents [OSTI]

A method and apparatus for detecting and imaging alpha particles sources is described. A dielectric coated high voltage electrode and a tungsten wire grid constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source to be quantitatively or qualitatively analyzed. A thin polyester film window allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

Anderson, D.F.

1980-10-29T23:59:59.000Z

125

Imaging alpha particle detector  

DOE Patents [OSTI]

A method and apparatus for detecting and imaging alpha particles sources is described. A conducting coated high voltage electrode (1) and a tungsten wire grid (2) constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source (3) to be quantitatively or qualitatively analyzed. A thin polyester film window (4) allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

Anderson, David F. (Los Alamos, NM)

1985-01-01T23:59:59.000Z

126

Assessment of the Exposure to and Dose from Radon Decay Products in Normally Occupied Homes  

Science Journals Connector (OSTI)

Assessment of the Exposure to and Dose from Radon Decay Products in Normally Occupied Homes ... In homes supplied by water with a high radon content, inhalation exposure from the radon in the water may occur on two different time scales: (a) long-term exposure that occurs due to an increase in the background radon concentration from radon released ... ... Experimental Assessment of the Short- and Long-Term Effects of 222Rn from Domestic Shower Water on the Dose Burden Incurred in Normally Occupied Homes ...

Philip K. Hopke; Bent. Jensen; Chih-Shan. Li; Nathalie. Montassier; Piotr. Wasiolek; Alfred J. Cavallo; Kenneth. Gatsby; Robert H. Socolow; Anthony C. James

1995-05-01T23:59:59.000Z

127

E-Print Network 3.0 - alpha-emitters radon lung Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Health- Publications and Products Collection: Environmental Sciences and Ecology 4 REPORT NO. 8 radiation hazards Summary: precludesdrawing definite conclusions from them....

128

E-Print Network 3.0 - alpha-track radon monitor Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Public Health Tracking Network COLORADO Keeping Track, Promoting Health Summary: 's geology, topography and industries shape many of these concerns. For example, uranium,...

129

Indoor radon concentrations in the town of Niksic, Montenegro  

Science Journals Connector (OSTI)

......ac.yu 1 Faculty of Natural Sciences and Mathematics...filter, which allows radon gas to enter the chamber volume...ranges from 7 Bq m3 (Cyprus) to 120 Bq m3 (Albania...283-291. Monograph Rare Gas Geochemistry - Applications...Montenegro. | Faculty of Natural Sciences and Mathematics......

N. Antovic; P. Vukotic; R. Zekic; R. Ilic

2007-05-01T23:59:59.000Z

130

Achievements and current activities of the Canadian radon program  

Science Journals Connector (OSTI)

......territorial governments to review the Canadian radon...of practices and standards for radiation protection...Quality assurance plans have been established...the USA and the Standards Council of Canada...2008 to develop a standard protocol for mapping...such as ground uranium concentration from......

Jing Chen; Ken Ford; Jeff Whyte; Kelley Bush; Deborah Moir; Jack Cornett

2011-07-01T23:59:59.000Z

131

Dennis, Eberhart, Dulikravich & Radons FINITE ELEMENT SIMULATION OF COOLING  

E-Print Network [OSTI]

). The simulations performed in this study consider ice packs applied to head and neck as well as using a head-cooling1 Dennis, Eberhart, Dulikravich & Radons FINITE ELEMENT SIMULATION OF COOLING OF REALISTIC 3-D Rapid cooling of the brain in the first minutes following the onset of cerebral ischemia

Dennis, Brian

132

Indoor radon problem in energy efficient multi-storey buildings  

Science Journals Connector (OSTI)

......estimated. INTRODUCTION The problems of energy saving and energy efficiency are in the spotlight of society. Buildings account for a...percentile exceeds 10 and only in one room it is 4. In each house, the minimal registered radon concentration drops below......

I. V. Yarmoshenko; A. V. Vasilyev; A. D. Onishchenko; S. M. Kiselev; M. V. Zhukovsky

2014-07-01T23:59:59.000Z

133

Radon control systems in existing and new construction: a review  

Science Journals Connector (OSTI)

......maintenance. In the active/passive house ventilation system, natural...unique characteristics of each house, the level of radon, the...soil gases as well, increases energy efficiency, uses a passive system that...walls before it can enter the house (wall suction) or blows air......

Naureen Mahbub Rahman; Bliss L. Tracy

2009-08-01T23:59:59.000Z

134

Distillation purification and radon assay of liquid xenon  

SciTech Connect (OSTI)

We succeeded to reduce the Kr contamination in liquid xenon by a factor of 1/1000 with a distillation system in Kamioka mine. Then, the remaining radioactivities (Radon and Kr) in purified liquid xenon were measured with the XMASS prototype detector. In this talk, the distillation system and the remaining internal radioactivity levels are reported.

Takeuchi, Yasuo [Kamioka Observatory, ICRR, Univ. of Tokyo, Kamioka-cho, Hida-shi, Gifu 506-1205 (Japan)

2005-09-08T23:59:59.000Z

135

Long-Term Observations of Indoor and Outdoor Radon Concentrations  

Science Journals Connector (OSTI)

......Radiation Protection Dosimetry Article Long-Term Observations of Indoor and Outdoor...Lapere Two sets of data obtained by long-term observations of radon concentration...phosphogypsum was used. Around a nuclear waste storage place containing radium, 22 dosemeters......

J. Uyttenhove; R. Lapere

1988-08-01T23:59:59.000Z

136

Radon control systems in existing and new construction: a review  

Science Journals Connector (OSTI)

......air-tightness of a home. The quantities...estimates of the total average radon entry rate...buildings due to energy saving measures or...measures are costs, energy consumption, incomplete diagnostic...process. Surveys among home-owners could provide......

Naureen Mahbub Rahman; Bliss L. Tracy

2009-08-01T23:59:59.000Z

137

The history of radon from a Swedish perspective  

Science Journals Connector (OSTI)

......increase when saving energy by decreasing...rate during the energy crisis in 1974...The country-averages of the indoor...representative sampling of consumption water in Sweden...recommendations of 1993 for homes and workplaces...regarding the averages, with radon...is unfit for consumption. More than 100......

Gun Astri Swedjemark

2004-07-01T23:59:59.000Z

138

The newest international trend about regulation of indoor radon  

Science Journals Connector (OSTI)

......AL of 400 Bq m3 for above-ground workplaces and an AL in the...soil, building materials or water. A list of elements to be...100-200(18) aAbove-ground workplaces. bUnderground workplaces...RADPAR-Radon Prevention and Remediation, grant agreement No. 20081217......

Francesco Bochicchio

2011-07-01T23:59:59.000Z

139

Content based image hashing via wavelet and radon transform  

Science Journals Connector (OSTI)

Image hash function based on the image content has applications in watermarking, authentication and image retrieval. This paper presents an algorithm for generating an image hash that is robust against content-preserving modifications and at the same ... Keywords: image hashing, radon transform, wavelet transform

Xin C. Guo; Dimitrios Hatzinakos

2007-12-01T23:59:59.000Z

140

Spherical radon transforms and mathematical problems of thermoacoustic tomography  

E-Print Network [OSTI]

The spherical Radon transform (SRT) integrates a function over the set of all spheres with a given set of centers. Such transforms play an important role in some newly developing types of tomography as well as in several areas of mathematics...

Ambartsoumian, Gaik

2009-06-02T23:59:59.000Z

Note: This page contains sample records for the topic "alpha excluding radon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

Radon releases from Australian uranium mining and milling projects: assessing the UNSCEAR approach  

Science Journals Connector (OSTI)

The release of radon gas and progeny from the mining and milling of uranium-bearing ores has long been recognised as a potential radiological health hazard. The standards for exposure to radon and progeny have decreased over time as the understanding of their health risk has improved. In recent years there has been debate on the long-term releases (10,000 years) of radon from uranium mining and milling sites, focusing on abandoned, operational and rehabilitated sites. The primary purpose has been estimates of the radiation exposure of both local and global populations. Although there has been an increasing number of radon release studies over recent years in the USA, Australia, Canada and elsewhere, a systematic evaluation of this work has yet to be published in the international literature. This paper presents a detailed compilation and analysis of Australian studies. In order to quantify radon sources, a review of data on uranium mining and milling wastes in Australia, as they influence radon releases, is presented. An extensive compilation of the available radon release data is then assembled for the various projects, including a comparison to predictions of radon behaviour where available. An analysis of cumulative radon releases is then developed and compared to the UNSCEAR approach. The implications for the various assessments of long-term releases of radon are discussed, including aspects such as the need for ongoing monitoring of rehabilitation at uranium mining and milling sites and life-cycle accounting.

Gavin M. Mudd

2008-01-01T23:59:59.000Z

142

Particle number fluctuations in nuclear collisions within excluded volume hadron gas model  

E-Print Network [OSTI]

The multiplicity fluctuations are studied in the van der Waals excluded volume hadron-resonance gas model. The calculations are done in the grand canonical ensemble within the Boltzmann statistics approximation. The scaled variances for positive, negative and all charged hadrons are calculated along the chemical freeze-out line of nucleus-nucleus collisions at different collision energies. The multiplicity fluctuations are found to be suppressed in the van der Waals gas. The numerical calculations are presented for two values of hard-core hadron radius, $r=0.3$ fm and 0.5 fm, as well as for the upper limit of the excluded volume suppression effects.

M. I. Gorenstein; M. Hauer; D. O. Nikolajenko

2007-02-26T23:59:59.000Z

143

Radon flux measurements on Gardinier and Royster phosphogypsum piles near Tampa and Mulberry, Florida  

SciTech Connect (OSTI)

As part of the planned Environmental Protection Agency (EPA) radon flux monitoring program for the Florida phosphogypsum piles, Pacific Northwest Laboratory (PNL), under contract to the EPA, constructed 50 large-area passive radon collection devices and demonstrated their use at two phosphogypsum piles near Tampa and Mulberry, Florida. The passive devices were also compared to the PNL large-area flow-through system. The main objectives of the field tests were to demonstrate the use of the large-area passive radon collection devices to EPA and PEI personnel and to determine the number of radon flux measurement locations needed to estimate the average radon flux from a phosphogypsum pile. This report presents the results of the field test, provides recommendations for long-term monitoring, and includes a procedure for making the radon flux measurements.

Hartley, J.N.; Freeman, H.D.

1986-01-01T23:59:59.000Z

144

The effectiveness of radon preventive and remedial measures in Irish homes  

Science Journals Connector (OSTI)

It is estimated that approximately 100?000 Irish homes have radon concentrations above the reference level of 200Bqm?3. To minimise the number of new homes with this problem, building regulations require that all new homes built since July 1998 in high radon areas are installed with radon barriers during construction. Measurements on local authority homes in a number of high radon areas have allowed the impact of these new regulations to be assessed. In County Cork a reduction of up to 70% in the mean radon concentration was observed in homes built since 1998 relative to those built before this date. A reduction in both the number of homes exceeding the reference level and the maximum concentration measured in homes was also measured. Homes exceeding the reference level were remediated with the use of an active sump. The results of this remedial work are also presented and show that the mean reduction in radon concentration achieved was 92%.

S Long; D Fenton; M Cremin; A Morgan

2013-01-01T23:59:59.000Z

145

Radon Progeny as a experimental tool for dosimetry of nanoaerosols  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Radon Progeny as a experimental tool for dosimetry of nanoaerosols Radon Progeny as a experimental tool for dosimetry of nanoaerosols Title Radon Progeny as a experimental tool for dosimetry of nanoaerosols Publication Type Journal Article LBNL Report Number LBNL-117E Year of Publication 2009 Authors Ruzer, Lev S., and Michael G. Apte Journal Radiation Biology. Radioecology (Russian) Volume 49 Start Page Chapter Issue 3 Pagination 395-404 Other Numbers LBNL-117E Abstract The study of aerosol exposure and dosimetry measurements and related quantitation of health effects are important to the understanding of the consequences of air pollution, and are discussed widely in the scientific literature. During the last 10 years the need to correlate aerosol exposure and biological effects has become especially important due to rapid development of a new, revolutionary industry - nanotechnology. Nanoproduct commerce is predicted to top $1 trillion by 2015. Quantitative assessment of aerosol particle behavior in air and in lung deposition, and dosimetry in different parts of the lung, particularly for nanoaerosols, remains poor despite several decades of study. Direct measurements on humans are still needed in order to validate the hollow cast, animal studies, and lung deposition modeling. We discuss here the use of nanoscale radon decay products as an experimental tool in the study of local deposition and lung dosimetry for nanoaerosols. The issue of the safe use of radon progeny in such measurements is discussed based on a comparison of measured exposure in 3 settings: general population, miners, and in a human experiment conducted at the Paul Scherer Institute (PSI) in Switzerland. One of the properties of radon progeny is that they consist partly of 1 nm radioactive particles called unattached activity; having extremely small size and high diffusion coefficients, these particles can be potentially useful as radioactive tracers in the study of nanometer-sized aerosols. We present a theoretical and experimental study of the correlation between the unattached activity and aerosol particle surface area, together with a description of its calibration and method for measurement of the unattached fraction

146

Unattached radon progeny as an experimental tool for dosimetry of  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Unattached radon progeny as an experimental tool for dosimetry of Unattached radon progeny as an experimental tool for dosimetry of nanoaerosols: Proposed method and research strategy Title Unattached radon progeny as an experimental tool for dosimetry of nanoaerosols: Proposed method and research strategy Publication Type Journal Article LBNL Report Number LBNL-117E Year of Publication 2010 Authors Ruzer, Lev S., and Michael G. Apte Journal Inhalation Toxicology Volume 22 Pagination 760-766 Abstract The study of aerosol exposure and dosimetry measurements and related quantitation of health effects are important to the understanding of the consequences of air pollution, and are discussed widely in the scientific literature. During the last 10 years the need to correlate aerosol exposure and biological effects has become especially important due to rapid development of a new, revolutionary industry - nanotechnology. Nanoproduct commerce is predicted to top $1 trillion by 2015. Quantitative assessment of aerosol particle behavior in air and in lung deposition, and dosimetry in different parts of the lung, particularly for nanoaerosols, remains poor despite several decades of study. Direct measurements on humans are still needed in order to validate the hollow cast, animal studies, and lung deposition modeling. We discuss here the use of nanoscale radon decay products as an experimental tool in the study of local deposition and lung dosimetry for nanoaerosols. The issue of the safe use of radon progeny in such measurements is discussed based on a comparison of measured exposure in 3 settings: general population, miners, and in a human experiment conducted at the Paul Scherer Institute (PSI) in Switzerland. One of the properties of radon progeny is that they consist partly of 1 nm radioactive particles called unattached activity; having extremely small size and high diffusion coefficients, these particles can be potentially useful as radioactive tracers in the study of nanometer-sized aerosols. We present a theoretical and experimental study of the correlation between the unattached activity and aerosol particle surface area, together with a description of its calibration and method for measurement of the unattached fraction

147

E-Print Network 3.0 - au radon gaz Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

est gal au rapport des intensits du tube de radon... place au milieu d'un tube Fis. 2. Une enveloppe ... Source: Ecole Polytechnique, Centre de mathmatiques Collection:...

148

E-Print Network 3.0 - atmospheric radon-222 concentration Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

1. Radon-222... concentrations in air include ... Source: Baskaran, Mark - Department of Geology, Wayne State University Collection: Geosciences ; Chemistry 30 1.0 MAJOR STUDIES...

149

National Radon Database. Volume 5. The EPA/state residential radon surveys: AR, IL, MD, MT, MS, TX, VA, WA and the Eastern Cherokee Nation, 1990-1992 (5 1/4 inch 1. 2mb) (for microcomputers). Data file  

SciTech Connect (OSTI)

The National Radon Database (NRDB) was developed by the United States Environmental Protection Agency (USEPA) to distribute information in two recent radon surveys: the EPA/State Residential Radon Surveys and the National Residential Radon Survey. The National Residential Radon Surveys collected annual average radon measurements on all levels of approximately 5,700 homes nationwide. Information collected during survey includes a detailed questionnaire on house characteristics, as well as radon measurements. The radon survey data for Volume 6 is contained on two diskettes. The data diskettes are accompanied by comprehensive documentation on the design and implementation of the survey, the development and use of sampling weights, a summary of survey results, and information concerning the household questionnaire.

Not Available

1992-01-01T23:59:59.000Z

150

National Radon Database. Volume 5. The EPA/state residential radon surveys: AR, IL, MD, MT, MS, TX, VA, WA, and the Eastern Cherokee Nation, 1990-1992 (3 1/2 inch, 1. 44mb) (for microcomputers). Data file  

SciTech Connect (OSTI)

The National Radon Database (NRDB) was developed by the United States Environmental Protection Agency (USEPA) to distribute information in two recent radon surveys: the EPA/State Residential Radon Surveys and the National Residential Radon Survey. The National Residential Radon Surveys collected annual average radon measurements on all levels of approximately 5,700 homes nationwide. Information collected during survey includes a detailed questionnaire on house characteristics, as well as radon measurements. The radon survey data for Volume 6 is contained on two diskettes. The data diskettes are accompanied by comprehensive documentation on the design and implementation of the survey, the development and use of sampling weights, a summary of survey results, and information concerning the household questionnaire.

Not Available

1992-01-01T23:59:59.000Z

151

Technical Report No.7, Investigation of radon and helium as possible fluid-phase precursors to earthquakes. Technical Report No. 2, Additional task: Radon, helium and geochemical monitoring on the Palmdale uplift.  

E-Print Network [OSTI]

Imperial Valley) HELIUM AND All with RADON IN WELL SAMPLES of the wells in the Southern Network are geothermal

Craig, H; Lupton, J E; Chung, Y; Horowitz, R M

1977-01-01T23:59:59.000Z

152

Influence of energy-saving measures on the radon concentration in some kindergartens in the Czech Republic  

Science Journals Connector (OSTI)

......Radon at Home and at Work Influence of energy-saving...obtain the average activity...current energy consumption standards...that recent energy-saving...long-term average indoor radon...et al. Home energy efficiency......

I. Fojtikova; K. Navratilova Rovenska

2014-07-01T23:59:59.000Z

153

A study of radon-222 concentrations in North Carolina groundwater  

SciTech Connect (OSTI)

The groundwater of 400 North Carolina homes was sampled to ascertain the distribution and extent of {sup 222}Rn in North Carolina groundwater. Arithmetic mean (AM) and geometric mean (GM) concentrations of 1,816 pCi L{sup {minus}1} and 656 pCi L{sup {minus}1} were found for the state. These results indicate that two-thirds of 114{degree}C. homes served by groundwater exceed the EPA proposed 300 pCi L{sup {minus}1} maximum contaminant level (MCL). Only 2% of NC homes exceeded 10,000 pCi L-1. The Eastern region had the lowest radon concentrations by far, with a GM of 2-)0 pCi L{sup {minus}1}. The Central region and Western region had GM`s of 794 pCi L{sup {minus}1} and 1,032 pCi L{sup {minus}1} respectively. The groundwater data approached a log normal distribution. No consistent trends were noted in the relationship between indoor radon concentrations and groundwater radon concentrations. A correlation coefficient of 0.00921 revealed a very weak linear relationship.

Evans, J.P.

1992-12-31T23:59:59.000Z

154

Radon emanation measurement using French and Russian track detectors  

Science Journals Connector (OSTI)

This paper presents the first results of a new Franco-Russian project: the International Centre for Radon Expertise (I.C.R.E.). The objectives of this center include determining the sources and contents of natural radioactive gases and their radioactive daughters in order to provide protection against radiation for the population and the environment, and trace the migration of radioactive elements in the soil and plants. Passive radon measurement techniques developed in France and in Russia have been used together to conduct preliminary studies. The results of a comparison of the two techniques, applied both in laboratory and outdoors, are also presented. In order to develop the one passive technique that will be used in future studies, the possibility of optimization using various French and Russian detectors has been investigated. Attempts have been made to compare the response of original measurement cells with nuclear track detectors. Comparisons of such track detector responses have been performed at the university of Franche-Comte in France using various radon environmental conditions (atmospheric gas, soil gas and in water).

D Klein; V Pautov; A Chambaudet; G Barenboim

1995-01-01T23:59:59.000Z

155

Alpha-decay half-lives, alpha-capture and alpha-nucleus potential  

E-Print Network [OSTI]

The alpha-decay half-lives and the alpha-capture cross-sections are evaluated in the framework of unified model for alpha-decay and alpha-capture. In the framework of this model the alpha-decay and alpha-capture are considered as penetration of the alpha-particle through the potential barrier formed by nuclear, Coulomb and centrifugal interactions between alpha-particle and nucleus. The spins and the parities of parent and daughter nuclei as well as the quadrupole and hexadecapole deformations of daughter nuclei are taken into account for evaluation of the alpha-decay half-lives. The alpha-decay half-lives for 344 nuclei and the alpha-capture cross-sections of 40Ca, 44Ca, 59Co, 208Pb and 209Bi agree well with the experimental data. The evaluated alpha-decay half-lives within the range 10^{-9} alpha-emitters are tabulated.

V. Yu. Denisov; A. A. Khudenko

2009-02-04T23:59:59.000Z

156

Ionic Asymmetry and Solvent Excluded Volume Effects on Spherical Electric Double Layers: A Density Functional Approach  

SciTech Connect (OSTI)

In this article we present a classical density functional theory for electrical double layers of spherical macroions that extends the capabilities of conventional approaches by accounting for electrostatic ion correlations, size asymmetry and excluded volume effects. The approach is based on a recent approximation introduced by Hansen-Goos and Roth for the hard sphere excess free energy of inhomogeneous fluids (J. Chem. Phys. 124, 154506). It accounts for the proper and efficient description of the effects of ionic asymmetry and solvent excluded volume, especially at high ion concentrations and size asymmetry ratios including those observed in experimental studies. Additionally, we utilize a leading functional Taylor expansion approximation of the ion density profiles. In addition, we use the Mean Spherical Approximation for multi-component charged hard sphere fluids to account for the electrostatic ion correlation effects. These approximations are implemented in our theoretical formulation into a suitable decomposition of the excess free energy which plays a key role in capturing the complex interplay between charge correlations and excluded volume effects. We perform Monte Carlo simulations in various scenarios to validate the proposed approach, obtaining a good compromise between accuracy and computational cost. We use the proposed computational approach to study the effects of ion size, ion size asymmetry and solvent excluded volume on the ion profiles, integrated charge, mean electrostatic potential, and ionic coordination number around spherical macroions in various electrolyte mixtures. Our results show that both solvent hard sphere diameter and density play a dominant role in the distribution of ions around spherical macroions, mainly for experimental water molarity and size values where the counterion distribution is characterized by a tight binding to the macroion, similar to that predicted by the Stern model.

Medasani, Bharat; Ovanesyan, Zaven; Thomas, Dennis G.; Sushko, Maria L.; Marucho, Marcelo

2014-05-29T23:59:59.000Z

157

Clean Water Act (excluding Section 404). Environmental guidance program reference book: Revision 6  

SciTech Connect (OSTI)

This Reference Book contains a current copy of the Clean Water Act (excluding Section 404) and those regulations that implement the statutes and appear to be most relevant to US Department of Energy (DOE) activities. The document is provided to DOE and contractor staff for informational purposes only and should not be interpreted as legal guidance. Updates that include important new requirements will be provided periodically. Questions concerning this Reference Book may be directed to Mark Petts, EH-231 (202/586-2609).

Not Available

1993-01-15T23:59:59.000Z

158

Invited Article: Radon and thoron intercomparison experiments for integrated monitors at NIRS, Japan  

SciTech Connect (OSTI)

Inhalation of radon ({sup 222}Rn) and its short-lived decay products and of products of the thoron ({sup 220}Rn) series accounts for more than half of the effective dose from natural radiation sources. At this time, many countries have begun large-scale radon and thoron surveys and many different measurement methods and instruments are used in these studies. Consequently, it is necessary to improve and standardize technical methods of measurements and to verify quality assurance by intercomparisons between laboratories. Four international intercomparisons for passive integrating radon and thoron monitors were conducted at the NIRS (National Institute of Radiological Sciences, Japan). Radon exercises were carried out in the 24.4 m{sup 3} inner volume walk-in radon chamber that has systems to control radon concentration, temperature, and humidity. Moreover, the NIRS thoron chamber with a 150 dm{sup 3} inner volume was utilized to provide three thoron intercomparisons. At present, the NIRS is the only laboratory world-wide that has carried out periodic thoron intercomparison of passive monitors. Fifty laboratories from 26 countries participated in the radon intercomparison, using six types of detectors (charcoal, CR-39, LR 115, polycarbonate film, electret plate, and silicon photodiode). Eighteen laboratories from 12 countries participated in the thoron intercomparisons, using two etch-track types (CR-39 and polycarbonate) detectors. The tests were made under one to three different exposures to radon and thoron. The data presented in this paper indicated that the performance quality of laboratories for radon measurement has been gradually increasing. Results of thoron exercises showed that the quality for thoron measurements still needs further development and additional studies are needed to improve its measuring methods. The present paper provides a summary of all radon and thoron international intercomparisons done at NIRS from 2007 to date and it describes the present status on radon and thoron passive, one-time cycle monitors.

Janik, M., E-mail: mirek@fml.nirs.go.jp; Ishikawa, T.; Omori, Y.; Kavasi, N. [National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage, 263-8555 Chiba (Japan)] [National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage, 263-8555 Chiba (Japan)

2014-02-15T23:59:59.000Z

159

A modelling methodology for the analysis of radon potential based on environmental geology and geographically weighted regression  

Science Journals Connector (OSTI)

Many countries have promoted environmental studies and established national radon programmes in order to identify those geographical areas where high indoor exposure risk of people to this radioactive gas are more likely to be found (often referred to ... Keywords: Environmental geology, Environmental radon potential modelling, Geographically Weighted Regression, Geostatistic, Indoor radon, Local spatial effect

Antonio Pasculli; Sergio Palermi; Annalina Sarra; Tommaso Piacentini; Enrico Miccadei

2014-04-01T23:59:59.000Z

160

Soil gas radon measurements in a region of the Bohemian Massif: investigations in the framework of an Austrian pilot study  

Science Journals Connector (OSTI)

......AGES - Austrian Agency for Health and Food Safety, Competence...the Austrian population. The health effects of indoor radon have...radon concentrations may be dangerous(2). Most people are exposed...According to the WHO, the actual health risk of indoor radon was underestimated......

Claudia Seidel; Andreas Baumgartner; Wolfgang Ringer; Joachim Grser; Harry Friedmann; Heribert Kaineder; Franz Josef Maringer

2011-05-01T23:59:59.000Z

Note: This page contains sample records for the topic "alpha excluding radon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

Development and management of a radon assessment strategy suitable for underground railway tunnelling projects  

Science Journals Connector (OSTI)

......annum for the duration of each project. INTRODUCTION The construction...best practice at the time of project development and for tunnelling...national authorities are at liberty to choose a different (lower...throughout the duration of the project. Pylon radon gas and radon......

C. J. Purnell; G. Frommer; K. Chan; A. A. Auch

2004-04-01T23:59:59.000Z

162

Mobility determination of lead isotopes in glass for retrospective radon measurements  

Science Journals Connector (OSTI)

......Fig-1 where Pb is seen to be depleted in the diffused profiles in...Radon in homes and risk of lung cancer: collaborative analysis of...radonexposure assessment and lung cancer risk. J. Exposure Anal...radon exposure and risk of lung cancer in Missouri. Am. J. Public......

Mikko Laitinen; Iiro Riihimki; Jrgen Ekman; A. R. Ananda Sagari; Lennart B. Karlsson; Somjai Sangyuenyongpipat; Sergey Gorelick; Heikki Kettunen; Heikki Penttil; Ragnar Hellborg; Timo Sajavaara; Johan Helgesson; Harry J. Whitlow

2008-08-01T23:59:59.000Z

163

Monitoring trends in civil engineering and their effect on indoor radon  

Science Journals Connector (OSTI)

......Against Radon at Home and at Work Monitoring...discussed. The effect of energy-efficient construction...high radon levels in energy-efficient new houses...level of 26 % in average. Among the various...for such trends are energy-efficient construction...the overall energy consumption. New building concepts......

W. Ringer

2014-07-01T23:59:59.000Z

164

IMPLEMENTATION OF THE NEW INTERNATIONAL STANDARDS IN SWISS LEGISLATION ON RADON PROTECTION IN DWELLINGS  

Science Journals Connector (OSTI)

......is to be given to the remediation of new builds that fail...prevent the entry of water, water steam and radon. It...direct contact with the ground or with a dirt-floor...Proportionality of radon remediation The switch from a limit......

Martha Palacios (Gruson); Fabio Barazza; Christophe Murith; Salome Ryf

2014-10-01T23:59:59.000Z

165

Radon impact in patients with broncho-pulmonary cancer in centre areas of Transylvania  

Science Journals Connector (OSTI)

Lung cancer is the most frequent cause of mortality caused by malignancies in the world. Radon, the second recognized carcinogenic agent involved in the development of lung cancer, after smoking, is a noble gas with a high mobility. By being continuously ... Keywords: lung cancer, morpho-pathological type of the lung cancer, prevention, radon, smoking, smoking cessation

Doina Adina Todea; Constantin Cosma; Loredana Elena Rosca; Andreea Cristina Herescu; Tiberius Dicu; Natalia Neagoe

2009-09-01T23:59:59.000Z

166

Journal of Hazardous Materials 132 (2006) 98110 Assessment of environmental radon hazard using human  

E-Print Network [OSTI]

. Dosimetric calculations gave a dose conversion coefficient of 15 mSv/WLM, which is higher than the value 5 m rights reserved. Keywords: Radon; Radon progeny; Human respiratory tract; Dose conversion coefficient serve as an indicator of underground uranium ores. It can also pass the surface between the soil

Yu, K.N.

167

Estimate of risk from environmental exposure to radon-222 and its decay products  

Science Journals Connector (OSTI)

... principal ways in which members of the public receive natural irradiation is by breathing the radon-222 decay products in air. ... -222 decay products in air. Radon gas is emitted by soil, rocks and building materials, all of which contain the ...

R. D. Evans; J. H. Harley; W. Jacobi; A. S. McLean; W. A. Mills; C. G. Stewart

1981-03-12T23:59:59.000Z

168

Meteorological Conditions Dependence of Radon Concentration in the Air above the Atlantic Ocean  

Science Journals Connector (OSTI)

... very likely to happen in June, and, finally, we have connected the concentration of radon and of its descendants to the origin of the air masses, for the air ... If the air comes from the north-west of France or from Great Britain, its radon concentration is always between 10 and 27 pc./m3; the mean speed wind blowing ...

J. FONTAN; D. BLANC; A. BOUVILLE; J. LACAZE

1963-02-09T23:59:59.000Z

169

Use of Radon to Trace the Flow Pattern of Gases in Furnaces  

Science Journals Connector (OSTI)

... cm.) has shown that the method is quite practicable. A 20 millicurie sample of radon was mixed with air in a gas-holder of about 350 litres capacity, and ... 4,000 litres per min. The aperture was of such size as to give the radon-air about the same linear velocity as the main stream. Samples of the gas ...

R. MAYORCAS; M. W. THRING

1943-12-18T23:59:59.000Z

170

Concentrations of Radon-222 in Coal Mines in England and Scotland  

Science Journals Connector (OSTI)

... in each mine and then taken to the Radiological Protection Service laboratory for content of radon to be measured. The sample was transferred to a vessel containing a zinc sulphide ... vessel containing a zinc sulphide screen held at a negative potential. The decay of the radon atoms produces positively charged radium-A atoms which are attracted to the screen, and ...

M. J. DUGGAN; D. M. HOWELL; P. J. SOILLEUX

1968-09-14T23:59:59.000Z

171

Radon-222, CO, CH4 and Continental Dust over the Greenland and Norwegian Seas  

Science Journals Connector (OSTI)

... The experiment was undertaken to investigate the relationships between these parameters and air mass trajectories. Radon (222Rn)-a radioactive rare gas emanating essentially from large continental land areas-and dust ... removed by coagulation and fallout or washed out by rain or fog, although comparison of radon level and dust data may be helpful in tracing the trajectory and mixing of air ...

R. E. LARSON; R. A. LAMONTAGNE; P. E. WILKNISS; W. I. WITTMANN

1972-12-08T23:59:59.000Z

172

Radon emanation and electric potential variations associated with transient deformation near reservoir lakes  

Science Journals Connector (OSTI)

... Two of the most often cited earthquake precursors are radon emanation and electric potential variations, but these few reported examples have generally been deemed ... few reported examples have generally been deemed questionable. If a mechanism relating crustal deformation to radon emanation or electrical signals does indeed exist, it is thought to involve fluids. Some ...

M. Trique; P. Richon; F. Perrier; J. P. Avouac; J. C. Sabroux

1999-05-13T23:59:59.000Z

173

New radon cancer hazard study no cause for alarm in Britain  

Science Journals Connector (OSTI)

... subject of a major health study to determine how cancers caused by the emission of radon gas from their foundations can be prevented. ... gas from their foundations can be prevented.Radon-222, a naturally occurring radioactive gas emitted from igneous rock with uranium content such ...

Bill Johnstone

1987-02-05T23:59:59.000Z

174

Fault location by radon and mercury detection at an active volcano in Nicaragua  

Science Journals Connector (OSTI)

... Radon was detected using a sensitive film enclosed in Track Etch Detector Cups which were buried ... -30 days. Analyses of the tracks on the film were performed by the manufacturer. Radon is reported as tracks per mm2 per 30 days (0.91 tracks per mm2 ...

William B. Crenshaw; Stanley N. Williams; Richard E. Stoiber

1982-11-25T23:59:59.000Z

175

Study on radon and radium concentrations in drinking water in west region of Iran  

E-Print Network [OSTI]

One of the most important characterizations of social health is existence the availability of safe drinking water. Since one of the sources of water contamination is nuclear contamination from radon gas, so in this research radon 222 concentration levels in water supplies in the Toyserkan (a region located in the west of Iran) is investigated. For measuring radon gas in water wells and springs Lucas chamber method is used. Review the results of these measurements that taken from 15th place show that, only five sites have radon concentrations above the limit dose. To reduce radon concentration, it is better to keep water in open pools in contact with air before the water is delivered to users.

Forozani, Ghasem

2011-01-01T23:59:59.000Z

176

Alpha track density using a semiconductor detector  

E-Print Network [OSTI]

of factors including variation in the initial dielectric thickness, and other undefined parameters. In addition, the resultant radon concentration reading is dependent upon the calibration factor used to interpret the track density reading. Obtaining...

Hamilton, Ian Scott

2012-06-07T23:59:59.000Z

177

Description of Hot and Dense Hadron Gas Properties in a New Excluded-Volume model  

E-Print Network [OSTI]

A new equation of state for a hot and dense hadron gas (HG) is obtained where the finite hard-core size of baryons has been incorporated in a thermodynamically consistent formulation of excluded volume correction. Our model differs from other existing approaches on the following points. We assign a hard-core volume only to each baryon and mesons though possess a small volume but they can fuse and interpenetrate into one another. Use of the full quantum statistics is made in obtaining the grand canonical partition function where excluded-volume correction has been incorporated by explicitly integrating over volume. We thus find that the new model works even for the cases of extreme temperatures and/or densities where most of other approaches fail. The model does not violate causality even at extreme densities. The temperature and density dependence of various thermodynamical quantities, e.g. pressure, baryon density, entropy and energy density compare well with the results of other microscopic HG models. After suitable parametrization of the centre-of-mass energy in terms of temperature and baryon chemical potential, we explore some new freeze-out criteria which exhibit full independence of the collision energy and of the structures of the colliding nuclei. We further demonstrate the suitability of our model in explaining various experimental results of the multiplicity-ratios of various particles and their antiparticles. Finally, we use our excluded-volume model to obtain the transport behaviour of the hot and/or dense HG such as shear viscosity to entropy ratio, speed of sound etc. and compare the results with earlier calculations.

