National Library of Energy BETA

Sample records for agri cultural crops

  1. Sunrise Agri Fuels | Open Energy Information

    Open Energy Info (EERE)

    Agri Fuels Jump to: navigation, search Name: Sunrise Agri Fuels Place: Bird Island, Minnesota Zip: 55310 Sector: Biomass Product: Manufacturer of Biomass Fuel Pellets for Pellet...

  2. Agri Source Fuels | Open Energy Information

    Open Energy Info (EERE)

    search Name: Agri-Source Fuels Place: Pensacola, Florida Zip: 32505 Product: Biodiesel producer located in Florida that owns a plant in Dade City. References: Agri-Source...

  3. Agri Energy Inc | Open Energy Information

    Open Energy Info (EERE)

    search Name: Agri-Energy Inc Place: Nashville, Tennessee Zip: 37201 Product: Biodiesel producer, located in Nashville, Tennessee. References: Agri-Energy Inc1 This...

  4. AgriFuel Company | Open Energy Information

    Open Energy Info (EERE)

    to: navigation, search Name: AgriFuel Company Place: Cranford, New Jersey Sector: Biofuels Product: AgriFuel produces and markets biofuels refined from waste vegetable oil,...

  5. East Kansas Agri Energy | Open Energy Information

    Open Energy Info (EERE)

    Kansas Agri Energy Jump to: navigation, search Name: East Kansas Agri-Energy Place: Garnett, Kansas Zip: 66032 Product: Dry-mill bioethanol producer Coordinates: 32.609607,...

  6. American Agri diesel LLC | Open Energy Information

    Open Energy Info (EERE)

    American Agri diesel LLC Jump to: navigation, search Name: American Agri-diesel LLC Place: Colorado Springs, Colorado Product: Biodiesel producer in Colorado. References: American...

  7. Agri Energy LLC | Open Energy Information

    Open Energy Info (EERE)

    Name: Agri-Energy LLC Place: Luverne, Minnesota Zip: 56156 Product: Corn trader and bioethanol producer. References: Agri-Energy LLC1 This article is a stub. You can help OpenEI...

  8. Commonwealth AgriEnergy | Open Energy Information

    Open Energy Info (EERE)

    Name: Commonwealth AgriEnergy Place: Hopkinsville, Kentucky Zip: 42241 Product: Bioethanol producer using corn as feedstock Coordinates: 36.867275, -87.487699 Show Map...

  9. East Kansas Agri-Energy, LLC

    SciTech Connect (OSTI)

    2007-12-01

    This is a combined heat and power (CHP) project profile on a 1.6 MW CHP application at East Kansas Agri-Energy, LLC in Garnett, Kansas.

  10. Mid America Agri Products | Open Energy Information

    Open Energy Info (EERE)

    Products Jump to: navigation, search Name: Mid America Agri Products Place: Madrid, Nebraska Zip: 69150 Product: Ethanol producer located in Madrid, Nebraska. Coordinates:...

  11. Agri Energy Funding Solutions | Open Energy Information

    Open Energy Info (EERE)

    Place: Omaha, Nebraska Zip: 68137-2495 Sector: Biomass, Wind energy Product: AGRI-ENERGY FUNDING SOLUTIONS is a market consultant for BioDiesel, Ethanol as well as Biomass...

  12. Agri capital GmbH | Open Energy Information

    Open Energy Info (EERE)

    capital GmbH Jump to: navigation, search Name: agri.capital GmbH Place: Muenster, North Rhine-Westphalia, Germany Zip: 48155 Product: Muenster-based agri.capital develops and...

  13. Agri Ethanol Products LLC AEPNC | Open Energy Information

    Open Energy Info (EERE)

    Ethanol Products LLC AEPNC Jump to: navigation, search Name: Agri-Ethanol Products LLC (AEPNC) Place: Raleigh, North Carolina Zip: 27615 Product: Ethanol producer and project...

  14. AgriKomp GmbH | Open Energy Information

    Open Energy Info (EERE)

    Zip: D-91732 Product: A major German and international group specializing in biogas plants. Subdidiaries France, Italy, Czech Rep, Poland References: agriKomp GmbH1 This...

  15. PRELIMINARY SURVEY OF U.S. STEEL CORPORATION--AGRI-CHEMICAL

    Office of Legacy Management (LM)

    PRELIMINARY SURVEY OF U.S. STEEL CORPORATION--AGRI-CHEMICAL (former Armour Fertilizer Works) Bartow, Florida Work performed by the Health and Safety Research Division Oak Ridge National Laboratory Oak Ridge, Tennessee 37830 March 1980 OAK RIDGE NATIONAL LABORATORY operated by UNION CARBIDE CORPORATION for the DEPARTMENT OF ENERGY as part of the Formerly Utilized Sites-- Remedial Action Program ..- _ "." --~ ____- - .___ _ --.. U.S. STEEL CORPORATION--AGRI-CHEMICAL (former Armour

  16. ch_4

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    and Game in reducing crop damage on adjacent private agri- cultural lands caused by wild game. INEEL is a designated National Environmental Research Park, functioning as a field...

  17. EIS-0300: Minnesota Agri-Power Project: Biomass for Rural Development, Granite Falls, Minnesota

    Broader source: Energy.gov [DOE]

    This EIS analyzes DOE and the Minnesota Environmental Quality Boards' [MEQB, a Minnesota State agency] decision to support a proposal by the Minnesota Valley Alfalfa Producers (MnVAP) to construct and operate a 75–103 megawatt biomass fueled gasifier and electric generating facility, known as the Minnesota Agri-Power Plant (MAPP), and associated transmission lines and alfalfa processing facilities.

  18. Wind Turbines Benefit Crops

    ScienceCinema (OSTI)

    Takle, Gene

    2013-03-01

    Ames Laboratory associate scientist Gene Takle talks about research into the effect of wind turbines on nearby crops. Preliminary results show the turbines may have a positive effect by cooling and drying the crops and assisting with carbon dioxide uptake.

  19. Radioactivity in food crops

    SciTech Connect (OSTI)

    Drury, J.S.; Baldauf, M.F.; Daniel, E.W.; Fore, C.S.; Uziel, M.S.

    1983-05-01

    Published levels of radioactivity in food crops from 21 countries and 4 island chains of Oceania are listed. The tabulation includes more than 3000 examples of 100 different crops. Data are arranged alphabetically by food crop and geographical origin. The sampling date, nuclide measured, mean radioactivity, range of radioactivities, sample basis, number of samples analyzed, and bibliographic citation are given for each entry, when available. Analyses were reported most frequently for /sup 137/Cs, /sup 40/K, /sup 90/Sr, /sup 226/Ra, /sup 228/Ra, plutonium, uranium, total alpha, and total beta, but a few authors also reported data for /sup 241/Am, /sup 7/Be, /sup 60/Co, /sup 55/Fe, /sup 3/H, /sup 131/I, /sup 54/Mn, /sup 95/Nb, /sup 210/Pb, /sup 210/Po, /sup 106/Ru, /sup 125/Sb, /sup 228/Th, /sup 232/Th, and /sup 95/Zr. Based on the reported data it appears that radioactivity from alpha emitters in food crops is usually low, on the order of 0.1 Bq.g/sup -1/ (wet weight) or less. Reported values of beta radiation in a given crop generally appear to be several orders of magnitude greater than those of alpha emitters. The most striking aspect of the data is the great range of radioactivity reported for a given nuclide in similar food crops with different geographical origins.

  20. Cultural Preservation

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    environmental protection program, LANL specialists oversee and manage the Laboratory's cultural resources programs. Several laws, including the National Historic Preservation...

  1. Cultural Preservation

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Environmental Stewardship » Environmental Protection » Cultural Preservation Cultural Preservation The Laboratory strives to balance its continued growth with proactive and effective management of cultural resources. June 27, 2012 Los Alamos is rich with native antiquities Ceramic pottery sherds found at Tsirege Pueblo at TA-54. The pueblo, which dates to the Classic period of the Ancestral Pueblo cultural period, AD 1325-1600, consisted of hundreds of rooms. The Tsirege site also contains

  2. CropEnergies | Open Energy Information

    Open Energy Info (EERE)

    search Name: CropEnergies Place: Mannheim, Saxony-Anhalt, Germany Zip: 68165 Sector: Biofuels Product: A German biofuels company focused on bioethanol production for use as...

  3. Engineered High Energy Crop (EHEC) Programs

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    ... are identifying crop species that produce large quantities of biomass with minimal inputs. ... produce large quantities of biomass with minimal inputs, but they are also developing ...

  4. Crop physiology calibration in the CLM

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Bilionis, I.; Drewniak, B. A.; Constantinescu, E. M.

    2015-04-15

    Farming is using more of the land surface, as population increases and agriculture is increasingly applied for non-nutritional purposes such as biofuel production. This agricultural expansion exerts an increasing impact on the terrestrial carbon cycle. In order to understand the impact of such processes, the Community Land Model (CLM) has been augmented with a CLM-Crop extension that simulates the development of three crop types: maize, soybean, and spring wheat. The CLM-Crop model is a complex system that relies on a suite of parametric inputs that govern plant growth under a given atmospheric forcing and available resources. CLM-Crop development used measurementsmore » of gross primary productivity (GPP) and net ecosystem exchange (NEE) from AmeriFlux sites to choose parameter values that optimize crop productivity in the model. In this paper, we calibrate these parameters for one crop type, soybean, in order to provide a faithful projection in terms of both plant development and net carbon exchange. Calibration is performed in a Bayesian framework by developing a scalable and adaptive scheme based on sequential Monte Carlo (SMC). The model showed significant improvement of crop productivity with the new calibrated parameters. We demonstrate that the calibrated parameters are applicable across alternative years and different sites.« less

  5. Crop physiology calibration in the CLM

    SciTech Connect (OSTI)

    Bilionis, I.; Drewniak, B. A.; Constantinescu, E. M.

    2015-04-15

    Farming is using more of the land surface, as population increases and agriculture is increasingly applied for non-nutritional purposes such as biofuel production. This agricultural expansion exerts an increasing impact on the terrestrial carbon cycle. In order to understand the impact of such processes, the Community Land Model (CLM) has been augmented with a CLM-Crop extension that simulates the development of three crop types: maize, soybean, and spring wheat. The CLM-Crop model is a complex system that relies on a suite of parametric inputs that govern plant growth under a given atmospheric forcing and available resources. CLM-Crop development used measurements of gross primary productivity (GPP) and net ecosystem exchange (NEE) from AmeriFlux sites to choose parameter values that optimize crop productivity in the model. In this paper, we calibrate these parameters for one crop type, soybean, in order to provide a faithful projection in terms of both plant development and net carbon exchange. Calibration is performed in a Bayesian framework by developing a scalable and adaptive scheme based on sequential Monte Carlo (SMC). The model showed significant improvement of crop productivity with the new calibrated parameters. We demonstrate that the calibrated parameters are applicable across alternative years and different sites.

  6. EIS-0481: Engineered High Energy Crop Programs Programmatic Environmen...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    1: Engineered High Energy Crop Programs Programmatic Environmental Impact Statement EIS-0481: Engineered High Energy Crop Programs Programmatic Environmental Impact Statement...

  7. ABSTRACT: Bioenergy Harvesting Technologies to Supply Crop Residues...

    Broader source: Energy.gov (indexed) [DOE]

    the project objectives for the integration of advanced logistical systems and focused bioenergy harvesting technologies that supply crop residues and energy crops in a large bale...

  8. International Crops Research Institute for the Semi Arid Tropics...

    Open Energy Info (EERE)

    Crops Research Institute for the Semi Arid Tropics Jump to: navigation, search Name: International Crops Research Institute for the Semi-Arid Tropics Place: India Sector: Biofuels...

  9. PETRO: Higher Productivity Crops for Biofuels

    SciTech Connect (OSTI)

    2012-01-01

    PETRO Project: The 10 projects that comprise ARPA-Es PETRO Project, short for Plants Engineered to Replace Oil, aim to develop non-food crops that directly produce transportation fuel. These crops can help supply the transportation sector with agriculturally derived fuels that are cost-competitive with petroleum and do not affect U.S. food supply. PETRO aims to redirect the processes for energy and carbon dioxide (CO2) capture in plants toward fuel production. This would create dedicated energy crops that serve as a domestic alternative to petroleum-based fuels and deliver more energy per acre with less processing prior to the pump.

  10. Engineered High Energy Crop (EHEC) Programs

    Office of Environmental Management (EM)

    THIS PAGE INTENTIONALLY LEFT BLANK Engineered High Energy Crop Programs Final Programmatic Environmental Impact Statement DOE/EIS-0481 JULY 2015 THIS PAGE INTENTIONALLY LEFT BLANK Engineered High Energy Crop Programs Final PEIS Responsible Federal Agency: U.S. Department of Energy, Advanced Research Projects Agency-Energy Cooperating Agencies: U.S. Department of Agriculture, Animal and Plant Health Inspection Service; U.S. Department of Agriculture, Forest Service Title: Engineered High Energy

  11. Higher U.S. Crop Prices Trigger Little Area Expansion so Marginal Land for Biofuel Crops Is Limited

    SciTech Connect (OSTI)

    Swinton, S.; Babcock, Bruce; James, Laura; Bandaru, Varaprasad

    2011-06-12

    By expanding energy biomass production on marginal lands that are not currently used for crops, food price increases and indirect climate change effects can be mitigated. Studies of the availability of marginal lands for dedicated bioenergy crops have focused on biophysical land traits, ignoring the human role in decisions to convert marginal land to bioenergy crops. Recent history offers insights about farmer willingness to put non-crop land into crop production. The 2006-09 leap in field crop prices and the attendant 64% gain in typical profitability led to only a 2% increase in crop planted area, mostly in the prairie states

  12. Reducing the negative human-health impacts of bioenergy crop...

    Office of Scientific and Technical Information (OSTI)

    ...man-health impacts of bioenergy crop emissions through region-specific crop selection Citation Details In-Document Search Title: Reducing the negative human-health impacts of ...

  13. D1 Fuel Crops Ltd | Open Energy Information

    Open Energy Info (EERE)

    D1 Fuel Crops Ltd Jump to: navigation, search Name: D1 Fuel Crops Ltd Place: London, United Kingdom Zip: SE1 2RE Product: London-based JV between BP and D1 oils focusing on the...

  14. Nebraska shows potential to produce biofuel crops | Department...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    shows potential to produce biofuel crops Nebraska shows potential to produce biofuel crops December 9, 2009 - 11:12am Addthis Joshua DeLung What are the key facts? Utilizing sites ...

  15. Potential Yield Mapping of Dedicated Energy Crops | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Potential Yield Mapping of Dedicated Energy Crops Potential Yield Mapping of Dedicated Energy Crops Breakout Session 1B-Integration of Supply Chains I: Breaking Down Barriers Potential Yield Mapping of Dedicated Energy Crops Chris Daly, Director, PRISM Climate Group, Oregon State University PDF icon daly_biomass_2014.pdf More Documents & Publications 2015 Peer Review Presentations-Terrestrial Feedstocks Switchgrass as a High-Potential Energy Crop Black Warrior: Sub-soil gas and fluid

  16. Opportunities for Energy Crop Production Based on Subfield Scale

    Office of Scientific and Technical Information (OSTI)

    Distribution of Profitability (Journal Article) | SciTech Connect Opportunities for Energy Crop Production Based on Subfield Scale Distribution of Profitability Citation Details In-Document Search Title: Opportunities for Energy Crop Production Based on Subfield Scale Distribution of Profitability Incorporation of dedicated herbaceous energy crops into row crop landscapes is a promising means to supply an expanding biofuel industry while increasing biomass yields, benefiting soil and water

  17. Potential Yield Mapping of Dedicated Energy Crops

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Yield Mapping of Dedicated Energy Crops Christopher Daly and Michael Halbleib PRISM Climate Group Sun Grant Western Region GIS Center Oregon State University Corvallis, Oregon, USA Sun Grant Initiative  Consortium of the nation's land-grant universities addressing national bioenergy and bioproduct challenges  Five Regional University Centers  Engaging agricultural and natural resource colleges in every state and territory Regional Feedstock Partnership U.S. Department of Agriculture

  18. Global crop yield losses from recent warming

    SciTech Connect (OSTI)

    Lobell, D; Field, C

    2006-06-02

    Global yields of the world-s six most widely grown crops--wheat, rice, maize, soybeans, barley, sorghum--have increased since 1961. Year-to-year variations in growing season minimum temperature, maximum temperature, and precipitation explain 30% or more of the variations in yield. Since 1991, climate trends have significantly decreased yield trends in all crops but rice, leading to foregone production since 1981 of about 12 million tons per year of wheat or maize, representing an annual economic loss of $1.2 to $1.7 billion. At the global scale, negative impacts of climate trends on crop yields are already apparent. Annual global temperatures have increased by {approx}0.4 C since 1980, with even larger changes observed in several regions (1). While many studies have considered the impacts of future climate changes on food production (2-5), the effects of these past changes on agriculture remain unclear. It is likely that warming has improved yields in some areas, reduced them in others, and had negligible impacts in still others; the relative balance of these effects at the global scale is unknown. An understanding of this balance would help to anticipate impacts of future climate changes, as well as to more accurately assess recent (and thereby project future) technologically driven yield progress. Separating the contribution of climate from concurrent changes in other factors--such as crop cultivars, management practices, soil quality, and atmospheric carbon dioxide (CO{sub 2}) levels--requires models that describe the response of yields to climate. Studies of future global impacts of climate change have typically relied on a bottom-up approach, whereby field scale, process-based models are applied to hundreds of representative sites and then averaged (e.g., ref 2). Such approaches require input data on soil and management conditions, which are often difficult to obtain. Limitations on data quality or quantity can thus limit the utility of this approach, especially at the local scale (6-8). At the global scale, however, many of the processes and impacts captured by field scale models will tend to cancel out, and therefore simpler empirical/statistical models with fewer input requirements may be as accurate (8, 9). Empirical/statistical models also allow the effects of poorly modeled processes (e.g., pest dynamics) to be captured and uncertainties to be readily quantified (10). Here we develop new, empirical/statistical models of global yield responses to climate using datasets on broad-scale yields, crop locations, and climate variability. We focus on global average yields for the six most widely grown crops in the world: wheat, rice, maize, soybeans, barley, and sorghum. Production of these crops accounts for over 40% of global cropland area (11). 55% of non-meat calories, and over 70% of animal feed (12).

  19. Watershed Scale Optimization to Meet Sustainable Cellulosic Energy Crop Demands

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Watershed Scale Optimization to Meet Sustainable Cellulosic Energy Crop Demands March 23, 2015 Analysis and Sustainability Peer Review Drs. Indrajeet Chaubey and Ben Gramig Purdue University This presentation does not contain any proprietary, confidential, or otherwise restricted information Goal Statement 2 * Overall goal is to conduct a watershed-scale sustainability assessment of multiple energy crops and removal of crop residues * Assessment conducted in two watersheds representative of

  20. Argonne National Laboratory Scientists Study Benefits of Bioenergy Crop

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Integration | Department of Energy Argonne National Laboratory Scientists Study Benefits of Bioenergy Crop Integration Argonne National Laboratory Scientists Study Benefits of Bioenergy Crop Integration August 5, 2015 - 4:47pm Addthis How can our landscapes be managed most effectively to produce crops for food, feed, and bioenergy, while also protecting our water resources by preventing the loss of nutrients from the soil? Dr. Cristina Negri and her team at the U.S. Department of Energy's

  1. EIS-0481: Engineered High Energy Crop Programs Programmatic Environmental

    Office of Environmental Management (EM)

    Impact Statement | Department of Energy 1: Engineered High Energy Crop Programs Programmatic Environmental Impact Statement EIS-0481: Engineered High Energy Crop Programs Programmatic Environmental Impact Statement Summary This Programmatic EIS (PEIS) evaluates the potential environmental impacts of implementing one or more programs to catalyze the deployment of engineered high energy crops (EHECs). A main component of the proposed EHEC programs would be providing financial assistance to

  2. Agronomic Suitability of Bioenergy Crops in Mississippi

    SciTech Connect (OSTI)

    Lemus, Rocky; Baldwin, Brian; Lang, David

    2011-10-01

    In Mississippi, some questions need to be answered about bioenergy crops: how much suitable land is available? How much material can that land produce? Which production systems work best in which scenarios? What levels of inputs will be required for productivity and longterm sustainability? How will the crops reach the market? What kinds of infrastructure will be necessary to make that happen? This publication helps answer these questions: ???????????????????????????????¢???????????????????????????????????????????????????????????????¢ Which areas in the state are best for bioenergy crop production? ???????????????????????????????¢???????????????????????????????????????????????????????????????¢ How much could these areas produce sustainably? ???????????????????????????????¢???????????????????????????????????????????????????????????????¢ How can bioenergy crops impact carbon sequestration and carbon credits? ???????????????????????????????¢???????????????????????????????????????????????????????????????¢ How will these crops affect fertilizer use and water quality? ???????????????????????????????¢?????????????

  3. Developing Switchgrass as a Bioenergy Crop

    SciTech Connect (OSTI)

    Bouton, J.; Bransby, D.; Conger, B.; McLaughlin, S.; Ocumpaugh, W.; Parrish, D.; Taliaferro, C.; Vogel, K.; Wullschleger, S.

    1998-11-08

    The utilization of energy crops produced on American farms as a source of renewable fuels is a concept with great relevance to current ecological and economic issues at both national and global scales. Development of a significant national capacity to utilize perennial forage crops, such as switchgrass (Panicum virgatum, L.) as biofuels could benefit our agricultural economy by providing an important new source of income for farmers. In addition energy production from perennial cropping systems, which are compatible with conventional fining practices, would help reduce degradation of agricultural soils, lower national dependence on foreign oil supplies, and reduce emissions of greenhouse gases and toxic pollutants to the atmosphere (McLaughlin 1998). Interestingly, on-farm energy production is a very old concept, extending back to 19th century America when both transpofiation and work on the farm were powered by approximately 27 million draft animals and fueled by 34 million hectares of grasslands (Vogel 1996). Today a new form of energy production is envisioned for some of this same acreage. The method of energy production is exactly the same - solar energy captured in photosynthesis, but the subsequent modes of energy conversion are vastly different, leading to the production of electricity, transportation fuels, and chemicals from the renewable feedstocks. While energy prices in the United States are among the cheapest in the world, the issues of high dependency on imported oil, the uncertainties of maintaining stable supplies of imported oil from finite reserves, and the environmental costs associated with mining, processing, and combusting fossil fuels have been important drivers in the search for cleaner burning fuels that can be produced and renewed from the landscape. At present biomass and bioenergy combine provide only about 4% of the total primary energy used in the U.S. (Overend 1997). By contrast, imported oil accounts for approximately 44% of the foreign trade deficit in the U.S. and about 45% of the total annual U.S. oil consumption of 34 quads (1 quad = 1015 Btu, Lynd et al. 1991). The 22 quads of oil consumed by transportation represents approximately 25% of all energy use in the US and excedes total oil imports to the US by about 50%. This oil has environmental and social costs, which go well beyond the purchase price of around $15 per barrel. Renewable energy from biomass has the potential to reduce dependency on fossil fhels, though not to totally replace them. Realizing this potential will require the simultaneous development of high yielding biomass production systems and bioconversion technologies that efficiently convert biomass energy into the forms of energy and chemicals usable by industry. The endpoint criterion for success is economic gain for both agricultural and industrial sectors at reduced environmental cost and reduced political risk. This paper reviews progress made in a program of research aimed at evaluating and developing a perennial forage crop, switchgrass as a regional bioenergy crop. We will highlight here aspects of research progress that most closely relate to the issues that will determine when and how extensively switchgrass is used in commercial bioenergy production.

  4. Water on Crop Biomass and Soil Permeability FINAL TECHNICAL REPORT

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Irrigating with Treated Oil and Gas Product Water on Crop Biomass and Soil Permeability FINAL TECHNICAL REPORT Prepared By Terry Brown, Jeffrey Morris, Patrick Richards and Joel...

  5. Engineered High Energy Crop Programs Draft Programmatic Environmental...

    Broader source: Energy.gov (indexed) [DOE]

    PAGE INTENTIONALLY LEFT BLANK Engineered High Energy Crop Programs Draft Programmatic Environmental Impact Statement DOEEIS-0481 DECEMBER 2014 THIS PAGE INTENTIONALLY LEFT BLANK...

  6. Safeguards Culture: Lessons Learned

    SciTech Connect (OSTI)

    Frazar, Sarah L.; Mladineo, Stephen V.

    2010-06-01

    Today, safeguards culture can be a useful tool for measuring nonproliferation postures, but so far its impact on the international safeguards regime has been underappreciated. There is no agreed upon definition for safeguards culture nor agreement on how it should be measured. This paper argues that safeguards culture as an indicator of a countrys nonproliferation posture can be a useful tool.

  7. Anaerobic thermophilic culture

    DOE Patents [OSTI]

    Ljungdahl, Lars G. (Athens, GA); Wiegel, Jurgen K. W. (Gottingen, DE)

    1981-01-01

    A newly discovered thermophilic anaerobe is described that was isolated in a biologically pure culture and designated Thermoanaerobacter ethanolicus ATCC 3/550. T. Ethanolicus is cultured in aqueous nutrient medium under anaerobic, thermophilic conditions and is used in a novel process for producing ethanol by subjecting carbohydrates, particularly the saccharides, to fermentation action of the new microorganism in a biologically pure culture.

  8. Reducing the negative human-health impacts of bioenergy crop emissions

    Office of Scientific and Technical Information (OSTI)

    through region-specific crop selection (Journal Article) | SciTech Connect Reducing the negative human-health impacts of bioenergy crop emissions through region-specific crop selection Citation Details In-Document Search Title: Reducing the negative human-health impacts of bioenergy crop emissions through region-specific crop selection An expected global increase in bioenergy-crop cultivation as an alternative to fossil fuels will have consequences on both global climate and local air

  9. Safeguards Culture: Lessons Learned

    SciTech Connect (OSTI)

    Mladineo, Stephen V.

    2009-05-27

    Abstract: At the 2005 INMM/ESARDA Workshop in Santa Fe, New Mexico, I presented a paper entitled Changing the Safeguards Culture: Broader Perspectives and Challenges. That paper described a set of theoretical models that can be used as a basis for evaluating changes to safeguards culture. This paper builds on that theoretical discussion to address practical methods for influencing culture. It takes lessons from methods used to influence change in safety culture and security culture, and examines the applicability of these lessons to changing safeguards culture. Paper: At the 2005 INMM/ESARDA Workshop on Changing the Safeguards Culture: Broader Perspectives and Challenges, in Santa Fe, New Mexico, I presented a paper entitled Changing the Safeguards Culture: Broader Perspectives and Challenges. That paper, coauthored by Karyn R. Durbin and Andrew Van Duzer, described a set of theoretical models that can be used as a basis for evaluating changes to safeguards culture. This paper updates that theoretical discussion, and seeks to address practical methods for influencing culture. It takes lessons from methods used to influence change in safety culture and security culture, and examines the applicability of these lessons to changing safeguards culture. Implicit in this discussion is an understanding that improving a culture is not an end in itself, but is one method of improving the underlying discipline, that is safety, security, or safeguards. Culture can be defined as a way of life, or general customs and beliefs of a particular group of people at a particular time. There are internationally accepted definitions of safety culture and nuclear security culture. As yet, there is no official agreed upon definition of safeguards culture. At the end of the paper I will propose my definition. At the Santa Fe Workshop the summary by the Co-Chairs of Working Group 1, The Further Evolution of Safeguards, noted: It is clear that safeguards culture needs to be addressed if the efficiency and effectiveness are to continue to be improved. This will require commitment and change at all levels, from States to facility operators. Cultural change has to come from good leadership, doing the right thing and beliefs are not sufficient behavior is what counts. We are optimistic that with sufficient effort and the right incentives, change can be accomplished quickly.

  10. Functional Genomics of Drought Tolerance in Bioenergy Crops

    SciTech Connect (OSTI)

    Yin, Hengfu [ORNL; Chen, Rick [ORNL; Yang, Jun [ORNL; Weston, David [ORNL; Chen, Jay [ORNL; Muchero, Wellington [ORNL; Ye, Ning [ORNL; Tschaplinski, Timothy J [ORNL; Wullschleger, Stan D [ORNL; Cheng, Zong-Ming [ORNL; Tuskan, Gerald A [ORNL; Yang, Xiaohan [ORNL

    2014-01-01

    With the predicted trends in climate change, drought will increasingly impose a grand challenge to biomass production. Most of the bioenergy crops have some degree of drought susceptibility with low water-use efficiency (WUE). It is imperative to improve drought tolerance and WUE in bioenergy crops for sustainable biomass production in arid and semi-arid regions with minimal water input. Genetics and functional genomics can play a critical role in generating knowledge to inform and aid genetic improvement of drought tolerance in bioenergy crops. The molecular aspect of drought response has been extensively investigated in model plants like Arabidopsis, yet our understanding of the molecular mechanisms underlying drought tolerance in bioenergy crops are limited. Crops exhibit various responses to drought stress depending on species and genotype. A rational strategy for studying drought tolerance in bioenergy crops is to translate the knowledge from model plants and pinpoint the unique features associated with individual species and genotypes. In this review, we summarize the general knowledge about drought responsive pathways in plants, with a focus on the identification of commonality and specialty in drought responsive mechanisms among different species and/or genotypes. We describe the genomic resources developed for bioenergy crops and discuss genetic and epigenetic regulation of drought responses. We also examine comparative and evolutionary genomics to leverage the ever-increasing genomics resources and provide new insights beyond what has been known from studies on individual species. Finally, we outline future exploration of drought tolerance using the emerging new technologies.

