Powered by Deep Web Technologies
Note: This page contains sample records for the topic "ak mi gom" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

NETL: Methane Hydrates - DOE/JIP GOM Hydrate Research Cruise  

NLE Websites -- All DOE Office Websites (Extended Search)

While Drilling Operations The downhole logging while drilling (LWD) operations in the Gulf of Mexico Gas Hydrate JIP Drilling Program (GOM-JIP) was designed in part to obtain...

2

NETL: Methane Hydrates - DOE/JIP GOM Hydrate Research Cruise  

NLE Websites -- All DOE Office Websites (Extended Search)

Wireline Logging Wireline Logging From: Timothy Collett, USGS Conventional Wireline Logging Operations in the Gulf of Mexico Gas Hydrate JIP Drilling Program Conventional wireline (CWL) logging operations in the Gulf of Mexico Gas Hydrate JIP Drilling Program (GOM-JIP) was scheduled to include the deployment of a signal logging string (Figure 1) and a vertical seismic profiling (VSP) tool (Figure 2) in several of the Atwater Valley and Keathley Canyon drill sites. The only wireline logging tool scheduled to be deployed was the FMS-sonic tool string, which consisted of the Formation MicroScanner (FMS), a general purpose inclinometer tool (GPIT), and scintillation gamma ray tool (SGT), and the dipole shear sonic imager tool (DSI). The vertical seismic imager tool (VSI) will also be deployed during the GOM-JIP drilling program. The wireline logging tools were provided by Schlumberger wireline services.

3

Performance Evaluation of HYCOM-GOM for Hydrokinetic Resource Assessment in the Florida Strait  

SciTech Connect

The U.S. Department of Energy (DoE) is assessing and mapping the potential off-shore ocean current hydrokinetic energy resources along the U.S. coastline, excluding tidal currents, to facilitate market penetration of water power technologies. This resource assessment includes information on the temporal and three-dimensional spatial distribution of the daily averaged power density, and the overall theoretical hydrokinetic energy production, based on modeled historical simulations spanning a 7-year period of record using HYCOM-GOM, an ocean current observation assimilation model that generates a spatially distributed three-dimensional representation of daily averaged horizontal current magnitude and direction time series from which power density time series and their statistics can be derived. This study ascertains the deviation of HYCOM-GOM outputs, including transport (flow) and power density, from outputs based on three independent observation sources to evaluate HYCOM-GOM performance. The three independent data sources include NOAA s submarine cable data of transport, ADCP data at a high power density location, and HF radar data in the high power density region of the Florida Strait. Comparisons with these three independent observation sets indicate discrepancies with HYCOM model outputs, but overall indicate that the HYCOM-GOM model can provide an adequate assessment of the ocean current hydrokinetic resource in high power density regions like the Florida Strait. Additional independent observational data, in particular stationary ADCP measurements, would be useful for expanding this model performance evaluation study. ADCP measurements are rare in ocean environments not influenced by tides, and limited to one location in the Florida Strait. HF radar data, although providing great spatial coverage, is limited to surface currents only.

Neary, Vincent S [ORNL; Gunawan, Budi [ORNL; Ryou, Albert S [ORNL

2012-06-01T23:59:59.000Z

4

NETL: National Methane Hydrates R&D Program- 2009 GOM JIP Expedition  

NLE Websites -- All DOE Office Websites (Extended Search)

Expedition - The LWD Program Expedition - The LWD Program GoM JIP Leg II will feature a state-of-the-art LWD tool combination that will provide unprecedented information on the nature of the sediments and their pore fill constituents. The program will feature full research-level LWD data on formation lithology and porosity, and will include Schlumberger’s MP3 (quadrapole sonic tool) and PeriScope (3-D high-resolution resistivity) tools. These tools will provide full 3-D information on the both acoustic (both compressional and shear wave) and electrical properties of the sediment enabling the improved evaluation of gas hydrate in both pore filling and fracture-filling modes. This full suite of LWD tools includes the 4.75" MP3 multipole acoustic tool immediately behind the 6.75" bit, followed by an 8.5" reamer which opens up the hole for the 6.75" LWD tools that follow. These include the geoVISION resistivity imaging tool, the EcoScope integrated propagation resistivity, density and neutron tool, the TeleScope MWD tool, the PeriScope directional propagation resistivity tool, and the sonicVISION monopole acoustic tool whose sensors are ~160 ft above the bit.

5

NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA  

Gasoline and Diesel Fuel Update (EIA)

176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY...

6

Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...

7

US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.

8

US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.

9

RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.

10

DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility

11

miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed

12

Port Nikiski, AK Liquefied Natural Gas Exports to Japan (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Nikiski, AK Liquefied Natural Gas Exports to Japan (Dollars per Thousand Cubic Feet) Port Nikiski, AK Liquefied Natural Gas Exports to Japan (Dollars per Thousand Cubic Feet)...

13

Kenai, AK Liquefied Natural Gas Exports to Russia (Dollars per...  

U.S. Energy Information Administration (EIA) Indexed Site

Kenai, AK Liquefied Natural Gas Exports to Russia (Dollars per Thousand Cubic Feet) Kenai, AK Liquefied Natural Gas Exports to Russia (Dollars per Thousand Cubic Feet) Decade...

14

MI  

NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)

15

DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP

16

DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4

17

RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...

18

St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...

19

DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.

20

miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either

Note: This page contains sample records for the topic "ak mi gom" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

AK-TRIBE-NATIVE VILLAGE OF NAPAKIAK  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

AK-TRIBE-NATIVE VILLAGE OF NAPAKIAK AK-TRIBE-NATIVE VILLAGE OF NAPAKIAK Energy Efficiency and Conservation Block Grant Program Location: Tribe AK-TRIBE-NATIVE VILLAGE OF NAPAKIAK AK American Recovery and Reinvestment Act: Proposed Action or Project Description The Native Village of Napakiak proposes to renovate/retrofit two buildings (Health Clinic and Community Center [former Transportation Building]) to become more energy efficient. Energy efficiency retrofits would include improvements to lighting systems, supplemental loads, air distribution systems, and/or heating and cooling systems, insulation, and windows/doors. Conditions: None Categorical Exclusion(s) Applied: B2.5, B5.1 *-For the complete DOE National Environmental Policy Act regulations regarding categorical exclusions, see Subpart D of 10 CFR10 21

22

AOCS Official Method Ak 2-92  

Science Conference Proceedings (OSTI)

Determination of Chlorophyll Content in Rapeseed/Canola (Colza) by Spectrometry AOCS Official Method Ak 2-92 Methods Methods and Analyses Analytical Chemistry Methods Downloads DEFINITION This method, adopted fr

23

AOCS Official Method Ak 3-94  

Science Conference Proceedings (OSTI)

Oil Content of Oilseeds by Nuclear Magnetic Resonance AOCS Official Method Ak 3-94 Methods Methods and Analyses Analytical Chemistry Methods Downloads DEFINITION This method determines the oil content of rapesee

24

AOCS Official Method Ak 1-92  

Science Conference Proceedings (OSTI)

Determination of Glucosinolate Content in Rapeseed and Canola by HPLC AOCS Official Method Ak 1-92 Methods Methods and Analyses Analytical Chemistry Methods Downloads DEFINITION This method, adopted from Part 1

25

AOCS Official Method Ak 5-01  

Science Conference Proceedings (OSTI)

Simultaneous Determination of Oil and Moisture Contents of Oilseeds Residues Pulsed Nuclear Magnetic Resonance Spectrometry AOCS Official Method Ak 5-01 Methods Methods and Analyses Analytical Chemistry Methods Downloads DEFINI

26

DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated

27

Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...

28

DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical

29

MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab

2008-10-01T23:59:59.000Z

30

DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP

31

Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)

2012-01-01T23:59:59.000Z

32

RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state

33

Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mkinen; Jorma Tarhio

2010-02-01T23:59:59.000Z

34

AOCS Recommended Practice Ak 4-95  

Science Conference Proceedings (OSTI)

Simultaneous Determination of Oil and Moisture Contents of Oilseeds Using Pulsed Nuclear Magnetic Resonance Spectrometry AOCS Recommended Practice Ak 4-95 Methods Methods and Analyses Analytical Chemistry Methods Downloads 339DD158D48E89A94ECC0763578B

35

Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png

36

Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls

37

,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...

38

,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...

39

Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.

40

Kenai, AK Liquefied Natural Gas Exports to China (Million Cubic...  

U.S. Energy Information Administration (EIA) Indexed Site

to China (Million Cubic Feet) Kenai, AK Liquefied Natural Gas Exports to China (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 1,127 - No Data...

Note: This page contains sample records for the topic "ak mi gom" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

AK-TRIBE-CENTRAL COUNCIL OF TLINGIT AND HAIDA INDIANS  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

AK-TRIBE-CENTRAL COUNCIL OF TLINGIT AND HAIDA INDIANS AK-TRIBE-CENTRAL COUNCIL OF TLINGIT AND HAIDA INDIANS Location: Tribe AK-TRIBE- CENTRAL COUNCIL OF TLINGIT AND HAIDA INDIANS AK American Recovery and Reinvestment Act: Proposed Action or Project Description The Central Council of the Tlingit and Haida Indian Tribes of Alaska propose to conduct energy audits of tribally owned facilities. Specific retrofit activities will be determined based on the results of the audits, and these retrofit activities will be submitted for appropriate NEPA review. Conditions: None Categorical Exclusion(s) Applied: A9, B5.1 *-For the complete DOE National Environmental Policy Act regulations regarding categorical exclusions, see Subpart D of 10 CFR10 21 This action would not: threaten a violation of applicable statutory, regulatory, or permit requirements for environment, safety, and health,

42

Ak-Chin Electric Utility Authority | Open Energy Information  

Open Energy Info (EERE)

Ak-Chin Electric Utility Authority Ak-Chin Electric Utility Authority Jump to: navigation, search Name Ak-Chin Electric Utility Authority Place Arizona Utility Id 25866 Utility Location Yes Ownership S NERC Location WECC NERC WECC Yes Activity Buying Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates Residential: $0.1010/kWh Commercial: $0.0815/kWh Industrial: $0.0550/kWh The following table contains monthly sales and revenue data for Ak-Chin Electric Utility Authority (Arizona).

43

Building Energy Software Tools Directory: AkWarm  

NLE Websites -- All DOE Office Websites (Extended Search)

AkWarm AkWarm AkWarm logo. Innovative, user-friendly, Windows-based software for home energy modeling. AkWarm is designed for weatherization assessment and the EPA Energy Star Home energy rating program. Features include: Graphical display of energy use by building component, improvement options analysis, design heat load, calculates CO2 emissions, and shows code compliance. Utility, weather data, and other libraries are maintained in a database library for easy updating. A separate database is available to archive all input and output data for detailed analysis of housing types, trends, amd energy use. Keywords home energy rating systems, home energy, residential modeling, weatherization Validation/Testing N/A Expertise Required Basic understanding of building construction, with a minimal level of

44

GRR/Section 13-AK-a - Land Use Assessment | Open Energy Information  

Open Energy Info (EERE)

GRRSection 13-AK-a - Land Use Assessment < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 13-AK-a -...

45

GRR/Section 9-AK-a - State Environmental Process | Open Energy...  

Open Energy Info (EERE)

GRRSection 9-AK-a - State Environmental Process < GRR Jump to: navigation, search Retrieved from "http:en.openei.orgwindex.php?titleGRRSection9-AK-a-StateEnvironmentalP...

46

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:

47

The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.

2005-05-01T23:59:59.000Z

48

DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co

49

DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP

50

DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;

51

DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:

52

DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on

53

AK-TRIBE-ASSOCIATION OF VILLAGE COUNCIL PRESIDENTS, INC  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

U.S. Department of Energy U.S. Department of Energy Categorical Exclusion Determination Form Program or Field Office: Energy Efficiency and Conservation Block Grant Program Project Title AK-TRIBE-ASSOCIATION OF VILLAGE COUNCIL PRESIDENTS, INC Location: Tribe AK-TRIBE- ASSOCIATION OF VILLAGE COUNCIL PRESIDENTS, INC AK American Recovery and Reinvestment Act: Proposed Action or Project Description: The Association of Village Council Presidents, Inc., (AVCP) proposes to renovate a steel-constructed building, built circa 1990 (First Avenue Building, US Survey 1002 Parcel 1, Lot 1), located in Bethel, Alaska, to an office building. Proposed building retrofits would include installation of an (EPA certified) wood-fired central boiler, a conventional (household size) energy efficient oil-fired boiler, a heat distribution

54

REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

55

MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units

56

Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper

2012-02-20T23:59:59.000Z

57

Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani

2012-10-01T23:59:59.000Z

58

Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel

2010-01-01T23:59:59.000Z

59

MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani

2012-12-01T23:59:59.000Z

60

Ak-Chin Indian Community Biomass Feasiiblity Study  

Science Conference Proceedings (OSTI)

Study of the conversion of chicken litter to biogas for the production of energy. There was an additional requirement that after extracting the energy from the chicken litter the nutrient value of the raw chicken litter had to be returned to the Ak-Chin Farms for use as fertilizer in a form and delivery method acceptable to the Farm.

Mark A. Moser, RCM Digesters, Inc.; Mark Randall, Daystar Consulting, LLC; Leonard S. Gold, Ak-Chin Energy Services & Utility Strategies Consulting Group

2005-12-31T23:59:59.000Z

Note: This page contains sample records for the topic "ak mi gom" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

Kenai, AK Liquefied Natural Gas Exports to Japan (Million Cubic...  

U.S. Energy Information Administration (EIA) Indexed Site

Million Cubic Feet) Kenai, AK Liquefied Natural Gas Exports to Japan (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 1,856 1,908 1,915 1,913 1,915...

62

Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)

2011-12-01T23:59:59.000Z

63

NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA  

Gasoline and Diesel Fuel Update (EIA)

0.00-1.99 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1996 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1996 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: In 1996, consumption of natural gas for agricultural use

64

GRR/Section 1-AK-a - Land Use Considerations | Open Energy Information  

Open Energy Info (EERE)

Page Edit with form History Facebook icon Twitter icon GRRSection 1-AK-a - Land Use Considerations < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY...

65

A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)

2012-07-15T23:59:59.000Z

66

File:INL-geothermal-ak.pdf | Open Energy Information  

Open Energy Info (EERE)

ak.pdf ak.pdf Jump to: navigation, search File File history File usage Alaska Geothermal Resources Size of this preview: 697 × 599 pixels. Other resolution: 698 × 600 pixels. Full resolution ‎(5,418 × 4,660 pixels, file size: 2.26 MB, MIME type: application/pdf) Description Alaska Geothermal Resources Sources Idaho National Laboratory Authors Patrick Laney; Julie Brizzee Related Technologies Geothermal Creation Date 2003-11-01 Extent State Countries United States UN Region Northern America States Alaska File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 12:21, 16 December 2010 Thumbnail for version as of 12:21, 16 December 2010 5,418 × 4,660 (2.26 MB) MapBot (Talk | contribs) Automated upload from NREL's "mapsearch" data

67

Recovery Act: Waste Energy Project at AK Steel Corporation Middletown  

Science Conference Proceedings (OSTI)

In 2008, Air Products and Chemicals, Inc. (Air Products) began development of a project to beneficially utilize waste blast furnace topgas generated in the course of the iron-making process at AK Steel Corporations Middletown, Ohio works. In early 2010, Air Products was awarded DOE Assistance Agreement DE-EE002736 to further develop and build the combined-cycle power generation facility. In June 2012, Air Products and AK Steel Corporation terminated work when it was determined that the project would not be economically viable at that time nor in the foreseeable future. The project would have achieved the FOA-0000044 Statement of Project Objectives by demonstrating, at a commercial scale, the technology to capture, treat, and convert blast furnace topgas into electric power and thermal energy.

Joyce, Jeffrey

2012-06-30T23:59:59.000Z

68

GRR/Section 6-AK-a - Transportation | Open Energy Information  

Open Energy Info (EERE)

GRR/Section 6-AK-a - Transportation GRR/Section 6-AK-a - Transportation < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 6-AK-a - Transportation 06AKATransportationOversizeOverweight.pdf Click to View Fullscreen Contact Agencies Alaska Department of Transportation and Public Facilities Regulations & Policies 17 AAC 25: Operations, Wheeled Vehicles Triggers None specified Click "Edit With Form" above to add content 06AKATransportationOversizeOverweight.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative _ 6-AK-a.1 to 6-AK-a.2 - Does the Load Exceed the Size or Weight Regulations for State Highway Transportation Established by 17 AAC 25?

69

Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.

1997-10-01T23:59:59.000Z

70

In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma

2013-06-01T23:59:59.000Z

71

OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown

2013-10-01T23:59:59.000Z

72

NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk

73

GRR/Section 7-AK-a - Power Plant Siting and Construction | Open...  

Open Energy Info (EERE)

form History Share this page on Facebook icon Twitter icon GRRSection 7-AK-a - Power Plant Siting and Construction < GRR Jump to: navigation, search GRR-logo.png...

74

One-sided Tauberian conditions for (A,k) summability method  

Science Conference Proceedings (OSTI)

In this paper, some one-sided Tauberian conditions for (A,k) summability method have been obtained. Keywords: (A ,k) summability, General control modulo, Moderate oscillation, Regularly generated sequence, Slow oscillation

?Brahim Anak; Mit Totur; Mehmet Dik

2010-03-01T23:59:59.000Z

75

GRR/Section 3-AK-c - Encroachment Permit | Open Energy Information  

Open Energy Info (EERE)

GRR/Section 3-AK-c - Encroachment Permit GRR/Section 3-AK-c - Encroachment Permit < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 3-AK-c - Encroachment Permit 03AKCEncroachmentOverview.pdf Click to View Fullscreen Contact Agencies Alaska Department of Transportation and Public Facilities Regulations & Policies 17 AAC 10.011: Encroachments Authorized 17 AAC 10.012: Approval Requirements 17 AAC 15.011: Utility Permits Triggers None specified Click "Edit With Form" above to add content 03AKCEncroachmentOverview.pdf 03AKCEncroachmentOverview.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative 3-AK-c.1 - Will the Developer Construct a Utility Within ADOT ROW or

76

Results from ORNL Characterization of Zr02-500-AK2 - Surrogate TRISO Material  

Science Conference Proceedings (OSTI)

This document is a compilation of the characterization data for the TRISO-coated surrogate particle batch designated ZrO2-500-AK2 that was produced at Oak Ridge National Laboratory (ORNL) as part of the Advanced Gas Reactor Fuel Development and Qualification (AGR) program. The ZrO2-500-AK2 material contains nominally 500 {micro}m kernels of yttria-stabilized zirconia (YSZ) coated with all TRISO layers (buffer, inner pyrocarbon, silicon carbide, and outer pyrocarbon). The ZrO2-500-AK2 material was created for: (1) irradiation testing in the High Flux Isotope Reactor (HFIR) and (2) limited dissemination to laboratories as deemed appropriate to the AGR program. This material was created midway into a TRISO fuel development program to accommodate a sudden opportunity to perform irradiation testing on surrogate material. While the layer deposition processes were chosen based on the best technical understanding at the time, technical progress at ORNL has led to an evolution in the perceived optimal deposition conditions since the createion of ZrO2-500-AK2. Thus, ZrO2-500-AK2 contains a reasonable TRISO microstructure, but does differ significanly from currently produced TRISO surrogates and fuel at ORNL. In this document, characterization data of the ZrO2-500-AK2 surrogate includes: size, shape, coating thickness, and density.

Hunn, John D [ORNL; Kercher, Andrew K [ORNL

2005-06-01T23:59:59.000Z

77

Results from ORNL characterization of ZrO2-500-AK2 - surrogate TRISO material  

Science Conference Proceedings (OSTI)

This document is a compilation of the characterization data for the TRISO-coated surrogate particles designated ZrO2-500-AK2 that was produced at Oak Ridge National Laboratory (ORNL) as part of the Advanced Gas Reactor Fuel Development and Qualification (AGR) program. The ZrO2-500-AK2 material contains nominally 500 {micro}m kernels of yttria-stabilized zirconia (YSZ) coated with all TRISO layers (buffer, inner pyrocarbon, silicon carbide, and outer pyrocarbon). The ZrO2-500-AK2 material was created for: (1) irradiation testing in the High Flux Isotope Reactor (HFIR) and (2) limited dissemination to laboratories as deemed appropriate to the AGR program. This material was created midway into a TRISO fuel development program to accommodate a sudden opportunity to perform irradiation testing on surrogate material. While the layer deposition processes were chosen based on the best technical understanding at the time, technical progress at ORNL has led to an evolution in the perceived optimal deposition conditions since the creation of ZrO2-500-AK2. Thus, ZrO2-500-AK2 contains a reasonable TRISO microstructure, but does differ significantly from currently produced TRISO surrogates and fuel at ORNL. In this document, characterization data of the ZrO2-500-AK2 surrogate includes: size, shape, coating thickness, and density.

Kercher, Andrew K [ORNL; Hunn, John D [ORNL

2005-06-01T23:59:59.000Z

78

Anemometer Data (Wind Speed, Direction) for Ugashik, AK (2001 - 2002) |  

Open Energy Info (EERE)

0 0 Varnish cache server Browse Upload data GDR 429 Throttled (bot load) Error 429 Throttled (bot load) Throttled (bot load) Guru Meditation: XID: 2142278290 Varnish cache server Anemometer Data (Wind Speed, Direction) for Ugashik, AK (2001 - 2002) Dataset Summary Description Wind data collected from Ugashik Traditional Village in Alaska from an anemometer as part of the Native American anemometer loan program. Monthly mean wind speed is available for 2001 through 2002, as is wind direction and turbulence data. Data is reported from a height of 20 m. The data was originally made available by Wind Powering America, a DOE Office of Energy Efficiency & Renewable Energy (EERE) program. A dynamic map displaying all available data from DOE anemometer loan programs is available http://www.windpoweringamerica.gov/anemometerloans/projects.asp.

79

Anemometer Data (Wind Speed, Direction) for Tanana, AK (2001 - 2002) |  

Open Energy Info (EERE)

40 40 Varnish cache server Anemometer Data (Wind Speed, Direction) for Tanana, AK (2001 - 2002) Dataset Summary Description Wind data collected from Tanana Village in Alaska from an anemometer as part of the Native American anemometer loan program. Monthly mean wind speed is available for 2001 through 2002, as is wind direction and turbulence data. Data is reported from a height of 20 m. The data was originally made available by Wind Powering America, a DOE Office of Energy Efficiency & Renewable Energy (EERE) program. A dynamic map displaying all available data from DOE anemometer loan programs is available http://www.windpoweringamerica.gov/anemometerloans/projects.asp. Source EERE Date Released November 09th, 2010 (4 years ago) Date Updated November 09th, 2010 (4 years ago)

80

AMENDMENT OF SOLICITATION/MODIFICATlON OF CONTRACT MI54 I See...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....