S. K. Tiwari; P. K. Srivastava; C. P. Singh

2011-11-10T23:59:59.000Z

178

Bifurcated Endograft (Excluder) in the Treatment of Isolated Iliac Artery Aneurysm: Preliminary Report  

SciTech Connect (OSTI)

The aim of this study was to evaluate the effectiveness of endovascular repair in the treatment of isolated iliac artery aneurysm (IAA) using Excluder bifurcated endograft. Eight consecutive patients with IAA were treated during a period of 45 months using Excluder bifurcated endograft. Two patients presented with isolated IAA rupture and were treated emergently, whereas the other six patients underwent elective treatment. All aneurysms lacked sufficient proximal necks and therefore were not suitable for tubular-shaped endograft. Follow-up imaging was performed at 1 week, at every 3 months during the first year, semiannually until 2 years, and annually afterward using angio-computed axial tomography and plain films. Technical success was achieved in all patients. No mortality was seen despite two patients having IAA rupture. Follow-up (12 to 60 months) was done in all but one patient. During this period, complications were observed in three patients. One patient developed sexual impotence at 3-month follow up; one patient presented unilateral gluteal claudication after the procedure, which resolved at 3 months; and one patient developed a graft porosity-related endoleak, which was successfully managed with placement of an additional ipsilateral iliac extension. Endovascular treatment of isolated IAA using bifurcated endograft is safe and can be an alternative to surgical treatment. The benefits from decreased morbidity and mortality of endoluminal treatment of isolated IAA using bifurcated endograft outweigh the minor complications associated with this technique, which are mostly related to occlusion of hypogastric arteries.

Zander, Tobias, E-mail: tobiaszander@gmx.de; Baldi, Sebastian; Rabellino, Martin [Las Palmas de Gran Canaria University, Endoluminal Vascular Department, Rambla Hospiten Clinic Group (Spain); Kirsch, David [Louisiana State University Health Sciences Center (United States); Llorens, Rafael; Zerolo, Ignacio [Las Palmas de Gran Canaria University, Department of Cardiosurgery, Rambla Hospiten Clinic Group (Spain); Qian, Zhong [Louisiana State University Health Sciences Center (United States); Maynar, Manuel [Las Palmas de Gran Canaria University, Endoluminal Vascular Department, Rambla Hospiten Clinic Group (Spain)

2009-09-15T23:59:59.000Z

179

E-Print Network 3.0 - alpha-alpha interaction contribution Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of Alberta Collection: Computer Technologies and Information Sciences 55 Join The Gator Nation GENERAL INFORMATION 2011-12 Summary: Pi Alpha Gamma Rho Alpha Kappa Alpha...

180

I. Excluded Volume Effects in Ising Cluster Distributions and Nuclear Multifragmentation II. Multiple-Chance Effects in Alpha-Particle Evaporation  

E-Print Network [OSTI]

New York, [Isin 25] E . Ising, Z. Phys. 31, 253 (1925). [d e d V o l u m e Effects in Ising Cluster Distributions andl u d e d Volume Effects i n Ising Cluster Distributions and

Breus, Dimitry E.

2005-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "alpha excluding radon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Uncertainties on alpha_S in global PDF analyses  

E-Print Network [OSTI]

We determine the uncertainty on the strong coupling alpha_S due to the experimental errors on the data fitted in global analysis of hard-scattering data, within the standard framework of leading-twist fixed-order collinear factorisation in the MSbar scheme, finding that alpha_S(M_Z^2) = 0.1202^{+0.0012}_{-0.0015} at next-to-leading order and alpha_S(M_Z^2) = 0.1171^{+0.0014}_{-0.0014} at next-to-next-to-leading order. We investigate the interplay between uncertainties on alpha_S and uncertainties on parton distribution functions (PDFs). We show, for the first time, how both these sources of uncertainty can be accounted for simultaneously in calculations of cross sections, and we provide eigenvector PDF sets with different fixed alpha_S values to allow further studies by the general user. We illustrate the application of these PDF sets by calculating cross sections for W, Z, Higgs boson and inclusive jet production at the Tevatron and LHC.

Martin, A D; Thorne, R S; Watt, G

2009-01-01T23:59:59.000Z

182

Infection with Strains of Citrus Tristeza Virus Does Not Exclude Superinfection by Other Strains of the Virus  

Science Journals Connector (OSTI)

...distinct strains. However, this model does not explain how hybrid viruses containing...Graft-transmissible diseases of detritus: handbook for detection and diagnosis. FAO, Rome...Infection with strains of Citrus tristeza virus does not exclude superinfection by other strains...

Svetlana Y. Folimonova; Cecile J. Robertson; Turksen Shilts; Alexey S. Folimonov; Mark E. Hilf; Stephen M. Garnsey; William O. Dawson

2009-11-18T23:59:59.000Z

183

Derr Track Storage Bldg Sigma Alpha  

E-Print Network [OSTI]

!( Derr Track Storage Bldg Solar House Entomology Lab Bldg Sigma Alpha Epsilon 11 MEAS Ocean Lab & Storage Avent Ferry Complex Building Sigma Phi Epsilon 7 Pi Kappa Alpha 10 Sigma Alpha Mu 4 Tau Kappa

Reeves, Douglas S.

184

Radon Concentration in Groundwater in the Central Region of Gyeongju, Korea - 13130  

SciTech Connect (OSTI)

Radon is a naturally occurring radioactive gas that is a well known cause of lung cancer through inhalation. Nevertheless, stomach cancer can also occur if radon-containing water is ingested. This study measured the radon concentration in groundwater for drinking or other domestic uses in the central region of Gyeongju, Korea. The groundwater samples were taken from 11 points chosen from the 11 administrative districts in the central region of Gyeongju by selecting a point per district considering the demographic distribution including the number of tourists who visit the ancient ruins and archaeological sites. The mean radon concentrations in the groundwater samples ranged from 14.38 to 9050.73 Bq.m{sup -3}, which were below the recommendations by the U.S. EPA and WHO. (authors)

Lee, Jung Min; Lee, A. Rim; Park, Chan Hee; Moon, Joo Hyun [Dongguk University, Seokjangdong, Gyeongju, Gyeongbuk, 780-714 (Korea, Republic of)] [Dongguk University, Seokjangdong, Gyeongju, Gyeongbuk, 780-714 (Korea, Republic of)

2013-07-01T23:59:59.000Z

185

Radon entry rate analyses using in situ tracer gas method application  

Science Journals Connector (OSTI)

......underestimate the complexity of energy retrofitting itself. In...Hazards Associated With Home Energy Retrofits. (2012) The National Renewable Energy Laboratory, U.S. Department...for the purpose of radon mitigation effectiveness proper evaluation......

A. Fro?ka; K. Jlek

2014-07-01T23:59:59.000Z

186

Preventing radon in new homes well worth it in the UK  

Science Journals Connector (OSTI)

Implementing basic preventive measures against radon in new homes is likely to be a highly cost effective public health intervention, with the potential to make a modest but worthwhile contribution to reducin...

2009-02-01T23:59:59.000Z

187

Indoor radon concentration measurements in some dwellings of the Penisola Sorrentina, South Italy  

Science Journals Connector (OSTI)

......multiple groups were performed by non-parametric Kruskal-Wallis test. All statistical analyses were performed using...values are represented by dots. The application of Kruskal-Wallis test demonstrated that the annual radon concentrations......

Maria Quarto; Mariagabriella Pugliese; Filomena Loffredo; Vincenzo Roca

2013-09-01T23:59:59.000Z

188

Radon levels and doses in dwellings in two villages in Kosovo, affected by depleted uranium  

Science Journals Connector (OSTI)

......villages in Kosovo, affected by depleted uranium G. Nafezi 1 A. Gregoric 2...included in the study was hit by depleted uranium projectiles during the North...1999. Although no impact of depleted uranium on radon levels has been observed......

G. Nafezi; A. Gregoric; J. Vaupotic; M. Bahtijari; M. Kuqali

2014-02-01T23:59:59.000Z

189

Development and application of the scintillation flask technique for the measurement of indoor radon-222 concentrations  

E-Print Network [OSTI]

continuous occupancy to conservatively calculate the number of WLM/year a person might receive. 29 TABLE 6 Radon Exposures (WLM/yr) in Selective Buildings on the Texas A 6 M University Campus. Minimum" ~MLM/ r Maximum* ~MLM/ Average* ~MLM... continuous occupancy to conservatively calculate the number of WLM/year a person might receive. 29 TABLE 6 Radon Exposures (WLM/yr) in Selective Buildings on the Texas A 6 M University Campus. Minimum" ~MLM/ r Maximum* ~MLM/ Average* ~MLM...

Vasquez, Gerard Michael

2012-06-07T23:59:59.000Z

190

The influence of fractal size distribution of covers on radon exhalation from uranium mill tailings  

Science Journals Connector (OSTI)

Tailings produced during mining and milling of uranium ores represent potentially large volumes of low level radioactive materials. A typical environmental problem associated with mill tailings is radon emanation. Covering tailings is widely applied to reduce radon exhalation rate. In this paper, the fractal theories and field covering tests are used to study the fractal characters of size distribution of six types of covering materials, including waste rock, sand, laterite, kaolin, mixture of sand and laterite, and mixture of waste rock and laterite, and their influences on radon exhalation. The size distributions of uranium tailings and the six aforementioned covering materials all exhibit a good fractal structure. The contents of fine grain increase with the increasing value of fractal dimension. The results of field radon measurement show that the radon emanation rate of tailings without covers is 14.718.6Bq/m2s. Covering tests were carried out of the six abovementioned covering materials with thickness of 0.4m, 0.8m, 1.2m, 1.6m and 2.0m. The results indicate that the application of these materials for cover layers can decrease the radon exhalation rate markedly. The effectiveness of a cover layer in reducing radon exhalation is related to its fractal texture of size distribution. Under the same thickness conditions, the attenuation coefficient of radon exhalation rate increases with the increasing fractal dimension of size distribution of covers. The empirical expressions of the attenuation coefficients in relation to fractal dimension D of size distribution and thickness x of covers is obtained for evaluating the effectiveness of final covers for uranium tailings impoundments.

Kaixuan Tan; Zehua Liu; Liangshu Xia; Junwen Lv; Hanqiao Hu

2012-01-01T23:59:59.000Z

191

Estimation of heat and chemical fluxes from a seafloor hydrothermal vent field using radon measurements  

Science Journals Connector (OSTI)

... exists at about 200 m above the depth of the vent field12'13. Distinct excess radon levels have been observed at Endeavour both in vent water and in the effluent plume ... vent water and in the effluent plume up to 17 km from the ridge axis14.Radon is a chemically inert gas with a radioactive half life of 3.85 days. ...

N. D. Rosenberg; J. E. Lupton; D. Kadko; R. Collier; M. D. Lilley; H. Pak

1988-08-18T23:59:59.000Z

192

Development of a method for determination of radon emanation from small soil samples  

E-Print Network [OSTI]

DEVELOPMENT OF A METHOD FOR DETERMINATION OF RADON EMANATION FROM S~ SOIL SAMPLES A Thesis by MICHAEL VINCENT MADONIA Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements... for the degree of MASTER OF SCIENCE December 1990 Major Subject: Health Physics DEVELOPMENT OF A METHOD FOR DETERMINATION OF RADON EMANATION FROM SMALL SOIL SAMPLES A Thesis by MICHAEL VINCENT MADONIA Approved as to style and content by: Milton E. Mc...

Madonia, Michael Vincent

2012-06-07T23:59:59.000Z

193

Influence of radon diffusion on the /sup 210/Pb distribution in sediments  

SciTech Connect (OSTI)

A mathematical model is presented which describes the distribution of radon 222 in sediments having a constant or variable depth distribution of radium 226. The model is extended to the distribution of lead 210, taking into account the mobility of radon (the precursor of /sup 210/Pb) within the sediment column. The /sup 210/Pb model is compared, at constant radium activity, with the conventional approach which disregards the radon diffusion when estimating sedimentation rates by the /sup 210/Pb method. The ratio between apparent and real sedimentation rate, s'/s, expressed as a function of three dimensionless parameters, demonstrates the importance of the radon diffusion effect. This effect is particularly important for sediments with small initial excess /sup 210/Pb activity, small sedimentation rate, large radon diffusivity, or a combination of these factors. Applied to Lake Geneva, the sedimentation is estimated to be larger by 30--50% than the original value by Krishnaswami et al, (1971). In sediments which are mixed at the surface (physical mixing or bioturbation), the /sup 210/PB activity in the mixed layer is diminished compared to that in the settling sediment material (Robbins et al., 1977), and radon diffusion makes the activity difference even larger, especially for low initial excess /sup 210/Pb activity, small sedimentation rate, and large mixing intensity. This result may be of importance for the balance of /sup 210/Pb in an aquatic system if the calculations are based on activities measured in the sediment.

Imboden, D.M.; Stiller, M.

1982-01-20T23:59:59.000Z

194

Development of radon sources with a high stability and a wide range  

SciTech Connect (OSTI)

A solid {sup 222}Rn (radon) source using a fibrous and porous SiC ceramic disk was developed. The emission rate of radon emanated from the disk depended on the content of {sup 226}Ra and the sintering temperature. A {sup 226}Ra sulfate ({sup 226}RaSO{sub 4}) solution was dropped on a fibrous SiC ceramic disk (33 mm?) of 1 mm in thickness, and sintered at 400 C. The radon concentration from a disk containing {sup 226}Ra of 1.85 MBq was measured to be 38 kBq m{sup ?3} at a carrier airflow rate of 0.5 L min{sup ?1}. By adjusting the {sup 226}Ra content or the sweep airflow rate, the radon concentrations were easily controlled over a wide range of over three orders of magnitude. The concentration was very stable for a long term. The compactness of the source disk made is easy for handling the source container and the shielding of gamma radiation from {sup 226}Ra and its decay products. Such advantages in a radon generation system are desirable for experiments of high-level, large-scale radon exposure.

Fukutsu, K.; Yamada, Y. [National Institute of Radiological Sciences, 4-9-1, Anagawa, Inage-ku, Chiba 263-8555 (Japan)] [National Institute of Radiological Sciences, 4-9-1, Anagawa, Inage-ku, Chiba 263-8555 (Japan)

2013-12-15T23:59:59.000Z

195

UN PROCD DE DOSAGE CONTINU DU RADON DANS L'AIR ATMOSPHRIQUE. APPLICATION A LA PROSPECTION DE L'URANIUM  

E-Print Network [OSTI]

: it permits measurement of the activity of radioactive products of radon in air ; the air permits pass through176 UN PROC?D? DE DOSAGE CONTINU DU RADON DANS L'AIR ATMOSPH?RIQUE. APPLICATION A LA PROSPECTION DE radon de l'air atmo- sphérique. Une pompe à grand débit aspire l'air à analyser à travers un papier

Boyer, Edmond

196

The influence of salt aerosol on alpha radiation detection by WIPP continuous air monitors  

SciTech Connect (OSTI)

Alpha continuous air monitors (CAMs) will be used at the Waste Isolation Pilot Plant (WIPP) to measure airborne transuranic radioactivity that might be present in air exhaust or in work-place areas. WIPP CAMs are important to health and safety because they are used to alert workers to airborne radioactivity, to actuate air-effluent filtration systems, and to detect airborne radioactivity so that the radioactivity can be confined in a limited area. In 1993, the Environmental Evaluation Group (EEG) reported that CAM operational performance was affected by salt aerosol, and subsequently, the WIPP CAM design and usage were modified. In this report, operational data and current theories on aerosol collection were reviewed to determine CAM quantitative performance limitations. Since 1993, the overall CAM performance appears to have improved, but anomalous alpha spectra are present when sampling-filter salt deposits are at normal to high levels. This report shows that sampling-filter salt deposits directly affect radon-thoron daughter alpha spectra and overall monitor efficiency. Previously it was assumed that aerosol was mechanically collected on the surface of CAM sampling filters, but this review suggests that electrostatic and other particle collection mechanisms are more important than previously thought. The mechanism of sampling-filter particle collection is critical to measurement of acute releases of radioactivity. 41 refs.

Bartlett, W.T.; Walker, B.A.

1996-01-01T23:59:59.000Z

197

Detection of Radon Emission at the Edges of Lunar Maria with the Apollo Alpha-Particle Spectrometer  

Science Journals Connector (OSTI)

...ecological balance away from...by advanced wastewater treatment. Both wastewater...tertiary sewage treatment or change...Physiol. Plant. 23, 828...Both advanced wastewater treatment and 1 FEBRUARY...bombardment or mass slumping...

Paul Gorenstein; Leon Golub; Paul Bjorkholm

1974-02-01T23:59:59.000Z

198

Nuclear Instruments and Methods in Physics Research A 564 (2006) 319323 Passive monitoring of the equilibrium factor inside a radon exposure  

E-Print Network [OSTI]

-lived radon progeny contributes about half of the total exposure of human beings to ionizing radiation of the determined ranges of F for a few LR 115 SSNTDs can give a very good estimate of the true equilibrium factor. It is also well known that the radon dose delivered to the lungs is not attributed to the radon gas itself

Yu, K.N.

199

Alpha-Particle Activity and Free Radicals from Tobacco  

Science Journals Connector (OSTI)

... unlikely to constitute any radiological hazard. The experiments indicated, for example, that if the radon-222 present and in equilibrium with radium-226 in the tobacco were inhaled in the ... by them, it would represent an intake of 16 pico-curies (pc.) of radon, whereas the average daily intake from the atmosphere by the general population, smoker and ...

ERNEST MARSDEN; MICHAEL A. COLLINS

1963-06-08T23:59:59.000Z

200

Naturally Occurring Alpha-Activity of Drinking Waters  

Science Journals Connector (OSTI)

... whether the observed values applied to radium-226 or also included gaseous products such as radon-222, known to exist in certain waters at considerably higher levels of activity than ... of 71 drinking waters available in Britain, and in addition we report the values for radon-222 and radium-224 (thorium X) when present.

R. C. TURNER; J. M. RADLEY; W. V. MAYNEORD

1961-02-04T23:59:59.000Z

Note: This page contains sample records for the topic "alpha excluding radon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Workshop on Precision Measurements of $\\alpha_s$  

SciTech Connect (OSTI)

These are the proceedings of the Workshop on Precision Measurements of {alpha}{sub s} held at the Max-Planck-Institute for Physics, Munich, February 9-11, 2011. The workshop explored in depth the determination of {alpha}{sub s}(m{sub Z}) in the {ovr MS} scheme from the key categories where high precision measurements are currently being made, including DIS and global PDF fits, {tau}-decays, electro-weak precision observables and Z-decays, event-shapes, and lattice QCD. These proceedings contain a short summary contribution from the speakers, as well as the lists of authors, conveners, participants, and talks.

Bethke, Siegfried; /Munich, Max Planck Inst.; Hoang, Andre H.; /Vienna U.; Kluth, Stefan; /Munich, Max Planck Inst.; Schieck, Jochen; /Munich U.; Stewart, Iain W.; Aoki, S.; Beneke, M.; Bethke, S.; Blumlein, J.; Brambilla, N.; Brodsky, S.; /MIT, LNS

2011-10-01T23:59:59.000Z

202

Water treatment facilities (excluding wastewater facilities). (Latest citations from the Selected Water Resources Abstracts database). Published Search  

SciTech Connect (OSTI)

The bibliography contains citations concerning the design, construction, costs, and operation of water treatment facilities. Facilities covered include those that provide drinking water, domestic water, and water for industrial use. Types of water treatment covered include reverse osmosis, chlorination, filtration, and ozonization. Waste water treatment facilities are excluded from this bibliography. (Contains 250 citations and includes a subject term index and title list.)

Not Available

1993-07-01T23:59:59.000Z

203

Predicting New Hampshire Indoor Radon Concentrations from geologic information and other covariates  

SciTech Connect (OSTI)

Generalized geologic province information and data on house construction were used to predict indoor radon concentrations in New Hampshire (NH). A mixed-effects regression model was used to predict the geometric mean (GM) short-term radon concentrations in 259 NH towns. Bayesian methods were used to avoid over-fitting and to minimize the effects of small sample variation within towns. Data from a random survey of short-term radon measurements, individual residence building characteristics, along with geologic unit information, and average surface radium concentration by town, were variables used in the model. Predicted town GM short-term indoor radon concentrations for detached houses with usable basements range from 34 Bq/m{sup 3} (1 pCi/l) to 558 Bq/m{sup 3} (15 pCi/l), with uncertainties of about 30%. A geologic province consisting of glacial deposits and marine sediments, was associated with significantly elevated radon levels, after adjustment for radium concentration, and building type. Validation and interpretation of results are discussed.

Apte, M.G.; Price, P.N.; Nero, A.V.; Revzan, K.L.

1998-05-01T23:59:59.000Z

204

An indoor radon survey of the X-ray rooms of Mexico City hospitals  

SciTech Connect (OSTI)

This paper presents the results of measurements of indoor radon concentrations in the X-ray rooms of a selection of hospitals in the metropolitan area of Mexico City. The metropolitan area of Mexico City is Mexico's largest metropolitan area by population; the number of patients requiring the use of X-rays is also the highest. An understanding of indoor radon concentrations in X-ray rooms is necessary for the estimation of the radiological risk to which patients, radiologists and medical technicians are exposed. The indoor radon concentrations were monitored for a period of six months using nuclear track detectors (NTD) consisting of a closed-end cup system with CR-39 (Lantrack Registered-Sign ) polycarbonate as detector material. The indoor radon concentrations were found to be between 75 and 170 Bq m{sup -3}, below the USEPA-recommended indoor radon action level for working places of 400 Bq m{sup -3}. It is hoped that the results of this study will contribute to the establishment of recommended action levels by the Mexican regulatory authorities responsible for nuclear safety.

Juarez, Faustino [Facultad de Ciencias, Universidad Autonoma del Estado de Mexico, Instituto Literario No. 100. Estado de Mexico, 50000, Mexico. Instituto de Geofisica, Universidad Nacional Autonoma de Mexico, Circuito (Mexico); Reyes, Pedro G. [Facultad de Ciencias, Universidad Autonoma del Estado de Mexico, Instituto Literario No. 100. Estado de Mexico, 50000 (Mexico); Espinosa, Guillermo [Instituto de Fisica, Universidad Nacional Autonoma de Mexico, Circuito Exterior Ciudad Universitaria, Mexico D.F. Cp.04510 (Mexico)

2013-07-03T23:59:59.000Z

205

Radon in Soil Gas Above Bedrock Fracture Sets at the Shepleys Hill Superfund Site  

SciTech Connect (OSTI)

The Idaho National Laboratory (INL) recently provided technical support for ongoing environmental remediation activities at the Shepleys Hill remediation site near Devens, MA (Figure 1). The technical support was requested as follow-on work to an initial screening level radiation survey conducted in 2008. The purpose of the original study was to assess the efficacy of the INL-developed Backpack Sodium Iodide System (BaSIS) for detecting elevated areas of natural radioactivity due to the decay of radon-222 gases emanating from the underlying fracture sets. Although the results from the initial study were mixed, the BaSIS radiation surveys did confirm that exposed bedrock outcrops have higher natural radioactivity than the surficial soils, thus a high potential for detecting elevated levels of radon and/or radon daughter products. (INL 2009) The short count times associated with the BaSIS measurements limited the ability of the system to respond to elevated levels of radioactivity from a subsurface source, in this instance radon gas emanating from fracture sets. Thus, it was postulated that a different methodology be employed to directly detect the radon in the soil gases. The CR-39 particle track detectors were investigated through an extensive literature and technology search. The relatively long deployment or detection time of several days, as well as the sensitivity of the measurement and robustness of the detectors made the CR-39 technology promising for deployment at the Shepleys Hill site.

J.R. Giles; T.L. McLing; M.V. Carpenter; C.J. Smith; W. Brandon

2012-12-01T23:59:59.000Z

206

In-vivo measurements of Pb-210 to determine cumulative exposure to radon daughters: A pilot study  

SciTech Connect (OSTI)

The objective of this study is to demonstrate the feasibility of estimating cumulative exposure of individuals to low concentrations of radon by measuring the amount of Pb-A-10 in their skeletons. This report presents progress to date establishing the validity of an vivo technique to measure skeletal burdens of Pb-210, accumulated from exposure to radon and radon progeny. With the skeletal content of Pb--210 and a model for Pb metabolism, cumulative exposure to radon and its short-lived daughters (radon/daughters) may be calculated for use in deriving a dose-response relationship between lung cancer and exposure to radon/daughters. Data are presented for 29 subjects exposed to above-average'' radon concentrations in their homes, showing the correlation between measured Pb--210 burdens, and measured pCi/l and WLM exposure estimates. Their results are compared to measurements of a population of 24 subject's presumed exposed to average concentrations. Measurements of a Pennsylvania family exposed for a year in a home with an extremely high radon content are also presented. Update of results of an ongoing study of the biological half-time of Pb--210 in man involving measurements, of a retired radiation worker with a 40 year old skeletal burden of Pb-210.

Laurer, G.R.; Cohen, N. (New York Univ. Medical Center, Tuxedo, NY (United States). Dept. of Environmental Medicine); Stark, A.; Ju, C. (New York State Dept. of Health, Albany, NY (United States). Bureau of Environmental and Occupational Epidemiology)

1991-05-01T23:59:59.000Z

207

Removal of Xenon and Radon from Contaminated Atmospheres with Dioxygenyl Hexafluoroantimonate, O2SbF6  

Science Journals Connector (OSTI)

... process gas, and the excess fluorine must be removed afterwards. I have shown that radon, the heaviest noble gas, can be collected by oxidation with liquid bromine trifluoride and ... ). I report here further experiments with a dioxygenyl salt, O2SbF6, which reacts with radon and xenon at 25 C and which appears very promising as a reagent for removing ...

L. STEIN

1973-05-04T23:59:59.000Z

208

Radon-222 progeny surface deposition and resuspension - residential materials  

SciTech Connect (OSTI)

In evaluating the hazards from indoor {sup 222}Rn, it is imperative that the behavior of the four short-lived particulate progeny are fully understood since they are the radioisotopes that deliver most of the radiobiological damage to occupants. One known characteristic of these radon progeny is that they deposit (plate out) onto macroscopic surfaces. Some of these plated-out atoms become resuspended when they disintegrate and decay to the next progeny, in particular, {sup 218}Po. Both of these mechanisms, plateout and resuspension, affect the airborne population of the individual daughters and their impact on the radiation energy delivered to the human respiratory system. There are two specific and separate areas of concern, One is that monitoring {sup 222} Rn levels alone, such as with charcoal canisters, is obviously not sufficient to determine the radiation dose since the daughters are never in absolute equilibrium with {sup 222}Rn. Further, from an internal dose standpoint, the {open_quotes}unattached{close_quotes} fraction (free ions) of the daughters are believed, by virtue of their deeper tissue depositions in the tracheo-bronchial tract, to deliver the greatest dose in the body. Currently, there are virtually no data on the measurements of both plateout rates and resuspension factors for specific individual residential material surfaces. This report presents experimental data of plateout rates in an indoor house for typical indoor materials. Results of measurements of resuspension factors for some of the materials are provided.

Leonard, B.E.

1994-12-31T23:59:59.000Z

209

Training Activities on Radioactive Waste Management at Moscow SIA -Radon-: Experience, Practice, Theory  

SciTech Connect (OSTI)

Management of radioactive waste relates to the category of hazardous activities. Hence the requirements to the professional level of managers and personnel working in this industry are very high. Education, training and examination of managers, operators and workers are important elements of assuring safe and efficient operation of radioactive waste management sites. The International Education Training Centre (IETC) at Moscow State Unitary Enterprise Scientific and Industrial Association 'Radon' (SIA 'Radon'), in co-operation with the International Atomic Energy Agency (IAEA), has developed expertise and provided training to waste management personnel for the last 10 years. The paper summarizes the current experience of the SIA 'Radon' in the organisation and implementation of the IAEA sponsored training and others events and outlines some of strategic educational elements, which IETC will continue to pursue in the coming years. (authors)

Batyukhnova, O.G.; Arustamov, A.E.; Dmitriev, S.A.; Agrinenko, V.V. [SUE SIA -Radon-, The 7-th Rostovsky Lane 2/14, Moscow (Russian Federation); Ojovan, M.I. [Immobilisation Science Laboratory, University of Sheffield, Sir Robert Hadfield Building (United Kingdom); Drace, Z. [International Atomic Energy Agency, Vienna (Austria)

2008-07-01T23:59:59.000Z

210

Radon concentrations in ground and drinking water in the state of Chihuahua, Mexico  

Science Journals Connector (OSTI)

This paper reports 222Rn concentrations in ground and drinking water of nine cities of Chihuahua State, Mexico. Fifty percent of the 114 sampled wells exhibited 222Rn concentrations exceeding 11Bq/L, the maximum contaminant level (MCL) recommended by the USEPA. Furthermore, around 48% (123 samples) of the tap-water samples taken from 255 dwellings showed radon concentrations over the MCL. There is an apparent correlation between total dissolved solids and radon concentration in ground-water. The high levels of 222Rn found may be entirely attributed to the nature of aquifer rocks.

L. Villalba; L. Colmenero Sujo; M.E. Montero Cabrera; A. Cano Jimnez; M. Rentera Villalobos; C.J. Delgado Mendoza; L.A. Jurado Tenorio; I. Dvila Rangel; E.F. Herrera Peraza

2005-01-01T23:59:59.000Z

211

Technical manual, redesigned ARC-2A automatic radon counter. Final report  

SciTech Connect (OSTI)

The ARC-2A Automatic Radon Counter (Serial No. 87003) was manufactured in 1987 by Ocean Communication Systems, Inc, Panama City, Florida. It was designed as a stand-alone system, but was consistently plagued with problems. The manufacturer could not repair the machine. The ARC-2A was completely redesigned at NCCOSC RDT and E Division. It is now interfaced to a computer. A new manual was written with updated information and user instructions. The ARC-2A is an integral part of ongoing electro-optic propagation studies.... Radon, Electro-optics, Aerosol.

Littfin, K.M.

1992-09-01T23:59:59.000Z

212

The improvement of methods used to estimate radon concentration in air using nuclear track film  

E-Print Network [OSTI]

THE IMPROVEMENT OF METHODS USED TO ESTIMATE RADON CONCENTRATION IN AIR USING NUCLEAR TRACK FILM A Thesis by JAMES G. JESSICK Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements... for the degree of MASTER OF SCIENCE December t 9BB Major Subject: Health Physics THE IMPROVEMENT OF METHODS USED TO ESTIMATE RADON CONCENTRATION IN AIR USING NUCLEAR TRACK FILM A Thesis by JAMES G. JESSICK Approved as to style and content by: Milton E...

Jessick, James G.

2012-06-07T23:59:59.000Z

213

Concentrations of dissolved radon-222 in water from selected wells and springs in Idaho, 1989-91  

SciTech Connect (OSTI)

Concentrations of dissolved radon-222, a naturally occurring radioactive gas, are found in water in Idaho. The U.S. Geological Survey collected water samples for radon-222 analyses from 338 Idaho wells and springs during 1989-91. These water samples were collected as part of ongoing monitoring programs with the Idaho Department of Water Resources and the U.S. Department of Energy. Concentrations of dissolved radon-222 in 372 of the water samples ranged from -58{+-}30 to 5,715{+-}66 picocuries per liter; the mean and median concentrations were 446{+-}35 and 242{+-}25 picocuries per liter, respectively.

Cecil, L.D.; Parliman, D.J.; Edwards, D.D.; Young, H.W.

1994-11-01T23:59:59.000Z

214

QA programme for radon and its short-lived progeny measuring instruments in NRPI Prague  

Science Journals Connector (OSTI)

......radon using a radium water solution standard with...to 2 bars of absolute atmospheric pressure with a system...store tank up to normal atmospheric pressure, which is...carnauba wax aerosol generator, pump, etc.) and...carnauba wax aerosol generator, production of well-defined......

K. Jlek; J. Thomas; M. Brabec

2008-06-01T23:59:59.000Z

215

Protection from radon exposure at home and at work in the directive 2013/59/Euratom  

Science Journals Connector (OSTI)

......national action plan). The basic...basic safety standards. On the other...are kept under review. This situation...transpose such standards into national...Radon action plan) and in Annex...schedules for reviews of the action plan (10) strategy......

F. Bochicchio

2014-07-01T23:59:59.000Z

216

Radon entry rate analyses using in situ tracer gas method application  

Science Journals Connector (OSTI)

......indoor environment, standard methods of radon diagnosis...ventilation (specific modes of HVAC systems operation...for new houses given in standards. Table-5. Results...efforts to comply with the standard requirements on new buildings...services in buildings like HVAC systems, water and gas......

A. Fro?ka; K. Jlek

2014-07-01T23:59:59.000Z

217

Monitoring trends in civil engineering and their effect on indoor radon  

Science Journals Connector (OSTI)

......with natural floors and clay houses. RADON AND ENERGY-EFFICIENT...In the European Union, the housing sector is currently responsible...building to reach a high level of energy efficiency. Within the EU-project...37 low-energy and passive houses in Austria. Both long-term......

W. Ringer

2014-07-01T23:59:59.000Z

218

A TIME-DEPENDENT METHOD FOR CHARACTERIZING THE DIFFUSION OF RADON-222 IN CONCRETE  

SciTech Connect (OSTI)

The porosity and diffusion length of concrete have been determined by measuring the time-dependent diffusion of radon through a thin slab of the material, One surface of the slab is exposed to a large, fixed radon concentration beginning at t=0. The radon that diffuses out of a portion of the opposite surface is collected during several contiguous time intervals. The total activity collected over a set of intervals beginning at t=0 and the steady-state flux of activity are used to calculate the porosity and diffusion length, As a test of these parameters, they are then used to predict the activity collected during other time intervals and for other sample thicknesses, Samples from two types of concrete were tested: one type yielded a porosity of 0.068 and a diffusion length of 12.6 cm; the respective values for the other were 0.32 and 16.9 cm. The predicted and experimental results agreed well, thereby verifying the assumption that concrete may be treated as a homogenous diffusion medium for radon.

Zapalac, Geordie H.

1981-07-01T23:59:59.000Z

219

Prevention of Lung Cancer by Remediation of Residential Exposure to Radon Daughters  

Science Journals Connector (OSTI)

......Exposure to Radon Daughters J.A. Mahaffey F.T. Cross J.R. Johnson M.C. Baechler The United States Bonneville Power Administration (BPA), as a part of an energy conservation programme in the states of Washington, Oregon, Idaho, Wyoming......

J.A. Mahaffey; F.T. Cross; J.R. Johnson; M.C. Baechler

1991-06-01T23:59:59.000Z

220

Dosimetric and epidemiological approaches to assessing radon doses?can the differences be reconciled?  

Science Journals Connector (OSTI)

......reconcile the two approaches. This is of importance...INTRODUCTION The management of the risk of...based on one of two approaches. The first uses...National Academy of Sciences and National Research...Amsterdam: Elsevier Science) (2003). Dosimetric...epidemiological approaches to assessing radon......

John W. Stather

2004-12-01T23:59:59.000Z

Note: This page contains sample records for the topic "alpha excluding radon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

Does the Addition of Fly Ash to Concrete Present a Radon Hazard? J. A. Siegel1  

E-Print Network [OSTI]

Street, Suite 450, Austin, Texas, 78701, USA Summary: Fly ash, a waste material from coal-fired power of fly ash [9]. Fly ash is a waste material from coal fired power plants; when added to concrete, fly ashDoes the Addition of Fly Ash to Concrete Present a Radon Hazard? J. A. Siegel1 , M. Juenger1 and J

Siegel, Jeffrey

222

Filter for on-line air monitor unaffected by radon progeny and method of using same  

DOE Patents [OSTI]

An apparatus for testing air having contaminants and radon progeny therein. The apparatus includes a sampling box having an inlet for receiving the air and an outlet for discharging the air. The sampling box includes a filter made of a plate of sintered stainless steel. The filter traps the contaminants, yet allows at least a portion of the radon progeny to pass therethrough. A method of testing air having contaminants and radon progeny therein. The method includes providing a testing apparatus that has a sampling box with an inlet for receiving the air and an outlet for discharging the air, and has a sintered stainless steel filter disposed within said sampling box; drawing air from a source into the sampling box using a vacuum pump; passing the air through the filter; monitoring the contaminants trapped by the filter; and providing an alarm when a selected level of contaminants is reached. The filter traps the contaminants, yet allows at least a portion of the radon progeny to pass therethrough.