  11. Scientists study ways to integrate biofuels and food crops on...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    courtesy Patty Campbell; click to view larger. Scientists study ways to integrate biofuels and food crops on farms By Payal Marathe * July 7, 2015 Tweet EmailPrint We ask a lot...

  12. Synthetic biology and crop engineering | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Synthetic biology and crop engineering Synthetic biology and crop engineering Breakout Session 2: Frontiers and Horizons Session 2-A: Synthetic Biology and the Promise of Biofuels Jonathan Burbaum, Program Director, Department of Energy, Office of Science, ARPA-E PDF icon b13_burbaum_2-a.pdf More Documents & Publications EIS-0481: Final Programmatic Environmental Impact Statement EIS-0481: Draft Programmatic Environmental Impact Statement EIS-0481: Notice of Intent to Prepare a Programmatic

  13. ORISE: Our Culture

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Our Culture The Oak Ridge Institute for Science and Education (ORISE) cares about its employees, and this is evident through the abundance of benefits-both tangible and...

  14. Bootheel Agri Energy | Open Energy Information

    Open Energy Info (EERE)

    Zip: 63801 Product: Developer of a now-postponed 100m gallon (378m litre) per year bioethanol plant in Sikeston, Missouri. Coordinates: 36.876525, -89.588284 Show Map Loading...

  15. Anaerobic thermophilic culture system

    DOE Patents [OSTI]

    Ljungdahl, Lars G. (Athens, GA); Wiegel, Jurgen K. W. (Gottingen, DE)

    1981-01-01

    A mixed culture system of the newly discovered microorganism Thermoanaerobacter ethanolicus ATCC31550 and the microorganism Clostridium thermocellum ATCC31549 is described. In a mixed nutrient culture medium that contains cellulose, these microorganisms have been coupled and cultivated to efficiently ferment cellulose to produce recoverable quantities of ethanol under anaerobic, thermophilic conditions.

  16. Abstract: Development and Deployment of a Short Rotation Woody Crops Harvesting System Based on a Case New Holland Forage Harvester and SRC Woody Crop Header

    Broader source: Energy.gov [DOE]

    This abstract highlights a project that will develop a single pass cut and chip harvesting system for short rotation woody crops that will improve the harvesting and logistic costs of processing woody crops.

  17. Safety Culture in Nuclear Installations

    Broader source: Energy.gov [DOE]

    IAEA-TECDOC-1329 Safety Culture in Nuclear Installations, Guidance for use in the Enhancement of Safety Culture, International Atomic Energy Agency IAEA, December 2002.

  18. Reducing the negative human-health impacts of bioenergy crop emissions through region-specific crop selection

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Porter, William C.; Rosenstiel, Todd N.; Guenther, Alex; Lamarque, Jean-Francois; Barsanti, Kelley

    2015-05-06

    An expected global increase in bioenergy-crop cultivation as an alternative to fossil fuels will have consequences on both global climate and local air quality through changes in biogenic emissions of volatile organic compounds (VOCs). While greenhouse gas emissions may be reduced through the substitution of next-generation bioenergy crops such as eucalyptus, giant reed, and switchgrass for fossil fuels, the choice of species has important ramifications for human health, potentially reducing the benefits of conversion due to increases in ozone (O₃) and fine particulate matter (PM₂̣₅) levels as a result of large changes in biogenic emissions. Using the Community Earth Systemmore » Model we simulate the conversion of marginal and underutilized croplands worldwide to bioenergy crops under varying future anthropogenic emissions scenarios. A conservative global replacement using high VOC-emitting crop profiles leads to modeled population-weighted O₃ increases of 5–27 ppb in India, 1–9 ppb in China, and 1–6 ppb in the United States, with peak PM₂̣₅ increases of up to 2 μgm⁻³. We present a metric for the regional evaluation of candidate bioenergy crops, as well as results for the application of this metric to four representative emissions profiles using four replacement scales (10–100% maximum estimated available land). Finally, we assess the total health and climate impacts of biogenic emissions, finding that the negative consequences of using high-emitting crops could exceed 50% of the positive benefits of reduced fossil fuel emissions in value.« less

  19. Reducing the negative human-health impacts of bioenergy crop emissions through region-specific crop selection

    Office of Scientific and Technical Information (OSTI)

    lopscience iopscience.iop.org Home Search Collections Journals About Contact us My lOPscience Reducing the negative human-health impacts of bioenergy crop emissions through region- specific crop selection This content has been downloaded from IOPscience. Please scroll down to see the full text. View the table of contents for this issue, or go to the journal homepage for more Download details: IP Address: 192.107.175.131 This content was downloaded on 30/07/2015 at 20:46 Please note that terms

  20. Argonne National Laboratory Scientists Study Benefits of Bioenergy Crop

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Integration | Argonne National Laboratory Argonne National Laboratory Scientists Study Benefits of Bioenergy Crop Integration Share Topic Energy Energy sources Renewable energy Browse By - Any - Energy -Energy efficiency --Vehicles ---Alternative fuels ---Automotive engineering ---Diesel ---Electric drive technology ---Hybrid & electric vehicles ---Hydrogen & fuel cells ---Internal combustion ---Powertrain research --Building design ---Construction --Manufacturing -Energy sources

  1. Crops reap benefits of Pantex irrigation system | National Nuclear Security

    National Nuclear Security Administration (NNSA)

    Administration Crops reap benefits of Pantex irrigation system | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery

  2. Mass algal culture system

    DOE Patents [OSTI]

    Raymond, Lawrence P. (Richland, WA)

    1982-01-01

    An apparatus and process for the culture of algae in a liquid medium is disclosed. The medium circulates through an open trough and is exposed to an atmosphere which is temperature regulated. The nutrient content of the liquid medium is regulated to control the chemical composition growth and reproduction characteristics of the cultured algae. Before it is allowed to strike the medium, sunlight is passed through a filter to remove wavelengths which are not photosynthetically active. Heat energy can be recovered from the filter.

  3. Mass algal culture system

    DOE Patents [OSTI]

    Raymond, Lawrence P. (Richland, WA)

    1981-01-01

    An apparatus and process for the culture of algae in a liquid medium is disclosed. The medium circulates through an open trough and is exposed to an atmosphere which is temperature regulated. The nutrient content of the liquid medium is regulated to control the chemical composition growth and reproduction characteristics of the cultured algae. Before it is allowed to strike the medium, sunlight is passed through a filter to remove wavelengths which are not photosynthetically active. Heat energy can be recovered from the filter.

  4. Hanford Cultural Resources - Hanford Site

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    About Us Hanford Site Wide Programs Hanford's Tribal Program Hanford Cultural Resources About Us Hanford's Tribal Program Home Hanford Cultural Resources DOE American Indian Tribal Government Policy (PDF) Hanford Cultural Resources Email Email Page | Print Print Page |Text Increase Font Size Decrease Font Size Cultural Resources Hanford Cultural Resources Tribal staffs are regularly consulted at the earliest opportunity for recommendations and advice on DOE-RL activities potentially affecting

  5. Abstract: Development and Deployment of a Short Rotation Woody Crops Harvesting System Based on a Case New Holland Forage Harvester and SRC Woody Crop Header

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Deployment of a Short Rotation Woody Crops Harvesting System Based on a Case New Holland Forage Harvester and SRC Woody Crop Header Despite the projected increase in demand for woody biomass from short rotation woody crops (SRWC) and the wide array of benefits associated with their production and use, the expansion and rapid deployment of these systems has been restricted by their high cost of production and in some situations a lack of market acceptance because of poor quality chips from first

  6. Biomass fuel from woody crops for electric power generation

    SciTech Connect (OSTI)

    Perlack, R.D.; Wright, L.L.; Huston, M.A.; Schramm, W.E.

    1995-06-22

    This report discusses the biologic, environmental, economic, and operational issues associated with growing wood crops in managed plantations. Information on plantation productivity, environmental issues and impacts, and costs is drawn from DOE`s Biofuels Feedstock Development as well as commercial operations in the US and elsewhere. The particular experiences of three countries--Brazil, the Philippines, and Hawaii (US)--are discussed in considerable detail.

  7. Methods for generating or increasing revenues from crops

    DOE Patents [OSTI]

    Copenhaver, Gregory P.; Keith, Kevin; Preuss, Daphne

    2007-03-20

    The present invention provides methods of doing business and providing services. For example, methods of increasing the revenue of crops are provided. To this end, the method includes the use of a nucleic acid sequences of plant centromeres. This will permit construction of stably inherited recombinant DNA constructs and mini chromosomes which can serve as vectors for the construction of transgenic plant and animal cells.

  8. Switchgrass as a High-Potential Energy Crop

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    7/109 Historical Perspective on How and Why Switchgrass was Selected as a "Model" High-Potential Energy Crop July 2007 Prepared by Lynn Wright Consultant to Bioenergy Resources and Engineering Systems Environmental Sciences Division DOCUMENT AVAILABILITY Reports produced after January 1, 1996, are generally available free via the U.S. Department of Energy (DOE) Information Bridge. Web site http://www.osti.gov/bridge Reports produced before January 1, 1996, may be purchased by members

  9. Measuring Safeguards Culture

    SciTech Connect (OSTI)

    Frazar, Sarah L.; Mladineo, Stephen V.

    2011-07-19

    As the International Atomic Energy Agency (IAEA) implements a State Level Approach to its safeguards verification responsibilities, a number of countries are beginning new nuclear power programs and building new nuclear fuel cycle faculties. The State Level approach is holistic and investigatory in nature, creating a need for transparent, non-discriminatory judgments about a state's nonproliferation posture. In support of this need, the authors previously explored the value of defining and measuring a state's safeguards culture. We argued that a clear definition of safeguards culture and an accompanying set of metrics could be applied to provide an objective evaluation and demonstration of a country's nonproliferation posture. As part of this research, we outlined four high-level metrics that could be used to evaluate a state's nuclear posture. We identified general data points. This paper elaborates on those metrics, further refining the data points to generate a measurable scale of safeguards cultures. We believe that this work could advance the IAEA's goals of implementing a safeguards system that is fully information driven, while strengthening confidence in its safeguards conclusions.

  10. Transgenic crops get a test in the wild

    SciTech Connect (OSTI)

    Cherfas, J.

    1991-02-22

    A novel British research program called PROSAMO - Planned Release of Selected and Modified Organisms - has just produced its first batch of results on the ecological behavior of a genetically manipulated variety of oil seed rape (known to Americans as canola). As expected, the preliminary data indicate that these plants do not outgrow their competitors in the wild, nor is there any evidence that they pass on their foreign genes to other species. PROSAMO is moving on to test other crops with other foreign genes. If these results are as reassuring, scientists around the world will have solid evidence with which to soothe fears.

  11. Switchgrass as a High-Potential Energy Crop | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Switchgrass as a High-Potential Energy Crop Switchgrass as a High-Potential Energy Crop Historical Perspective on How and Why Switchgrass was Selected as a "Model" High-Potential Energy Crop PDF icon ornl_switchgrass.pdf More Documents & Publications 2015 Peer Review Presentations-Terrestrial Feedstocks Biomass Econ 101: Measuring the Technological Improvements on Feedstocks Costs 2015 Peer Review Presentations-Sustainability and Strategic Analysis

  12. Methane emission from single cropping rice paddies amended different manures

    SciTech Connect (OSTI)

    Du Daodeng; Tao Zhan

    1996-12-31

    Methane emission fluxes were determined from single cropping rice paddies amended with different manures through a productively comparative experiment. The average fluxes in the whole growth season ranged from 3.92 to 10.96 mg/m{sup 2}.hr. The compost amended paddies gave the highest emission fluxes of 10.26 mg/m{sup 2}.hr, while the fluxes from the other manure amended paddies ranked as follows: horse dung biogas digester sediment 10.02, chemical fertilizer only 8.81, nightsoil biogas sediment 7.76, chicken dropping biogas digester sediment 4.48 and pig dung biogas digester sediment 3.92 mg/m{sup 2}.hr. The latter 3 sediments gave the significant less ({alpha} < 0.05) fluxes than compost. The highest fluxes peaks of all treated paddies appeared unanimously between the stages of the midtillering and the earing, with a half of total CH{sub 4} emissions were produced in this period which could be chosen as the key period for control of CH{sub 4} emission from the single cropping rice paddies. The positive correlation of the fluxes with the temperatures in 5 cm soil layers and the negative correlation of the fluxes with the rice yields, the soil N and P{sub 2}O{sub 5} contents were also observed.

  13. Cultural Resources | Open Energy Information

    Open Energy Info (EERE)

    source History View New Pages Recent Changes All Special Pages Semantic SearchQuerying Get Involved Help Apps Datasets Community Login | Sign Up Search Page Edit History Cultural...

  14. Cost Methodology for Biomass Feedstocks: Herbaceous Crops and Agricultural Residues

    SciTech Connect (OSTI)

    Turhollow Jr, Anthony F; Webb, Erin; Sokhansanj, Shahabaddine

    2009-12-01

    This report describes a set of procedures and assumptions used to estimate production and logistics costs of bioenergy feedstocks from herbaceous crops and agricultural residues. The engineering-economic analysis discussed here is based on methodologies developed by the American Society of Agricultural and Biological Engineers (ASABE) and the American Agricultural Economics Association (AAEA). An engineering-economic analysis approach was chosen due to lack of historical cost data for bioenergy feedstocks. Instead, costs are calculated using assumptions for equipment performance, input prices, and yield data derived from equipment manufacturers, research literature, and/or standards. Cost estimates account for fixed and variable costs. Several examples of this costing methodology used to estimate feedstock logistics costs are included at the end of this report.

  15. Biomass resource potential for selected crops in Hawaii. [Koa haole (giant leucaena); napier and guinea grass

    SciTech Connect (OSTI)

    Seki, A.

    1982-06-01

    The biomass crops selected for review were koa haole (giant leucaena), napier and guinea grass, and eucalyptus (saligna, grandis, and globulus). The islands examined were Hawaii, Kauai, Maui, and Molokai. The potential land acreage for growing these crops was estimated grossly. As anticipated, the island of Hawaii had the largest land potential with eucalyptus having the greatest potential land acreage.

  16. Surveys of organizational culture and safety culture in nuclear power

    SciTech Connect (OSTI)

    Brown, Walter S.

    2000-07-30

    The results of a survey of organizational culture at a nuclear power plant are summarized and compared with those of a similar survey which has been described in the literature on ''high-reliability organizations''. A general-purpose cultural inventory showed a profile of organizational style similar to that reported in the literature; the factor structure for the styles was also similar to that of the plant previously described. A specialized scale designed to measure ''safety culture'' did not distinguished among groups within the organization that would be expected to differ.

  17. SO/sub 2/ dose-response sensitivity classification data for crops and natural vegetation species

    SciTech Connect (OSTI)

    Irving, P.M.; Ballou, S.W.

    1980-09-01

    Over the past several years studies have been made on the interaction of sulfur dioxide (SO/sub 2/) and vegetation by performing field research and by developing analytical procedures for applying field observation data to energy impact assessments. As a result of this work, numerous reports have been prepared on crop-pollutant interactions, such as dose-response data; on the applications of such data to screening approaches for identifying crops at risk; and on models that predict crop yield reductions from point source emissions of SO/sub 2/. Data that were used for these studies, such as the crop-at-risk screening procedure, are presented in this report. Maps are also presented that show the national distribution of SO/sub 2/-sensitive crops and natural vegetation.

  18. Organizational Culture and Safety Culture: Are they one and the...

    Office of Environmental Management (EM)

    upward information flow won't exist in the safety aspect for very long. If employee involvement in planning is not a norm for the organizational culture - employee involvement in...

  19. FermiCulture Subscription Form

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    The FermiCulture email list is used to send email announcements and reminders about upcoming cultural events at Fermilab (e.g., the Fermilab Arts, Film, and Lecture series). This is a private, announcement-only mail list and will never be used for spamming or discussions. Subscribers receive approximately five emails per month. Use the form below to subscribe to (or unsubscribe from) the FermiCulture list. Email address: Name (First Last): Subscribe to email list Unsubscribe from email list Send

  20. Could crop height affect the wind resource at agriculturally productive wind farm sites?

    SciTech Connect (OSTI)

    Vanderwende, Brian; Lundquist, Julie K.

    2015-11-07

    The collocation of cropland and wind turbines in the US Midwest region introduces complex meteorological interactions that could influence both agriculture and wind-power production. Crop management practices may affect the wind resource through alterations of land-surface properties. We use the weather research and forecasting (WRF) model to estimate the impact of crop height variations on the wind resource in the presence of a large turbine array. A hypothetical wind farm consisting of 121 1.8-MW turbines is represented using the WRF model wind-farm parametrization. We represent the impact of selecting soybeans rather than maize by altering the aerodynamic roughness length in a region approximately 65 times larger than that occupied by the turbine array. Roughness lengths of 0.1 and 0.25 m represent the mature soy crop and a mature maize crop, respectively. In all but the most stable atmospheric conditions, statistically significant hub-height wind-speed increases and rotor-layer wind-shear reductions result from switching from maize to soybeans. Based on simulations for the entire month of August 2013, wind-farm energy output increases by 14 %, which would yield a significant monetary gain. Further investigation is required to determine the optimal size, shape, and crop height of the roughness modification to maximize the economic benefit and minimize the cost of such crop-management practices. As a result, these considerations must be balanced by other influences on crop choice such as soil requirements and commodity prices.

  1. Power Lines and Crops Can Be Good Neighbors

    SciTech Connect (OSTI)

    2010-08-01

    Two of the Pacific Northwests greatest economic assets are its wealth of agriculture and its clean and reliable electricity fueled largely by hydropower. Sometimes the two intersect. Transmission lines carrying electricity to the regions farms, businesses and homes must, of necessity, span large areas where people grow crops and orchards. To ensure a safe and reliable flow of electricity across these expanses, trees and other vegetation must be managed to certain standards. At the same time, the Bonneville Power Administration which owns and operates three-quarters of the regions high-voltage transmission recognizes the importance of our regions agricultural bounty. We are committed to working with individuals and agricultural communities to facilitate ongoing land-use activities in transmission rights-of-way as long as those uses are compatible with transmission safety and reliability standards. Our goal with vegetation management is to keep you and your property safe while protecting the reliability of our regions electricity system. By working together, BPA and landowners can protect the system and public safety.

  2. ABSTRACT: Bioenergy Harvesting Technologies to Supply Crop Residues In a Densified Large Square Bale Format

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Integration of Advanced Logistical Systems and Focused Bioenergy Harvesting Technologies to Supply Crop Residues and Energy Crops in a Densified Large Square Bale Format OBP WBS: 1.2.1.4 Principal Investigator: Maynard Herron Co-Principal Investigator: Bob Matousek Performing Organization: AGCO Sub-Recipients: INL, Stinger Inc., OSU, ISU, TAMU, Noble Foundation Project objectives support the adoption and production goals of the Office of Biomass Programs for feedstock adoption and cost

  3. Watershed Scale Evaluation of the Sustainability and Productivity of Dedicated Energy Crop and Woody Biomass Operations

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Optimization of Southeastern Forest Biomass Crop Production: Watershed Scale Evaluation of the Sustainability and Productivity of Dedicated Energy Crop and Woody Biomass Operations DOE Bioenergy Technologies Office (BETO) 2015 Project Peer Review March 23, 2015 Sustainability and Strategic Analysis George Chescheir N. C. State University Jami Nettles Weyerhaeuser Company Goal Statement Develop and disseminate science-based information for sustainable production of biofuel feedstock in a forestry

  4. Perspectives on Changing Safeguards Culture

    SciTech Connect (OSTI)

    Mladineo, Stephen V.; Durbin, Karyn R.; Van Duzer, Andrew

    2005-12-01

    The importance of culture in the nuclear field has become widely recognized. In the wake of the 9-11 attacks in the United States, and terrorist attacks worldwide, the international community has become interested in strengthening nuclear security culture for much of the same reasons that it became interested in strengthening the nuclear safety culture in the 1980s. The accidents that occurred at Three Mile Island and Chernobyl led to a realization that nuclear operations in one country can directly affect other countries. The accidents also led to the realization that technology alone cannot guarantee safety and that the human element has a key role to play in the safety operation of nuclear power plans.

  5. Hanford cultural resources management plan

    SciTech Connect (OSTI)

    Chatters, J.C.

    1989-06-01

    As a federal agency, the US Department of Energy (DOE) has been directed by Congress and the President to provide leadership in the preservation of prehistoric, historical, and cultural resources on lands it administers, to manage these in a spirit of stewardship for future generations, and to protect and preserve the rights of Native Americans to religious freedom. The purpose of this document is to describe how the DOE-Richland Operations (DOE-RL) will meet those responsibilities on the Hanford Site, pursuant to guidelines for Agency Responsibilities under the Historic Preservation Act (FR 53:31, February 17, 1988). This document is intended for multiple uses. Among other things, the text is designed as a manual for cultural resource managers to follow and as an explanation of the process of cultural resource regulatory compliance for the DOE-RL and Site contractors. 10 refs., 17 figs., 11 tabs.

  6. Potential producers and their attitudes toward adoption of biomass crops in central Florida

    SciTech Connect (OSTI)

    Rahmani, M.; Hodges, A.W.; Stricker, J.A.

    1996-12-31

    A recent study by the University of Florida, Center for Biomass Programs (1996) showed that biomass crops have potential as a new agricultural commodity in central Florida. Both herbaceous and woody biomass crops have high yields, and weather and soil conditions are favorable. In the Polk County area over 40,371 ha (100,000 A) of phosphate-mined land and about 161,486 ha (400,000 A) of pastureland may be available for biomass production at low opportunity cost. Phosphate land is owned by a few mining companies while pastureland is owned by or rented to cattlemen. Infrastructure for large-scale crop production, such as in the Midwest United States, does not presently exist in central Florida. Personal interviews were conducted with phosphate company managers and a mail survey was conducted with 940 landowners, with at least 16 ha (40 A) of agricultural land. Data were gathered related to decision making factors in growing biomass and other new crops. Results suggested that economic factors, particularly availability of an established market and an assured high return per acre were considered the most important factors. Lack of familiarity with new crops was an important barrier to their adoption. Potential net returns and production costs were considered the most important information needed to make decisions about growing biomass crops.

  7. A National Assessment of Promising Areas for Switchgrass, Hybrid Poplar, or Willow Energy Crop Production

    SciTech Connect (OSTI)

    Graham, R.L.; Walsh, M.E.

    1999-02-01

    The objective of this paper is to systematically assess the cropland acreage that could support energy crops and the expected farm gate and delivered prices of energy crops. The assessment is based on output from two modeling approaches: (1) the Oak Ridge County-Level Energy Crop (ORECCL) database (1996 version) and (2) the Oak Ridge Integrated Bioenergy Analysis System (ORIBAS). The former provides county-level estimates of suitable acres, yields, and farmgate prices of energy crops (switchgrass, hybrid poplar, willow) for all fifty states. The latter estimates delivered feedstock prices and quantities within a state at a fine resolution (1 km2) and considers the interplay between transportation costs, farmgate prices, cropland density, and facility demand. It can be used to look at any type of feedstock given the appropriate input parameters. For the purposes of this assessment, ORIBAS has been used to estimate farmgate and delivered switchgrass prices in 11 states (AL, FL, GA, IA, M N, MO, ND, NE, SC, SD, and TN). Because the potential for energy crop production can be considered from several perspectives, and is evolving as policies, economics and our basic understanding of energy crop yields and production costs change, this assessment should be viewed as a snapshot in time.

  8. Could crop height affect the wind resource at agriculturally productive wind farm sites?

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Vanderwende, Brian; Lundquist, Julie K.

    2015-11-07

    The collocation of cropland and wind turbines in the US Midwest region introduces complex meteorological interactions that could influence both agriculture and wind-power production. Crop management practices may affect the wind resource through alterations of land-surface properties. We use the weather research and forecasting (WRF) model to estimate the impact of crop height variations on the wind resource in the presence of a large turbine array. A hypothetical wind farm consisting of 121 1.8-MW turbines is represented using the WRF model wind-farm parametrization. We represent the impact of selecting soybeans rather than maize by altering the aerodynamic roughness length inmore » a region approximately 65 times larger than that occupied by the turbine array. Roughness lengths of 0.1 and 0.25 m represent the mature soy crop and a mature maize crop, respectively. In all but the most stable atmospheric conditions, statistically significant hub-height wind-speed increases and rotor-layer wind-shear reductions result from switching from maize to soybeans. Based on simulations for the entire month of August 2013, wind-farm energy output increases by 14 %, which would yield a significant monetary gain. Further investigation is required to determine the optimal size, shape, and crop height of the roughness modification to maximize the economic benefit and minimize the cost of such crop-management practices. As a result, these considerations must be balanced by other influences on crop choice such as soil requirements and commodity prices.« less

  9. Benefits of supplementing an industrial waste anaerobic digester with energy crops for increased biogas production

    SciTech Connect (OSTI)

    Nges, Ivo Achu; Escobar, Federico; Fu Xinmei; Bjoernsson, Lovisa

    2012-01-15

    Highlights: Black-Right-Pointing-Pointer This study demonstrates the feasibility of co-digestion food industrial waste with energy crops. Black-Right-Pointing-Pointer Laboratory batch co-digestion led to improved methane yield and carbon to nitrogen ratio as compared to mono-digestion of industrial waste. Black-Right-Pointing-Pointer Co-digestion was also seen as a means of degrading energy crops with nutrients addition as crops are poor in nutrients. Black-Right-Pointing-Pointer Batch co-digestion methane yields were used to predict co-digestion methane yield in full scale operation. Black-Right-Pointing-Pointer It was concluded that co-digestion led an over all economically viable process and ensured a constant supply of feedstock. - Abstract: Currently, there is increasing competition for waste as feedstock for the growing number of biogas plants. This has led to fluctuation in feedstock supply and biogas plants being operated below maximum capacity. The feasibility of supplementing a protein/lipid-rich industrial waste (pig manure, slaughterhouse waste, food processing and poultry waste) mesophilic anaerobic digester with carbohydrate-rich energy crops (hemp, maize and triticale) was therefore studied in laboratory scale batch and continuous stirred tank reactors (CSTR) with a view to scale-up to a commercial biogas process. Co-digesting industrial waste and crops led to significant improvement in methane yield per ton of feedstock and carbon-to-nitrogen ratio as compared to digestion of the industrial waste alone. Biogas production from crops in combination with industrial waste also avoids the need for micronutrients normally required in crop digestion. The batch co-digestion methane yields were used to predict co-digestion methane yield in full scale operation. This was done based on the ratio of methane yields observed for laboratory batch and CSTR experiments compared to full scale CSTR digestion of industrial waste. The economy of crop-based biogas production is limited under Swedish conditions; therefore, adding crops to existing industrial waste digestion could be a viable alternative to ensure a constant/reliable supply of feedstock to the anaerobic digester.

  10. Using a Decision Support System to Optimize Production of Agricultural Crop Residue Biofeedstock

    SciTech Connect (OSTI)

    Reed L. Hoskinson; Ronald C. Rope; Raymond K. Fink

    2007-04-01

    For several years the Idaho National Laboratory (INL) has been developing a Decision Support System for Agriculture (DSS4Ag) which determines the economically optimum recipe of various fertilizers to apply at each site in a field to produce a crop, based on the existing soil fertility at each site, as well as historic production information and current prices of fertilizers and the forecast market price of the crop at harvest, for growing a crop such as wheat, potatoes, corn, or cotton. In support of the growing interest in agricultural crop residues as a bioenergy feedstock, we have extended the capability of the DSS4Ag to develop a variable-rate fertilizer recipe for the simultaneous economically optimum production of both grain and straw, and have been conducting field research to test this new DSS4Ag. In this paper we report the results of two years of field research testing and enhancing the DSS4Ags ability to economically optimize the fertilization for the simultaneous production of both grain and its straw, where the straw is an agricultural crop residue that can be used as a biofeedstock.

  11. Opportunities for Energy Crop Production Based on Subfield Scale Distribution of Profitability

    SciTech Connect (OSTI)

    Ian Bonner; Kara Cafferty; David Muth Jr.; Mark Tomer

    2014-10-01

    Incorporation of dedicated herbaceous energy crops into row crop landscapes is a promising means to supply an expanding biofuel industry while increasing biomass yields, benefiting soil and water quality, and increasing biodiversity. Despite these positive traits energy crops remain largely unaccepted due to concerns over their practicality and cost of implementation. This paper presents a case study on Hardin County, Iowa to demonstrate how subfield decision making can be used to target candidate areas for conversion to energy crop production. The strategy presented integrates switchgrass (Panicum virgatum L.) into subfield landscape positions where corn (Zea mays L.) grain is modeled to operate at a net economic loss. The results of this analysis show that switchgrass integration has the potential to increase sustainable biomass production from 48 to 99% (depending on the rigor of conservation practices applied to corn stover collection) while also improving field level profitability. Candidate land area is highly sensitive to grain price (0.18 to 0.26 US$ kg-1) and dependent on the acceptable net profit for corn production (ranging from 0 to -1,000 US$ ha-1). This work presents the case that switchgrass can be economically implemented into row crop production landscapes when management decisions are applied at a subfield scale and compete against areas of the field operating at a negative net profit.