Note: This page contains sample records for the topic "ak mi gom" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay

82

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA

83

Circuit Breaker Maintenance; Volume 1: Low-Voltage Circuit Breakers; Part 2: GE AK Models: Volume 1: Low-Voltage Circuit Breakers Pa rt 2: GE AK Models  

Science Conference Proceedings (OSTI)

This comprehensive guide will help utilities improve their maintenance of GE model AK circuit breakers. It consolidates industry guidelines, applicable standards, original equipment manufacturer recommendations, and hands-on experience relative to these circuit breakers. Ultimately, improved maintenance will increase reliability and reduce costs associated with corrective maintenance and equipment downtime.

1992-05-02T23:59:59.000Z

84

GRR/Section 11-AK-a - State Cultural Considerations | Open Energy  

Open Energy Info (EERE)

1-AK-a - State Cultural Considerations 1-AK-a - State Cultural Considerations < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 11-AK-a - State Cultural Considerations 11AKAStateCulturalConsiderations (2).pdf Click to View Fullscreen Contact Agencies Alaska Department of Natural Resources Regulations & Policies AS 41.35.060: Power to Acquire AS 41.35.070: Preservation of Historic Resources AS 41.35.090: Notice AS 41.35.100: Excavation Triggers None specified Click "Edit With Form" above to add content 11AKAStateCulturalConsiderations (2).pdf 11AKAStateCulturalConsiderations (2).pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative It is the policy of the State of Alaska to preserve and protect the

85

GRR/Section 3-AK-a - State Competitive Mineral Leasing Process | Open  

Open Energy Info (EERE)

GRR/Section 3-AK-a - State Competitive Mineral Leasing Process GRR/Section 3-AK-a - State Competitive Mineral Leasing Process < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 3-AK-a - State Competitive Mineral Leasing Process 03AKAStateCompetitiveMineralLeasingProcess.pdf Click to View Fullscreen Contact Agencies Alaska Department of Natural Resources Alaska Division of Oil and Gas Regulations & Policies Alaska Land Act: AS 38.05 Alaska Statutes Alaska Administrative Code Triggers None specified Click "Edit With Form" above to add content 03AKAStateCompetitiveMineralLeasingProcess.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range.

86

GRR/Section 5-AK-a - Drilling and Well Development | Open Energy  

Open Energy Info (EERE)

GRR/Section 5-AK-a - Drilling and Well Development GRR/Section 5-AK-a - Drilling and Well Development < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 5-AK-a - Drilling and Well Development 05AKADrillingWellDevelopment.pdf Click to View Fullscreen Contact Agencies Alaska Oil and Gas Conservation Commission Alaska Department of Natural Resources Regulations & Policies Alaska Statutes Alaska Administrative Code Triggers None specified Click "Edit With Form" above to add content 05AKADrillingWellDevelopment.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative All wells drilled in search or in support of the recovery of geothermal

87

GRR/Section 14-AK-d - Section 401 Water Quality Certification | Open Energy  

Open Energy Info (EERE)

GRR/Section 14-AK-d - Section 401 Water Quality Certification GRR/Section 14-AK-d - Section 401 Water Quality Certification < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 14-AK-d - Section 401 Water Quality Certification 14AKDSection401WaterQualityCertification.pdf Click to View Fullscreen Contact Agencies Alaska Department of Environmental Conservation United States Environmental Protection Agency U S Army Corps of Engineers Regulations & Policies Alaska Water Quality Standards Alaska Statutes Alaska Administrative Code Triggers None specified Click "Edit With Form" above to add content 14AKDSection401WaterQualityCertification.pdf 14AKDSection401WaterQualityCertification.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range.

88

GRR/Section 18-AK-c - Waste Disposal Permit Process | Open Energy  

Open Energy Info (EERE)

AK-c - Waste Disposal Permit Process AK-c - Waste Disposal Permit Process < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 18-AK-c - Waste Disposal Permit Process 18AKC - WasteDisposalPermitProcess (1).pdf Click to View Fullscreen Contact Agencies Alaska Department of Environmental Conservation Regulations & Policies AS 46.03.110 Waste Disposal Permit Regulations 18 AAC 60.200 et seq Triggers None specified Click "Edit With Form" above to add content 18AKC - WasteDisposalPermitProcess (1).pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative The Alaska Department of Environmental Conservation (DEC) is responsible

89

GRR/Section 15-AK-a - Air Quality Assessment Process | Open Energy  

Open Energy Info (EERE)

GRR/Section 15-AK-a - Air Quality Assessment Process GRR/Section 15-AK-a - Air Quality Assessment Process < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 15-AK-a - Air Quality Assessment Process 15AKAAirQualityAssessmentProcess.pdf Click to View Fullscreen Contact Agencies Alaska Department of Environmental Conservation Regulations & Policies Alaska Statutes Alaska Statute Title 46 Alaska Administrative Code 18 AAC 50 Air Quality Regulations 40 CFR 71 Operating Permits Triggers None specified Click "Edit With Form" above to add content 15AKAAirQualityAssessmentProcess.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range.

90

GRR/Section 15-AK-b - Air Quality Minor Permit | Open Energy Information  

Open Energy Info (EERE)

GRR/Section 15-AK-b - Air Quality Minor Permit GRR/Section 15-AK-b - Air Quality Minor Permit < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 15-AK-b - Air Quality Minor Permit 15AKBAirQualityMinorPermit.pdf Click to View Fullscreen Contact Agencies Alaska Department of Environmental Conservation Regulations & Policies Alaska Statutes Alaska Administrative Code 18 AAC 50 Air Quality Control Regulations 40 CFR Chapter I, Subchapter C - Air Programs Triggers None specified Click "Edit With Form" above to add content 15AKBAirQualityMinorPermit.pdf 15AKBAirQualityMinorPermit.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative The mission of the Air Permit Program is to protect the Alaskan environment

91

GRR/Section 18-AK-a - Storage Tank Registration | Open Energy Information  

Open Energy Info (EERE)

GRR/Section 18-AK-a - Storage Tank Registration GRR/Section 18-AK-a - Storage Tank Registration < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 18-AK-a - Storage Tank Registration 18AKA - StorageTankRegistration (1).pdf Click to View Fullscreen Contact Agencies Alaska Department of Environmental Conservation Regulations & Policies AS 46.03.380 As 46.03.385 18 AAC 78 Underground Storage Tanks Triggers None specified Click "Edit With Form" above to add content 18AKA - StorageTankRegistration (1).pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative Any project that requires installation or operation of a storage tank must

92

GRR/Section 14-AK-b - Alaska Pollutant Discharge Elimination System Permit  

Open Energy Info (EERE)

GRR/Section 14-AK-b - Alaska Pollutant Discharge Elimination System Permit GRR/Section 14-AK-b - Alaska Pollutant Discharge Elimination System Permit < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 14-AK-b - Alaska Pollutant Discharge Elimination System Permit 14AKBAlaskaPollutantDischargeEliminationSystemPermit (1).pdf Click to View Fullscreen Contact Agencies Alaska Department of Environmental Conservation United States Environmental Protection Agency Regulations & Policies Alaska Statutes Alaska Administrative Code Triggers None specified Click "Edit With Form" above to add content 14AKBAlaskaPollutantDischargeEliminationSystemPermit (1).pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range.

93

GRR/Section 4-AK-b - Geophysical Exploration Permit | Open Energy  

Open Energy Info (EERE)

4-AK-b - Geophysical Exploration Permit 4-AK-b - Geophysical Exploration Permit < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 4-AK-b - Geophysical Exploration Permit 04AKBGeophysicalExplorationPermit.pdf Click to View Fullscreen Contact Agencies Alaska Department of Natural Resources Alaska Division of Oil and Gas Regulations & Policies Alaska Statutes Alaska Administrative Code Triggers None specified Click "Edit With Form" above to add content 04AKBGeophysicalExplorationPermit.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative A Geophysical Exploration Permit is necessary for conducting seismic

94

GRR/Section 19-AK-b - Temporary Use of Water Permit | Open Energy  

Open Energy Info (EERE)

9-AK-b - Temporary Use of Water Permit 9-AK-b - Temporary Use of Water Permit < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 19-AK-b - Temporary Use of Water Permit 19AKBTemporaryUseOfWaterPermit.pdf Click to View Fullscreen Contact Agencies Alaska Department of Natural Resources Alaska Division of Mining Land and Water Regulations & Policies Alaska Water Use Act Alaska Statutes Alaska Administrative Code Triggers None specified Click "Edit With Form" above to add content 19AKBTemporaryUseOfWaterPermit.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative In Alaska, water is declared a public resource belonging to the people of

95

GRR/Section 9-AK-a - Alaska Environmental Process | Open Energy Information  

Open Energy Info (EERE)

GRR/Section 9-AK-a - Alaska Environmental Process GRR/Section 9-AK-a - Alaska Environmental Process < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 9-AK-a - Alaska Environmental Process 09AKAStateEnvironmentalProcess (1).pdf Click to View Fullscreen Contact Agencies Alaska Department of Natural Resources Regulations & Policies AS 38.05.035: Powers & Duties of ADNR Director AS 38.05.082: Leases for Shore Fisheries AS 38.05.115: Conditions of Sale AS 38.05.850: Permits AS 38.05.945: Notice AS 38.05.946: Hearings Triggers None specified Click "Edit With Form" above to add content 09AKAStateEnvironmentalProcess (1).pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range.

96

GRR/Section 14-AK-c - Alaska UIC Permit | Open Energy Information  

Open Energy Info (EERE)

GRR/Section 14-AK-c - Alaska UIC Permit GRR/Section 14-AK-c - Alaska UIC Permit < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 14-AK-c - Alaska UIC Permit 14AKCAlaskaUICPermit.pdf Click to View Fullscreen Triggers None specified Click "Edit With Form" above to add content 14AKCAlaskaUICPermit.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative The Alaska Underground Injection Control Permit is regulated by the Environmental Protection Agency. The EPA regulates Class V injection wells on Federal lands, many tribal lands, and in some states like Alaska. Injection wells are overseen by either a state or Tribal Agency or one of

97

GRR/Section 8-AK-a - Transmission | Open Energy Information  

Open Energy Info (EERE)

8-AK-a - Transmission 8-AK-a - Transmission < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 8-AK-a - Transmission 08AKATransmission.pdf Click to View Fullscreen Triggers None specified Click "Edit With Form" above to add content 08AKATransmission.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative Under the Alaska Public Utilities Regulatory Act, transmission is included in Alaska's regulation of public utilities. According to AS 42.05.990(5), "public utility" or "utility" includes every corporation whether public, cooperative, or otherwise, company, individual, or association of

98

GRR/Section 4-AK-c - Geothermal Exploration Permit | Open Energy  

Open Energy Info (EERE)

4-AK-c - Geothermal Exploration Permit 4-AK-c - Geothermal Exploration Permit < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 4-AK-c - Geothermal Exploration Permit 04AKCGeothermalExplorationPermit.pdf Click to View Fullscreen Contact Agencies Alaska Department of Natural Resources Alaska Division of Oil and Gas Regulations & Policies Alaska Statutes Alaska Administrative Code Triggers None specified Click "Edit With Form" above to add content 04AKCGeothermalExplorationPermit.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative The Alaska Department of Natural Resources requires filing an application

99

GRR/Section 14-AK-a - Nonpoint Source Pollution | Open Energy Information  

Open Energy Info (EERE)

GRR/Section 14-AK-a - Nonpoint Source Pollution GRR/Section 14-AK-a - Nonpoint Source Pollution < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 14-AK-a - Nonpoint Source Pollution 14AKANonpointSourcePollution.pdf Click to View Fullscreen Contact Agencies Alaska Department of Environmental Conservation Regulations & Policies Alaska Statutes Alaska Administrative Code Triggers None specified Click "Edit With Form" above to add content 14AKANonpointSourcePollution.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative Alaska's Nonpoint Source Water Pollution Control Strategy is a statewide plan for protecting Alaska's natural resources from polluted runoff also

100

GRR/Section 19-AK-a - Water Access and Water Rights Issues | Open Energy  

Open Energy Info (EERE)

GRR/Section 19-AK-a - Water Access and Water Rights Issues GRR/Section 19-AK-a - Water Access and Water Rights Issues < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 19-AK-a - Water Access and Water Rights Issues 19AKAWaterAccessWaterRights.pdf Click to View Fullscreen Contact Agencies Alaska Department of Natural Resources Alaska Division of Mining Land and Water Regulations & Policies Alaska Water Use Act Alaska Statutes Alaska Administrative Code Triggers None specified Click "Edit With Form" above to add content 19AKAWaterAccessWaterRights.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative In Alaska, water is declared a public resource belonging to the people of

Note: This page contains sample records for the topic "ak mi gom" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

GRR/Section 3-AK-b - Right of Ways (ROWs) | Open Energy Information  

Open Energy Info (EERE)

GRR/Section 3-AK-b - Right of Ways (ROWs) GRR/Section 3-AK-b - Right of Ways (ROWs) < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 3-AK-b - Right of Ways (ROWs) 03AKBRightOfWaysROWs.pdf Click to View Fullscreen Contact Agencies Alaska Department of Natural Resources Alaska Division of Mining Land and Water Regulations & Policies Alaska Statutes Alaska Administrative Code Triggers None specified Click "Edit With Form" above to add content 03AKBRightOfWaysROWs.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative The Alaska Division of Mining Land and Water (ML&W) oversees land use within the state and issues right of ways, easements or permit to use state

102

GRR/Section 3-AK-e - Land Use Permit | Open Energy Information  

Open Energy Info (EERE)

3-AK-e - Land Use Permit 3-AK-e - Land Use Permit < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 3-AK-e - Land Use Permit 03AKELandUsePermit.pdf Click to View Fullscreen Contact Agencies Alaska Department of Natural Resources Alaska Division of Mining Land and Water Regulations & Policies Alaska Statutes Alaska Administrative Code Triggers None specified Click "Edit With Form" above to add content 03AKELandUsePermit.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative A land use permit in Alaska covers a number of uses of state land that are less invasive and do not require a full property interest such as a lease

103

DOE - Office of Legacy Management -- Amchitka Island Test Center - AK 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Amchitka Island Test Center - AK 01 Amchitka Island Test Center - AK 01 FUSRAP Considered Sites Site: Amchitka Island Test Center (AK.01) Designated Name: Alternate Name: Location: Evaluation Year: Site Operations: Site Disposition: Radioactive Materials Handled: Primary Radioactive Materials Handled: Radiological Survey(s): Site Status: Also see Amchitka Island Test Center Documents Related to Amchitka Island Test Center Draft Long-Term Surveillance Plan for the Amchitka Island, Alaska, Project Site (September 2013) An Assessment of the Reported Leakage of Anthropogenic Radionuclides From the Underground Nuclear Test Sites at Amchitka Island, Alaska, USA to the Surface Environment. Conceptual Site Models as a Tool in Evaluation Ecological health; The Case of the Department of Energys Amchitka Island Nuclear Test Site.

104

GRR/Section 7-AK-c - Certificate of Public Convenience and Necessity | Open  

Open Energy Info (EERE)

GRR/Section 7-AK-c - Certificate of Public Convenience and Necessity GRR/Section 7-AK-c - Certificate of Public Convenience and Necessity < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 7-AK-c - Certificate of Public Convenience and Necessity 07AKCCertificateOfPublicConvenienceAndNecessity.pdf Click to View Fullscreen Contact Agencies Regulatory Commission of Alaska Regulations & Policies AS 42.05.175: Timeline for Final Orders AS 42.05.221: Certificates Required AS 42.05.711: Exemptions 3 AAC 48.645: Application 3 AAC 48.648: Complete Applications 3 AAC 48.650: Incomplete Applications AAC Title 3 2012 Supplement Triggers None specified Click "Edit With Form" above to add content 07AKCCertificateOfPublicConvenienceAndNecessity.pdf Error creating thumbnail: Page number not in range.

105

GRR/Section 20-AK-a - Well Abandonment Process | Open Energy Information  

Open Energy Info (EERE)

20-AK-a - Well Abandonment Process 20-AK-a - Well Abandonment Process < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 20-AK-a - Well Abandonment Process 20AKAWellAbandonmentProcess.pdf Click to View Fullscreen Contact Agencies Alaska Oil and Gas Conservation Commission Regulations & Policies 20 AAC 25.105 20 AAC 25.112 Triggers None specified Click "Edit With Form" above to add content 20AKAWellAbandonmentProcess.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative This flowchart illustrates the process for abandoning wells in the state of Alaska. The Alaska Oil and Gas Conservation Commission ("commission")

106

GRR/Section 6-AK-b - Construction Storm Water Permitting | Open Energy  

Open Energy Info (EERE)

GRR/Section 6-AK-b - Construction Storm Water Permitting GRR/Section 6-AK-b - Construction Storm Water Permitting < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 6-AK-b - Construction Storm Water Permitting 06AKBConstructionStormWaterPermitting (1).pdf Click to View Fullscreen Contact Agencies Alaska Department of Environmental Conservation Regulations & Policies 18 AAC 72: Wastewater Treatment and Disposal Triggers None specified Click "Edit With Form" above to add content 06AKBConstructionStormWaterPermitting (1).pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative From DEC Website: The goal of the Storm Water Program is to reduce or eliminate pollutants in

107

GRR/Section 3-AK-d - State Noncompetitive Mineral Leasing Process | Open  

Open Energy Info (EERE)

GRR/Section 3-AK-d - State Noncompetitive Mineral Leasing Process GRR/Section 3-AK-d - State Noncompetitive Mineral Leasing Process < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 3-AK-d - State Noncompetitive Mineral Leasing Process 03AKDStateNoncompetitiveMineralLeasingProcess.pdf Click to View Fullscreen Contact Agencies Alaska Department of Natural Resources Alaska Division of Oil and Gas Regulations & Policies Alaska Land Act: AS 38.05 Alaska Statutes Alaska Administrative Code Triggers None specified Click "Edit With Form" above to add content 03AKDStateNoncompetitiveMineralLeasingProcess.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range.

108

GRR/Section 18-AK-b - Hazardous Waste Permit Process | Open Energy  

Open Energy Info (EERE)

8-AK-b - Hazardous Waste Permit Process 8-AK-b - Hazardous Waste Permit Process < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 18-AK-b - Hazardous Waste Permit Process 18AKB - HazardousWastePermitProcess (1).pdf Click to View Fullscreen Contact Agencies Alaska Department of Environmental Conservation United States Environmental Protection Agency Regulations & Policies AS 46.03.302 18 AAC 60.020 Triggers None specified Click "Edit With Form" above to add content 18AKB - HazardousWastePermitProcess (1).pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative The Alaska Department of Environmental Conservation defers to the federal

109

GRR/Section 15-AK-c - Title V Operating Permit | Open Energy Information  

Open Energy Info (EERE)

GRR/Section 15-AK-c - Title V Operating Permit GRR/Section 15-AK-c - Title V Operating Permit < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 15-AK-c - Title V Operating Permit 15AKCTitleVOperatingPermit.pdf Click to View Fullscreen Contact Agencies Alaska Department of Environmental Conservation United States Environmental Protection Agency Regulations & Policies Alaska Statutes Alaska Administrative Code 18 AAC 50 Air Quality Control Triggers None specified Click "Edit With Form" above to add content 15AKCTitleVOperatingPermit.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative One of the major initiatives Congress added to the Clean Air Act in 1990 is

110

GRR/Section 6-AK-c - Drinking Water Permit | Open Energy Information  

Open Energy Info (EERE)

6-AK-c - Drinking Water Permit 6-AK-c - Drinking Water Permit < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 6-AK-c - Drinking Water Permit 06AKCDrinkingWaterPermit.pdf Click to View Fullscreen Contact Agencies Alaska Department of Environmental Conservation Regulations & Policies 18 AAC 80 Drinking Water 40 CFR 141 40 CFR 142 40 CFR 143 Triggers None specified Click "Edit With Form" above to add content 06AKCDrinkingWaterPermit.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative Alaska's drinking water program is monitored under the Alaska Department of Environmental Conservation. The type of permit required depends on the

111

miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li

2009-01-01T23:59:59.000Z

112

NETL: Methane Hydrates - DOE/JIP GOM Hydrate Research Cruise  

NLE Websites -- All DOE Office Websites (Extended Search)

Pressurized Coring Equipment Pressurized Coring Equipment Pressure Core Equipment used by the Gulf of Mexico Gas Hydrate JIP Drilling Program Pressure Core Equipment - Photo Gallery One of the key objectives of the ChevronTexaco Gulf of Mexico hydrates Joint Industry Project is the collection and analyses of deepwater sediment samples. Because these samples may contain hydrate which is only stable at specific temperature and pressure conditions it is necessary to use specialized sampling equipment. Otherwise, the combination of reduced pressure and increased temperatures as the sample is retrieved through 4,000 feet of gulf seawater will fully dissociate the hydrate, leaving only gas and water. Although techniques exist to infer hydrates presence from distinctive geochemical markers, we have lost the ability to image the nature of hydrate distribution, or to conduct measurements of the various physical and chemical properties of hydrates in the host sediments.

113

NETL: Methane Hydrates - DOE/JIP GOM Hydrate Research Cruise  

NLE Websites -- All DOE Office Websites (Extended Search)

available. Day 10 - 26 April 2005 Day 10 photos showing core taken using the Fugro Hydraulic Piston Corer (FHPC) and the seabed frame which houses the FHPC. Core1 core2...

114

NETL: Methane Hydrates - DOE/JIP GOM Hydrate Research Cruise  

NLE Websites -- All DOE Office Websites (Extended Search)

Non-pressurized and Pressure Core Handling Non-pressurized Core Handling (Fugro Hydraulic Piston Corer and Fugro Corer) Photo of Core packed in ice bath Core packed in ice...

115

NETL: Methane Hydrates - DOE/JIP GOM Hydrate Research Cruise  

NLE Websites -- All DOE Office Websites (Extended Search)

Geochemistry Program On-Board Uncle John From: Miriam Kastner, University of California at San Diego On-Board Geochemistry Analyses The objectives of the geochemistry program are...

116

NETL: Methane Hydrates - DOE/JIP GOM Hydrate Research Cruise  

NLE Websites -- All DOE Office Websites (Extended Search)

the omni-directional source generates compressional, shear, and Stoneley waves into hard formations. The configuration of the DSI also allows recording of both in-line and...

117

NETL: Methane Hydrates - DOE/JIP GOM Hydrate Research Cruise  

NLE Websites -- All DOE Office Websites (Extended Search)

Analysis - Fugro Operations and Geotechnical Investigations PDF-7.13MB National Methane Hydrate R&D Program website. Photos: Photo Gallery - miscellaneous - Photos from...

118

NETL: Methane Hydrates - DOE/JIP GOM Hydrate Research Cruise  

NLE Websites -- All DOE Office Websites (Extended Search)

- Contacts Contact information for technical or media related information is listed below. Media Related Inquiries: Otis Mills Office of Public Affairs Coordination, NETL...