Phillips, Terrance D. (Aiken, SC); Edwards, Howard D. (Augusta, GA)

1999-01-01T23:59:59.000Z

223

Radon Series Comp. Appl. Math 8, 129 c de Gruyter 2009 Optimal consumption and investment with  

E-Print Network [OSTI]

Radon Series Comp. Appl. Math 8, 1�29 c de Gruyter 2009 Optimal consumption and investment investment/con- sumption problem for continuous time market models. By applying results from sto- chastic, together with margin tradings on certain financial products, the exposure to losses of investments

Paris-Sud XI, Université de

224

RADON AND RADIUM CONCENTRATION IN WATER FROM NORTH-WEST OF ROMANIA AND THE ESTIMATED DOSES  

Science Journals Connector (OSTI)

......524 Bq l1 with the average of 0.085 Bq l1...population during the consumption of water. Table-2 shows that the average of committed effective...expected doses from the consumption of water in Romania...Assessment for Radon in Homes and Workplaces...International Atomic Energy Agency. International......

M. Moldovan; V. Benea; D. C. Ni??; B. Papp; B. D. Burghele; N. Bican-Bri?an; C. Cosma

2014-07-01T23:59:59.000Z

225

Diurnal and seasonal variability of outdoor radon concentration in the area of the NRPI Prague  

Science Journals Connector (OSTI)

......Against Radon at Home and at Work Diurnal...designed to be low energy consuming and independent...NRPI, where hourly averages of temperature and...Typical current consumption of the entire station...Diurnal and monthly averages of measured atmospheric...are given monthly averages of a v, of the......

K. Jilek; M. Slezkova; J. Thomas

2014-07-01T23:59:59.000Z

226

CORRELATIVE AND MULTIVARIATE ANALYSIS OF INCREASED RADON CONCENTRATION IN UNDERGROUND LABORATORY  

Science Journals Connector (OSTI)

......regression methods for the indoor radon measurements. Nucl. Technol. Radiat. Prot. (2014) 29(1):17-23. 4 Brun R. , Rademakers F. ROOT-an object oriented data analysis framework. Nucl. Inst. Methods Phys. Res. A (1997) 389:81. 5 Hoecker......

Dimitrije M. Maleti?; Vladimir I. Udovi?i?; Radomir M. Banjanac; Dejan R. Jokovi?; Aleksandar L. Dragi?; Nikola B. Veselinovi?; Jelena Filipovi?

2014-07-01T23:59:59.000Z

227

Radon spectroscopy of packet delay Andre Broido, Ryan King, Evi Nemeth, kc claffy  

E-Print Network [OSTI]

techniques, specifically the Radon transform previously applied in geophysics [6] and computer tomography [7 the feasibility of Internet spectroscopy techniques for analysis of rate limiting, packet interarrival delay packet trace data, we find that delay's quantization in micro- and millisecond range is ubiquitous

California at San Diego, University of

228

Effect of radon dose on cleanup criteria and using RESRAD for chemical risk assessment  

SciTech Connect (OSTI)

The US Department of Energy has used RESRAD, a pathway analysis program developed at Argonne National Laboratory, in conjunction with the as low as reasonably achievable (ALARA) principle to develop site-specific residual radioactive material guidelines (cleanup criteria) for many sites. This study examines the effects of the radon pathway, recently added to the RESRAD program, on the calculation of uranium, radium, and thorium cleanup criteria. The results show that the derived uranium guidelines will not be affected by the radon ingrowth considerations. The effect of radon on radium and thorium generic guidelines is more significant, but the model does indicate that at the generic soil limits used for radium and thorium the indoor radon decay product concentrations would be below the 0.02 working level standard. This study also examines the feasibility of applying RESRAD to chemical risk assessment. The results show that RESRAD can perform risk assessment of toxic chemicals after simple modifications. Expansion of the RESRAD database to include chemical compounds will increase its capability to handle chemical risk assessments. 11 refs., 3 tabs.

Yu, C.; Cheng, J.-J. (Argonne National Lab., IL (United States)); Wallo, A. III (USDOE, Washington, DC (United States))

1991-01-01T23:59:59.000Z

229

395NUCLEAR ENGINEERING AND TECHNOLOGY, VOL.37 NO.4, AUGUST 2005 CONSTRUCTION OF AN ENVIRONMENTAL RADON  

E-Print Network [OSTI]

395NUCLEAR ENGINEERING AND TECHNOLOGY, VOL.37 NO.4, AUGUST 2005 CONSTRUCTION OF AN ENVIRONMENTAL RADON MONITORING SYSTEM USING CR-39 NUCLEAR TRACK DETECTORS GIL HOON AHN* and JAI-KI LEE1 National Nuclear Management & Control Agency 305-600, POX 114 Yuseong, Daejeon, Korea 1 Dept. of Nuclear

230

Alpha  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

is on the order of the torus major radius. Let us now consider, following Similon and Sudan, 17 an Alfve n wave packet, with a characteristic perpendicular wave number k 0...

231

Calculation of gamma radiation dose rate and radon concentration due to granites used as building materials in Iran  

Science Journals Connector (OSTI)

......G. Magusa, North Cyprus, via Mersin 10, Turkey Natural radioactivity concentrations...equivalent from all natural sources of radiation...health(4). Radon gas is a radionuclide present...to determining the natural radioactivity concentration......

A. Abbasi

2013-07-01T23:59:59.000Z

232

Identification of anomalous radon concentrations due to geodynamic processes by elimination of Rn variations caused by other factors  

Science Journals Connector (OSTI)

......dissolved in underground water (Mishel 1987...fluctuations in atmospheric pressure (Dowell...usually a major generator of radon in underground...convection due to lower atmospheric heating. Towards...the underground water, at Fuchu Observatory......

M. Finkelstein; S. Brenner; L. Eppelbaum; E. Ne'Eman

1998-05-01T23:59:59.000Z

233

Influence of energy-saving measures on the radon concentration in some kindergartens in the Czech Republic  

Science Journals Connector (OSTI)

......improvements to the energy efficiency of the buildings...increasing the energy efficiency of buildings...villa-type house built at the...et al. Home energy efficiency and radon related...Energy and Passive Houses in Austria......

I. Fojtikova; K. Navratilova Rovenska

2014-07-01T23:59:59.000Z

234

Recoil-alpha-fission and recoil-alpha-alpha-fission events observed in the reaction Ca-48 + Am-243  

E-Print Network [OSTI]

Products of the fusion-evaporation reaction Ca-48 + Am-243 were studied with the TASISpec set-up at the gas-filled separator TASCA at the GSI Helmholtzzentrum f\\"ur Schwerionenforschung. Amongst the detected thirty correlated alpha-decay chains associated with the production of element Z=115, two recoil-alpha-fission and five recoil-alpha-alpha-fission events were observed. The latter are similar to four such events reported from experiments performed at the Dubna gas-filled separator. Contrary to their interpretation, we propose an alternative view, namely to assign eight of these eleven decay chains of recoil-alpha(-alpha)-fission type to start from the 3n-evaporation channel 115-288. The other three decay chains remain viable candidates for the 2n-evaporation channel 115-289.

U. Forsberg; D. Rudolph; L. -L. Andersson; A. Di Nitto; Ch. E. Dllmann; J. M. Gates; P. Golubev; K. E. Gregorich; C. J. Gross; R. -D. Herzberg; F. P. Hessberger; J. Khuyagbaatar; J. V. Kratz; K. Rykaczewski; L. G. Sarmiento; M. Schdel; A. Yakushev; S. berg; D. Ackermann; M. Block; H. Brand; B. G. Carlsson; D. Cox; X. Derkx; J. Dobaczewski; K. Eberhardt; J. Even; C. Fahlander; J. Gerl; E. Jger; B. Kindler; J. Krier; I. Kojouharov; N. Kurz; B. Lommel; A. Mistry; C. Mokry; W. Nazarewicz; H. Nitsche; J. P. Omtvedt; P. Papadakis; I. Ragnarsson; J. Runke; H. Schaffner; B. Schausten; Y. Shi; P. Thrle-Pospiech; T. Torres; T. Traut; N. Trautmann; A. Trler; A. Ward; D. E. Ward; N. Wiehl

2015-02-10T23:59:59.000Z

235

Targeted alpha therapy for cancer  

Science Journals Connector (OSTI)

Targeted alpha therapy (TAT) offers the potential to inhibit the growth of micrometastases by selectively killing isolated and preangiogenic clusters of cancer cells. The practicality and efficacy of TAT is tested by in vitro and in vivo studies in melanoma, leukaemia, colorectal, breast and prostate cancers, and by a phase 1 trial of intralesional TAT for melanoma. The alpha-emitting radioisotope used is Bi-213, which is eluted from the Ac-225 generator and chelated to a cancer specific monoclonal antibody (mab) or protein (e.g. plasminogen activator inhibitor-2 PAI2) to form the alpha-conjugate (AC). Stable alpha-ACs have been produced which have been tested for specificity and cytotoxicity in vitro against melanoma (9.2.27 mab), leukaemia (WM60), colorectal (C30.6), breast (PAI2, herceptin), ovarian (PAI2, herceptin, C595), prostate (PAI2, J591) and pancreatic (PAI2, C595) cancers. Subcutaneous inoculation of 11.5 million human cancer cells into the flanks of nude mice causes tumours to grow in all mice. Tumour growth is compared for untreated controls, nonspecific AC and specific AC, for local (subcutaneous) and systemic (tail vein or intraperitoneal) injection models. The 213Bi-9.2.27 AC is injected into secondary skin melanomas in stage 4 patients in a dose escalation study to determine the effective tolerance dose, and to measure kinematics to obtain the equivalent dose to organs. In vitro studies show that TAT is one to two orders of magnitude more cytotoxic to targeted cells than non-specific ACs, specific beta emitting conjugates or free isotopes. In vivo local TAT at 2 days post-inoculation completely prevents tumour formation for all cancers tested so far. Intra-lesional TAT can completely regress advanced sc melanoma but is less successful for breast and prostate cancers. Systemic TAT inhibits the growth of sc melanoma xenografts and gives almost complete control of breast and prostate cancer tumour growth. Intralesional doses up to 450 Ci in human patients are effective in regressing melanomas, with no concomitant complications. These results point to the application of local and systemic TAT in the management of secondary cancer. Results of the phase 1 clinical trial of TAT of subcutaneous, secondary melanoma indicate proof of the principle that TAT can make tumours in patients regress.

Barry J Allen; Chand Raja; Syed Rizvi; Yong Li; Wendy Tsui; David Zhang; Emma Song; Chang Fa Qu; John Kearsley; Peter Graham; John Thompson

2004-01-01T23:59:59.000Z

236

Sediment-water chemical exchange in the coastal zone traced by in situ radon-222 flux measurements  

SciTech Connect (OSTI)

In situ radon-222 flux experiments conducted in benthic chambers in Cape Lookout Bight, a small marine basin on the North Carolina coast, reveal that enhanced chemical transport across the sediment-water interface during summer months is caused by abiogenic bubble tube structures. Transport rates for dissolved radon, methane, and ammonium more than three times greater than those predicted on the basis of molecular diffusion occur when open tubes are maintained by semidiurnal low-tide bubbling.

Martens, C.S. (Univ. of North Carolina, Chapel Hill); Kipphut, G.W.; Klump, J.V.

1980-04-18T23:59:59.000Z

237

Local Varying-Alpha Theories  

E-Print Network [OSTI]

In a recent paper we demonstrated how the simplest model for varying alpha may be interpreted as the effect of a dielectric material, generalized to be consistent with Lorentz invariance. Unlike normal dielectrics, such a medium cannot change the speed of light, and its dynamics obey a Klein-Gordon equation. This work immediately suggests an extension of the standard theory, even if we require compliance with Lorentz invariance. Instead of a wave equation, the dynamics may satisfy a local algebraic relation involving the permittivity and the properties of the electromagnetic field, in analogy with more conventional dielectric (but still preserving Lorentz invariance). We develop the formalism for such theories and investigate some phenomenological implications. The problem of the divergence of the classical self-energy can be solved, or at least softened, in this framework. Some interesting new cosmological solutions for the very early universe are found, including the possibility of a bounce, inflation and expansion with a loitering phase, all of which are induced by early variations in alpha.

John D. Barrow; Joao Magueijo

2014-12-10T23:59:59.000Z

238

Investigations of factors affecting the use of uranium metal as a source of alpha particles for the evaluation of alpha track detectors  

E-Print Network [OSTI]

OF CONTENTS ABSTRACT. DEDICATION. ACKNOWLEDGMENTS . . TABLE OF CONTENTS. . LIST OF FIGURES. LIST OF TABLES. CHAPTER INTRODUCTION. Radon: an overview. . Review of radon detection. Objective. II THEORY Particle tracks. . Track etching. Oxides... OF TABLES Table 1 Table 2 Table 3 Table 4 Isotopes of radon of interest. . Total decay chain of uranium-238. Effect of the position of the detector in the etchant. . . . . . . . . . . . Tracks number counted for two different batch of films...

Voirin, Marc

2012-06-07T23:59:59.000Z

239

SHOE V.1.5 ALPHA  

Energy Science and Technology Software Center (OSTI)

002913MLTPL00 Sandia Higher Order Elements (SHOE) v 0.5 alpha http://midas3.kitware.com/midas/folder/10328

240

DISCOVERY OF AN H{alpha} EMITTING DISK AROUND THE SUPERMASSIVE BLACK HOLE OF M31  

SciTech Connect (OSTI)

Due to its proximity, the mass of the supermassive black hole in the nucleus of the Andromeda galaxy (M31), the most massive black hole in the Local Group of galaxies, has been measured by several methods involving the kinematics of a stellar disk which surrounds it. We report here the discovery of an eccentric H{alpha} emitting disk around the black hole at the center of M31 and show how modeling this disk can provide an independent determination of the mass of the black hole. Our model implies a mass of 5.0{sup +0.8}{sub -1.0} Multiplication-Sign 10{sup 7} M{sub Sun} for the central black hole, consistent with the average of determinations by methods involving stellar dynamics, and compatible (at 1{sigma} level) with measurements obtained from the most detailed models of the stellar disk around the central black hole. This value is also consistent with the M-{sigma} relation. In order to make a comparison, we applied our simulation on the stellar kinematics in the nucleus of M31 and concluded that the parameters obtained for the stellar disk are not formally compatible with the parameters obtained for the H{alpha} emitting disk. This result suggests that the stellar and the H{alpha} emitting disks are intrinsically different from each other. A plausible explanation is that the H{alpha} emission is associated with a gaseous disk. This hypothesis is supported by the detection of traces of weaker nebular lines in the nuclear region of M31. However, we cannot exclude the possibility that the H{alpha} emission is, at least partially, generated by stars.

Menezes, R. B.; Steiner, J. E.; Ricci, T. V., E-mail: robertobm@astro.iag.usp.br [Instituto de Astronomia Geofisica e Ciencias Atmosfericas, Universidade de Sao Paulo, Rua do Matao 1226, Cidade Universitaria, Sao Paulo, SP CEP 05508-090 (Brazil)

2013-01-10T23:59:59.000Z

Note: This page contains sample records for the topic "alpha excluding radon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Alpha Technologies | Open Energy Information  

Open Energy Info (EERE)

Technologies Technologies Jump to: navigation, search Name Alpha Technologies Place Bellingham, Washington State Zip 98226 Sector Services, Solar Product Bellingham (WA)-based firm offering, among other products, power conversion products designed specifically for the PV market, plus installation services for solar systems. Coordinates 48.75235°, -122.471219° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.75235,"lon":-122.471219,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

242

Derr Track Storage Bldg Sigma Alpha  

E-Print Network [OSTI]

!( Derr Track Storage Bldg Japan Center Memorial Bell Tower Solar House Primrose Chancellor & Storage Bio. Sci Avent Ferry Complex Building Sigma Phi Epsilon 7 Welch Pi Kappa Alpha 10 Sigma Alpha Mu 4 and Visitor's Center Thompson Admin II Bostian Library Storage Facility Winston Clark Ricks Robertson Harris

Reeves, Douglas S.

243

Elementary Processes Underlying Alpha Channeling in Tokamaks  

SciTech Connect (OSTI)

Alpha channeling in tokamaks is speculative, but also extraordinarily attractive. Waves that can accomplish this effect have been identified. Key aspects of the theory now enjoy experimental confirmation. This paper will review the elementary processes of wave-particle interactions in plasma that underlie the alpha channeling effect

NM.J. Fisch

2012-06-15T23:59:59.000Z

244

Alpha Renewable Energy | Open Energy Information  

Open Energy Info (EERE)

Renewable Energy Renewable Energy Jump to: navigation, search Name Alpha Renewable Energy Place Atlanta, Georgia Sector Biomass Product Manufacturer of biomass wood gas stoves and standalone power generators for rural areas. References Alpha Renewable Energy[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Alpha Renewable Energy is a company located in Atlanta, Georgia . References ↑ "Alpha Renewable Energy" Retrieved from "http://en.openei.org/w/index.php?title=Alpha_Renewable_Energy&oldid=342033" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties

245

Bacterial Alpha Amylase Paper Disc Tests on Starch Agar  

Science Journals Connector (OSTI)

...Articles Bacterial Alpha Amylase Paper Disc Tests on Starch Agar Egon Stark Ralph...Mass. Bacterial Alpha Amylase Paper Disc Tests on Starch Agar EGON STARK...hydrolysis of soluble starch by a bacterial alpha-amylase preparation, so...

Egon Stark; Ralph Wellerson Jr.; Philip A. Tetrault; Carl F. Kossack

1953-09-01T23:59:59.000Z

246

ALPHA-DECAY STUDIES IN THE HEAVY-ELEMENT REGION  

E-Print Network [OSTI]

231, Curium-242, and Americium-241 (Thesis), AECU-2757 (rimental Results A. Alpha Decay of Americium-243 L Alpha-Particle Energy of Americium-243 New Alpha Groups of

Hummel, John Philip

2010-01-01T23:59:59.000Z

247

An investigation of radon exhalation rate and estimation of radiation doses in coal and fly ash samples  

Science Journals Connector (OSTI)

Coal is a technologically important material used for power generation. Its cinder (fly ash) is used in the manufacturing of bricks, sheets, cement, land filling etc. Coal and its by-products often contain significant amounts of radionuclides, including uranium which is the ultimate source of the radioactive gas radon. Burning of coal and the subsequent atmospheric emission cause the redistribution of toxic radioactive trace elements in the environment. In the present study, radon exhalation rates in coal and fly ash samples from the thermal power plants at Kolaghat (W.B.) and Kasimpur (U.P.) have been measured using sealed Can technique having LR-115 type II detectors. The activity concentrations of 238U, 232Th, and 40K in the samples of Kolaghat power station are also measured. It is observed that the radon exhalation rate from fly ash samples from Kolaghat is higher than from coal samples and activity concentration of radionuclides in fly ash is enhanced after the combustion of coal. Fly ash samples from Kasimpur show no appreciable change in radon exhalation. Radiation doses from the fly ash samples have been estimated from radon exhalation rate and radionuclide concentrations.

A.K. Mahur; Rajesh Kumar; Meena Mishra; D. Sengupta; Rajendra Prasad

2008-01-01T23:59:59.000Z

248

In-vivo measurements of Pb-210 to determine cumulative exposure to radon daughters: A pilot study. Final report, 1 March, 1990--May 31, 1991  

SciTech Connect (OSTI)

The objective of this study is to demonstrate the feasibility of estimating cumulative exposure of individuals to low concentrations of radon by measuring the amount of Pb-A-10 in their skeletons. This report presents progress to date establishing the validity of an vivo technique to measure skeletal burdens of Pb-210, accumulated from exposure to radon and radon progeny. With the skeletal content of Pb--210 and a model for Pb metabolism, cumulative exposure to radon and its short-lived daughters (radon/daughters) may be calculated for use in deriving a dose-response relationship between lung cancer and exposure to radon/daughters. Data are presented for 29 subjects exposed to ``above-average`` radon concentrations in their homes, showing the correlation between measured Pb--210 burdens, and measured pCi/l and WLM exposure estimates. Their results are compared to measurements of a population of 24 subject`s presumed exposed to average concentrations. Measurements of a Pennsylvania family exposed for a year in a home with an extremely high radon content are also presented. Update of results of an ongoing study of the biological half-time of Pb--210 in man involving measurements, of a retired radiation worker with a 40 year old skeletal burden of Pb-210.

Laurer, G.R.; Cohen, N. [New York Univ. Medical Center, Tuxedo, NY (United States). Dept. of Environmental Medicine; Stark, A.; Ju, C. [New York State Dept. of Health, Albany, NY (United States). Bureau of Environmental and Occupational Epidemiology

1991-05-01T23:59:59.000Z

249

Maximizing the field of view for a computer-assisted alpha track counting system  

E-Print Network [OSTI]

ACKNOWLEDGMENTS . . TABLE OF CONTENTS. LIST OF FIGURES. . LIST OF TABLES . CHAPTER INTRODUCTION. . Radon: An Overview. Radon: Detection Techniques . Objective . 1V . Vl via II THEORY Particle Tracks . Track Etching Image Analysis. Calibration... Factor 10 13 III EXPERIMENT Materials and Description. Image Processing System Uramum Foil. Radon Source Detector System. 15 15 15 17 17 18 CHAPTER Etclung. Expenmental Procedure Determinanon of Proper Light Source . . Determination...

Buxkemper, Mark Anthony

2012-06-07T23:59:59.000Z

250

CRAD, Safety Basis - Oak Ridge National Laboratory TRU ALPHA...  

Broader source: Energy.gov (indexed) [DOE]

Safety Basis - Oak Ridge National Laboratory TRU ALPHA LLWT Project CRAD, Safety Basis - Oak Ridge National Laboratory TRU ALPHA LLWT Project November 2003 A section of Appendix C...

251

CRAD, Quality Assurance - Oak Ridge National Laboratory TRU ALPHA...  

Broader source: Energy.gov (indexed) [DOE]

Quality Assurance - Oak Ridge National Laboratory TRU ALPHA LLWT Project CRAD, Quality Assurance - Oak Ridge National Laboratory TRU ALPHA LLWT Project November 2003 A section of...

252

CRAD, Management - Oak Ridge National Laboratory TRU ALPHA LLWT...  

Broader source: Energy.gov (indexed) [DOE]

Management - Oak Ridge National Laboratory TRU ALPHA LLWT Project CRAD, Management - Oak Ridge National Laboratory TRU ALPHA LLWT Project November 2003 A section of Appendix C to...

253

E-Print Network 3.0 - alpha continuous air Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

; Environmental Sciences and Ecology ; Biology and Medicine 3 A study of the polyethylene membrane used in diffusion chambers for radon gas concentration measurements...

254

E-Print Network 3.0 - alpha-particle-emitting isotope 259db Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Department of Chemistry, Texas A&M University Collection: Physics 2 A study of the polyethylene membrane used in diffusion chambers for radon gas concentration measurements...

255

Direct constraints on diffusion models from cosmic-ray positron data: Excluding the minimal model for dark matter searches  

Science Journals Connector (OSTI)

Galactic cosmic-ray (CR) transport parameters are usually constrained by the boron-to-carbon ratio. This procedure is generically plagued with degeneracies between the diffusion coefficient and the vertical extent of the Galactic magnetic halo. The latter is of paramount importance for indirect dark matter (DM) searches because it fixes the amount of DM annihilation or decay that contributes to the local antimatter CR flux. These degeneracies could be broken by using secondary radioactive species, but the current data still have large error bars, and this method is extremely sensitive to the very local interstellar medium properties. Here, we propose to use the low-energy CR positrons in the GeV range as another direct constraint on diffusion models. We show that the PAMELA data disfavor small diffusion halo (L?3??kpc) and large diffusion slope models and exclude the minimal configuration [Maurin etal. Astrophys. J. 555, 585 (2001); Donato etal. Phys. Rev. D 69, 063501 (2004)] widely used in the literature to bracket the uncertainties in the DM signal predictions. This is complementary to indirect constraints (diffuse radio and gamma-ray emissions) and has a strong impact on DM searches. Indeed, this makes the antiproton constraints more robust while enhancing the discovery/exclusion potential of current and future experiments, like AMS-02 and GAPS, especially in the antiproton and antideuteron channels.

Julien Lavalle; David Maurin; Antje Putze

2014-10-15T23:59:59.000Z

256

Dynamics of pulled desorption with effects of excluded volume interaction: The p-Laplacian diffusion equation and its exact solution  

E-Print Network [OSTI]

We analyze the dynamics of desorption of a polymer molecule which is pulled at one of its ends with force $f$, trying to desorb it. We assume a monomer to desorb when the pulling force on it exceeds a critical value $f_{c}$. We formulate an equation for the average position of the $n^{th}$ monomer, which takes into account excluded volume interaction through the blob-picture of a polymer under external constraints. The approach leads to a diffusion equation with a $p$-Laplacian for the propagation of the stretching along the chain. This has to be solved subject to a moving boundary condition. Interestingly, within this approach, the problem can be solved exactly in the trumpet, stem-flower and stem regimes. In the trumpet regime, we get $\\tau=\\tau_{0}n_d^{2}$ where $n_d$ is the number of monomers that have desorbed at the time $\\tau$. $\\tau_{0}$ is known only numerically, but for $f$ close to $f_{c}$, it is found to be $\\tau_{0}\\sim f_c/(f^{2/3}-f_{c}^{2/3})$. If one used simple Rouse dynamics, this result changes to {\

K. L. Sebastian; V. G. Rostiashvili; T. A. Vilgis

2011-08-31T23:59:59.000Z

257

Direct constraints on diffusion models from cosmic-ray positron data: Excluding the Minimal model for dark matter searches  

E-Print Network [OSTI]

Galactic Cosmic-ray (CR) transport parameters are usually constrained by the boron-to-carbon ratio. This procedure is generically plagued with degeneracies between the diffusion coefficient and the vertical extent of the Galactic magnetic halo. The latter is of paramount importance for indirect dark matter (DM) searches, because it fixes the amount of DM annihilation or decay that contributes to the local antimatter CR flux. These degeneracies could be broken by using secondary radioactive species, but the current data still have large error bars, and this method is extremely sensitive to the very local interstellar medium (ISM) properties. Here, we propose to use the low-energy CR positrons in the GeV range as another direct constraint on diffusion models. We show that the PAMELA data disfavor small diffusion halo ($L\\lesssim 3$ kpc) and large diffusion slope models, and exclude the minimal ({\\em min}) configuration (Maurin et al. 2001, Donato et al. 2004) widely used in the literature to bracket the uncertainties in the DM signal predictions. This is complementary to indirect constraints (diffuse radio and gamma-ray emissions) and has strong impact on DM searches. Indeed this makes the antiproton constraints more robust while enhancing the discovery/exclusion potential of current and future experiments, like AMS-02 and GAPS, especially in the antiproton and antideuteron channels.

Julien Lavalle; David Maurin; Antje Putze

2015-01-22T23:59:59.000Z

258

The ENVIRAD project: a way to control and to teach how to protect from high indoor radon level  

Science Journals Connector (OSTI)

The environmental radioactivity (ENVIRAD) project involves students of Italian secondary schools with the aim to make them acquainted with the radon measurement techniques. The first step of the project has consisted of the introduction of the participants into some themes not treated in usual curricula to supply the student with the cultural skill to carry out survey about radon concentrations in the school and eventually in other buildings. The second ENVIRAD's part is the creation of a network for the continuous on-line measurements of radon exhalation from soil for geophysical applications. The feasibility of the project has been verified by 1-year work with a pilot school during the season 2002/2003. In the following year, 18 schools will join the project.

A.M. Esposito; M. Ambrosio; E. Balzano; L. Gialanella; M. Pugliese; V. Roca; M. Romano; C. Sabbarese; G. Venoso

2005-01-01T23:59:59.000Z

259

Nuclear diagnostic for fast alpha particles  

DOE Patents [OSTI]

This invention relates generally to high energy confined plasmas and more particularly is directed to measuring the velocity distribution of confined energetic alpha particles resulting from deuterium-tritium fusion reactions in a confined energetic plasma.

Grisham, L.R.; Post, D.E. Jr.; Dawson, J.M.

1983-11-23T23:59:59.000Z

260

Alpha Channeling in Rotating Plasma with Stationary Waves  

SciTech Connect (OSTI)

An extension of the alpha channeling effect to supersonically rotating mirrors shows that the rotation itself can be driven using alpha particle energy. Alpha channeling uses radiofrequency waves to remove alpha particles collisionlessly at low energy. We show that stationary magnetic fields with high n? can be used for this purpose, and simulations show that a large fraction of the alpha energy can be converted to rotation energy.

A. Fetterman and N.J. Fisch

2010-02-15T23:59:59.000Z

Note: This page contains sample records for the topic "alpha excluding radon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

(Data in thousand metric tons of silicon content unless otherwise noted) Domestic Production and Use: Estimated value of silicon alloys and metal (excluding semiconductor-and solar-  

E-Print Network [OSTI]

Production and Use: Estimated value of silicon alloys and metal (excluding semiconductor- and solar- grade and aluminum alloys and the chemical industry. The semiconductor and solar industries, which manufacture chips%; Venezuela, 15%; Canada, 8%; and other, 8%. Silicon metal: Brazil, 38%; South Africa, 24%; Canada, 16

262

Formation of Hydrogen Peroxide in Water Irradiated with X- and Alpha-Rays  

Science Journals Connector (OSTI)

... of very different ionic density, namely, 09 A. X-rays and polonium or radon?-rays. Methods. The irradiation with X-rays and the titration of hydrogen peroxide ... x-rays. The ionic yield, in the case of X-rays, suggests that the radon (3-rays probably account for less than 5 per cent of the total effect ...

P. BONET-MAURY; M. LEFORT

1948-09-04T23:59:59.000Z

263

Radon monitoring in groundwater samples from some areas of northern Rajasthan, India, using a RAD7 detector  

Science Journals Connector (OSTI)

......and groundwater. Natural water contains dissolved...rocks(1). Radon gas and its radioactive...water samples from Cyprus and Greece in the...16.29.3 (8) Cyprus 0.3-20 5.9...water in Greece and Cyprus: implications to...water from various natural sources using nuclear......

Asha Rani; Rohit Mehra; Vikas Duggal

2013-03-01T23:59:59.000Z

264

The Dispersion of Radon Above Deeply Buried Uranium Ore: Millennium Deposit, Athabasca Basin, SK , K Hattori1  

E-Print Network [OSTI]

The Dispersion of Radon Above Deeply Buried Uranium Ore: Millennium Deposit, Athabasca Basin, SK M, Ottawa, ON, 2 Cameco Corporation, Saskatoon, SK Depth Profiles Canada Mining Innovation Council Natural., Portella, P., Olson, R.A., 2007. Unconformity- associated uranium deposits of the Athabasca Basin

265

A pilot study of the dependence of radon concentration on the tectonic structures, using simple geophysical methods  

Science Journals Connector (OSTI)

......concentration of 40K and uranium is more or less stable. The low radon and uranium concentrations measured...supported by the research plan MSM6840770040 of...McMurry P. H. A review of atmospheric aerosol...Plastino W. , et al. Uranium groundwater anomalies...main unit with standard accessories, multi-electrode......

L. Thinova; A. Fronka; K. Rovenska

2011-05-01T23:59:59.000Z

266

Residential Radon Exposure, Histologic Types, and Lung Cancer Risk. A CaseControl Study in Galicia, Spain  

Science Journals Connector (OSTI)

...a federal action plan for saving lives...Radon_Action_Plan.pdf . 6. A citizen's...exposure? A systematic review.Int J Radiat Biol...and American Indian uranium miners: an update...carcinoma in German uranium miners.Cancer 2006...was measured using standard procedures. Results...

Juan Miguel Barros-Dios; Alberto Ruano-Ravina; Mnica Prez-Ros; Margarita Castro-Bernrdez; Jose Abal-Arca; and Marta Tojo-Castro

2012-06-01T23:59:59.000Z

267

Residential Radon Exposure, Histologic Types, and Lung Cancer Risk. A CaseControl Study in Galicia, Spain  

Science Journals Connector (OSTI)

...in miners (WISMUT Mining Company) have revealed...Perez-Rios Writing, review, and/or revision...a federal action plan for saving lives...Radon_Action_Plan.pdf . 6. A citizen's...exposure? A systematic review.Int J Radiat Biol...was measured using standard procedures. Results...

Juan Miguel Barros-Dios; Alberto Ruano-Ravina; Mnica Prez-Ros; Margarita Castro-Bernrdez; Jose Abal-Arca; and Marta Tojo-Castro

2012-06-01T23:59:59.000Z

268

Radon (Rn-222) and thoron (Rn-220) emanation fractions from three separate formations of oil field pipe scale  

E-Print Network [OSTI]

because of the external radiation exposure but also because of the radon gas emissions, both of which are due to the radioactive minerals contained in the scale. It was believed that the structure of the scale is formed tightly enough to prevent much...

Fruchtnicht, Erich Harold

2004-11-15T23:59:59.000Z

269

Radon concentration in drinking water and supplementary exposure in Bia-tei mining area, Bihor county (Romania)  

Science Journals Connector (OSTI)

......partially of the Sectoral Operational Programme-Increase of Economic Competitiveness co-financed by the European Regional Development...Heloisa F. Radon (222Rn) concentration in indoor air near the coal mining area of Nui Beo, North of Vietnam. J. Environ. Radioact......

Mircea Moldovan; Dan Constantin Nita; Alexandra Cucos-Dinu; Tiberius Dicu; Nicoleta Bican-Brisan; Constantin Cosma

2014-03-01T23:59:59.000Z

270

AlphaWatt Ltd | Open Energy Information  

Open Energy Info (EERE)

AlphaWatt Ltd AlphaWatt Ltd Jump to: navigation, search Name AlphaWatt Ltd Place London, United Kingdom Zip EC1V 4PY Sector Solar Product Solar project developer, plans to become an independent power provider. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

271

Exotic decay model and alpha decay studies  

SciTech Connect (OSTI)

In exotic decay studies, the lifetime of alpha emission occurs crucially in the branching ratio calculation. In this work, we extend our previous exotic decay model to calculate the same. But, in this case unlike in the exotic decay, the redistribution of charge for given masses of the fragments has to be taken into account since the charge-to-mass ratio of the alpha fragment differs from that of the parent nucleus. We have therefore modified the Yukawa-plus-exponential potential in the post-scission region in our model suitably so as to allow the required charge redistribution among the fragments in the region between sharp contact and the point up to which the finite-range effects persist. The success of this model for alpha decay is as good as for the exotic decay studies.

Shanmugam, G.; Kamalaharan, B. (Department of Physics, Presidency College, Madras 600005, India (IN))

1990-04-01T23:59:59.000Z

272

Energy production in varying {\\alpha} theories  

E-Print Network [OSTI]

Aims. On the basis the theoretical model proposed by Bekenstein for {\\alpha}'s variation, we analyze the equations that describe the energy exchange between matter and both the electromagnetic and the scalar fields. Methods. We determine how the energy flow of the material is modified by the presence of a scalar field. We estimate the total magnetic energy of matter from the "sum rules techniques". We compare the results with data obtained from the thermal evolution of the Earth and other planets. Results. We obtain stringent upper limits to the variations in {\\alpha} that are comparable with those obtained from atomic clock frequency variations. Conclusions. Our constraints imply that the fundamental length scale of Bekenstein's theory "lB" cannot be larger than Planck's length "lP".