  12. Results from intercropping fast-growing trees and food crops at Morogoro, Tanzania

    SciTech Connect (OSTI)

    Redhead, J.F.

    1992-12-31

    In Morogoro, Tanzania, agroforestry trials were set up to investigate intercropping with primarily eucalypt species. The climate in the region is very similar to Kolar, Karnataka State, India. Three crops-sorghum, bean and maize-were grown annually under Eucalyptus tereticornis at 2.5 m x 2.5 m for three years with a range of weeding practices. Plots that were intercropped with beans showed best results. Shading by the eucalypts after three years resulted in negligible crop yields in all treatments. Three tree spacings of E. camaldulensis (3 m x 3 m, 4 m x 4 m, and 5 m x 5 m) were combined with the intercropping of beans and maize. Beans gave satisfactory yields at all spacings, but the maize showed significantly depressed yields at 3 m x 3 m at 4 m x 4 m, but was similar to pure maize crop at 5 m x 5 m spacing. Overall the extra revenue from a food crop in the first and second year of tree growth increases the return from the land. The short rotation of fast growing trees depleted the soil of nutrients and, as with other crops, the fertility would have to be maintained by applying fertilizer.

  13. Hemicellulolytic organisms in the particle-associated microbiota of the hoatzin crop

    SciTech Connect (OSTI)

    Godoy-Vitorino, Filipa; Malfatti, Stephanie; Garcia-Amado, Maria A.; Dominguez-Bello, Maria Gloria; Hugenholtz, Phillip; Tringe, Susannah

    2011-05-31

    The hoatzin (Opisthocomus hoazin) is a South American herbivorous bird, that has an enlarged crop analogous to the rumen, where foregut microbes degrade the otherwise indigestible plant materials, providing energy to the host. The crop harbors an impressive array of microorganisms with potentially novel cellulolytic enzymes. Thie study describes the composition ofthe particle-associated microbiota in the hoatzin crop, combining a survey of 16S rRNA genes in 7 adult birds and metagenome sequencing of two animals. The pyrotag survey demonstrates that Prevotellaceae, are the most abundant and ubiquitous taxa, suggesting that the degradation of hemicellulose is an important activity in the crop. Nonetheless, preliminary results from the metagnome of the particle-associated microbiota of two adult birds show that the crop microbiome contains a high number of genes encoding cellulases (such as GH5) more abundant than those of the termite gut, as well as genes encoding hemicellulases. These preliminary results show that the carbohydate-active enzyme genes in the cropmetagenome could be a source of biochemical catalysts able to deconstruct plant biomass.

  14. Global Simulation of Bioenergy Crop Productivity: Analytical framework and Case Study for Switchgrass

    SciTech Connect (OSTI)

    Nair, S. Surendran; Nichols, Jeff A. {Cyber Sciences}; Post, Wilfred M; Wang, Dali; Wullschleger, Stan D; Kline, Keith L; Wei, Yaxing; Singh, Nagendra; Kang, Shujiang

    2014-01-01

    Contemporary global assessments of the deployment potential and sustainability aspects of biofuel crops lack quantitative details. This paper describes an analytical framework capable of meeting the challenges associated with global scale agro-ecosystem modeling. We designed a modeling platform for bioenergy crops, consisting of five major components: (i) standardized global natural resources and management data sets, (ii) global simulation unit and management scenarios, (iii) model calibration and validation, (iv) high-performance computing (HPC) modeling, and (v) simulation output processing and analysis. A case study with the HPC- Environmental Policy Integrated Climate model (HPC-EPIC) to simulate a perennial bioenergy crop, switchgrass (Panicum virgatum L.) and global biomass feedstock analysis on grassland demonstrates the application of this platform. The results illustrate biomass feedstock variability of switchgrass and provide insights on how the modeling platform can be expanded to better assess sustainable production criteria and other biomass crops. Feedstock potentials on global grasslands and within different countries are also shown. Future efforts involve developing databases of productivity, implementing global simulations for other bioenergy crops (e.g. miscanthus, energycane and agave), and assessing environmental impacts under various management regimes. We anticipated this platform will provide an exemplary tool and assessment data for international communities to conduct global analysis of biofuel biomass feedstocks and sustainability.

  15. Introduction to Safety Culture Advice

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Safety Culture Advice Thursday, June 7, 2012 As expressed in past advice, and in draft advice being proposed today, the safe and effective treatment of Hanford's tank waste through vitrification, is a priority for the Hanford Advisory Board. The cornerstone of vitrification is the Waste Treatment Plant. We all want the WTP to work safely and effectively. The Tank Waste Committee and the Health Safety and Environmental Protection Committee are bringing this advice forward today in response to

  16. "Berkeley Lab Cultural Festival," October 26, 2011

    ScienceCinema (OSTI)

    Lee, Soo; Simon, Horst; Grasz, Erna; Carl, Rachel; Ezeife, Loretta; Serafino, Adel;

    2013-05-29

    This is the First Annual Berkeley Lab Cultural Festival, sponsored by the Lab-Wide Diversity and Inclusion Council subcommittee.

  17. DOE - NNSA/NFO -- Cultural Resources

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Cultural Resources NNSA/NFO Language Options U.S. DOE/NNSA - Nevada Field Office Click to subscribe to NNSS News Cultural Resources Environmental Cultural photo Prehistoric cultural resources are abundant at the Nevada National Security Site (NNSS), indicating Native Americans have occupied the region for more than 10,000 years. Historic artifacts of more recent origin are also present, reflecting use by miners, ranchers and settlers who traveled through the area. The Nevada Field Office is

  18. Tuberous legumes: preliminary evaluation of tropical Australian and introduced species as fuel crops

    SciTech Connect (OSTI)

    Saxon, E.C.

    1981-04-01

    The evaluation of native and introduced legumes with starch-storing roots or tubers was undertaken to test whether plants traditionally collected as food by Australian aborigines might have a role in the development of crops for liquid fuel production (by fermentation of carbohydrates to ethanol). Tuberous-rooted legumes from overseas were planted at the Commonwealth Scientific and Industrial Research Organization, division of Tropical Crops and Pastures, Kimberley Research Station, Western Australia (15/sup 0/39'S, 128/sup 0/42'E) in December 1974, March 1978 and February 1979. Roots from the latter plantings were harvested in June 1979. Native plant material was collected during visits to aboriginal communities in the Kimberleys between April and June 1979. The native and introduced specimens were analyzed for fermentable carbohydrate and protein content. Several native plants appear more promising than introduced species as liquid fuel crops.

  19. Improving the Way We Harvest & Deliver Biofuels Crops | Department of

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Energy the Way We Harvest & Deliver Biofuels Crops Improving the Way We Harvest & Deliver Biofuels Crops May 24, 2013 - 9:40am Addthis The self-propelled baler collects and packages bales of feedstock on-site that can be immediately loaded and sent to a biorefinery for use. | Photo courtesy of Antares Group. The self-propelled baler collects and packages bales of feedstock on-site that can be immediately loaded and sent to a biorefinery for use. | Photo courtesy of Antares Group. The

  20. Build Replication into Corporate Culture | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Build Replication into Corporate Culture Build Replication into Corporate Culture This presentation addresses how to build replication into the corporate culture. PDF icon Build...

  1. A literature review of safety culture.

    SciTech Connect (OSTI)

    Cole, Kerstan Suzanne; Stevens-Adams, Susan Marie; Wenner, Caren A.

    2013-03-01

    Workplace safety has been historically neglected by organizations in order to enhance profitability. Over the past 30 years, safety concerns and attention to safety have increased due to a series of disastrous events occurring across many different industries (e.g., Chernobyl, Upper Big-Branch Mine, Davis-Besse etc.). Many organizations have focused on promoting a healthy safety culture as a way to understand past incidents, and to prevent future disasters. There is an extensive academic literature devoted to safety culture, and the Department of Energy has also published a significant number of documents related to safety culture. The purpose of the current endeavor was to conduct a review of the safety culture literature in order to understand definitions, methodologies, models, and successful interventions for improving safety culture. After reviewing the literature, we observed four emerging themes. First, it was apparent that although safety culture is a valuable construct, it has some inherent weaknesses. For example, there is no common definition of safety culture and no standard way for assessing the construct. Second, it is apparent that researchers know how to measure particular components of safety culture, with specific focus on individual and organizational factors. Such existing methodologies can be leveraged for future assessments. Third, based on the published literature, the relationship between safety culture and performance is tenuous at best. There are few empirical studies that examine the relationship between safety culture and safety performance metrics. Further, most of these studies do not include a description of the implementation of interventions to improve safety culture, or do not measure the effect of these interventions on safety culture or performance. Fourth, safety culture is best viewed as a dynamic, multi-faceted overall system composed of individual, engineered and organizational models. By addressing all three components of safety culture, organizations have a better chance of understanding, evaluating, and making positive changes towards safety within their own organization.

  2. Simulation of the long-term accumulation of radiocontaminants in crop plants

    SciTech Connect (OSTI)

    Schreckhise, R.G.

    1980-03-01

    Most radiological dose assessment models ignore the long-term buildup of radiocontaminants in the soil. When they estimate levels in crop plants from root uptake, these models account only for the annual input from the source into the soil. Almost all of the models ignore the build-up of contaminants in the soil profile due to the accumulation in the roots and the build-up from the above-ground plant material that is buried by plowing. The model described in this report simulates the entire system involved in the cycling and accumulation of radionuclides in cultivated land. The model, named CROPRE, was developed to predict both the long-term accumulation of radionuclides and the resulting concentrations of radionuclides in vegetation. This model was designed to include: (1) the chronic input of contaminated irrigation water into both the soil compartment and directly onto the surface of the vegetation; (2) the incorporation of radiocontaminants in the soil organic matter pool and their eventual release for re-uptake by subsequent crops; (3) the removal of contaminants from the system when the crops are harvested; and (4) the downward movement of radionuclides and their loss from the system by percolation. The CROPRE model more realistically simulates the cycling of radiocontaminants in crop plants over long periods of time than does the other models. It is recommended that it be incorporated into existing radiation dose commitment models.

  3. Algal Culture Management and Strain Selection Workshop

    Broader source: Energy.gov [DOE]

    ATP3 (Algae Testbed Public-Private Partnership) will be hosting the Microalgal Culture Management and Strain Selection Workshop August 24–28, 2015, at The University of Texas at Austin. Topics will include isolating and identifying microalgae, handling and managing microalgal cultures, screening for desirable characteristics, genetically improving strains, and analyzing lipids and higher-value products. Workshop modules will include hands-on bioprospecting, performing sample measurements, monitoring cultures for contaminants, and analyzing algal biomass composition.

  4. MOWII Webinar: Wind Development Cultural Resource Management

    Broader source: Energy.gov [DOE]

    During the planning stages, wind energy development can be affected by the regulatory process relative to cultural resource management issues. Section 106 of the National Historic Preservation Act ...

  5. Montana Cultural Records Webpage | Open Energy Information

    Open Energy Info (EERE)

    LibraryAdd to library Web Site: Montana Cultural Records Webpage Abstract Provides access to the Montana Antiquities Database and provides information about the structure and...

  6. Cultural Roadmap Meeting | OpenEI Community

    Open Energy Info (EERE)

    Team met with members of the geothermal permitting community who had experience and involvement in navigating the tribal and cultural process. During the afternoon workshop,...

  7. LPG marketers thank the rain gods for hefty crop-drying market in '89

    SciTech Connect (OSTI)

    Not Available

    1990-04-01

    One of the pleasant bits of news that sprouted in many places across the country last fall concerned the increased LP-gas gallonage for crop drying. It is difficult to predict the farmers or dryers' consumption of propane in any given season. The demand for this fuel in drying operations is determined almost entirely by weather conditions, and since climate remains a perennial question mark, no one knows until the season is well under way how much moisture content the plants will exhibit. In another area, predictions can be complicated by the variations of individual farm practices as well as the evolving technology of drying equipment, including burners. This article, reports on the crop drying market as seen by various LP-gas dealers and others outside the industry.

  8. Evaluation of sweet sorghum as a potential ethanol crop in Mississippi

    SciTech Connect (OSTI)

    Horton, David Scott

    2011-08-01

    Petroleum prices have made alternative fuel crops a viable option for ethanol production. Sweet sorghum [Sorghum bicolor] is a non-food crop that may produce large quantities of ethanol with minimal inputs. Eleven cultivars were planted in 2008 and 2009 as a half-season crop. Four-row plots 6.9 m by 0.5 m, were monitored bimonthly for ???°Brix, height, and sugar accumulation. Yield and extractable sap were taken at the end of season. Stalk yield was greatest for the cultivar Sugar Top (4945 kg ha-1) and lowest for Simon (1054 kg ha-1). Dale ranked highest ethanol output (807 L ha-1) while Simon (123 L ha-1) is the lowest. All cultivars peak Brix accumulation occurs in early October. Individual sugar concentrations indicated sucrose is the predominant sugar with glucose and fructose levels dependent on cultivar. Supplemental ethanol in fermented wort was the best preservative tested to halt degradation of sorghum wort.

  9. Illinois biomass resources: annual crops and residues; canning and food-processing wastes. Preliminary assessment

    SciTech Connect (OSTI)

    Antonopoulos, A A

    1980-06-01

    Illinois, a major agricultural and food-processing state, produces vast amounts of renewable plant material having potential for energy production. This biomass, in the form of annual crops, crop residues, and food-processing wastes, can be converted to alternative fuels (such as ethanol) and industrial chemicals (such as furfural, ethylene, and xylene). The present study provides a preliminary assessment of these Illinois biomass resources, including (a) an appraisal of the effects of their use on both agriculture and industry; (b) an analysis of biomass conversion systems; and (c) an environmental and economic evaluation of products that could be generated from biomass. It is estimated that, of the 39 x 10/sup 6/ tons of residues generated in 1978 in Illinois from seven main crops, about 85% was collectible. The thermal energy equivalent of this material is 658 x 10/sup 6/ Btu, or 0.66 quad. And by fermenting 10% of the corn grain grown in Illinois, some 323 million gallons of ethanol could have been produced in 1978. Another 3 million gallons of ethanol could have been produced in the same year from wastes generated by the state's food-processing establishments. Clearly, Illinois can strengthen its economy substantially by the development of industries that produce biomass-derived fuels and chemicals. In addition, a thorough evaluation should be made of the potential for using the state's less-exploitable land for the growing of additional biomass.

  10. DOE BiomassDevelopment and Deployment of a Short Rotation Woody Crops Harvesting System Based on a Case New Holland Forage Harvester and SRC Woody Crop Header RDD Review Template

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Development and Deployment of a Short Rotation Woody Crops Harvesting System Based on a Case New Holland Forage Harvester and SRC Woody Crop Header March 25, 2015 Terrestrial Feedstocks Timothy A. Volk SUNY ESF This presentation does not contain any proprietary, confidential, or otherwise restricted information Goal Statement * Develop, test and deploy a single pass cut and chip harvester combined with a handling, transportation and storage system that is effective and efficient in a range of

  11. Reversible gelling culture media for in-vitro cell culture in three-dimensional matrices

    DOE Patents [OSTI]

    An, Yuehuei H. (Charleston, SC); Mironov, Vladimir A. (Mt. Pleasant, SC); Gutowska, Anna (Richland, WA)

    2000-01-01

    A gelling cell culture medium useful for forming a three dimensional matrix for cell culture in vitro is prepared by copolymerizing an acrylamide derivative with a hydrophilic comonomer to form a reversible (preferably thermally reversible) gelling linear random copolymer in the form of a plurality of linear chains having a plurality of molecular weights greater than or equal to a minimum gelling molecular weight cutoff, mixing the copolymer with an aqueous solvent to form a reversible gelling solution and adding a cell culture medium to the gelling solution to form the gelling cell culture medium. Cells such as chondrocytes or hepatocytes are added to the culture medium to form a seeded culture medium, and temperature of the medium is raised to gel the seeded culture medium and form a three dimensional matrix containing the cells. After propagating the cells in the matrix, the cells may be recovered by lowering the temperature to dissolve the matrix and centrifuging.

  12. Cultural intelligence support for military operations

    SciTech Connect (OSTI)

    Guthormsen, Amy M.; MacKerrow, Edward P; Merritt, Terence M; Morgart, Ruth E

    2010-04-08

    It has long been recognized that military success relies on knowledge of the enemy. In the context of standard warfare, adequate knowledge of the enemy may be gained by analyzing observable, measurable data. In the context of modern counterinsurgency operations and the global war on terror, the task of predicting the behavior of the enemy is vastly more complex and difficult. Without an understanding of the ways individuals in the host nation interpret and react to events, no amount of objective information can provide the insight required to accurately predict behavior. US military doctrine has begun to recognize the importance of the many ways that local culture can affect operation success. Increasingly military decision makers use cultural information in the service of operation planning, and troops are provided with pre-deployment cultural training. However, no amount of training can cover the breadth and depth of potentially useful cultural information, and no amount of careful planning can avoid the need to adapt as situations develop. Therefore, a critical challenge is to provide useful tools to US personnel in their efforts to collect, analyze, and utilize cultural information. Essential functions for cultural support tools include the following: (1) to narrow down a broad range of available data and focus the user's attention on context-relevant information, (2) to present cultural information in an easily understood form, (3) to prompt the user to seek relevant information in the environment, (4) to synthesize information, and (5) to predict outcomes based on possible courses of operation. In this paper, we begin by reviewing the ways in which military operations can benefit from cultural intelligence. We then discuss frameworks for analyzing cultural information in the context of a military operation. We conclude with a demonstration of our current efforts to develop a tool that meets the aforementioned functional challenges.

  13. Development and Deployment of a Short Rotation Woody Crops Harvesting System Based on a Case New Holland Forage Harvester and SRC Woody Crop Header

    SciTech Connect (OSTI)

    Eisenbies, Mark; Volk, Timothy

    2014-10-03

    Demand for bioenergy sourced from woody biomass is projected to increase; however, the expansion and rapid deployment of short rotation woody crop systems in the United States has been constrained by high production costs and sluggish market acceptance due to problems with quality and consistency from first-generation harvesting systems. The objective of this study was to evaluate the effect of crop conditions on the performance of a single-pass, cut and chip harvester based on a standard New Holland FR-9000 series forage harvester with a dedicated 130FB short rotation coppice header, and the quality of chipped material. A time motion analysis was conducted to track the movement of machine and chipped material through the system for 153 separate loads over 10 days on a 54-ha harvest. Harvester performance was regulated by either ground conditions, or standing biomass on 153 loads. Material capacities increased linearly with standing biomass up to 40 Mgwet ha-1 and plateaued between 70 and 90 Mgwet hr-1. Moisture contents ranged from 39 to 51% with the majority of samples between 43 and 45%. Loads produced in freezing weather (average temperature over 10 hours preceding load production) had 4% more chips greater than 25.4 mm (P < 0.0119). Over 1.5 Mgdry ha-1 of potentially harvested material (6-9% of a load) was left on site, of which half was commercially undesirable meristematic pieces. The New Holland harvesting system is a reliable and predictable platform for harvesting material over a wide range of standing biomass; performance was consistent overall in 14 willow cultivars.

  14. Department of Energy Management of Cultural Resources

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2001-05-02

    The purpose of this Policy is to ensure that Department of Energy (DOE) programs, including the National Nuclear Security Administration (NNSA), and field elements integrate cultural resources management into their missions and activities. Certified 1-28-11. No cancellation.

  15. Integrated Safety Management Safety Culture Resources | Department of

    Office of Environmental Management (EM)

    Energy Safety Culture Resources Integrated Safety Management Safety Culture Resources A collection of resources available in implementing ISM safety culture activities Safety from the Operator's Perspective: We are All in This Together (2005) Transcript, Keeping the Edge: Enhancing Performance Through Managing Culture (2003), Edgar H. Schein, Ph.D. Proceedings of the Advisory Committee on Reactor Safeguards Safety Culture Workshop (2003) Safety Culture in Nuclear Installations: Guidance for

  16. Idaho National Laboratory Cultural Resource Management Plan

    SciTech Connect (OSTI)

    Lowrey, Diana Lee

    2009-02-01

    As a federal agency, the U.S. Department of Energy has been directed by Congress, the U.S. president, and the American public to provide leadership in the preservation of prehistoric, historic, and other cultural resources on the lands it administers. This mandate to preserve cultural resources in a spirit of stewardship for the future is outlined in various federal preservation laws, regulations, and guidelines such as the National Historic Preservation Act, the Archaeological Resources Protection Act, and the National Environmental Policy Act. The purpose of this Cultural Resource Management Plan is to describe how the Department of Energy, Idaho Operations Office will meet these responsibilities at the Idaho National Laboratory. This Laboratory, which is located in southeastern Idaho, is home to a wide variety of important cultural resources representing at least 13,500 years of human occupation in the southeastern Idaho area. These resources are nonrenewable; bear valuable physical and intangible legacies; and yield important information about the past, present, and perhaps the future. There are special challenges associated with balancing the preservation of these sites with the management and ongoing operation of an active scientific laboratory. The Department of Energy, Idaho Operations Office is committed to a cultural resource management program that accepts these challenges in a manner reflecting both the spirit and intent of the legislative mandates. This document is designed for multiple uses and is intended to be flexible and responsive to future changes in law or mission. Document flexibility and responsiveness will be assured through annual reviews and as-needed updates. Document content includes summaries of Laboratory cultural resource philosophy and overall Department of Energy policy; brief contextual overviews of Laboratory missions, environment, and cultural history; and an overview of cultural resource management practices. A series of appendices provides important details that support the main text.

  17. Idaho National Laboratory Cultural Resource Management Plan

    SciTech Connect (OSTI)

    Lowrey, Diana Lee

    2011-02-01

    As a federal agency, the U.S. Department of Energy has been directed by Congress, the U.S. president, and the American public to provide leadership in the preservation of prehistoric, historic, and other cultural resources on the lands it administers. This mandate to preserve cultural resources in a spirit of stewardship for the future is outlined in various federal preservation laws, regulations, and guidelines such as the National Historic Preservation Act, the Archaeological Resources Protection Act, and the National Environmental Policy Act. The purpose of this Cultural Resource Management Plan is to describe how the Department of Energy, Idaho Operations Office will meet these responsibilities at the Idaho National Laboratory. This Laboratory, which is located in southeastern Idaho, is home to a wide variety of important cultural resources representing at least 13,500 years of human occupation in the southeastern Idaho area. These resources are nonrenewable; bear valuable physical and intangible legacies; and yield important information about the past, present, and perhaps the future. There are special challenges associated with balancing the preservation of these sites with the management and ongoing operation of an active scientific laboratory. The Department of Energy, Idaho Operations Office is committed to a cultural resource management program that accepts these challenges in a manner reflecting both the spirit and intent of the legislative mandates. This document is designed for multiple uses and is intended to be flexible and responsive to future changes in law or mission. Document flexibility and responsiveness will be assured through annual reviews and as-needed updates. Document content includes summaries of Laboratory cultural resource philosophy and overall Department of Energy policy; brief contextual overviews of Laboratory missions, environment, and cultural history; and an overview of cultural resource management practices. A series of appendices provides important details that support the main text.

  18. Idaho National Laboratory Cultural Resource Management Plan

    SciTech Connect (OSTI)

    Julie Braun Williams

    2013-02-01

    As a federal agency, the U.S. Department of Energy has been directed by Congress, the U.S. president, and the American public to provide leadership in the preservation of prehistoric, historic, and other cultural resources on the lands it administers. This mandate to preserve cultural resources in a spirit of stewardship for the future is outlined in various federal preservation laws, regulations, and guidelines such as the National Historic Preservation Act, the Archaeological Resources Protection Act, and the National Environmental Policy Act. The purpose of this Cultural Resource Management Plan is to describe how the Department of Energy, Idaho Operations Office will meet these responsibilities at Idaho National Laboratory in southeastern Idaho. The Idaho National Laboratory is home to a wide variety of important cultural resources representing at least 13,500 years of human occupation in the southeastern Idaho area. These resources are nonrenewable, bear valuable physical and intangible legacies, and yield important information about the past, present, and perhaps the future. There are special challenges associated with balancing the preservation of these sites with the management and ongoing operation of an active scientific laboratory. The Department of Energy, Idaho Operations Office is committed to a cultural resource management program that accepts these challenges in a manner reflecting both the spirit and intent of the legislative mandates. This document is designed for multiple uses and is intended to be flexible and responsive to future changes in law or mission. Document flexibility and responsiveness will be assured through regular reviews and as-needed updates. Document content includes summaries of Laboratory cultural resource philosophy and overall Department of Energy policy; brief contextual overviews of Laboratory missions, environment, and cultural history; and an overview of cultural resource management practices. A series of appendices provides important details that support the main text.

  19. Assessment of Nuclear Safety Culture at the Idaho Cleanup Project...

    Office of Environmental Management (EM)

    Assessment of Nuclear Safety Culture at the Idaho Cleanup Project Sodium Bearing Waste ... Independent Oversight Assessment of Nuclear Safety Culture at the Idaho Cleanup ...

  20. Assessment of Nuclear Safety Culture at the Salt Waste Processing...

    Office of Environmental Management (EM)

    Oversight Assessment of Nuclear Safety Culture at the Salt Waste Processing Facility ... Independent Oversight Assessment of Nuclear Safety Culture at the Salt Waste ...

  1. BLM Manual 8140 - Protecting Cultural Resources | Open Energy...

    Open Energy Info (EERE)

    section provides general guidance for protecting cultural resources from natural or human-caused deterioration; for making decisions about recovering significant cultural...

  2. Independent Oversight Follow-up Assessment of Safety Culture...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Assessment of Safety Culture at the Waste Treatment and Immobilization Plant - June 2014 Independent Oversight Follow-up Assessment of Safety Culture at the Waste Treatment and...

  3. Enterprise Assessments Follow-up Assessment of Safety Culture...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Assessment of Safety Culture at the Hanford Site Waste Treatment and Immobilization Plant - June 2015 Enterprise Assessments Follow-up Assessment of Safety Culture at the Hanford...

  4. Wyoming Department of State Parks and Cultural Resources | Open...

    Open Energy Info (EERE)

    Cultural Resources Jump to: navigation, search Name: Wyoming Department of State Parks and Cultural Resources Abbreviation: SPCR Address: 2301 Central Avenue Place: Cheyenne,...

  5. New culturing tool reveals a full genome from single cells

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    New culturing tool reveals New culturing tool reveals a full genome from single cells A new technique for genetic analysis, "gel microdroplets," helps scientists generate complete...

  6. Determine metrics and set targets for soil quality on agriculture residue and energy crop pathways

    SciTech Connect (OSTI)

    Ian Bonner; David Muth

    2013-09-01

    There are three objectives for this project: 1) support OBP in meeting MYPP stated performance goals for the Sustainability Platform, 2) develop integrated feedstock production system designs that increase total productivity of the land, decrease delivered feedstock cost to the conversion facilities, and increase environmental performance of the production system, and 3) deliver to the bioenergy community robust datasets and flexible analysis tools for establishing sustainable and viable use of agricultural residues and dedicated energy crops. The key project outcome to date has been the development and deployment of a sustainable agricultural residue removal decision support framework. The modeling framework has been used to produce a revised national assessment of sustainable residue removal potential. The national assessment datasets are being used to update national resource assessment supply curves using POLYSIS. The residue removal modeling framework has also been enhanced to support high fidelity sub-field scale sustainable removal analyses. The framework has been deployed through a web application and a mobile application. The mobile application is being used extensively in the field with industry, research, and USDA NRCS partners to support and validate sustainable residue removal decisions. The results detailed in this report have set targets for increasing soil sustainability by focusing on primary soil quality indicators (total organic carbon and erosion) in two agricultural residue management pathways and a dedicated energy crop pathway. The two residue pathway targets were set to, 1) increase residue removal by 50% while maintaining soil quality, and 2) increase soil quality by 5% as measured by Soil Management Assessment Framework indicators. The energy crop pathway was set to increase soil quality by 10% using these same indicators. To demonstrate the feasibility and impact of each of these targets, seven case studies spanning the US are presented. The analysis has shown that the feedstock production systems are capable of simultaneously increasing productivity and soil sustainability.

  7. Genome-Wide Analysis of miRNA targets in Brachypodium and Biomass Energy Crops

    SciTech Connect (OSTI)

    Green, Pamela J.