119

NETL: Methane Hydrates - DOE/JIP GOM Hydrate Research Cruise  

NLE Websites -- All DOE Office Websites (Extended Search)

The DOEJIP Gulf of Mexico Hydrate Research Cruise Status Reports During this expedition we will maintain an intermittent log of information relayed from the chief scientist on the...

120

NETL: Methane Hydrates - DOE/JIP GOM Hydrate Research Cruise  

NLE Websites -- All DOE Office Websites (Extended Search)

Pressurized Coring Equipment Pressure Core Equipment used by the Gulf of Mexico Gas Hydrate JIP Drilling Program Pressure Core Equipment - Photo Gallery One of the key objectives...

Note: This page contains sample records for the topic "ak mi gom" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

NETL: Methane Hydrates - DOE/JIP GOM Hydrate Research Cruise  

NLE Websites -- All DOE Office Websites (Extended Search)

Core Processing Core Processing Photos and other pertinent images from the cruise will be posted in the "Photo Gallery" as they become available. Core Processing Photos taken by NETL scientist aboard the Uncle John. These photos show the various tools used to analyze pressurized and non-pressurized core taken from the first drilling location at Atwater Valley. A_Transferring core to lab B_Pressure Core Transfer Chamber BC_Pressure core lab BCC_Core Processing Lab Transferring core to lab Pressure core transfer chamber Pressure core lab Core Processing lab BD_Pressure core analysis tools2 C_Pressure core analysis tools Ga Tech Mechanical Measurements Tool GeoTek Core logger Pressure core analysis tools Pressure core analysis tools Georgia Tech Mechanical measurements tool GeoTek core logger

122

NETL: Methane Hydrates - DOE/JIP GOM Hydrate Research Cruise  

NLE Websites -- All DOE Office Websites (Extended Search)

The DOE/JIP Gulf of Mexico Hydrate Research Cruise The DOE/JIP Gulf of Mexico Hydrate Research Cruise Status Reports During this expedition we will maintain an intermittent log of information relayed from the chief scientist on the expedition. To view a report for a particular day click on the "Day x" link in any highlighted box. The planned cruise timeline [PDF-13KB] is April 17 - May 21, 2005. This is the "planned" timeline. The schedule may change without prior notification due weather conditions or other unplanned occurrences. April 17 Day 1 April 18 Day 2 April 19 Day 3 April 20 Day 4 April 21 Day 5 April 22 Day 6 April 23 Day 7 April 24 Day 8 April 25 Day 9 April 26 Day 10 April 27 Day 11 April 28 Day 12 April 29 Day 13 April 30 Day 14 May 1 Day 15 May 2 Day 16 May 3 Day 17 May 4 Day 18 May 5

123

NETL: Methane Hydrates - DOE/JIP GOM Hydrate Research Cruise  

NLE Websites -- All DOE Office Websites (Extended Search)

Core Handling Core Handling From: Cruise Prospectus [PDF-827KB] Visit the Photo Gallery for more pictures showing core handling Non-pressurized and Pressure Core Handling Non-pressurized Core Handling (Fugro Hydraulic Piston Corer and Fugro Corer) Photo of Core packed in ice bath Core packed in ice bath Cores that might contain gas hydrates should be recovered as quickly as possible. An ice bath may be used in some cases to slow the dissociation process. A core reception/preparation van will be on the deck of the Uncle John where individual cores (perhaps up to 9 m long) can be laid on ‘core hooks' and quickly drilled, labeled and sectioned. Infrared (IR) camera imaging will be done as soon as practical after core recovery. Both track-mounted and hand held IR cameras will be used to identify the

124

NETL: Methane Hydrates - DOE/JIP GOM Hydrate Research Cruise  

NLE Websites -- All DOE Office Websites (Extended Search)

Cruise Cruise Special Report - Bottom-Simulating Reflections(BSR). Seismic lines from deep continental shelves all around the world contain anomalous reflections known as bottom-simulating reflections(BSR). The reflections mimic the sea-floor topography at a near constant depth below the surface, and commonly cut across geological layers. The nature of the reflection indicates a horizon across which seismic velocity dramatically decreases. At one time, scientists thought the reflection must be due to some mineralogical alteration in the sediment due to heat and pressure. Once the existence of natural methane hydrate was established, BSRs were thought to record the decrease in velocity when passing from hydrate-bearing sediments to those containing only water. Therefore, BSRs were thought to be a direct indicator of hydrate: no BSR meant no hydrate. However, the velocity contrast between hydrate and no-hydrate was determined to be insufficient to cause BSRs. Today, scientists have established that BSRs are an indication of concentrations of free methane gas that is blocked from further upward migration by the presence of methane hydrate in the overlying layers. Consequently, the distribution of BSRs may mark only a subset of the areas containing hydrate.

125

1990,"AK","Combined Heat and Power, Commercial Power","All Sources",4,85.9,80.09  

U.S. Energy Information Administration (EIA) Indexed Site

STATE_CODE","PRODUCER_TYPE","FUEL_SOURCE","GENERATORS","NAMEPLATE_CAPACITY STATE_CODE","PRODUCER_TYPE","FUEL_SOURCE","GENERATORS","NAMEPLATE_CAPACITY (Megawatts)","SUMMER_CAPACITY (Megawatts)" 1990,"AK","Combined Heat and Power, Commercial Power","All Sources",4,85.9,80.09 1990,"AK","Combined Heat and Power, Commercial Power","Coal",3,65.5,61.1 1990,"AK","Combined Heat and Power, Commercial Power","Petroleum",1,20.4,18.99 1990,"AK","Combined Heat and Power, Industrial Power","All Sources",23,229.4,204.21 1990,"AK","Combined Heat and Power, Industrial Power","Natural Gas",28,159.32,136.67 1990,"AK","Combined Heat and Power, Industrial Power","Petroleum",8,68.28,65.86

126

Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)

2010-01-01T23:59:59.000Z

127

Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)

2012-07-01T23:59:59.000Z

128

DEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE  

E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.

129

GRR/Section 17-AK-a - Aesthetic Resource Assessment | Open Energy  

Open Energy Info (EERE)

form form View source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Page Edit with form History Facebook icon Twitter icon » GRR/Section 17-AK-a - Aesthetic Resource Assessment < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 17-AK-a - Aesthetic Resource Assessment 17AKAAestheticResourceAssessment.pdf Click to View Fullscreen Triggers None specified Click "Edit With Form" above to add content 17AKAAestheticResourceAssessment.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative

130

GRR/Section 4-AK-a - State Exploration Process | Open Energy Information  

Open Energy Info (EERE)

Page Page Edit with form History Facebook icon Twitter icon » GRR/Section 4-AK-a - State Exploration Process < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 4-AK-a - State Exploration Process 04AKAStateExplorationProcess.pdf Click to View Fullscreen Contact Agencies Alaska Department of Natural Resources Alaska Division of Oil and Gas Alaska Oil and Gas Conservation Commission Regulations & Policies Alaska Statutes Alaska Administrative Code Triggers None specified Click "Edit With Form" above to add content 04AKAStateExplorationProcess.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range.

131

GRR/Section 12-AK-a - Flora & Fauna Considerations | Open Energy  

Open Energy Info (EERE)

Page Page Edit with form History Facebook icon Twitter icon » GRR/Section 12-AK-a - Flora & Fauna Considerations < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 12-AK-a - Flora & Fauna Considerations 12AKAFloraFaunaConsiderations (1).pdf Click to View Fullscreen Contact Agencies Alaska Department of Fish and Game Regulations & Policies AS 16.05.841: Fishways AS 16.05.871: Protection of Fish and Game AS 16.20: Conservation and Protection 5 AAC 95.011: Waters Important to Anadromous Fish Triggers None specified Click "Edit With Form" above to add content 12AKAFloraFaunaConsiderations (1).pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range.

132

Anemometer Data (Wind Speed, Direction) for YKHC-Bethel, AK (2003 - 2004) |  

Open Energy Info (EERE)

YKHC-Bethel, AK (2003 - 2004) YKHC-Bethel, AK (2003 - 2004) Dataset Summary Description Wind data collected from YKHC - Bethel in Alaska from an anemometer as part of the Native American anemometer loan program. Monthly mean wind speed is available for 2003 through 2004, as is wind direction and turbulence data. Data is reported from a height of 20 m. The data was originally made available by Wind Powering America, a DOE Office of Energy Efficiency & Renewable Energy (EERE) program. A dynamic map displaying all available data from DOE anemometer loan programs is available http://www.windpoweringamerica.gov/anemometerloans/projects.asp. Source EERE Date Released November 09th, 2010 (4 years ago) Date Updated November 09th, 2010 (4 years ago) Keywords wind wind direction wind speed

133

GRR/Section 19-AK-c - Permit to Appropriate | Open Energy Information  

Open Energy Info (EERE)

Page Page Edit with form History Facebook icon Twitter icon » GRR/Section 19-AK-c - Permit to Appropriate < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 19-AK-c - Permit to Appropriate 19AKCPermitToAppropriate.pdf Click to View Fullscreen Contact Agencies Alaska Department of Natural Resources Alaska Division of Mining Land and Water Regulations & Policies Alaska Water Use Act Alaska Statutes Alaska Administrative Code Triggers None specified Click "Edit With Form" above to add content 19AKCPermitToAppropriate.pdf 19AKCPermitToAppropriate.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative In Alaska, water is declared a public resource belonging to the people of

134

File:EIA-AK-CookInlet-Liquids.pdf | Open Energy Information  

Open Energy Info (EERE)

AK-CookInlet-Liquids.pdf AK-CookInlet-Liquids.pdf Jump to: navigation, search File File history File usage Alaska's Cook Inlet By 2001 Liquids Reserve Class Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(5,100 × 6,600 pixels, file size: 10.19 MB, MIME type: application/pdf) Description Alaska's Cook Inlet By 2001 Liquids Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States Alaska File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment

135

File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload

136

MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.

2011-05-01T23:59:59.000Z

137

AMENDMENT OF SOLICITATION/MODIFICATlON OF CONTRACT MI54 I See Block 16C I  

National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)

138

Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab

2007-03-01T23:59:59.000Z

139

GRR/Section 3-AK-g - Utility Permit to Construct on ADOT&PF ROW | Open  

Open Energy Info (EERE)

GRR/Section 3-AK-g - Utility Permit to Construct on ADOT&PF ROW GRR/Section 3-AK-g - Utility Permit to Construct on ADOT&PF ROW < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 3-AK-g - Utility Permit to Construct on ADOT&PF ROW 03AKGUtilityPermitToConstructOnADOTROW (1).pdf Click to View Fullscreen Contact Agencies Alaska Department of Transportation and Public Facilities U S Army Corps of Engineers United States Coast Guard Bureau of Indian Affairs Bureau of Land Management Federal Aviation Administration Alaska Department of Natural Resources Regulations & Policies 11 AAC 195.010: Anadromous Fish 17 AAC 15.021: Application for Utility Permit Triggers None specified Click "Edit With Form" above to add content 03AKGUtilityPermitToConstructOnADOTROW (1).pdf

140

Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A

2008-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "ak mi gom" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

File:NREL-ak-50m.pdf | Open Energy Information  

Open Energy Info (EERE)

ak-50m.pdf ak-50m.pdf Jump to: navigation, search File File history File usage Alaska Mainland Regions Annual Average Wind Speed at 50 Meters (PDF) Size of this preview: 776 × 599 pixels. Other resolution: 777 × 600 pixels. Full resolution ‎(1,647 × 1,272 pixels, file size: 6.1 MB, MIME type: application/pdf) Title Alaska Mainland Regions Annual Average Wind Speed at 50 Meters (PDF) Description Alaska Mainland Regions Annual Average Wind Speed at 50 Meters (PDF) Sources National Renewable Energy Laboratory Related Technologies Wind Creation Date 2010/01/15 Extent State Countries United States UN Region Northern America States Alaska File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 15:08, 21 December 2010 Thumbnail for version as of 15:08, 21 December 2010 1,647 × 1,272 (6.1 MB) MapBot (Talk | contribs) Automated upload from NREL's "mapsearch" data

142

File:NREL-ak2-50m.pdf | Open Energy Information  

Open Energy Info (EERE)

ak2-50m.pdf ak2-50m.pdf Jump to: navigation, search File File history File usage Alaska Panhandle Annual Average Wind Speed at 50 Meters (PDF) Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 1.8 MB, MIME type: application/pdf) Title Alaska Panhandle Annual Average Wind Speed at 50 Meters (PDF) Description Alaska Panhandle Annual Average Wind Speed at 50 Meters (PDF) Sources National Renewable Energy Laboratory Related Technologies Wind Creation Date 2010/01/15 Extent State Countries United States UN Region Northern America States Alaska File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 17:46, 21 December 2010 Thumbnail for version as of 17:46, 21 December 2010 1,275 × 1,650 (1.8 MB) MapBot (Talk | contribs) Automated upload from NREL's "mapsearch" data

143

2012,"Total Electric Power Industry","AK","Natural Gas",6,244.7,210.5  

U.S. Energy Information Administration (EIA) Indexed Site

TYPE_OF_PRODUCER","STATE_CODE","FUEL_SOURCE","GENERATORS","NAMEPLATE_CAPACITY TYPE_OF_PRODUCER","STATE_CODE","FUEL_SOURCE","GENERATORS","NAMEPLATE_CAPACITY (Megawatts)","SUMMER_CAPACITY (Megawatts)" 2012,"Total Electric Power Industry","AK","Natural Gas",6,244.7,210.5 2012,"Total Electric Power Industry","AK","Petroleum",4,4.8,4.8 2012,"Total Electric Power Industry","AK","Wind",1,24.6,24 2012,"Total Electric Power Industry","AK","All Sources",11,274.1,239.3 2012,"Total Electric Power Industry","AR","Coal",1,755,600 2012,"Total Electric Power Industry","AR","Natural Gas",1,22,20 2012,"Total Electric Power Industry","AR","All Sources",2,777,620

144

Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester

2012-07-01T23:59:59.000Z

145

T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab

2012-02-11T23:59:59.000Z

146

LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance

147

PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos

2008-06-27T23:59:59.000Z

148

C:\Annual\VENTCHAP.V8\NGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

6 6 Energy Information Administration / Natural Gas Annual 2002 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2001 2002 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2001-2002 Figure None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2002 (Million Cubic Feet) Figure GOM = Gulf of Mexico Sources:

149

C:\Annual\VENTCHAP.V8\NGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2002 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2001 2002 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2001-2002 Figure None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2002 (Million Cubic Feet) Figure GOM = Gulf of Mexico Sources:

150

Microsoft Word - Figure_3_4.doc  

Gasoline and Diesel Fuel Update (EIA)

7 7 None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s A l a b a m a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2002 2003 2002 Figure 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2002-2003 Figure 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2003 (Million Cubic Feet) GOM = Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly and Annual Quantity and Value of Natural Gas Report," and the United States Mineral Management

151

File:EIA-AK-NorthSlope-BOE.pdf | Open Energy Information  

Open Energy Info (EERE)

File File Edit with form History Facebook icon Twitter icon » File:EIA-AK-NorthSlope-BOE.pdf Jump to: navigation, search File File history File usage Alaskan North Slope By 2001 BOE Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 2.16 MB, MIME type: application/pdf) Description Alaskan North Slope By 2001 BOE Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States Alaska File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment

152

Why Sequence Sinorhizobium meliloti strains AK83 and BL225C?  

NLE Websites -- All DOE Office Websites (Extended Search)

Sinorhizobium meliloti Sinorhizobium meliloti strains AK83 and BL225C? Nitrogen is a crucial element for plant growth and makes up nearly 80 percent of the Earth's atmosphere. Unfortunately plants can't use atmospheric nitrogen unless it is converted into another form. Fertilizers can supply the needed nitrogen, but they are made using processes that contribute to the amount of greenhouse gases in the atmosphere. On the other hand, symbiotic nitrogen fixation done by bacteria such as Rhizobia residing in the soil or in the roots of plants bypasses the need for nitrogen fertilizers and allows farmers to plant crops in marginal lands that might not normally be used as such. Symbiotic nitrogen fixation contributes some 90 million tons of fixed nitrogen annually for legume crops such as soybeans, red clover and peas. S meliloti is a symbiotic

153

File:EIA-AK-CookInlet-Gas.pdf | Open Energy Information  

Open Energy Info (EERE)

File File Edit with form History Facebook icon Twitter icon » File:EIA-AK-CookInlet-Gas.pdf Jump to: navigation, search File File history File usage Alaska's Cook Inlet By 2001 Gas Reserve Class Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(5,100 × 6,600 pixels, file size: 10.19 MB, MIME type: application/pdf) Description Alaska's Cook Inlet By 2001 Gas Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States Alaska File history Click on a date/time to view the file as it appeared at that time.

154

3AK RIDGE NATIONAL LABORATORY OPERAiEO BY MARTIN MARIE,TA ENERGY SYSTEMS, INC.  

Office of Legacy Management (LM)

.I Y. ,J,.- i .I Y. ,J,.- i - 3AK RIDGE NATIONAL LABORATORY OPERAiEO BY MARTIN MARIE,TA ENERGY SYSTEMS, INC. POST OFFICE BOX X OAK RIOGE. TENNESSEE 37631 July 20, 1984 Ms. Gale P. Turi Division of Remedial Action Projects Office of Nuclear Energy U.S. Department of Energy MS - NE24 Washington, D.C. 20545 Dear Ms. Turi: Radfoloafcal Survey of the Guterl Steel Fad1 ftya 1 o&a As requested, a visit was made to the Guterl Steel facility (formerly Simonds Saw and Steel) on July 9, 1984 to determine if there have been significant changes in the radiological status of the facility since the last survey. In general, measurements made during this survey are con- sistent with those made during the 1977 survey (ORNL) and a follow-up survey in 1981 (FBD). Significant amounts of contaminated material are present in the rolling

155

Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.

2003-12-01T23:59:59.000Z

156

RH-TRU Waste Inventory Characterization by AK and Proposed WIPP RH-TRU Waste Characterization Objectives  

SciTech Connect

The U.S. Department of Energy (DOE)-Carlsbad Field Office (CBFO) has developed draft documentation to present the proposed Waste Isolation Pilot Plant (WIPP) remote-handled (RH-) transuranic (TRU) waste characterization program to its regulators, the U.S. Environmental Protection Agency and the New Mexico Environment Department. Compliance with Title 40, Code of Federal Regulations, Parts 191 and 194; the WIPP Land Withdrawal Act (PL 102-579); and the WIPP Hazardous Waste Facility Permit, as well as the Certificates of Compliance for the 72-B and 10-160B Casks, requires that specific waste parameter limits be imposed on DOE sites disposing of TRU waste at WIPP. The DOE-CBFO must control the sites' compliance with the limits by specifying allowable characterization methods. As with the established WIPP contact handled TRU waste characterization program, the DOE-CBFO has proposed a Remote-Handled TRU Waste Acceptance Criteria (RH-WAC) document consolidating the requirements from various regulatory drivers and proposed allowable characterization methods. These criteria are consistent with the recommendation of a recent National Academy Sciences/National Research Council to develop an RH-TRU waste characterization approach that removes current self imposed requirements that lack a legal or safety basis. As proposed in the draft RH-WAC and other preliminary documents, the DOE-CBFO RH-TRU waste characterization program proposes the use of acceptable knowledge (AK) as the primary method for obtaining required characterization information. The use of AK involves applying knowledge of the waste in light of the materials or processes used to generate the waste. Documentation, records, or processes providing information about various attributes of a waste stream, such as chemical, physical, and radiological properties, may be used as AK and may be applied to individual waste containers either independently or in conjunction with radiography, visual examination, assay, and other sampling and analytical data. RH-TRU waste cannot be shipped to WIPP on the basis of AK alone if documentation demonstrating that all of the prescribed limits in the RH-WAC are met is not available, discrepancies exist among AK source documents describing the same waste stream and the most conservative assumptions regarding those documents indicates that a limit will not be met, or all required data are not available for a given waste stream.

Most, W. A.; Kehrman, R.; Gist, C.; Biedscheid, J.; Devarakonda, J.; Whitworth, J.

2002-02-26T23:59:59.000Z

157

Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available

2011-10-01T23:59:59.000Z

158

New indices of geomagnetic activity at test: Comparing the correlation of the analogue ak index with the digital Ah and IHV  

E-Print Network (OSTI)

New indices of geomagnetic activity at test: Comparing the correlation of the analogue ak index Abstract We test here two recently proposed indices of geomagnetic activity, the Ah index and the IHV index, which are based on digitally available hourly geomagnetic measurements. We study their correlation

Mursula, Kalevi

159

Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.

2006-08-29T23:59:59.000Z

160

Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-

2009-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "ak mi gom" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan

2008-01-01T23:59:59.000Z

162

NETL: National Methane Hydrates R&D Program- 2009 GOM JIP Expedition  

NLE Websites -- All DOE Office Websites (Extended Search)

The National Methane Hydrates R&D Program The National Methane Hydrates R&D Program 2009 Gulf of Mexico JIP - Leg II DOE-Sponsored Expedition Confirms Resource-Quality Gas Hydrate in the Gulf of Mexico Leg II Initial Scientific Reports Now Available Photo of semi-submersible Helix Project Background Participants Pre-Drilling Expedition Overview Drilling/Logging Sites The LWD Program Site Summaries Walker Ridge-Block 313 Green Canyon-Block 955 Alaminos Canyon block 21 and East Breaks block 992 JIP Website [external site] FITI article - Summer 2009 Leg II Initial Scientific Reports On May 6, 2009, the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL)in collaboration with the U.S. Geological Survey (USGS), the U.S. Minerals Management Service, an industry research consortium led by Chevron, and others completed a landmark gas hydrate

163

NETL: National Methane Hydrates R&D Program- 2009 GOM JIP Expedition  

NLE Websites -- All DOE Office Websites (Extended Search)

soon as possible. Please note as you access these reports that the data and preliminary results represent work very much still in progress. Studies to calibrate pre-drill...

164

NETL: National Methane Hydrates R&D Program- 2009 GOM JIP Expedition  

NLE Websites -- All DOE Office Websites (Extended Search)

A small isolated sand body within the target interval was penetrated by the 1995 ExxonMobil Rockefeller well (EB992 001). Log data from that well indicated a sand 130 ft...

165

NETL: National Methane Hydrates R&D Program- 2009 GOM JIP Expedition  

NLE Websites -- All DOE Office Websites (Extended Search)

and geophysical evaluations of numerous potential sites, seeking evidence for active petroleum systems (gas sources and migration pathways) co-located with sand-prone...

166

,"GOM Gross EST",,,"Louisiana Gross EST",,,"New Mexico Gross...  

U.S. Energy Information Administration (EIA) Indexed Site

Gross EST",,,"Wyoming Gross EST",,,"Other States Gross EST",,,"Lower 48 Gross EST",,,"Alaska Gross State Data",,,"U. S. Gross EST" ,"Initial Est","Revised Est",,"Initial...