Kraiselburd, Lucila; Sisterna, Pablo; Vucetich, Hctor; 10.1051/0004-6361/201015970

2011-01-01T23:59:59.000Z

273

Radiological hazards of alpha-contaminated waste  

SciTech Connect (OSTI)

The radiological hazards of alpha-contaminated wastes are discussed in this overview in terms of two components of hazard: radiobiological hazard, and radioecological hazard. Radiobiological hazard refers to human uptake of alpha-emitters by inhalation and ingestion, and the resultant dose to critical organs of the body. Radioecological hazard refers to the processes of release from buried wastes, transport in the environment, and translocation to man through the food chain. Besides detailing the sources and magnitude of hazards, this brief review identifies the uncertainties in their estimation, and implications for the regulatory process.

Rodgers, J.C.

1982-01-01T23:59:59.000Z

274

Assessment of radon concentration and external gamma radiation level in the environs of Narwapahar uranium mine, India and its radiological significance  

Science Journals Connector (OSTI)

In the environs of uranium mining, milling and processing facilities and in the uranium mineralized terrain, a little higher ambient radon concentration and gamma radiation level may be expected in comparison ...

B. K. Rana; R. M. Tripathi; J. S. Meena

2011-11-01T23:59:59.000Z

275

Production of alpha-amylase by yeast  

SciTech Connect (OSTI)

The enzyme alpha-amylase confers to an organism the enzymatic activity for the degradation of polyglucosides with alpha-1,4 glycosidic bonds such as starch and glycogen which are among the major storage compounds in plants and animals. Most alpha-amylases are single polypeptides of molecular weights around 50,000 dalton. They are generally found in the digestive tract of animals and in germinating seeds. Among the products released upon enzymatic degradation of polyglucosides maltose, a sugar that can be utilized as carbon source by yeast, is a major constituent. A cDNA segment complementary to mouse salivary amylase messenger RNA has been inserted into the yeast expression vector pMA56 behind the promoter of the gene encoding alcohol dehydrogenase I of yeast. Yeast transformants harboring plasmids with the normal orientation of the promoter and the mouse amylase cDNA gene produce amylase and release the enzyme in free form into the culture medium. Approximately 90% of the amylase activity is found in the medium. Yeast strains carrying MAL allele and transformed with a plasmid which directed the synthesis of mouse alpha-amylase were tested on plates containing starch and in batch fermentations using different high molecular weight sugars and oligosaccharides as carbon source. The results of these experiments will be discussed. (Refs. 21).

Thomse, K.K.

1987-01-01T23:59:59.000Z

276

The SimCore/Alpha Functional Simulator  

Science Journals Connector (OSTI)

We have developed a function-level processor simulator, SimCore/Alpha Functional Simulator Version 2.0 (SimCore Version 2.0), for processor architecture research and processor education. This paper describes the design and implementation of SimCore Version ...

Kenji Kise; Takahiro Katagiri; Hiroki Honda; Toshitsugu Yuba

2004-06-01T23:59:59.000Z

277

H-alpha observations of zeta Tauri  

E-Print Network [OSTI]

We report H-alpha observations of zeta Tauri, taken between late 2000 and early 2006. Next to extending existing long-term montioring of the disk state of this star we report an intermediate timescale of about 69 days to be present in the V/R variations of the Halpha line. The observational data will be published together with this manuscript.

E. Pollmann; Th. Rivinius

2008-01-29T23:59:59.000Z

278

E-Print Network 3.0 - alpha hnf-3alpha negatively Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Manchester Collection: Biology and Medicine 4 VANDERBILT UNIVERSITY OFFICE OF CAMPUS RECREATION Summary: 1 Alpha Delta Pi III 2 Ankurage I II 3 Don't Haze Me Bro 2 II I 4 Gram...

279

E-Print Network 3.0 - alpha cap alpha Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Pi Greek Woman of the Year Ann... Marie Frappier - Rho Gamma Greek Man of the Year Jordan Fischette - Alpha Tau Omega Greek Professor... of the Year Carl Braunlich Philanthropy...

280

E-Print Network 3.0 - alpha-1-antitrypsin augmentation therapy...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Alpha-1-Antitrypsin Alpha-Hydroxybutyrate Dehydrogenase (aHBDH) ALTSGPT Amylase Amylase (Alpha) Amylase Source: Rodriguez, Carlos - Department of Mathematics and Statistics, State...

Note: This page contains sample records for the topic "alpha excluding radon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

E-Print Network 3.0 - alpha-1 antitrypsin deficiency Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Alpha-1-Antitrypsin Alpha-Hydroxybutyrate Dehydrogenase (aHBDH) ALTSGPT Amylase Amylase (Alpha) Amylase Source: Rodriguez, Carlos - Department of Mathematics and Statistics, State...

282

E-Print Network 3.0 - alpha chi sigma Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Alpha: 2515 Leon Street KS...Kappa Sigma: 1002 West 26th Street LCA...Lambda Chi Alpha... ACW...Alpha Chi Omega: 2420 Nueces Street ADP...

283

CRAD, Training - Oak Ridge National Laboratory TRU ALPHA LLWT...  

Broader source: Energy.gov (indexed) [DOE]

Training - Oak Ridge National Laboratory TRU ALPHA LLWT Project CRAD, Training - Oak Ridge National Laboratory TRU ALPHA LLWT Project November 2003 A section of Appendix C to DOE G...

284

The effects of alpha particle irradiation on stainless steel  

E-Print Network [OSTI]

A Monte Carlo code was developed to calculate the alpha particle emission rate from WGPu. It yielded information pertaining to the alpha particle source strength at the WGPU and stainless steel interface as well as the damage production and He...

Shipp, John Douglas

1999-01-01T23:59:59.000Z

285

HIGH TEMPERATURE TREATMENT OF INTERMEDIATE-LEVEL RADIOACTIVE WASTES - SIA RADON EXPERIENCE  

SciTech Connect (OSTI)

This review describes high temperature methods of low- and intermediate-level radioactive waste (LILW) treatment currently used at SIA Radon. Solid and liquid organic and mixed organic and inorganic wastes are subjected to plasma heating in a shaft furnace with formation of stable leach resistant slag suitable for disposal in near-surface repositories. Liquid inorganic radioactive waste is vitrified in a cold crucible based plant with borosilicate glass productivity up to 75 kg/h. Radioactive silts from settlers are heat-treated at 500-700 0C in electric furnace forming cake following by cake crushing, charging into 200 L barrels and soaking with cement grout. Various thermochemical technologies for decontamination of metallic, asphalt, and concrete surfaces, treatment of organic wastes (spent ion-exchange resins, polymers, medical and biological wastes), batch vitrification of incinerator ashes, calcines, spent inorganic sorbents, contaminated soil, treatment of carbon containing 14C nuclide, reactor graphite, lubricants have been developed and implemented.

Sobolev, I.A.; Dmitriev, S.A.; Lifanov, F.A.; Kobelev, A.P.; Popkov, V.N.; Polkanov, M.A.; Savkin, A.E.; Varlakov, A.P.; Karlin, S.V.; Stefanovsky, S.V.; Karlina, O.K.; Semenov, K.N.

2003-02-27T23:59:59.000Z

286

Robust Hydraulic Fracture Monitoring (HFM) of Multiple Time Overlapping Events Using a Generalized Discrete Radon Transform  

E-Print Network [OSTI]

In this work we propose a novel algorithm for multiple-event localization for Hydraulic Fracture Monitoring (HFM) through the exploitation of the sparsity of the observed seismic signal when represented in a basis consisting of space time propagators. We provide explicit construction of these propagators using a forward model for wave propagation which depends non-linearly on the problem parameters - the unknown source location and mechanism of fracture, time and extent of event, and the locations of the receivers. Under fairly general assumptions and an appropriate discretization of these parameters we first build an over-complete dictionary of generalized Radon propagators and assume that the data is well represented as a linear superposition of these propagators. Exploiting this structure we propose sparsity penalized algorithms and workflow for super-resolution extraction of time overlapping multiple seismic events from single well data.

Ely, Gregory

2013-01-01T23:59:59.000Z

287

Electrical Resistance of Alpha Hydrogen?Palladium  

Science Journals Connector (OSTI)

Electrical resistancemeasurements of gas?charged alpha hydrogen?palladium alloys have been made in the range 100 to 400C. The fractional increase of palladiumresistance caused by addition of hydrogen is proportional to hydrogen concentration. The constant of proportionality is independent of temperature indicating that Matthiessen's rule is inapplicable to this system. When the results of this work are combined with those of previous authors all of the data can be adequately represented in the range 75 to 400C by the equation (R/R 0) 1 = (2.410.04) m where R is the resistance of alpha hydrogen?palladium R 0 is the resistance of hydrogen?free palladium and m is the hydrogen?to?palladium atom ratio.

W. T. Lindsay Jr.; F. W. Pement

1962-01-01T23:59:59.000Z

288

Alternate Alpha Induced Reactions for NIF Radiochemistry  

SciTech Connect (OSTI)

Radiochemical analysis of NIF capsule residues has been identified as a potential diagnostic of NIF capsule performance. In particular, alpha-induced nuclear reactions that occur on tracer elements added to the NIF capsule have been shown through simulation to be a very sensitive diagnostic for mix. The short range of the alpha particles makes them representative of the hot spot where they are created through the fusion of deuterium and tritium. Reactions on elements doped into the innermost part of the capsule ablator would therefore be sensitive to material that had mixed into the hot spot. Radiochemical determinations of activated detector elements may perhaps be the only true measure of mix that occurs in a NIF capsule, particularly in cases when the capsule fails.

Shaughnessy, D A; Moody, K J; Bernstein, L A

2010-02-26T23:59:59.000Z

289

$\\alpha$ Centauri A in the far infrared  

E-Print Network [OSTI]

Chromospheres and coronae are common phenomena on solar-type stars. Understanding the energy transfer to these heated atmospheric layers requires direct access to the relevant empirical data. Study of these structures has, by and large, been limited to the Sun thus far. The region of the temperature reversal can be directly observed only in the far infrared and submm. We aim at the determination of the characteristics of the atmosphere in the region of the temperature minimum of the solar sister star alpha Cen A. For the nearby binary system alpha Centauri, stellar parameters are known with high accuracy from measurements. For the basic model parameters Teff, log g and [Fe/H], we interpolate in the grid of GAIA/PHOENIX stellar model atmospheres and compute the corresponding model for the G2 V star alpha Cen A. Comparison with photometric measurements shows excellent agreement between observed photospheric data in the optical and infrared. For longer wavelengths, the modelled spectral energy distribution is co...

Liseau, R; Olofsson, G; Bryden, G; Marshall, J P; Ardila, D; Aran, A Bayo; Danchi, W C; del Burgo, C; Eiroa, C; Ertel, S; Fridlund, M C W; Krivov, A V; Pilbratt, G L; Roberge, A; Thbault, P; Wiegert, J; White, G J

2012-01-01T23:59:59.000Z

290

Alpha Particle Physics Experiments in the Tokamak Fusion Test Reactor  

SciTech Connect (OSTI)

Alpha particle physics experiments were done on the Tokamak Fusion Test Reactor (TFTR) during its deuterium-tritium (DT) run from 1993-1997. These experiments utilized several new alpha particle diagnostics and hundreds of DT discharges to characterize the alpha particle confinement and wave-particle interactions. In general, the results from the alpha particle diagnostics agreed with the classical single-particle confinement model in magnetohydrodynamic (MHD) quiescent discharges. Also, the observed alpha particle interactions with sawteeth, toroidal Alfvn eigenmodes (TAE), and ion cyclotron resonant frequency (ICRF) waves were roughly consistent with theoretical modeling. This paper reviews what was learned and identifies what remains to be understood.

Budny, R.V.; Darrow, D.S.; Medley, S.S.; Nazikian, R.; Zweben, S.J.; et al.

1998-12-14T23:59:59.000Z

291

Assessment of the radiological impact of gamma and radon dose ratesat former U mining sites in Central Asia  

Science Journals Connector (OSTI)

An assessment of the radiological situation due to exposure to gamma radiation, radon and thoron was carried out at selected former uranium mining and processing sites in the Central Asian countries of Kazakhstan, Kyrgyzstan, Uzbekistan and Tajikistan. Gamma dose rate measurements were made using various field instruments and radon/thoron measurements were carried out using discriminative radon (222Rn)/thoron (220Rn) solid state nuclear track detectors (SSNTD). The detectors were exposed for an extended period of time, including at least three seasonal periods in a year, in different outdoor and indoor public and residential environments at the selected uranium legacy sites. The results showed that gamma, Rn and Tn doses were in general low, which consequently implies a low/relatively low radiological risk. The major radiation hazard is represented by abandoned radioactive filtration material that was being used as insulation by some Minkush residents (Kyrgyzstan) for a longer period of time. Annual radiation doses of several hundred mSv could be received as a consequence of using this material domestically. In addition, the gamma and Rn/Tn dose rates at Digmai, Tajikistan, could reach values of several 10mSv/a. The doses of ionizing radiation deriving from external radiation (gamma dose rate), indoor radon and thoron with their short-lived progenies in several cases exceeded the recommended annual effective dose threshold level of 10mSv. At none of the sites investigated did the individual annual effective doses exceed 30mSv, the internationally recommended value for considering intervention. Current doses of ionizing radiation do not represent a serious hazard to the health of the resident public, but this issue should be adequately addressed to further reduce needless exposure of the resident public to ionizing radiation.

P. Stegnar; I. Shishkov; M. Burkitbayev; B. Tolongutov; M. Yunusov; R. Radyuk; B. Salbu

2013-01-01T23:59:59.000Z

292

Complex-Energy Shell-Model Description of Alpha Decay  

SciTech Connect (OSTI)

In his pioneering work of alpha decay, Gamow assumed that the alpha particle formed inside the nucleus tunnels through the barrier of the alpha-daughter potential. The corresponding metastable state can be viewed as a complex-energy solution of the time-independent Schroedinger equation with the outgoing boundary condition. The formation of the alpha cluster, missing in the original Gamow formulation, can be described within the R-matrix theory in terms of the formation amplitude. In this work, the alpha decay process is described by computing the formation amplitude and barrier penetrability in a large complex-energy configuration space spanned by the complex-energy eigenstates of the finite Woods-Saxon (WS) potential. The proper normalization of the decay channel is essential as it strongly modifies the alpha-decay spectroscopic factor. The test calculations are carried out for the ^{212}Po alpha decay.

Id Betan, R. [Rosario Physics Institute, Rosario, Argentina] [Rosario Physics Institute, Rosario, Argentina; Nazarewicz, Witold [ORNL] [ORNL

2011-01-01T23:59:59.000Z

293

Extreme alpha-clustering in the 18O nucleus  

E-Print Network [OSTI]

The structure of the 18O nucleus at excitation energies above the alpha decay threshold was studied using 14C+alpha resonance elastic scattering. A number of states with large alpha reduced widths have been observed, indicating that the alpha-cluster degree of freedom plays an important role in this N not equal Z nucleus. However, the alpha-cluster structure of this nucleus is very different from the relatively simple pattern of strong alpha-cluster quasi-rotational bands in the neighboring 16O and 20Ne nuclei. A 0+ state with an alpha reduced width exceeding the single particle limit was identified at an excitation energy of 9.9+/-0.3 MeV. We discuss evidence that states of this kind are common in light nuclei and give possible explanations of this feature.

E. D. Johnson; G. V. Rogachev; V. Z. Goldberg; S. Brown; D. Robson; A. M. Crisp; P. D. Cottle; C. Fu; J. Giles; B. W. Green; K. W. Kemper; K. Lee; B. T. Roeder; R. E. Tribble

2009-06-19T23:59:59.000Z

294

Alpha decay from fission isomeric states  

Science Journals Connector (OSTI)

Alpha-decay half-lives from shape isomeric states of some even-even isotopes of U, Pu and Cm nuclei are calculated by using fission theory in the parametrisation of a spheroid intersected with a sphere. The potential barrier was calculated in the framework of the liquid-drop model of Myers and Swiatecki (1967) extended for systems with different charge densities; a phenomenological shell correction was introduced. The WKB computed lifetimes are many orders of magnitude longer than that of the spontaneous fission process, in agreement with experimental results.

D N Poenaru; M Ivascu

1981-01-01T23:59:59.000Z

295

Uranium-238 and thorium-232 series concentrations in soil, radon-222 indoor and drinking water concentrations and dose assessment in the city of Aldama, Chihuahua, Mexico  

Science Journals Connector (OSTI)

High-resolution gamma spectrometry was used to determine the concentration of 40K, 238U and 232Th series in soil samples taken from areas surrounding the city of Aldama, in Chihuahua. Results of indoor air short-time sampling, with diffusion barrier charcoal detectors, revealed relatively high indoor radon levels, ranging from 29 to 422 Bq/m3; the radon concentrations detected exceeded 148 Bq/m3 in 76% of the homes tested. Additionally, liquid scintillation counting showed concentrations of radon in drinking water ranging from 4.3 to 42 kBq/m3. The high activity of 238U in soil found in some places may be a result of the uranium milling process performed 20 years ago in the area. High radon concentrations indoor and in water may be explained by assuming the presence of uranium-bearing rocks underneath of the city, similar to a felsic dike located near Aldama. The estimated annual effective dose of gamma radiation from the soil and radon inhalation was 3.83 mSv.

L. Colmenero Sujo; M.E. Montero Cabrera; L. Villalba; M. Rentera Villalobos; E. Torres Moye; M. Garca Len; R. Garca-Tenorio; F. Mireles Garca; E.F. Herrera Peraza; D. Snchez Aroche

2004-01-01T23:59:59.000Z

296

Comparison of active and passive methods for radon exhalation from a highexposure building material  

Science Journals Connector (OSTI)

......Famagusta, North Cyprus, Mersin10, Turkey...is a radioactive gas, which has a half-life...ionising radiation from natural sources. This contribution...method To measure Rn gas, an AlphaGUARD model...Bq m3 for the Rn gas at workplaces(16...Photon attenuation, natural radioactivity content......

A. Abbasi; F. Mirekhtiary

2013-12-01T23:59:59.000Z

297

ARE RADON GAS MEASUREMENTS ADEQUATE FOR EPIDEMIOLOGICAL STUDIES AND CASE CONTROL  

E-Print Network [OSTI]

, 34000 Kragujevac Serbia and Montenegro 2 Department of Physics and Materials Science, City University the product of PAEC ? t, where PAEC is the potential alpha energy concentration (usually expressed. With this argument, it is asserted that the total radiation dose should be relatively constant and independent

Yu, K.N.

298

A Precise Determination of $\\alpha_s$ from the C-parameter Distribution  

E-Print Network [OSTI]

We present a global fit for $\\alpha_s(m_Z)$, analyzing the available C-parameter data measured at center-of-mass energies between $Q=35$ and $207$ GeV. The experimental data is compared to a N$^3$LL$^\\prime$ + $\\mathcal{O}(\\alpha_s^3)$ + $\\Omega_1$ theoretical prediction (up to the missing 4-loop cusp anomalous dimension), which includes power corrections coming from a field theoretical nonperturbative soft function. The dominant hadronic parameter is its first moment $\\Omega_1$, which is defined in a scheme which eliminates the $\\mathcal{O}(\\Lambda_{\\rm QCD})$ renormalon ambiguity. The resummation region plays a dominant role in the C-parameter spectrum, and in this region a fit for $\\alpha_s(m_Z)$ and $\\Omega_1$ is sufficient. We find $\\alpha_s(m_Z)=0.1123\\pm 0.0015$ and $\\Omega_1=0.421\\pm 0.063\\,{\\rm GeV}$ with $\\chi^2/\\rm{dof}=0.988$ for $404$ bins of data. These results agree with the prediction of universality for $\\Omega_1$ between thrust and C-parameter within 1-$\\sigma$.

Hoang, Andr H; Mateu, Vicent; Stewart, Iain W

2015-01-01T23:59:59.000Z

299

CRAD, Training - Oak Ridge National Laboratory TRU ALPHA LLWT Project |  

Broader source: Energy.gov (indexed) [DOE]

TRU ALPHA LLWT TRU ALPHA LLWT Project CRAD, Training - Oak Ridge National Laboratory TRU ALPHA LLWT Project November 2003 A section of Appendix C to DOE G 226.1-2 "Federal Line Management Oversight of Department of Energy Nuclear Facilities." Consists of Criteria Review and Approach Documents (CRADs) used for a November 2003 assessment of the Training Program portion of an Operational Readiness Review of the Oak Ridge National Laboratory TRU ALPHA LLWT Project. CRADs provide a recommended approach and the types of information to gather to assess elements of a DOE contractor's programs. CRAD, Training - Oak Ridge National Laboratory TRU ALPHA LLWT Project More Documents & Publications CRAD, Quality Assurance - Oak Ridge National Laboratory TRU ALPHA LLWT Project

300

Analysis of Gamma Radiation from a Radon Source: Indications of a Solar Influence  

E-Print Network [OSTI]

This article presents an analysis of about 29,000 measurements of gamma radiation associated with the decay of radon in a sealed container at the Geological Survey of Israel (GSI) Laboratory in Jerusalem between 28 January 2007 and 10 May 2010. These measurements exhibit strong variations in time of year and time of day, which may be due in part to environmental influences. However, time-series analysis reveals a number of periodicities, including two at approximately 11.2 year$^{-1}$ and 12.5 year$^{-1}$. We have previously found these oscillations in nuclear-decay data acquired at the Brookhaven National Laboratory (BNL) and at the Physikalisch-Technische Bundesanstalt (PTB), and we have suggested that these oscillations are attributable to some form of solar radiation that has its origin in the deep solar interior. A curious property of the GSI data is that the annual oscillation is much stronger in daytime data than in nighttime data, but the opposite is true for all other oscillations. This may be a systematic effect but, if it is not, this property should help narrow the theoretical options for the mechanism responsible for decay-rate variability.

Peter A. Sturrock; Gideon Steinitz; Ephraim Fischbach; Daniel Javorsek, II; Jere H. Jenkins

2012-05-01T23:59:59.000Z

Note: This page contains sample records for the topic "alpha excluding radon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

An investigation of radon release and mobility in the subsurface environment. Final project report  

SciTech Connect (OSTI)

Processes affecting transport of volatile species in the shallow soil column have recently been recognized as having a substantial impact on a broad array of real world problems. Investigations of volatile transport have ranged from studies of probable health impacts of radon infiltration into homes to pesticide and volatile organic contaminant mobility in the soil column. The objectives of many of these studies has been the development of numerical models of vapor phase (and solute) transport in shallow soils. An early model, LEACHM, developed by Hutson and Wagenent was recently modified enabling it to describe both solute and vapor phase transport of volatile chemicals in the soil. Subsequent tests of the latter model, named LEACHV, showed that use outside of a very restricted range of soil conditions resulted in large mass balance errors and unreasonable values for soil gas concentrations and vapor flux. The present research was undertaken in an effort to identify and correct the subroutines responsible for the problems and to allow the model to describe vapor phase transport in a much broader range of soil conditions.

Thomas, D.

1997-06-01T23:59:59.000Z

302

Catalyzing Alpha-Channeling by Minority Ion Injection in Mirror...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Maintaining fuel ions hotter than electrons would greatly facilitate controlled nuclear fusion. Alpha channeling is a technique that can potentially extract energy from fusion...

303

Alpha-particle optical potential proofs at astrophysically relevant energies  

E-Print Network [OSTI]

$(\\alpha,\\gamma)$ and $(\\alpha$,n) reaction cross sections recently measured close to the reaction thresholds are rather well described by a previously developed regional optical potential. Thus, particular features of the $\\alpha$-particle optical potential at energies below the Coulomb barrier, besides parameters describing $\\alpha$-particle elastic scattering at higher energies are confirmed. Additional limitations of similar statistical model calculations for minor reaction channels are shown to be most likely due to an overlooked process or critical values of statistical model parameters around closed nuclear shells.

M. Avrigeanu; V. Avrigeanu

2008-11-01T23:59:59.000Z

304

Guidelines Establishing Criteria for Excluding Buildings from the Energy Performance Requirements of Section 543 of the National Energy Conservation Policy Act as Amended by the Energy Policy Act of 2005  

Broader source: Energy.gov [DOE]

This document contains the Guidelines Establishing Criteria for Excluding Buildings from the Energy Performance Requirements of Section 543 of the National Energy Conservation Policy Act as Amended by the Energy Policy Act of 2005

305

Optical Counterparts to Damped Lyman Alpha Systems  

E-Print Network [OSTI]

Previously we have shown (Maller et al, 1998) that the kinematics of Damped Lyman Alpha Systems (DLAS) as measured by Prochaska and Wolfe (1998) can be reproduced in a multiple disk model (MDM) if the gaseous disks are of sufficient radial extent. Here we discuss this model's predictions for the relationship between DLAS and Lyman break galaxies (LBGs), which we here take to be objects at z~3 brighter than R=25.5. We expect that future observations of the correlations between DLAS and LBGs will provide a new data set able to discriminate between different theoretical models of the DLAS. Djorgovski (1997) has already detected a few optical counterparts and more studies are underway.

Ariyeh H. Maller; Jason X. Prochaska; Rachel S. Somerville; Joel R. Primack

2000-02-24T23:59:59.000Z

306

Jet Production in ep Collisions at Low Q^2 and Determination of $\\alpha_{s}$  

E-Print Network [OSTI]

The production of jets is studied in deep-inelastic e+p scattering at low negative four momentum transfer squared 5alpha_s.

Aaron, FD; Alexa, C; Andreev, V; Antunovic, B; Backovic, S; Baghdasaryan, A; Barrelet, E; Bartel, W; Begzsuren, K; Belousov, A; Bizot, J C; Boudry, V; Bozovic-Jelisavcic, I; Bracinik, J; Brandt, G; Brinkmann, M; Brisson, V; Bruncko, D; Bunyatyan, A; Buschhorn, G; Bystritskaya, L; Campbell, A J; Cantun Avila, K B; Cerny, K; Cerny, V; Chekelian, V; Cholewa, A; Contreras, J G; Coughlan, J A; Cozzika, G; Cvach, J; Dainton, J B; Daum, K; Deak, M; Delcourt, B; Delvax, J; De Wolf, E A; Diaconu, C; Dodonov, V; Dossanov, A; Dubak, A; Eckerlin, G; Efremenko, V; Egli, S; Eliseev, A; Elsen, E; Falkiewicz, A; Favart, L; Fedotov, A; Felst, R; Feltesse, J; Ferencei, J; Fischer, D J; Fleischer, M; Fomenko, A; Gabathuler, E; Gayler, J; Ghazaryan, Samvel; Glazov, A; Glushkov, I; Goerlich, L; Gogitidze, N; Gouzevitch, M; Grab, C; Greenshaw, T; Grell, B R; Grindhammer, G; Habib, S; Haidt, D; Helebrant, C; Henderson, R C W; Hennekemper, E; Henschel, H; Herbst, M; Herrera, G; Hildebrandt, M; Hiller, K H; Hoffmann, D; Horisberger, R; Hreus, T; Jacquet, M; Janssen, X; Jonsson, L; Jung, A W; Jung, H; Kapichine, M; Katzy, J; Kenyon, I R; Kiesling, C; Klein, M; Kleinwort, C; Kluge, T; Knutsson, A; Kogler, R; Kosior, E; Kostka, P; Kraemer, M; Krastev, K; Kretzschmar, J; Kropivnitskaya, A; Kruger, K; Kutak, K; Landon, M P J; Lange, W; Lastovicka-Medin, G; Laycock, P; Lebedev, A; Lendermann, V; Levonian, S; Li, G; Lipka, K; Liptaj, A; List, B; List, J; Loktionova, N; Lopez-Fernandez, R; Lubimov, V; Makankine, A; Malinovski, E; Marage, P; Marti, Ll; Martyn, H U; Maxfield, S J; Mehta, A; Meyer, A B; Meyer, H; Meyer, H; Meyer, J; Mikocki, S; Milcewicz-Mika, I; Moreau, F; Morozov, A; Morris, J V; Mozer, M U; Mudrinic, M; Muller, K; Murin, P; Naumann, Th; Newman, P R; Niebuhr, C; Nikiforov, A; Nikitin, D; Nowak, G; Nowak, K; Olsson, J E; Osman, S; Ozerov, D; Palichik, V; Panagoulias, I; Pandurovic, M; Papadopoulou, Th; Pascaud, C; Patel, G D; Pejchal, O; Perez, E; Petrukhin, A; Picuric, I; Piec, S; Pitzl, D; Placakyte, R; Pokorny, B; Polifka, R; Povh, B; Radescu, V; Rahmat, A J; Raicevic, N; Raspiareza, A; Ravdandorj, T; Reimer, P; Rizvi, E; Robmann, P; Roland, B; Roosen, R; Rostovtsev, A; Rotaru, M; Tabasco, J E Ruiz; Rusakov, S; Salek, D; Sankey, D P C; Sauter, M; Sauvan, E; Schmitt, S; Schoeffel, L; Schoning, A; Schultz-Coulon, H C; Sefkow, F; Shaw-West, R N; Shtarkov, L N; Shushkevich, S; Sloan, T; Smiljanic, Ivan; Soloviev, Y; Sopicki, P; South, D; Spaskov, V; Specka, A; Staykova, Z; Steder, M; Stella, B; Stoicea, G; Straumann, U; Sunar, D; Sykora, T; Tchoulakov, V; Thompson, G; Thompson, P D; Toll, T; Tomasz, F; Tran, T H; Traynor, D; Trinh, T N; Truol, P; Tsakov, I; Tseepeldorj, B; Turnau, J; Urban, K; Valkarova, A; Vallee, C; Van Mechelen, P; Trevino, A Vargas; Vazdik, Y; Vinokurova, S; Volchinski, V; von den Driesch, M; Wegener, D; Wissing, Ch; Wunsch, E; Zacek, J; Zalesak, J; Zhang, Z; Zhokin, A; Zimmermann, T; Zohrabyan, H; Zomer, F

2010-01-01T23:59:59.000Z

307

Escherichia coli produces a cytoplasmic alpha-amylase, AmyA.  

Science Journals Connector (OSTI)

...liquefying alpha-amylases of bacilli...digested amylose, starch, amylopectin, and maltodextrins...specific for the alpha-anomeric...an alpha-amylase rather than...digested amylose, starch, amylopectin, and maltodextrins...specific for the alpha-anomeric...an alpha-amylase rather than...

M Raha; I Kawagishi; V Mller; M Kihara; R M Macnab

1992-10-01T23:59:59.000Z

308

New Advances in Alpha-Beta Searching Jonathan Schaeffer  

E-Print Network [OSTI]

New Advances in Alpha-Beta Searching Jonathan Schaeffer Dept. of Computing Science Alpha-Beta has been the algorithm of choice for game-tree search for over three decades. Its suc- cess the search efficiency. Although state-of- the-art game-playing programs build trees that are close in size

Dumas, Jean-Guillaume

309

Elastic alpha scattering experiments and the alpha-nucleus optical potential at low energies  

E-Print Network [OSTI]

High precision angular distribution data of ($\\alpha$,$\\alpha$) elastic scattering are presented for the nuclei $^{89}$Y, $^{92}$Mo, $^{106,110,116}$Cd, $^{112,124}$Sn, and $^{144}$Sm at energies around the Coulomb barrier. Such data with small experimental uncertainties over the full angular range (20-170 degrees) are the indispensable prerequisite for the extraction of local optical potentials and for the determination of the total reaction cross section $\\sigma_{\\rm{reac}}$. A systematic fitting procedure was applied to the presented experimental scattering data to obtain comprehensive local potential parameter sets which are composed of a real folding potential and an imaginary potential of Woods-Saxon surface type. The obtained potential parameters were used in turn to construct a new systematic $\\alpha$-nucleus potential with very few parameters. Although this new potential cannot reproduce the angular distributions with the same small deviations as the local potential, the new potential is able to predict the total reaction cross sections for all cases under study.

P. Mohr; G. G. Kiss; Zs. Flp; D. Galaviz; Gy. Gyrky; E. Somorjai

2012-12-12T23:59:59.000Z

310

CRAD, Radiological Controls - Oak Ridge National Laboratory TRU ALPHA LLWT  

Broader source: Energy.gov (indexed) [DOE]

TRU TRU ALPHA LLWT Project CRAD, Radiological Controls - Oak Ridge National Laboratory TRU ALPHA LLWT Project November 2003 A section of Appendix C to DOE G 226.1-2 "Federal Line Management Oversight of Department of Energy Nuclear Facilities." Consists of Criteria Review and Approach Documents (CRADs) used for a November 2003 assessment of the Radiation Protection Program portion of an Operational Readiness Review of the Oak Ridge National Laboratory TRU ALPHA LLWT Project. CRADs provide a recommended approach and the types of information to gather to assess elements of a DOE contractor's programs. CRAD, Radiological Controls - Oak Ridge National Laboratory TRU ALPHA LLWT Project More Documents & Publications CRAD, Quality Assurance - Oak Ridge National Laboratory TRU ALPHA LLWT

311

CRAD, Quality Assurance - Oak Ridge National Laboratory TRU ALPHA LLWT  

Broader source: Energy.gov (indexed) [DOE]

Quality Assurance - Oak Ridge National Laboratory TRU ALPHA Quality Assurance - Oak Ridge National Laboratory TRU ALPHA LLWT Project CRAD, Quality Assurance - Oak Ridge National Laboratory TRU ALPHA LLWT Project November 2003 A section of Appendix C to DOE G 226.1-2 "Federal Line Management Oversight of Department of Energy Nuclear Facilities." Consists of Criteria Review and Approach Documents (CRADs) used for a November 2003 assessment of the Quality Assurance Program portion of an Operational Readiness Review of the Oak Ridge National Laboratory TRU ALPHA LLWT Project. CRADs provide a recommended approach and the types of information to gather to assess elements of a DOE contractor's programs. CRAD, Quality Assurance - Oak Ridge National Laboratory TRU ALPHA LLWT Project More Documents & Publications

312

The alpha-cluster model applied to {sup 96}Ru  

SciTech Connect (OSTI)

The states of {sup 96}Ru are investigated in terms of the a alpha+ core structure. The ground state band of the alpha+{sup 92}Mo system is obtained through a local cluster-core potential which includes a fixed set of parameters employed in other mass regions. The calculated spectrum gives a good general description of the experimental {sup 96}Ru levels. The reduced alpha-widths, B(E2) transition rates and rms intercluster separations are determined for the members of the ground state band. The results show that the model can reproduce the order of magnitude of the experimental B(E2) values without the use of effective charges and indicate that the first members of the ground state band present a stronger alpha-cluster character. Predictions concerning a negative parity band of the alpha+{sup 92}Mo system are also shown.

Souza, M. A.; Miyake, H. [Institute of Physics, Universidade de Sao Paulo, Sao Paulo-SP (Brazil)

2010-05-21T23:59:59.000Z

313

Antihydrogen Trapped in the ALPHA Experiment  

ScienceCinema (OSTI)

In 2010 the ALPHA collaboration succeeded in trapping antihydrogen atoms for the first time.[i] Stored antihydrogen promises to be a unique tool for making high precision measurements of the structure of this first anti-atom. Achieving this milestone presented several substantial experimental challenges and this talk will describe how they were overcome. The unique design features of the ALPHA apparatus will be explained.[ii] These allow a high intensity positron source and an antiproton imaging detector similar to the one used in the ATHENA[iii] experiment to be combined with an innovative magnet design of the anti-atom trap. This seeks to minimise the perturbations to trapped charged particles which may cause particle loss and heating[iv]. The diagnostic techniques used to measure the diameter, number, density, and temperatures of both plasmas will be presented as will the methods developed to actively compress and cool of both plasma species to sizes and temperatures [v],[vi], [vii] where trapping attempts with a reasonable chance of success can be tried. The results of the successful trapping experiments will be outlined as well as some subsequent experiments to improve the trapping rate and storage time. [i] 'Trapped antihydrogen' G.B. Andresen et al., Nature 468, 673 (2010) [ii]'A Magnetic Trap for Antihydrogen Confinement' W. Bertsche et al., Nucl. Instr. Meth. Phys. Res. A566, 746 (2006) [iii] Production and detection of cold antihydrogen atoms M.Amoretti et al., Nature 419, 456 (2002). [iv]' Antihydrogen formation dynamics in a multipolar neutral anti-atom trap' G.B. Andresen et al., Phys. Lett. B 685, 141 (2010) [v]' Evaporative Cooling of Antiprotons to Cryogenic Temperatures', G.B. Andresen et al. Phys. Rev. Lett 105, 013003 (2010) [vi]'Compression of Antiproton Clouds for Antihydrogen Trapping' G. B. Andresen et al. Phys. Rev. Lett 100, 203401 (2008) [vii] 'Autoresonant Excitation of Antiproton Plasmas' G.B. Andresen et al., Phys. Rev. Lett. 106, 025002 (2011) Organizer: Ferdinand Hahn PH/DT Detector Seminar webpage

None

2011-04-25T23:59:59.000Z

314

E-Print Network 3.0 - alpha gamma sur Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Johnson Alpha Delta Pi Summary: Marie Frappier - Rho Gamma Greek Man of the Year Jordan Fischette - Alpha Tau Omega Greek Professor... : Sigma Gamma Rho 3.13 PHC: Alpha Xi...