    2015-08-11

    MicroRNAs (miRNAs) contribute to the control of numerous biological processes through the regulation of specific target mRNAs. Although the identities of these targets are essential to elucidate miRNA function, the targets are much more difficult to identify than the small RNAs themselves. Before this work, we pioneered the genome-wide identification of the targets of Arabidopsis miRNAs using an approach called PARE (German et al., Nature Biotech. 2008; Nature Protocols, 2009). Under this project, we applied PARE to Brachypodium distachyon (Brachypodium), a model plant in the Poaceae family, which includes the major food grain and bioenergy crops. Through in-depth global analysis and examination of specific examples, this research greatly expanded our knowledge of miRNAs and target RNAs of Brachypodium. New regulation in response to environmental stress or tissue type was found, and many new miRNAs were discovered. More than 260 targets of new and known miRNAs with PARE sequences at the precise sites of miRNA-guided cleavage were identified and characterized. Combining PARE data with the small RNA data also identified the miRNAs responsible for initiating approximately 500 phased loci, including one of the novel miRNAs. PARE analysis also revealed that differentially expressed miRNAs in the same family guide specific target RNA cleavage in a correspondingly tissue-preferential manner. The project included generation of small RNA and PARE resources for bioenergy crops, to facilitate ongoing discovery of conserved miRNA-target RNA regulation. By associating specific miRNA-target RNA pairs with known physiological functions, the research provides insights about gene regulation in different tissues and in response to environmental stress. This, and release of new PARE and small RNA data sets should contribute basic knowledge to enhance breeding and may suggest new strategies for improvement of biomass energy crops.

  8. An Integrative Modeling Framework to Evaluate the Productivity and Sustainability of Biofuel Crop Production Systems

    SciTech Connect (OSTI)

    Zhang, Xuesong; Izaurralde, Roberto C.; Manowitz, David H.; West, T. O.; Post, W. M.; Thomson, Allison M.; Bandaru, V. P.; Nichols, J.; Williams, J.R.

    2010-09-08

    The potential expansion of biofuel production raises food, energy, and environmental challenges that require careful assessment of the impact of biofuel production on greenhouse gas (GHG) emissions, soil erosion, nutrient loading, and water quality. In this study, we describe a spatially-explicit integrative modeling framework (SEIMF) to understand and quantify the environmental impacts of different biomass cropping systems. This SEIMF consists of three major components: 1) a geographic information system (GIS)-based data analysis system to define spatial modeling units with resolution of 56 m to address spatial variability, 2) the biophysical and biogeochemical model EPIC (Environmental Policy Integrated Climate) applied in a spatially-explicit way to predict biomass yield, GHG emissions, and other environmental impacts of different biofuel crops production systems, and 3) an evolutionary multi-objective optimization algorithm for exploring the trade-offs between biofuel energy production and unintended ecosystem-service responses. Simple examples illustrate the major functions of the SEIMF when applied to a 9-county Regional Intensive Modeling Area (RIMA) in SW Michigan to 1) simulate biofuel crop production, 2) compare impacts of management practices and local ecosystem settings, and 3) optimize the spatial configuration of different biofuel production systems by balancing energy production and other ecosystem-service variables. Potential applications of the SEIMF to support life cycle analysis and provide information on biodiversity evaluation and marginal-land identification are also discussed. The SEIMF developed in this study is expected to provide a useful tool for scientists and decision makers to understand sustainability issues associated with the production of biofuels at local, regional, and national scales.

  9. Vulnerability of crops and native grasses to summer drying in the U.S. Southern Great Plains

    SciTech Connect (OSTI)

    Raz-Yaseef, Naama; Billesbach, Dave P.; Fischer, Marc L.; Biraud, Sebastien C.; Gunter, Stacey A.; Bradford, James A.; Torn, Margaret S.

    2015-08-31

    The Southern Great Plains are characterized by a fine-scale mixture of different land-cover types, predominantly winter-wheat and grazed pasture, with relatively small areas of other crops, native prairie, and switchgrass. Recent droughts and predictions of increased drought in the Southern Great Plains, especially during the summer months, raise concern for these ecosystems. We measured ecosystem carbon and water fluxes with eddy-covariance systems over cultivated cropland for 10 years, and over lightly grazed prairie and new switchgrass fields for 2 years each. Growing-season precipitation showed the strongest control over net carbon uptake for all ecosystems, but with a variable effect: grasses (prairie and switchgrass) needed at least 350 mm of precipitation during the growing season to become net carbon sinks, while crops needed only 100 mm. In summer, high temperatures enhanced evaporation and led to higher likelihood of dry soil conditions. Therefore, summer-growing native prairie species and switchgrass experienced more seasonal droughts than spring-growing crops. For wheat, the net reduction in carbon uptake resulted mostly from a decrease in gross primary production rather than an increase in respiration. Flux measurements suggested that management practices for crops were effective in suppressing evapotranspiration and decomposition (by harvesting and removing secondary growth), and in increasing carbon uptake (by fertilizing and conserving summer soil water). In light of future projections for wetter springs and drier and warmer summers in the Southern Great Plains, our study indicates an increased vulnerability in native ecosystems and summer crops over time.

  10. Cultural Resource Program and Curation Services - Hanford Site

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Public Safety and Resource Protection (PSRP) Cultural Resource Program and Curation Services Public Safety and Resource Protection (PSRP) Public Safety and Resource Protection Home Cultural Resource Program and Curation Services Ecological Monitoring Environmental Surveillance Meteorology and Climatology Services Seismic Monitoring Cultural Resource Program and Curation Services Email Email Page | Print Print Page |Text Increase Font Size Decrease Font Size Cultural Resource Program and Curation

  11. Atmospheric inversion of the surface carbon flux with consideration of the spatial distributions of US crop production and consumption

    SciTech Connect (OSTI)

    Chen, J. M.; Fung, J. W.; Mo, G.; Deng, F.; West, Tristram O.

    2015-01-01

    In order to improve quantification of the spatial distribution of carbon sinks and sources in the conterminous USA, we conduct a nested global atmospheric inversion with consideration of the spatial information of crop production and consumption. Spatially distributed 5 county-level cropland net primary productivity, harvested biomass, soil carbon change, and human and livestock consumption data over the conterminous USA are used for this purpose. Time-dependent Bayesian synthesis inversions are conducted based on CO? observations at 210 stations to infer CO? fluxes globally at monthly time steps with a nested focus on 30 regions in North America. Prior land surface carbon 10 fluxes are first generated using a biospheric model, and the inversions are constrained using prior fluxes with and without adjustments for crop production and consumption over the 20022007 period. After these adjustments, the inverted regional carbon sink in the US Midwest increases from 0.25 0.03 Pg C yr? to 0.42 0.13 Pg C yr?, whereas the large sink in the US Southeast forest region is weakened from 0.410.12 Pg C yr? 15 to 0.29 0.12 Pg C yr?. These adjustments also reduce the inverted sink in the West region from 0.066 0.04 Pg C yr? to 0.040 0.02 Pg C yr?1 because of high crop consumption and respiration by humans and livestock. The general pattern of sink increase in crop production areas and sink decreases (or source increases) in crop consumption areas highlights the importance of considering the lateral carbon transfer in crop 20 products in atmospheric inverse modeling, which provides an atmospheric perspective of the overall carbon balance of a region.

  12. Atmospheric inversion of surface carbon flux with consideration of the spatial distribution of US crop production and consumption

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Chen, J. M.; Fung, J. W.; Mo, G.; Deng, F.; West, T. O.

    2015-01-19

    In order to improve quantification of the spatial distribution of carbon sinks and sources in the conterminous US, we conduct a nested global atmospheric inversion with detailed spatial information on crop production and consumption. County-level cropland net primary productivity, harvested biomass, soil carbon change, and human and livestock consumption data over the conterminous US are used for this purpose. Time-dependent Bayesian synthesis inversions are conducted based on CO₂ observations at 210 stations to infer CO₂ fluxes globally at monthly time steps with a nested focus on 30 regions in North America. Prior land surface carbon fluxes are first generated usingmore » a biospheric model, and the inversions are constrained using prior fluxes with and without adjustments for crop production and consumption over the 2002–2007 period. After these adjustments, the inverted regional carbon sink in the US Midwest increases from 0.25 ± 0.03 to 0.42 ± 0.13 Pg C yr⁻¹, whereas the large sink in the US southeast forest region is weakened from 0.41 ± 0.12 to 0.29 ± 0.12 Pg C yr⁻¹. These adjustments also reduce the inverted sink in the west region from 0.066 ± 0.04 to 0.040 ± 0.02 Pg C yr⁻¹ because of high crop consumption and respiration by humans and livestock. The general pattern of sink increases in crop production areas and sink decreases (or source increases) in crop consumption areas highlights the importance of considering the lateral carbon transfer in crop products in atmospheric inverse modeling, which provides a reliable atmospheric perspective of the overall carbon balance at the continental scale but is unreliable for separating fluxes from different ecosystems.« less

  13. Atmospheric inversion of surface carbon flux with consideration of the spatial distribution of US crop production and consumption

    SciTech Connect (OSTI)

    Chen, J. M.; Fung, J. W.; Mo, G.; Deng, F.; West, T. O.

    2015-01-19

    In order to improve quantification of the spatial distribution of carbon sinks and sources in the conterminous US, we conduct a nested global atmospheric inversion with detailed spatial information on crop production and consumption. County-level cropland net primary productivity, harvested biomass, soil carbon change, and human and livestock consumption data over the conterminous US are used for this purpose. Time-dependent Bayesian synthesis inversions are conducted based on CO? observations at 210 stations to infer CO? fluxes globally at monthly time steps with a nested focus on 30 regions in North America. Prior land surface carbon fluxes are first generated using a biospheric model, and the inversions are constrained using prior fluxes with and without adjustments for crop production and consumption over the 20022007 period. After these adjustments, the inverted regional carbon sink in the US Midwest increases from 0.25 0.03 to 0.42 0.13 Pg C yr?, whereas the large sink in the US southeast forest region is weakened from 0.41 0.12 to 0.29 0.12 Pg C yr?. These adjustments also reduce the inverted sink in the west region from 0.066 0.04 to 0.040 0.02 Pg C yr? because of high crop consumption and respiration by humans and livestock. The general pattern of sink increases in crop production areas and sink decreases (or source increases) in crop consumption areas highlights the importance of considering the lateral carbon transfer in crop products in atmospheric inverse modeling, which provides a reliable atmospheric perspective of the overall carbon balance at the continental scale but is unreliable for separating fluxes from different ecosystems.

  14. Increasing cell culture population doublings for long-term growth of finite life span human cell cultures

    DOE Patents [OSTI]

    Stampfer, Martha R; Garbe, James C

    2015-02-24

    Cell culture media formulations for culturing human epithelial cells are herein described. Also described are methods of increasing population doublings in a cell culture of finite life span human epithelial cells and prolonging the life span of human cell cultures. Using the cell culture media disclosed alone and in combination with addition to the cell culture of a compound associated with anti-stress activity achieves extended growth of pre-stasis cells and increased population doublings and life span in human epithelial cell cultures.

  15. Vegetable Oil from Leaves and Stems: Vegetative Production of Oil in a C4 Crop

    SciTech Connect (OSTI)

    2012-01-01

    PETRO Project: Arcadia Biosciences, in collaboration with the University of California-Davis, is developing plants that produce vegetable oil in their leaves and stems. Ordinarily, these oils are produced in seeds, but Arcadia Biosciences is turning parts of the plant that are not usually harvested into a source of concentrated energy. Vegetable oil is a concentrated source of energy that plants naturally produce and is easily separated after harvest. Arcadia Biosciences will isolate traits that control oil production in seeds and transfer them into leaves and stems so that all parts of the plants are oil-rich at harvest time. After demonstrating these traits in a fast-growing model plant, Arcadia Biosciences will incorporate them into a variety of dedicated biofuel crops that can be grown on land not typically suited for food production

  16. Enhanced Carbon Concentration in Camelina: Development of a Dedicated, High-value Biofuels Crop

    SciTech Connect (OSTI)

    2012-01-01

    PETRO Project: UMass is developing an enhanced, biofuels-producing variant of Camelina, a drought-resistant, cold-tolerant oilseed crop that can be grown in many places other plants cannot. The team is working to incorporate several genetic traits into Camelina that increases its natural ability to produce oils and add the production of energy-dense terpene molecules that can be easily converted into liquid fuels. UMass is also experimenting with translating a component common in algae to Camelina that should allow the plants to absorb higher levels of carbon dioxide (CO2), which aids in enhancing photosynthesis and fuel conversion. The process will first be demonstrated in tobacco before being applied in Camelina.

  17. Production and fuel characteristics of vegetable oil from oilseed crops in the Pacific Northwest

    SciTech Connect (OSTI)

    Auld, D.L.; Bettis, B.L.; Peterson, C.L.

    1982-01-01

    The purpose of this research was to evaluate the potential yield and fuel quality of various oilseed crops adapted to the Pacific Northwest as a source of liquid fuel for diesel engines. The seed yield and oil production of three cultivars of winter rape (Brassica napus L.), two cultivars of safflower (Carthamus tinctorius L.) and two cultivars of sunflower (Helianthus annuus L.) were evaluated in replicated plots at Moscow. Additional trials were conducted at several locations in Idaho, Oregon and Washington. Sunflower, oleic and linoleic safflower, and low and high erucic acid rapeseed were evaluated for fatty acid composition, energy content, viscosity and engine performance in short term tests. During 20 minute engine tests power output, fuel economy and thermal efficiency were compared to diesel fuel. Winter rape produced over twice as much farm extractable oil as either safflower or sunflower. The winter rape cultivars, Norde and Jet Neuf had oil yields which averaged 1740 and 1540 L/ha, respectively. Vegetable oils contained 94 to 95% of the KJ/L of diesel fuel, but were 11.1 to 17.6 times more viscous. Viscosity of the vegetable oils was closely related to fatty acid chain length and number of unsaturated bonds (R/sup 2/=.99). During short term engine tests all vegetable oils produced power outputs equivalent to diesel, and had thermal efficiencies 1.8 to 2.8% higher than diesel. Based on these results it appears that species and cultivars of oilseed crops to be utilized as a source of fuel should be selected on the basis of oil yield. 1 figure, 5 tables.

  18. Development of a Single-Pass Cut-and-Chip Harvest System for Short Rotation Woody Crops

    Broader source: Energy.gov [DOE]

    Breakout Session 1B—Integration of Supply Chains I: Breaking Down Barriers Development of a Single-Pass Cut-and-Chip Harvest System for Short Rotation Woody Crops Timothy Volk, Senior Research Associate, State University of New York—College of Environmental Science and Forestry

  19. Vulnerability of crops and native grasses to summer drying in the U.S. Southern Great Plains

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Raz-Yaseef, Naama; Billesbach, Dave P.; Fischer, Marc L.; Biraud, Sebastien C.; Gunter, Stacey A.; Bradford, James A.; Torn, Margaret S.

    2015-08-31

    The Southern Great Plains are characterized by a fine-scale mixture of different land-cover types, predominantly winter-wheat and grazed pasture, with relatively small areas of other crops, native prairie, and switchgrass. Recent droughts and predictions of increased drought in the Southern Great Plains, especially during the summer months, raise concern for these ecosystems. We measured ecosystem carbon and water fluxes with eddy-covariance systems over cultivated cropland for 10 years, and over lightly grazed prairie and new switchgrass fields for 2 years each. Growing-season precipitation showed the strongest control over net carbon uptake for all ecosystems, but with a variable effect: grassesmore » (prairie and switchgrass) needed at least 350 mm of precipitation during the growing season to become net carbon sinks, while crops needed only 100 mm. In summer, high temperatures enhanced evaporation and led to higher likelihood of dry soil conditions. Therefore, summer-growing native prairie species and switchgrass experienced more seasonal droughts than spring-growing crops. For wheat, the net reduction in carbon uptake resulted mostly from a decrease in gross primary production rather than an increase in respiration. Flux measurements suggested that management practices for crops were effective in suppressing evapotranspiration and decomposition (by harvesting and removing secondary growth), and in increasing carbon uptake (by fertilizing and conserving summer soil water). In light of future projections for wetter springs and drier and warmer summers in the Southern Great Plains, our study indicates an increased vulnerability in native ecosystems and summer crops over time.« less

  20. Historical Perspective on How and Why Switchgrass was Selected as a "Model" High-Potential Energy Crop

    SciTech Connect (OSTI)

    Wright, Lynn L

    2007-11-01

    A review of several publications of the Biofuels Feedstock Development Program, and final reports from the herbaceous crop screening trials suggests that there were several technical and non-technical factors that influenced the decision to focus on one herbaceous "model" crop species. The screening trials funded by the U.S. Department of Energy in the late 1980's to early 1990's assessed a wide range of about 34 species with trials being conducted on a wide range of soil types in 31 different sites spread over seven states in crop producing regions of the U.S. While several species, including sorghums, reed canarygrass and other crops, were identified as having merit for further development, the majority of institutions involved in the herbaceous species screening studies identified switchgrass as having high priority for further development. Six of the seven institutions included switchgrass among the species recommended for further development in their region and all institutions recommended that perennial grasses be given high research priority. Reasons for the selection of switchgrass included the demonstration of relatively high, reliable productivity across a wide geographical range, suitability for marginal quality land, low water and nutrient requirements, and positive environmental attributes. Economic and environmental assessments by Oak Ridge National Laboratory's Biofuels Feedstock Development Program staff together with the screening project results, and funding limitations lead to making the decision to further develop only switchgrass as a "model" or "prototype" species in about 1990. This paper describes the conditions under which the herbaceous species were screened, summarizes results from those trials, discusses the various factors which influenced the selection of switchgrass, and provides a brief evaluation of switchgrass with respect to criteria that should be considered when selecting and developing a crop for biofuels and bioproducts.

  1. Making Energy Efficiency Part of Corporate Culture

    Broader source: Energy.gov (indexed) [DOE]

    Clemmer Ken Roden Nissan North America Making Energy Efficiency Part of Corporate Culture June 12, 2012 Nissan Motor Company, Ltd. 20 Production Sites 160 Countries (Sales) 160,000 Employees 2 Nissan U.S. Manufacturing Plants 3 Nissan Americas Region Headquarters Franklin, TN Americas HQs 4 Nissan Environmental Philosophy "For the future of our planet and generations to come, we are doing everything we can to help our natural environment, by reducing the environmental impact in real world

  2. Russian Culture | National Nuclear Security Administration

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Culture | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working at NNSA Blog Home

  3. Corporate Culture | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Corporate Culture | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Countering Nuclear Terrorism About Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Library Bios Congressional Testimony Fact Sheets Newsletters Press Releases Photo Gallery Jobs Apply for Our Jobs Our Jobs Working at NNSA

  4. OPSEC and Culture in Control Systems

    Energy Savers [EERE]

    Operational Security (OPSEC) to Support a Cyber Security Culture in Control Systems Environments Version 1.0 Draft Recommended Practice February 2007 DISCLAIMER This report was prepared as an account of work sponsored by an agency of the U.S. Government. Neither the U.S. Government nor any agency thereof, nor any employee, makes any warranty, expressed or implied, or assumes any legal liability or responsibility for any third party's use, or the results of such use, or any information,

  5. Welcome to the Cultural Resources Newsletter

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    September 2003 Volume 1, Number 1 In This Issue * Executive Order Update * DOE Participates in International Cold War "Memory" Conference * 2004 DOE Cultural Resources Forum * FPO Site Visits * Oak Ridge K-25 MOA * Oak Ridge Manhattan Project Strategic Plan * Johnson Delivers Paper in St. Petersburg, Russia Published by the Department of Energy History Division Editors: F.G. Gosling, Ph.D., Chief Historian Terrence R. Fehner, Ph.D., Senior Historian Technical Advisor: Travis Hulsey

  6. Integration of Safety Culture Attributes into EFCOG Work Planning...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    and WP&C Collaboration Example WP&C Culture Related CRADS PDF icon Integration of Safety Culture Attributes into EFCOG Work Planning and Control Guidance Document More Documents &...

  7. CULTURAL RESOURCES MANAGEMENT PLAN FOR THE NEVADA TEST SITE

    National Nuclear Security Administration (NNSA)

    17 2.7 Unexpected Discoveries of Cultural Materials . . . . . . . . . . . . . . . . . . . . . . . . . . . 18 3 CRM METHODS AND STANDARDS .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19 3.1 Personnel .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19 3.2 Cultural Resources Surveys . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19 3.3 Data Recovery .. . . . . . . .

  8. Safety Culture - Discussion framing - Dirk Dunning, Issue Manager

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    - Tank Waste Committee - September 23, 2015 Safety Culture - Discussion framing - Dirk Dunning, Issue Manager Safety Culture The Hanford Advisory Board has made several attempts at crafting and providing advice on the topic of Safety Culture. The resulting changes have not addressed the root issues and have been far less than desired. The purpose of this discussion is to start at the beginning of why "Safety Culture" as a phrase and topic exists, to develop a common understanding among

  9. Sponsoring, Mentoring and Guiding Cultural Diverse Young Scientists...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Sponsoring, Mentoring and Guiding Cultural Diverse Young Scientists and Engineers Presentation on successful mentoring. PDF icon Partnership meeting presentation 020711...

  10. Track 1: Safety Culture- Taking ISMS to the Next Level

    Broader source: Energy.gov [DOE]

    ISM Workshop Presentations Knoxville Convention Center, Knoxville, TN August 2009 Track 1: Safety Culture - Taking ISMS to the Next Level

  11. Training Framework to Improve the DOE Performance-Based Culture

    Broader source: Energy.gov [DOE]

    Guidance Memorandum for implementing the Secretaries initiative for improving the Performanced-Based Culture of the Department.

  12. Welcome to the Cultural Resources Newsletter | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Welcome to the Cultural Resources Newsletter Welcome to the Cultural Resources Newsletter PDF icon Welcome to the Cultural Resources Newsletter More Documents & Publications Secretary Directs FPO to Prepare Strategic Plan Strategic Plan Submitted to the Secretary Microsoft Word - August06.doc

  13. Safety Culture at the WTP White Paper: Potential Attachment for Advice on Waste Treatment Plant Safety Culture

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    29/2011 Page 1 of 6 Safety Culture at the WTP White Paper: Potential Attachment for Advice on Waste Treatment Plant Safety Culture Introduction This white paper provides context for the Hanford Advisory Board's (HAB) concerns regarding safety culture at the Waste Treatment Plant (WTP). This document is intended to clarify terminology associated with "safety culture" and to provide background about its conception, application, and development. The HAB has advised that a rigorous safety

  14. A photorespiratory bypass increases plant growth and seed yield in biofuel crop Camelina sativa

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Dalal, Jyoti; Lopez, Harry; Vasani, Naresh B.; Hu, Zhaohui; Swift, Jennifer E.; Yalamanchili, Roopa; Dvora, Mia; Lin, Xiuli; Xie, Deyu; Qu, Rongda; et al

    2015-10-29

    Camelina sativa is an oilseed crop with great potential for biofuel production on marginal land. The seed oil from camelina has been converted to jet fuel and improved fuel efficiency in commercial and military test flights. Hydrogenation-derived renewable diesel from camelina is environmentally superior to that from canola due to lower agricultural inputs, and the seed meal is FDA approved for animal consumption. However, relatively low yield makes its farming less profitable. Our study is aimed at increasing camelina seed yield by reducing carbon loss from photorespiration via a photorespiratory bypass. Genes encoding three enzymes of the Escherichia coli glycolatemore » catabolic pathway were introduced: glycolate dehydrogenase (GDH), glyoxylate carboxyligase (GCL) and tartronic semialdehyde reductase (TSR). These enzymes compete for the photorespiratory substrate, glycolate, convert it to glycerate within the chloroplasts, and reduce photorespiration. As a by-product of the reaction, CO2 is released in the chloroplast, which increases photosynthesis. Camelina plants were transformed with either partial bypass (GDH), or full bypass (GDH, GCL and TSR) genes. Furthermore, transgenic plants were evaluated for physiological and metabolic traits.« less

  15. The global gridded crop model intercomparison: Data and modeling protocols for Phase 1 (v1.0)

    SciTech Connect (OSTI)

    Elliott, J.; Müller, C.; Deryng, D.; Chryssanthacopoulos, J.; Boote, K. J.; Büchner, M.; Foster, I.; Glotter, M.; Heinke, J.; Iizumi, T.; Izaurralde, R. C.; Mueller, N. D.; Ray, D. K.; Rosenzweig, C.; Ruane, A. C.; Sheffield, J.

    2015-02-11

    We present protocols and input data for Phase 1 of the Global Gridded Crop Model Intercomparison, a project of the Agricultural Model Intercomparison and Improvement Project (AgMIP). The project consist of global simulations of yields, phenologies, and many land-surface fluxes using 12–15 modeling groups for many crops, climate forcing data sets, and scenarios over the historical period from 1948 to 2012. The primary outcomes of the project include (1) a detailed comparison of the major differences and similarities among global models commonly used for large-scale climate impact assessment, (2) an evaluation of model and ensemble hindcasting skill, (3) quantification of key uncertainties from climate input data, model choice, and other sources, and (4) a multi-model analysis of the agricultural impacts of large-scale climate extremes from the historical record.

  16. The global gridded crop model intercomparison: Data and modeling protocols for Phase 1 (v1.0)

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Elliott, J.; Müller, C.; Deryng, D.; Chryssanthacopoulos, J.; Boote, K. J.; Büchner, M.; Foster, I.; Glotter, M.; Heinke, J.; Iizumi, T.; et al

    2015-02-11

    We present protocols and input data for Phase 1 of the Global Gridded Crop Model Intercomparison, a project of the Agricultural Model Intercomparison and Improvement Project (AgMIP). The project consist of global simulations of yields, phenologies, and many land-surface fluxes using 12–15 modeling groups for many crops, climate forcing data sets, and scenarios over the historical period from 1948 to 2012. The primary outcomes of the project include (1) a detailed comparison of the major differences and similarities among global models commonly used for large-scale climate impact assessment, (2) an evaluation of model and ensemble hindcasting skill, (3) quantification ofmore » key uncertainties from climate input data, model choice, and other sources, and (4) a multi-model analysis of the agricultural impacts of large-scale climate extremes from the historical record.« less

  17. Development of a Single-Pass Cut-and-Chip Harvest System for Short Rotation Woody Crops

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Single-Pass Cut-and-Chip Harvest System for Short Rotation Woody Crops T.A. Volk, SUNY ESF, Syracuse, NY M. Eisenbies, L.P. Abrahamson, S. Karapetyan, A. Lewis, M. McArdle, J. Posselius, S. Shi, R. Shuren, B. Stanton, B. Summers, J. Zerpa  Funding support and project partners  Project objective  Background on single pass cut and chip system  Harvester effective material capacity (throughput)  Harvesting system efficiency  Harvesting cost improvements  Commercialization of

  18. Sun Grant/DOE Regional Biomass Feedstock Partnership:Herbaceous Energy Crops and CRP Land for Biomass Production

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Review Sun Grant/DOE Regional Biomass Feedstock Partnership: Herbaceous Energy Crops and CRP Land for Biomass Production (Award # GO85041; WBS 7.6.2.5) 23-27 March 2015 Technology Area Review: Feedstock Supply and Logistics Vance Owens, Director North Central Sun Grant Center South Dakota State University This presentation does not contain any proprietary, confidential, or otherwise restricted information Goal Statement  Development of more accurate cost supply information and improved

  19. The combined effects of elevated carbon dioxide and ozone on crop systems

    SciTech Connect (OSTI)

    Miller, J.E.; Heagle, A.S.; Shafer, S.R.; Heck, W.W.

    1994-12-31

    Concentrations of carbon dioxide (CO{sub 2}) and ozone (O{sub 3}) in the troposphere have risen in the last century due to industrialization. Current levels of tropospheric O{sub 3} suppress growth of crops and other plants, and O{sub 3} concentrations may continue to rise with changes in global climate. On the other hand, projected increases in atmospheric concentrations of CO{sub 2} in the next 50 to 100 years are expected to cause significant increases in growth of most species. Since elevated concentrations of these gases will co-occur, it is important to understand their joint action. Until recently, however, the combined effects of O{sub 3} and CO{sub 2} have received little attention. Most publications on combined CO{sub 2} and O{sub 3} effects have described experiments conducted in greenhouse or controlled-environment facilities. To date, data on responses of agricultural species to the combined gases have come from experiments with radish, tomato, white clover, tobacco, or wheat. In most cases, CO{sub 2} stimulated and O{sub 3} suppressed growth of the plant tissues studied, and CO{sub 2} usually attenuated development of O{sub 3}-induced visible injury. Some data have indicated a tendency for CO{sub 2}, in concentrations up to double the current ambient level, to attenuate effects of O{sub 3} on growth, but statistical analyses of such data often have not supported such a conclusion. In this paper, the results of a recent field experiment with soybean are reported, and the results are compared to other similar research with elevated atmospheric concentrations of both O{sub 3} and CO{sub 2}.

  20. Leucaena and tall grasses as energy crops in humid lower south USA

    SciTech Connect (OSTI)

    Prine, G.M.; Woodard, K.R.; Cunilio, T.V.

    1994-12-31

    The tropical leguminous shrub/tree, leucaena (Leucaena spp. mainly leucocephala), and perennial tropical tall grasses such as elephantgrass (Pennisetum purpureum), sugarcane, and energycane (Saccharum spp.) are well adapted to the long growing seasons and high rainfall of the humid lower South. In much of the area the topgrowth is killed by frost during winter and plants regenerate from underground parts in spring. Selected accessions from a duplicated 373 accession leucaena nursery had an average annual woody stem dry matter production of 31.4 Mg ha{sup -1}. Average oven dry stem wood yields from selected accessions adjusted for environmental enrichment over the 4 growth seasons were 78.9 Mg ha{sup -1} total and average annual yield of 19.7 Mg ha{sup -1}. The tall perennial grasses have linear growth rates of 18 to 27 g m{sup 2}d{sup -1} for long periods (140 to 196 d and sometimes longer) each season. Oven dry biomass yields of tall grasses have varied from 20 to 45 Mg ha{sup -1} in mild temperature locations to over 60 Mg ha{sup -1} yr{sup -1} in warm subtropics of the lower Florida peninsula. Tall grasses and leucaena, once established, may persist for many seasons. A map showing the possible range of the crops in lower South is shown. Highest biomass yields of tall grasses have been produced when irrigated with sewage effluent or when grown on phosphatic clay and muck soils of south Florida. Several companies are considering using leucaena and/or tall grasses for bioenergy in the phosphatic mining area of Polk County, Florida.