167

NETL: National Methane Hydrates R&D Program- 2009 GOM JIP Expedition  

NLE Websites -- All DOE Office Websites (Extended Search)

high is cut by complex network of faults that can provide pathways for migrating fluids and gases. Geophysical data reviewed during assessment of the site revealed a...

168

NETL: National Methane Hydrates R&D Program- 2009 GOM JIP Expedition  

NLE Websites -- All DOE Office Websites (Extended Search)

of fracture-filling gas hydrate. As drilling proceeding, the lack of use of heavy drilling fluids and slow penetration rates (both designed intentionally to maximize the...

169

Gas Hydrate Characterization in the GoM using Marine EM Methods  

SciTech Connect

In spite of the importance of gas hydrate as a low-carbon fuel, a possible contributor to rapid climate change, and a significant natural hazard, our current understanding about the amount and distribution of submarine gas hydrate is somewhat poor; estimates of total volume vary by at least an order of magnitude, and commercially useful concentrations of hydrate have remained an elusive target. This is largely because conventional geophysical tools have intrinsic limitations in their ability to quantitatively image hydrate. It has long been known from well logs that gas hydrate is resistive compared to the host sediments, and electrical and electromagnetic methods have been proposed and occasionally used to image hydrates. This project seeks to expand our capabilities to use electromagnetic methods to explore for gas hydrate in the marine environment. An important basic science aspect of our work was to quantify the resistivity of pure gas hydrate as a function of temperature at seafloor pressures. We designed, constructed, and tested a highpressure cell in which hydrate could be synthesized and then subjected to electrical conductivity measurements. Impedance spectroscopy at frequencies between 20 Hz and 2 MHz was used to separate the effect of the blocking electrodes from the intrinsic conductivity of the hydrate. We obtained very reproducible results that showed that pure methane hydrate was several times more resistive than the water ice that seeded the synthesis, 20,000 {Ohm}m at 0{degrees}#14;C, and that the activation energy is 30.6 kJ/mol over the temperature range of -15 to 15{degrees}#14;C. Adding silica sand to the hydrate, however, showed that the addition of the extra phase caused the conductivity of the assemblage to increase in a counterintuitive way. The fact that the increased conductivity collapsed after a percolation threshold was reached, and that the addition of glass beads does not produce a similar increase in conductivity, together suggest that while the surface of the gas hydrate grains are not intrinsically conductive, the presence of sand does increase their conductivity. In the field component of this project, we carried out an 18day cruise on the R.V. Roger Revelle in the Gulf of Mexico from 7th-??26th October 2008 to collect controlled-source electromagnetic (CSEM) data over four hydrate prospects; blocks AC 818, WR 313, GC 955, and MC 118. During these surveys we deployed 30 ocean bottom electromagnetic (OBEM) recorders a total of 94 times at four survey areas and towed the Scripps Undersea Electromagnetic Source Instrument (SUESI) a total of 103 hours. SUESI transmission was 200 A on a 50 m dipole antenna at heights of 70-100 m above the seafloor. We also towed a neutrally buoyant 3-axis electric field recorder behind the SUESI antenna at a constant offset of 300 m. The use of a towed receiver that is "flown" above the seafloor allowed us to operate in areas where seafloor infrastructure such as wellheads, pipelines, and installed scientific equipment existed. We reduced the data to apparent resistivity psuedosections. The most compelling results come from the hydrate observatory at MC 118, where a localized resistivity anomaly is clearly identified under the southeast crater in an otherwise uniform 1 {Ohm}m background. The data from MC 118 also show that authigenic carbonate does not necessarily express itself as a confounding resistor, as was feared at the start of this project. While the results from the other prospects are much more complicated, the data are well correlated with known geology, and line to line agreement is good. Although these data are not amenable to 1D inversion as was initially hoped, we expect to use a newly developed 2D CSEM inversion code to continue to get useful information from this rich data set.

Steven Constable

2012-03-31T23:59:59.000Z

170

NETL: National Methane Hydrates R&D Program- 2009 GOM JIP Expedition  

NLE Websites -- All DOE Office Websites (Extended Search)

- Site Summaries - Site Summaries Site Summary – Walker Ridge Block 313 The drill sites at Walker Ridge 313 lies in ~6,500 ft of water within the western part of the “Terrebonne” mini-basin in the northern Gulf of Mexico. The primary target of drilling were a series of strong seismic anomaly that lay approximately 3,000 fbsf (feet below the seafloor). These anomalies exhibit strong “positive” amplitude response, indicating a horizon in the subsurface across which the speed of sound waves significantly increases. In addition, these same horizons, when traced deeper to the west, are observed to switch “polarity” to a strong negative response. Pre-drill interpretations determined that this collection of seismic responses was indicative of free gas accumulations (the negative anomalies) being trapped within porous and permeable sand horizons by significant accumulations of overlying gas hydrate within the sediment pore space. The primary goal of JIP drilling at this site was to test the validity of this interpretation through drilling and logging of wells at this site.

171

NETL: National Methane Hydrates R&D Program- 2009 GOM JIP Expedition  

NLE Websites -- All DOE Office Websites (Extended Search)

Green Canyon Block 955 Green Canyon Block 955 The gas hydrates JIP site selection team identified numerous potential targets in Green Canyon block 955. Three of these sites were drilled in Leg II. The wells are located in over 6,500 ft of water near the foot of the Sigsbee Escarpment. The locations are near a major embayment into the Escarpment (“Green Canyon”) which has served as a persistent focal point for sediment delivery into the deep Gulf of Mexico. Topographic map of the seafloor in the Green Canyon area. Topographic map of the seafloor in the Green Canyon area. Block 955 lies just seaward of the Sigsbee Escarpment in ~6,500 feet of water Green Canyon block 995 includes a prominent channel/levee complex that has transported and deposited large volumes of sandy sediment from the canyon to the deep Gulf of Mexico abyssal plain. The southwest corner of the block includes a recently developed structural high caused by deeper mobilization of salt. The crest of the structural high is cut by complex network of faults that can provide pathways for migrating fluids and gases. Geophysical data reviewed during assessment of the site revealed a complex array of geophysical responses near the inferred base of gas hydrate stability. Some of these responses are suggestive of free gas and some indicative of gas hydrate, but all are limited to depths that are near or below the inferred base of gas hydrate stability.

172

Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah

2011-04-21T23:59:59.000Z

173

Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI

2012-06-01T23:59:59.000Z

174

ORISE "AK RlDGE lNSTlT"TE FOR SCIENCE AND EDUCATION  

Office of Legacy Management (LM)

t\i,;;; il.,. (' t\i,;;; il.,. (' . d ORISE "AK RlDGE lNSTlT"TE FOR SCIENCE AND EDUCATION August 1,200l Robert Atkin U.S. Department of Energy Oak Ridge Operations Office P.O. Box 2001 Oak Ridge, TN 3783 1 SUBJECT: CONTRACT NO. DE-AC05000R22750 FINAL REPORT-VERIFICATION SURVEY OF THE NEW BRUNSWICK LABORATORY SITE, NEW BRUNSWICK, NEW JERSEY Dear Mr. Atkin: The Environmental Survey and Site Assessment Program (ESSAP) of the Oak Ridge Institute for Science and Education (ORISE) conducted verification surveys at the New Brunswick Laboratory Site, located in the town of New Brunswick, New Jersey, during the period of August through November 1996. A draft report detailing the procedures and results of the survey was submitted to the U.S. Department of Energy

175

A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.

2008-06-01T23:59:59.000Z

176

Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan

2008-09-30T23:59:59.000Z

177

NONPROFIT ORG DETROIT, MI  

E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor

178

Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production  

NLE Websites -- All DOE Office Websites (Extended Search)

miR156 miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production Chunxiang Fu 1 , Ramanjulu Sunkar 2 , Chuanen Zhou 1 , Hui Shen 3,4 , Ji-Yi Zhang 3,4 , Jessica Matts 2 , Jennifer Wolf 1 , David G. J. Mann 4,5 , C. Neal Stewart Jr 4,5 , Yuhong Tang 3,4 and Zeng-Yu Wang 1,4, * 1 Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 2 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USA 3 Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 4 BioEnergy Science Center, Oak Ridge, TN, USA 5 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 10 October 2011; revised 8 December 2011; accepted 12 December 2011. *Correspondence (Tel 1-580-224 6830; fax 1-580-224 6802; email zywang@noble.org) Re-use

179

Event Images from ArgoNeuT: Mini LArTPC Exposure to Fermilab's NuMI Beam Project  

DOE Data Explorer (OSTI)

ArgoNeuT is a joint NSF/DOE R&D project at Fermilab to expose a small-scale liquid argon time projection chamber (LArTPC) to the NuMI neutrino beam. Liquid argon detectors are an exciting class of neutrino experiments because they can provide bubble chamber quality images and excellent background rejection. In these detectors, neutrinos passing through a large volume of argon interact with an argon atom, producing light and ionization particles. An electric field within the detector causes these charged particles to drift through the volume of argon, leaving a path of ionization electrons. As they drift, the ionization electrons induce current in two wire planes and are collected at a third plane. Measurement of the signals created within the wires, the position of the wires within the planes, the drift velocity of the ionization particles, and time of drift (from scintillation light or elsewhere) provides all the information needed for 3D reconstruction of the event. ArgoNeuT's neutrino source is the NuMI (Neutrinos at the Main Injector) beam. The beam passes through the MINOS (Main Injector Neutrino Oscillation search) near and far detectors, positioned at 1 km and 735 km from the target at Fermilab. ArgoNeuT is located at Fermilab upstream of the MINOS near detector, and is calibrated using muons that traverse the chamber and penetrate several layers into MINOS[Copied with editing from http://t962.fnal.gov/index.html]. A small selection of event images are made available.

180

Intensive archaeological survey of the proposed Central Sanitary Wastewater Treatment Facility, Savannah River Site, Aiken and Barnwell Counties, South Carolina  

SciTech Connect

The project area for the proposed Central Sanitary Wastewater Treatment Facility on the Savannah River Site includes a six-acre tract along Fourmile Branch and 18 mi of trunk line corridors. Archaeological investigations of the six-acre parcel resulted in the discovery of one small prehistoric site designated 38AK465. This cultural resource does not have the potential to add significantly to archaeological knowledge of human occupation in the region. The Savannah River Archaeological Research Program (SRARP) therefore recommends that 38AK465 is not eligible for nomination to the National Register of Historic Places (NRHP) and further recommends a determination of no effect. Archaeological survey along the trunk line corridors implicated previously recorded sites 38AK92, 38AK145, 38AK415, 38AK417, 38AK419, and 38AK436. Past disturbance from construction had severely disturbed 38AK92 and no archaeological evidence of 38AK145, 38AK419, and 38AK436 was recovered during survey. Lacking further evidence for the existence of these sites, the SRARP recommends that 38AK92, 38AK145, 38AK419, and 38AK436 are not eligible for nomination to the NRHP and thus warrant a determination of no effect. Two of these sites, 38Ak415 and 38AK417, required further investigation to evaluate their archaeological significance. Both of the sites have the potential to yield significant data on the prehistoric period occupation of the Aiken Plateau and the SRARP recommends that they are eligible for nomination to the NRHP. The Savannah River Archaeological Research Program recommends that adverse effects to sites 38AK415 and 38AK417 from proposed construction can be mitigated through avoidance.

Stephenson, D.K.; Sassaman, K.E.

1993-11-01T23:59:59.000Z

Note: This page contains sample records for the topic "ak mi gom" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

ENERGY lab ENERGY lab Methane Hydrate Federal Advisory Committee Gas Hydrate Program Activities in FY2013 Ray Boswell, DOE/NETL June 7, 2013 DOE Gas Hydrate R&D Program Spending Historical Results (through 2010) - Conducted three safe/successful Arctic/Deepwater field programs on time, on budget. - Resolved GH-drilling hazards facing GoM operations. - Identified the resource target (sands:10,000s Tcf); with international implications. - 2007 test with BP key input to USGS confirmation of technically- recoverable resources in AK: test earned industry buy-in for subsequent scientific testing in PBU. - 2009 GoM program proved GH exploration approach with field results, and further informed 2008 BOEM assessment. - Enabled the first modeling of GH response to climate change.

182

A large liquid argon time projection chamber for long-baseline, off-axis neutrino oscillation physics with the NuMI beam  

Science Conference Proceedings (OSTI)

Results from neutrino oscillation experiments in the last ten years have revolutionized the field of neutrino physics. While the overall oscillation picture for three neutrinos is now well established and precision measurements of the oscillation parameters are underway, crucial issues remain. In particular, the hierarchy of the neutrino masses, the structure of the neutrino mixing matrix, and, above all, CP violation in the neutrino sector are the primary experimental challenges in upcoming years. A program that utilizes the newly commissioned NuMI neutrino beamline, and its planned upgrades, together with a high-performance, large-mass detector will be in an excellent position to provide decisive answers to these key neutrino physics questions. A Liquid Argon time projection chamber (LArTPC) [2], which combines fine-grained tracking, total absorption calorimetry, and scalability, is well matched for this physics program. The few-millimeter-scale spatial granularity of a LArTPC combined with dE/dx measurements make it a powerful detector for neutrino oscillation physics. Scans of simulated event samples, both directed and blind, have shown that electron identification in {nu}{sub e} charged current interactions can be maintained at an efficiency of 80%. Backgrounds for {nu}{sub e} appearance searches from neutral current events with a {pi}{sup 0} are reduced well below the {approx} 0.5-1.0% {nu}{sub e} contamination of the {nu}{sub {mu}} beam [3]. While the ICARUS collaboration has pioneered this technology and shown its feasibility with successful operation of the T600 (600-ton) LArTPC [4], a detector for off-axis, long-baseline neutrino physics must be many times more massive to compensate for the low event rates. We have a baseline concept [5] based on the ICARUS wire plane structure and commercial methods of argon purification and housed in an industrial liquefied-natural-gas tank. Fifteen to fifty kton liquid argon capacity tanks have been considered. A very preliminary cost estimate for a 50-kton detector is $100M (unloaded) [6]. Continuing R&D will emphasize those issues pertaining to implementation of this very large scale liquid argon detector concept. Key hardware issues are achievement and maintenance of argon purity in the environment of an industrial tank, the assembly of very large electrode planes, and the signal quality obtained from readout electrodes with very long wires. Key data processing issues include an initial focus on rejection of cosmic rays for a surface experiment. Efforts are underway at Fermilab and a small number of universities in the US and Canada to address these issues with the goal of embarking on the construction of industrial-scale prototypes within one year. One such prototype could be deployed in the MiniBooNE beamline or in the NuMI surface building where neutrino interactions could be observed. These efforts are complementary to efforts around the world that include US participation, such as the construction of a LArTPC for the 2-km detector location at T2K [7]. The 2005 APS neutrino study [1] recommendations recognize that ''The development of new technologies will be essential for further advances in neutrino physics''. In a recent talk to EPP2010, Fermilab director P. Oddone, discussing the Fermilab program, states on his slides: ''We want to start a long term R&D program towards massive totally active liquid Argon detectors for extensions of NOvA''. [8]. As such, we are poised to enlarge our R&D efforts to realize the promise of a large liquid argon detector for neutrino physics.

Finley, D.; Jensen, D.; Jostlein, H.; Marchionni, A.; Pordes, S.; Rapidis, P.A.; /Fermilab; Bromberg, C.; /Michigan State U.; Lu, C.; McDonald, T.; /Princeton U.; Gallagher, H.; Mann, A.; Schneps, J.; /Tufts U.; Cline, D.; Sergiampietri, F.; Wang, H.; /UCLA; Curioni, A.; Fleming, B.T.; /Yale U.; Menary, S.; /York U., Canada

2005-09-01T23:59:59.000Z

183

Folk Song 2  

E-Print Network (OSTI)

/ yang gcig gis nyon/ 'dir 'tsogs kyis nyon dang nga glu bas len/ 1rta 'do ba skyes sa spang lung khug/ 2rgyugs gom lag ngoms sa rta mang gras// O ye/ yang gcig gis nyon/ 'dir 'tsogs kyis nyon dang nga glu bas len/ 3stag shar ba skes sa na zl'i dkyil... // 4gzugs lhu drug ngoms sa khrom p'i gral// O ye/ yang gcig gis nyon/ 'dir 'tsogs kyis nyon dang nga glu bas len/ last updated by World Oral Literature Project staff on Wednesday, Tuesday, June 8, 2010 5sman bu mo skyes sa pha m'i rtsibs// 6lag...

Tshe ring bsam 'grub

184

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

Sequestration: Educational Training and Research through Classroom, Field, and Laboratory Investigations Background Fundamental and applied research on carbon capture, utilization...

185

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

Fields in Wyoming: Monitoring, Verification, and Accounting Techniques for Determining Gas Transport and Caprock Integrity Background Increased attention is being placed on...

186

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

a method to produce industrial chemicals by mineralization of co 2 captured from fossil fuel combustion flue gas. the beneficial use of co 2 will reduce greenhouse gas emissions...

187

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

dissolutionprecipitation reactions and cracking. * Continuing the assessment of rate and natural peridotite carbonation in the field. Benefits The project will make a vital...

188

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

processes that would occur during geologic storage of CO 2 . It uses parallel computation methods to allow rapid and efficient modeling assessment of CO 2 injection strategies and...

189

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

monitoring, verification, and accounting (MVA); geological related analytical tools; methods to interpret geophysical models; well completion and integrity for long-term CO2...

190

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

verification, and accounting (MVA); geological related analytical tools;methods to interpret geophysical models; well completion and integrity for long- term CO2...

191

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

deployment costs more quickly by replacing some of the physical operational tests with virtual power plant simulations. Project Overview The ultimate goal of CCSI is to deliver...

192

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

rate and power demand. Students also analyze how the regulatory control system impacts power plant performance and stability. In addition, students practice start-up, shutdown,...

193

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent...

194

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

is supported by the Department of Energy, and the Department of Interior Bureau of Safety and Environmental Enforcement. Funding for this work has also been provided by...

195

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

of this lab-scale research effort is to characterize the effect of air composition on SOFC cathodes, as well as to propose and test degradation mitigation strategies. Specific...

196

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

of this goal will have significant impact for the nation given the size of the market, expected growth in energy demand, and the age of the existing power plant fleet....

197

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

overall goal of this project is to understand the role of cathode surface properties in SOFC performance. Project objectives are as follows: * Observe local electronic structure,...

198

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

300 hours) and crystallization characteristics. * Evaluate basic compatibility with other SOFC materials including flow and wetting. Accomplishments * Early on in this project it...

199

Albany, OR * Fairbanks, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

layer for lower Cr content stainless steel is thicker, which suggests that, for extended SOFC operation, at least 17 percent Cr is needed for alloys used in SOFCs. Benefits...

200

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

evolution to performance degradation * New tools were developed for examination of SOFC performance based on deconvolution of electrochemical impedance spectroscopy. *...

Note: This page contains sample records for the topic "ak mi gom" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

beneficial partnerships with industry, entrepreneurs, and other agencies. From nanotechnology and computer modeling to bench-scale testing and large-scale industrial process...

202

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

Alstom's Chemical Looping Combustion Technology with CO2 Capture for New and Existing Coal-Fired Power Plants Background The Advanced Combustion Systems (ACS) Program of the U.S....

203

Albany, OR * Fairbanks, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

304-285-1379 stephen.zitney@netl.doe.gov Chris Guenther Director Computational Science Division Office of Research and Development 304-285-4483 chris.guenther@netl.doe.gov...

204

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

into the atmosphere without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires a...

205

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

transgressive sandstone reservoirs deposited on unconformity surfaces during local subsidence. Other possibilities are porous carbonate units that have been exposed to...

206

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

02142 617-842-5569 bruno.marino@pem-carbon.com PARTNERS AXYS Technologies, Inc. Kansas City Plant Lawrence Berkeley National Laboratory (LBNL) LI-COR, Inc. Rutgers University...

207

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

the program. * Training modules for CO2 wellbore management issues, CO2 transportation, history of production in the Permian Basin, residual oil zones as a major CCUS target,...

208

Albany, OR * Fairbanks, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

will be subject to requirements of packaging for survivability, accuracy, low power consumption, portability, connectivity, and ease of manufacture, installation, and use. In...

209

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

CO 2 Geological Storage: Coupled Hydro-Chemo-Thermo-Mechanical Phenomena-From Pore-Scale Processes to Macroscale Implications Background Increased attention is being placed on...

210

Albany, OR * Fairbanks, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

tubing and main steam piping in coal-fired steam boilers, as well as in heat-recovery steam generators used in combined cycle plants. This has been done to try to eliminate the...

211

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

Fax: 406-994-5958 repasky@ece.montana.edu PARTNERS None Development of a 1 x N Fiber Optic Sensor Array for Carbon Sequestration Monitoring Background Fundamental and...

212

Albany, OR * Fairbanks, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

area aligns with the recommendations put forward in the SEAB Federal Research Report on Shale Gas, and efforts amongst Federal agencies to coordinate unconventional oil and gas...

213

Albany, OR * Fairbanks, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

as the horizontal drilling and multi-stage hydraulic fracturing used for shale gas and shale oil production, have potential to impact the environment. Because these new drilling...

214

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

storage. A key part of this effort is the integration of the project data from geologic mapping, waste injection wells, and field demonstrations in the western part of the...

215

Albany, OR * Fairbanks, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

of clean energy systems (e.g., transport gasification, chemical looping). The application of these models will lead to a reduction in cost associated with the development...

216

Albany, OR * Fairbanks, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

information can be used as a basis to predict the bulk thermodynamic and kinetic material properties by force-field modeling, Monte Carlo simulation, and molecular...

217

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

with larger volume CO2 injection systems such as at Cranfield, MS. GEO-SEQ is a public-private research and development partnership that delivers the technology and information...

218

Albany, OR * Fairbanks, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

Equipment (CARE) Background The mission of the U.S. Department of EnergyNational Energy Technology Laboratory (DOENETL) Existing Plants, Emissions, & Capture (EPEC)...

219

Albany, OR * Fairbanks, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

environmental control technologies to enable full use of the nation's vast coal reserves, while at the same time allowing the current fleet of coal-fired power plants to...

220

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

other areas such as energy harvesting and storage, petroleum refining, and industrial pollution control. Description Researchers at the University of Connecticut are developing a...

Note: This page contains sample records for the topic "ak mi gom" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

Albany, OR * Fairbanks, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

(DOE) Office of Fossil Energy (FE) provides a mechanism to conduct cooperative FE R&D projects between DOE and the HBCUOMI community. This program encourages private sector...

222

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

the related industries of CO 2 injection for enhanced oil recovery (CO 2 -EOR), natural gas storage, and natural gas pipelines will help to define the risks expected to be...

223

Albany, OR * Fairbanks, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

useable products and fuels while reducing greenhouse gas (GHG) emissions. During photosynthesis, algae capture CO2 and sunlight to convert them into oxygen and biomass. Up to 99...