315

Thalamocortical Mechanisms for the Anteriorization of Alpha Rhythms during Propofol-Induced Unconsciousness  

E-Print Network [OSTI]

As humans are induced into a state of general anesthesia via propofol, the normal alpha rhythm (813 Hz) in the occipital cortex disappears and a frontal alpha rhythm emerges. This spatial shift in alpha activity is called ...

Vijayan, Sujith

316

Measurement of microbial alpha-amylases with p-nitrophenyl glycosides as the substrate complex.  

Science Journals Connector (OSTI)

...Starch is acted on by alpha-amylase to yield alpha-amylose plus amylopectin. This enzymatic hydrolysis...on straight-chain amylose than on branched amylopectin. Fur- thermore, the alpha-amylase is not thought to...

R W Trepeta; S C Edberg

1984-01-01T23:59:59.000Z

317

Computer program for the sensitivity calculation of a CR-39 detector in a diffusion chamber for radon measurements  

SciTech Connect (OSTI)

Computer software for calculation of the sensitivity of a CR-39 detector closed in a diffusion chamber to radon is described in this work. The software consists of two programs, both written in the standard Fortran 90 programming language. The physical background and a numerical example are given. Presented software is intended for numerous researches in radon measurement community. Previously published computer programs TRACK-TEST.F90 and TRACK-VISION.F90 [D. Nikezic and K. N. Yu, Comput. Phys. Commun. 174, 160 (2006); D. Nikezic and K. N. Yu, Comput. Phys. Commun. 178, 591 (2008)] are used here as subroutines to calculate the track parameters and to determine whether the track is visible or not, based on the incident angle, impact energy, etching conditions, gray level, and visibility criterion. The results obtained by the software, using five different V functions, were compared with the experimental data found in the literature. Application of two functions in this software reproduced experimental data very well, while other three gave lower sensitivity than experiment.

Nikezic, D., E-mail: nikezic@kg.ac.rs; Stajic, J. M. [Faculty of Science, University of Kragujevac, R. Domanovica 12, Kragujevac 34000 (Serbia)] [Faculty of Science, University of Kragujevac, R. Domanovica 12, Kragujevac 34000 (Serbia); Yu, K. N. [Department of Physics and Materials Science, City University of Hong Kong, 83 Tat Chee Avenue (Hong Kong)] [Department of Physics and Materials Science, City University of Hong Kong, 83 Tat Chee Avenue (Hong Kong)

2014-02-15T23:59:59.000Z

318

Rogers, V.C., K.K. Nielson, 1991, "Multiphase Radon Generation and Transport in Porous Minerals," Health Physics Vol. 60, No. 6, 807-813.  

E-Print Network [OSTI]

Radioactivity (TENR) Cause by Non-Uranium Mining, October 16-19, Szczyrk, Poland. Usman, S.S., H.Spitz, and J Limited presented at the Nuclear Regulatory Commission Uranium Recovery Licensing Workshop, January 11 to Monitor Radon Emissions from Uranium Tailings," Contract Number EP-D-05-002, Work Assignment No. 4

319

Estimation of dose contribution from 226Ra, 232Th and 40K radon exhalation rates in soil samples from Shivalik foot hills in India  

Science Journals Connector (OSTI)

......than the limit (370 Bq kg1) set in the 1979 Organization for Economic Co-operation and Development report. The calculated values...of radon exhalation rate and estimation of radiation doses in coal and fly ash samples. Appl. Radiat. Isot. (2008) 66:401-406......

R. P. Chauhan; Pooja Chauhan; Anil Pundir; Sunil Kamboj; Vakul Bansal; R. S. Saini

2014-01-01T23:59:59.000Z

320

The atmospheric reactivity of. alpha. -methyltetrahydrofuran  

SciTech Connect (OSTI)

Biomass-derived {alpha}-methyltetrahydrofuran (MTHF) has been proposed as an automotive fuel additive. Since MTHF is a volatile organic compound, the environmental impact of evaporation to the atmosphere needs to be considered. The major loss process of MTHF in the atmosphere is expected to occur via reaction with hydroxyl radical; hence we have conducted a study of the kinetics of the reaction OH + MTHF {yields} products using both absolute (flash photolysis resonance fluorescence) and relative rate techniques. The absolute rate experiments were performed over the temperature range 240-400 K at total pressures of 35 Torr (4.7 kPa) argon; the relative rate experiments were conducted at 295 K in 740 Torr (99 kPa) synthetic air. The results from both techniques were in good agreement and yield k{sub 1} = (2.52 {plus minus} 0.74) {times} 10{sup {minus}12} exp-((650 {plus minus} 80)/T) cm{sup 3} molecule{sup {minus}1} s{sup {minus}1}, with k{sub 1} (298 K) = 2.2 {times} 10{sup {minus}11} cm{sup 3} molecule{sup {minus}1}. The implications of these results for the atmospheric chemistry of MTHF are discussed.

Wallington, T.J.; Siegl, W.O. (Ford Motor Company, Dearborn, MI (USA)); Liu, Renzhang; Zhang, Zhengyu; Huie, R.E.; Kurylo, M.J. (National Institute of Standards and Technology, Gaithersburg, MD (USA))

1990-10-01T23:59:59.000Z

Note: This page contains sample records for the topic "alpha excluding radon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

E-Print Network 3.0 - alpha particle emission Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

(or, positron-- the anti-particle to the beta-- emission) or alpha particle... Different types of radiation (alpha, beta, gammas, and neutrons) have different ways in which they...

322

E-Print Network 3.0 - alpha -bungarotoxin binding Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Limited Keywords: binding sites; protein structure; geometry; alpha... CPA, 4CPA, 5CPA, alpha-amylase 6TAA) their ... Source: Engelman, Donald M.- Department of Molecular...

323

Thick-Target Neutron Yield from the 19F(alpha,n) Reaction  

E-Print Network [OSTI]

Thick-target neutron yields from the 19F(alpha,n) reaction are reported for E(alpha) = 3.5 - 10.0 MeV.

E. B. Norman; T. E. Chupp; K. T. Lesko; G. L. Woodruff; P. J. Grant

2014-11-01T23:59:59.000Z

324

E-Print Network 3.0 - alpha particle energy Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

to mirror machines can benefit this concept by efficiently redirecting alpha particle energy... -transverse wave propagation. As a result, modes suitable for alpha particle...

325

E-Print Network 3.0 - alpha particle effects Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

to mirror machines can benefit this concept by efficiently redirecting alpha particle energy... -transverse wave propagation. As a result, modes suitable for alpha particle...

326

Sensitive Immunoassay of a Biomarker TumorNecrosis Factor-[alpha...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Biomarker TumorNecrosis Factor-alpha Based on Poly(guanine)-Functionalized Silica Nanoparticle Sensitive Immunoassay of a Biomarker TumorNecrosis Factor-alpha Based on...

327

Thick-Target Neutron Yield from the 19F(alpha,n) Reaction  

E-Print Network [OSTI]

Thick-target neutron yields from the 19F(alpha,n) reaction are reported for E(alpha) = 3.5 - 10.0 MeV.

Norman, E B; Lesko, K T; Woodruff, G L; Grant, P J

2014-01-01T23:59:59.000Z

328

E-Print Network 3.0 - alpha2-adrenoceptor antagonists studied...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Physiology & Behavior (2002) 76... . amic alpha1 and alpha2adrenoceptors and food intake in rats. 39. Dglucose 40. 41... nervous system in the regulation of these ......

329

E-Print Network 3.0 - alpha fetoprotein radioimmunoassay Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

test Alpha-fetoprotein (AFP), Estriol, h... , Benefits for Alpha-Fetoprotein IV Screening Test, Benefits for Treatment of Genetic Errors of Metabolism Source: Lammers, Peter J. -...

330

E-Print Network 3.0 - alpha reactions Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

resulting from... radioactive decay of the release an alpha particle from its parent isotope (e.g., alpha decay ... Source: Yucca Mountain Project, US EPA Collection:...

331

Generating long streams of $1/f^alpha$ noise  

E-Print Network [OSTI]

We review existing methods for generating long streams of 1/f^alpha noise ($0generator (white outside some bounds) in order to generate very long streams of noise without an exhaustive computer memory load. For $\\alpha=2$ it is shown why the process is equivalent to a random-walk and can be obtained simply by a first order filtering of white noise. As soon as $\\alphagenerators with $\\alpha>2$. The software is available from http://planck.lal.in2p3.fr/article.php3?id\\_article=8

S. Plaszczynski

2005-10-04T23:59:59.000Z

332

Non-resonant triple alpha reaction rate at low temperature  

SciTech Connect (OSTI)

Our experimental goal is to study the non-resonant triple alpha reaction rate at low temperture (T < 10{sup 8} K). The {sup 13}C(p,d) reaction at 66 MeV has been used to probe the alpha-unbound continuum state in {sup 12}C just below the 2{sup nd} 0{sup +} state at 7.65 MeV. The transition strength to the continuum state is predicted to be sensitive to the non-resonant triple alpha reaction rate. The experiment has been performed at iThemba LABS. We report the present status of the experiment.

Itoh, T.; Tamii, A.; Aoi, N.; Fujita, H.; Hashimoto, T.; Miki, K.; Ogata, K. [Research Center for Nuclear Physics, Osaka University, Ibaraki, Osaka 567-0047 (Japan); Carter, J.; Donaldson, L.; Sideras-Haddad, E. [Schools of Physics, University of Witwatersrand, Johannesburg 2050 (South Africa); Furuno, T.; Kawabata, T. [Departments of Physics, Kyoto University, Sakyo, Kyoto, 606-8502 (Japan); Kamimura, M. [RIKEN Nishina Center, Wako, Saitama, 351-0198 (Japan); Nemulodi, F.; Neveling, R.; Smit, F. D.; Swarts, C. [iThemba Laboratory for Accelerator Based Sciences Somerset, West, 7129 (South Africa)

2014-05-02T23:59:59.000Z

333

Methods of Using Alpha Channeling Together with Transformer Recharging |  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Methods of Using Alpha Channeling Together with Transformer Recharging Methods of Using Alpha Channeling Together with Transformer Recharging A tokamak current can be sustained using rf waves for transformer recharging at low density and high-Z with high efficiency if the resistivity is kept high enough during the radio frequency recharging stage. At the same time, operation in the hot ion mode via alpha channeling increases the effective fusion reactivity. The two separate inventions can be made to work synergistically. Specifically, by operating the tokamak in a low-density recharge phase, the lower hybrid wave penetrates the plasma more effectively. High reactivity is obtained by operation in the hot ion mode through the alpha channeling technique. Then, by using a high temperature relaxation stage, not only is the plasma current sustained

334

City of Alpha, Minnesota (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Alpha, Minnesota (Utility Company) Alpha, Minnesota (Utility Company) Jump to: navigation, search Name City of Alpha Place Minnesota Utility Id 266 Utility Location Yes Ownership M NERC Location MRO Activity Bundled Services Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Commercial Residential Residential Average Rates Residential: $0.0758/kWh Commercial: $0.0957/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=City_of_Alpha,_Minnesota_(Utility_Company)&oldid=409261" Categories:

335

Energetics of [alpha]-helix formation in peptides and proteins  

E-Print Network [OSTI]

This thesis focuses on the energetics of !-helix formation in peptides and proteins. The [alpha]-helix is the most prevalent type of secondary structure found in proteins, and has arguably dominated our thinking about ...

Schubert, Christian Reinhold

2009-01-01T23:59:59.000Z

336

Use of S-. alpha. diagram for representing tokamak equilibrium  

SciTech Connect (OSTI)

A use of the S-{alpha} diagram is proposed as a tool for representing the plasma equilibrium with a qualitative characterization of its stability through pattern recognition. The diagram is an effective tool for visually presenting the relationship between the shear and dimensionless pressure gradient of an equilibrium. In the PBX-M tokamak, an H-mode operating regime with high poloidal {beta} and L-mode regime with high toroidal {beta}, obtained using different profile modification techniques, are found to have distinct S-{alpha} trajectory patterns. Pellet injection into a plasma in the H-mode regime with high toroidal {beta}, obtained using different profile modification techniques, are found to have distinct S-{alpha} trajectory patterns. Pellet injection into a plasma in the H-mode regime results in favorable qualities of both regimes. The {beta} collapse process and ELM event also manifest themselves as characteristic changes in the S-{alpha} pattern.

Takahashi, H.; Chance, M.; Kessel, C.; LeBlanc, B.; Manickam, J.; Okabayashi, M.

1991-05-01T23:59:59.000Z

337

The use of radon (Rn-222) and volatile organic compounds in monitoring soil gas to localize NAPL contamination at a gas station in Rio Claro, So Paulo State, Brazil  

Science Journals Connector (OSTI)

Abstract This study focuses on the presence of radon (222Rn) and volatile organic compounds (VOCs) in soil gases at a gas station located in the city of Rio Claro, So Paulo, Brazil, where a fossil fuel leak occurred. The spatial distribution results show a correlation between 222Rn and VOCs, consistent with the fact that radon gas has a greater chemical affinity with organic phases than with water. This finding demonstrates that the presence of a residual hydrocarbon phase in an aquifer can retain radon, leading to a reduced radon content in the soil gas. The data in this study confirm the results of previous investigations, in which the method used in this study provided a preliminary fingerprint of a contaminated area. Furthermore, the data analysis time is brief, and only simple equipment is required.

E.Q. Barbosa; J.A. Galhardi; D.M. Bonotto

2014-01-01T23:59:59.000Z

338

Quantum Monte Carlo calculations of neutron-alpha scattering  

E-Print Network [OSTI]

We describe a new method to treat low-energy scattering problems in few-nucleon systems, and we apply it to the five-body case of neutron-alpha scattering. The method allows precise calculations of low-lying resonances and their widths. We find that a good three-nucleon interaction is crucial to obtain an accurate description of neutron-alpha scattering.

Kenneth M. Nollett; Steven C. Pieper; R. B. Wiringa; J. Carlson; G. M. Hale

2006-12-09T23:59:59.000Z

339

Characterization of salivary alpha-amylase binding to Streptococcus sanguis  

SciTech Connect (OSTI)

The purpose of this study was to identify the major salivary components which interact with oral bacteria and to determine the mechanism(s) responsible for their binding to the bacterial surface. Strains of Streptococcus sanguis, Streptococcus mitis, Streptococcus mutans, and Actinomyces viscosus were incubated for 2 h in freshly collected human submandibular-sublingual saliva (HSMSL) or parotid saliva (HPS), and bound salivary components were eluted with 2% sodium dodecyl sulfate. By sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western transfer, alpha-amylase was the prominent salivary component eluted from S. sanguis. Studies with {sup 125}I-labeled HSMSL or {sup 125}I-labeled HPS also demonstrated a component with an electrophoretic mobility identical to that of alpha-amylase which bound to S. sanguis. Purified alpha-amylase from human parotid saliva was radiolabeled and found to bind to strains of S. sanguis genotypes 1 and 3 and S. mitis genotype 2, but not to strains of other species of oral bacteria. Binding of ({sup 125}I)alpha-amylase to streptococci was saturable, calcium independent, and inhibitable by excess unlabeled alpha-amylases from a variety of sources, but not by secretory immunoglobulin A and the proline-rich glycoprotein from HPS. Reduced and alkylated alpha-amylase lost enzymatic and bacterial binding activities. Binding was inhibited by incubation with maltotriose, maltooligosaccharides, limit dextrins, and starch.

Scannapieco, F.A.; Bergey, E.J.; Reddy, M.S.; Levine, M.J. (State Univ. of New York, Buffalo (USA))

1989-09-01T23:59:59.000Z

340

Norepinephrine infusion with and without alpha-adrenergic blockade by phentolamine increases salivary alpha amylase in healthy men  

Science Journals Connector (OSTI)

AbstractBackground Mental stress reliably induces increases in salivary alpha amylase (sAA), a suggested surrogate marker for sympathetic nervous system (SNS) reactivity. While stress-induced sAA increases correlate with norepinephrine (NE) secretion, a potential mediating role of noradrenergic mechanisms remains unclear. In this study, we investigated for the first time in humans whether a NE-stress-reactivity mimicking NE-infusion with and without alpha-adrenergic blockade by phentolamine would induce changes in sAA. Methods In a single-blind placebo-controlled within-subjects design, 21 healthy men (2966 years) took part in three different experimental trials varying in terms of substance infusion with a 1-min first infusion followed by a 15-min second infusion: saline-infusion (trial-1), NE-infusion (5?g/min) without alpha-adrenergic blockade (trial-2), and with phentolamine-induced non-selective blockade of alpha1- and alpha2-adrenergic receptors (trial-3). Saliva samples were collected immediately before, during, and several times after substance infusion in addition to blood pressure and heart rate readings. Results Experimental trials significantly differed in sAA reactivity to substance-infusion (p=.001) with higher sAA reactivity following NE-infusion with (trial-3; p=.001) and without alpha-adrenergic-blockade (trial-2; p=.004) as compared to placebo-infusion (trial-1); sAA infusion reactivity did not differ between trial-2 and trial-3 (p=.29). Effective phentolamine application was verified by blood pressure and heart rate infusion reactivity. Salivary cortisol was not affected by NE, either with or without alpha-adrenergic-blockade. Conclusions We found that NE-infusion stimulates sAA secretion, regardless of co-administered non-selective alpha-adrenergic blockade by phentolamine, suggesting that the mechanism underlying stress-induced sAA increases may involve NE.

Ulrike Kuebler; Roland von Knel; Nadja Heimgartner; Claudia Zuccarella-Hackl; Guido Stirnimann; Ulrike Ehlert; Petra H. Wirtz

2014-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "alpha excluding radon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Purification and characterization of the extracellular alpha-amylase from Streptococcus bovis JB1.  

Science Journals Connector (OSTI)

...alpha-amylase. alpha-Amylase activity on...active on amylopectin as on amylose. The major...extracellular alpha-amylase from Streptococcus...active on amylopectin as on amylose. The major...2.1.1 alpha-Amylases | Amino Acid...

S N Freer

1993-05-01T23:59:59.000Z

342

the International Civil Aviation Organization (ICAO) adopted a resolution that not only accepted a long-term strat-egy for reducing emissions but also excluded language intended to prevent unilateral application of EU legislation  

E-Print Network [OSTI]

of atmospheric pollution, airliners cross many borders and fly through many regula- tory jurisdictions a long-term strat- egy for reducing emissions but also excluded language intended to prevent unilateral-standing disagreement between in- dustrialized and developing countries about preventing climate change. Secondly

Sibille, Etienne

343

{open_quotes}Radon{close_quotes} - the system of Soviet designed regional waste management facilities  

SciTech Connect (OSTI)

The Soviet Union established a system of specialized regional facilities to dispose of radioactive waste generated by sources other than the nuclear fuel cycle. The system had 16 facilities in Russia, 5 in Ukraine, one in each of the other CIS states, and one in each of the Baltic Republics. These facilities are still being used. The major generators of radioactive waste they process these are research and industrial organizations, medical and agricultural institution and other activities not related to nuclear power. Waste handled by these facilities is mainly beta- and gamma-emitting nuclides with half lives of less than 30 years. The long-lived and alpha-emitting isotopic content is insignificant. Most of the radwaste has low and medium radioactivity levels. The facilities also handle spent radiation sources, which are highly radioactive and contain 95-98 percent of the activity of all the radwaste buried at these facilities.

Horak, W.C.; Reisman, A.; Purvis, E.E. III

1997-07-01T23:59:59.000Z

344

Jet Production in ep Collisions at High $Q^2$ and Determination of $\\alpha_s$  

E-Print Network [OSTI]

The production of jets is studied in deep-inelastic ep scattering at large negative four momentum transfer squared 150alpha_s(M_Z) = 0.1168 +/-0.0007 (exp.) +0.0046/-0.0030 (th.) +/-0.0016(pdf).

Aaron, FD; Alimujiang, K; Andreev, V; Antunovic, B; Asmone, A; Backovic, S; Baghdasaryan, A; Barrelet, E; Bartel, W; Begzsuren, K; Belousov, A; Bizot, J C; Boudry, V; Bozovic-Jelisavcic, I; Bracinik, J; Brandt, G; Brinkmann, M; Brisson, V; Bruncko, D; Bunyatyan, A; Buschhorn, G; Bystritskaya, L; Campbell, A J; Cantun Avila, K B; Cassol-Brunner, F; Cerny, K; Cerny, V; Chekelian, V; Cholewa, A; Contreras, J G; Coughlan, J A; Cozzika, G; Cvach, J; Dainton, J B; Daum, K; Deak, M; de Boer, Y; Delcourt, B; Del Degan, M; Delvax, J; De Roeck, A; De Wolf, E A; Diaconu, C; Dodonov, V; Dossanov, A; Dubak, A; Eckerlin, G; Efremenko, V; Egli, S; Eliseev, A; Elsen, E; Falkiewicz, A; Faulkner, P J W; Favart, L; Fedotov, A; Felst, R; Feltesse, J; Ferencei, J; Fischer, D -J; Fleischer, M; Fomenko, A; Gabathuler, E; Gayler, J; Ghazaryan, Samvel; Glazov, A; Glushkov, I; Goerlich, L; Gogitidze, N; Gouzevitch, M; Grab, C; Greenshaw, T; Grell, B R; Grindhammer, G; Habib, S; Haidt, D; Helebrant, C; Henderson, R C W; Hennekemper, E; Henschel, H; Herbst, M; Herrera, G; Hildebrandt, M; Hiller, K H; Hoffmann, D; Horisberger, R; Hreus, T; Jacquet, M; Janssen, M E; Janssen, X; Jemanov, V; Jonsson, L; Jung, Andreas Werner; Jung, H; Kapichine, M; Katzy, J; Kenyon, I R; Kiesling, C; Klein, M; Kleinwort, C; Kluge, T; Knutsson, A; Kogler, R; Korbel, V; Kostka, P; Kraemer, M; Krastev, K; Kretzschmar, J; Kropivnitskaya, A; Kruger, K; Kutak, K; Landon, M P J; Lange, W; Lastovicka-Medin, G; Laycock, P; Lebedev, A; Leibenguth, G; Lendermann, V; Levonian, S; Li, G; Lipka, K; Liptaj, A; List, B; List, J; Loktionova, N; Lopez-Fernandez, R; Lubimov, V; Lytkin, L; Makankine, A; Malinovski, E; Marage, P; Marti, Ll; Martyn, H -U; Maxfield, S J; Mehta, A; Meyer, A B; Meyer, H; Meyer, H; Meyer, J; Michels, V; Mikocki, S; Milcewicz-Mika, I; Moreau, F; Morozov, A; Morris, J V; Mozer, Matthias Ulrich; Mudrinic, M; Muller, K; Murin, P; Naroska, B; Naumann, Th; Newman, P R; Niebuhr, C; Nikiforov, A; Nowak, G; Nowak, K; Nozicka, M; Olivier, B; Olsson, J E; Osman, S; Ozerov, D; Palichik, V; Panagoulias, I; Pandurovic, M; Papadopoulou, Th; Pascaud, C; Patel, G D; Pejchal, O; Perez, E; Petrukhin, A; Picuric, I; Piec, S; Pitzl, D; Placakyte, R; Pokorny, B; Polifka, R; Povh, B; Preda, T; Radescu, V; Rahmat, A J; Raicevic, N; Raspiareza, A; Ravdandorj, T; Reimer, P; Rizvi, E; Robmann, P; Roland, B; Roosen, R; Rostovtsev, A; Rotaru, M; Ruiz Tabasco, J E; Rurikova, Z; Rusakov, S; Salek, D; Sankey, D P C; Sauter, M; Sauvan, E; Schmitt, S; Schmitz, C; Schoeffel, L; Schoning, A; Schultz-Coulon, H -C; Sefkow, F; Shaw-West, R N; Sheviakov, I; Shtarkov, L N; Shushkevich, S; Sloan, T; Smiljanic, Ivan; Soloviev, Y; Sopicki, P; South, D; Spaskov, V; Specka, Arnd E; Staykova, Z; Steder, M; Stella, B; Stoicea, G; Straumann, U; Sunar, D; Sykora, T; Tchoulakov, V; Thompson, G; Thompson, P D; Toll, T; Tomasz, F; Tran, T H; Traynor, D; Trinh, T N; Truol, P; Tsakov, I; Tseepeldorj, B; Turnau, J; Urban, K; Valkarova, A; Vallee, C; Van Mechelen, P; Vargas Trevino, A; Vazdik, Y; Vinokurova, S; Volchinski, V; von den Driesch, M; Wegener, D; Wissing, Ch; Wunsch, E; Zacek, J; Zalesak, J; Zhang, Z; Zhokin, A; Zimmermann, T; Zohrabyan, H; Zomer, F; Zus, R

2010-01-01T23:59:59.000Z

345

Calibration constant of Alpha track detector-polycarbonate film, CAPFILM PC  

E-Print Network [OSTI]

parameters for LR-1 15 11 were found to be with 2.5 N NaOH for 145 minutes at 60 C (Vasudevan 1991). Both LR-1 15 and CAPFILM PC were simultaneously exposed in the radon exposure chamber which was connected to a barrel containing uranium ore. The exposed film...

Chung, Isaac Young

2012-06-07T23:59:59.000Z

346

E-Print Network 3.0 - alpha rara gene Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

found, some of the genes present... the classification, we excluded from Vijver's dataset all samples that presented mutations in the ... Source: Moscato, Pablo - Newcastle...

347

3alpha clustering in the excited states of 16C  

E-Print Network [OSTI]

The alpha cluster states of 16C are investigated by using the antisymmetrized molecular dynamics. It is shown that two different types of alpha cluster states exist: triangular and linear-chain states. The former has an approximate isosceles triangular configuration of alpha particles surrounded by four valence neutrons occupying sd-shell, while the latter has the linearly aligned alpha particles with two sd-shell neutrons and two pf-shell neutrons. It is found that the structure of the linear-chain state is qualitatively understood in terms of the 3/2 pi- and 1/2 sigma- molecular orbit as predicted by molecular-orbital model, but there exists non-negligible Be+alpha+2n correlation. The band-head energies of the triangular and linear-chain rotational bands are 8.0 and 15.5 MeV, and the latter is close to the He+Be threshold energy. It is also shown that the linear-chain state becomes the yrast sstate at J=10 with excitation energy 27.8 MeV owing to its very large moment-of-inertia comparable with hyperdeformation.

T. Baba; Y. Chiba; M. Kimura

2014-10-03T23:59:59.000Z

348

Understanding Partition Coefficient, Kd, Values Volume II: Review of Geochemistry and Available Kd Values for Cadmium, Cesium, Chromium, Lead, Plutonium, Radon, Strontium, Thorium, Tritium (3H), and Uranium  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Air and Radiation Air and Radiation EPA 402-R-99-004B Environmental Protection August 1999 Agency UNDERSTANDING VARIATION IN PARTITION COEFFICIENT, K d , VALUES Volume II: Review of Geochemistry and Available K d Values for Cadmium, Cesium, Chromium, Lead, Plutonium, Radon, Strontium, Thorium, Tritium ( 3 H), and Uranium UNDERSTANDING VARIATION IN PARTITION COEFFICIENT, K d , VALUES Volume II: Review of Geochemistry and Available K d Values for Cadmium, Cesium, Chromium, Lead, Plutonium, Radon, Strontium, Thorium, Tritium ( 3 H), and Uranium August 1999 A Cooperative Effort By: Office of Radiation and Indoor Air Office of Solid Waste and Emergency Response U.S. Environmental Protection Agency Washington, DC 20460 Office of Environmental Restoration U.S. Department of Energy Washington, DC 20585

349

int. j. radiat. biol 2002, vol. 78, no. 7, 593 604 Do low dose-rate bystander eVects in uence domestic radon risks?  

E-Print Network [OSTI]

int. j. radiat. biol 2002, vol. 78, no. 7, 593± 604 Do low dose-rate bystander eVects in uence that bystander radon risk estimation. eVects can be induced by high-LET radiation even Conclusions : Bystander e of inverse dose-rate eVects by high- exposed to low doses of low-LET radiation (SawantLET radiation

Brenner, David Jonathan

350

Ly-alpha emission from GRB host galaxies  

E-Print Network [OSTI]

Ly-alpha emission is indicative of on-going star formation in a dust-poor environment. Ly-alpha imaging is therefore a probe of the star formation rate and of the dust-content of Gamma-Ray Burst host galaxies. Both of these parameters are central to our understanding of GRB progenitors and of how the environments affect the propagation of afterglow emission out of host galaxies. We have started a program aimed at imaging high redshift (z>2) host galaxies of GRBs at the Ly-alpha resonance line from neutral hydrogen. Here were report the results from imaging of the fields of GRB 000301C and GRB 000926 and outline upcoming observations of further hosts.

J. P. U. Fynbo; P. Moller; B. Thomsen; J. Hjorth; J. Gorosabel; M. I. Andersen; M. P. Egholm; S. Holland; B. L Jensen; H. Pedersen; M. Weidinger

2003-01-13T23:59:59.000Z

351

Continuous air monitor for alpha-emitting aerosol particles  

SciTech Connect (OSTI)

A new alpha Continuous Air Monitor (CAM) sampler is being developed for use in detecting the presence of alpha-emitting aerosol particles. The effort involves design, fabrication and evaluation of systems for the collection of aerosol and for the processing of data to speciate and quantify the alpha emitters of interest. At the present time we have a prototype of the aerosol sampling system and we have performed wind tunnel tests to characterize the performance of the device for different particle sizes, wind speeds, flow rates and internal design parameters. The results presented herein deal with the aerosol sampling aspects of the new CAM sampler. Work on the data processing, display and alarm functions is being done in parallel with the particle sampling work and will be reported separately at a later date. 17 refs., 5 figs., 3 tabs.

McFarland, A.R.; Ortiz, C.A. (Texas A and M Univ., College Station, TX (USA). Dept. of Mechanical Engineering); Rodgers, J.C.; Nelson, D.C. (Los Alamos National Lab., NM (USA))

1990-01-01T23:59:59.000Z

352

Indirect Measurements for (p,{alpha}) Reactions Involving Boron Isotopes  

SciTech Connect (OSTI)

Light elements lithium, beryllium and boron (LiBeB) were used in the last years as 'possible probe' for a deeper understanding of some extra-mixing phenomena occurring in young Main-Sequence stars. They are mainly destroyed by (p,{alpha}) reactions and cross section measurements for such channels are then needed. The Trojan Horse Method (THM) allows one to extract the astrophysical S(E)-factor without the experience of tunneling through the Coulomb barrier. In this work a resume of the recent results about the {sup 11}B(p,{alpha}{sub 0}){sup 8}Be and {sup 10}B(p,{alpha}){sup 7}Be reactions is shown.

Lamia, L.; Spitaleri, C.; Romano, S.; Cherubini, S.; Crucilla, V.; Gulino, M.; La Cognata, M.; Pizzone, R. G.; Puglia, S. M. R.; Sergi, M. L.; Tudisco, S.; Tumino, A. [Laboratori Nazionali del Sud, Catania (Italy); Dipartimento di Metodologie Fisiche e Chimiche per l'Ingegneria, Universita di Catania, Catania (Italy); Carlin, N.; Szanto, M. G. del; Liguori Neto, R.; Moura, M. M. de; Munhoz, M. G.; Souza, F. A.; Suaide, A. A. P.; Szanto, E. [Departamento de Fisica Nuclear, Universitade de Sao Paulo, Sao Paulo (Brazil)] (and others)

2008-04-06T23:59:59.000Z

353

Automated docking of {alpha}-(1,4)- and {alpha}-(1,6)-linked glucosyl trisaccharides in the glucoamylase active site  

SciTech Connect (OSTI)

Low-energy conformers of five {alpha}-(1,4)- and {alpha}-(1,6)-linked glucosyl trisaccharides were flexibly docked into the glucoamylase active site using AutoDock 2.2. To ensure that all significant conformational space was searched, the starting trisaccharide conformers for docking were all possible combinations of the corresponding disaccharide low-energy conformers. All docked trisaccharides occupied subsites {minus}1 and +1 in very similar modes to those of corresponding nonreducing-end disaccharides. For linear substrates, full binding at subsite +2 occurred only when the substrate reducing end was {alpha}-(1,4)-linked, with hydrogen-bonding with the hydroxy-methyl group being the only polar interaction there. Given the absence of other important interactions at this subsite, multiple substrate conformations are allowed. For the one docked branched substrate, steric hindrance in the {alpha}-(1,6)-glycosidic oxygen suggests that the active-site residues have to change position for hydrolysis to occur. Subsite +1 of the glucoamylase active site allows flexibility in binding but, at least in Aspergillus glucoamylases, subsite +2 selectively binds substrates {alpha}-(1,4)-linked between subsites +1 and +2. Enzyme engineering to limit substrate flexibility at subsite +2 could improve glucoamylase industrial properties.

Countinho, P.M.; Reilly, P.J. [Iowa State Univ., Ames, IA (United States). Dept. of Chemical Engineering; Dowd, M.K. [Dept. of Agriculture, New Orleans, LA (United States). Southern Regional Research Center

1998-06-01T23:59:59.000Z

354

Study of the Pygmy Dipole Resonance in {sup 124}Sn by means of the ({alpha},{alpha}'{gamma}) reaction  

SciTech Connect (OSTI)

In recent years {alpha}-{gamma} coincidence experiments at 136 MeV incident energy on {sup 48}Ca, {sup 140}Ce, {sup 138}Ba and {sup 124}Sn were performed at the KVI in Groningen to study the isospin character of electric dipole excitations below the particle threshold, frequently called Pygmy Dipole Resonance (PDR). An array of HPGe {gamma}-detectors has been used in coincidence with the Big-Bite Spectrometer (BBS) and a resolution of about 10 keV in the {gamma}-ray energy has been achieved. The results show that the excitation patterns of the PDR in the ({alpha},{alpha}') reaction seem to differ significantly from results obtained in Nuclear Resonance Fluorescence (NRF)({gamma},{gamma}') measurements. The PDR, which until now has been assigned to one excitation mode, splits up into two parts: One that is excited in ({alpha},{alpha}'{gamma}) and ({gamma},{gamma}') reactions (denoting a dominant isoscalar character), and one that is only excited in ({gamma},{gamma}')(denoting a dominant isovector character). This indicates that two different excitation mechanisms produce these low-lying E1 excitations [1], The preliminary results of the latest measurements on the N = 82 nucleus {sup 138}Ba and the Z = 50 nucleus {sup 124}Sn show that this break up into two parts is a common feature of the PDR in semi-magic nuclei.