  1. Using The Corngrass1 Gene To Enhance The Biofuel Properties Of Crop Plants

    SciTech Connect (OSTI)

    Hake, Sarah; Chuck, George

    2015-10-29

    The development of novel plant germplasm is vital to addressing our increasing bioenergy demands. The major hurdle to digesting plant biomass is the complex structure of the cell walls, the substrate of fermentation. Plant cell walls are inaccessible matrices of macromolecules that are polymerized with lignin, making fermentation difficult. Overcoming this hurdle is a major goal toward developing usable bioenergy crop plants. Our project seeks to enhance the biofuel properties of perennial grass species using the Corngrass1 (Cg1) gene and its targets. Dominant maize Cg1 mutants produce increased biomass by continuously initiating extra axillary meristems and leaves. We cloned Cg1 and showed that its phenotype is caused by over expression of a unique miR156 microRNA gene that negatively regulates SPL transcription factors. We transferred the Cg1 phenotype to other plants by expressing the gene behind constitutive promoters in four different species, including the monocots, Brachypodium and switchgrass, and dicots, Arabidopsis and poplar. All transformants displayed a similar range of phenotypes, including increased biomass from extended leaf production, and increased vegetative branching. Field grown switchgrass transformants showed that overall lignin content was reduced, the ratio of glucans to xylans was increased, and surprisingly, that starch levels were greatly increased. The goals of this project are to control the tissue and temporal expression of Cg1 by using different promoters to drive its expression, elucidate the function of the SPL targets of Cg1 by generating gain and loss of function alleles, and isolate downstream targets of select SPL genes using deep sequencing and chromatin immunoprecipitation. We believe it is possible to control biomass accumulation, cell wall properties, and sugar levels through manipulation of either the Cg1 gene and/or its SPL targets.

  2. Northern New Mexican pueblo preserves cultural history through

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    collaborative tours with Los Alamos National Laboratory Pueblo preserves cultural history through collaborative tours Northern New Mexican pueblo preserves cultural history through collaborative tours with Los Alamos National Laboratory San Ildefonso Pueblo's Summer Education Enhancement Program brought together academic and cultural learning in the form of a recent tour of Cave Kiva Trail in Mortandad Canyon. August 24, 2015 Students from the San Ildefonso Pueblo Summer Education

  3. DOE - NNSA/NFO -- Photo Library Cultural Resources

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Cultural Resources NNSA/NFO Language Options U.S. DOE/NNSA - Nevada Field Office Photo Library - Cultural Resources Prehistoric cultural resources are abundant at the Nevada National Security Site, indicating Native Americans have occupied the region for more than 10,000 years. Historic artifacts of more recent origin are also present, reflecting use by miners, ranchers and settlers who traveled through the area. Instructions: Click the photograph THUMBNAIL to view the photograph details Click

  4. Pueblo De San Ildefonso Department of Environmental and Cultural

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Preservation Program Overview 2015 | Department of Energy Pueblo De San Ildefonso Department of Environmental and Cultural Preservation Program Overview 2015 Pueblo De San Ildefonso Department of Environmental and Cultural Preservation Program Overview 2015 Topic: Director Raymond Martinez, and Governor Mountain, provided the membership with an update on the Pueblo de San Ildefonso's perspectives on: environmental clean up and cultural preservation. PDF icon San I Update - September 30, 2015

  5. Making Energy Efficiency Part of Corporate Culture | Department of Energy

    Energy Savers [EERE]

    Making Energy Efficiency Part of Corporate Culture Making Energy Efficiency Part of Corporate Culture This presentation discusses how Nissan Motor Company incorporated energy efficiency into its corporate environment through executive management support and cross-functional corporate teams. PDF icon Making Energy Efficiency Part of Corporate Culture (June 12, 2012) More Documents & Publications Energy Management and Financing Nissan Case Study for Superior Energy Performance Nissan Showcases

  6. Integration of Safety Culture Attributes into EFCOG Work Planning and

    Office of Environmental Management (EM)

    Control Guidance Document | Department of Energy Integration of Safety Culture Attributes into EFCOG Work Planning and Control Guidance Document Integration of Safety Culture Attributes into EFCOG Work Planning and Control Guidance Document May 15, 2013 Presenters: Steele Coddington, NSTec, Las Vegas, and John McDonald, WRPS, Hanford Topics Covered: Integration of Safety Culture (SC) Attributes into EFCOG Work Planning and Control Guidance Document Linking SC to WP&C CRADS EFCOG and DOE

  7. Pueblo De San Ildefonso Department of Environmental and Cultural...

    Energy Savers [EERE]

    Environmental and Cultural Preservation Program Overview 2015 Topic: Director Raymond Martinez, and Governor Mountain, provided the membership with an update on the Pueblo de San...

  8. Essential Innovations Ekistics Town Planning Jiangsu Sifang Culture...

    Open Energy Info (EERE)

    Geothermal energy Product: Announced in October 2006, this is a JV between Essential Innovation of Canada, Ekistics Town Planning also of Canada, and Jiangsu Sifang Culture...

  9. Sponsoring, Mentoring and Guiding Cultural Diverse Young Scientists and

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Engineers | Argonne National Laboratory Sponsoring, Mentoring and Guiding Cultural Diverse Young Scientists and Engineers Presentation on successful mentoring. PDF icon Partnership meeting presentation 020711

  10. Independent Oversight Assessment of the Nuclear Safety Culture...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    ... culture become the accepted way of doing business. ... psychology, organizational development, human factorshuman performance, ... the membership of small teams (with target ...

  11. Key Practical Issues in Strengthening Safety Culture, INSAG-15

    Broader source: Energy.gov [DOE]

    Key Pratical Issues in Strengthening Safety Culture, INSAG-15. A report by the International Nuclear Safety Advisory Gorup, International Atomic Energy Agency, Vienna, 2002.

  12. Hanford Site, Tribes Raise Awareness of Culturally Significant...

    Energy Savers [EERE]

    sunny day, Conrad, Mendez, and Longenecker walked through the site. There's only one small path in and out to protect the simulated cultural sites and data collection efforts...

  13. CSB Investigations and Safety Culture | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    from occurring again. Analysis of Safety Systems CSB Investigations and Safety Culture More Documents & Publications Nuclear Safety Workshop Summary Operating Experience...

  14. Wyoming Department of State Parks and Cultural Resources and...

    Open Energy Info (EERE)

    and Historic Sites - Rules and Regulations, Chapter 1Legal Abstract This chapter sets forth the rules and regulations of the Wyoming Department of State Parks and Cultural...

  15. BLM Manual 8120 - Tribal Consultation Under Cultural Resources...

    Open Energy Info (EERE)

    search OpenEI Reference LibraryAdd to library PermittingRegulatory Guidance - GuideHandbook: BLM Manual 8120 - Tribal Consultation Under Cultural ResourcesPermitting...

  16. BLM Manual 8110 - Identifying and Evaluating Cultural Resources...

    Open Energy Info (EERE)

    search OpenEI Reference LibraryAdd to library PermittingRegulatory Guidance - GuideHandbook: BLM Manual 8110 - Identifying and Evaluating Cultural ResourcesPermitting...

  17. A GIS approach to cultural resources management and NEPA compliance

    SciTech Connect (OSTI)

    Moeller, K.

    1996-06-01

    Cultural resources management and historic preservation compliance are best approached within the broader framework of natural resources planning and land management. Argonne National Laboratory is currently assisting federal agencies with the development of computer- based resource management systems for large facilities, and cultural resources management and preservation are components of these systems. In the area of cultural resources, Argonne is using the GIS tool to demonstrate how federal facilities can manage large, complex databases, integrate cultural resource data with other environmental variables, model distributions of resources to aid in inventory and evaluation, link the data to quantitative and impact modes, and effectively manage and monitor resource planning activities and environmental compliance.

  18. Preservation technologies; tools for enhanced cultural resource management

    SciTech Connect (OSTI)

    Culbertson, J.D.

    1995-12-01

    Legislation enacted since the mid sixties has defined requirements for cultural resource management. This is an important area of environmental management that has received only limited attention. Cultural resources are integral to environmental systems; they need to be considered in any resource management activities. They also provide important information about long term changes in environmental systems and the effects of human activity.

  19. Historical Perspective on How and Why Switchgrass was Seleced as a "Model" High-Potential Energy Crop

    SciTech Connect (OSTI)

    Wright, Lynn

    2007-07-01

    Economic and environmental assessments by Oak Ridge National Laboratorys Biofuels Feedstock Development Program staff together with the screening project results, and funding limitations lead to making the decision to further develop only switchgrass as a model or prototype species in about 1990. This paper describes the conditions under which the herbaceous species were screened, summarizes results from those trials, discusses the various factors which influenced the selection of switchgrass, and provides a brief evaluation of switchgrass with respect to criteria that should be considered when selecting and developing a crop for biofuels and bioproducts.

  20. Texas Panhandle soil-crop-beef food chain for uranium: a dynamic model validated by experimental data

    SciTech Connect (OSTI)

    Wenzel, W.J.; Wallwork-Barber, K.M.; Rodgers, J.C.; Gallegos, A.F.

    1982-01-01

    Long-term simulations of uranium transport in the soil-crop-beef food chain were performed using the BIOTRAN model. Experimental data means from an extensive Pantex beef cattle study are presented. Experimental data were used to validate the computer model. Measurements of uranium in air, soil, water, range grasses, feed, and cattle tissues are compared to simulated uranium output values in these matrices when the BIOTRAN model was set at the measured soil and air values. The simulations agreed well with experimental data even though metabolic details for ruminants and uranium chemical form in the environment remain to be studied.

  1. Idaho National Laboratory Cultural Resource Monitoring Report for FY 2009

    SciTech Connect (OSTI)

    Brenda R. Pace; Julie B. Braun

    2009-10-01

    This report describes the cultural resource monitoring activities of the Idaho National Laboratorys (INL) Cultural Resource Management (CRM) Office during fiscal year 2009 (FY 2009). Throughout the year, thirty-eight cultural resource localities were revisited including: two locations with Native American human remains, one of which is a cave, two additional caves, twenty-two prehistoric archaeological sites, six historic homesteads, two historic stage stations, two historic trails, and two nuclear resources, including Experimental Breeder Reactor-I, which is a designated National Historic Landmark. Several INL project areas were also monitored in FY 2009 to assess project compliance with cultural resource recommendations and monitor the effects of ongoing project activities. Although impacts were documented at a few locations and trespassing citations were issued in one instance, no significant adverse effects that would threaten the National Register eligibility of any resources were observed. Monitoring also demonstrated that several INL projects generally remain in compliance with recommendations to protect cultural resources.

  2. Idaho National Laboratory Cultural Resource Monitoring Report for FY 2008

    SciTech Connect (OSTI)

    Brenda R. Pace

    2009-01-01

    This report describes the cultural resource monitoring activities of the Idaho National Laboratorys (INL) Cultural Resource Management (CRM) Office during fiscal year 2008 (FY 2008). Throughout the year, 45 cultural resource localities were revisited including: two locations of heightened Shoshone-Bannock tribal sensitivity, four caves, one butte, twenty-eight prehistoric archaeological sites, three historic homesteads, two historic stage stations, one historic canal construction camp, three historic trails, and Experimental Breeder Reactor-I, which is a designated National Historic Landmark. Several INL project areas were also monitored in FY 2008 to assess project compliance with cultural resource recommendations, confirm the locations of previously recorded cultural resources in relation to project activities, to assess the damage caused by fire-fighting efforts, and to watch for cultural materials during ground disturbing activities. Although impacts were documented at a few locations, no significant adverse effects that would threaten the National Register eligibility of any resource were observed. Monitoring also demonstrated that INL projects generally remain in compliance with recommendations to protect cultural resources

  3. Idaho National Laboratory Cultural Resource Monitoring Report for 2013

    SciTech Connect (OSTI)

    Julie B. Williams; Brenda Pace

    2013-10-01

    This report describes the cultural resource monitoring activities of the Idaho National Laboratorys (INL) Cultural Resource Management (CRM) Office during 2013. Throughout the year, thirty-eight cultural resource localities were revisited including: two locations with Native American human remains, one of which is also a cave; fourteen additional caves; seven prehistoric archaeological sites ; four historic archaeological sites; one historic trail; one nuclear resource (Experimental Breeder Reactor-I, a designated National Historic Landmark); and nine historic structures located at the Central Facilities Area. Of the monitored resources, thirty-three were routinely monitored, and five were monitored to assess project compliance with cultural resource recommendations along with the effects of ongoing project activities. On six occasions, ground disturbing activities within the boundaries of the Power Burst Facility/Critical Infrastructure Test Range Complex (PBF/CITRC) were observed by INL CRM staff prepared to respond to any additional finds of Native American human remains. In addition, two resources were visited more than once as part of the routine monitoring schedule or to monitor for additional damage. Throughout the year, most of the cultural resources monitored had no visual adverse changes resulting in Type 1determinations. However, Type 2 impacts were noted at eight sites, indicating that although impacts were noted or that a project was operating outside of culturally cleared limitations, cultural resources retained integrity and noted impacts did not threaten National Register eligibility. No new Type 3 or any Type 4 impacts that adversely impacted cultural resources and threatened National Register eligibility were observed at cultural resources monitored in 2013.

  4. Minnesota Agri-Power Project. Quarterly report, January--March, 1998

    SciTech Connect (OSTI)

    Wilbur, D.

    1998-05-01

    The Minnesota Valley Alfalfa Producers propose to build an alfalfa processing plant integrated with an advanced power plant system at the Granite Falls, Minnesota industrial park to provide 75 MW of base load electric power and a competitively priced source of value added alfalfa based products. This project utilizes air blown fluidized bed gasification technology to process alfalfa stems and another biomass to produce a hot, clean, low heating value gas that will be used in a gas turbine. Exhaust heat from the gas turbine will be used to generate steam to power a steam turbine and provide steam for the processing of the alfalfa leaf into a wide range of products including alfalfa leaf meal, a protein source for livestock. This progress report describes feedstock testing, feedstock supply system, performance guarantees, sales contracts, environmental permits, education, environment, economy, and project coordination and control.

  5. Idaho National Laboratory Cultural Resource Monitoring Report for FY 2010

    SciTech Connect (OSTI)

    INL Cultural Resource Management Office

    2010-10-01

    This report describes the cultural resource monitoring activities of the Idaho National Laboratorys (INL) Cultural Resource Management (CRM) Office during fiscal year 2010 (FY 2010). Throughout the year, thirty-three cultural resource localities were revisited, including somethat were visited more than once, including: two locations with Native American human remains, one of which is a cave, two additional caves, twenty-six prehistoric archaeological sites, two historic stage stations, and Experimental Breeder Reactor-I, which is a designated National Historic Landmark. The resources that were monitored included seventeen that are routinely visited and sixteen that are located in INL project areas. Although impacts were documented at a few locations and one trespassing incident (albeit sans formal charges) was discovered, no significant adverse effects that would threaten the National Register eligibility of any resources were observed. Monitoring also demonstrated that several INL projects generally remain in compliance with recommendations to protect cultural resources.

  6. Best Practices Workshop for Safety Culture | Y-12 National Security...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    from 20 organizations recently met at Y-12 to share safety culture best practices and lessons learned. The two-day workshop featured more than two dozen presentations on...

  7. Operational Pause at Savannah River Site Benefits Safety Culture, Operations

    Broader source: Energy.gov [DOE]

    AIKEN, S.C. – EM and the Savannah River Site (SRS) management and operations contractor are seeing positive impacts on safety culture as the site works to restore operations following last year’s operational pause.

  8. Annual training event instrumental in region's safety culture |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Department of Energy Annual training event instrumental in region's safety culture Annual training event instrumental in region's safety culture September 8, 2014 - 10:00am Addthis Participants receive hands-on demonstrations for protective equipment. This year’s event offers 45 safety courses and seminars. Participants receive hands-on demonstrations for protective equipment. This year's event offers 45 safety courses and seminars. Oak Ridge, TN - This week, the Oak Ridge Office of

  9. BISfuel Collaborative Culture | Center for Bio-Inspired Solar Fuel

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Production BISfuel Collaborative Culture 3 Nov 2013 Dalvin Mendez is the fifth year graduate student in the lab of Professor Ana Moore. He is involved in research projects on synthesis of artificial dyes capable of providing driving force for water oxidation or proton reduction catalysis and testing the efficiencies of the fuel cells. "The culture of the BISfuel Center is very collaborative. EFRC provided two things that I came to ASU for: the energy related research and the program

  10. Indoctrinating Subcontractors into the DOE Safety Culture and Expectations

    Office of Environmental Management (EM)

    | Department of Energy Indoctrinating Subcontractors into the DOE Safety Culture and Expectations Indoctrinating Subcontractors into the DOE Safety Culture and Expectations August 2009 Presenter: Daryl Schilperoort, Washington Closure Hanford Track: 1-1 Topic Covered: Why Indoctrinate Subcontractors? WCH is limited to doing no more than 40% self performance of RCCC value (large business limitation). Many of WCH subcontracts target small businesses with limited experience in the DOE safety

  11. EM Supports Program that Fosters Region's Safety Culture | Department of

    Office of Environmental Management (EM)

    Energy Supports Program that Fosters Region's Safety Culture EM Supports Program that Fosters Region's Safety Culture September 10, 2013 - 12:00pm Addthis Participants in Safety Fest Tennessee receive a hands-on demonstration about electrical safety. Participants in Safety Fest Tennessee receive a hands-on demonstration about electrical safety. This year’s event offers 40 safety courses. Participants discuss relevant safety issues and best practices. This year's event offers 40 safety

  12. Idaho National Laboratory Cultural Resource Management Annual Report FY 2006

    SciTech Connect (OSTI)

    Clayton F. Marler; Julie Braun; Hollie Gilbert; Dino Lowrey; Brenda Ringe Pace

    2007-04-01

    The Idaho National Laboratory Site is home to vast numbers and a wide variety of important cultural resources representing at least a 13,500-year span of human occupation in the region. As a federal agency, the Department of Energy Idaho Operations Office has legal responsibility for the management and protection of those resources and has delegated these responsibilities to its primary contractor, Battelle Energy Alliance (BEA). The INL Cultural Resource Management Office, staffed by BEA professionals, is committed to maintaining a cultural resource management program that accepts these challenges in a manner reflecting the resources importance in local, regional, and national history. This annual report summarizes activities performed by the INL Cultural Resource Management Office staff during Fiscal Year 2006. This work is diverse, far-reaching and though generally confined to INL cultural resource compliance, also includes a myriad of professional and voluntary community activities. This document is intended to be both informative to internal and external stakeholders, and to serve as a planning tool for future cultural resource management work to be conducted on the INL.

  13. Review of Nuclear Safety Culture at the Hanford Site Waste Treatment...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Review of Nuclear Safety Culture at the Hanford Site Waste Treatment and Immobilization Plant Project, October 2010 Review of Nuclear Safety Culture at the Hanford Site Waste ...

  14. UTEX The Culture Collection of Algae at The University of Texas...

    Open Energy Info (EERE)

    UTEX The Culture Collection of Algae at The University of Texas at Austin Jump to: navigation, search Name: University of Texas at Austin The Culture Collection of Algae...

  15. Herbaceous crops for energy in Italy: Present status of the research program promoted by ENEL (Italian Electric Company)

    SciTech Connect (OSTI)

    Schenone, G.

    1996-12-31

    The paper presents a synthesis of the main results of the research program promoted by ENEL (Italian Electric Company) on herbaceous energy crops. The objective of the program is to evaluate the potentials of different species and cultivars for biomass fuel production in Italy. For the most promising species, all the links of the chain from cultivation to delivery at the plant gate at the lowest possible cost have to be organized. So far the following species gave annual productivities above 20 dry tons/ha: fiber sorghum (Sorghum sp.); miscanthus (Miscanthus sinensis); and giant reed (Arundo donax). The highest biomass yields, well above 40 dry tons/ha in several trials, were given by giant reed.

  16. Idaho National Laboratory Cultural Resource Management Annual Report FY 2007

    SciTech Connect (OSTI)

    Julie Braun; Hollie Gilbert; Dino Lowrey; Clayton Marler; Brenda Pace

    2008-03-01

    The Idaho National Laboratory (INL) Site is home to vast numbers and a wide variety of important cultural resources representing at least a 13,500-year span of human land use in the region. As a federal agency, the Department of Energy Idaho Operations Office has legal responsibility for the management and protection of those resources and has delegated these responsibilities to its primary contractor, Battelle Energy Alliance (BEA). The BEA professional staff is committed to maintaining a cultural resource management program that accepts these challenges in a manner reflecting the resources importance in local, regional, and national history. This annual report summarizes activities performed by the INL Cultural Resource Management Office (CRMO) staff during fiscal year 2007. This work is diverse, far-reaching and though generally confined to INL cultural resource compliance, also includes a myriad of professional and voluntary community activities. This document is intended to be both informative to internal and external stakeholders, and to serve as a planning tool for future cultural resource management work to be conducted on the INL.

  17. Identifying Differences in Cultural Behavior in Online Groups

    SciTech Connect (OSTI)

    Gregory, Michelle L.; Engel, David W.; Bell, Eric B.; Mcgrath, Liam R.

    2012-07-23

    We have developed methods to identify online communities, or groups, using a combination of structural information variables and content information variables from weblog posts and their comments to build a characteristic footprint for groups. We have worked with both explicitly connected groups and 'abstract' groups, in which the connection between individuals is in interest (as determined by content based features) and behavior (metadata based features) as opposed to explicit links. We find that these variables do a good job at identifying groups, placing members within a group, and helping determine the appropriate granularity for group boundaries. The group footprint can then be used to identify differences between the online groups. In the work described here we are interested in determining how an individual's online behavior is influenced by their membership in more than one group. For example, individuals belong to a certain culture; they may belong as well to a demographic group, and other 'chosen' groups such as churches or clubs. There is a plethora of evidence surrounding the culturally sensitive adoption, use, and behavior on the Internet. In this work we begin to investigate how culturally defined internet behaviors may influence behaviors of subgroups. We do this through a series of experiments in which we analyze the interaction between culturally defined behaviors and the behaviors of the subgroups. Our goal is to (a) identify if our features can capture cultural distinctions in internet use, and (b) determine what kinds of interaction there are between levels and types of groups.

  18. Hanford Cultural Resources Laboratory annual report for fiscal year 1994

    SciTech Connect (OSTI)

    Nickens, P.R.; Wright, M.K.; Cadoret, N.A.; Dawson, M.V.; Harvey, D.W.; Simpson, E.M.

    1995-09-01

    The Hanford Site occupies 560 sq. miles of land along the Columbia River in SE Washington. The Hanford Reach of the river is one of the most archaeologically rich areas in the western Columbia Plateau. To manage the Hanford Site`s archaeological, historical, and cultural resources, the Hanford Cultural Resources Laboratory (HCRL) was established in 1987. HCRL ensures DOE complies with federal statutes, regulations, and guidelines. In FY 1994, HCRL conducted cultural resource reviews, conducted programs to identify and monitor historic and archaeological sites, etc. HCRL staff conducted 511 reviews, 29 of which required archaeological surveys and 10 of which required building documentation. Six prehistoric sites, 23 historic sites, one paleontological site, and two sites with historic and prehistoric components were discovered.

  19. INTEGRATED SAFETY MANAGEMENT SYSTEM SAFETY CULTURE IMPROVEMENT INITIATIVE

    SciTech Connect (OSTI)

    MCDONALD JA JR

    2009-01-16

    In 2007, the Department of Energy (DOE) identified safety culture as one of their top Integrated Safety Management System (ISMS) related priorities. A team was formed to address this issue. The team identified a consensus set of safety culture principles, along with implementation practices that could be used by DOE, NNSA, and their contractors. Documented improvement tools were identified and communicated to contractors participating in a year long pilot project. After a year, lessons learned will be collected and a path forward determined. The goal of this effort was to achieve improved safety and mission performance through ISMS continuous improvement. The focus of ISMS improvement was safety culture improvement building on operating experience from similar industries such as the domestic and international commercial nuclear and chemical industry.

  20. INEEL Cultural Resource Management Program Annual Report - 2004

    SciTech Connect (OSTI)

    Clayton F. Marler

    2005-01-01

    As a federal agency, the U.S. Department of Energy has been directed by Congress, the U.S. president, and the American public to provide leadership in the preservation of prehistoric, historic, and other cultural resources on the lands it administers. This mandate to preserve cultural resources in a spirit of stewardship for the future is outlined in various federal preservation laws, regulations, and guidelines such as the National Historic Preservation Act, the Archaeological Resources Protection Act, and the National Environmental Policy Act. The Idaho National Engineering and Environmental Laboratory Site is located in southeastern Idaho, and is home to vast numbers and a wide variety of important cultural resources representing at least 13,000-year span of human occupation in the region. These resources are nonrenewable, bear valuable physical and intangible legacies, and yield important information about the past, present, and perhaps the future. There are special challenges associated with balancing the preservation of these resources with the management and ongoing operation of an active scientific laboratory, while also cleaning up the waste left by past programs and processes. The Department of Energy Idaho Operations Office has administrative responsibility for most of the Site, excluding lands and resources managed by the Naval Reactors Facility and (in 2004) Argonne National Laboratory-West. The Department of Energy is committed to a cultural resource program that accepts these challenges in a manner reflecting both the spirit and intent of the legislative requirements. This annual report is an overview of Cultural Resource Management Program activities conducted during Fiscal Year 2004 and is intended to be both informative to external stakeholders and to serve as a planning tool for future cultural resource management work to be conducted on the Site.

  1. Fluorescent tracking of nickel ions in human cultured cells (Journal

    Office of Scientific and Technical Information (OSTI)

    Article) | SciTech Connect Fluorescent tracking of nickel ions in human cultured cells Citation Details In-Document Search Title: Fluorescent tracking of nickel ions in human cultured cells The carcinogenic activity of various nickel (Ni) compounds is likely dependent upon their ability to enter cells and elevate intracellular levels of Ni ions. Water-insoluble Ni compounds such as NiS and Ni{sub 3}S{sub 2} were shown in vitro to enter cells by phagocytosis and potently induce tumors in

  2. Cultural Artifacts Cross Eras at the NNSS | Department of Energy

    Office of Environmental Management (EM)

    Cultural Artifacts Cross Eras at the NNSS Cultural Artifacts Cross Eras at the NNSS May 29, 2014 - 12:00pm Addthis This petroglyph is among the many prehistoric artifacts at the NNSS. This petroglyph is among the many prehistoric artifacts at the NNSS. Bower Cabin, on the NNSS, is a dwelling associated with mining dating to the early part of the 20th century. During the 1920s, writer B.M. Bower wrote 11 of her many popular novels while living in this cabin with her family. She was posthumously

  3. Guidelines for Evaluating and Documenting Traditional Cultural Properties (NPS, 1998)

    Broader source: Energy.gov [DOE]

    This National Park Service bulletin is meant to assist federal agencies, State Historic Preservation Officers, local governments, Indian tribes, and other historic preservation practitioners in determining whether properties thought to have traditional cultural significance are eligible for inclusion in the National Register of Historic Places.

  4. Guidelines for Evaluating and Documenting Traditional Cultural Properties

    Broader source: Energy.gov [DOE]

    This National Park Service bulletin is meant to assist federal agencies, State Historic Preservation Officers, local governments, Indian tribes, and other historic preservation practitioners in determining whether properties thought to have traditional cultural significance are eligible for inclusion in the National Register of Historic Places.

  5. CULTURAL RESOURCE MANAGEMENT PLAN FOR BROOKHAVEN NATIONAL LABORATORY.

    SciTech Connect (OSTI)

    DAVIS, M.

    2005-04-01

    The Cultural Resource Management Plan (CRMP) for Brookhaven National Laboratory (BNL) provides an organized guide that describes or references all facets and interrelationships of cultural resources at BNL. This document specifically follows, where applicable, the format of the U.S. Department of Energy (DOE) Environmental Guidelines for Development of Cultural Resource Management Plans, DOE G 450.1-3 (9-22-04[m1]). Management strategies included within this CRMP are designed to adequately identify the cultural resources that BNL and DOE consider significant and to acknowledge associated management actions. A principal objective of the CRMP is to reduce the need for additional regulatory documents and to serve as the basis for a formal agreement between the DOE and the New York State Historic Preservation Officer (NYSHPO). The BNL CRMP is designed to be a ''living document.'' Each section includes identified gaps in the management plan, with proposed goals and actions for addressing each gap. The plan will be periodically revised to incorporate new documentation.