224

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

Water Gas Shift Membrane Reactors Utilizing Novel, Non-precious Metal Mixed Matrix Membranes Background The U.S. Department of Energy (DOE) promotes development of novel hydrogen...

225

WDR-PK-AK-018  

SciTech Connect

Method - CES SOP-HW-P556 'Field and Bulk Gamma Analysis'. Detector - High-purity germanium, 40% relative efficiency. Calibration - The detector was calibrated on February 8, 2006 using a NIST-traceable sealed source, and the calibration was verified using an independent sealed source. Count Time and Geometry - The sample was counted for 20 minutes at 72 inches from the detector. A lead collimator was used to limit the field-of-view to the region of the sample. The drum was rotated 180 degrees halfway through the count time. Date and Location of Scans - June 1,2006 in Building 235 Room 1136. Spectral Analysis Spectra were analyzed with ORTEC GammaVision software. Matrix and geometry corrections were calculated using OR TEC Isotopic software. A background spectrum was measured at the counting location. No man-made radioactivity was observed in the background. Results were determined from the sample spectra without background subtraction. Minimum detectable activities were calculated by the Nureg 4.16 method. Results - Detected Pu-238, Pu-239, Am-241 and Am-243.

Hollister, R

2009-08-26T23:59:59.000Z

226

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

and Temporal Heterogeneities in Reservoir and Seal Petrology, Mineralogy, and Geochemistry: Implications for CO2 Sequestration Prediction, Simulation, and Monitoring...

227

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

Southern North American Coal Corporation North Carolina Department of Commerce NRG Energy Nuclear Energy Institute Oak Ridge National Laboratory Old Dominion Electric Corporation...

228

Albany, OR * Fairbanks, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

Low-Rank Coal to Gasifiers Background Gasification of coal or other solid feedstocks (wood waste, petcoke, etc.) is a clean way to generate electricity and produce or...

229

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

transport membrane (HTM) system separates H2 from coal-derived syngas after it has been produced via the water-gas shift (WGS) reaction, which is a key part of this process. The...

230

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

could be reduced and additional pore space freed up to sequester CO 2 . However, the produced formation water is typically of low quality (typically due to elevated total...

231

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

Sequestration Training and Research Program in Capture and Transport: Development of the Most Economical Separation Method for CO 2 Capture Background Fundamental and applied...

232

Albany, OR * Fairbanks, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

* Cr- and Pb-contaminated soils * Dredging spoils * Coal boiler bottom ash * Mineral wool Smelting * Primary Fe, Cr, Ni & Ti ores * Zn smelter wastes * Aluminum potliner *...

233

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

developed CCS technologies hold great promise to significantly reduce emissions from fossil fuels, but the engineering, economic, and environmental viability of these...

234

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

dioxide (co 2 ) emissions, and will help to maintain the nation's leadership in the export of gas turbine equipment. Project Description to date, the use of YaG materials as...

235

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

(3) improving efficiency of storage operations; and (4) developing Best Practices Manuals. These technologies will lead to future CO2 management for coal-based electric power...

236

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

(3) improving efficiency of storage operations; and (4) developing Best Practices Manuals. These technologies will lead to future CO 2 management for coal-based electric power...

237

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

Permian Basin Region of western Texas and southeastern New Mexico through an established technology transfer network, online capabilities, and a communications COST Total Project...

238

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

University of Pittsburgh URS Corporation Virginia Tech Turbine Thermal Management The gas turbine is the workhorse of power generation, and technology advances to current...

239

Albany, OR * Fairbanks, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

to provide comprehensive measurements of fuel flow conditions representative in modern gas turbine engines. This project is managed by the U.S. Department of Energy (DOE)...

240

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

methods to interpret geophysical models; well completion and integrity for long-term CO2 storage; and CO2 capture. Project Description NETL is partnering with the University of...

Note: This page contains sample records for the topic "ak mi gom" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

This allows researchers to conduct a wider range of transient simulations and to impose a load profile on the turbine in the system. The addition of a dSpace simulator has expanded...

242

Albany, OR * Archorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

processes due to its flexibility to accommodate numerous feedstocks such as coal, biomass, and natural gas, and to produce a variety of products, including heat and...

243

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

Schlumberger Carbon Services Spectra Energy Corporation Tenaska Taylorville, LLC Total Gas and Power Ventures USA, Inc. Vectren Corporation COST Total Project Value 28,948,987...

244

Albany, OR * Fairbanks, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

are porous permeable clastic or carbonate rocks that have contained fluids such as brine, oil, or gas in the natural void spaces of the rocks. Unconventional storage types include...

245

Albany, OR * Fairbanks, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

types are porous permeable clastic or carbonate rocks that have fluids such as brine, oil, or gas in the natural void spaces of the rocks. Unconventional storage types include...

246

Albany, OR * Archorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

common to CO 2 storage and other subsurface energy needs (e.g. shale gas, tight oil, deepwater and ultra- deepwater, and unconventional fossil resources). This set of...

247

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

Core Laboratories CSX Gas Dart Oil & Gas Corporation Denbury Resources, Inc. Dominion Duke Energy Eastern Coal Council Edison Electric Institute Electric Power Research...

248

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

has been constructed and tested in static and dynamic scanning conditions in numerous field studies. The team is preparing to test and deploy the beta prototype which has...

249

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

TX Website: www.netl.doe.gov Customer Service: 1-800-553-7681 Geomechanical Impacts of Shale Gas Activities Background During hydraulic fracturing of unconventional resources,...

250

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

1-800-553-7681 Interdisciplinary Investigation of CO2 Sequestration in Depleted Shale Gas Formations Background The overall goal of the Department of Energy's (DOE) Carbon...

251

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

and 35 MPa, respectively, and higher. an integrated research approach that couples thermodynamic calculations and focused experiments will be used to identify Heas that will...

252

Albany, OR * Fairbanks, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

Department of Materials Science & Engineering Box 352120, University of Washington Seattle, WA 98195 206-685-8272 ohuchi@u.washington.edu PROJECT DURATION Start Date 09212011...

253

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

WV 26507 304-285-1345 traci.rodosta@netl.doe.gov Brian Dressel Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA...

254

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

Coal-Seq III Consortium: Advancing the Science of CO 2 Sequestration in Coal Seam and Gas Shale Reservoirs Background Through its core research and development (R&D) program...

255

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

flow conditions and prevention of compaction damage in deepwater production in offshore environments. The increased use of foamed cement systems in high-stress environments...

256

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

complex settings, including ultra-deep formations, both onshore and offshore. Innovative exploration and production technologies are needed to effectively and economically access...

257

Albany, OR * Fairbanks, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

Background Oxy-fuel combustion technology offers the benefits of zero-emission power generation coupled with economical carbon capture and storage. In order to boost cycle...

258

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

the potential to improve the efficiency and environmental impact of coal-based power generation systems. Currently available carbon dioxide (CO2) capture and storage technologies...

259

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

CFD simulations by accounting for particle size and density distribution in reacting multiphase flows, and developing predictive capability at the porous microstructure scale...

260

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

technique to estimate hydraulic conductance in pores. * Constructing and simulating a multiphase system with regular and irregular geometries. * Improve the fidelity of physics...

Note: This page contains sample records for the topic "ak mi gom" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

data sets to verify models that simulate CO2 trapping mechanisms in heterogeneous porous reservoirs at an intermediate to large scale. The basic processes of CO2 trapping...

262

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

and the Department of Chemical Engineering. Figure 2: Discussion of fluid flow in porous medium FE0002254, February 2013 * STORE developed a short course that discusses the...

263

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

and Technology Collaborative (ZERT) have expertise in development of code to simulate multiphase flow through porous media and fracture networks, facilities and expertise for...

264

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

community (Figure 1). ISGS researchers are already committed to analyzing the environmental conditions (pressure and temperature) in the wells, and the chemical composition...

265

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

emitted into the atmosphere without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications will...

266

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

Effective Exploration of New 760-Degrees- Celsius-Capability Steels for Coal Energy Background The Department of Energy (DOE) Crosscutting Research Program serves as a bridge...

267

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

change. NETL GateCycle modeling evaluated a number of factors for their impact on thermal efficiency in a sub-critical single reheat pulverized coal power plant. The...

268

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

sandstone formations. * Examine the fundamental physics of how fluid flow in porous geologic media occurs. * Use the data to assist computer simulations of CO 2 injection...

269

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

blow out preventers, risers, etc. At present, there is NO accurate database for these fluid properties at extreme conditions associated with ultra-deep formations. As we have...

270

Albany, OR * Anchorage, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

and hydrogen. The National Energy Technology Laboratory (NETL) is partnering with Viresco Energy, LLC (Viresco) to evaluate the Steam Hydro- gasification Reaction (SHR) process, a...

271

Albany, OR * Fairbanks, AK * Morgantown...  

NLE Websites -- All DOE Office Websites (Extended Search)

with advanced fossil-fuel based power production. NETL has teamed with the DOE's Ames Laboratory to develop tools capable of integrating materials design into the overall...

272

Shallow water flow is a serious drilling hazard encoun-tered across several areas of the Gulf of Mexico (GoM).  

E-Print Network (OSTI)

question: "How does fresh- water come to be near the seafloor in deepwater areas of the Gulf of Mexico extending from onshore to offshore. This option is not generally accepted by experienced Gulf of MexicoShallow water flow is a serious drilling hazard encoun- tered across several areas of the Gulf

Texas at Austin, University of

273

Evaluation of Cavity Collapse and Surface Crater Formation at the Salut Underground Nuclear Test in U20ak, Nevada National Security Site, and the Impact of Stability of the Ground Surface  

Science Conference Proceedings (OSTI)

At the request of Jerry Sweeney, the LLNL Containment Program performed a review of nuclear test-related data for the Salut underground nuclear test in U20ak to assist in evaluating this legacy site as a test bed for application technologies for use in On-Site Inspections (OSI) under the Comprehensive Nuclear Test Ban Treaty. Review of the Salut site is complicated because the test experienced a subsurface, rather than surface, collapse. Of particular interest is the stability of the ground surface above the Salut detonation point. Proposed methods for on-site verification include radiological signatures, artifacts from nuclear testing activities, and imaging to identify alteration to the subsurface hydrogeologogy due to the nuclear detonation. Sweeney's proposal requires physical access at or near the ground surface of specific underground nuclear test locations at the Nevada Nuclear Test Site (NNSS, formerly the Nevada Test Site), and focuses on possible activities such as visual observation, multispectral measurements, and shallow, and deep geophysical surveys.

Pawloski, G A

2012-04-25T23:59:59.000Z

274

Microsoft Word - MI.01-8.doc  

Office of Legacy Management (LM)

ORNL/RASA-96/7 ORNL/RASA-96/7 Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray S. P. McKenzie R. F. Carrier C. A. Johnson ORNL/RASA-96/7 LIFE SCIENCES DIVISION Environmental Restoration and Waste Management Non-Defense Programs (Certification Documentation Review, Investigation, and Completion: Internal Activity No. 14B477101) Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray, S. P. McKenzie, R. F. Carrier and C. A. Johnson Date Final issued - August 2002 Date Draft issued - July 1997

275

MI ROPYROLIZER FOR RAPID IOIDENTIFI ATION  

POTENTIAL APPLI ATIONS Agribusiness: Crop Testing & Verification Bio-fuels: Plants/Algae Lipid Content Homeland & International Security: Bio-Agent ...

276

MI 3 --Seite 1 Pinkal / Siekmann / Benzmuller  

E-Print Network (OSTI)

Differentialgleichungen (bis 2/2000), Dozentur f¨ur Wissenschaftliches Rechnen, Institut f¨ur Wissenschaftliches Rechnen, Grundausstattung Dr. Gerd Kunert, Professur Wissenschaftliches Rechnen, Grundausstattung Dr. Michael The?¨ur Modellprobleme in Gebieten mit Kanten, betrachtet. #12;A3 Meyer/Jung 7 Im Arbeits- und Ergebnisbericht 1996

Benzmüller, Christoph - FR 6.2

277

Detroit, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

6 2007 2008 2009 2010 2011 View History Pipeline Volumes 0 81 753 21 79 19 1996-2011 Pipeline Prices -- 8.28 6.58 4.53 8.37 5.17 1996-2011...

278

Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011...

279

Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

9,158 8,756 14,925 22,198 41,964 42,866 1996-2012 Pipeline Prices 7.77 7.48 4.85 4.87 4.48 3.18 1996...

280

Detroit, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

22,904 27,220 43,980 44,275 43,690 50,347 1996-2012 Pipeline Prices 6.88 8.37 4.01 4.69 4.26 3.10...

Note: This page contains sample records for the topic "ak mi gom" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

C:\\ANNUAL\\VENTCHAP.V8\\NGA.VP  

Gasoline and Diesel Fuel Update (EIA)

4 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99...

282

Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998...

283

C:\\ANNUAL\\VENTCHAP.V8\\NewNGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 15. Marketed Production of Natural Gas in the United States, 2001...

284

C:\\ANNUAL\\VENTCHAP.V8\\NGAla1109.vp  

Gasoline and Diesel Fuel Update (EIA)

0 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy...

285

NGA98fin5.vp  

Annual Energy Outlook 2012 (EIA)

NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99...

286

Wind Generation Feasibility Study in Bethel, AK  

DOE Green Energy (OSTI)

This report studies the wind resources in the Yukon-Kuskokwim Health Corporation (YKHC) region, located in southwestern Alaska, and the applicability of wind generation technologies to YKHC facilities.

Tom Humphrey, YKHC; Lance Kincaid, EMCOR Energy & Technologies

2004-07-31T23:59:59.000Z

287

Jeffrey W. Leppo, AK Bar No. 0001003 Ryan P. Steen, AK Bar No. 0912084  

E-Print Network (OSTI)

in Anchorage, Alaska. AOGA's fifteen member companies account for the majority of oil and gas exploration: jwleppo@stoel.com rpsteen@stoel.com A ttorneys for Plaintiff Alaska Oil and Gas Association IN THE UNITED STATES DISTRICT COURT FOR THE DISTRICT OF ALASKA ALASKA OIL AND GAS ASSOCIATION, Civ. No. Plaintiff, V

288

NOT FOR CIRCULATION OUTSIDE OF ENERGY INC.  

E-Print Network (OSTI)

As the U.S. offshore Gulf of Mexico (GOM) oil and gas province has matured, the exploration and production industry has pushed into deeper waters supported by technology advances and the growing awareness that the GOM represents one of the most important supply areas for hydrocarbons. This case presents an analysis of GOM deepwater development from the perspective of our virtual company, Energy Inc., a company that was faced with developing an entry strategy for the GOM deepwater in 1998. It includes an overview of GOM trends and incorporates specific U.S. energy policy questions, as outlined below. Should the U.S., through its federal Minerals Management Service (MMS), an agency of the Department of Interior, provide incentives for risk taking in GOM deepwater blocks through royalty relief? How should expensive transportation infrastructure investments be made to deliver GOM production to shore and under what policy and regulatory framework?

unknown authors

1998-01-01T23:59:59.000Z

289

MI ROFA RI ATED FIELD ALI RATION ASSEM LY  

Remote sensing Gas chromatography Chemical sensing TE HNOLOGI AL ENEFITS Small and portable No monitoring needed High accuracy with as low as

290

MI ROFA RI ATED FIELD ALI RATION ASSEM LY  

Remote sensing Gas chromatography ... remote sensors. The Field Calibration Assembly is designed at a small scale for incorporation into the intake

291

NEVADA BUREAU OF MINES AND GEOLOGY SPECIAL PUBLICATION MI-1996  

E-Print Network (OSTI)

gold mines in the United States. Five new mines came into production in 1997: Placer Dome's Pipeline and South Pipeline deposits in Crescent Valley in Lander County (part of the Cortez Mines complex Mountain Mine, 484,430 oz; Placer Dome's Cortez Gold Mines (including Pipeline), 407,973 oz; Independence

Tingley, Joseph V.

292

NEVADA BUREAU OF MINES AND GEOLOGY SPECIAL PUBLICATION MI-1994  

E-Print Network (OSTI)

Laboratory System, Accession Summary Report T0701789, 2007. [14] B. Stager, A. Ruegamer, Tonopah Test Ranges a herd of 250 were found dead in the northwestern Nevada Test and Training Range (NTTR) in southern collected in February 2008 at the Nevada Testing and Training Range. Units in per mil (%). Sample d15 N NO3

Tingley, Joseph V.

293

Construction of the NuMI underground laboratory facilities  

SciTech Connect

At Fermilab, a 4000-ft long underground complex has recently been constructed for a high-energy physics experiment. The complex is sited up to 350 ft, below grade principally in bedrock. The rock excavations were mined by TBM and drill and blast methods and supported by a combination of rock bolts, dowels and shotcrete. Water control was achieved using a combination of pre- and post-excavation grouting, drainage systems, drip shielding and air desiccation measures.

Laughton, Christopher; Bruen, Michael P

2003-01-01T23:59:59.000Z

294

St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

59,044 56,015 56,094 66,775 52,380 65,815 66,723 2012 62,390 62,442 72,035 61,364 66,456 54,973 52,240 66,101 67,443 61,205 62,762 65,084 2013 56,510 52,567 58,126 43,917...

295

Fuel Economy of the 2013 Mitsubishi i-MiEV  

NLE Websites -- All DOE Office Websites (Extended Search)

the Mobile Version of This Page Automatic (A1) Electricity Compare Side-by-Side EV EPA Fuel Economy Miles per Gallon Personalize Electricity* 112 Combined 126 City 99 Highway...

296

A FUNDAMENTAL REAKTHROUGH IN HEAT TRANSFER TE HNOLOGY FOR MI ...  

owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2011-4637P ONTA T INFORMATION

297

Marysville, MI Natural Gas Imports by Pipeline from Canada  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Imports by Point of Entry (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet)

298

Alternative Uses for Vacant Land in Detroit, MI.  

E-Print Network (OSTI)

??Detroit is situated in a historically productive lake plain in the Great Lakes region of the Midwestern United States. Geographic centrality, access to rail and (more)

Yun, Michael

2008-01-01T23:59:59.000Z

299

Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4,338 5,323 4,952 3,361 3,295 2,761 2,838 2,182 2,061 2,644 3,085 5,122 2012 6,067 6,721 3,354 3,404 2,923 1,986 2,475...

300

Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.85 4.76 4.36 4.62 4.73 4.70 4.74 4.75 4.21 3.83 3.85 3.79 2012 3.29 3.05 2.61 2.35 2.68 2.64 3.07 3.16 3.14 3.60 3.93...

Note: This page contains sample records for the topic "ak mi gom" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 1,408 2,674 212 579 179 606 34 642 270 1,367 826 1,150 2012 326 264 147 899 1,654 1,086 217 801 1,053 1,472 121 61 2013...

302

Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.95 5.33 2013 3.80 4.50 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure...

303

Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.36 2.55 2.26 2.30 2000's 3.74 4.57 3.03 5.47 6.47 8.12 7.61 6.88 8.37 4.01 2010's 4.69 4.26...

304

Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 3,465 2,693 3,676 3,988 3,357 3,437 765 3,916 4,318 4,473 4,851 4,752 2012 5,562 5,372 5,253 3,745 3,354 2,811 2,935 3,822...

305

Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 14,901 11,501 10,925 7,671 2000's 6,171 405 1,948 2,514 1,117 0 0 81 753 21 2010's 79 19 - No...

306

Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.75 2.51 2.43 2.51 2000's 3.82 9.34 3.56 5.96 6.27 -- -- 8.28 6.58 4.53 2010's 8.37 5.17 - No...

307

Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.71 4.55 4.42 4.87 4.86 4.93 4.77 4.76 4.38 4.25 3.90 3.76 2012 3.32 2.95 2.71 2.49 2.42 2.74 3.14 3.24 3.03 3.42 3.93...

308

Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 638 5,286 3,377 691 2000's 5,320 3,651 NA 811 4,455 5,222 3,483 9,158 8,756 14,925 2010's 22,198...

309

St. Clair, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.04 3.16 2.07 2.62 2000's 4.45 4.54 3.19 5.84 6.50 9.93 7.44 6.97 10.03 5.10 2010's 4.97 4.29...

310

Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.72 4.58 4.22 4.51 4.66 4.73 4.55 4.45 4.19 3.92 3.79 3.60 2012 3.14 2.95 2.61 2.33 2.50 2.62 3.08 3.12 2.99 3.41 4.13...

311

Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 30,410 31,080 24,908 25,049 2000's 36,007 35,644 7,431 19,737 40,030 40,255 22,156 22,904 27,220...

312

St. Clair, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

7 2008 2009 2010 2011 2012 View History Pipeline Volumes 9,633 9,104 6,544 5,591 5,228 3,531 1996-2012 Pipeline Prices 6.97 10.03 5.10 4.97 4.29 2.63 1996-2012...

313

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec; 2011: 123: 237: 33: 91: 238: 1,469: 571: 38: 1,605: 552: 270: 2012: 51: 42: 2,029: 475: 370: 52: 45: 69: 221 ...

314

Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.97 2.36 2.17 2.47 2000's 2.91 3.92 NA 5.06 6.83 7.92 7.36 7.77 7.48 4.85 2010's 4.87 4.48 3.18...

315

Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.48 2.17 2.06 2000's NA NA 3.95 -- 7.80 -- 7.07 7.59 8.59 3.80 2010's 4.44 4.42 2.99...

316

Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 10 1,827 135 2000's NA NA 74 0 303 0 24 876 2,252 5,651 2010's 5,694 9,946 8,099...

317

Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 8 11 2013 16 140 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure of...

318

ENERGY SURETY MI ROGRID - Home - Energy Innovation Portal  

Emergency Response Alternate Energy and Power Supply TE HNOLOGI AL ENEFITS Risk Assessment assists in planning and analysis of potential risks

319

miR290-5p and miR292-5p Activate the Immunoglobulin kappa Locus  

E-Print Network (OSTI)

empty vector control or Doxycycline-inducible Blimp1 cDNA,presence of ethanol or Doxycycline (1:5000, 16hr). Data wasCCA CCT GGT ACT GCG ACT C Doxycycline Experiments pFG12-TRE-

Garcia, Patty Bertha

2012-01-01T23:59:59.000Z

320

Molecular Cell STAT3 Activation of miR-21 and miR-181b-1  

E-Print Network (OSTI)

cells via a positive feedback loop involving NF-kB, Lin28, let-7, and IL-6. We identify differentially, respectively, inhibit PTEN and CYLD tumor suppressors, leading to increased NF-kB activity required to maintain

Bulyk, Martha L.

Note: This page contains sample records for the topic "ak mi gom" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Les bKa'brgyad - Sources canoniques et tradition de Nyangral Nyima 'od zer  

E-Print Network (OSTI)

la Pense, li la famille du bouddha Ak?obhya (Thugs Mi bskyod pa'i rigs) nomm dPal Heruka snying rje rol pa'i rgyud (?r?-heruka-karu??kr??ita-tantra), tabli par l'?c?rya H??- kara12 , venu de l'Inde de l'est, prs de Zahor (Est du Bengale) (r... mi tra, Pra chen ha ti, Rum bu ghu ya dhe ba, Dha na sang tri, Shan ting ghar ba. 21 'Ju mi pham (s.d., vol. 21 : 15) mentionne galement cette neuvime cassette, dont les autres gter ston qui ont dcouvert des cycles de bKa' brgyad ne parlent pas...