Endres, J.; Zilges, A. [Institut fuer Kernphysik, Universitaet zu Koeln (Germany); Pietralla, N.; Savran, D.; Sonnabend, K. [Institut fuer Kernphysik, TU Darmstadt (Germany); Harakeh, M. N.; Stoica, V.; Woertche, H. [Kernfysisch Versneller Instituut, University of Groningen (Netherlands); Butler, P.; Herzberg, R. D.; Scheck, M. [Department of Physics, University of Liverpool (United Kingdom); Kruecken, R. [Physik-Department E12, TU Muenchen (Germany); Popescu, L. [SCK-CEN, Mol (Belgium); Harissopulos, S.; Lagoyannis, A. [I.N.P. NCSR Demokritos, Athens (Greece)

2009-01-28T23:59:59.000Z

355

Inclusive-jet photoproduction at HERA and determination of alphas  

E-Print Network [OSTI]

Inclusive-jet cross sections have been measured in the reaction ep->e+jet+X for photon virtuality Q2 energies in the region 142 energy, ETjet, and pseudorapidity, etajet, for jets with ETjet > 17 GeV and -1 energy-scale dependence of the coupling was determined. The value of alphas(Mz) extracted from the measurements based on the kT jet algorithm is alphas(Mz) = 0.1206 +0.0023 -0.0022 (exp.) +0.0042 -0.0035 (th.); the results from the anti-kT and SIScone algorithms are compatible with this value and have a similar precision.

ZEUS Collaboration; H. Abramowicz; I. Abt; L. Adamczyk; M. Adamus; R. Aggarwal; S. Antonelli; P. Antonioli; A. Antonov; M. Arneodo; V. Aushev; Y. Aushev; O. Bachynska; A. Bamberger; A. N. Barakbaev; G. Barbagli; G. Bari; F. Barreiro; N. Bartosik; D. Bartsch; M. Basile; O. Behnke; J. Behr; U. Behrens; L. Bellagamba; A. Bertolin; S. Bhadra; M. Bindi; C. Blohm; V. Bokhonov; T. Bold; K. Bondarenko; E. G. Boos; K. Borras; D. Boscherini; D. Bot; I. Brock; E. Brownson; R. Brugnera; N. Brummer; A. Bruni; G. Bruni; B. Brzozowska; P. J. Bussey; B. Bylsma; A. Caldwell; M. Capua; R. Carlin; C. D. Catterall; S. Chekanov; J. Chwastowski; J. Ciborowski; R. Ciesielski; L. Cifarelli; F. Cindolo; A. Contin; A. M. Cooper-Sarkar; N. Coppola; M. Corradi; F. Corriveau; M. Costa; G. D'Agostini; F. Dal Corso; J. del Peso; R. K. Dementiev; S. De Pasquale; M. Derrick; R. C. E. Devenish; D. Dobur; B. A. Dolgoshein; G. Dolinska; A. T. Doyle; V. Drugakov; L. S. Durkin; S. Dusini; Y. Eisenberg; P. F. Ermolov; A. Eskreys; S. Fang; S. Fazio; J. Ferrando; M. I. Ferrero; J. Figiel; M. Forrest; B. Foster; G. Gach; A. Galas; E. Gallo; A. Garfagnini; A. Geiser; I. Gialas; A. Gizhko; L. K. Gladilin; D. Gladkov; C. Glasman; O. Gogota; Yu. A. Golubkov; P. Gottlicher; I. Grabowska-Bold; J. Grebenyuk; I. Gregor; G. Grigorescu; G. Grzelak; O. Gueta; M. Guzik; C. Gwenlan; T. Haas; W. Hain; R. Hamatsu; J. C. Hart; H. Hartmann; G. Hartner; E. Hilger; D. Hochman; R. Hori; K. Horton; A. Huttmann; Z. A. Ibrahim; Y. Iga; R. Ingbir; M. Ishitsuka; H. -P. Jakob; F. Januschek; T. W. Jones; M. Jungst; I. Kadenko; B. Kahle; S. Kananov; T. Kanno; U. Karshon; F. Karstens; I. I. Katkov; M. Kaur; P. Kaur; A. Keramidas; L. A. Khein; J. Y. Kim; D. Kisielewska; S. Kitamura; R. Klanner; U. Klein; E. Koffeman; N. Kondrashova; O. Kononeko; P. Kooijman; Ie. Korol; I. A. Korzhavina; A. Kotanski; U. Kotz; H. Kowalski; O. Kuprash; M. Kuze; A. Lee; B. B. Levchenko; A. Levy; V. Libov; S. Limentani; T. Y. Ling; M. Lisovyi; E. Lobodzinska; W. Lohmann; B. Lohr; E. Lohrmann; K. R. Long; A. Longhin; D. Lontkovskyi; O. Yu. Lukina; J. Maeda; S. Magill; I. Makarenko; J. Malka; R. Mankel; A. Margotti; G. Marini; J. F. Martin; A. Mastroberardino; M. C. K. Mattingly; I. -A. Melzer-Pellmann; S. Mergelmeyer; S. Miglioranzi; F. Mohamad Idris; V. Monaco; A. Montanari; J. D. Morris; K. Mujkic; B. Musgrave; K. Nagano; T. Namsoo; R. Nania; A. Nigro; Y. Ning; T. Nobe; U. Noor; D. Notz; R. J. Nowak; A. E. Nuncio-Quiroz; B. Y. Oh; N. Okazaki; K. Oliver; K. Olkiewicz; Yu. Onishchuk; K. Papageorgiu; A. Parenti; E. Paul; J. M. Pawlak; B. Pawlik; P. G. Pelfer; A. Pellegrino; W. Perlanski; H. Perrey; K. Piotrzkowski; P. Plucinski; N. S. Pokrovskiy; A. Polini; A. S. Proskuryakov; M. Przybycien; A. Raval; D. D. Reeder; B. Reisert; Z. Ren; J. Repond; Y. D. Ri; A. Robertson; P. Roloff; I. Rubinsky; M. Ruspa; R. Sacchi; U. Samson; G. Sartorelli; A. A. Savin; D. H. Saxon; M. Schioppa; S. Schlenstedt; P. Schleper; W. B. Schmidke; U. Schneekloth; V. Schonberg; T. Schorner-Sadenius; J. Schwartz; F. Sciulli; L. M. Shcheglova; R. Shehzadi; S. Shimizu; I. Singh; I. O. Skillicorn; W. Slominski; W. H. Smith; V. Sola; A. Solano; D. Son; V. Sosnovtsev; A. Spiridonov; H. Stadie; L. Stanco; N. Stefaniuk; A. Stern; T. P. Stewart; A. Stifutkin; P. Stopa; S. Suchkov; G. Susinno; L. Suszycki; J. Sztuk-Dambietz; D. Szuba; J. Szuba; A. D. Tapper; E. Tassi; J. Terron; T. Theedt; H. Tiecke; K. Tokushuku; J. Tomaszewska; V. Trusov; T. Tsurugai; M. Turcato; O. Turkot; T. Tymieniecka; M. Vazquez; A. Verbytskyi; O. Viazlo; N. N. Vlasov; R. Walczak; W. A. T. Wan Abdullah; J. J. Whitmore; L. Wiggers; M. Wing; M. Wlasenko; G. Wolf; H. Wolfe; K. Wrona; A. G. Yagues-Molina; S. Yamada; Y. Yamazaki; R. Yoshida; C. Youngman; O. Zabiegalov; A. F. Zarnecki; L. Zawiejski; O. Zenaiev; W. Zeuner; B. O. Zhautykov; N. Zhmak; C. Zhou; A. Zichichi; Z. Zolkapli; D. S. Zotkin

2012-05-28T23:59:59.000Z

356

Taking the Band Function Too Far: A Tale of Two $\\alpha$'s  

E-Print Network [OSTI]

The long standing problem of identifying the emission mechanism operating in gamma-ray bursts (GRBs) has produced a myriad of possible models that have the potential of explaining the observations. Generally, the empirical Band function is fit to the observed gamma-ray data and the fit parameters are used to infer which radiative mechanisms are at work in GRB outflows. In particular, the distribution of the Band function's low-energy power law index, $\\alpha$, has led to the so-called synchrotron "line-of-death" (LOD) which is a statement that the distribution cannot be explained by the simplest of synchrotron models alone. As an alternatively fitting model, a combination of a blackbody in addition to the Band function is used, which in many cases provide a better or equally good fit. It has been suggested that such fits would be able to alleviate the LOD problem for synchrotron emission in GRBs. However, these conclusions rely on the Band function's ability to fit a synchrotron spectrum within the observed e...

Burgess, J Michael; Yu, Hoi-Fung

2014-01-01T23:59:59.000Z

357

Guidelines Establishing Criteria for Excluding Buildings from the Energy Performance Requirements of Section 543 of the National Energy Conservation Policy Act as Amended by the Energy Policy Act of 2005  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Guidelines Establishing Criteria for Excluding Buildings Guidelines Establishing Criteria for Excluding Buildings from the Energy Performance Requirements of Section 543 of the National Energy Conservation Policy Act as Amended by the Energy Policy Act of 2005 January 27, 2006 These guidelines and accompanying criteria fulfill the requirement under Section 543(c)(3) of the National Energy Conservation Policy Act (NECPA) as amended by the Energy Policy Act of 2005 (EPACT). Section 543(c)(3) states that the Secretary of Energy shall issue guidelines that establish criteria for exclusions from the energy performance requirement for a fiscal year, any Federal building or collection of Federal buildings, within the statutory framework provided by the law. The purpose of these guidelines is to clarify and explicate, as necessary, the statutory

358

Guidelines Establishing Criteria for Excluding Buildings from the Energy Performance Requirements of Section 543 of the National Energy Conservation Policy Act as Amended by the Energy Policy Act of 2005  

Broader source: Energy.gov (indexed) [DOE]

Guidelines Establishing Criteria for Excluding Buildings Guidelines Establishing Criteria for Excluding Buildings from the Energy Performance Requirements of Section 543 of the National Energy Conservation Policy Act as Amended by the Energy Policy Act of 2005 January 27, 2006 These guidelines and accompanying criteria fulfill the requirement under Section 543(c)(3) of the National Energy Conservation Policy Act (NECPA) as amended by the Energy Policy Act of 2005 (EPACT). Section 543(c)(3) states that the Secretary of Energy shall issue guidelines that establish criteria for exclusions from the energy performance requirement for a fiscal year, any Federal building or collection of Federal buildings, within the statutory framework provided by the law. The purpose of these guidelines is to clarify and explicate, as necessary, the statutory

359

Chapter Advisor E-mail Alpha Delta Pi Courtney O'Neill-Chapter Advisor courtneyoneill2004@yahoo.com  

E-Print Network [OSTI]

Chapter Advisor E-mail Alpha Delta Pi Courtney O'Neill- Chapter Advisor courtneyoneill2004@yahoo.com Alpha Delta Pi Kendra Stewart-On Campus stewartk@cofc.edu Alpha Epsilon Pi Alex Green - Chapter Advisor Magwood- Chapater Advisor graymag7@bellsouth.net Alpha Kappa Alpha Debbie Counts-On-Campus countsd

Kunkle, Tom

360

Young alpha-enriched giant stars in the solar neighbourhood  

E-Print Network [OSTI]

We derive age constraints for 1639 red giants in the APOKASC sample for which seismic parameters from Kepler, as well as effective temperatures, metallicities and [{\\alpha}/Fe] values from APOGEE DR12 are available. We investigate the relation between age and chemical abundances for these stars, using a simple and robust approach to obtain ages. We first derive stellar masses using standard seismic scaling relations, then determine the maximum possible age for each star as function of its mass and metallicity, independently of its evolutionary stage. While the overall trend between maximum age and chemical abundances is a declining fraction of young stars with increasing [{\\alpha}/Fe], at least 14 out of 241 stars with [{\\alpha}/Fe]>0.13 are younger than 6 Gyr. Five stars with [{\\alpha}/Fe]>0.2 have ages below 4 Gyr. We examine the effect of modifications in the standard seismic scaling relations, as well as the effect of very low helium fractions, but these changes are not enough to make these stars as old a...

Martig, Marie; Aguirre, Victor Silva; Hekker, Saskia; Mosser, Benoit; Elsworth, Yvonne; Bovy, Jo; Stello, Dennis; Anders, Friedrich; Garca, Rafael A; Tayar, Jamie; Rodrigues, Thase S; Basu, Sarbani; Carrera, Ricardo; Ceillier, Tugdual; Chaplin, William J; Chiappini, Cristina; Frinchaboy, Peter M; Garca-Hernndez, D A; Hearty, Fred R; Holtzman, Jon; Johnson, Jennifer A; Mathur, Savita; Mszros, Szabolcs; Miglio, Andrea; Nidever, David; Pinsonneault, Marc; Schiavon, Ricardo P; Schneider, Donald P; Serenelli, Aldo; Shetrone, Matthew; Zamora, Olga

2014-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "alpha excluding radon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Zinc oxide nanoparticles as novel alpha-amylase inhibitors  

Science Journals Connector (OSTI)

Amylase inhibitors also known as starch blockers contain substances that prevent dietary starches from being absorbed by the body via inhibiting breakdown of complex sugars to simpler ones. In this sense these materials are projected as having potential applications in diabetes control. In this context we report on zinc oxide nanoparticles as possible alpha-amylase inhibitors. Zinc oxide nanoparticles have been synthesized using soft-chemistry approach and 1-thioglycerol was used as a surfactant to yield polycrystalline nanoparticles of size ? 18 ? nm stabilized in wurtzite structure. Conjugation study and structural characterization have been done using x-ray diffraction technique Fourier transform infrared spectroscopy UV-visible spectroscopy and transmission electron microscopy. Cytotoxicity studies on human fibrosarcoma (HT-1080) and skin carcinoma (A-431) cell lines as well as mouse primary fibroblast cells demonstrate that up to a dose of 20 ? ? g / ml ZnOnanoparticles are nontoxic to the cells. We report for the first time the alpha-amylase inhibitory activity of ZnOnanoparticles wherein an optimum dose of 20 ? ? g / ml was sufficient to exhibit 49% glucose inhibition at neutral p H and 35 ? C temperature. This inhibitory activity was similar to that obtained with acarbose (a standard alpha-amylase inhibitor) thereby projecting ZnOnanoparticles as novel alpha-amylase inhibitors.

Sandip Dhobale; Trupti Thite; S. L. Laware; C. V. Rode; Soumya J. Koppikar; Ruchika-Kaul Ghanekar; S. N. Kale

2008-01-01T23:59:59.000Z

362

CRAD, Management- Oak Ridge National Laboratory TRU ALPHA LLWT Project  

Broader source: Energy.gov [DOE]

A section of Appendix C to DOE G 226.1-2 "Federal Line Management Oversight of Department of Energy Nuclear Facilities." Consists of Criteria Review and Approach Documents (CRADs) used for a November 2003 assessment of the Management Program portion of an Operational Readiness Review of the Oak Ridge National Laboratory TRU ALPHA LLWT Project.

363

THE TWO REGIMES OF PHOTOSPHERIC MOTIONS IN {alpha} HYDRA  

SciTech Connect (OSTI)

High-resolution spectroscopic observations of {alpha} Hya were acquired between 2003 and 2010. Analysis of line shifts, differential shifts, line widths, and line bisectors points to two regimes of velocity fields in the photosphere of {alpha} Hya: (1) normal granulation embedded in (2) large convection cells. Variations occur on a wide range of timescales, from several years on down. Radial velocity variations, which are irregular and span 786 m s{sup -1}, have a distribution consistent with a true mean rise velocity of the large cells of {approx}725 m s{sup -1} and a dispersion of {approx}220 m s{sup -1}. The distribution of granulation velocities, as measured from the widths of spectral lines, shows only small variations, consistent with the two regime concepts. On the multi-year timescale, radial velocity changes, small temperature variations ({approx}10 K), and small line-width variations ({approx}<0.8%) track each other, possibly with phase shifts. The granulation velocity gradient for {alpha} Hya is about half as large as the Sun's and no variation with time was seen, implying that any variation in velocity gradient from one large cell to the next must be less than a few percent. The asymmetry in the granulation velocity distribution, as specified in the flux deficit, is smaller than expected for {alpha} Hya's position in the HR diagram and appears to be variable.

Gray, David F., E-mail: dfgray@uwo.ca [Department of Physics and Astronomy, University of Western Ontario, London, Ontario N6A 3K7 (Canada)

2013-02-10T23:59:59.000Z

364

The coronal Ne/O abundance of alpha Centauri  

E-Print Network [OSTI]

Recent improvements in the modeling of solar convection and line formation led to downward revisions of the solar photospheric abundances of the lighter elements, which in turn led to changes in the radiative opacity of the solar interior and hence to conflicts with the solar convection zone depth as inferred from helioseismic oscillation frequencies. An increase of the solar Ne/O abundance to values as observed for nearby stars has been proposed as a solution. Because of the absence of strong neon lines in the optical, neon abundances are difficult to measure and the correct solar and stellar Ne/O abundances are currently hotly debated. Based on X-ray spectra obtained with XMM-Newton, we determine a reference value of Ne/O for the inactive, solar-like star alpha Cen (primarily alpha Cen B, which is the dominant component in X-rays), with three independent, line-based methods, using differential emission measure reconstruction and an emission measure-independent method. Our results indicate a value of approx. 0.28 for Ne/O in alpha Cen, approximately twice the value measured for the Sun, but still below the average value obtained for other stars. The low Ne/O abundance of the Sun is peculiar when compared to alpha Cen and other stars; our results emphasize the necessity to obtain more and accurate Ne/O abundance measurements of low activity stars.

C. Liefke; J. H. M. M. Schmitt

2006-09-01T23:59:59.000Z

365

Physics of alpha channelling and related TFTR experiments  

E-Print Network [OSTI]

Physics of alpha channelling and related TFTR experiments N.J. Fisch Princeton Plasma Physics in magnetic fusion research centred on attaining plasmas close to thermonuclear condi- tions. Of particular interest was the heating of the plasma to thermonuclear temperatures, say, to at least 10 ke

366

Preparation of {alpha},{beta}-unsaturated carboxylic acids and esters  

DOE Patents [OSTI]

Disclosed is a process for the preparation of {alpha},{beta}-unsaturated carboxylic acids and esters thereof which comprises contacting formaldehyde or a source of formaldehyde with a carboxylic acid, ester or anhydride in the presence of a catalyst comprising an oxide of niobium.

Gogate, M.R.; Spivey, J.J.; Zoeller, J.R.

1998-09-15T23:59:59.000Z

367

Probing Alpha-Vacua of Black Holes in LHC  

E-Print Network [OSTI]

Motivated by the idea of alpha-vacua in Schwarzschild spacetime, we studied the deformed spectrum of Hawking radiation. Such a deformation would leave signatures on the small black hole evaporation in LHC because their vacuum deviates from the Unruh state.

Tower Wang

2007-04-18T23:59:59.000Z

368

Preparation of NIF Scale Poly ((alpha)-METHYLSTYRENE) Mandrels  

SciTech Connect (OSTI)

All planned National Ignition Facility (NIF) capsule targets except machined beryllium require a plastic mandrel upon which the ablator is applied. This mandrel must at least meet if not exceed the symmetry and surface finish requirements of the final capsule. The mandrels are produced by a two-step process. In the first step a thin-walled poly({alpha}-methylstyrene)(P{alpha}MS) shell is produced using microencapsulation techniques. This shell is overcoated with 10 to 15 {micro}m of glow discharge polymer (GDP) and then pyrolyzed at 300 C. This pyrolysis causes the P{alpha}MS to depolymerize to gas phase monomer that diffuses away through the more thermally stable plasma polymer shell, which retains all the symmetry of the original P{alpha}MS shell. Thus our challenge has been to produce 2-mm-diameter P{alpha}MS shells to serve as these initial ''decomposable'' mandrels that meet or exceed the current NIF design specifications. The basic microencapsulation process used in producing P{alpha}MS mandrels involves using a droplet generator to produce a water droplet (Wl) encapsulated by a fluorobenzene solution of P{alpha}MS (O), this compound droplet being suspended in a stirred aqueous bath (W2). Historically this bath has contained poly(vinyl alcohol) (PVA, 88% hydrolyzed, mol. wt. {approx}25,000 g/mol) to prevent agglomeration of the initially fluid compound droplets. As the compound droplets are stirred in the bath, the fluorobenzene solvent slowly dissipates leaving a solid P{alpha}MS shell. The internal water is subsequently removed by low temperature drying. We found using these techniques that 2-mm shells could easily be produced, however their low mode sphericity did not meet design specifications. In our last published report we detailed how replacement of the PVA with poly(acrylic acid) (PAA) resulted in a major improvement in sphericity due to a greatly increased interfacial tension between the bath and the compound droplet, relative to the use of PVA as the bath additive. P{alpha}MS mandrels produced using PAA in the bath along with slow curing to suppress Marangoni convection that was perturbing the mode 10 to 20 symmetry resulted in 2-mm-diameter P{alpha}MS shells with mode 2 out-of-round{sup 10} (OOR) of {approx}0.5 {micro}m (as well as non-concentricity (NC) < 1%) which meet the capsule design requirements. A representative set of equatorial traces produced by our AFM-based Spheremapper along with the computed power spectrum is shown in Figure 1 for an average shell. Although the power spectrum is at or below the design specification at nearly all modes one can see in the traces some degree of roughness which manifests itself at the very high modes in the power spectrum.

Takagi, M; Cook, R; McQuillan, B; Elsner, F; Stephens, R; Nikroo, A; Paguio, S

2002-06-07T23:59:59.000Z

369

ESTABLISHING {alpha} Oph AS A PROTOTYPE ROTATOR: IMPROVED ASTROMETRIC ORBIT  

SciTech Connect (OSTI)

The nearby star {alpha} Oph (Ras Alhague) is a rapidly rotating A5IV star spinning at {approx} 89% of its breakup velocity. This system has been imaged extensively by interferometric techniques, giving a precise geometric model of the star's oblateness and the resulting temperature variation on the stellar surface. Fortuitously, {alpha} Oph has a previously known stellar companion, and characterization of the orbit provides an independent, dynamically based check of both the host star and the companion mass. Such measurements are crucial to constrain models of such rapidly rotating stars. In this study, we combine eight years of adaptive optics imaging data from the Palomar, AEOS, and CFHT telescopes to derive an improved, astrometric characterization of the companion orbit. We also use photometry from these observations to derive a model-based estimate of the companion mass. A fit was performed on the photocenter motion of this system to extract a component mass ratio. We find masses of 2.40{sup +0.23}{sub -0.37} M{sub sun} and 0.85{sup +0.06}{sub -0.04} M{sub sun} for {alpha} Oph A and {alpha} Oph B, respectively. Previous orbital studies of this system found a mass too high for this system, inconsistent with stellar evolutionary calculations. Our measurements of the host star mass are more consistent with these evolutionary calculations, but with slightly higher uncertainties. In addition to the dynamically derived masses, we use IJHK photometry to derive a model-based mass for {alpha} Oph B, of 0.77 {+-} 0.05 M{sub sun} marginally consistent with the dynamical masses derived from our orbit. Our model fits predict a periastron passage on 2012 April 19, with the two components having a 50 mas separation from 2012 March to May. A modest amount of interferometric and radial velocity data during this period could provide a mass determination of this star at the few percent level.

Hinkley, Sasha; Hillenbrand, Lynne; Crepp, Justin R. [Department of Astronomy, California Institute of Technology, 1200 E. California Blvd., MC 249-17, Pasadena, CA 91125 (United States); Monnier, John D. [Astronomy Department, University of Michigan, 941 Dennison Bldg., Ann Arbor, MI 48109-1090 (United States); Oppenheimer, Ben R.; Brenner, Douglas; Sivaramakrishnan, Anand [Astrophysics Department, American Museum of Natural History, Central Park West at 79th Street, New York, NY 10024 (United States); Roberts, Lewis C. Jr; Zhao Ming; Vasisht, Gautam; Pueyo, Laurent [Jet Propulsion Laboratory, California Institute of Technology, 4800 Oak Grove Dr., Pasadena, CA 91109 (United States); Ireland, Michael [School of Physics, University of Sydney, NSW 2006 (Australia); Zimmerman, Neil [Department of Astronomy, Columbia University, 550 West 120th Street, New York, NY 10027 (United States); Parry, Ian R. [Institute of Astronomy, University of Cambridge, Madingley Road, Cambridge CB3 0HA (United Kingdom); Martinache, Frantz [National Astronomical Observatory of Japan, Subaru Telescope, Hilo, HI 96720 (United States); Lai, Olivier [CFHT Corp., 65-1238 Mamalahoa Hwy., Kamuela, HI 96743 (United States); Soummer, Remi [STScI, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Beichman, Charles [NASA Exoplanet Science Institute, California Institute of Technology, Pasadena, CA 91125 (United States); Lloyd, James P.; Bernat, David [Department of Astronomy, Cornell University, Ithaca, NY 14853 (United States)

2011-01-10T23:59:59.000Z

370

E-Print Network 3.0 - alpha particle driven Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

A275A283. Printed in the UK PII: S0741-3335(97)81172-4 Alpha-particle physics in the tokamak fusion test reactor Summary: . 5. Alpha-particle instabilities A search for the...

371

Trans-chalcone: a novel small molecule inhibitor of mammalian alpha-amylase  

Science Journals Connector (OSTI)

Trans...-chalcone (1,3-diphenyl-2-propen-1-one), a biphenolic core structure of flavonoids precursor was tested for inhibitory activity toward alpha-amylase. Porcine pancreatic alpha-amylase was ...

Mahmoud Najafian; Azadeh Ebrahim-Habibi; Nastaran Hezareh

2011-03-01T23:59:59.000Z

372

E-Print Network 3.0 - alpha 1-adrenoceptor binding Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of alpha-methyl d-glucopyranoside. Biochem J 109... binding site in hog pancreatic alpha-amylase. Biochemistry 15, 1987-93. 57 Sevilla, N., Steer, M. L... ., Helmreich, E....

373

Characterization and molecular cloning of thermostable alpha-amylase from Streptomyces sp.To1  

Science Journals Connector (OSTI)

A new thermophilic Streptomyces...sp. TO1, isolated from Tunisian soil, produced a thermostable alpha-amylase and pullulanase. The gene encoding for the alpha-amylase activity was cloned into the multicopy clonin...

Lotfi Mellouli; Raoudha Ghorbel; Alya Kammoun; Monia Mezghani

1996-07-01T23:59:59.000Z

374

Determination of alpha-amylase activity in dextran, ficoll and polyethylene glycol solutions  

Science Journals Connector (OSTI)

A new insoluble chromolytic substrate for the spectrophotometric determination of alpha-amylase activity (starch cross-linked with 1,4 ... phase-forming polymers interfere with some commonly used alpha-amylase as...

Ivo afa?k; Miroslava afa?kov

375

E-Print Network 3.0 - alpha inhibits growth Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Miller,W., and Lipman,D.J. (1997) Summary: of the inhibition of alpha-glucosidase, alpha-amylase, and cyclomaltodextrin glucanosyltransferase by acarbose... ,W., Tanguy,M.,...

376

EIS-0305: Treating Transuranic (TRU)/Alpha Low-Level at the Oak...  

Broader source: Energy.gov (indexed) [DOE]

05: Treating Transuranic (TRU)Alpha Low-Level at the Oak Ridge National Laboratory, Oak Ridge, Tennessee EIS-0305: Treating Transuranic (TRU)Alpha Low-Level at the Oak Ridge...

377

EIS-0305: Treating Transuranic (TRU)/Alpha Low-Level at the Oak...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

305: Treating Transuranic (TRU)Alpha Low-Level at the Oak Ridge National Laboratory, Oak Ridge, Tennessee EIS-0305: Treating Transuranic (TRU)Alpha Low-Level at the Oak Ridge...

378

E-Print Network 3.0 - alpha pparalpha protects Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

GTTTTGCTTTCTCAGATCTT GGC P h PPAR-alpha... G 6.83 1.21 + L15702 Complement factor B CFB 4.45 1.18 + X01683 Alpha-1-antitrypsin SERPINA1 2... identifies the NF-kappa...

379

E-Print Network 3.0 - acid receptor alpha Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

alpha Page: << < 1 2 3 4 5 > >> 1 List of Abbreviations Acknowledgments Summary: jejunum LCA lithocholic acid LRH-1 liver receptor homolog-1 LXR liver X receptor alpha MeOH...

380

E-Print Network 3.0 - alpha particle loss Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

results for: alpha particle loss Page: << < 1 2 3 4 5 > >> 1 Plasma Phys. Control. Fusion 39 (1997) A275A283. Printed in the UK PII: S0741-3335(97)81172-4 Alpha-particle...

Note: This page contains sample records for the topic "alpha excluding radon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

E-Print Network 3.0 - alpha particle analysis Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

results for: alpha particle analysis Page: << < 1 2 3 4 5 > >> 1 Plasma Phys. Control. Fusion 39 (1997) A275A283. Printed in the UK PII: S0741-3335(97)81172-4 Alpha-particle...

382

Purification and characterization of periplasmic alpha-amylase from Xanthomonas campestris K-11151.  

Science Journals Connector (OSTI)

...9005-82-7 Amylose 9037-22-3 Amylopectin 9057-02-7...3.2.1.1 alpha-Amylases EC 3.2.1...cyclomaltodextrinase | Amylopectin metabolism Amylose metabolism Cell...purification alpha-Amylases isolation & purification...

J Abe; N Onitsuka; T Nakano; Y Shibata; S Hizukuri; E Entani

1994-06-01T23:59:59.000Z

383

ON THE SOURCES OF CARBON FOR THE INDUCED BIOSYNTHESIS OF ALPHA-AMYLASE IN PSEUDOMONAS SACCHAROPHILA  

Science Journals Connector (OSTI)

...induced biosynthesis of alpha-amylase in Pseudomonas saccharophila...INDUCED BIOSYNTHESIS OF ALPHA-AMYLASE IN PSEUDOMONAS SACCHAROPHILA...proteins of E. coli do not break down to their constituent...amylase synthesis by starch, P. saccharophila also...

Alvin Markovitz; Harold P. Klein

1955-12-01T23:59:59.000Z

384

Recovery Cleanup Project at Y-12 Leaves Alpha 5 with an Empty...  

National Nuclear Security Administration (NNSA)

Office NPO News Releases Recovery Cleanup Project at Y-12 Leaves Alpha ... Recovery Cleanup Project at Y-12 Leaves Alpha 5 with an Empty Feeling applicationmsword icon R-10-21...

385

E-Print Network 3.0 - alpha centauri binary Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

the south later on. Crux the Southern Cross, with Beta and Alpha Centauri... than the sun. It is the fourth brightest star in the sky after Sirius, Canopus and Alpha Centauri....

386

E-Print Network 3.0 - alpha energy measurements Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

2) in front of two different detectors for alpha spectroscopy. At first, an energy measurement... L-97 On the evidence of high-energy alpha emitters (E 10.6 MeV) in monazite D....

387

E-Print Network 3.0 - alpha line profile Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

fusion test reactor Summary: -particle confinement and thermalization (solid and dashed lines). The alphas near their birth energy of 3.5 MeV can... of the alpha-energy spectrum...

388

E-Print Network 3.0 - alpha particle spectroscopy Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

and Isotopes 59 (2003) 363-366 Comparison among alpha-particle energy losses... July 2003 Abstract In the present work, we compare the alpha-particle energy losses in air...

389

E-Print Network 3.0 - alpha-decay recoil products Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Summary: .A., Sherriff, B.L., Fleet, M.E., McCammon, C., 1991. Alpha-decay damage in titanite: American Mineralogist, 76... , G.R., Ewing, R.C., 1988. Alpha decay damage in...

390

Morphological characterization of recombinant strains of Aspergillus oryzae producing alpha-amylase during batch cultivations  

Science Journals Connector (OSTI)

Three alpha-amylase producing strains of Aspergillus oryzae used for ... dense mycelium is more efficient in producing ?-amylase.

Anders Spohr; Morten Carlsen; Jens Nielsen; John Villadsen

1997-01-01T23:59:59.000Z

391

Attention-modulated Alpha-band Oscillations Protect against Intrusion of Irrelevant Information  

E-Print Network [OSTI]

after a cue to attend to that hand, but shows in- creased power after a cue to attend to the foot alpha power. However, the alpha-band modulation was not simply locked to the cue offset. The tem- poral in the sequence, peri- stimulus alpha power predicted the degree to which that irrel- evant stimulus distorted

Sekuler, Robert

392

Words number: 25491 Assessment of salivary alpha-amylase -a stress biomarker -in2  

E-Print Network [OSTI]

1 Words number: 25491 Assessment of salivary alpha-amylase - a stress biomarker - in2 pregnant patients.3 4 Running tittle: Salivary alpha-amylase: a stress biomarker in pregnant patients5 6 Jean, Psychological5 Saliva6 Salivary alpha-Amylases7 Caesarean Section8 9 10 inserm-00847842,version1-24Jul2013 #12

Boyer, Edmond

393

alpha-amylase and Glucose Oxidase as Promising Improvers for Wheat Bread  

Science Journals Connector (OSTI)

The effects of alpha-amylase and glucose oxidase as bread improvers on the textural and thermal properties of bread were evaluated by the rapid viscosity analysis and differential scanning calorimetry. It was found that alpha-amylase and glucose oxidase ... Keywords: alpha-amylase, Glucose oxidase, viscosity, Bread quality

Jie Zeng; Haiyan Gao; Guanglei Li; Xinhong Liang

2011-04-01T23:59:59.000Z

394

The Roles of Testosterone and Alpha-Amylase in Exercise-Induced Sexual Arousal in Women  

E-Print Network [OSTI]

The Roles of Testosterone and Alpha-Amylase in Exercise-Induced Sexual Arousal in Women Lisa Dawn EA, and Meston CM. The roles of testosterone and alpha-amylase in exercise-induced sexual arousal; Alpha-Amylase Introduction Dynamic, cardiovascular exercise has many well-documented health benefits

Meston, Cindy

395

Purification and some properties of an extracellular alpha-amylase from Bacteroides amylophilus.  

Science Journals Connector (OSTI)

...characteristic of alpha-type amylases. The relative...hydrolysis of amylose, soluble starch, amylopectin, and dextrin...characteristic of alpha-type amylases. The relative...hydrolysis of amylose, soluble starch, amylopectin, and dextrin...metabolism Amylopectin metabolism Amylose metabolism...Extracellular Alpha- Amylase from Bacteroides...

S J McWethy; P A Hartman

1977-03-01T23:59:59.000Z

396

Measurement of the CKM angle alpha with the B-factories  

E-Print Network [OSTI]

B-meson decays involving b->u transitions are sensitive to the Unitarity Triangle angle alpha (or phi_2). The B-factories at SLAC and KEK have made significant progress toward the measurement of alpha in recent years. This paper summarizes the results of the B-factories' constraints on alpha.

A. Bevan

2005-12-20T23:59:59.000Z

397

Direct study of the alpha-nucleus optical potential at astrophysical energies using the 64Zn(p,alpha)61Cu reaction  

E-Print Network [OSTI]

In the model calculations of heavy element nucleosynthesis processes the nuclear reaction rates are taken from statistical model calculations which utilize various nuclear input parameters. It is found that in the case of reactions involving alpha particles the calculations bear a high uncertainty owing to the largely unknown low energy alpha-nucleus optical potential. Experiments are typically restricted to higher energies and therefore no direct astrophysical consequences can be drawn. In the present work a (p,alpha) reaction is used for the first time to study the alpha-nucleus optical potential. The measured 64Zn(p,alpha)61Cu cross section is uniquely sensitive to the alpha-nucleus potential and the measurement covers the whole astrophysically relevant energy range. By the comparison to model calculations, direct evidence is provided for the incorrectness of global optical potentials used in astrophysical models.

Gyrky, Gy; Halsz, Z; Kiss, G G; Szcs, T

2014-01-01T23:59:59.000Z

398

Small-Molecule Inhibition of TNF-alpha  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Small-Molecule Inhibition of TNF-alpha Tumour necrosis factor is a polypeptide cytokine involved in inflammation and the acute phase response. TNF-alpha is present in larger quantities in persons with rheumatoid arthritis or Crohn's disease. Direct inhibition of TNF-a by the commercial biological agents etanercept (Enbrel), infliximab (Remicade), adalimumab (Humira), has produced significant advances in rheumatoid arthritis treatment and validated the extra-cellular inhibition of this proinflammatory cytokine as an effective therapy. However, despite considerable incentives, viable leads for analogous small-molecule inhibitors of TNF-a have not been reported (1). Such drugs with attendant advantages in manufacturing, patient accessibility, administration, and compliance would represent a major advance in the treatment of TNF-a mediated diseases.