  6. Method and system of culturing an algal mat

    DOE Patents [OSTI]

    Das, Keshav C; Cannon, Benjamin R; Bhatnagar, Ashish; Chinnasamy, Senthil

    2014-05-13

    A system and method for culturing algae are presented. The system and method utilize a fog of growth medium that is delivered to an algal mat generator along with a stream of CO.sub.2 to promote growth of algal cells contained in the generator.

  7. A photorespiratory bypass increases plant growth and seed yield in biofuel crop Camelina sativa

    SciTech Connect (OSTI)

    Dalal, Jyoti; Lopez, Harry; Vasani, Naresh B.; Hu, Zhaohui; Swift, Jennifer E.; Yalamanchili, Roopa; Dvora, Mia; Lin, Xiuli; Xie, Deyu; Qu, Rongda; Sederoff, Heike W.

    2015-10-29

    Camelina sativa is an oilseed crop with great potential for biofuel production on marginal land. The seed oil from camelina has been converted to jet fuel and improved fuel efficiency in commercial and military test flights. Hydrogenation-derived renewable diesel from camelina is environmentally superior to that from canola due to lower agricultural inputs, and the seed meal is FDA approved for animal consumption. However, relatively low yield makes its farming less profitable. Our study is aimed at increasing camelina seed yield by reducing carbon loss from photorespiration via a photorespiratory bypass. Genes encoding three enzymes of the Escherichia coli glycolate catabolic pathway were introduced: glycolate dehydrogenase (GDH), glyoxylate carboxyligase (GCL) and tartronic semialdehyde reductase (TSR). These enzymes compete for the photorespiratory substrate, glycolate, convert it to glycerate within the chloroplasts, and reduce photorespiration. As a by-product of the reaction, CO2 is released in the chloroplast, which increases photosynthesis. Camelina plants were transformed with either partial bypass (GDH), or full bypass (GDH, GCL and TSR) genes. Furthermore, transgenic plants were evaluated for physiological and metabolic traits.

  8. Co-cultured Synechococcus and Shewanella Produce Hydrocarbons without

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Cellulosic Feedstock - Energy Innovation Portal Co-cultured Synechococcus and Shewanella Produce Hydrocarbons without Cellulosic Feedstock DOE Grant Recipients University of Minnesota Contact University of Minnesota About This Technology <span id="Caption"><span id="ctl00_MainContentHolder_zoomimage_defaultCaption">Shewanella Oneidensis naturally produces hydrocarbons without cellulosic feedstock.</span></span> Shewanella Oneidensis naturally

  9. Cultural analysis: The missing factor in root-cause evaluation

    SciTech Connect (OSTI)

    Lamb, H.

    1989-01-01

    The purpose of this paper is to provide a model that can focus attention on appropriate cultural targets of inquiry, provide a completion criterion for root-cause completeness, and illustrate results. The illustration provided is as follows: Discover the root causes(s) related to issues of a nuclear reactor operator sleeping, inattention to duties, failure to adhere to procedures, and management inaction or adequate action.

  10. Establishing and Promoting a Culture of Safety in Chemistry Laboratory Research

    SciTech Connect (OSTI)

    Fryberger, Teresa

    2014-12-23

    Final technical/scientific report for the project, Establishing and Promoting a Culture of Safety in Chemistry Laboratory Research.

  11. Best Practices Workshop for Safety Culture | Y-12 National Security Complex

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Best Practices Workshop for ... Best Practices Workshop for Safety Culture Posted: November 15, 2014 - 11:35am CNS President Jim Haynes, NNSA Production Office Manager Steve Erhart, DOE Organizational Culture Program Advisor Rizwan Shah and CNS Safety Culture Program Manager Paul Wasilko welcome participants to the best practices workshop held at the Y-12 National Security Complex. More than 65 contractor and federal employees from 20 organizations recently met at Y-12 to share safety culture

  12. Microsoft PowerPoint - January Safety Culture.pptx [Read-Only]

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Culture Presentation to Hanford Advisory Board Steve Pfaff February 9, 2012 Safety Culture * Safety culture is an organization's values and behaviors modeled by its leaders and internalized by its members, which serve to make safe performance of work the to make safe performance of work the overriding priority to protect the workers, public, and the environment. (DOE ISMS Guide, DOE G 450.4-1C) ORP is Not Alone! Safety is Everyone's responsibility * Who helps us in our safety culture efforts? -

  13. Microsoft Word - 2015 12 7 Organizational Safety Culture - HAB Advice first draft Rev 1.....docx

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    COMMITTEE DISCUSSION Hanford Advisory Board Advice: Testing Safety Culture in Practice Lead Issue Managers: Dirk Dunning and Liz Mattson Background The Hanford Advisory Board (HAB, Board) has been focused on reviewing, discussing, and issuing advice on safety culture since the Defense Nuclear Facilities Safety Board issued its Recommendation 2011-1: Safety Culture at the Waste Treatment and Immobilization Plant in June 2011. Safety culture terminology has created confusion in our discussions, as

  14. DOE Policy 141.1: Management of Cultural Resources | Department of Energy

    Office of Environmental Management (EM)

    Policy 141.1: Management of Cultural Resources DOE Policy 141.1: Management of Cultural Resources The purpose of DOE Policy 141.1 is to ensure that Department of Energy (DOE) programs and field elements integrate cultural resources management into their missions and activities and to raise the level of awareness and accountability among DOE contractors concerning the importance of the Department's cultural resource-related legal and trust responsibilities. Download Document PDF icon DOE

  15. INL Cultural Resource Monitoring Report for FY 2015

    SciTech Connect (OSTI)

    Pace, Brenda Ringe; Olson, Christina Liegh; Gilbert, Hollie Kae; Holmer, Marie Pilkington

    2015-10-01

    This report describes the cultural resource monitoring activities of the Idaho National Laboratorys (INL) Cultural Resource Management (CRM) Office during fiscal year (FY) 2015. Throughout the year, 67 total monitoring visits were completed, with several especially sensitive resources visited on more than one occasion. Overall, FY 2015 monitoring included surveillance of the following 49 individual cultural resource localities: three locations with human remains, one of which is also a cave; nine additional caves; twenty prehistoric archaeological sites; five historic archaeological sites; two historic trails; Experimental Breeder Reactor I (EBR-I), a National Historic Landmark; Aircraft Nuclear Propulsion (ANP) objects located at EBR-I; and eight Arco Naval Proving Ground (NPG) property types. Several INL work processes and projects were also monitored to confirm compliance with original INL CRM recommendations and assess the effects of ongoing work. On two occasions, ground disturbing activities within the boundaries of the Power Burst Facility/Critical Infrastructure Test Range Complex (PBF/CITRC) were observed by INL CRM staff prepared to respond to any additional finds of Native American human remains. Finally, the current location housing INL Archives and Special Collections was evaluated once. Most of the cultural resources monitored in FY 2015 exhibited no adverse impacts, resulting in Type 1 impact assessments. However, Type 2 impacts were noted 13 times. In one case, a portion of a historic trail was graded without prior review or coordination with the INL CRM Office, resulting in impacts to the surface of the trail and one archaeological site. Evidence of unauthorized artifact collection/ looting was also documented at three archaeological sites located along INL powerlines. Federal agents concluded a FY 2012 investigation by filing civil charges and levying fine under the Archaeological Resource Protection Act against one INL employee for this kind of illegal removal of artifacts from INL lands. Goodales Cutoff of the Oregon Trail showed evidence of heavy use associated with grazing. A number of previously reported Type 2 impacts were also once again documented at the EBR-I National Historic Landmark, including spalling and deterioration of bricks due to inadequate drainage, minimal maintenance, and rodent infestation. The ANP engines and locomotive on display at the EBR-I Visitors Center also exhibited impacts related to long term exposure. Finally, most of the Arco NPG properties monitored at Central Facilities Area exhibited problems with lack of timely and appropriate maintenance as well as inadequate drainage. No new Type 3 or Type 4 impacts that adversely affected significant cultural resources and threatened National Register eligibility were documented in FY 2015.

  16. Ion beam analysis in cultural heritage studies: Milestones and perspectives

    SciTech Connect (OSTI)

    Dran, Jean-Claude; Calligaro, Thomas

    2013-07-18

    For three decades, ion beam analysis (IBA) in external mode was considered as the best choice for the characterisation of cultural heritage materials, as it combines excellent analytical performance and non-invasive character. However, in recent years, other analytical techniques arose as serious competitors, such as those based on synchrotron radiation (X-ray absorption, fluorescence or diffraction) or those using portable instruments (XRF, micro-Raman). It is shown that nevertheless IBA remains unmatched thanks to two unique features, namely the analysis of light elements and the high-resolution 3D chemical imaging.

  17. WTP Safety Culture Advice Joint Topic (HSEP/TWC)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    January 2012 v1 Page 1 of 2 Note: The views expressed in committee meetings should not be considered a substitute for full HAB consensus on any particular issue. WTP Safety Culture Advice Joint Topic (HSEP/TWC) Framing questions for discussion regarding DOE's recently released Implementation Plan: Re: Secretary Chu's response to the DNFSB with the Implementation Plan for Recommendation 2011-1 (December 27, 2011) Note: The ORP coordinator for the DOE Response to DNFSB 2011-1 is Steve Pfaff. o

  18. Fuel from Tobacco and Arundo Donax: Synthetic Crop for Direct Drop-in Biofuel Production through Re-routing the Photorespiration Intermediates and Engineering Terpenoid Pathways

    SciTech Connect (OSTI)

    None

    2012-02-15

    PETRO Project: Biofuels offer renewable alternatives to petroleum-based fuels that reduce net greenhouse gas emissions to nearly zero. However, traditional biofuels production is limited not only by the small amount of solar energy that plants convert through photosynthesis into biological materials, but also by inefficient processes for converting these biological materials into fuels. Farm-ready, non-food crops are needed that produce fuels or fuel-like precursors at significantly lower costs with significantly higher productivity. To make biofuels cost-competitive with petroleum-based fuels, biofuels production costs must be cut in half.

  19. American Material Culture: Investigating a World War II Trash Dump

    SciTech Connect (OSTI)

    Julie Braun

    2005-10-01

    The Idaho National Laboratory: An Historical Trash Trove Historians and archaeologists love trash, the older the better. Sometimes these researchers find their passion in unexpected places. In this presentation, the treasures found in a large historic dump that lies relatively untouched in the middle of the Idaho National Laboratory (INL) will be described. The U.S. military used the central portion of the INL as one of only six naval proving grounds during World War II. They dumped trash in dry irrigation canals during and after their wartime activities and shortly before the federal government designated this arid and desolate place as the nations nuclear reactor testing station in 1949. When read critically and combined with memories and photographs, the 60-year old trash provides a glimpse into 1940s culture and the everyday lives of ordinary people who lived and worked during this time on Idahos desert. Thanks to priceless stories, hours of research, and the ability to read the language of historic artifacts, the dump was turned from just another trash heap into a treasure trove of 1940s memorabilia. Such studies of American material culture serve to fire our imaginations, enrich our understanding of past practices, and humanize history. Historical archaeology provides opportunities to integrate inanimate objects with animated narrative and, the more recent the artifacts, the more human the stories they can tell.

  20. Safety Culture and Best Practices at Japan's Fusion Research Facilities

    SciTech Connect (OSTI)

    Rule, Keith

    2014-05-01

    The Safety Monitor Joint Working Group (JWG) is one of the magnetic fusion research collaborations between the US Department of Energy and the government of Japan. Visits by occupational safety personnel are made to participating institutions on a biennial basis. In the 2013 JWG visit of US representatives to Japan, the JWG members noted a number of good safety practices in the safety walkthroughs. These good practices and safety culture topics are discussed in this paper. The JWG hopes that these practices for worker safety can be adopted at other facilities. It is a well-known, but unquantified, safety principle that well run, safe facilities are more productive and efficient than other facilities (Rule, 2009). Worker safety, worker productivity, and high quality in facility operation all complement each other (Mottel, 1995).

  1. Safety Culture And Best Practices At Japan's Fusion Research Facilities

    SciTech Connect (OSTI)

    Rule, K.; King, M.; Takase, Y.; Oshima, Y.; Nishimura, K.; Sukegawa, A.

    2014-04-01

    The Safety Monitor Joint Working Group (JWG) is one of the magnetic fusion research collaborations between the US Department of Energy and the government of Japan. Visits by occupational safety personnel are made to participating institutions on a biennial basis. In the 2013 JWG visit of US representatives to Japan, the JWG members noted a number of good safety practices in the safety walkthroughs. These good practices and safety culture topics are discussed in this paper. The JWG hopes that these practices for worker safety can be adopted at other facilities. It is a well-known, but unquantified, safety principle that well run, safe facilities are more productive and efficient than other facilities (Rule, 2009). Worker safety, worker productivity, and high quality in facility operation all complement each other (Mottel, 1995).

  2. DISPELLING MYTHS AND MISCONCEPTIONS TO IMPLEMENT A SAFETY CULTURE

    SciTech Connect (OSTI)

    Potts, T. Todd; Smith, Ken; Hylko, James M.

    2003-02-27

    Industrial accidents are typically reported in terms of technological malfunctions, ignoring the human element in accident causation. However, over two-thirds of all accidents are attributable to human and organizational factors (e.g., planning, written procedures, job factors, training, communication, and teamwork), thereby affecting risk perception, behavior and attitudes. This paper reviews the development of WESKEM, LLC's Environmental, Safety, and Health (ES&H) Program that addresses human and organizational factors from a top-down, bottom-up approach. This approach is derived from the Department of Energy's Integrated Safety Management System. As a result, dispelling common myths and misconceptions about safety, while empowering employees to ''STOP work'' if necessary, have contributed to reducing an unusually high number of vehicle, ergonomic and slip/trip/fall incidents successfully. Furthermore, the safety culture that has developed within WESKEM, LLC's workforce consists of three common characteristics: (1) all employees hold safety as a value; (2) each individual feels responsible for the safety of their co-workers as well as themselves; and (3) each individual is willing and able to ''go beyond the call of duty'' on behalf of the safety of others. WESKEM, LLC as a company, upholds the safety culture and continues to enhance its existing ES&H program by incorporating employee feedback and lessons learned collected from other high-stress industries, thereby protecting its most vital resource - the employees. The success of this program is evident by reduced accident and injury rates, as well as the number of safe work hours accrued while performing hands-on field activities. WESKEM, LLC (Paducah + Oak Ridge) achieved over 800,000 safe work hours through August 2002. WESKEM-Paducah has achieved over 665,000 safe work hours without a recordable injury or lost workday case since it started operations on February 28, 2000.

  3. Getting on the same page-Safety Culture | Y-12 National Security Complex

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Getting on the same ... Getting on the same page-Safety Culture Posted: July 21, 2015 - 5:27pm Safety culture encompasses our core values, attitudes and behaviors that emphasize safety - the protection of people and the environment - as the overriding priority of our work. The National Nuclear Security Administration Production Office and Consolidated Nuclear Security are committed to having a strong safety culture. The combined core values of NPO and CNS - trust, excellence, teamwork,

  4. Independent Oversight Follow-up Assessment of Safety Culture at the Waste

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Treatment and Immobilization Plant - June 2014 | Department of Energy Assessment of Safety Culture at the Waste Treatment and Immobilization Plant - June 2014 Independent Oversight Follow-up Assessment of Safety Culture at the Waste Treatment and Immobilization Plant - June 2014 June 2014 This report documents the results of a follow-up assessment of safety culture at the Waste Treatment and Immobilization Plant (WTP). The primary objective of the assessment was to provide information

  5. An Independent Evaluation of Safety Culture at the U.S. Department of

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Energy Office of Health, Safety and Security- Headquarters | Department of Energy An Independent Evaluation of Safety Culture at the U.S. Department of Energy Office of Health, Safety and Security- Headquarters An Independent Evaluation of Safety Culture at the U.S. Department of Energy Office of Health, Safety and Security- Headquarters March 2013 An Independent Evaluation of Safety Culture at the U.S. Department of Energy Office of Health, Safety and Security- Headquarters This report

  6. Using Operational Security (OPSEC) to Support a Cyber Security Culture in

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Control Systems Environments | Department of Energy Using Operational Security (OPSEC) to Support a Cyber Security Culture in Control Systems Environments Using Operational Security (OPSEC) to Support a Cyber Security Culture in Control Systems Environments This document reviews several key operational cyber security elements that are important for control systems and industrial networks and how those elements can drive the creation of a cyber security-sensitive culture. PDF icon Using

  7. Review of Nuclear Safety Culture at the Hanford Site Waste Treatment and

    Energy Savers [EERE]

    Immobilization Plant Project, October 2010 | Department of Energy Review of Nuclear Safety Culture at the Hanford Site Waste Treatment and Immobilization Plant Project, October 2010 Review of Nuclear Safety Culture at the Hanford Site Waste Treatment and Immobilization Plant Project, October 2010 October 2010 Report for independent review of the nuclear safety culture at the Waste Treatment and Immobilization Plant (WTP) project at DOE's Hanford Site. This report provides the results of a

  8. Enterprise Assessments Follow-up Assessment of Safety Culture at the

    Office of Environmental Management (EM)

    Hanford Site Waste Treatment and Immobilization Plant - June 2015 | Department of Energy Follow-up Assessment of Safety Culture at the Hanford Site Waste Treatment and Immobilization Plant - June 2015 Enterprise Assessments Follow-up Assessment of Safety Culture at the Hanford Site Waste Treatment and Immobilization Plant - June 2015 June 2015 Follow-up Assessment of Safety Culture at the Hanford Site Waste Treatment and Immobilization Plant The U.S. Department of Energy (DOE) independent

  9. DOE Policy 141.1: Management of Cultural Resources (DOE, 2001...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    to raise the level of awareness and accountability among DOE contractors concerning the importance of the Department's cultural resource-related legal and trust responsibilities. ...

  10. NMSA 18-6-9 - Cultural Properties Act | Open Energy Information

    Open Energy Info (EERE)

    Properties ActLegal Abstract Governs excavation of, injury or destruction to, and criminal damage to cultural property. Published NA Year Signed or Took Effect 1993 Legal...

  11. Environmental Guidelines for Development of Cultural Resource Management Plans--Update

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2004-09-22

    This Guide provides guidelines for the development of an individual Cultural Resource Management Plan for each DOE facility and program. Canceled by DOE N 251.82.

  12. Integration of Safety Culture Attributes into the EFCOG WP&C Program Guideline Document

    Broader source: Energy.gov [DOE]

    Slide Presentation by Steele Coddington, NSTec, Las Vegas and John McDonald, WRPS, Hanford. Integration of Safety Culture Attributes into EFCOG Work Planning and Control Guidance Document.

  13. Assessment of Safety Culture at the U.S. Departmen to Energy...

    Office of Environmental Management (EM)

    collection and analysis efforts. 1 While there are various safety culture models, the definition used in the Energy Facility Contractors Group report, which was accepted by the...

  14. Apical polarity in three-dimensional culture systems: where to now?

    SciTech Connect (OSTI)

    Inman, J.L.; Bissell, Mina

    2010-01-21

    Delineation of the mechanisms that establish and maintain the polarity of epithelial tissues is essential to understanding morphogenesis, tissue specificity and cancer. Three-dimensional culture assays provide a useful platform for dissecting these processes but, as discussed in a recent study in BMC Biology on the culture of mammary gland epithelial cells, multiple parameters that influence the model must be taken into account.

  15. Algae culture for cattle feed and water purification. Final report

    SciTech Connect (OSTI)

    Varani, F.T.; Schellenbach, S.; Veatch, M.; Grover, P.; Benemann, J.

    1980-05-16

    The feasibility of algae growth on centrate from anaerobic digester effluent and the refeed of both effluent solids and the algae to feedlot cattle were investigated. The digester was operated with dirt feedlot manure. The study serves as a supplement for the work to design a utility sized digester for the City of Lamar to convert local feedlot manure into a fuel gas. The biogas produced would power the electrical generation plant already in service. Previous studies have established techniques of digester operation and the nutritional value for effluent solids as fed to cattle. The inclusion of a single-strain of algae, Chlorella pyrenidosa in the process was evaluated here for its capability (1) to be grown in both open and closed ponds of the discharge water from the solids separation part of the process, (2) to purify the discharge water, and (3) to act as a growth stimulant for cattle feed consumption and conversion when fed at a rate of 6 grams per head per day. Although it was found that the algae could be cultured and grown on the discharge water in the laboratory, the study was unable to show that algae could accomplish the other objectives successfully. However, the study yielded supplementary information useful to the overall process design of the utility plant. This was (1) measurement of undried digester solids fed to cattle in a silage finishing ration (without algae) at an economic value of $74.99 per dry ton based on nutritional qualities, (2) development of a centrate treatment system to decolorize and disinfect centrate to allow optimum algae growth, and (3) information on ionic and mass balances for the digestion system. It is the recommendation of this study that algae not be used in the process in the Lamar bioconversion plant.

  16. A U T H O R S Daniel R. Hitchcock U.S. Department

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    U T H O R S Daniel R. Hitchcock $ U.S. Department of Agri- culture Forest Service, Center for Forested Wetlands Research, U.S.A.; dhitchc@clemson.edu Dan Hitchcock is currently the coastal environmental quality specialist for the South Carolina Sea Grant Extension Program in Charleston, South Carolina. His previous postdoctoral experience with the U.S. Department of Agriculture Forest Service focused on tritium phytoremediation. Dan has a Ph.D. in bio- logical and agricultural engineering, an

  17. Environmental resources of selected areas of Hawaii: Cultural environment and aesthetic resources

    SciTech Connect (OSTI)

    Trettin, L.D.; Petrich, C.H.; Saulsbury, J.W.

    1996-01-01

    This report has been prepared to make available and archive the background scientific data and related information collected on the cultural environment and aesthetic resources during the preparation of the environmental impact statement (EIS) for Phases 3 and 4 of the Hawaii Geothermal Project (HGP) as defined by the state of Hawaii in its April 1989 proposal to Congress. The cultural environment in the Geothermal Resource Zone (GRZ) and associated study area consists of Native Hawaiian cultural and religious practices and both Native Hawaiian and non-Native Hawaiian cultural resources. This report consists of three sections: (1) a description of Native Hawaiian cultural and religious rights, practices, and values; (2) a description of historic, prehistoric, and traditional Native Hawaiian sites; and (3) a description of other (non-native) sites that could be affected by development in the study area. Within each section, the level of descriptive detail varies according to the information currently available. The description of the cultural environment is most specific in its coverage of the Geothermal Resource Subzones in the Puna District of the island of Hawaii and the study area of South Maui. Ethnographic and archaeological reports by Cultural Advocacy Network Developing Options and International Archaeological Research Institute, Inc., respectively, supplement the descriptions of these two areas with new information collected specifically for this study. Less detailed descriptions of additional study areas on Oahu, Maui, Molokai, and the island of Hawaii are based on existing archaeological surveys.

  18. Cultural Resource Protection Plan for the Remote-Handled Low-Level Waste Disposal Facility at the Idaho National Laboratory

    SciTech Connect (OSTI)

    Pace, Brenda Ringe; Gilbert, Hollie Kae

    2015-05-01

    This plan addresses cultural resource protection procedures to be implemented during construction of the Remote Handled Low Level Waste project at the Idaho National Laboratory. The plan proposes pre-construction review of proposed ground disturbing activities to confirm avoidance of cultural resources. Depending on the final project footprint, cultural resource protection strategies might also include additional survey, protective fencing, cultural resource mapping and relocation of surface artifacts, collection of surface artifacts for permanent curation, confirmation of undisturbed historic canal segments outside the area of potential effects for construction, and/or archaeological test excavations to assess potential subsurface cultural deposits at known cultural resource locations. Additionally, all initial ground disturbing activities will be monitored for subsurface cultural resource finds, cultural resource sensitivity training will be conducted for all construction field personnel, and a stop work procedure will be implemented to guide assessment and protection of any unanticipated discoveries after initial monitoring of ground disturbance.

  19. Environmental guidelines for Development of Cultural Resource Management plans. Working draft for comment

    SciTech Connect (OSTI)

    Not Available

    1994-04-01

    DOE has stewardship responsibilities for managing the cultural resources remaining on DOE-owned and other lands impacted by DOE programs. Goal of the DOE-wide Cultural Resource Management (CRM) program is to identify and consolidate compliance actions associated with statutory and regulatory requirements. This document is to provide guidelines to DOE field managers; its implementation is intended to assure that each DOE facility and program complies with executive orders, statutes, and regulations governing the management of cultural resources. It covers CRM goals, existing conditions, CRM methods, CRM procedures and administration, and plan attachments. Glossary, legislation, and documents are covered in appendices.

  20. 7th Workshop on Risk Informed Regulation and Safety Culture | Department of

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Energy 7th Workshop on Risk Informed Regulation and Safety Culture 7th Workshop on Risk Informed Regulation and Safety Culture May 19, 2015 - 5:51pm Addthis Sarah Lennon at the Qinshann Nuclear Power Plan Museum Sarah Lennon at the Qinshann Nuclear Power Plan Museum Sarah Lennon, Acting Director of the Office of Bilateral Cooperation attended the 7th Workshop on Risk Informed Regulation and Safety Culture held in Shenzhen, China, from March 23-27. More than 70 Chinese participants attended

  1. Safety Reports Series No. 11, Developing Safety Culture in Nuclear Activities: Practical Suggestions to Assist Progress, International Atomic Energy Agency

    Broader source: Energy.gov [DOE]

    Safety Reports Series No. 11, Developing Safety Culture in Nuclear Activities: Practical Suggestions to Assist Progress, International Atomic Energy Agency

  2. Reconstitution activity of hypoxic cultured human cord blood CD34-positive cells in NOG mice

    SciTech Connect (OSTI)

    Shima, Haruko; Takubo, Keiyo; Iwasaki, Hiroko; Yoshihara, Hiroki; Gomei, Yumiko; Hosokawa, Kentaro; Arai, Fumio; Takahashi, Takao; Suda, Toshio

    2009-01-16

    Hematopoietic stem cells (HSCs) reside in hypoxic areas of the bone marrow. However, the role of hypoxia in the maintenance of HSCs has not been fully characterized. We performed xenotransplantation of human cord blood cells cultured in hypoxic or normoxic conditions into adult NOD/SCID/IL-2R{gamma}{sup null} (NOG) mice. Hypoxic culture (1% O{sub 2}) for 6 days efficiently supported the maintenance of HSCs, although cell proliferation was suppressed compared to the normoxic culture. In contrast, hypoxia did not affect in vitro colony-forming ability. Upregulation of a cell cycle inhibitor, p21, was observed in hypoxic culture. Immunohistochemical analysis of recipient bone marrow revealed that engrafted CD34{sup +}CD38{sup -} cord blood HSCs were hypoxic. Taken together, these results demonstrate the significance of hypoxia in the maintenance of quiescent human cord blood HSCs.

  3. Proceedings of the Advisory Committee on Reactor Safeguards Safety Culture Workshop

    Office of Energy Efficiency and Renewable Energy (EERE)

    NUREG/CP-0183, Proceedings of the Advisory Committee on Reactor Safeguards Safety Culture Workshop, June 12, 2003 U.S. Nuclear Regulatory Commission Advisory Committee on Reactor Safeguards Washington, DC 20555-0001.

  4. Nissan Showcases the Results of an Energy-Wise Corporate Culture

    Broader source: Energy.gov [DOE]

    This case study describes the benefits of Nissan instilling a deep-rooted, company-wide culture of energy efficiency and how it informed long-term success in energy management and plant-wide energy performance.

  5. Hanford Site, Tribes Raise Awareness of Culturally Significant Resources With Training Site

    Broader source: Energy.gov [DOE]

    RICHLAND, Wash. – About seven acres in size, the cultural resources test beds site is a small area of the 586-square-mile Hanford site. But its impact is big.

  6. Enhanced growth medium and method for culturing human mammary epithelial cells

    DOE Patents [OSTI]

    Stampfer, Martha R. (7290 Sayre Dr., Oakland, CA 94611); Smith, Helene S. (5693 Cabot Dr., Oakland, CA 94611); Hackett, Adeline J. (82 Evergreen Dr., Orinda, CA 94563)

    1983-01-01

    Methods are disclosed for isolating and culturing human mammary epithelial cells of both normal and malignant origin. Tissue samples are digested with a mixture including the enzymes collagenase and hyaluronidase to produce clumps of cells substantially free from stroma and other undesired cellular material. Growing the clumps of cells in mass culture in an enriched medium containing particular growth factors allows for active cell proliferation and subculture. Clonal culture having plating efficiencies of up to 40% or greater may be obtained using individual cells derived from the mass culture by plating the cells on appropriate substrates in the enriched media. The clonal growth of cells so obtained is suitable for a quantitative assessment of the cytotoxicity of particular treatment. An exemplary assay for assessing the cytotoxicity of the drug adriamycin is presented.

  7. Characteristics of enriched cultures for bio-huff-`n`-puff tests at Jilin oil field

    SciTech Connect (OSTI)

    Xiu-Yuan Wang; Gang Dai; Yan-Fen Xue; Shu-Hua Xie

    1995-12-31

    Three enriched cultures (48, 15a, and 26a), selected from more than 80 soil and water samples, could grow anaerobically in the presence of crude oil at 30{degrees}C and could ferment molasses to gases and organic acids. Oil recovery by culture 48 in the laboratory model experiment was enhanced by 25.2% over the original reserves and by 53.7% over the residual reserves. Enriched culture 48 was composed of at least 4 species belonging to the genera Eubacterium, Fusobacterium, and Bacteroides. This enriched culture was used as inoculum for MEOR field trials at Jilin oil field with satisfactory results. The importance of the role of these isolates in EOR was confirmed by their presence and behavior in the fluids produced from the microbiologically treated reservoir.