Sampel, Tenzin

2008-01-01T23:59:59.000Z

322

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Computational Facilities Description Scientists at NETL's laboratories use the Geoscience Analysis, Interpretation, and Assessments (GAIA) Computational Facilities for...

323

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Investigation on Pyroelectric Ceramic Temperature Sensors for Energy System Applications Background There is an increasing need to monitor processing parameters such as...

324

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

CO 2 -Binding Organic Liquids Gas Capture with Polarity-Swing-Assisted Regeneration Background The mission of the U.S. Department of EnergyNational Energy Technology Laboratory...

325

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

and are also stringent in order to avoid poisoning catalysts utilized in making liquids from fuel gas, electrodes in fuel cells, and selective catalytic reduction...

326

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

modeling, laboratory experiments, and industry input to develop physics-based methods, models, and tools to support the development and deployment of advanced...

327

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

of clean energy systems. Accomplishments The AVESTAR team successfully deployed 3-D virtual IGCC immersive training systems at NETL and West Virginia University that allow...

328

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent...

329

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

volatilization from interconnect alloys using solution conductivity. Schematic of a SOFC highlighting potential degradation mechanisms. The GEGR project assists the SOFCs...

330

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

project phases focused on cell and stack research and development with emphasis on SOFC performance enhancement (power density, fuel utilization, and degradation), cost...

331

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

chemical state of pulse laser deposited thin-film cathodes were measured. * A symmetric SOFC cell for ultra-small angle X-ray scattering studies was designed and constructed. The...

332

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

coatingscale durability through thermal cycling. * Drew the interest of a major SOFC manufacturer and specialty SOFC metals producer. Benefits nGimat's SBIR project...

333

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

assists the SOFCs program in meeting its cost and performance targets by ensuring that SOFC seals can achieve reliable operation over an extended operating life. The program...

334

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

methods developed in this ONR program can now be applied to the testing of a Delphi Gen 4 SOFC stack in the DOE research program. Benefits This NUWC project assists the SOFCs...

335

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

region or matching oxygen vacancy concen- trations. * Demonstrated that periodic reverse SOFC operation serves to prolong SOFC lifetimes. * Demonstrated elemental surface valence...

336

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

* Conduct bench-scale testing of the complete ICES incorporating the selected particle growth method with the optimized capture duct and diffuser systems to enable the...

337

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

and Engine Technology Background The mission of the U.S. Department of Energy's National Energy Technology Laboratory (DOENETL) Carbon Capture Program is to develop innovative...

338

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Testing of Rapid PSA for CO 2 Capture Background The mission of the U.S. Department of EnergyNational Energy Technology Laboratory (DOENETL) Carbon Capture Research &...

339

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

including lignite and sub-bituminous coal, make up about half of U.S. coal production and reserves. They have lower energy and sulfur contents than bituminous coal, but higher...

340

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Research Institute Background The mission of the U.S. Department of EnergyNational Energy Technology Laboratory (DOENETL) Carbon Capture Program is to develop innovative...

Note: This page contains sample records for the topic "ak mi gom" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

of Technology (Georgia Tech) will obtain data and develop models of the turbulent burning rate of HHC fuels at realistic conditions and in inhomo- geneous conditions such as...

342

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Gasifier; hot gas filtration; continuous ash depressurization systems; and various instrumentation, sampling, and controls systems. After only eight years from the time of...

343

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

gasifier; hot gas filtration; continuous ash depressurization systems; and various instrumentation, sampling, and controls systems. Only eight years after construction and...

344

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

capture technologies developed by the DOE program may also be applied to natural gas power plants after addressing the R&D challenges associated with the relatively low...

345

Anemometer Data (Wind Speed, Direction) for YKHC-Bethel, AK ...  

Open Energy Info (EERE)

Powering America, a DOE Office of Energy Efficiency & Renewable Energy (EERE) program. A dynamic map displaying all available data from DOE anemometer loan programs...

346

Anemometer Data (Wind Speed, Direction) for Tanana, AK (2001...  

Open Energy Info (EERE)

Powering America, a DOE Office of Energy Efficiency & Renewable Energy (EERE) program. A dynamic map displaying all available data from DOE anemometer loan programs...

347

Anemometer Data (Wind Speed, Direction) for Ugashik, AK (2001...  

Open Energy Info (EERE)

Powering America, a DOE Office of Energy Efficiency & Renewable Energy (EERE) program. A dynamic map displaying all available data from DOE anemometer loan programs...

348

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Transport Membrane (ITM) Oxygen Technology for Integration in IGCC and Other Advanced Power Generation Systems Background Oxygen is among the top five chemicals produced worldwide...

349

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

materials requirements for all fossil energy systems, including materials for advanced power generation technologies, such as coal gasification, heat engines, such as turbines,...

350

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Aerodynamics and Heat Transfer Studies of Parameters Specific to the IGCC- Requirements: High Mass Flow Endwall Contouring, Leading Edge Filleting and Blade Tip Ejection under...

351

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Effects of Hot Streak and Phantom Cooling on Heat Transfer in a Cooled Turbine Stage Including Particulate Deposition-The Ohio State University Background Sophisticated...

352

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

FutureGen 2.0 Background The combustion of fossil fuels for electricity generation is one of the largest contributors to carbon dioxide (CO 2 ) emissions in the United States and...

353

CCP-AK-LANL-004 Central Characterization Project  

E-Print Network (OSTI)

is subsequently reduced using high purity calcium metal to produce metallic plutonium and a calcium fluoride slag by evaporation and passed to a denitration process where it is converted to uranium oxide. This oxide is re-used

354

Building Energy Software Tools Directory: AkWarm  

NLE Websites -- All DOE Office Websites (Extended Search)

and Renewable Energy EERE Home | Programs & Offices | Consumer Information Building Energy Software Tools Directory Search Search Help Building Energy Software Tools Directory...

355

Building Energy Software Tools Directory: AkWarm  

NLE Websites -- All DOE Office Websites (Extended Search)

Tools by Country Australia Austria Belarus Belgium Brazil Canada Chile China Czech Republic Denmark Finland France Germany India Ireland Israel Italy Japan Netherlands New Zealand...

356

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

(3) improving efficiency of storage operations; and (4) developing Best Practices Manuals. Deploying these technologies in commercial-scale applications will require a...

357

Kenai, AK Liquefied Natural Gas Exports Price to China (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 2000's -- -- -- 2010's --...

358

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

main bulk phases, the Nb solid solution, and Nb silicides will be developed. Formation energies of the undoped and doped Nb-Si-Cr will be calculated and compared. Interfacial...

359

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

can contribute to the reduction of overall greenhouse gas emissions from fossil power plants. One area of research is the development and characterization of multiple...

360

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Vito Cedro III Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236-0940 412-386-7406 vito.cedro@netl.doe.gov Jason S....

Note: This page contains sample records for the topic "ak mi gom" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Zip State City NAME 99504 AK Anchorage Torgerson, Marissa Raeanne  

E-Print Network (OSTI)

, Petersham, MA 01366; §Departamento de Ecologi´a, Edificio de Ciencias, Universidad del Alcala´, E-28871 at Harvard Forest, Petersham, Massachusetts (42°54 N, 72°18 W), on eight species of trees and shrubs, 1­5 m

Almor, Amit

362

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Archer Daniels Midland Company: CO 2 Capture from Biofuels Production and Storage into the Mt. Simon Sandstone Background Carbon dioxide (CO 2 ) emissions from industrial...

363

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

diverse number of systems and chemical processes ranging from catalysts developments for Fischer-Tropsch synthesis applications, nanoscience, development of dense membrane systems...

364

Electrical Resistance Tomographic Profile L2, Site 0, Barrow AK  

Science Conference Proceedings (OSTI)

Figure 7a in http://esd.lbl.gov/files/about/staff/susanhubbard/PUBLISHED_-_Hubbard-Hydrogeology-2012_with_Gangodagamage_et_al.pdf

Susan Hubbard, Baptiste Dafflon

2013-12-08T23:59:59.000Z

365

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

and unknown samples. Analyses are used to characterize the fundamental properties of unconventional natural gas and oil reservoirs, ultra-deepwater and frontier-region...

366

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

of the plant. Calera's process reduces carbon dioxide and pollutant emissions by using waste streams to make useable products. In the Sub-phase 2a, Calera completed the detailed...

367

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

WGS National Carbon Capture Center - Water-Gas Shift Tests to Reduce Steam Use Background In cooperation with Southern Company Services, the U.S. Department of Energy (DOE)...

368

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

of filter elements to remove ash from the syngas prior to it being utilized in a gas turbine or fuel cell. The elements are arranged in columns called "candles" and contained...

369

AK-TRIBE-ASSOCIATION OF VILLAGE COUNCIL PRESIDENTS, INC  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

include installation of an (EPA certified) wood-fired central boiler, a conventional (household size) energy efficient oil-fired boiler, a heat distribution system, energy...

370

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

Unique Low Thermal Conductivity Thermal Barrier Coating (TBC) Architectures-UES Background Gas turbine engines used in integrated gasification combined cycle power plants require...

371

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

a novel catalyzed wall heat exchanger, and a network of heat exchangers to support thermal self-sufficiency. * Completed test stand modifications at UTC Power to support...

372

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

correspond to reflected-shock temperature (1180 K) and pressure (13.06 atm) for a stoichiometric H 2 -O 2 mixture in argon. Comparison with chemical kinetics mechanisms is good...

373

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA...  

NLE Websites -- All DOE Office Websites (Extended Search)

oil recovery (EOR) application. The industrial source of CO 2 will be a petroleum-coke-to-chemicals (methanol and other by-products) gasification plant being developed by...

374

Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Houston, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

NETL R&D Tackles Technological NETL R&D Tackles Technological Challenges of the Williston Basin's Bakken Formation Recent development of the Bakken Formation in the Williston Basin of western North Dakota and eastern Montana is a good example of persistent analysis of geologic data and adaptation of new completion technologies overcoming the challenges posed by unconventional reservoirs. However, as with most unconventional plays, as Bakken development continues, questions regarding

375

Ak-Chin Village, Arizona: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

283838°, -112.0876431° 283838°, -112.0876431° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":33.0283838,"lon":-112.0876431,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

376

Estimating Gas Production from a Cut Off Survey  

U.S. Energy Information Administration (EIA)

Test files have been generated for several areas for the initial model development and testing. Test files for Texas, Oklahoma, GOM, New Mexico, Louisiana, ...

377

Cracking in Other Material Systems - Programmaster.org  

Science Conference Proceedings (OSTI)

Oct 11, 2012 ... Program Organizers: Ramgopal Thodla, DNV Columbus; Suresh Divi, TIMET; Sai Venkateswaran, BP America Inc., E&P GoM Production

378

NETL: Oil & Natural Gas Technologies Reference Shelf - Presentation  

NLE Websites -- All DOE Office Websites (Extended Search)

The northern GOM is a prolific hydrocarbon province where rapid migration of oil, gases, and brines from deep subsurface petroleum reservoirs occurs through faults...

379

Offshore Oil and Gas Platforms as Stepping Stones for Expansion of Coral Communities: A Molecular Genetic Analysis.  

E-Print Network (OSTI)

??The northern Gulf of Mexico (GOM) is one of the most productive oil and gas exploration areas in the world, currently containing approximately 3,800 offshore (more)

Atchison, Amy D

2005-01-01T23:59:59.000Z

380

The Resource Potential of Natural Gas Hydrates  

NLE Websites -- All DOE Office Websites (Extended Search)

risks Schematic representation of offshore spill risk profile % of recorded spills & drilling phase in the GOM & North Sea -Source: SINTEF Database * Cementing Failures *...

Note: This page contains sample records for the topic "ak mi gom" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

Abbreviations  

Gasoline and Diesel Fuel Update (EIA)

Department of Energy EIA Energy Information Administration, U.S. Department of Energy FERC Federal Energy Regulatory Commission GOM Gulf of Mexico LNG Liquefied natural gas Mcf...

382

3-5-09_Final_Testimony_(EIA)_(Gruenspecht).pdf  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

feet in the Pacific, and 21 trillion cubic feet in the Eastern GOM. Assumptions about exploration, development, and production of economical fields, such as drilling schedules,...

383

Environmnentally Assisted Cracking in O&G - Programmaster.org  

Science Conference Proceedings (OSTI)

Oct 10, 2012... TIMET; Sai Venkateswaran, BP America Inc., E&P GoM Production ... State University; 2Shell International Exploration and Production, Inc.

384

CX-007493: Categorical Exclusion Determination | Department of...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Exclusion Determination CX-007493: Categorical Exclusion Determination GoM Miocene Carbon Dioxide Site Characterization Mega Transect: High-Resolution 3-dimensional Seismic...

385

Microsoft Word - figure_03.doc  

Gasoline and Diesel Fuel Update (EIA)

Gas in the United States and the Gulf of Mexico, 2005 (Million Cubic Feet) GOM Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity...

386

U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

1 1 Regional maps Figure F6. Coal supply regions Figure F6. Coal Supply Regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming OTHER WEST Rocky Mountain Southwest Northwest KY AK 1000 0 SCALE IN MILES Source: U.S. Energy Information Administration, Office

387

EIA - Daily Report 10/24/05 - Hurricane Impacts on U.S. Oil ...  

U.S. Energy Information Administration (EIA) Indexed Site

24, 4:00 pm Shut-in Status Date Shut-in Oil (bbld) % of Total Federal GOM Shut-in Gas (mmcfd) % of Total Federal GOM 10242005 1,018,478 64.6% 5,472 54.2% 10212005 986,805...

388

EIA Report 11/22/05 - Hurricane Impacts on U.S. Oil & Natural...  

U.S. Energy Information Administration (EIA) Indexed Site

2, 3:00 pm Shut-in Status Date Shut-in Oil (bbld) % of Total Federal GOM Shut-in Gas (mmcfd) % of Total Federal GOM 11222005 621,233 39.4% 3,219 31.9% 11212005 633,064 40.2%...

389

Temporal and Spatial Variability in Juvenile Red Snapper Otolith Elemental Signatures in the Northern Gulf of Mexico  

E-Print Network (OSTI)

in the Northern Gulf of Mexico WILLIAM F. PATTERSON III* Department of Biology, University of West Florida, 11000 of the northern Gulf of Mexico (GOM) to determine if otolith elemental signatures could be employed as natural important reef fishes in the U.S. Gulf of Mexico (GOM). Significant bycatch mortality caused by shrimp

Chen, Zhongxing

390

Investigation of Vertical and Horizontal Momentum Transfer in the Gulf of Mexico Using Empirical Mode Decomposition Method  

E-Print Network (OSTI)

Investigation of Vertical and Horizontal Momentum Transfer in the Gulf of Mexico Using Empirical of deep mooring stations in the Gulf of Mexico (GOM) have been analyzed with the newly developed empirical are in general agreement with the modeled results by Oey and Lee. 1. Introduction The Gulf of Mexico (GOM

391

C:\Annual\VENTCHAP.V8\NGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

2 2 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2002 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost

392

NGA_99fin.vp  

Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure

393

C:\ANNUAL\VENTCHAP.V8\NGA.VP  

Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1997 (Dollars per Thousand Cubic Feet) Figure

394

C:\ANNUAL\VENTCHAP.V8\NewNGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 28. Average Price of Natural Gas Delivered to U.S. Onsystem Residential Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition."

395

NGA98fin5.vp  

Gasoline and Diesel Fuel Update (EIA)

1998 1998 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure

396

C:\ANNUAL\VENTCHAP.V8\NewNGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 30. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 31. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2001 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of

397

NGA98fin5.vp  

Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1998 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental

398

C:\ANNUAL\VENTCHAP.V8\NGAla1109.vp  

Gasoline and Diesel Fuel Update (EIA)

2000 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-99.99 10.00-11.99 12.00+ 19. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2000 (Dollars per Thousand Cubic Feet) Figure 20. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2000 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural

399

C:\Annual\VENTCHAP.V8\NGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

2002 2002 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA 910, "Monthly Natural Gas Marketer Survey." 17. Average Price of Natural Gas Delivered to U.S. Commercial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration

400

Microsoft Word - Figure_18_19.doc  

Gasoline and Diesel Fuel Update (EIA)

9 9 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2004 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2004 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$2.49 price category.

Note: This page contains sample records for the topic "ak mi gom" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

49 49 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2003 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2003 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$1.99 price category.

402

NGA_99fin.vp  

Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1999 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental

403

C:\ANNUAL\VENTCHAP.V8\NGAla1109.vp  

Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 17. Average Price of Natural Gas Delivered to U.S. Residential

404

Welcome to the Efficient Windows Collaborative  

NLE Websites -- All DOE Office Websites (Extended Search)

Window Selection Tool: New Construction Windows Window Selection Tool: New Construction Windows The Window Selection Tool will take you through a series of design conditions pertaining to your design and location. It is a step-by-step decision-making tool to help determine the most energy efficient window for your house. SELECT LOCATION: AK Anchorage AK Fairbanks AL Birmingham AL Mobile AR Little Rock AZ Flagstaff AZ Phoenix AZ Tucson CA Arcata CA Bakersfield CA Daggett CA Fresno CA Los Angeles CA Red Bluff CA Sacramento CA San Diego CA San Francisco CO Denver CO Grand Junction CT Hartford DC Washington DE Wilmington FL Daytona Beach FL Jacksonville FL Miami FL Tallahassee FL Tampa GA Atlanta GA Savannah HI Honolulu IA Des Moines ID Boise IL Chicago IL Springfield IN Indianapolis KS Wichita KY Lexington KY Louisville LA Lake Charles LA New Orleans LA Shreveport MA Boston MD Baltimore ME Portland MI Detroit MI Grand Rapids MI Houghton MN Duluth MN Minneapolis MO Kansas City MO St. Louis MS Jackson MT Billings MT Great Falls NC Raleigh ND Bismarck NE Omaha NH Concord NJ Atlantic City NM Albuquerque NV Las Vegas NV Reno NY Albany NY Buffalo NY New York OH Cleveland OH Dayton OK Oklahoma City OR Medford OR Portland PA Philadelphia PA Pittsburgh PA Williamsport RI Providence SC Charleston SC Greenville SD Pierre TN Memphis TN Nashville TX Brownsville TX El Paso TX Fort Worth TX Houston TX Lubbock TX San Antonio UT Cedar City UT Salt Lake City VA Richmond VT Burlington WA Seattle WA Spokane WI Madison WV Charleston WY Cheyenne AB Edmonton MB Winnipeg ON Toronto PQ Montreal SELECT HOUSE TYPE:

405

May All Good Things Gather Here: Life, Religion and Marriage in a Mi nyag Tibetan Village  

E-Print Network (OSTI)

;#15; #29;#31;#3;#14;#12; 3 #11;#5;#12;#6;#3;#20; #8;#20; #31;#6;#7; #29;#7;#5;8#16;#11;#3; #14; #15;#7;#5;#14;#3;#19;#5;#17;.#7;#5; #5;#14; #14;#5;#7;#8; #5;#7;#8;#11;#12; #6;#5;#20;#5;9 : ?@AB@A : >C?DEFGH@AB@A : CIH@AB@A : EKDLMAB@A : N...

Bkra shis bzang po

2012-01-01T23:59:59.000Z

406

Ruofan Wu, Hieu Pham Trung Nguyen and Zetian Mi INTRODUCTION TO LEDs  

E-Print Network (OSTI)

-in-a-Wire Light Emitting Diodes and Prevention Method Nano-electronic Devices and Materials, Electrical Computer., Efficiency droop in nitride-based light-emitting diodes. Physica Status Solidi a-Applications and Materials history. Nature Photonics 2007, 1 (4), 189-192. [4] Holonyak, N., Is the light emitting diode (LED

Barthelat, Francois

407

"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn  

E-Print Network (OSTI)

May ________. A vistas la pornografa. Primera Hora, 22la medida contra la pornografa. El Nuevo Da, 13 Junecomunicacin contra la pornografa. El Nuevo Da, 16 May

Rivera, Petra Raquel

2010-01-01T23:59:59.000Z

408

Classes Are Starting Soon! Prof"..roMI Photography G,aph~ o..,rgn  

E-Print Network (OSTI)

Simone Gori and Val HamburQer, then atthe UnOiersily of FreiburQ in Germany, is a noyel Yariation ofthe .... S~deshows > Mind~Br'" Combiml1iOll of the RO'il1illU_liKed_lilies ""d Enigma Gori and HamburQer

409

Superfund Record of Decision (EPA Region 5): Wash King Laundry, Baldwin, MI, March 1993  

SciTech Connect

This decision document presents the selected remedial action for the Wash King Laundry Superfund site in Baldwin, Pleasant Plains Township, Michigan. The groundwater remedial action consists of the following: groundwater monitoring; deed restrictions; and groundwater extraction with physical/chemical treatment. The lagoon remedial action consists of the following: excavation of contaminated sediments and soils and off-site disposal.

1993-03-01T23:59:59.000Z

410

Characterization of UNUSUAL LATERAL ORGANS : a miRNA regulated F-Box protein  

E-Print Network (OSTI)

between ULO and the HD-ZIP proteins in planta. Anotherof homodomain-leucine zipper (HD-Zip) proteins. Plant SignalKANADI and class III HD-Zip gene families regulate embryo

Smith, Peter Thomas

2009-01-01T23:59:59.000Z

411

Integrated modeling within a Hydrologic Information System: An OpenMI based approach  

Science Conference Proceedings (OSTI)

This paper presents a prototype software system for integrated environmental modeling that provides interoperability between the Consortium of Universities for the Advancement of Hydrologic Science, Inc. (CUAHSI) Hydrologic Information System (HIS) and ... Keywords: Data management, Environmental management, Integrated modeling, Systems analysis

Anthony M. Castronova; Jonathan L. Goodall; Mehmet B. Ercan

2013-01-01T23:59:59.000Z

412

SEMIPERMEA LE MEM RANES FOR MI ROMA HINED SILI ON SURFA ES 5 US ...  

co-fabricated filtration system for enhancement of ... increases functionality and integration of micro ... for the U.S. Department of Energys National Nuclear ...

413

Informa(on and Resources Water Quality and Mi/ga/on: Bifenthrin and Fipronil  

E-Print Network (OSTI)

strategy, Pesticides fluxes, Surface water, Vineyard Introduction The intensive use of pesticides for crop on the mobilisation of pesticides and total fluxes in surface water. Moreover, the effect of the sampling strategy ranged from 1.0 to 60 g. Effect of sampling strategy on the estimation of pesticides fluxes in the river

Hammock, Bruce D.