399

Anomalous loss of DT alpha particles in the Tokamak Fusion Test Reactor  

SciTech Connect (OSTI)

An escaping alpha collector probe has been developed for TFTR`s DT phase. Energy distributions of escaping alphas have been determined by measuring the range of {alpha}-particles implanted into nickel foils located within the alpha collector. Results at 1.0 MA of plasma current are in good agreement with predictions for first orbit alpha loss. Results at 1.8 MA, however, show a significant anomalous loss of partially thermalized alphas (in addition to the expected first orbit loss), which is not observed with the lost alpha scintillator detectors in DT plasmas, but does resemble the anomalous delayed loss seen in DD plasmas. None of the candidate explanations proposed thus far are fully consistent with the anomalous loss observations. An experiment designed to study the effect of plasma major radius shifts on {alpha}-particle loss has led to a better understanding of {alpha}-particle dynamics in tokamaks. Intuitively, one might suppose that confined marginally passing {alpha}-particles forced to move toward higher magnetic field during an inward major radius shift (i.e., compression) would mirror and become trapped particles, leading to increased alpha loss. Such an effect was looked for during the shift experiment, however, no significant changes in alpha loss to the 90{degree} lost alpha scintillator detector were observed during the shifts. It is calculated that the energy gained by an {alpha}-particle during the inward shift is sufficient to explain this result. However, an unexpected loss of partially thermalized {alpha}-particles near the passing/trapped boundary was observed to occur between inward and outward shifts at an intermediate value of plasma current (1.4 MA). This anomalous loss feature is not yet understood.

Herrmann, H.W.

1997-09-01T23:59:59.000Z

400

Measurement of the CKM angle phi2 (alpha)  

E-Print Network [OSTI]

We present recent measurements of the unitarity triangle angle phi2(alpha) using B -> pi pi, B -> rho rho, and B -> rho pi decays. The measurements are based on data samples collected with the Belle and BaBar detectors at the KEKB and PEP-II e+e- colliders, respectively. We also report on a new measurement of a CP-violating asymmetry in B -> a_1+ pi- decay which will allow to constrain further the angle phi2.

A. Somov

2007-08-29T23:59:59.000Z

Note: This page contains sample records for the topic "alpha excluding radon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Michrochannel plate for position sensitive alpha particle detection  

SciTech Connect (OSTI)

This paper will describe the use of a microchannel plate (MCP) as the associated particle detector on a sealed tube neutron generator. The generator produces neutrons and associated alpha particles for use as a probe to locate and identify hidden explosives in associated particle imaging (API). The MCP measures the position in two dimensions and precise timing of the incident alpha particle, information which is then used to calculate the emission time and direction of the corresponding neutron. The MCP replaces the position-sensitive photomultipler tube (PSPMT) which, until recently, had been the only detector available for measuring position and timing for alpha particles in neutron generator applications. Where the PSPMT uses charge division for generating position information, a process that requires a first order correction to each pulse, the MCP uses delay-line timing, which requires no correction. The result is a device with an order of magnitude improvement in both position resolution and timing compared to the PSPMT. Hardware and software development and the measurements made to characterize the MCP for API applications are described.

Paul Hurley and James Tinsley

2007-08-31T23:59:59.000Z

402

State-of-the-Art Predictions for C-parameter and a Determination of alpha_s  

E-Print Network [OSTI]

The C-parameter event-shape distribution for e+e- annihilation into hadrons is computed in the framework of SCET including input from fixed-order perturbation theory. We calculate all missing ingredients for achieving N3LL resummation accuracy in the cross section, which is then matched onto O(alpha_s^3) fixed-order results. Hadronization power corrections are incorporated as a convolution with a nonperturbative shape function. Wide-angle soft radiation effects introduce an O(Lambda_QCD) renormalon ambiguity in the cross section, which we cure by switching to the Rgap short-distance scheme. We also include hadron mass effects, but find their effect is rather small. Performing fits to the tail of the C-parameter distribution for many center of mass energies we find that the strong coupling constant is alpha_s(mZ) = 0.1123 +-0.0015, with chi^2/dof=0.99.

Hoang, Andre H; Mateu, Vicent; Stewart, Iain W

2015-01-01T23:59:59.000Z

403

K{alpha} satellite transitions in elements with 12{<=}Z{<=}30 produced by electron incidence  

SciTech Connect (OSTI)

The emission of x-ray satellite lines in the K{alpha} region of Mg, Si, Sc, Ti, Cr, Fe, Ni, and Zn induced by electron incidence was studied by means of wavelength dispersive spectroscopy. The satellite lines studied were K{alpha}{sup '}, K{alpha}{sub 3}, K{alpha}{sub 4}, K{alpha}{sub 5}, K{alpha}{sub 6}, and two transitions denoted here as K{alpha}{sub 22} and K{alpha}{sub 12}. Energy shifts with respect to the main K{alpha}{sub 1} diagram line and transition probabilities relative to the whole K{alpha} group were determined for a number of lines through a careful spectral processing. The dependence of these parameters, as well as of the K{beta}:K{alpha} intensity ratio, on the atomic number was compared with previous experimental and theoretical determinations when available. A discussion about the different mechanisms responsible for vacancy creation involved in the production of double-ionization satellites was performed in the light of the results obtained. Finally, the behavior of the satellite intensities as a function of the incidence energy was discussed for silicon.

Limandri, Silvina P.; Carreras, Alejo C.; Trincavelli, Jorge C. [Instituto de Fisica Enrique Gaviola, Consejo Nacional de Investigaciones Cientificas y Tecnicas (Argentina); Facultad de Matematica, Astronomia y Fisica, Universidad Nacional de Cordoba, Cordoba (Argentina); Bonetto, Rita D. [Centro de Investigacion y Desarrollo en Ciencias Aplicadas Dr. Jorge Ronco (CINDECA), Consejo Nacional de Investigaciones Cientificas y Tecnicas (Argentina); Facultad de Ciencias Exactas, Facultad de Ingenieria, Universidad Nacional de La Plata, La Plata (Argentina)

2010-09-15T23:59:59.000Z

404

Questions and Answers - What are alpha rays? How are they produced?  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Why do we use radioactivityto destroy cancers? Why do we use radioactivity<br>to destroy cancers? Previous Question (Why do we use radioactivity to destroy cancers?) Questions and Answers Main Index Next Question (What is an alpha particle?) What is an alpha particle? What are alpha rays? How are they produced? Alpha "rays" are actually high speed particles. Early researchers tended to refer to any form of energetic radiation as rays, and the term is still used. An alpha particle is made up of two protons and two neutrons, all held together by the same strong nuclear force that binds the nucleus of any atom. In fact, an alpha particle really is a nucleus - it's the same as the nucleus of a common atom of helium - but it doesn't have any electrons around it, and it's traveling very fast. Alpha particles are a type of

405

Synthesis and evaluation of novel [alpha]-heteroaryl-phenylpropanoic acid derivatives as PPAR[alpha/gamma] dual agonists  

SciTech Connect (OSTI)

The synthesis of a new series of phenylpropanoic acid derivatives incorporating an heteroaryl group at the {alpha}-position and their evaluation for binding and activation of PPAR{alpha} and PPAR{gamma} are presented in this report. Among the new compounds, (S)-3-{l_brace}4-[3-(5-methyl-2-phenyl-oxazol-4-yl)-propyl]-phenyl{r_brace}-2-1,2,3-triazol-2-yl-propionic acid (17j), was identified as a potent human PPAR{alpha}/{gamma} dual agonist (EC{sub 50} = 0.013 and 0.061 {micro}M, respectively) with demonstrated oral bioavailability in rat and dog. 17j was shown to decrease insulin levels, plasma glucose, and triglycerides in the ZDF female rat model. In the human apolipoprotein A-1/CETP transgenic mouse model 17j produced increases in hApoA1 and HDL-C and decreases in plasma triglycerides. The increased potency for binding and activation of both PPAR subtypes observed with 17j when compared to previous analogs in this series was explained based on results derived from crystallographic and modeling studies.

Casimiro-Garcia, Agustin; Bigge, Christopher F.; Davis, Jo Ann; Padalino, Teresa; Pulaski, James; Ohren, Jeffrey F.; McConnell, Patrick; Kane, Christopher D.; Royer, Lori J.; Stevens, Kimberly A.; Auerbach, Bruce; Collard, Wendy; McGregor, Christine; Song, Kun; Pfizer

2010-09-27T23:59:59.000Z

406

Tobacco plants transformed with the bean. alpha. ai gene express an inhibitor of insect. alpha. -amylase in their seeds. [Nicotiana tabacum; Tenebrio molitor  

SciTech Connect (OSTI)

Bean (Phaseolus vulgaris L.) seeds contain a putative plant defense protein that inhibits insect and mammalian but not plant {alpha}-amylases. We recently presented strong circumstantial evidence that this {alpha}-amylase inhibitor ({alpha}Al) is encoded by an already-identified lectin gene whose product is referred to as lectin-like-protein (LLP). We have now made a chimeric gene consisting of the coding sequence of the lectin gene that encodes LLP and the 5{prime} and 3{prime} flanking sequences of the lectin gene that encodes phytohemagglutinin-L. When this chimeric gene was expressed in transgenic tobacco (Nicotiana tabacum), we observed in the seeds a series of polypeptides (M{sub r} 10,000-18,000) that cross-react with antibodies to the bean {alpha}-amylase inhibitor. Most of these polypeptides bind to a pig pancreas {alpha}-amylase affinity column. An extract of the seeds of the transformed tobacco plants inhibits pig pancreas {alpha}-amylase activity as well as the {alpha}-amylase present in the midgut of Tenebrio molitor. We suggest that introduction of this lectin gene (to be called {alpha}ai) into other leguminous plants may be a strategy to protect the seeds from the seed-eating larvae of Coleoptera.

Altabella, T.; Chrispeels, M.J. (Univ. of California, San Diego, La Jolla (USA))

1990-06-01T23:59:59.000Z

407

Organization Advisor Type Name Email Address Alpha Delta Pi Chapter Advisor Allison Thompson aburkethompson@hotmail.com  

E-Print Network [OSTI]

Organization Advisor Type Name Email Address Alpha Delta Pi Chapter Advisor Allison Thompson aburkethompson@hotmail.com Alpha Delta Pi On-Campus Advisor Kendra Stewart stewartk@cofc.edu Alpha Epsilon Pi Chapter Advisor Andrew London andrewlondon@london.com Alpha Epsilon Pi On-Campus Advisor Marsha Alterman

Young, Paul Thomas

408

Expression of POEM, a positive regulator of osteoblast differentiation, is suppressed by TNF-{alpha}  

SciTech Connect (OSTI)

Highlights: {yields} TNF-{alpha} inhibits POEM gene expression. {yields} Inhibition of POEM gene expression is caused by NF-{kappa}B activation by TNF-{alpha}. {yields} Over-expression of POEM recovers inhibition of osteoblast differentiation by TNF-{alpha}. -- Abstract: POEM, also known as nephronectin, is an extracellular matrix protein considered to be a positive regulator of osteoblast differentiation. In the present study, we found that tumor necrosis factor-{alpha} (TNF-{alpha}), a key regulator of bone matrix properties and composition that also inhibits terminal osteoblast differentiation, strongly inhibited POEM expression in the mouse osteoblastic cell line MC3T3-E1. TNF-{alpha}-induced down-regulation of POEM gene expression occurred in both time- and dose-dependent manners through the nuclear factor kappa B (NF-{kappa}B) pathway. In addition, expressions of marker genes in differentiated osteoblasts were down-regulated by TNF-{alpha} in a manner consistent with our findings for POEM, while over-expression of POEM recovered TNF-{alpha}-induced inhibition of osteoblast differentiation. These results suggest that TNF-{alpha} inhibits POEM expression through the NF-{kappa}B signaling pathway and down-regulation of POEM influences the inhibition of osteoblast differentiation by TNF-{alpha}.

Tsukasaki, Masayuki [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan)] [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan); Yamada, Atsushi, E-mail: yamadaa@dent.showa-u.ac.jp [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan)] [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan); Suzuki, Dai [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan)] [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan); Aizawa, Ryo [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan) [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan); Department of Periodontology, School of Dentistry, Showa University, 2-1-1 Kitasenzoku, Ohta, Tokyo 145-8515 (Japan); Miyazono, Agasa [Department of Periodontology, School of Dentistry, Showa University, 2-1-1 Kitasenzoku, Ohta, Tokyo 145-8515 (Japan)] [Department of Periodontology, School of Dentistry, Showa University, 2-1-1 Kitasenzoku, Ohta, Tokyo 145-8515 (Japan); Miyamoto, Yoichi; Suzawa, Tetsuo; Takami, Masamichi; Yoshimura, Kentaro [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan)] [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan); Morimura, Naoko [Laboratory for Comparative Neurogenesis, RIKEN Brain Science Institute, 2-1 Hirosawa, Wako-shi, Saitama 351-0198 (Japan)] [Laboratory for Comparative Neurogenesis, RIKEN Brain Science Institute, 2-1 Hirosawa, Wako-shi, Saitama 351-0198 (Japan); Yamamoto, Matsuo [Department of Periodontology, School of Dentistry, Showa University, 2-1-1 Kitasenzoku, Ohta, Tokyo 145-8515 (Japan)] [Department of Periodontology, School of Dentistry, Showa University, 2-1-1 Kitasenzoku, Ohta, Tokyo 145-8515 (Japan); Kamijo, Ryutaro [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan)] [Department of Biochemistry, School of Dentistry, Showa University, 1-5-8 Hatanodai, Shinagawa, Tokyo 142-8555 (Japan)

2011-07-15T23:59:59.000Z

409

Activation of bean (Phaseolus vulgaris) [alpha]-amylase inhibitor requires proteolytic processing of the proprotein  

SciTech Connect (OSTI)

Seeds of the common bean (Phaseolus vulgaris) contain a plant defense protein that inhibits the [alpha]-amylases of mammals and insects. This [alpha]-amylase inhibitor ([alpha]Al) is synthesized as a proprotein on the endoplasmic reticulum and is proteolytically processed after arrival in the protein storage vacuoles to polypeptides of relative molecular weight (M[sub r]) 15,000 to 18,000. The authors report two types of evidence that proteolytic processing is linked to activation of the inhibitory activity. First, by surveying seed extracts of wild accessions of P. vulgaris and other species in the genus Phaseolus, they found that antibodies to [alpha]Al recognize large (M[sub r] 30,000-35,000) polypeptides as well as typical [alpha]Al processing products (M[sub r] 15,000-18,000). [alpha]Al activity was found in all extracts that had the typical [alpha]Al processed polypeptides, but was absent from seed extracts that lacked such polypeptides. Second, they made a mutant [alpha]Al in which asparagine-77 is changed to aspartic acid-77. This mutation slows down the proteolytic processing of pro-[alpha]Al when the gene is expressed in tobacco. When pro-[alpha]Al was separated from mature [alpha]Al by gel filtration, pro-[alpha]Al was found not to have [alpha]-amylase inhibitory activity. The authors interpret these results to mean that formation of the active inhibitor is causally related to proteolytic processing of the proprotein. They suggest that the polypeptide cleavage removes a conformation constraint on the precursor to produce the biochemically active molecule. 43 refs., 5 figs., 1 tab.

Pueyo, J.J.; Hunt, D.C.; Chrispeels, M.J. (Univ. of California, San Diego, La Jolla (United States))

1993-04-01T23:59:59.000Z

410

Role of Hepatocyte Nuclear Factor 4 alpha in Hepatocyte Proliferation  

E-Print Network [OSTI]

-binding domain and the ligand-binding domain for proper binding of HNF4? to its response elements. A lack of the ligand-binding domain can reduce the affinity of HNF4? for its response elements by 75-fold (Chandra, Huang et al. 2013). HNF4?s ligand..., 2013, with permission from American Physiological Society. Hepatology, 57(3): 2480-2490, Hepatocyte Nuclear Factor 4 alpha Deletion Promotes Diethylnitrosamine-induced Hepatocellular Carcinoma in Rodents, 2013, with permission from John Wiley & Sons...

Walesky, Chad Michael

2014-05-31T23:59:59.000Z

411

Measurement of the CKM Angle Alpha at BaBar  

SciTech Connect (OSTI)

We present BABAR experiment studies to measure the CKM angle {alpha} of the Unitarity Triangle. The measurements are based on the B meson decays into the two-body state ({pi}{pi}), the quasi two-body state ({rho}{rho}), and the three-body state ({pi}{sup +}{pi}{sup -}{pi}{sup 0}). The results are obtained from data samples of about 230 million {Upsilon}(4S) {yields} B{bar B} decays collected between 1999 and 2004 with the BABAR detector at the PEP-II asymmetric-energy B Factory at SLAC.

Yeche, C.; /Saclay

2006-04-14T23:59:59.000Z

412

Subthreshold K+ production in deuteron and alpha induced nuclear reactions  

E-Print Network [OSTI]

Double differential cross sections have been measured for pi+ and K+ emitted around midraidity in d+A and He+A collisions at a beam kinetic energy of 1.15 GeV/nucleon. The total pi+ yield increases by a factor of about 2 when using an alpha projectile instead of a deuteron whereas the K+ yield increases by a factor of about 4. According to transport calculations, the K+ enhancement depends both on the number of hadron-hadron collisions and on the energy available in those collisions: their center-of-mass energy increases with increasing number of projectile nucleons.

M. Debowski; P. Senger; M. Boivin; Y. LeBornec; P. Courtat; R. Gacougnolle; E. Grosse; S. Kabana; T. Kirchner; P. Koczon; M. Mang; E. Schwab; B. Tatischeff; A. Wagner; W. Walus; N. Willis; G. Wolf; R. Wurzinger; J. Yonnet

1997-09-10T23:59:59.000Z

413

Alpha Decay of the Isomers of Fr214  

Science Journals Connector (OSTI)

Alpha decay from the ground state and an isomeric state of Fr214 has been observed. The ground state has a half-life of 5.00.2 msec, and the isomeric state, 3.350.05 msec, at an excitation energy of 123 keV. A level scheme for At210 based on several ? transitions observed is presented. The similarity of the energy levels of Bi208 with those of At210 suggests that the addition of a proton pair to Bi208 does not significantly alter the nature of the particle-hole interactions observed for Bi208.

David F. Torgerson; Richard A. Gough; Ronald D. Macfarlane

1968-10-20T23:59:59.000Z

414

CRAD, Safety Basis - Oak Ridge National Laboratory TRU ALPHA LLWT Project |  

Broader source: Energy.gov (indexed) [DOE]

TRU ALPHA LLWT TRU ALPHA LLWT Project CRAD, Safety Basis - Oak Ridge National Laboratory TRU ALPHA LLWT Project November 2003 A section of Appendix C to DOE G 226.1-2 "Federal Line Management Oversight of Department of Energy Nuclear Facilities." Consists of Criteria Review and Approach Documents (CRADs) used for a November 2003 assessment of the Safety Basis portion of an Operational Readiness Review of the Oak Ridge National Laboratory TRU ALPHA LLWT Project. CRADs provide a recommended approach and the types of information to gather to assess elements of a DOE contractor's programs. CRAD, Safety Basis - Oak Ridge National Laboratory TRU ALPHA LLWT Project More Documents & Publications CRAD, Conduct of Operations - Oak Ridge National Laboratory TRU ALPHA LLWT

415

V-075: EMC AlphaStor Command Injection and Format String Flaws Let Remote  

Broader source: Energy.gov (indexed) [DOE]

5: EMC AlphaStor Command Injection and Format String Flaws Let 5: EMC AlphaStor Command Injection and Format String Flaws Let Remote Users Execute Arbitrary Code V-075: EMC AlphaStor Command Injection and Format String Flaws Let Remote Users Execute Arbitrary Code January 23, 2013 - 12:26am Addthis PROBLEM: EMC AlphaStor Command Injection and Format String Flaws Let Remote Users Execute Arbitrary Code PLATFORM: EMC AlphaStor 4.0 prior to build 800 (All platforms) ABSTRACT: Two vulnerabilities were reported in EMC AlphaStor. REFERENCE LINKS: ESA-2013-008: SecurityTracker Alert ID: 1028020 Secunia Advisory SA51930 CVE-2013-0928 CVE-2013-0929 IMPACT ASSESSMENT: Medium DISCUSSION: A remote user can send a specially crafted DCP run command to inject commands and cause the Device Manager (rrobotd.exe) to execute arbitrary code on the target system [CVE-2013-0928].

416

V-075: EMC AlphaStor Command Injection and Format String Flaws Let Remote  

Broader source: Energy.gov (indexed) [DOE]

5: EMC AlphaStor Command Injection and Format String Flaws Let 5: EMC AlphaStor Command Injection and Format String Flaws Let Remote Users Execute Arbitrary Code V-075: EMC AlphaStor Command Injection and Format String Flaws Let Remote Users Execute Arbitrary Code January 23, 2013 - 12:26am Addthis PROBLEM: EMC AlphaStor Command Injection and Format String Flaws Let Remote Users Execute Arbitrary Code PLATFORM: EMC AlphaStor 4.0 prior to build 800 (All platforms) ABSTRACT: Two vulnerabilities were reported in EMC AlphaStor. REFERENCE LINKS: ESA-2013-008: SecurityTracker Alert ID: 1028020 Secunia Advisory SA51930 CVE-2013-0928 CVE-2013-0929 IMPACT ASSESSMENT: Medium DISCUSSION: A remote user can send a specially crafted DCP run command to inject commands and cause the Device Manager (rrobotd.exe) to execute arbitrary code on the target system [CVE-2013-0928].

417

Alpha-decay Rates of Yb and Gd in Solar Neutrino Detectors  

E-Print Network [OSTI]

The $\\alpha$-decay rates for the nuclides $^{168,170,171,172,173,174,176}$Yb and $^{148,150,152,154}$Gd have been estimated from transmission probabilities in a systematic $\\alpha$-nucleus potential and from an improved fit to $\\alpha$-decay rates in the rare-earth mass region. Whereas ${\\alpha}$-decay of $^{152}$Gd in natural gadolinium is a severe obstacle for the use of gadolinium as a low-energy solar-neutrino detector, we show that ${\\alpha}$-decay does not contribute significantly to the background in a ytterbium detector. An extremely long ${\\alpha}$-decay lifetime of $^{168}$Yb is obtained from calculation, which may be close to the sensitivity limit in a low-background solar neutrino detector.

M. Fujiwara; T. Kawabata; P. Mohr

2002-03-03T23:59:59.000Z

418

Alpha particle cluster states in fp-shell nuclei  

Science Journals Connector (OSTI)

Alpha particle cluster structure is known experimentally to persist throughout the mass range 16?A?20, and has been very successfully described in this region in terms of the Buck-Dover-Vary local potential cluster model. It is argued that an analogous cluster structure should be present in nuclei at the beginning of the fp shell, and the available experimental data are examined to determine likely alpha particle cluster state candidates in the mass range 40?A?44. Calculations of the cluster state spectra and mean square cluster-core separation distances (which may be readily used to evaluate E2 electromagnetic transition rates) for Ca40, Ca42, Sc42, Sc43, Ti43, and Ti44 using the above-mentioned model are presented, and compared with experimental measurements where possible. The agreement between theory and experiment is generally good (although inferior to that obtained in the sd shell), and points to the desirability of an extension and improvement of the measurements of the properties of the excited states in these nuclei.

A. C. Merchant

1987-08-01T23:59:59.000Z

419

The impact of alpha/Fe enhanced stellar evolutionary tracks on the ages of elliptical galaxies  

E-Print Network [OSTI]

We complement our study of alpha/Fe enhanced stellar population models of Lick absorption indices (Thomas et al. 2003) by comparing two sets of alpha/Fe enhanced models. In both models the impact on Lick indices due to alpha/Fe enhancement is accounted for through a modification of the stellar absorption line-strengths using the response functions of Tripicco & Bell (1995). One set of models, however, uses solar-scaled, the other alpha/Fe enhanced stellar evolutionary tracks. Since the alpha/Fe enhanced tracks are hotter than the solar-scaled ones (Salasnich et al. 2000), the correspondent stellar population models have slightly weaker metallic indices (i.e. Mgb, etc.) and stronger Balmer line indices (Hbeta) (Maraston et al 2003). Here we explore quantitatively the impact of this effect on the alpha/Fe ratios, metallicities and ages that are derived for elliptical galaxies. We find that the modest decrease of the metallic indices Mgb and balance each other, such that fully consistent alpha/Fe ratios are derived for stellar systems using alpha/Fe enhanced models with either solar-scaled or alpha/Fe enhanced stellar tracks. The decrease of the metallic indices and the increase of Hbeta conspire in a way that also consistent metallicities are obtained. The derived ages, instead, are significantly different. The inclusion of alpha/Fe enhanced stellar tracks leads to the derivation of ages as high as 30 Gyr for elliptical galaxies. For the same objects, ages not older than 15 Gyr are obtained, if alpha/Fe enhanced models using solar-scaled tracks are adopted. This may indicate that current stellar evolutionary models overestimate the bluing of stellar evolutionary tracks due to alpha/Fe enhanced chemical mixtures at super-solar metallicities.

Daniel Thomas; Claudia Maraston

2003-02-04T23:59:59.000Z

420

E-Print Network 3.0 - alpha-helical protein backbones Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

features (alpha helices hydrophobic or amphipathic) 12;Hydropathy plots... 12;From micro to nano 12;Ribosome makes proteins 12;From ribosome to 3D- Protein ... Source:...

Note: This page contains sample records for the topic "alpha excluding radon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

E-Print Network 3.0 - alpha -hydroxy-5 cap Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

36 Relations between PET-derived measures of thalamic glucose metabolism and EEG alpha power Summary: Relations between PET-derived measures of thalamic glucose metabolism and...

422

E-Print Network 3.0 - alpha transitions producing Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Associazione Euratom-ENEA sulla Fusione ENEA C.R. Frascati Collection: Plasma Physics and Fusion 22 Alpha-Investing Sequential Control of Expected False Discoveries Summary: them...

423

E-Print Network 3.0 - alpha sources Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Imre Pzsit and Andreas Enqvist... (Rossi-alpha) methods, are used to determine the subcritical reactivity of the system. Although Source: Pzsit, Imre - Department of Reactor...

424

E-Print Network 3.0 - alpha compact lithotriptor Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

or the correlation... (Rossi-alpha) methods, are used to determine the subcritical reactivity of the system. Although Source: Pzsit, Imre - Department of Reactor...

425

E-Print Network 3.0 - alpha feto protein Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Online Material This supplement contains Summary: binding protein, putative CNG03730 alpha-amylase, putative CNC01390 peptide-N4-(N... , putative CNA05310 expressed protein...

426

Alpha-amylase inhibitor changes during processing of sweet potato and taro tubers  

Science Journals Connector (OSTI)

Alpha-amylase inhibitor changes during processing ofsweet potatoes (Ipomoea batatas) and taro (Colocasia esculenta...)indicated that varietal differences profoundly influence the thermalinactivation profile. The ...

M.R. Rekha; G. Padmaja

2002-01-01T23:59:59.000Z

427

E-Print Network 3.0 - alpha-amylase inhibitor peptide Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

peptide Search Powered by Explorit Topic List Advanced Search Sample search results for: alpha-amylase inhibitor peptide Page: << < 1 2 3 4 5 > >> 1 Inferring Functional...

428

E-Print Network 3.0 - alpha synuclein induced Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

synuclein induced Search Powered by Explorit Topic List Advanced Search Sample search results for: alpha synuclein induced Page: << < 1 2 3 4 5 > >> 1 The Aggregation and...

429

E-Print Network 3.0 - alpha-deuterium isotope effects Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

deuterium isotope effects Search Powered by Explorit Topic List Advanced Search Sample search results for: alpha-deuterium isotope effects Page: << < 1 2 3 4 5 > >> 1 ISOTOPE...

430

E-Print Network 3.0 - alpha7-nicotinic acetylcholine receptor...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

lpyridazine-3-yloctahydropyrrolo3,4-c 11CA-582941 Summary: .B. Mikkelsen J.D. Cognitive improvement by activation of alpha7 nicotinic acetylcholine receptors: from...

431

E-Print Network 3.0 - alpha interacting tip60 Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Nitrocellulose Summary: the interaction of transferred receptor proteins with a polypep- tide ligand. We chose alpha... . Characterization of the Interaction of...

432

E-Print Network 3.0 - activated receptor alpha Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

C colon CA cholic acid CAR constitutive activeandrostane receptor CDCA... jejunum LCA lithocholic acid LRH-1 liver receptor homolog-1 LXR liver X receptor alpha MeOH...

433

E-Print Network 3.0 - anti-il-2 receptor alpha Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Collection: Mathematics 2 List of Abbreviations Acknowledgments Summary: jejunum LCA lithocholic acid LRH-1 liver receptor homolog-1 LXR liver X receptor alpha MeOH...

434

E-Print Network 3.0 - alpha 2b-adrenergic receptor Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Biology and Medicine 5 List of Abbreviations Acknowledgments Summary: jejunum LCA lithocholic acid LRH-1 liver receptor homolog-1 LXR liver X receptor alpha MeOH...

435

E-Print Network 3.0 - alpha administration zmiany Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Stetson University Collection: Mathematics 49 WilkersonSt University Dr Summary: Rd Four Towers New East Campus Parking Deck Aluxiliary Services Alpha Chi Omega Spec Towns Track...

436

E-Print Network 3.0 - alpha-induced nuclear reactions Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

nuclear reactions Search Powered by Explorit Topic List Advanced Search Sample search results for: alpha-induced nuclear reactions Page: << < 1 2 3 4 5 > >> 1 Scintillation of...

437

E-Print Network 3.0 - alpha phase predicts Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

enic instabilities driven by fusion- produced alpha particles is investigated by hybrid MHD-particle simulations... rates are quite small. The effects of nonlinear mode dynamics...

438

E-Print Network 3.0 - alpha coding sequence Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

will generate conservative Alpha code sequences for unaligned memory access. If the profile does not indicate... Pentium or a 200-MHz Pentium Pro when executing translated...

439

E-Print Network 3.0 - alpha 2-macroglobulin implications Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

receptor-associated protein. Proc. Natl... Tigue, K., Battey, J.F., and Argraves, W.S. (1991). Primary struc- ture of alpha 2-macroglobulin receptor... residues on...

440

E-Print Network 3.0 - alpha class glutathione Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

the Detoxification of 2-Phenylpropenal, a Reactive Summary: of the genotoxic aldehyde acrolein by human glutathione transferases of classes alpha, pi, and mu. Mol. Pharmacol......

Note: This page contains sample records for the topic "alpha excluding radon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

E-Print Network 3.0 - alpha induced reactions Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

production balances the various energy losses and the fusion reaction is self-sustaining. The product ions... (alpha particles in the case of a deuterium-tritium plasma)...

442

E-Print Network 3.0 - alpha particle degradation Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

24 James W. Van Dam US Burning Plasma Organization Summary: dominantly self-heated by fusion products (e.g., alpha particles) from thermonuclear reactions in the plasma......

443

E-Print Network 3.0 - alpha particle destabilization Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

26 James W. Van Dam US Burning Plasma Organization Summary: dominantly self-heated by fusion products (e.g., alpha particles) from thermonuclear reactions in the plasma......

444

E-Print Network 3.0 - alpha1-proteinase inhibitor api Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

api Search Powered by Explorit Topic List Advanced Search Sample search results for: alpha1-proteinase inhibitor api Page: << < 1 2 3 4 5 > >> 1 Protease Inhibitors -Application...

445

E-Print Network 3.0 - alpha angle measurement Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

9 Calibration of the University of North Dakota's Citation Summary: Measurement Unit 12;12;Calibration Procedure Heading Angle Offset Alpha Angle Calibration Beta...

446

E-Print Network 3.0 - alpha satellite subset Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

and Astronautics, Massachusetts Institute of Technology (MIT) Collection: Engineering 40 WIND Measurements of Proton and Alpha Particle Flow and Number Density J. T. Steinberg...

447

E-Print Network 3.0 - ancestral alpha satellites Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

College London Collection: Environmental Sciences and Ecology ; Biology and Medicine 30 WIND Measurements of Proton and Alpha Particle Flow and Number Density J. T. Steinberg...

448

E-Print Network 3.0 - alpha-voltaic power source Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Albuquerque, New Mexico, January 2000 Miniaturized Radioisotope Solid State Power Sources Summary: for an alpha-voltaic or a hybrid thermoelectricalpha-voltaic power...

449

E-Print Network 3.0 - alpha-recoil damaged minerals Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Summary: ... 7.1 7.1.2 Alpha-Recoil and Uranium Series Disequilibrium... (VI) in the Hanford subsurface is retarded by both...

450

Comparison of MCNP6 and experimental results for neutron counts, Rossi-{alpha}, and Feynman-{alpha} distributions  

SciTech Connect (OSTI)

MCNP6, the general-purpose Monte Carlo N-Particle code, has the capability to perform time-dependent calculations by tracking the time interval between successive events of the neutron random walk. In fixed-source calculations for a subcritical assembly, the zero time value is assigned at the moment the neutron is emitted by the external neutron source. The PTRAC and F8 cards of MCNP allow to tally the time when a neutron is captured by {sup 3}He(n, p) reactions in the neutron detector. From this information, it is possible to build three different time distributions: neutron counts, Rossi-{alpha}, and Feynman-{alpha}. The neutron counts time distribution represents the number of neutrons captured as a function of time. The Rossi-a distribution represents the number of neutron pairs captured as a function of the time interval between two capture events. The Feynman-a distribution represents the variance-to-mean ratio, minus one, of the neutron counts array as a function of a fixed time interval. The MCNP6 results for these three time distributions have been compared with the experimental data of the YALINA Thermal facility and have been found to be in quite good agreement. (authors)

Talamo, A.; Gohar, Y. [Argonne National Laboratory, 9700 S. Cass Ave., Lemont, IL 60439 (United States); Sadovich, S.; Kiyavitskaya, H.; Bournos, V.; Fokov, Y.; Routkovskaya, C. [Joint Institute for Power and Nuclear Research-Sosny, 99 Academician A.K. Krasin Str., Minsk 220109 (Belarus)

2013-07-01T23:59:59.000Z

451

working lunch menus prices excludes VAT  

E-Print Network [OSTI]

person +2 items £12.50 per person +3 items £15.00 per person +4 items £17.50 per person meat » mini pie with a coconut dipping sauce » all butter pastry mini sausage roll » traditional melton mowbray pork pie » scotch

452

Properties of planar Nb/{alpha}-Si/Nb Josephson junctions with various degrees of doping of the {alpha}-Si layer  

SciTech Connect (OSTI)

The properties of Nb/{alpha}-Si/Nb planar Josephson junctions with various degrees of doping of the amorphous silicon layer are experimentally studied. Tungsten is used as a doping impurity. The properties of the Josephson junctions are shown to change substantially when the degree of doping of the {alpha}-Si layer changes: a current transport mechanism and the shape of the current-voltage characteristic of the junctions change. Josephson junctions with SNS-type conduction are formed in the case of a fully degenerate {alpha}-Si layer. The properties of such junctions are described by a classical resistive model. Josephson junctions with a resonance mechanism of current transport through impurity centers are formed at a lower degree of doping of the {alpha}-Si layer. The high-frequency properties of such junctions are shown to change. The experimental results demonstrate that these junctions are close to SINIS-type Josephson junctions.