  8. DOE P 141.1 Department of Energy Management of Cultural Resources

    Energy Savers [EERE]

    U.S. Department of Energy POLICY Washington, D.C. Approved: 5-2-01 SUBJECT: DEPARTMENT OF ENERGY MANAGEMENT OF CULTURAL RESOURCES PURPOSE AND SCOPE The purpose of this Policy is- *...

  9. Environmental guidelines for development of Cultural Resource Management plans. Final report

    SciTech Connect (OSTI)

    1995-08-01

    The purpose of this document is to provide guidelines to the DOE field managements with responsibility for the development of an individual Cultural Resource Management Plan for each DOE facility and program.

  10. DOE P 141.1 – Department of Energy Management of Cultural Resources (DOE, 2001)

    Broader source: Energy.gov [DOE]

    The purpose of this Policy is (1) to ensure that U.S. Department of Energy (DOE) programs, including the National Nuclear Security Administration (NNSA), and field elements integrate cultural resources management into their missions and activities, and (2) to raise the level of awareness and accountability among DOE (including NNSA) contractors concerning the importance of DOE's cultural resource-related legal and trust responsibilities.

  11. DOE P 141.1 – Department of Energy Management of Cultural Resources

    Broader source: Energy.gov [DOE]

    The purpose of this Policy is (1) to ensure that U.S. Department of Energy (DOE) programs, including the National Nuclear Security Administration (NNSA), and field elements integrate cultural resources management into their missions and activities, and (2) to raise the level of awareness and accountability among DOE (including NNSA) contractors concerning the importance of DOE's cultural resource-related legal and trust responsibilities.

  12. What Has DOE Been Doing in the Area of Safety Culture? | Department of

    Office of Environmental Management (EM)

    Energy What Has DOE Been Doing in the Area of Safety Culture? What Has DOE Been Doing in the Area of Safety Culture? September 20, 2012 Presenter: James Hutton, Acting Associate Deputy Assistant Secretary for Safety, Security, and Quality Programs and Chief Nuclear Safety Advisor Office of Environmental Management US Department of Energy Topics Covered: Promote a shift from a focus on compliance toward pursuit of excellence Joint DOE/EFCOG working group - 2007 Experience assisted DOE in

  13. DOE Tribal Intern Focuses on Integrating Energy Policy and Navajo Cultural

    Office of Environmental Management (EM)

    Values | Department of Energy Focuses on Integrating Energy Policy and Navajo Cultural Values DOE Tribal Intern Focuses on Integrating Energy Policy and Navajo Cultural Values July 22, 2014 - 12:36pm Addthis The 2014 Sandia/Tribal Energy Program summer interns: Aaron Cate, Sandra Begay-Campbell, Thomas Jones, and Len Necefer. Photo from Sandra Begay-Campbell, Sandia National Laboratories The 2014 Sandia/Tribal Energy Program summer interns: Aaron Cate, Sandra Begay-Campbell, Thomas Jones,

  14. Transgenic approaches to altering carbon and nitrogen partitioning in whole plants: assessing the potential to improve crop yields and nutritional quality

    SciTech Connect (OSTI)

    Yadav, Umesh P.; Ayre, Brian G.; Bush, Daniel R.

    2015-04-22

    The principal components of plant productivity and nutritional value, from the standpoint of modern agriculture, are the acquisition and partitioning of organic carbon (C) and nitrogen (N) compounds among the various organs of the plant. The flow of essential organic nutrients among the plant organ systems is mediated by its complex vascular system, and is driven by a series of transport steps including export from sites of primary assimilation, transport into and out of the phloem and xylem, and transport into the various import-dependent organs. Manipulating C and N partitioning to enhance yield of harvested organs is evident in the earliest crop domestication events and continues to be a goal for modern plant biology. Research on the biochemistry, molecular and cellular biology, and physiology of C and N partitioning has now matured to an extent that strategic manipulation of these transport systems through biotechnology are being attempted to improve movement from source to sink tissues in general, but also to target partitioning to specific organs. These nascent efforts are demonstrating the potential of applied biomass targeting but are also identifying interactions between essential nutrients that require further basic research. In this review, we summarize the key transport steps involved in C and N partitioning, and discuss various transgenic approaches for directly manipulating key C and N transporters involved. In addition, we propose several experiments that could enhance biomass accumulation in targeted organs while simultaneously testing current partitioning models.

  15. Transgenic approaches to altering carbon and nitrogen partitioning in whole plants: assessing the potential to improve crop yields and nutritional quality

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Yadav, Umesh P.; Ayre, Brian G.; Bush, Daniel R.

    2015-04-22

    The principal components of plant productivity and nutritional value, from the standpoint of modern agriculture, are the acquisition and partitioning of organic carbon (C) and nitrogen (N) compounds among the various organs of the plant. The flow of essential organic nutrients among the plant organ systems is mediated by its complex vascular system, and is driven by a series of transport steps including export from sites of primary assimilation, transport into and out of the phloem and xylem, and transport into the various import-dependent organs. Manipulating C and N partitioning to enhance yield of harvested organs is evident in themore » earliest crop domestication events and continues to be a goal for modern plant biology. Research on the biochemistry, molecular and cellular biology, and physiology of C and N partitioning has now matured to an extent that strategic manipulation of these transport systems through biotechnology are being attempted to improve movement from source to sink tissues in general, but also to target partitioning to specific organs. These nascent efforts are demonstrating the potential of applied biomass targeting but are also identifying interactions between essential nutrients that require further basic research. In this review, we summarize the key transport steps involved in C and N partitioning, and discuss various transgenic approaches for directly manipulating key C and N transporters involved. In addition, we propose several experiments that could enhance biomass accumulation in targeted organs while simultaneously testing current partitioning models.« less

  16. Development of Genomic and Genetic Tools for Foxtail Millet, and Use of These Tools in the Improvement of Biomass Production for Bioenergy Crops

    SciTech Connect (OSTI)

    Doust, Andrew, N.

    2011-11-11

    The overall aim of this research was to develop genomic and genetic tools in foxtail millet that will be useful in improving biomass production in bioenergy crops such as switchgrass, napier grass, and pearl millet. A variety of approaches have been implemented, and our lab has been primarily involved in genome analysis and quantitative genetic analysis. Our progress in these activities has been substantially helped by the genomic sequence of foxtail millet produced by the Joint Genome Institute (Bennetzen et al., in prep). In particular, the annotation and analysis of candidate genes for architecture, biomass production and flowering has led to new insights into the control of branching and flowering time, and has shown how closely related flowering time is to vegetative architectural development and biomass accumulation. The differences in genetic control identified at high and low density plantings have direct relevance to the breeding of bioenergy grasses that are tolerant of high planting densities. The developmental analyses have shown how plant architecture changes over time and may indicate which genes may best be manipulated at various times during development to obtain required biomass characteristics. This data contributes to the overall aim of significantly improving genetic and genomic tools in foxtail millet that can be directed to improvement of bioenergy grasses such as switchgrass, where it is important to maximize vegetative growth for greatest biomass production.

  17. Idaho National Laboratory Cultural Resource Management Office FY 2011 Activity Report

    SciTech Connect (OSTI)

    Julie Braun Williams; Brenda R. Pace; Hollie K. Gilbert; Christina L. Olson

    2012-09-01

    The Idaho National Laboratory (INL) Site is home to vast numbers and a wide variety of important cultural resources representing at least a 13,500 year span of human land use in the region. As a federal agency, the Department of Energy, Idaho Operations Office (DOE-ID) has legal responsibility for the management and protection of the resources and has contracted these responsibilities to Battelle Energy Alliance (BEA). The BEA professional staff is committed to maintaining a cultural resource management program that accepts the challenge of preserving INL cultural resources in a manner reflecting their importance in local, regional, and national history. This report is intended as a stand-alone document that summarizes activities performed by the INL Cultural Resource Management Office (CRMO) staff during fiscal year 2011. This work is diverse, far-reaching and though generally confined to INL cultural resource compliance, also includes a myriad of professional and voluntary community activities. This document is intended to be informative to both internal and external stakeholders, serve as a planning tool for future INL cultural resource management work, and meet an agreed upon legal requirement.

  18. Idaho National Laboratory Cultural Resource Management Office FY 2010 Activity Report

    SciTech Connect (OSTI)

    Hollie K. Gilbert; Clayton F. Marler; Christina L. Olson; Brenda R. Pace; Julie Braun Williams

    2011-09-01

    The Idaho National Laboratory (INL) Site is home to vast numbers and a wide variety of important cultural resources representing at least a 13,500 year span of human land use in the region. As a federal agency, the Department of Energy, Idaho Operations Office (DOE-ID) has legal responsibility for the management and protection of the resources and has contracted these responsibilities to Battelle Energy Alliance (BEA). The BEA professional staff is committed to maintaining a cultural resource management program that accepts the challenge of preserving INL cultural resources in a manner reflecting their importance in local, regional, and national history. This report summarizes activities performed by the INL Cultural Resource Management Office (CRMO) staff during fiscal year 2010. This work is diverse, far-reaching and though generally confined to INL cultural resource compliance, also includes a myriad of professional and voluntary community activities. This document is intended to be informative to both internal and external stakeholders and to serve as a planning tool for future INL cultural resource management work.

  19. Environmental and societal consequences of a possible CO/sub 2/-induced climate change. Volume II, Part 8. Impacts of rising atmospheric carbon dioxide levels on agricultural growing seasons and crop water use efficiencies

    SciTech Connect (OSTI)

    Newman, J. E.

    1982-09-01

    The researchable areas addressed relate to the possible impacts of climate change on agricultural growing seasons and crop adaptation responses on a global basis. The research activities proposed are divided into the following two main areas of investigation: anticipated climate change impacts on the physical environmental characteristics of the agricultural growing seasons and, the most probable food crop responses to the possible changes in atmospheric CO/sub 2/ levels in plant environments. The main physical environmental impacts considered are the changes in temperature, or more directly, thermal energy levels and the growing season evapotranspiration-precipitation balances. The resulting food crop, commercial forest and rangeland species response impacts addressed relate to potential geographical shifts in agricultural growing seasons as determined by the length in days of the frost free period, thermal energy changes and water balance changes. In addition, the interaction of possible changes in plant water use efficiencies during the growing season in relationship to changing atmospheric CO/sub 2/ concentrations, is also considered under the scenario of global warming due to increases in atmospheric CO/sub 2/ concentration. These proposed research investigations are followed by adaptive response evaluations.

  20. Development of a cell culture surface conversion technique using alginate thin film for evaluating effect upon cellular differentiation

    SciTech Connect (OSTI)

    Nakashima, Y.; Tsusu, K.; Minami, K.; Nakanishi, Y.

    2014-06-15

    Here, we sought to develop a cell culture surface conversion technique that would not damage living cells. An alginate thin film, formed on a glass plate by spin coating of sodium alginate solution and dipping into calcium chloride solution, was used to inhibit adhesion of cells. The film could be removed by ethylenediaminetetraacetate (EDTA) at any time during cell culture, permitting observation of cellular responses to conversion of the culture surface in real time. Additionally, we demonstrated the validity of the alginate thin film coating method and the performance of the film. The thickness of the alginate thin film was controlled by varying the rotation speed during spin coating. Moreover, the alginate thin film completely inhibited the adhesion of cultured cells to the culture surface, irrespective of the thickness of the film. When the alginate thin film was removed from the culture surface by EDTA, the cultured cells adhered to the culture surface, and their morphology changed. Finally, we achieved effective differentiation of C2C12 myoblasts into myotube cells by cell culture on the convertible culture surface, demonstrating the utility of our novel technique.

  1. Concentration-dependent gene expression responses to flusilazole in embryonic stem cell differentiation cultures

    SciTech Connect (OSTI)

    Dartel, Dorien A.M. van; Pennings, Jeroen L.A.; Fonteyne, Liset J.J. de la; Brauers, Karen J.J.; Claessen, Sandra; Delft, Joost H. van; Kleinjans, Jos C.S.; Piersma, Aldert H.

    2011-03-01

    The murine embryonic stem cell test (EST) is designed to evaluate developmental toxicity based on compound-induced inhibition of embryonic stem cell (ESC) differentiation into cardiomyocytes. The addition of transcriptomic evaluation within the EST may result in enhanced predictability and improved characterization of the applicability domain, therefore improving usage of the EST for regulatory testing strategies. Transcriptomic analyses assessing factors critical for risk assessment (i.e. dose) are needed to determine the value of transcriptomic evaluation in the EST. Here, using the developmentally toxic compound, flusilazole, we investigated the effect of compound concentration on gene expression regulation and toxicity prediction in ESC differentiation cultures. Cultures were exposed for 24 h to multiple concentrations of flusilazole (0.54-54 {mu}M) and RNA was isolated. In addition, we sampled control cultures 0, 24, and 48 h to evaluate the transcriptomic status of the cultures across differentiation. Transcriptomic profiling identified a higher sensitivity of development-related processes as compared to cell division-related processes in flusilazole-exposed differentiation cultures. Furthermore, the sterol synthesis-related mode of action of flusilazole toxicity was detected. Principal component analysis using gene sets related to normal ESC differentiation was used to describe the dynamics of ESC differentiation, defined as the 'differentiation track'. The concentration-dependent effects on development were reflected in the significance of deviation of flusilazole-exposed cultures from this transcriptomic-based differentiation track. Thus, the detection of developmental toxicity in EST using transcriptomics was shown to be compound concentration-dependent. This study provides further insight into the possible application of transcriptomics in the EST as an improved alternative model system for developmental toxicity testing.

  2. Best Seller Cites Westinghouse Safety Culture at WIPP as "World-Wide Standard"

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Best Seller Cites Westinghouse Safety Culture at WIPP As "World-Wide Standard" CARLSBAD, N.M., October 23, 2001 -- A best-selling business book recognizes the safety culture created by Westinghouse at the U.S. Department of Energy's Waste Isolation Pilot Plant (WIPP) located near Carlsbad, New Mexico, as "the worldwide standard for safety practices." The book, originally published by Linkage Press of Lexington, Massachusetts, as Linkage Inc.'s Best Practices in Organization

  3. Guidelines for Evaluating and Documenting Traditional Cultural Properties (NPS, 1990, revised 1998)

    Broader source: Energy.gov [DOE]

    This National Park Service bulletin is meant to assist federal agencies, State Historic Preservation Officers, local governments, Indian tribes, and other historic preservation practitioners in determining whether properties thought to have traditional cultural significance are eligible for inclusion in the National Register of Historic Places.

  4. LIPID PRODUCTION BY DUNALIELLA SALINA IN BATCH CULTURE: EFFECTS OF NITROGEN LIMITATION AND LIGHT INTENSITY

    SciTech Connect (OSTI)

    Weldy, C.S.; Huesemann, M.

    2007-01-01

    Atmospheric carbon dioxide (CO2) concentrations are increasing and may cause unknown deleterious environmental effects if left unchecked. The Intergovernmental Panel on Climate Change (IPCC) has predicted in its latest report a 2C to 4C increase in global temperatures even with the strictest CO2 mitigation practices. Global warming can be attributed in large part to the burning of carbon-based fossil fuels, as the concentration of atmospheric CO2 is directly related to the burning of fossil fuels. Biofuels which do not add CO2 to the atmosphere are presently generated primarily from terrestrial plants, i.e., ethanol from corn grain and biodiesel from soybean oil. The production of biofuels from terrestrial plants is severely limited by the availability of fertile land. Lipid production from microalgae and its corresponding biodiesel production have been studied since the late 1970s but large scale production has remained economically infeasible due to the large costs of sterile growing conditions required for many algal species. This study focuses on the potential of the halophilic microalgae species Dunaliella salina as a source of lipids and subsequent biodiesel production. The lipid production rates under high light and low light as well as nitrogen suffi cient and nitrogen defi cient culture conditions were compared for D. salina cultured in replicate photobioreactors. The results show (a) cellular lipid content ranging from 16 to 44% (wt), (b) a maximum culture lipid concentration of 450mg lipid/L, and (c) a maximum integrated lipid production rate of 46mg lipid/L culture*day. The high amount of lipids produced suggests that D. salina, which can be mass-cultured in non-sterile outdoor ponds, has strong potential to be an economically valuable source for renewable oil and biodiesel production.

  5. Tombs, tunnels, and terraces a cultural resources survey of a former ammunition supply point in Okinawa, Japan

    SciTech Connect (OSTI)

    Verhaaren, B. T.; Levenson, J. B.; Komine, G.

    2000-02-09

    U.S. forces serving at military bases on foreign soil are obligated to act as good stewards of the cultural and natural resources under their control. However, cultural resources management presents special challenges at U.S. bases in other countries where cultural properties laws differ in emphasis and detail from those in the United States and issues of land ownership and occupancy are not always clear. Where status of forces agreements (SOFAs) exist, environmental governing standards bridge the gap between U.S. and host nation cultural priorities. In Japan, the Department of Defense Japan Environmental Governing Standards (JEGS) fill this function. Under Criteria 12-4.2 and 12-4.3 of the JEGS, U.S. Forces Japan commit themselves to inventory and protect cultural properties found on the lands they control or use. Cultural properties include archaeological sites, tombs, historic buildings, and shrines. Natural monuments, such as landscape features or plant and animal species, may also be designated as cultural properties. As part of this commitment, in February 1999 a cultural resources inventory was conducted in Area 1, part of Kadena Air Base (AB), Okinawa, Japan. Area 1, the former U.S. army Ammunition Supply Point 1, is currently used primarily for training exercises and recreational paint ball.

  6. Independent Oversight Follow-up Assessment of Safety Culture at the Waste Treatment and Immobilization Plant - June 2014

    Office of Environmental Management (EM)

    Follow-up Assessment of Safety Culture at the Waste Treatment and Immobilization Plant May 2011 June 2014 Office of Environment, Safety and Health Assessments Office of Independent Enterprise Assessments U.S. Department of Energy Independent Oversight Follow-up Assessment of Safety Culture at the Waste Treatment and Immobilization Plant Table of Contents 1.0 Introduction

  7. Cultural Resources

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Expand Projects & Initiatives Finance & Rates Expand Finance & Rates Involvement & Outreach Expand Involvement & Outreach Doing Business Expand Doing Business...

  8. Self-Reliability and Motivation in a Nuclear Security Culture Enhancement Program

    SciTech Connect (OSTI)

    Rogers,E.; deBoer,G.; Crawford, C.; De Castro, K.; Landers, J.

    2009-10-19

    The threat of nuclear terrorism has become a global concern. Many countries continue to make efforts to strengthen nuclear security by enhancing systems of nuclear material protection, control, and accounting (MPC&A). Though MPC&A systems can significantly upgrade nuclear security, they do not eliminate the "human factor." Gen. Eugene Habiger, a former "Assistant Secretary for Safeguards and Security" at the U.S. Department of Energys (DOE) nuclear-weapons complex and a former commander of U.S. strategic nuclear forces, has observed that "good security is 20% equipment and 80% people." Although eliminating the "human factor" is not possible, accounting for and mitigating the risk of the insider threat is an essential element in establishing an effective nuclear security culture. This paper will consider the organizational role in mitigating the risk associated with the malicious insider through monitoring and enhancing human reliability and motivation as well as enhancing the nuclear security culture.

  9. Self-Reliability and Motivation in a Nuclear Security Culture Enhancement Program

    SciTech Connect (OSTI)

    Crawford, Cary E.; de Boer, Gloria; De Castro, Kara; Landers, John; Rogers, Erin

    2010-10-01

    The threat of nuclear terrorism has become a global concern. Many countries continue to make efforts to strengthen nuclear security by enhancing systems of nuclear material protection, control, and accounting (MPC&A). Though MPC&A systems can significantly upgrade nuclear security, they do not eliminate the human factor. Gen. Eugene Habiger, a former Assistant Secretary for Safeguards and Security at the U.S. Department of Energys (DOE) nuclear-weapons complex and a former commander of U.S. strategic nuclear forces, has observed that good security is 20% equipment and 80% people.1 Although eliminating the human factor is not possible, accounting for and mitigating the risk of the insider threat is an essential element in establishing an effective nuclear security culture. This paper will consider the organizational role in mitigating the risk associated with the malicious insider through monitoring and enhancing human reliability and motivation as well as enhancing the nuclear security culture.

  10. Open-access databases as unprecedented resources and drivers of cultural change in fisheries science

    SciTech Connect (OSTI)

    McManamay, Ryan A; Utz, Ryan

    2014-01-01

    Open-access databases with utility in fisheries science have grown exponentially in quantity and scope over the past decade, with profound impacts to our discipline. The management, distillation, and sharing of an exponentially growing stream of open-access data represents several fundamental challenges in fisheries science. Many of the currently available open-access resources may not be universally known among fisheries scientists. We therefore introduce many national- and global-scale open-access databases with applications in fisheries science and provide an example of how they can be harnessed to perform valuable analyses without additional field efforts. We also discuss how the development, maintenance, and utilization of open-access data are likely to pose technical, financial, and educational challenges to fisheries scientists. Such cultural implications that will coincide with the rapidly increasing availability of free data should compel the American Fisheries Society to actively address these problems now to help ease the forthcoming cultural transition.

  11. Culturally relevant science: An approach to math science education for hispanics. Final technical report

    SciTech Connect (OSTI)

    Montellano, B.O. de

    1996-11-14

    This progress report summarizes results of a teacher workshop. A letter sent to 17 teachers who had participated in the workshop requested a report of any activities undertaken and copies of lesson plans and materials developed. Only nine responses were received, and not all of them demonstrated a satisfactory level of activity. Teachers who submitted materials showing the most promise were invited to participate in the Summer Writing Workshop. A partial first draft of a companion volume for the teacher`s manual was written which provides a rationale for culturally relevant science and presents the cultural and scientific background needed. The outline of the book is presented in Appendix 1. Appendix 2 is a sample chapter from the book.

  12. Bile Culture and Susceptibility Testing of Malignant Biliary Obstruction via PTBD

    SciTech Connect (OSTI)

    Yu Haipeng; Guo Zhi Xing Wenge; Guo Xiuying; Liu Fang; Li Baoguo

    2012-10-15

    Purpose: To assess the information obtained by bile culture and susceptibility testing for malignant biliary obstruction by a retrospective one-center study. Methods: A total of 694 patients with malignant biliary obstruction received percutaneous transhepatic biliary drainage during the period July 2003 to September 2010, and subsequently, bile specimens were collected during the procedure. Among the 694 patients, 485 were men and 209 were women, ranging in age from 38 to 78 years (mean age 62 years). Results: A total of 42.9% patients had a positive bile culture (298 of 694). Further, 57 species of microorganisms and 342 strains were identified; gram-positive bacteria accounted for 50.9% (174 of 342) and gram-negative bacteria accounted for 41.5% (142 of 342) of these strains. No anaerobes were obtained by culture during this study. The most common microorganisms were Enterococcus faecalis (41 of 342, 11.9%), Escherichia coli (34 of 342, 9.9%), Klebsiella pneumoniae (28 of 342, 8.2%), Staphylococcus epidermidis (19 of 342, 5.5%), Enterococcus (18 of 342, 5.3%), and Enterobacter cloacae (16 of 342, 4.7%). The percentage of {beta}-lactamase-producing gram-positive bacteria was 27.6% (48 of 174), and the percentage of gram-negative bacteria was 19.7% (28 of 142). The percentage of enzyme-producing Escherichia coli was 61.7% (21 of 34). Conclusion: The bile cultures in malignant biliary obstruction are different from those in the Tokyo Guidelines and other benign biliary obstruction researches, which indicates that a different antibacterial therapy should be applied. Thus, knowledge of the antimicrobial susceptibility data could aid in the better use of antibiotics for the empirical therapy of biliary infection combined with malignant biliary obstruction.

  13. Holding Mother Earth Sacred: Photo Journal Through an American Indian and Canadian Aboriginal Cultural Lens

    Office of Environmental Management (EM)

    HOLDING MOTHER EARTH SACRED Developing Energy Resources * Creating Sustainable Jobs * Honoring Indigenous Beliefs A Photo Journal Through an American Indian and Canadian Aboriginal Cultural Lens Vision Intention / Intersecting Points of Focus * To highlight the important role Native American and Aboriginal workers have in conventional energy production, sustainable energy development and green job creation on tribal lands in the US and Canada * To raise awareness about OH & S and

  14. Calculating the Cultural Significance of American Indian Plants: Paiute and Shoshone

    National Nuclear Security Administration (NNSA)

    Calculating the Cultural Significance of American Indian Plants: Paiute and Shoshone Ethnobotany at Yucca Mountain, Nevada Author(s): Richard W. Stoffle, David B. Halmo, Michael J. Evans, John E. Olmsted Source: American Anthropologist, New Series, Vol. 92, No. 2 (Jun., 1990), pp. 416-432 Published by: Blackwell Publishing on behalf of the American Anthropological Association Stable URL: http://www.jstor.org/stable/680153 . Accessed: 04/05/2011 18:13 Your use of the JSTOR archive indicates your

  15. Columbia River System Operation Review : Final Environmental Impact Statement, Appendix D: Cultural Resources.

    SciTech Connect (OSTI)

    Columbia River System Operation Review

    1995-11-01

    This study attempts to identify and analyze the impacts of the System Operating Strategy (SOS) alternatives on cultural resources. The impacts include effects on Native American traditional cultural values, properties and practices. They also include effects on archeological or historic properties meeting the criteria of the National Register of Historic Places. In addition to responding to the requirements of the National Environmental Policy Act (NEPA), this analysis addresses the requirements of the National Historic Preservation Act (NHPA), the Archeological Resources Protection Act (ARPA), the Native American Graves Protection and Repatriation Act (NAGPRA), the Native American Religious Freedom Act (NARFA), and other relevant legislation. To meet their legally mandated cultural resources requirements, the SOR agencies will develop agreements and Implementation Plans with the appropriate State Historic Preservation Officers (SHPOs), Tribes, and the Advisory Council on Historic Preservation (ACHP) detailing the measures necessary to best manage the resource. The planning and implementation activities will be staged over a number of years in consultation with affected Tribes.

  16. Idaho National Laboratory Cultural Resource Monitoring Report for Fiscal Year 2007

    SciTech Connect (OSTI)

    Brenda R. Pace

    2007-10-01

    This report describes the cultural resource monitoring activities of the Idaho National Laboratorys (INL) Cultural Resource Management (CRM) Office during fiscal year 2007 (FY 2007). In FY 2007, 40 localities were revisited: two locations of heightened Shoshone-Bannock tribal sensitivity, four caves, three butte/craters, twelve prehistoric archaeological sites, two historic stage stations, nine historic homesteads, a portion of Goodales Cutoff of the Oregon Trail, a portion of historic trail T-16, one World War II dump, four buildings from the World War II period, and Experimental Breeder Reactor I, a modern scientific facility and National Historic Landmark. Several INL project areas were also monitored in FY 2007. This included direct observation of ground disturbing activities within the Power Burst Facility (PBF, now designated as the Critical Infrastructure Test Range Complex CITRC), backfilling operations associated with backhoe trenches along the Big Lost River, and geophysical surveys designed to pinpoint subsurface unexploded ordnance in the vicinity of the Naval Ordnance Disposal Area. Surprise checks were also made to three ongoing INL projects to ensure compliance with INL CRM Office recommendations to avoid impacts to cultural resources. Although some impacts were documented, no significant adverse effects that would threaten the National Register eligibility of any resource were observed at any location.

  17. Ethanol-induced cell damage in cultured rat antral mucosa assessed by chromium-51 release

    SciTech Connect (OSTI)

    Sewell, R.B.; Ling, T.S.; Yeomans, N.D.

    1986-08-01

    We have developed an in vitro method for studying ethanol-induced injury to gastric mucosa using organ culture of rat antrum. Cell damage was assessed by measurement of the release of (/sup 51/Cr)sodium chromate from preloaded cells, a method adapted from a standard immunologic technique. This system provided rapid and highly reproducible quantitation of tissue injury as assessed by /sup 51/Cr release into the culture medium. The threshold concentration for ethanol-induced damage was between 10 and 15% v/v, similar to in vivo thresholds observed by others. /sup 51/Cr release could also be induced by very short exposure to ethanol (5-15 min), and then continued despite ethanol removal. Interestingly, after continuous ethanol exposure, a plateau of maximum /sup 51/Cr release was reached 60 min after exposure to ethanol over the concentration range 20-50%, suggesting tissue adaptation to ethanol damage. This organ culture system, which allows precise control of experimental conditions, may be useful for studying mechanisms of gastric mucosal injury and protection.

  18. Nearly Finished Genomes Produced Using Gel Microdroplet Culturing (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)

    ScienceCinema (OSTI)

    Fitzsimmons, Michael [LANL

    2013-01-25

    Michael Fitzsimmons from Los Alamos National Laboratory gives a talk titled "Nearly Finished Genomes Produced Using Gel Microdroplet Culturing" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

  19. Ecological and Cultural Importance of a Species at Risk of Extinction, Pacific Lamprey, 1964-2002 Technical Report.

    SciTech Connect (OSTI)

    Close, David A.