414

Nitrate-responsive miR393/AFB3 regulatory module controls root system architecture in  

E-Print Network (OSTI)

Universidad Católica de Chile, Santiago 8331010, Chile; b Department of Plant and Soil Sciences, Delaware activated cell sorter (FACS) and extracted total RNA as described previously (9). KNO3 treat- ment induced

Green, Pamela

415

UCRL-MI-224010 ARM-06-012 ARM's Support for GCM Improvement:...  

NLE Websites -- All DOE Office Websites (Extended Search)

updrafts. Because the total mass of water condensed into clouds is controlled by thermodynamics, a greater number of droplets for the same mass of cloud water means that the...

416

"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn  

E-Print Network (OSTI)

Puertorriquea. Humacao, Puerto Rico: Editorial Furidi,and Colonization of Puerto Rico, 1493-1599. San Juan: Centroand U.S. Imperialism in Puerto Rico. Berkeley: University of

Rivera, Petra Raquel

2010-01-01T23:59:59.000Z

417

"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn.  

E-Print Network (OSTI)

??My dissertation examines entanglements of race, place, gender, and class in Puerto Rican reggaetn. Based on ethnographic and archival research in San Juan, Puerto Rico, (more)

Rivera, Petra Raquel

2010-01-01T23:59:59.000Z

418

Technical Section: CHuMI viewer: Compressive huge mesh interactive viewer  

Science Conference Proceedings (OSTI)

The preprocessing of large meshes to provide and optimize interactive visualization implies a complete reorganization that often introduces significant data growth. This is detrimental to storage and network transmission, but in the near future could ... Keywords: Interactive visualization, Large meshes, Lossless compression, Out-of-core

Clment Jamin; Pierre-Marie Gandoin; Samir Akkouche

2009-08-01T23:59:59.000Z

419

LAT HING MI RO OPTI AL SWIT H - Home - Energy Innovation ...  

owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2013-10084P

420

Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

DOE Green Energy (OSTI)

gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.

2006-08-29T23:59:59.000Z

Note: This page contains sample records for the topic "ak mi gom" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

ANRV286-MI60-17 ARI 25 May 2006 23:56 The Bacterial  

E-Print Network (OSTI)

Molecular Genetics and Microbiology, University of Texas, Austin, Texas 78712-0231; email: philipl energy-transducing membranes (133). It is widespread within the microbial world and in plants. Homologs

Georgiou, George

422

Office of Fossil Energy  

NLE Websites -- All DOE Office Websites (Extended Search)

and Rice to be appropriate. The initial ocean locations are Blake Ridge, Hydrate Ridge, Peru Margin and GOM. The permafrost location is Mallik. Although the ultimate goal of the...

423

Detection and Production of Methane Hydrate  

NLE Websites -- All DOE Office Websites (Extended Search)

and Rice to be appropriate. The initial ocean locations are Blake Ridge, Hydrate Ridge, Peru Margin and GOM. The permafrost location is Mallik. Although the ultimate goal of the...

424

A Proposal for Analyzing and Forecasting Lower-Atmospheric Undular Bores in the Western Gulf of Mexico Region  

Science Conference Proceedings (OSTI)

A method is presented for analyzing and forecasting the occurrence of lower-atmospheric undular bores over the western and central Gulf of Mexico (GOM) and adjacent land areas using standard operational forecasting and analysis techniques. The ...

Philip A. Lutzak

2013-02-01T23:59:59.000Z

425

Investigation of Vertical and Horizontal Momentum Transfer in the Gulf of Mexico Using Empirical Mode Decomposition Method  

Science Conference Proceedings (OSTI)

Data from a series of deep mooring stations in the Gulf of Mexico (GOM) have been analyzed with the newly developed empirical mode decomposition and Hilbert spectral analysis method, abbreviated as HilbertHuang transformation (HHT). The flows in ...

Ronald J. Lai; Norden Huang

2005-08-01T23:59:59.000Z

426

Natural Gas - U.S. Energy Information Administration (EIA) -...  

Annual Energy Outlook 2012 (EIA)

Archive) JUMP TO: In The News | Overview | PricesDemandSupply | Storage In the News: Natural gas drilling activity in the U.S. Gulf of Mexico (GOM) generally increased over the...

427

Gulf of Mexico Proved Reserves By Water Depth, 2009  

Gasoline and Diesel Fuel Update (EIA)

Gulf of Mexico Proved Reserves and Production by Water Depth, 2009 1 Gulf of Mexico Proved Reserves and Production by Water Depth The Gulf of Mexico Federal Offshore region (GOM...

428

Office of Fossil Energy DOE Award No.: DE-NT0005668 Quarterly...  

NLE Websites -- All DOE Office Websites (Extended Search)

Fossil Energy DOE Award No.: DE-NT0005668 Quarterly Report October 2009 to April 2011 Gas Hydrate Characterization in the GoM using Marine EM Methods Submitted by: Scripps...

429

Eddy and Wind-Forced Heat Transports in the Gulf of Mexico  

Science Conference Proceedings (OSTI)

The Gulf of Mexico (GOM) receives heat from the Caribbean Sea via the YucatanLoop Current (LC) system, and the corresponding ocean heat content (OHC) is important to weather and climate of the continental United States. However, the mechanisms ...

Y-L. Chang; L-Y. Oey

2010-12-01T23:59:59.000Z

430

Microsoft Word - figure_03.doc  

Gasoline and Diesel Fuel Update (EIA)

Cubic Feet) None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over GOM Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-895...

431

Microsoft Word - figure_03.doc  

Gasoline and Diesel Fuel Update (EIA)

Cubic Feet) None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over GOM Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-895A...

432

Microsoft Word - figure_03.doc  

Gasoline and Diesel Fuel Update (EIA)

1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over GOM Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-895, "Annual Quantity...

433

Microsoft Word - figure_03.doc  

Annual Energy Outlook 2012 (EIA)

1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over GOM Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-895A, "Annual Quantity...

434

Thermal regime of the NW shelf of the Gulf of Mexico. 1) Thermal and pressure fields  

E-Print Network (OSTI)

Thermal regime of the NW shelf of the Gulf of Mexico. 1) Thermal and pressure fields Bulletin de la) Abstract The thermal field of the Gulf of Mexico (GoM) is analyzed from a comprehensive temperature temperature et de pression. Résumé Le régime thermique du Golfe du Mexique (GoM ­ Gulf of Mexico) est examiné

Paris-Sud XI, Université de

435

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Geological Sequestration Geological Sequestration Consortium-Development Phase Illinois Basin - Decatur Project Site Background The U.S. Department of Energy Regional Carbon Sequestration Partnership (RCSP) Initiative consists of seven partnerships. The purpose of these partnerships is to determine the best regional approaches for permanently storing carbon dioxide (CO2) in geologic formations. Each RCSP includes stakeholders comprised of state and local agencies, private companies, electric utilities, universities, and nonprofit organizations. These partnerships are the core of a nationwide network helping to establish the most suitable technologies, regulations, and infrastructure needs for carbon storage. The partnerships include more than 400 distinct organizations, spanning 43 states

436

Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

CONTACT CONTACT Cathy Summers Director, Process Development Division National Energy Technology Laboratory 1450 Queen Ave., SW Albany, OR 97321-2198 541-967-5844 cathy.summers@netl.doe.gov An Integrated Approach To Materials Development Traditional trial-and-error method in materials development is time consuming and costly. In order to speed up materials discovery for a variety of energy applications, an integrated approach for multi-scale materials simulations and materials design has

437

Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Large Scale Simulations of the Large Scale Simulations of the Mechanical Properties of Layered Transition Metal Ternary Compounds for FE Power Systems Background The U.S. Department of Energy (DOE) promotes the advancement of computational capabilities to develop materials for advanced fossil energy power systems. The DOE's National Energy Technology Laboratory (NETL) Advanced Research (AR) Program is working to enable the next generation of Fossil Energy (FE) power systems. The goal of

438

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Investigations and Investigations and Rational Design of Durable High- Performance SOFC Cathodes- Georgia Institute of Technology Background The mission of the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) is to advance energy options to fuel our economy, strengthen our security, and improve our environment. With the Solid Oxide Fuel Cells (SOFCs) program and systems coordination from the Solid State Energy Conversion Alliance (SECA), DOE/ NETL is leading the research, development, and demonstration of solid SOFCs for both domestic coal and natural gas fueled central generation power systems that enable low cost, high efficiency, near-zero emissions and water usage, and carbon dioxide (CO 2 ) capture. Cathode durability is critical to long-term SOFC performance for commercial deployment.

439

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Oxygen Carriers for Coal-Fueled Oxygen Carriers for Coal-Fueled Chemical Looping Combustion Background Fundamental and applied research on carbon capture and storage (CCS) technologies is necessary to allow the current fleet of coal-fired power plants to comply with existing and emerging environmental regulations. These technologies offer great potential for mitigating carbon dioxide (CO 2 ) emissions into the atmosphere without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires a significantly expanded workforce trained in various CCS technical and non-technical disciplines that are currently under-represented in the United States. Education and training activities are needed to develop a future generation of geologists, scientists, and engineers who

440

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Novel Supercritical Carbon Dioxide Novel Supercritical Carbon Dioxide Power Cycle Utilizing Pressurized Oxy-combustion in Conjunction with Cryogenic Compression Background The Advanced Combustion Systems (ACS) Program of the U.S. Department of Energy/ National Energy Technology Laboratory (DOE/NETL) is aiming to develop advanced oxy- combustion systems that have the potential to improve the efficiency and environmental impact of coal-based power generation systems. Currently available carbon dioxide (CO2) capture and storage technologies significantly reduce the efficiency of the power cycle. The ACS Program is focused on developing advanced oxy-combustion systems capable of achieving power plant efficiencies approaching those of air-fired systems without CO2 capture. Additionally, the program looks to accomplish this while maintaining near

Note: This page contains sample records for the topic "ak mi gom" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

PO Box 880 PO Box 880 Morgantown, WV 26507 304-285-1345 traci.rodosta@netl.doe.gov Andrea McNemar Project Manager National Energy Technology Laboratory 3610 Collins Ferry Road PO Box 880 Morgantown, WV 26507 304-285-2024 andrea.mcnemar@netl.doe.gov Charles D. Gorecki Technical Contact Senior Research Manager Energy & Environmental Research Center University of North Dakota 15 North 23 rd Street, Stop 9018 Grand Forks, ND 58202-9018 701-777-5355 cgorecki@undeerc.org Edward N. Steadman Deputy Associate Director for Research Energy & Environmental Research Center University of North Dakota 15 North 23 rd Street, Stop 9018 Grand Forks, ND 58202-9018 701-777-5279 esteadman@undeerc.org John A. Harju Associate Director for Research Energy & Environmental Research Center University of North Dakota

442

File:EIA-AK-CookInlet-BOE.pdf | Open Energy Information  

Open Energy Info (EERE)

CookInlet-BOE.pdf CookInlet-BOE.pdf Jump to: navigation, search File File history File usage Alaska's Cook Inlet By 2001 BOE Reserve Class Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(5,100 × 6,600 pixels, file size: 10.19 MB, MIME type: application/pdf) Description Alaska's Cook Inlet By 2001 BOE Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States Alaska File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:55, 20 December 2010 Thumbnail for version as of 16:55, 20 December 2010 5,100 × 6,600 (10.19 MB) MapBot (Talk | contribs) Automated bot upload

443

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Geological & Environmental Sciences Geological & Environmental Sciences Subsurface Experimental Laboratories Autoclave and Core Flow Test Facilities Description Researchers at NETL study subsurface systems in order to better characterize and understand gas-fluid-rock and material interactions that impact environmental and resource issues related to oil, gas, and CO2 storage development. However, studying the wide variety of subsurface environments related to hydrocarbon and CO2 systems requires costly and technically challenging tools and techniques. As a result, NETL's Experimental Laboratory encompasses multi-functional, state-of-the-art facilities that perform a wide spectrum of geological studies providing an experimental basis for modeling of various subsurface phenomena and processes. This includes, but is not

444

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Improving Durability of Turbine Components through Trenched Film Cooling and Contoured Endwalls-University of Texas at Austin Background Gas turbine operation utilizing coal-derived high hydrogen fuels (synthesis gas, or syngas) requires new cooling configurations for turbine components. The use of syngas is likely to lead to degraded cooling performance resulting from rougher surfaces and partial blockage of film cooling holes. In this project the University of Texas at Austin (UT) in cooperation with The Pennsylvania State University (Penn State) will investigate the development of new film cooling and endwall cooling designs for maximum performance when subjected to high levels of contaminant depositions. This project was competitively selected under the University Turbine Systems Research

445

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Single-Crystal Sapphire Optical Fiber Single-Crystal Sapphire Optical Fiber Sensor Instrumentation for Coal Gasifiers Background Accurate temperature measurement inside a coal gasifier is essential for safe, efficient, and cost-effective operation. However, current sensors are prone to inaccurate readings and premature failure due to harsh operating conditions including high temperatures (1,200-1,600 degrees Celsius [°C]), high pressures (up to 1000 pounds per square inch gauge [psig]), chemical corrosiveness, and high flow rates, all of which lead to corrosion, erosion, embrittlement, and cracking of gasifier components as well as sensor failure. Temperature measurement is a critical gasifier control parameter because temperature is a critical factor influencing the gasification and it leads to impacts in efficiency and

446

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Unraveling the Role of Transport, Unraveling the Role of Transport, Electrocatalysis, and Surface Science in the SOFC Cathode Oxygen Reduction Reaction-Boston University Background The mission of the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) is to advance energy options to fuel our economy, strengthen our security, and improve our environment. With the Solid Oxide Fuel Cells (SOFCs) program and systems coordination from the Solid State Energy Conversion Alliance (SECA), DOE/NETL is leading the research, development, and demonstration of SOFCs for both domestic coal and natural gas fueled central generation power systems that enable low cost, high efficiency, near-zero emissions and water usage, and carbon dioxide (CO 2 ) capture The electrochemical performance of SOFCs can be substantially influenced by

447

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Low-Swirl Injectors for Hydrogen Gas Low-Swirl Injectors for Hydrogen Gas Turbines in Near-Zero Emissions Coal Power Plants-Lawrence Berkeley National Laboratory Background The U.S. Department of Energy Hy(DOE) Lawrence Berkeley National Laboratory (LBNL) is leading a project in partnership with gas turbine manufacturers and universities to develop a robust ultra-low emission combustor for gas turbines that burn high hydrogen content (HHC) fuels derived from gasification of coal. A high efficiency and ultra-low emissions HHC fueled gas turbine is a key component of a near-zero emis- sions integrated gasification combined cycle (IGCC) clean coal power plant. This project is managed by the DOE National Energy Technology Laboratory (NETL). NETL is researching advanced turbine technology with the goal of producing reliable,

448

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Demonstration of a Coal-Based Demonstration of a Coal-Based Transport Gasifier Background Coal is an abundant and indigenous energy resource and currently supplies almost 38 percent of the United States' electric power. Demand for electricity, vital to the nation's economy and global competitiveness, is projected to increase by almost 28 percent by 2040. The continued use of coal is essential for providing an energy supply that supports sustainable economic growth. Unfortunately, nearly half of the nation's electric power generating infrastructure is more than 30 years old and in need of substantial refurbishment or replacement. Additional capacity must also be put in service to keep pace with the nation's ever-growing demand for electricity. It is in the public interest

449

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Foamed Wellbore Cement Foamed Wellbore Cement Stability under Deep Water Conditions Background Foamed cement is a gas-liquid dispersion that is produced when an inert gas, typically nitrogen, is injected into a conventional cement slurry to form microscopic bubbles. Foamed cements are ultralow-density systems typically employed in formations that are unable to support annular hydrostatic pressure exerted by conventional cement slurries. More recently, the use of foamed cement has expanded into regions with high-stress environments, for example, isolating problem formations typical in the Gulf of Mexico. In addition to its light-weight application, foamed cement has a unique resistance to temperature and pressure-induced stresses. Foamed cement exhibits superior fluid

450

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Scale Computational Design and Scale Computational Design and Synthesis of Protective Smart Coatings for Refractory Metal Alloys Background The goal of the University Coal Research (UCR) Program within the Department of Energy (DOE) National Energy Technology Laboratory (NETL) is to further the understanding of coal utilization. Since the program's inception in 1979, its primary objectives have been to (1) improve understanding of the chemical and physical processes involved in the conversion and utilization of coal so it can be used in an environmentally acceptable manner, (2) maintain and upgrade the coal research capabilities of and facilities at U.S. colleges and universities, and (3) support the education of students in the area of coal science. The National Energy Technology Laboratory's Office of Coal and Power Systems supports

451

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Conversion of CO2 in Commercial Conversion of CO2 in Commercial Materials using Carbon Feedstocks Background The Department of Energy's (DOE) Carbon Storage Program encompasses five Technology Areas: (1) Geologic Storage and Simulation and Risk Assessment (GSRA), (2) Monitoring, Verification, Accounting and Assessment (MVAA), (3) Carbon Dioxide (CO2) Use and Re-Use, (4) Regional Carbon Sequestration Partnerships (RCSP), and (5) Focus Areas for Sequestration Science. The first three Technology Areas comprise the Core Research and Development (R&D), which includes studies ranging from applied laboratory to pilot-scale research focused on developing new technologies and systems for greenhouse gas (GHG) mitigation through carbon storage. This project is part of the Core R&D CO2 Use and Re-use Technology Area and focuses on developing pathways

452

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Experimental and Chemical Kinetics Experimental and Chemical Kinetics Study of the Combustion of Syngas and High Hydrogen Content Fuels- Pennsylvania State University Background Pennsylvania State University is teaming with Princeton University to enhance scientific understanding of the underlying factors affecting combustion for turbines in integrated gasification combined cycle (IGCC) plants operating on synthesis gas (syngas). The team is using this knowledge to develop detailed, validated combustion kinetics models that are useful to support the design and future research and development needed to transition to fuel flexible operations, including high hydrogen content (HHC) fuels derived from coal syngas, the product of gasification of coal. This project also funda- mentally seeks to resolve previously reported discrepancies between published ex-

453

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Coating Issues in Coal-Derived Synthesis Coating Issues in Coal-Derived Synthesis Gas/Hydrogen-Fired Turbines-Oak Ridge National Laboratory Background The Department of Energy (DOE) Oak Ridge National Laboratory (ORNL) is leading research on the reliable operation of gas turbines when fired with synthesis gas (syngas) and hydrogen-enriched fuel gases with respect to firing temperature and fuel impurity levels (water vapor, sulfur, and condensable species). Because syngas is derived from coal, it contains more carbon and more impurities than natural gas. In order to achieve the desired efficiency, syngas-fired systems need to operate at very high temperatures but under combustion conditions necessary to reduce nitrogen oxide (NO X ) emissions. ORNL's current project is focused on understanding the performance of high-

454

Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Diode Laser Cladding of High Diode Laser Cladding of High Temperature Alloys Used in USC Coal- Fired Boilers Background The Advanced Research (AR) Materials Program addresses materials requirements for all fossil energy systems, including materials for advanced power generation and coal fuels technologies. Examples of these technologies include coal gasification, heat engines such as turbines, combustion systems, fuel cells, hydrogen production, and carbon capture

455

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Electrochemical Processes Electrochemical Processes for CO2 Capture and Conversion to Commodity Chemicals Background The Department of Energy's (DOE) Carbon Storage Program encompasses five Technology Areas: (1) Geologic Storage and Simulation and Risk Assessment (GSRA), (2) Monitoring, Verification, Accounting and Assessment (MVAA), (3) Carbon Dioxide (CO2) Use and Re-Use, (4) Regional Carbon Sequestration Partnerships (RCSP), and (5) Focus Areas for Sequestration Science. The first three Technology Areas comprise the Core Research and Development (R&D), which includes studies ranging from applied laboratory to pilot-scale research focused on developing new technologies and systems for greenhouse gas (GHG) mitigation through carbon storage. This project is part of the

456

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Preparation and Testing of Corrosion- Preparation and Testing of Corrosion- and Spallation-Resistant Coatings- University of North Dakota Background The life of turbine components is a significant issue in gas fired turbine power systems. In this project the University of North Dakota (UND) will advance the maturity of a process capable of bonding oxide-dispersion strengthened alloy coatings onto nickel-based superalloy turbine parts. This will substantially improve the lifetimes and maximum use temperatures of parts with and without thermal barrier coatings (TBCs). This project is laboratory research and development and will be performed by UND at their Energy & Environmental Research Center (EERC) facility and the Department of Mechanical Engineering. Some thermal cycle testing will occur at Siemens Energy

457

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Integrated Assessment Model for Predicting Integrated Assessment Model for Predicting Potential Risks to Groundwater and Surface Water Associated with Shale Gas Development Background The EPAct Subtitle J, Section 999A-999H established a research and development (R&D) program for ultra-deepwater and unconventional natural gas and other petroleum resources. This legislation identified three program elements to be administered by a consortium under contract to the U.S. Department of Energy. Complementary research performed by the National Energy Technology Laboratory's (NETL) Office of Research and Development (ORD) is a fourth program element of this cost-shared program. NETL was also tasked with managing the consortium: Research Partnership to Secure Energy for America (RPSEA). Historically, the Complementary R&D Program being carried out by NETL's ORD has focused

458

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Demonstration of Enabling Spar-Shell Demonstration of Enabling Spar-Shell Cooling Technology in Gas Turbines - Florida Turbine Technologies Background The Florida Turbine Technologies (FTT) spar-shell gas turbine airfoil concept has an internal structural support (the spar) and an external covering (the shell). This concept allows the thermal-mechanical and aerodynamic requirements of the airfoil design to be considered separately, thereby enabling the overall design to be optimized for the harsh environment these parts are exposed to during operation. Such optimization is one of the major advantages of the spar-shell approach that is not possible with today's conventional monolithic turbine components. The proposed design integrates a novel cooling approach based on Advanced Recircu-

459

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Los Alamos National Laboratory - Los Alamos National Laboratory - Advancing the State of Geologic Sequestration Technologies towards Commercialization and Pre-Combustion Capture Goals Background The U.S. Department of Energy's (DOE) National Energy Technology Laboratory (NETL) is helping to develop technologies to capture, separate, and store carbon dioxide (CO 2 ) to aid in reducing greenhouse gas (GHG) emissions without adversely influencing energy use or hindering economic growth. Carbon capture and sequestration (CCS) - the capture of CO 2 from large point sources and subsequent injection into deep geologic formations for permanent storage - is one option that is receiving considerable attention. NETL is devoted to improving geologic carbon sequestration technology by funding research projects aimed at removing barriers to commercial-scale

460

Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Solid Oxide Fuel Cell Cathodes: Solid Oxide Fuel Cell Cathodes: Unraveling the Relationship among Structure, Surface Chemistry, and Oxygen Reduction-Boston University Background The mission of the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) is to advance energy options to fuel our economy, strengthen our security, and improve our environment. With the Solid Oxide Fuel Cells (SOFCs) program and systems coordination from the Solid State Energy Conversion Alliance (SECA), DOE/NETL is leading the research, development, and demonstration of SOFCs for both domestic coal and natural gas fueled central generation power systems that enable low cost, high efficiency, near-zero emissions and water usage, and carbon dioxide (CO 2 ) capture The Boston University (BU) project was competitively selected to acquire the fundamental

Note: This page contains sample records for the topic "ak mi gom" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Materials for Robust Repair Materials for Robust Repair of Leaky Wellbores in CO2 Storage Formations Background The overall goal of the Department of Energy's (DOE) Carbon Storage Program is to develop and advance technologies that will significantly improve the effectiveness of geologic carbon storage, reduce the cost of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent storage of carbon dioxide (CO2) to reduce greenhouse gas (GHG) emissions without adversely affecting energy use or hindering economic growth. Geologic carbon storage involves the injection of CO2 into underground formations that have the ability to securely contain the CO2 permanently. Technologies being

462

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Oxy-fired Pressurized Fluidized Bed Oxy-fired Pressurized Fluidized Bed Combustor Development and Scale-up for New and Retrofit Coal-fired Power Plants Background The Advanced Combustion Systems (ACS) Program of the U.S. Department of Energy/ National Energy Technology Laboratory (DOE/NETL) is aiming to develop advanced oxy-combustion systems that have the potential to improve the efficiency and environmental impact of coal-based power generation systems. Currently available carbon dioxide (CO2) capture and storage technologies significantly reduce the efficiency of the power cycle. The ACS Program is focused on developing advanced oxy-combustion systems capable of achieving power plant efficiencies approaching those of air-fired systems without CO2 capture. Additionally, the program looks to

463

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Quantification Quantification of Wellbore Leakage Risk Using Non-Destructive Borehole Logging Techniques Background Through its core research and development program administered by the National Energy Technology Laboratory (NETL), the U.S. Department of Energy (DOE) emphasizes monitoring, verification, and accounting (MVA), as well as computer simulation and risk assessment, of possible carbon dioxide (CO 2 ) leakage at CO 2 geologic storage sites. MVA efforts focus on the development and deployment of technologies that can provide an accurate accounting of stored CO 2 , with a high level of confidence that the CO 2 will remain stored underground permanently. Effective application of these MVA technologies will ensure the safety of geologic storage projects with respect to both human health and the

464

Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Storage Research Storage Research Carbon capture and storage (CCS) is a key component of the U.S. carbon management portfolio. Numerous studies have shown that CCS can account for up to 55 percent of the emissions reductions needed to stabilize and ultimately reduce atmospheric concentrations of CO 2 . NETL's Carbon Storage Program is readying CCS technologies for widespread commercial deployment by 2020. The program's goals are:

465

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Sequestration Sequestration Training and Research Background Increased attention is being placed on research into technologies that capture and store carbon dioxide (CO2). Carbon capture and storage (CCS) technologies offer great potential for reducing CO2 emissions and, in turn, mitigating global climate change without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires a significantly expanded workforce trained in various CCS specialties that are currently under- represented in the United States. Education and training activities are needed to develop a future generation of geologists, scientists, and engineers who possess the skills required for implementing and deploying CCS technologies.