Gudkov, A. L., E-mail: gudkov@niifp.ru [Lukin Scientific Research Institute of Physical Problems, ZAO Kompelst (Russian Federation); Kupriyanov, M. Yu. [Moscow State University, Skobeltsyn Institute of Nuclear Physics (Russian Federation); Samus', A. N. [Lukin Scientific Research Institute of Physical Problems, ZAO Kompelst (Russian Federation)

2012-05-15T23:59:59.000Z

453

Search for Antimatter in Space with the Alpha Magnetic Spectrometer  

E-Print Network [OSTI]

The Alpha Magnetic Spectrometer (AMS) is a state of the art particle physics experiment for the extraterrestrial study of antimatter, matter and missing matter. AMS successfully completed the precursor STS91 Discovery flight (June 2nd-12th, 1998), completing 152 orbits at 52 degrees of latitude and about 400 km of height, collecting more than 100 million CR events. In this paper we report on the first flight experience and we present preliminary results on the search for nuclear antimatter. No antimatter nuclei with Z>=2 were detected. We obtain a model dependent upper limit on the anti-He /He flux 2, improving the results of previous published searches performed with stratospheric balloons.

Roberto Battiston

1999-07-12T23:59:59.000Z

454

Measurement of natural radioactivity and radon exhalation rate in fly ash samples from a thermal power plant and estimation of radiation doses  

Science Journals Connector (OSTI)

Fly ash produced by coal-burning in thermal power station has become a subject of world wide interest in recent years because of its diverse uses in construction activities and considerable economic and environmental importance. Fly ash is used in the production of bricks, sheets, cement and also in land filling etc. Indian coals used in thermal power plants are found to have high ash contents, resulting in the production of large amount of fly ash. Coal contains radionuclides including uranium (the source of inert gas radon), Th and K. Thus coal combustion results in enhanced concentration of natural radionuclides 226Ra, 232Th and 40K. Since these radionuclides concentration in fly ash plays an important role in health physics it is important to measure radionuclides concentration in fly ash. In the present work enhanced radioactivity and radon exhalation rate from fly ash samples collected from a thermal power plant of NTPC (National Thermal Power Corporation), Dadri (U.P.) India, have been measured. A high resolution gamma ray spectroscopic system has been used for the measurement of natural radioactivity (226Ra, 232Th and 40K). Gamma spectrometric measurements were carried out at Inter-University Accelerator Centre, New Delhi using a coaxial n-type \\{HPGe\\} detector (EG&G, ORTEC, Oak Ridge, USA). Activity concentration of 226Ra varies from 81.82.2 to 177.310.0Bqkg?1 with an average value of 118.67.4Bqkg?1 and of 232Th from 111.63.2 to 178.53.9Bqkg?1 with an average value of 147.03.4Bqkg?1. 40K activity was found to be below detection limit in some samples while other samples have shown potassium activity to vary from 365.94.8 to 495.96.2Bqkg?1 with an average value of 352.04.5Bqkg?1. Surface radon exhalation rates (EA) and Mass exhalation rates (EM) in these samples were measured by Sealed can technique using LR-115 type II track detectors. EA is found to vary from 80.19.3 to 242.716.3mBqm?2h?1 with an average value 155.512.8mBqm?2h?1, while EM varies from 3.10.4 to 9.30.6mBqkg?1h?1 with an average value of 6.00.5mBqkg?1h?1. Radium equivalent activity (Raeq), related to the external gamma dose and internal dose due to radon and its daughters range from 283.2 to 422.4Bqkg?1 with an average value of 353.9Bqkg?1. The calculated values of external hazard index (Hex) vary from 0.77 to 1.87 with an average value of 1.03. Most of the samples show the value of Raeq close to the allowed upper limit of 370Bqkg?1 and Hex close to unity respectively except in two samples. Annual effective dose varies from 0.15 to 0.23mSvy?1 with an average value 0.19mSvy?1.

Mamta Gupta; Ajay Kumar Mahur; Rati Varshney; R.G. Sonkawade; K.D. Verma; Rajendra Prasad

2013-01-01T23:59:59.000Z

455

Reconciling steady-state Kalman and alpha-beta filter design  

E-Print Network [OSTI]

The deterministic design of the alpha-beta filter and the stochastic design of its Kalman counterpart are placed on a common basis. The first step is to find the continuous-time filter architecture which transforms into the alpha-beta discrete...

Painter, John H.; Kerstetter, D.; Jowers, S.

456

PPPL-2878 UC-426 February 1993 Tritium Diagnostics by Balmer-alpha Emission  

E-Print Network [OSTI]

PPPL-2878 UC-426 February 1993 Tritium Diagnostics by Balmer-alpha Emission C H Skinner, A T Ramsey emission from tritium in a plasma may be distinguished from deuterium emission by a small isotope shift. A diagnostic system to measure tritium Balmer-alpha emission from the plasma edge has been installed on TFTR

457

Alpha-ketoglutarate dehydrogenase: a target and generator of oxidative stress  

Science Journals Connector (OSTI)

...dehydrogenase: a target and generator of oxidative stress Laszlo...therefore could contribute to the induction of oxidative stress. This...nitration. 2. alpha-KGDH as a generator of oxidative stress It is...dehydrogenase: a target and generator of oxidative stress. | Alpha-ketoglutarate...

2005-01-01T23:59:59.000Z

458

Haloalkaliphilic maltotriose-forming alpha-amylase from the archaebacterium Natronococcus sp. strain Ah-36.  

Science Journals Connector (OSTI)

...N-bromosuccinimide. The amylase hydrolyzed...starch, amylose, amylopectin, and, more...glucose of an alpha-configuration...substrate. The amylase hydrolyzed...N-bromosuccinimide. The amylase hydrolyzed...starch, amylose, amylopectin, and, more...glucose of an alpha-configuration...

T Kobayashi; H Kanai; T Hayashi; T Akiba; R Akaboshi; K Horikoshi

1992-06-01T23:59:59.000Z

459

Technical NoteFEASIBILITY STUDIES OF ALPHA-PARTICLE CHANNELING IN MIRROR MACHINES  

E-Print Network [OSTI]

Technical NoteFEASIBILITY STUDIES OF ALPHA-PARTICLE CHANNELING IN MIRROR MACHINES A. I. ZHMOGINOV such as mirror machines can benefit this concept by efficiently redirecting a-particle energy to fuel ion heating designs and for proof-of-principle experiments. KEYWORDS: alpha channeling, mirror machines, ray tracing

460

Clostridium perfringens Alpha-toxin Recognizes the GM1a-TrkA Complex*S  

E-Print Network [OSTI]

-toxin. Clostridiumperfringensalpha-toxinisthemajorvirulencefactor in the pathogenesis of gas gangrene. Alpha-toxin is a 43-kDa pro and induces a signal transduction cascade that promotes the release of chemokines. Therefore, we conclude, the pathogenic bacterium most widely distributed in nature (6), produces one PLC alpha-toxin that is highly cyto

Gleeson, Joseph G.

Note: This page contains sample records for the topic "alpha excluding radon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

Ten channel background alpha radiometer for nondestructive analysis of low activity samples  

SciTech Connect (OSTI)

The description of a ten-channel alpha-radiometer based on large-area semiconductor detectors is presented in this paper. The radiometer is intended for determination of soil pollution by alpha-active radionuclides using thick samples. The analysis of isotopes is also provided. The concentrations of Pu and Am isotopes in soil samples are determined.

Pugatch, V.M.; Pavlenko, Y.N.; Vasiliev, Y.O.; Nenakhov, A.N.; Tkatch, N.M.; Barabash, L.I.; Berdnichenko, S.V.; Litovchenko, P.G.; Rosenfeld, A.B.; Zinets, O.S. (Inst. for Nuclear Research, Kiev (USSR))

1992-10-01T23:59:59.000Z

462

Structural and Biophysical Studies of the Human IL-7/IL-7R[alpha] Complex  

SciTech Connect (OSTI)

IL-7 and IL-7R{alpha} bind the {gamma}{sub c} receptor, forming a complex crucial to several signaling cascades leading to the development and homeostasis of T and B cells. We report that the IL-7R{alpha} ectodomain uses glycosylation to modulate its binding constants to IL-7, unlike the other receptors in the {gamma}{sub c} family. IL-7 binds glycosylated IL-7R{alpha} 300-fold more tightly than unglycosylated IL-7R{alpha}, and the enhanced affinity is attributed primarily to an accelerated on rate. Structural comparison of IL-7 in complex to both forms of IL-7R{alpha} reveals that glycosylation does not participate directly in the binding interface. The SCID mutations of IL-7R{alpha} locate outside the binding interface with IL-7, suggesting that the expressed mutations cause protein folding defects in IL-7R{alpha}. The IL-7/IL-7R{alpha} structures provide a window into the molecular recognition events of the IL-7 signaling cascade and provide sites to target for designing new therapeutics to treat IL-7-related diseases.

McElroy, Craig A.; Dohm, Julie A.; Walsh, Scott T.R.; (OSU); (UPENN)

2009-03-06T23:59:59.000Z

463

Is alpha-Pinene a Substrate for Permeability-Glycoprotein in Wood Rats?  

E-Print Network [OSTI]

Is alpha-Pinene a Substrate for Permeability- Glycoprotein in Wood Rats? Adam K. Green & Shannon L Media, Inc. 2006 Abstract alpha-Pinene is the dominant monoterpene in Juniperus monosperma. Wood rat generalist, and Sprague-Dawley rats, and (2) in Caco-2 cells that over express Pgp. We also measured Pgp

Mladenoff, David

464

Measurements of the Release of Alpha Quartz: A New Standard for Impedance-Matching Experiments  

SciTech Connect (OSTI)

Measurements of the release of alpha quartz into SiO2 aerogel are found to agree well with previous near-direct measurements for that aerogel Hugoniot. The results establish alpha quartz as an impedance-matching standard that, because of its transparency, enables higher-accuracy measurements and knowledge of the pressure profile in the pusher.

Boehly, T.R.; Miller, J.E.; Meyerhofer, D.D.; Eggert, J.H.; Celliers, P.M.; Hicks, D.G.; Collins, G.W.

2008-01-14T23:59:59.000Z

465

EIS-0305: Treating Transuranic (TRU)/Alpha Low-Level at the Oak Ridge  

Broader source: Energy.gov (indexed) [DOE]

05: Treating Transuranic (TRU)/Alpha Low-Level at the Oak 05: Treating Transuranic (TRU)/Alpha Low-Level at the Oak Ridge National Laboratory, Oak Ridge, Tennessee EIS-0305: Treating Transuranic (TRU)/Alpha Low-Level at the Oak Ridge National Laboratory, Oak Ridge, Tennessee SUMMARY This EIS evaluates DOE's proposal to construct, operate, and decontaminate/decommission a Transuranic (TRU) Waste Treatment Facility in Oak Ridge, Tennessee. The four waste types that would be treated at the proposed facility would be remote-handled TRU mixed waste sludge, liquid low-level waste associated with the sludge, contact-handled TRU/alpha low-level waste solids, and remote-handled TRU/alpha low-level waste solids. The mixed waste sludge and some of the solid waste contain metals regulated under the Resource Conservation and Recovery Act and may be

466

Building the bridge between Damped Ly-alpha Absorbers and Lyman Break galaxies  

E-Print Network [OSTI]

In 2000, we started the program ``Building the Bridge between Damped Ly-alpha Absorbers and Lyman-Break Galaxies: Ly-alpha Selection of Galaxies'' at the European Southern Observatory's Very Large Telescope. This project is an attempt to use Ly-alpha selection of high-z galaxies to bridge the gap between absorption- and emission-selected galaxies by creating a large database of z=3 galaxies belonging to the abundant population of faint (R>25.5) galaxies probed by the Damped Ly-alpha Absorbers (DLAs). Here we present the first results of our program, namely the results from a deep Ly-alpha study of the field of the z=2.85 DLA towards Q2138-4427.

J. P. U. Fynbo; C. Ledoux; P. Moller; B. Thomsen; I. Burud; B. Leibundgut

2002-05-15T23:59:59.000Z

467

Calculating alpha Eigenvalues in a Continuous-Energy Infinite Medium with Monte Carlo  

SciTech Connect (OSTI)

The {alpha} eigenvalue has implications for time-dependent problems where the system is sub- or supercritical. We present methods and results from calculating the {alpha}-eigenvalue spectrum for a continuous-energy infinite medium with a simplified Monte Carlo transport code. We formulate the {alpha}-eigenvalue problem, detail the Monte Carlo code physics, and provide verification and results. We have a method for calculating the {alpha}-eigenvalue spectrum in a continuous-energy infinite-medium. The continuous-time Markov process described by the transition rate matrix provides a way of obtaining the {alpha}-eigenvalue spectrum and kinetic modes. These are useful for the approximation of the time dependence of the system.

Betzler, Benjamin R. [Los Alamos National Laboratory; Kiedrowski, Brian C. [Los Alamos National Laboratory; Brown, Forrest B. [Los Alamos National Laboratory; Martin, William R. [Los Alamos National Laboratory

2012-09-04T23:59:59.000Z

468

alpha-Amylase biosynthesis: signal sequence prevents normal conversion of the unprocessed precursor molecule to the biologically active form  

Science Journals Connector (OSTI)

alpha-Amylase biosynthesis: signal sequence prevents...processed and glycosylated form of alpha-amylase molecules. The two precursors as well...in the series "Enzymic mechanism of starch break- down in germinating rice seeds." Paper...

S Miyata; T Akazawa

1982-01-01T23:59:59.000Z

469

RADON: A BIBLIOGRAPHY  

E-Print Network [OSTI]

Consulting. (Uranium City, Saskatchewan. Canada) Summary ofKeith Consulting. (Uranium City. Saskatchewan. Canada) Radontins. (Uranium City. Saskatchewan, Canada) IS p. , 03//79.

Lepman, S.R.

2010-01-01T23:59:59.000Z

470

Radon lung dosimetry models  

Science Journals Connector (OSTI)

......and specifies the breathing cycle times within a given breath...Reineking(28) 9.0 (working+diesel) 6.7 (without working Harley...20. bAerosols produced by diesel combustion and mining processes...2.041 Gy at R2 (24). In general, about 10 % of the total bifurcation......

W. Hofmann; R. Winkler-Heil

2011-05-01T23:59:59.000Z

471

RADON: A BIBLIOGRAPHY  

E-Print Network [OSTI]

Naturally occurring radionuclides in building materials are a source of external and internal radiation

Lepman, S.R.

2010-01-01T23:59:59.000Z

472

Daytime Secretion of Salivary Cortisol and Alpha-Amylase in Preschool-Aged Children with Autism and Typically Developing Children  

Science Journals Connector (OSTI)

We examined daytime salivary cortisol and salivary alpha-amylase (sAA) secretion levels and variability in...

Sharon A. Kidd; Blythe A. Corbett

2012-12-01T23:59:59.000Z

473

Spatially Resolved Gas Kinematics within a Ly$\\alpha$ Nebula: Evidence for Large-scale Rotation  

E-Print Network [OSTI]

We use spatially extended measurements of Ly$\\alpha$ as well as less optically thick emission lines from an $\\approx$80 kpc Ly$\\alpha$ nebula at $z\\approx1.67$ to assess the role of resonant scattering and to disentangle kinematic signatures from Ly$\\alpha$ radiative transfer effects. We find that the Ly$\\alpha$, CIV, HeII, and CIII] emission lines all tell a similar story in this system, and that the kinematics are broadly consistent with large-scale rotation. First, the observed surface brightness profiles are similar in extent in all four lines, strongly favoring a picture in which the Ly$\\alpha$ photons are produced in situ instead of being resonantly scattered from a central source. Second, we see low kinematic offsets between Ly$\\alpha$ and the less optically thick HeII line ($\\sim$100-200 km s$^{-1}$), providing further support for the argument that the Ly$\\alpha$ and other emission lines are all being produced within the spatially extended gas. Finally, the full velocity field of the system shows cohe...

Prescott, Moire K M; Dey, Arjun

2014-01-01T23:59:59.000Z

474

First-principles study of the crystal and electronic structures of {alpha}-tetragonal boron  

SciTech Connect (OSTI)

The crystal and electronic structures of {alpha}-tetragonal ({alpha}-t) boron were investigated by first-principles calculation. Application of a simple model assuming 50 atoms in the unit cell indicated that {alpha}-t boron had a metallic density of state, thus contradicting the experimental fact that it is a p-type semiconductor. The presence of an additional two interstitial boron atoms at the 4c site made {alpha}-t boron semiconductive and the most stable. The cohesive energy per atom was as high as those of {alpha}- and {beta}-rhombohedral boron, suggesting that {alpha}-t boron is produced more easily than was previously thought. The experimentally obtained {alpha}-t boron in nanobelt form had about two interstitial atoms at the 8i sites. We consider that the shallow potential at 8i sites generates low-energy phonon modes, which increase the entropy and consequently decrease the free energy at high temperatures. Calculation of the electronic band structure showed that the highest valence band had a larger dispersion from {Gamma} to Z than from {Gamma} to X; this indicated a strong anisotropy in hole conduction. - Graphical abstract: Calculated electron densities of B{sub 50} and B{sub 50}+2B at site 4c (configuration B).

Hayami, Wataru, E-mail: hayami.wataru@nims.go.j [Exploratory Nanomaterials Research Laboratory, National Institute for Materials Science, 1-1 Namiki, Tsukuba, Ibaraki 305-0044 (Japan); Otani, Shigeki [Exploratory Nanomaterials Research Laboratory, National Institute for Materials Science, 1-1 Namiki, Tsukuba, Ibaraki 305-0044 (Japan)

2010-07-15T23:59:59.000Z

475

Measurement of the cross section of charmed hadrons and the nuclear dependence alpha  

SciTech Connect (OSTI)

With data from the SELEX experiment we study charm hadro-production. We report the differential production cross sections as function of the longitudinal and transverse momentum, as well as for two different target materials, of 14 charmed hadron and/or their decay modes. This is the most extensive study to date. SELEX is a fixed target experiment at Fermilab with high forward acceptance; it took data during 1996-1997 with 600 GeV/c {Sigma}{sup -} and {pi}{sup -}, and 540 GeV/c proton and {pi}{sup +} beams. It used 5 target foils (two copper and three diamond). We use the results to determine {alpha}, used in parametrizing the production cross section as {infinity} A{sup {alpha}}, where A is the mass number of the target nuclei. We found within our statistics that {alpha} is independent of the longitudinal momentum fraction x{sub F} in the interval 0.1 < x{sub F} < 1.0, with {alpha} = 0.778 {+-} 0.014. The average value of {alpha} for charm production by pion beams is {alpha}{sub meson} = 0.850 {+-} 0.028. This is somewhat larger than the corresponding average {alpha}{sub baryon} = 0.755 {+-} 0.016 for charm production by baryon beams ({Sigma}{sup -} and protons).

Blanco-Covarrubias, E.Alejandro; /San Luis Potosi U.

2009-12-01T23:59:59.000Z

476

Kelvin--Helmholtz instability in solar H-alpha surges  

E-Print Network [OSTI]

We study the evolutionary conditions for Kelvin--Helmholtz (KH) instability in a H-alpha solar surge observed in NOAA AR 8227 on 1998 May 30. The jet with speeds in the range of 45--50 km/s, width of 7 Mm, and electron number density of 3.83 x 10^{10} cm^{-3} is assumed to be confined in a twisted magnetic flux tube embedded in a magnetic field of 7 G. The temperature of the plasma flow is of the order of 10^5 K while that of its environment is taken to be 2 x 10^6 K. The electron number density of surrounding magnetized plasma has a typical for the TR/lower corona region value of 2 x 10^{9} cm^{-3}. Under these conditions, the Alfven speed inside the jet is equal to 78.3 km/s. We model the surge as a moving magnetic flux tube for two magnetic field configurations: (i) a twisted tube surrounded by plasma with homogeneous background magnetic field, and (ii) a twisted tube which environment is plasma with also twisted magnetic field. The magnetic field twist in given region is characterized by the ratio of azim...

Zhelyazkov, I; Chandra, R; Srivastava, A K; Mishonov, T

2015-01-01T23:59:59.000Z

477

Making Damped Lyman Alpha Systems in Semi-Analytic Models  

E-Print Network [OSTI]

The velocity profiles of weak metal absorption lines can be used to observationally probe the kinematic state of gas in damped Lyman-alpha systems. Prochaska and Wolfe have argued that the flat distribution of velocity widths combined with the asymmetric line profiles indicate that the DLAS are disks with large rotation velocities. An alternative explanation has been proposed by Haehnelt, Steinmetz, and Rauch, in which the observed large velocity widths and asymmetric profiles can be produced by lines of sight passing through two or more clumps each having relatively small internal velocity dispersions. We investigate the plausibility of this scenario in the context of semi-analytic models based on hierarchical merging trees and including simple treatments of gas dynamics, star formation, supernova feedback, and chemical evolution. We find that all the observed properties of the metal-line systems including the distribution of velocities and the asymmetric profiles, can be reproduced by lines of sight passing through sub-clumps that are bound within larger virialized dark matter halos. In order to produce enough multiple hits, we find that the cold gas must be considerably more extended than the optical radius of the proto-galaxies, perhaps even beyond the tidal radius of the sub-halo. This could occur due to tidal stripping or supernova-driven outflows.

Ariyeh H. Maller; Rachel S. Somerville; Jason X. Prochaska; Joel R. Primack

1998-12-20T23:59:59.000Z

478

Performance of International Space Station Alpha electric power systems  

SciTech Connect (OSTI)

The International Space Station Alpha (ISSA) will be an Earth-orbiting laboratory in space. It will house experimental payloads, distribute resource utilities, and support human habitation for conducting research and science experiments in a microgravity environment. Electrical power is a major utility to support successful achievement of the mission goal. The ISSA United States On-Orbit Segment (USOS) Electric Power System (EPS) power generation capability will vary with orbital parameters, natural and induced environment, and hardware aging/replacement throughout the ISSA life. Power capability will be further restricted by various assembly configurations during ISSA buildup, by various flight attitudes, by shadowing on the solar arrays, by EPS operational constraints, such as pointing accuracy, battery charging, as well as operating voltage setpoints, and by ISSA operational constraints either to avoid long-term solar array shadowing from the adjacent solar array or to accommodate ISSA maneuver during proximity operations with other space vehicles, mating, and departing. Design of the ISSA USOS EPS takes into consideration the various equipment degradation modes, operation constraints, and orbital conditions to make it compatible with the environments and to meet power, lifetime, and performance requirements.

Hill, R.; Lu, C.Y.; Padhye, V.; Hajela, G.; Hague, L. [Rockwell International, Canoga Park, CA (United States). Rocketdyne Division

1995-12-31T23:59:59.000Z

479

Shadow prediction model for the International Space Station Alpha  

SciTech Connect (OSTI)

A Fortran computer model, SHADOW5, was developed to predict shadows on the solar arrays of the International Space Station Alpha (ISSA) for general flight modes. This shadow model was incorporated into the EPSOP-F (Electrical Power System On-Orbit Performance) program to conduct ISSA power analyses for various operating conditions. This paper describes the mathematical methods of the model and shows the typical results predicted with the model. Vector analyses with coordinate transformations were used to trace the shadows between the potential shadowing and shadowed components of the station during the sun portion of the orbit. Including the space shuttle orbiter, 40 components were modeled. The basic shapes of the components were assumed to be either planar or cylindrical. The elemental areas obtained from the Cartesian grid lines allocated on the component surfaces were projected in the sun vector direction to reconstruct shadows on the shadowed planar surface. Comparison of predicted results with other models showed good agreement. Ease of preparing input data and relatively short CPU time make this model suitable for shadow analyses required for the many design and flight configurations of the space station.

Chung, D.K. [Rockwell International, Canoga Park, CA (United States). Rocketdyne Division

1995-12-31T23:59:59.000Z

480

SOLAR H{alpha} OSCILLATIONS FROM INTENSITY AND DOPPLER OBSERVATIONS  

SciTech Connect (OSTI)

Chromospheric wave activity around flares and filaments has been a research focus for years, and could provide indirect measurements of local conditions that are not otherwise accessible. One interesting observed phenomenon is oscillations in filaments, activated by distant flares and the large-scale waves they produce. Characteristics of these oscillations, such as periods, amplitudes, and lifetimes, can provide unique information about the filament. We measure oscillation properties in flares and filaments from H{alpha} chromospheric data using a new method that provides important spatial and frequency content of the dynamics. We apply the method to two flare events where filaments are observed to oscillate and determine their properties. We find strong oscillatory signal in flaring active regions in the chromosphere over a range of frequencies. Two filaments are found to oscillate without any detectable chromospheric wave acting as an activation mechanism. We find that filaments oscillate with periods of tens of minutes, but variations are significant at small spatial scales along the filamentary region. The results suggest that there is a frequency dependence of the oscillation amplitude, as well as a spatial dependence along single filaments that is more difficult to quantify. It also appears that the strength of the oscillations does not necessarily depend on the strength of the trigger, although there are other possible effects that make this conclusion preliminary. Applications of this technique to other events and different data sets will provide important new insights into the local energy densities and magnetic fields associated with dynamic chromospheric structures.

Jackiewicz, Jason [New Mexico State University, Department of Astronomy, P.O. Box 30001, MSC 4500, Las Cruces, NM 88003 (United States)] [New Mexico State University, Department of Astronomy, P.O. Box 30001, MSC 4500, Las Cruces, NM 88003 (United States); Balasubramaniam, K. S., E-mail: jasonj@nmsu.edu [Space Vehicles Directorate, Air Force Research Laboratory, Kirtland AFB, NM 87114 (United States)

2013-03-01T23:59:59.000Z

Note: This page contains sample records for the topic "alpha excluding radon" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

Nonradioactive demonstration of the Alpha D and D Pilot Facility  

SciTech Connect (OSTI)

The Alpha-Contained Decontamination and Disassembly (AD and D) pilot facility was designed to demonstrate the process flowsheet under conditions typical to those expected in a production facility. To achieve this, nonradioactive waste items similar to those in retrievable storage at the Savannah River Plant burial ground (e.g. gloveboxes), were chemically sprayed and size reduced. During process runs, parameters such as feed rate, oxide removal, etching rate, and secondary waste generation were determined. The exhaust system was monitored during operation to ensure that exhaust from the facility was sufficiently filtered before release to the atmosphere. The strategy for decontamination techniques required development during the nonradioactive testing period. Under investigation during process runs were both once-through and recirculating washes, and their correlation to oxide removal and etching rates on the stainless steel feed items. Wash products of the decontamination process were analyzed for concentration of Ni, Cr, Fe, Mn, and Si, major components of stainless steel. Size reduction techniques were also developed during the nonradioactive testing period. An array of conventional power and pneumatic tools were tested and evaluated. Plasma arc torch operating parameters; standoff distance, ampere setting, and cutting angle were determined.

Wobser, J.K.

1983-01-01T23:59:59.000Z

482

Comparison of nonerythroid alpha-spectrin genes reveals strict homology among diverse species.  

Science Journals Connector (OSTI)

...excluded by four discordant hybrids. LITERATURE CITED 1. Barton...q24) by somatic cell hybrid analysis and in situ hybridization...x human diploid fibroblast hybrids. Somatic Cell Genet. 7...V. T. 1985. Stabilizing infrastructure of cell mem- branes. Annu...

T L Leto; D Fortugno-Erikson; D Barton; T L Yang-Feng; U Francke; A S Harris; J S Morrow; V T Marchesi; E J Benz Jr

1988-01-01T23:59:59.000Z

483

A measurement of $alpha_s(Q^2)$ from the Gross-Llewellyn Smith Sum Rule  

E-Print Network [OSTI]

We extract a set of values for the Gross-Llewellyn Smith sum rule at different values of 4-momentum transfer squared ($Q^{2}$), by combining revised CCFR neutrino data with data from other neutrino deep-inelastic scattering experiments for $1 < Q^2 < 15 GeV^2/c^2$. A comparison with the order $\\alpha^{3}_{s}$ theoretical predictions yields a determination of $\\alpha_{s}$ at the scale of the Z-boson mass of $0.114 \\pm^{.009}_{.012}$. This measurement provides a new and useful test of perturbative QCD at low $Q^2$, because of the low uncertainties in the higher order calculations.

J. H. Kim; D. A. Harris

1998-08-19T23:59:59.000Z

484

alpha. -Amylase of Clostridium thermosulfurogenes EM1: Nucleotide sequence of the gene, processing of the enzyme, and comparison to other. alpha. -amylases  

SciTech Connect (OSTI)

The nucleotide sequence of the {alpha}-amylase gene (amyA) from Clostridium thermosulfurogenes EM1 cloned in Escherichia coli was determined. The reading frame of the gene consisted of 2,121 bp. Comparison of the DNA sequence data with the amino acid sequence of the N terminus of the purified secreted protein of C. thermosulfurogenes Em1 suggested that the {alpha}-amylase is translated form mRNA as a secretory precursor with a signal peptide of 27 amino acid residues. The deduced amino acid sequence of the mature {alpha}-amylase contained 679 residues, resulting in a protein with a molecular mass of 75,112 Da. In E. coli the enzyme was transported to the periplasmic space and the signal peptide was cleaved at exactly the same site between two alanine residues. Comparison of the amino acid sequence of the C. thermosulfurogenes EM1 {alpha}-amylase with those from other bacterial and eukaryotic {alpha}-amylases showed several homologous regions, probably in the enzymatically functioning regions. The tentative Ca{sup 2+}-binding site (consensus region I) of this Ca{sub 2+}-independent enzyme showed only limited homology. The deduced amino acid sequence of a second obviously truncated open reading frame showed significant homology to the malG gene product of E. coli. Comparison of the {alpha}-amylase gene region of C. thermosulfurogenes EM1 (DSM3896) with the {beta}-amylase gene region of C. thermosulfurogenes (ATCC 33743) indicated that both genes have been exchanged with each other at identical sites in the chromosomes of these strains.

Bahl, H.; Burchhardt, G.; Spreinat, A.; Haeckel, K.; Wienecke, A.; Antranikian, G.; Schmidt, B. (Georg-August-Univ., Gottingen (Germany))

1991-05-01T23:59:59.000Z

485

Vegetation uptake from burial ground alpha waste trenches  

SciTech Connect (OSTI)

This study was conducted as part of an evaluation of the potential radiological consequences of reinhabiting the SRS burial ground. The objective was to determine the uptake of buried, low-level, transuranic waste from unlined earthen trenches by forest vegetation. Two tree plots were established in 1979. One plot was put over a trench containing alpha waste and the other in an area without trenches. When the tree seedlings were sampled during 1979 and 1980, and analysized for {sup 239}Pu and {sup 238}Pu, there was only a small difference in radionuclude concentration between trees planted over the trench and those planted on the control plot because of the limited root intrusion into the trench by the seedlings. However, when trees were sample in 1986, 1987, and 1988 and analyzed for {sup 241}Am, {sup 238}Pu, {sup 239}Pu, and {sup 237}Np activity, the average activity of all of these isotopes was significantly higher over the trenches than in the control plot. These measurements indicate that tree roots will extract transuranic isotopes from buried, low-level waste. The amount of radioisotopes moved from the trenches to the surface is small and the level in the trees is low enough that dose from exposure will be small. The long term effects of transport of radioisotopes from the trenches to the surface soil was evaluated by estimating the accumulation in the surface soil. Transuranic activity in selected food crops was calculated using the soil activity and the literature derived concentration factors. In all cases, the activity of the transuranic isotopes in the edible portion of the plants was quite low. The activity in the leaf tissue was much higher than in the seed. However, it should be noted that in only one case was the activity higher than the naturally occurring activity of {sup 40}K in the pine foliage.

Murphy, C.E. Jr.; Tuckfield, R.C.

1989-01-01T23:59:59.000Z

486

E-Print Network 3.0 - alpha-tocopherol beta-carotene cancer Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

beta-carotene cancer Search Powered by Explorit Topic List Advanced Search Sample search results for: alpha-tocopherol beta-carotene cancer Page: << < 1 2 3 4 5 > >> 1 Consommation...

487

E-Print Network 3.0 - anti-tcr alpha beta Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Technologies and Information Sciences 4 VANDERBILT UNIVERSITY OFFICE OF CAMPUS RECREATION Summary: 1 Alpha Tau Omega 2 II 2 Beta Theta Pi 3 III 3 Deke DROP II 4 Sigma Nu III...

488

E-Print Network 3.0 - alpha -trihydroxy-5 beta Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Technologies and Information Sciences 4 VANDERBILT UNIVERSITY OFFICE OF CAMPUS RECREATION Summary: 1 Alpha Tau Omega 2 II 2 Beta Theta Pi 3 III 3 Deke DROP II 4 Sigma Nu III...

489

E-Print Network 3.0 - alpha beta t-cell Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Technologies and Information Sciences 4 VANDERBILT UNIVERSITY OFFICE OF CAMPUS RECREATION Summary: 1 Alpha Tau Omega 2 II 2 Beta Theta Pi 3 III 3 Deke DROP II 4 Sigma Nu III...

490

E-Print Network 3.0 - alpha 1i chain Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

de Mxico Collection: Mathematics 4 VANDERBILT UNIVERSITY OFFICE OF CAMPUS RECREATION Summary: Chi 2 II 6 Sigma Alpha Epsilon 1 I I 7 Phi Psi II III 8 Phi Gamma Delta 4 I...

491

E-Print Network 3.0 - alpha 1-3gal beta Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Biotechnology ; Biology and Medicine 5 VANDERBILT UNIVERSITY OFFICE OF CAMPUS RECREATION Summary: 1 Alpha Tau Omega 2 II 2 Beta Theta Pi 3 III 3 Deke DROP II 4 Sigma Nu III...

492

E-Print Network 3.0 - alpha -fetoprotein controls Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Engineering ; Mathematics 65 NetInfo Editions 4.x User Manual Summary: and Internet addresses: alpha 192.42.172.1 bravo 192.42.172.2 charlie 192.42.172.3 Two of the...

493

E-Print Network 3.0 - alpha 1-microglobulin destroys Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Technologies and Information Sciences 4 NetInfo Editions 4.x User Manual Summary: and Internet addresses: alpha 192.42.172.1 bravo 192.42.172.2 charlie 192.42.172.3 Two of the...

494

E-Print Network 3.0 - alpha -spectrometric determination Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

to determine its configuration. These files are all flat, or ASCII files, and must... and Internet addresses: alpha 192.42.172.1 bravo 192.42.172.2 charlie 192.42.172.3 Two of the...

495

E-Print Network 3.0 - alpha -chloro ethers Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Technologies and Information Sciences 31 NetInfo Editions 4.x User Manual Summary: and Internet addresses: alpha 192.42.172.1 bravo 192.42.172.2 charlie 192.42.172.3 Two of the...

496

E-Print Network 3.0 - alpha indirect conversion Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Technologies and Information Sciences 77 NetInfo Editions 4.x User Manual Summary: and Internet addresses: alpha 192.42.172.1 bravo 192.42.172.2 charlie 192.42.172.3 Two of the...

497

E-Print Network 3.0 - alpha -reductase activity Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Biology and Medicine ; Chemistry 82 NetInfo Editions 4.x User Manual Summary: and Internet addresses: alpha 192.42.172.1 bravo 192.42.172.2 charlie 192.42.172.3 Two of the...

498

E-Print Network 3.0 - alpha-synuclein processing aggregation...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

FEBS Lett. 2002;522(1-3):9-13. 25... and Aggregation of Alpha-Synuclein in Organic Solvents: Modeling the Effects of Membranes. Biochemistry. 2003... the conformation of...

499

E-Print Network 3.0 - alpha ligands activate Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

256, 201213 The Automatic Search for Ligand Binding Sites in Summary: CPA, 4CPA, 5CPA, alpha-amylase 6TAA) their binding location was predicted as a part of the active site......

500

Characteristics of alpha-amylase isozymes in cytologenetically different wheat cultivars  

Science Journals Connector (OSTI)

The isoenzyme composition of alpha-amylase is studied by polyacrylamide gel electrophoresis in...Triticum durum, 2n = 4x = 28, BBAA) lacks the isoenzymes encoded by 6D and 7D chromosomes that are present in commo...

V. P. Netsvetaev; E. D. Badaeva

2014-07-01T23:59:59.000Z