466

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

R& R& D FAC T S Natural Gas & Oil R&D CONTACTS George Guthrie Focus Area Lead Office of Research and Development National Energy Technology Laboratory 626 Cochrans Mill Road Pittsburgh, PA 15236-0940 412-386-6571 george.guthrie@netl.doe.gov Kelly Rose Technical Coordinator Office of Research and Development National Energy Technology Laboratory 1450 Queen Avenue SW Albany, OR 97321-2152 541-967-5883 kelly.rose@netl.doe.gov PARTNERS Carnegie Mellon University Pittsburgh, PA Oregon State University Corvallis, OR Pennsylvania State University State College, PA University of Pittsburgh Pittsburgh, PA URS Corporation Pittsburgh, PA Virginia Tech Blacksburg, VA West Virginia University Morgantown, WV

467

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Gulf of Mexico Miocene CO Gulf of Mexico Miocene CO 2 Site Characterization Mega Transect Background Carbon capture and storage (CCS) technologies offer the potential for reducing CO 2 emissions without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires adequate geologic formations capable of (1) storing large volumes of CO 2 , (2) receiving injected CO 2 at efficient and economic rates, and (3) retaining CO 2 safely over extended periods. Research efforts are currently focused on conventional and unconventional storage formations within depositional environments such as: deltaic, fluvial, alluvial, strandplain, turbidite, eolian, lacustrine, clastic shelf, carbonate shallow shelf, and reef. Conventional storage types are porous permeable clastic or carbonate rocks that have

468

Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

DOE Leads Collaborative Effort DOE Leads Collaborative Effort to Quantify Environmental Changes that Coincide with Shale Gas Development Background DOE's National Energy Technology Laboratory (NETL) is leading a joint industry/ government research project to document environmental changes that occur during the lifecycle of shale gas development. The research plan calls for one year of environmental monitoring before development takes place to establish baseline conditions and account for seasonal variations. Monitoring then will continue through the different stages of unconventional shale gas development including: road and pad construction, drilling, and hydraulic fracturing, and for at least one year of subsequent production operations. The study will take place at a Range Resources-Appalachia

469

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

General Electric General Electric Background GE Power & Water, along with GE Global Research Center, has an ongoing U.S. Depart- ment of Energy (DOE) program to develop gas turbine technology for coal-based integrated gasification combined cycle (IGCC) power generation that will improve efficiency, reduce emissions, lower costs, and allow for carbon capture and storage (CCS). GE is broadening this development effort, along with expanding applicability to industrial applications such as refineries and steel mills under the American Recovery and Reinvestment Act (ARRA). ARRA funding will be utilized to facilitate a set of gas turbine technology advancements that will improve the efficiency, emissions, and cost performance of turbines with industrial CCS. ARRA industrial technology acceleration,

470

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Livermore National Laboratory Livermore National Laboratory - Advancing the State of Geologic Sequestration Technologies towards Commercialization Background The U.S. Department of Energy's (DOE) National Energy Technology Laboratory (NETL) is helping to develop carbon capture and storage (CCS) technologies to capture, separate, and store carbon dioxide (CO 2 ) in order to reduce green-house gas emissions without adversely influencing energy use or hindering economic growth. Carbon sequestration technologies capture and store CO 2 by injecting and permanently storing it in underground geologic formations. NETL is working to advance geologic carbon sequestration technology by funding research projects that aim to accelerate deployment and remove barriers to commercial-scale carbon sequestration. Lawrence Livermore National Laboratory

471

Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

r r oj e c t Fac t s Advanced Research Micro-Structured Sapphire Fiber Sensors for Simultaneous Measurements of High Temperature and Dynamic Gas Pressure in Harsh Environments Background Securing a sustainable energy economy by developing affordable and clean energy from coal and other fossil fuels is central to the mission of the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL). To further this mission, NETL funds research and development of novel sensors that can function under the

472

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Oxy-Fuel Turbo Machinery Oxy-Fuel Turbo Machinery Development for Energy Intensive Industrial Applications-Clean Energy Systems Background Clean Energy Systems (CES), with support from Siemens Energy and Florida Turbine Technologies (FTT), has an ongoing U.S. Department of Energy (DOE) program to develop an oxy-fuel combustor for highly efficient near zero emission power plants. CES is expanding this development for an industrial-scale, oxy-fuel reheat combustor- equipped intermediate-pressure oxy-fuel turbine (IP-OFT) under the American Recovery and Reinvestment Act (ARRA). Through the design, analysis, and testing of a modified Siemens SGT-900 gas turbine, the team will demonstrate a simple-cycle oxy-fuel system. ARRA funding is accelerating advancement in OFT technology for

473

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Passive Wireless Acoustic Wave Sensors Passive Wireless Acoustic Wave Sensors for Monitoring CO 2 Emissions for Geological Sequestration Sites Background The overall goal of the Department of Energy's (DOE) Carbon Storage Program is to develop and advance technologies that will significantly improve the effectiveness of geologic carbon storage, reduce the cost of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent storage of carbon dioxide (CO 2 ) to reduce greenhouse gas (GHG) emissions without adversely affecting energy use or hindering economic growth. Geologic carbon storage involves the injection of CO 2 into underground formations that have the ability to securely contain the CO

474

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Criteria for Flame- Criteria for Flame- holding Tendencies within Premixer Passages for High Hydrogen Content Fuels-University of California, Irvine Background The gas turbine community must develop low emissions systems while increasing overall efficiency for a widening source of fuels. In this work, the University of California, Irvine (UCI) will acquire the fundamental knowledge and understanding to facilitate the development of robust, reliable, and low emissions combustion systems with expanded high hydrogen content (HHC) fuel flexibility. Specifically, understanding flashback and the subsequent flameholding tendencies associated with geometric features found within combustor fuel/air premixers will enable the development of design guides to estimate flame holding tendencies for lean, premixed emission combustion systems

475

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Combining Space Geodesy, Seismology, Combining Space Geodesy, Seismology, and Geochemistry for MVA of CO2 in Sequestration Background Through its core research and development program administered by the National Energy Technology Laboratory (NETL), the U.S. Department of Energy (DOE) emphasizes monitoring, verification, and accounting (MVA), as well as computer simulation and risk assessment, of possible carbon dioxide (CO2) leakage at CO2 geologic storage sites. MVA efforts focus on the development and deployment of technologies that can provide an accurate accounting of stored CO2, with a high level of confidence that the CO2 will remain stored underground permanently. Effective application of these MVA technologies will ensure the safety of geologic storage projects with respect to both

476

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Enhanced Analytical Simulation Tool for Enhanced Analytical Simulation Tool for CO2 Storage Capacity Estimation and Uncertainty Quantification Background The overall goal of the Department of Energy's (DOE) Carbon Storage Program is to develop and advance technologies that will significantly improve the effectiveness of geologic carbon storage, reduce the cost of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent storage of carbon dioxide (CO2) to reduce greenhouse gas (GHG) emissions without adversely affecting energy use or hindering economic growth. Geologic carbon storage involves the injection of CO2 into underground formations that have the ability to securely contain the CO2 permanently. Technologies being

477

2013,1,"AK",3522,"Chugach Electric Assn Inc",0,,,,0,0,,,,0,0...  

U.S. Energy Information Administration (EIA) Indexed Site

762,0,181.531,12801.234,3064.185,58.615,0,15924.034,15248,226,1,0,15475 2013,1,"VT",7601,"Green Mountain Power Corp",39.65,10.83,0,0,50.48,1068,276,0,0,1344,3998,216,0,0,4214...

478

US Fish and Wildlife Service biomonitoring operations manual, Appendices A--K  

Science Conference Proceedings (OSTI)

Volume 2 contains Appendices and Summary Sheets for the following areas: A-Legislative Background and Key to Relevant Legislation, B- Biomonitoring Operations Workbook, C-Air Monitoring, D-Introduction to the Flora and Fauna for Biomonitoring, E-Decontamination Guidance Reference Field Methods, F-Documentation Guidance, Sample Handling, and Quality Assurance/Quality Control Standard Operating Procedures, G-Field Instrument Measurements Reference Field Methods, H-Ground Water Sampling Reference Field Methods, I-Sediment Sampling Reference Field Methods, J-Soil Sampling Reference Field Methods, K-Surface Water Reference Field Methods. Appendix B explains how to set up strategy to enter information on the ``disk workbook``. Appendix B is enhanced by DE97006389, an on-line workbook for users to be able to make revisions to their own biomonitoring data.

Gianotto, D.F.; Rope, R.C.; Mondecar, M.; Breckenridge, R.P.; Wiersma, G.B.; Staley, C.S.; Moser, R.S.; Sherwood, R.; Brown, K.W.

1993-04-01T23:59:59.000Z

479

ARM Climate Modeling Best Estimate Barrow, AK (ARMBE-ATM NSAC1)  

SciTech Connect

The ARM CMBE-ATM [Xie, McCoy, Klein et al.] data file contains a best estimate of several selected atmospheric quantities from ACRF observations and NWP analysis data.

Renata McCoy; Shaocheng Xie

2010-10-05T23:59:59.000Z

480

ARM Climate Modeling Best Estimate Barrow, AK (ARMBE-ATM NSAC1)  

DOE Data Explorer (OSTI)

The ARM CMBE-ATM [Xie, McCoy, Klein et al.] data file contains a best estimate of several selected atmospheric quantities from ACRF observations and NWP analysis data.

Renata McCoy; Shaocheng Xie

Note: This page contains sample records for the topic "ak mi gom" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

ARM Climate Modeling Best Estimate Barrow, AK (ARMBE-CLDRAD NSAC1 V2.1)  

SciTech Connect

The ARM CMBE-ATM [Xie, McCoy, Klein et al.] data file contains a best estimate of several selected atmospheric quantities from ACRF observations and NWP analysis data.

Renata McCoy; Shaocheng Xie

2010-08-11T23:59:59.000Z

482

ARM Climate Modeling Best Estimate Barrow, AK (ARMBE-CLDRAD NSAC1)  

SciTech Connect

The ARM CMBE-ATM [Xie, McCoy, Klein et al.] data file contains a best estimate of several selected atmospheric quantities from ACRF observations and NWP analysis data.

Renata McCoy; Shaocheng Xie

2012-05-14T23:59:59.000Z

483

ARM Climate Modeling Best Estimate Barrow, AK (ARMBE-ATM NSAC1)  

SciTech Connect

The ARM CMBE-ATM [Xie, McCoy, Klein et al.] data file contains a best estimate of several selected atmospheric quantities from ACRF observations and NWP analysis data.

Renata McCoy; Shaocheng Xie

2012-05-14T23:59:59.000Z

484

ARM Climate Modeling Best Estimate Barrow, AK (ARMBE-ATM NSAC1 V4)  

SciTech Connect

The ARM CMBE-ATM [Xie, McCoy, Klein et al.] data file contains a best estimate of several selected atmospheric quantities from ACRF observations and NWP analysis data.

Renata McCoy; Shaocheng Xie; ,

2013-12-26T23:59:59.000Z

485

ARM Climate Modeling Best Estimate Barrow, AK (ARMBE-CLDRAD NSAC1 V2.1)  

DOE Data Explorer (OSTI)

The ARM CMBE-ATM [Xie, McCoy, Klein et al.] data file contains a best estimate of several selected atmospheric quantities from ACRF observations and NWP analysis data.

Renata McCoy; Shaocheng Xie

486

ARM Climate Modeling Best Estimate Barrow, AK (ARMBE-CLDRAD NSAC1)  

DOE Data Explorer (OSTI)

The ARM CMBE-ATM [Xie, McCoy, Klein et al.] data file contains a best estimate of several selected atmospheric quantities from ACRF observations and NWP analysis data.

Renata McCoy; Shaocheng Xie

487

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Surface-Modified Electrodes: Enhancing Surface-Modified Electrodes: Enhancing Performance Guided by In-Situ Spectroscopy and Microscopy- Stanford University Background The mission of the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) is to advance energy options to fuel our economy, strengthen our security, and improve our environment. With the Solid Oxide Fuel Cells (SOFCs) program and systems coordination from the Solid State Energy Conversion Alliance (SECA), DOE/NETL is leading the research, development, and demonstration of SOFCs for both domestic coal and natural gas fueled central generation power systems that enable low cost, high efficiency, near-zero emissions and water usage, and carbon dioxide (CO 2 ) capture. The electrochemical performance of SOFCs can be substantially influenced by mass and

488

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Large Eddy Simulation Modeling of Large Eddy Simulation Modeling of Flashback and Flame Stabilization in Hydrogen-Rich Gas Turbines using a Hierarchical Validation Approach- University of Texas at Austin Background The focus of this project is the development of advanced large eddy simulation (LES)-based combustion modeling tools that can be used to design low emissions combustors burning high hydrogen content fuels. The University of Texas at Austin (UT) will develop models for two key topics: (1) flame stabilization, lift- off, and blowout when fuel-containing jets are introduced into a crossflow at high pressure, and (2) flashback dynamics of lean premixed flames with detailed description of flame propagation in turbulent core and near-wall flows. The jet- in-crossflow (JICF) configuration is widely used for rapid mixing of reactants

489

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Efficient Efficient Regeneration of Physical and Chemical Solvents for CO 2 Capture Background Fundamental and applied research on carbon capture and storage (CCS) technologies is necessary to allow the current fleet of coal-fired power plants to comply with existing and emerging environmental regulations. These technologies offer great potential for mitigating carbon dioxide (CO 2 ) emissions into the atmosphere without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires a significantly expanded workforce trained in various CCS technical and non-technical disciplines that are currently under-represented in the United States. Education and training activities are needed to develop a future generation of geologists, scientists, and engineers who

490

File:EIA-AK-NorthSlope-liquids.pdf | Open Energy Information  

Open Energy Info (EERE)

Alaskan North Slope By 2001 Liquids Reserve Class Alaskan North Slope By 2001 Liquids Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 2.17 MB, MIME type: application/pdf) Description Alaskan North Slope By 2001 Liquids Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States Alaska File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:57, 20 December 2010 Thumbnail for version as of 16:57, 20 December 2010 6,600 × 5,100 (2.17 MB) MapBot (Talk | contribs) Automated bot upload

491

File:EIA-AK-NPRA-ANWR-GAS.pdf | Open Energy Information  

Open Energy Info (EERE)

National Petroleum Reserve-Alaska and Arctic National Wildlife Refuge 1002 Area By 2001 Gas Reserve Class National Petroleum Reserve-Alaska and Arctic National Wildlife Refuge 1002 Area By 2001 Gas Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 6.78 MB, MIME type: application/pdf) Description National Petroleum Reserve-Alaska and Arctic National Wildlife Refuge 1002 Area By 2001 Gas Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States Alaska File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment

492

File:EIA-AK-NorthSlope-gas.pdf | Open Energy Information  

Open Energy Info (EERE)

Alaskan North Slope By 2001 Gas Reserve Class Alaskan North Slope By 2001 Gas Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 2.16 MB, MIME type: application/pdf) Description Alaskan North Slope By 2001 Gas Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States Alaska File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:57, 20 December 2010 Thumbnail for version as of 16:57, 20 December 2010 6,600 × 5,100 (2.16 MB) MapBot (Talk | contribs) Automated bot upload

493

File:EIA-AK-NPRA-ANWR-LIQ.pdf | Open Energy Information  

Open Energy Info (EERE)

National Petroleum Reserve-Alaska and Arctic National Wildlife Refuge 1002 Area By 2001 Liquids Reserve Class National Petroleum Reserve-Alaska and Arctic National Wildlife Refuge 1002 Area By 2001 Liquids Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 6.77 MB, MIME type: application/pdf) Description National Petroleum Reserve-Alaska and Arctic National Wildlife Refuge 1002 Area By 2001 Liquids Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States Alaska File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment

494

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Commercial Scale CO2 Injection and Commercial Scale CO2 Injection and Optimization of Storage Capacity in the Southeastern United States Background The overall goal of the Department of Energy's (DOE) Carbon Storage Program is to develop and advance technologies that will significantly improve the effectiveness of geologic carbon storage, reduce the cost of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent storage of carbon dioxide (CO2) to reduce greenhouse gas (GHG) emissions without adversely affecting energy use or hindering economic growth. Geologic carbon storage involves the injection of CO2 into underground formations that have the ability to securely contain the CO2 permanently. Technologies being

495

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Turbine Thermal Management-NETL-RUA Turbine Thermal Management-NETL-RUA Background The U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) is researching advanced turbine technology with the goal of producing reliable, affordable, and environmentally friendly electric power in response to the nation's increasing energy challenges. With the Hydrogen Turbine Program, NETL is leading the research, development, and demonstration of technologies to achieve power production from high-hydrogen-content fuels derived from coal that is clean, efficient, and cost-effective, and minimizes carbon dioxide (CO 2 ) emissions, and will help maintain the nation's leadership in the export of gas turbine equipment. The NETL Regional University Alliance (RUA) is an applied research collaboration that

496

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Scoping Studies to Evaluate the Benefits Scoping Studies to Evaluate the Benefits of an Advanced Dry Feed System on the Use of Low Rank Coal in Integrated Gasification Combined Cycle Background Gasification of coal or other solid feedstocks (biomass, petroleum coke, etc.) produces synthesis gas (syngas), which can be cleaned and used to produce electricity and a variety of commercial products that support the U.S. economy, decrease U.S. dependence on oil imports, and meet current and future environmental emission standards. The major challenge is cost, which needs to be reduced to make integrated gasification combined cycle (IGCC) technology competitive. An IGCC plant combines a combustion turbine operating on a gasified fuel stream--syngas--with a steam turbine to capture what would otherwise be waste heat. Currently, the estimated cost of power from IGCC is higher than

497

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Reliability and Durability of Materials Reliability and Durability of Materials and Components for SOFCs - Oak Ridge National Laboratory Background The U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) has a mission to advance energy options to fuel our economy, strengthen our security, and improve our environment. With the Solid Oxide Fuel Cells (SOFCs) program and systems coordination from the Solid State Energy Conversion Alliance (SECA), DOE/NETL is leading the research, development, and demonstration of SOFCs for both domestic coal and natural gas fueled central generation power systems that enable low cost, high efficiency, near-zero emissions and water usage, and carbon dioxide (CO 2 ) capture. Oak Ridge National Laboratory's (ORNL) project was selected to acquire the fundamental

498

Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

SOFC Protection Coatings Based on a SOFC Protection Coatings Based on a Cost-Effective Aluminization Process- NexTech Materials Background To make solid oxide fuel cell (SOFC) systems easier to manufacture and reduce costs, less expensive stainless steels have been substituted into the stack design as alternatives to ceramic interconnects. Stainless has also been substituted for high-cost, nickel-based superalloys in balance of plant (BOP) components. For successful implementation of these steels, protective coatings are necessary to protect the air-facing metal surfaces from high-temperature corrosion/oxidation and chromium (Cr) volatilization. NexTech Materials Ltd. (NexTech) will develop an aluminide diffusion coating as a low- cost alternative to conventional aluminization processes and evaluate the ability of the

499

Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Patricia Rawls Patricia Rawls Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road Pittsburgh, PA 15236-0940 412-386-5882 patricia.rawls@netl.doe.gov Sankaran Sundaresan Principal Investigator Princeton University Department of Chemical Engineering Princeton, NJ 08544 609-258-4583 sundar@princeton.edu PROJECT DURATION Start Date 10/01/2011 End Date 09/30/2014 COST Total Project Value $420,366 DOE/Non-DOE Share $300,000 / $120,366 Implementation and Refinement

500

Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Methanol Economy Methanol Economy Background Fossil fuels such as coal, oil, and natural gas are composed of hydrocarbons with varying ratios of carbon and hydrogen. Consumption of hydrocarbons derived from fossil fuels is integral to modern day life in the U.S. Hydrocarbons are used as fuels and raw materials in the transportation sector and in many industrial production processes including chemicals, petrochemicals, plastics, pharmaceuticals, agrochemicals, and rubber.