    2002-07-01

    The cultural and ecological values of Pacific lamprey (Lampetra tridentata) have not been understood by Euro-Americans and thus their great decline has almost gone unnoticed except by Native Americans, who elevated the issue and initiated research to restore its populations, at least in the Columbia Basin. They regard Pacific lamprey as a highly valued resource and as a result ksuyas (lamprey) has become one of their cultural icons. Ksuyas are harvested to this day as a subsistence food by various tribes along the Pacific coast and are highly regarded for their cultural value. Interestingly, our review suggests that the Pacific lamprey plays an important role in the food web, may have acted as a buffer for salmon from predators, and may have been an important source of marine nutrients to oligotrophic watersheds. This is very different from the Euro-American perception that lampreys are pests. We suggest that cultural biases affected management policies.

  20. Presentation, Safety from the Operator's Perspective: We are All in This Together, Safety Culture in All We Do

    Broader source: Energy.gov [DOE]

    A presentation by Jim Ellis, President and CEO, Institute of Nuclear Power Operators (INPO), Safety from the Operator’s Perspective: We Are All in this Together, Safety Culture in All We Do.

  1. Design, Fabrication, and Operation of Innovative Microalgae Culture Experiments for the Purpose of Producing Fuels: Final Report, Phase I

    SciTech Connect (OSTI)

    Not Available

    1985-01-01

    A conceptual design was developed for a 1000-acre (water surface) algae culture facility for the production of fuels. The system is modeled after the shallow raceway system with mixing foils that is now being operated at the University of Hawaii. A computer economic model was created to calculate the discounted breakeven price of algae or fuels produced by the culture facility. A sensitivity analysis was done to estimate the impact of changes in important biological, engineering, and financial parameters on product price.

  2. ADAPTIVE MANAGEMENT AND PLANNING MODELS FOR CULTURAL RESOURCES IN OIL & GAS FIELDS IN NEW MEXICO AND WYOMING

    SciTech Connect (OSTI)

    Peggy Robinson

    2005-07-01

    This report summarizes activities that have taken place in the last six (6) months (January 2005-June 2005) under the DOE-NETL cooperative agreement ''Adaptive Management and Planning Models for Cultural Resources in Oil and Gas Fields, New Mexico and Wyoming'' DE-FC26-02NT15445. This project examines the practices and results of cultural resource investigation and management in two different oil and gas producing areas of the United States: southeastern New Mexico and the Powder River Basin of Wyoming. The project evaluates how cultural resource investigations have been conducted in the past and considers how investigation and management could be pursued differently in the future. The study relies upon full database population for cultural resource inventories and resources and geomorphological studies. These are the basis for analysis of cultural resource occurrence, strategies for finding and evaluating cultural resources, and recommendations for future management practices. Activities can be summarized as occurring in either Wyoming or New Mexico. Gnomon as project lead, worked in both areas.

  3. The Biofuels Revolution: Understanding the Social, Cultural and Economic Impacts of Biofuels Development on Rural Communities

    SciTech Connect (OSTI)

    Dr. Theresa L. Selfa; Dr. Richard Goe; Dr. Laszlo Kulcsar; Dr. Gerad Middendorf; Dr. Carmen Bain

    2013-02-11

    The aim of this research was an in-depth analysis of the impacts of biofuels industry and ethanol plants on six rural communities in the Midwestern states of Kansas and Iowa. The goal was to provide a better understanding of the social, cultural, and economic implications of biofuels development, and to contribute to more informed policy development regarding bioenergy.Specific project objectives were: 1. To understand how the growth of biofuel production has affected and will affect Midwestern farmers and rural communities in terms of economic, demographic, and socio-cultural impacts; 2. To determine how state agencies, groundwater management districts, local governments and policy makers evaluate or manage bioenergy development in relation to competing demands for economic growth, diminishing water resources, and social considerations; 3. To determine the factors that influence the water management practices of agricultural producers in Kansas and Iowa (e.g. geographic setting, water management institutions, competing water-use demands as well as producers?? attitudes, beliefs, and values) and how these influences relate to bioenergy feedstock production and biofuel processing; 4. To determine the relative importance of social-cultural, environmental and/or economic factors in the promotion of biofuels development and expansion in rural communities; The research objectives were met through the completion of six detailed case studies of rural communities that are current or planned locations for ethanol biorefineries. Of the six case studies, two will be conducted on rural communities in Iowa and four will be conducted on rural communities in Kansas. A ??multi-method? or ??mixed method? research methodology was employed for each case study.

  4. Culturally relevant science: An approach to math science education for Hispanics. Final technical report

    SciTech Connect (OSTI)

    Ortiz de Montellano, B.

    1996-11-14

    As planned a letter was sent out to 17 teachers who had participated in a Summer 1994 workshop on ``Culturally Relevant Science for Hispanics`` at Michigan State. These teachers were supposed to have spent the intervening time developing lesson plans and curricula. The letter requested a report of any activities undertaken and copies of lesson plans and materials developed by February 1996 with a stipend of $400 for satisfactory reports. It was a disappointment to only get 9 responses and not all of them demonstrating a satisfactory level of activity. Diana Marinez, Dean of Science at Texas A and M University, Corpus Christi, who is the other developer of this curriculum and the author reviewed the submitted materials and chose those showing the most promise to be invited to participate in the Summer Writing Workshop. Spring of 1996 and particularly in May--June, the author wrote a partial first draft of a companion volume for the teacher`s manual which would provide a rationale for doing culturally relevant science, present the cultural and the scientific background that teachers would need in order to be able to teach. One of the goals of this curriculum is that it should be off-the-shelf ready to teach and that teachers would not have to do extra research to encourage its adoption. The outline of the book is appendix 1. The Writing Workshop was held at Texas A and M University, Corpus Christi from July 14 to July 27, 1996. Participating teachers chose topics that they were interested in developing and wrote first drafts. These were distributed to all participants and critiqued by the workshop directors before being rewritten. Some teachers were more productive than others depending on their science background. In total an impressive number of lesson plans were written. These lesson plans are listed in Appendix 3. Appendix 4 is a sample lesson. Work still needs to be done on both the source book and the teachers` manual.

  5. Endangered species and cultural resources program, Naval Petroleum Reserves in California: Annual report FY95

    SciTech Connect (OSTI)

    1996-04-01

    In FY95, EG and G Energy Measurements, Inc. (EG and G/EM) continued to support efforts to protect endangered species and cultural resources at the Naval Petroleum Reserves in California (NPRC). These efforts are conducted to ensure NPRC compliance with regulations regarding the protection of listed species and cultural resources on Federal properties. Population monitoring activities are conducted annually for San Joaquin kit foxes, giant kangaroo rats, blunt-nosed leopard lizards, and Hoover`s wooly-star. To mitigate impacts of oil field activities on listed species, 674 preactivity surveys covering approximately 211 hectares (521 acres) were conducted in FY95. EG and G/EM also assisted with mitigating effects from third-party projects, primarily by conducting biological and cultural resource consultations with regulatory agencies. EG and G/EM has conducted an applied habitat reclamation program at NPRC since 1985. In FY95, an evaluation of revegetation rates on reclaimed and non-reclaimed disturbed lands was completed, and the results will be used to direct future habitat reclamation efforts at NPRC. In FY95, reclamation success was monitored on 50 sites reclaimed in 1985. An investigation of factors influencing the distribution and abundance of kit foxes at NPRC was initiated in FY94. Factors being examined include habitat disturbance, topography, grazing, coyote abundance, lagomorph abundance, and shrub density. This investigation continued in FY95 and a manuscript on this topic will be completed in FY96. Also, Eg and G/EM completed collection of field data to evaluate the effects of a well blow-out on plant and animal populations. A final report will be prepared in FY96. Finally, EG and G/EM completed a life table analysis on San Joaquin kit foxes at NPRC.

  6. Influence of ethanol on fatty acid composition of phospholipids in cultured neurons

    SciTech Connect (OSTI)

    Morrisson, M.; Wilce, P.A.; Shanley, B.C.

    1984-07-31

    Animals chronically exposed to ethanol show changes in neural membrane lipids which may underlie the development of tolerance and physical dependence. The object of this study was to investigate changes in the fatty acid composition of neuronal phospholipids cultured in the presence of ethanol (55 or 110 mM) for periods up to 7 days. Decreases were observed in the percentage of individual and total saturated fatty acids, while the double bond index: total saturated fatty acid ratio, increased. These changes do not support the hypothesis that neural membrane lipid composition changes to counteract the fluidizing action of ethanol. 13 references, 2 tables.

  7. Culturally relevant science: An approach to math science education for Hispanics

    SciTech Connect (OSTI)

    Montellano, B.O. de

    1996-11-14

    This report describes later stages of a program to develop culturally relevant science and math programs for Hispanic students. Part of this effort was follow-up with 17 teachers who participated in early stages of the program. Response was not very good. Included with the report is a first draft effort for curriculum materials which could be used as is in such a teaching effort. Several of the participating teachers were invited to a writing workshop, where lesson plans were drafted, and critiqued and following rework are listed in this publication. Further work needs to be completed and is ongoing.

  8. AN OVERVIEW OF CULTURAL RESOURCES ON PAHUTE AND RAINIER MESAS ON THE

    National Nuclear Security Administration (NNSA)

    AN OVERVIEW OF CULTURAL RESOURCES ON PAHUTE AND RAINIER MESAS ON THE NEVADA TEST SITE, NYE COUNTY, NEVADA by Lonnie C. Pippin with contributions by Jonathan 0. Davis Stephen R. Durand Ronald L. Reno and Robert K. Vierra Prepared for U.S. Department of Energy Nevada Operations Office Las Vegas, Nevada 1986 Technical Report No. 45 ISBN 0-945920-45-8 ISSN 0897-6376 ACKNOWLEDGEMENTS "Many i n d i v i d u a l s have contributed to the development of this o v e r v i e w and to each we owe a s p

  9. Historic, enthnohistoric and prehistoric cultural resource inventory. Final technical report, November 1980-May 1982

    SciTech Connect (OSTI)

    Not Available

    1982-01-01

    The goal of this study is to provide a literature search and write a historical narrative of the cultural significance of the study area for the proposed WyCoalGas Inc., pipeline, railroad, well fields, and coal gasification plant. The request for a cultural resource investigation states at a minimum the study shall be a literature search on the narrow one mile corridor along the proposed pipelines, areas included within the various facilities plus a one mile buffer surrounding these facilities. In addition, the study must be tied into appropriate local, state, and national history. The writer of this history has felt a responsibility for providing a realistic assessment of the themes of the study area's historical development. Several ideas have been concentrated upon: its American Indian heritage; the Euro-American's exploitive relationship with the region; and the overriding fragile, arid nature of its land. It is hoped that the government agencies and ultimately the energy company will feel a similiar responsibility toward the study area's historical integrity.

  10. Functional dissection of the Hox protein Abdominal-B in Drosophila cell culture

    SciTech Connect (OSTI)

    Zhai, Zongzhao [Key Laboratory of the Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beichen West Road, Chaoyang, Beijing 100101 (China) [Key Laboratory of the Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beichen West Road, Chaoyang, Beijing 100101 (China); CellNetworks - Cluster of Excellence, Centre for Organismal Studies (COS) Heidelberg, University of Heidelberg, D-69120 Heidelberg (Germany); Graduate School of Chinese Academy of Sciences, Beijing 100039 (China); Yang, Xingke, E-mail: yangxk@ioz.ac.cn [Key Laboratory of the Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beichen West Road, Chaoyang, Beijing 100101 (China)] [Key Laboratory of the Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beichen West Road, Chaoyang, Beijing 100101 (China); Lohmann, Ingrid, E-mail: ilohmann@flydev.org [CellNetworks - Cluster of Excellence, Centre for Organismal Studies (COS) Heidelberg, University of Heidelberg, D-69120 Heidelberg (Germany)] [CellNetworks - Cluster of Excellence, Centre for Organismal Studies (COS) Heidelberg, University of Heidelberg, D-69120 Heidelberg (Germany)

    2011-11-04

    Highlights: Black-Right-Pointing-Pointer ct340 CRM was identified to be the posterior spiracle enhancer of gene cut. Black-Right-Pointing-Pointer ct340 is under the direct transcriptional control of Hox protein Abd-B. Black-Right-Pointing-Pointer An efficient cloning system was developed to assay protein-DNA interaction. Black-Right-Pointing-Pointer New features of Abd-B dependent target gene regulation were detected. -- Abstract: Hox transcription factors regulate the morphogenesis along the anterior-posterior (A/P) body axis through the interaction with small cis-regulatory modules (CRMs) of their target gene, however so far very few Hox CRMs are known and have been analyzed in detail. In this study we have identified a new Hox CRM, ct340, which guides the expression of the cell type specification gene cut (ct) in the posterior spiracle under the direct control of the Hox protein Abdominal-B (Abd-B). Using the ct340 enhancer activity as readout, an efficient cloning system to generate VP16 activation domain fusion protein was developed to unambiguously test protein-DNA interaction in Drosophila cell culture. By functionally dissecting the Abd-B protein, new features of Abd-B dependent target gene regulation were detected. Due to its easy adaptability, this system can be generally used to map functional domains within sequence-specific transcriptional factors in Drosophila cell culture, and thus provide preliminary knowledge of the protein functional domain structure for further in vivo analysis.

  11. Annual review of cultural resource investigations by the Savannah River Archaeological Research Program. Fiscal year 1995

    SciTech Connect (OSTI)

    Brooks, M.J.; Brooks, R.D.; Sassaman, K.E.; Crass, D.C.

    1995-10-01

    The Savannah River Archaeological Research Program (SRARP) continued through FY95 with the United States Department of Energy to fulfill a threefold mission of cultural resource management, research, and public education at the Savannah River Site. Over 2,300 acres of land on the SRS came under cultural resources review in FY95. This activity entailed 30 field surveys, resulting in the recording of 86 new sites. Twenty-two existing sites within survey tract boundaries were revisited to update site file records. Research conducted by SRARP was reported in 11 papers and monographs published during FY95. SRARP staff also presented research results in 18 papers at professional meetings. Field research included several testing programs, excavations, and remote sensing at area sites, as well as data collection abroad. Seven grants were acquired by SRARP staff to support off-site research. In the area of heritage education, the SRARP expanded its activities in FY95 with a full schedule of classroom education, public outreach, and on-site tours. Volunteer excavations at the Tinker Creek site were continued with the Augusta Archaeological Society and other avocational groups, and other off-site excavations provided a variety of opportunities for field experience. Some 80 presentations, displays and tours were provided for schools, historical societies, civic groups, and environmental and historical awareness day celebrations. Additionally, SRARP staff taught four anthropology courses at area colleges.

  12. Algal Testbed Public Private Partnerships Workshop on Principles and Processes: Algae Culture Management, Production and Downstream Harvesting

    Broader source: Energy.gov [DOE]

    The Spring 2016 ATP3 workshop will occur May 16th-20th at Santa Fe Community College (SFCC) and the Los Alamos National Lab's New Mexico Consortium (LANL NMC). These unique facilities will give participants incredible insights into aspects across the algae value chain and the food, energy and water nexus. Lectures will cover the fundamentals of managing microalgal cultures, culturing techniques, measuring and analyzing biomass, harvesting and processing technologies, as well as life cycle analysis and operations at the production scale. Participants will have opportunities to work in the laboratory and learn how to measure culture density (cell counting and optical density), use a light and fluorescence microscope, use flow cytometry, and perform gravimetric analyses (dry weight and ash-free dry weight), and techniques necessary to analyze biomass compounds.

  13. Algae Testbed Public Private Partnership Workshop on Principles and Processes: Algae Culture Management, Production and Downstream Harvesting

    Broader source: Energy.gov [DOE]

    The spring 2016 Algae Testbed Public Private Partnership (ATP3) workshop will occur May 16–20, 2016, at Santa Fe Community College and Los Alamos National Laboratory's New Mexico Consortium Biological Laboratory. These unique facilities will give participants incredible insights into aspects across the algae value chain and the food, energy, and water nexus. Lectures will cover the fundamentals of managing microalgal cultures, culturing techniques, measuring and analyzing biomass, harvesting and processing technologies, and life-cycle analysis and operations at the production scale. Participants will have opportunities to work in the laboratory and learn how to measure culture density (cell counting and optical density), use a light and fluorescence microscope, use flow cytometry, and perform gravimetric analyses (dry weight and ash-free dry weight) and techniques necessary to analyze biomass compounds.

  14. An Approach for Assessing the Signature Quality of Various Chemical Assays when Predicting the Culture Media Used to Grow Microorganisms

    SciTech Connect (OSTI)

    Holmes, Aimee E.; Sego, Landon H.; Webb-Robertson, Bobbie-Jo M.; Kreuzer, Helen W.; Anderson, Richard M.; Unwin, Stephen D.; Weimar, Mark R.; Tardiff, Mark F.; Corley, Courtney D.

    2013-02-01

    We demonstrate an approach for assessing the quality of a signature system designed to predict the culture medium used to grow a microorganism. The system was comprised of four chemical assays designed to identify various ingredients that could be used to produce the culture medium. The analytical measurements resulting from any combination of these four assays can be used in a Bayesian network to predict the probabilities that the microorganism was grown using one of eleven culture media. We evaluated combinations of the signature system by removing one or more of the assays from the Bayes network. We measured and compared the quality of the various Bayes nets in terms of fidelity, cost, risk, and utility, a method we refer to as Signature Quality Metrics

  15. ADAPTIVE MANAGEMENT AND PLANNING MODELS FOR CULTURAL RESOURCES IN OIL & GAS FIELDS IN NEW MEXICO AND WYOMING

    SciTech Connect (OSTI)

    Peggy Robinson

    2004-07-01

    This report contains a summary of activities of Gnomon, Inc. and five subcontractors that have taken place during the first six months of 2004 (January 1, 2004-June 30, 2004) under the DOE-NETL cooperative agreement: ''Adaptive Management and Planning Models for Cultural Resources in Oil & Gas Fields in New Mexico and Wyoming'', DE-FC26-02NT15445. Although Gnomon and all five subcontractors completed tasks during these six months, most of the technical experimental work was conducted by the subcontractor, SRI Foundation (SRIF). SRIF created a sensitivity model for the Azotea Mesa area of southeastern New Mexico that rates areas as having a very good chance, a good chance, or a very poor chance of containing cultural resource sites. SRIF suggested that the results of the sensitivity model might influence possible changes in cultural resource management (CRM) practices in the Azote Mesa area of southeastern New Mexico.

  16. Production of bio-based materials using photobioreactors with binary cultures

    DOE Patents [OSTI]

    Beliaev, Alex S; Pinchuk, Grigoriy E; Hill, Eric A; Fredrickson, Jim K

    2013-08-27

    A method, device and system for producing preselected products, (either finished products or preselected intermediary products) from biobased precursors or CO.sub.2 and/or bicarbonate. The principal features of the present invention include a method wherein a binary culture is incubated with a biobased precursor in a closed system to transform at least a portion of the biobased precursor to a preselected product. The present invention provides a method of cultivation that does not need sparging of a closed bioreactor to remove or add a gaseous byproduct or nutrient from a liquid medium. This improvement leads to significant savings in energy consumption and allows for the design of photobioreactors of any desired shape. The present invention also allows for the use of a variety of types of waste materials to be used as the organic starting material.

  17. Cell culture arrays using micron-sized ferromagnetic ring-shaped thin films

    SciTech Connect (OSTI)

    Huang, Chen-Yu; Wei, Zung-Hang; Lai, Mei-Feng; Ger, Tzong-Rong

    2015-05-07

    Cell patterning has become an important technology for tissue engineering. In this research, domain walls are formed at the two ends of a ferromagnetic ring thin film after applying a strong external magnetic field, which can effectively attract magnetically labeled cells and control the position for biological cell. Magnetophoresis experiment was conducted to quantify the magnetic nanoparticle inside the cells. A ring-shaped magnetic thin films array was fabricated through photolithography. It is observed that magnetically labeled cells can be successfully attracted to the two ends of the ring-shaped magnetic thin film structure and more cells were attracted and further attached to the structures. The cells are co-cultured with the structure and kept proliferating; therefore, such ring thin film can be an important candidate for in-vitro biomedical chips or tissue engineering.

  18. Cultural Resource Investigations for the Resumption of Transient Testing of Nuclear Fuels and Material at the Idaho National Laboratory

    SciTech Connect (OSTI)

    Brenda R. Pace; Julie B. Williams

    2013-11-01

    The U. S. Department of Energy (DOE) has a need to test nuclear fuels under conditions that subject them to short bursts of intense, high-power radiation called transient testing in order to gain important information necessary for licensing new nuclear fuels for use in U.S. nuclear power plants, for developing information to help improve current nuclear power plant performance and sustainability, for improving the affordability of new generation reactors, for developing recyclable nuclear fuels, and for developing fuels that inhibit any repurposing into nuclear weapons. To meet this mission need, DOE is considering alternatives for re-use and modification of existing nuclear reactor facilities to support a renewed transient testing program. One alternative under consideration involves restarting the Transient Reactor Test (TREAT) reactor located at the Materials and Fuels Complex (MFC) on the Idaho National Laboratory (INL) site in southeastern Idaho. This report summarizes cultural resource investigations conducted by the INL Cultural Resource Management Office in 2013 to support environmental review of activities associated with restarting the TREAT reactor at the INL. These investigations were completed in order to identify and assess the significance of cultural resources within areas of potential effect associated with the proposed action and determine if the TREAT alternative would affect significant cultural resources or historic properties that are eligible for nomination to the National Register of Historic Places. No archaeological resources were identified in the direct area of potential effects for the project, but four of the buildings proposed for modifications are evaluated as historic properties, potentially eligible for nomination to the National Register of Historic Places. This includes the TREAT reactor (building #), control building (building #), guardhouse (building #), and warehouse (building #). The proposed re-use of these historic properties is consistent with original missions related to nuclear reactor testing and is expected to result in no adverse effects to their historic significance. Cultural resource investigations also involved communication with representatives from the Shoshone-Bannock Tribes to characterize cultural resources of potential tribal concern. This report provides a summary of the cultural resources inventoried and assessed within the defined areas of potential effect for the resumption of transient testing at the INL. Based on these analyses, proposed activities would have no adverse effects on historic properties within the APEs that have been defined. Other archaeological resources and cultural resources of potential concern to the Shoshone-Bannock Tribes and others that are located near the APEs are also discussed with regard to potential indirect impacts. The report concludes with general recommendations for measures to reduce impacts to all identified resources.

  19. Safety Series No. 75-INSAG-4, Safety Culture: A report by the International Nuclear Safety Advisory Group, International Atomic Energy Agency

    Broader source: Energy.gov [DOE]

    Safety Series No. 75-INSAG-4, Safety Culture: A report by the International Nuclear Safety Advisory Group, International Atomic Energy Agency, IAEA, 1991

  20. Method for sustaining microorganism culture in syngas fermentation process in decreased concentration or absence of various substrates

    DOE Patents [OSTI]

    Adams, Stephen S.; Scott, Syrona; Ko, Ching-Whan

    2015-05-19

    The present invention relates to methods for sustaining microorganism culture in a syngas fermentation reactor in decreased concentration or absence of various substrates comprising: adding carbon dioxide and optionally alcohol; maintaining free acetic acid concentrations; and performing the above mentioned steps within specified time.

  1. A Framework Approach to Evaluate Cross-Cultural Adaptation of Public Engagement Strategies for Radioactive Waste Management - 13430

    SciTech Connect (OSTI)

    Hermann, Laura

    2013-07-01

    The complex interplay of politics, economics and culture undermines attempts to define universal best practices for public engagement in the management of nuclear materials. In the international context, communicators must rely on careful adaptation and creative execution to make standard communication techniques succeed in their local communities. Nuclear professionals need an approach to assess and adapt culturally specific public engagement strategies to meet the demands of their particular political, economic and social structures. Using participant interviews and public sources, the Potomac Communications Group reviewed country-specific examples of nuclear-related communication efforts to provide insight into a proposed approach. The review considered a spectrum of cultural dimensions related to diversity, authority, conformity, proximity and time. Comparisons help to identify cross-cultural influences of various public engagement tactics and to inform a framework for communicators. While not prescriptive in its application, the framework offers a way for communicators to assess the salience of outreach tactics in specific situations. The approach can guide communicators to evaluate and tailor engagement strategies to achieve localized public outreach goals. (authors)

  2. The role of photo-osmotic adaptation in semi-continuous culture and lipid particle release from Dunaliella viridis

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Davis, Ryan W.; Carvalho, Benjamin J.; Jones, Howland D. T.; Singh, Seema

    2014-05-13

    Great efforts have been made to elucidate the phenotypic responses of alga to varying levels of nutrients, osmotic environments, and photosynthetically active radiation intensities, though the role of interactions among these variables is largely nebulous. We also describe a general method for establishing and maintaining semi-continuous cultures of the halophilic microalgal production strain, Dunaliella viridis, that is independent of variations in salinity and illumination intensity. Using this method, the cultures were evaluated to elucidate the overlapping roles of photosynthetic and osmotic adaptation on the accumulation and compositional variation of the biomass, photosynthetic productivity, and physiological biomarkers, as well as spectroscopicmore » and morphological details at the single-cell level. Correlation matrices defining the relationships among the observables and based on variation of the illumination intensity and salinity were constructed for predicting bioproduct yields for varying culture conditions. Following maintenance of stable cultures for 6-week intervals, phenotypic responses to photo-osmotic drift were explored using a combination of single-cell hyperspectral fluorescence imaging and flow cytometry. In addition to morphological changes, release of lipid microparticles from the cells that is disproportionate to cell lysis was observed under hypotonic drift, indicating the existence of a reversible membrane permeation mechanism in Dunaliella. Furthermore, this phenomenon introduces the potential for low-cost strategies for recovering lipids and pigments from the microalgae by minimizing the requirement for energy intensive harvesting and dewatering of the biomass. The results should be applicable to outdoor culture, where seasonal changes resulting in variable solar flux and precipitation and evaporation rates are anticipated.« less

  3. National Register of Historic Places multiple property documentation form -- Historic, archaeological, and traditional cultural properties of the Hanford Site, Washington

    SciTech Connect (OSTI)

    Nickens, P.R.

    1997-08-01

    The US Department of Energy`s Hanford Site encompasses an area of 560 square miles on the Columbia River in southeastern Washington. Since 1943, the Hanford Site has existed as a protected area for activities primarily related to the production of radioactive materials for national defense uses. For cultural resources on the Hanford Site, establishment of the nuclear reservation as a high security area, with public access restricted, has resulted in a well-protected status, although no deliberate resource protection measures were in effect to mitigate effects of facilities construction and associated activities. Thus, the Hanford Site contains an extensive record of aboriginal archaeological sites and Native American cultural properties, along with pre-Hanford Euro-American sites (primarily archaeological in nature with the removal of most pre-1943 structures), and a considerable number of Manhattan Project/Cold War era buildings and structures. The recent mission change from production to clean up and disposal of DOE lands created a critical need for development and implementation of new and different cultural resource management strategies. DOE-RL has undertaken a preservation planning effort for the Hanford Site. The intent of this Plan is to enable DOE-RL to organize data and develop goals, objectives, and priorities for the identification, evaluation, registration, protection, preservation, and enhancement of the Site`s historical and cultural properties. Decisions made about the identification, evaluation, registration and treatment of historic properties are most aptly made when relationships between individual properties and other similar properties are considered. The historic context and the multiple property documentation (NTD) process provides DOE-RL the organizational framework for these decisions. Once significant patterns are identified, contexts developed, and expected properties are defined, the NTD process provides the foundation for future decisions concerning the management of significant cultural resources on the Hanford Site.

  4. The role of photo-osmotic adaptation in semi-continuous culture and lipid particle release from Dunaliella viridis

    SciTech Connect (OSTI)

    Davis, Ryan W.; Carvalho, Benjamin J.; Jones, Howland D. T.; Singh, Seema

    2014-05-13

    Great efforts have been made to elucidate the phenotypic responses of alga to varying levels of nutrients, osmotic environments, and photosynthetically active radiation intensities, though the role of interactions among these variables is largely nebulous. We also describe a general method for establishing and maintaining semi-continuous cultures of the halophilic microalgal production strain, Dunaliella viridis, that is independent of variations in salinity and illumination intensity. Using this method, the cultures were evaluated to elucidate the overlapping roles of photosynthetic and osmotic adaptation on the accumulation and compositional variation of the biomass, photosynthetic productivity, and physiological biomarkers, as well as spectroscopic and morphological details at the single-cell level. Correlation matrices defining the relationships among the observables and based on variation of the illumination intensity and salinity were constructed for predicting bioproduct yields for varying culture conditions. Following maintenance of stable cultures for 6-week intervals, phenotypic responses to photo-osmotic drift were explored using a combination of single-cell hyperspectral fluorescence imaging and flow cytometry. In addition to morphological changes, release of lipid microparticles from the cells that is disproportionate to cell lysis was observed under hypotonic drift, indicating the existence of a reversible membrane permeation mechanism in Dunaliella. Furthermore, this phenomenon introduces the potential for low-cost strategies for recovering lipids and pigments from the microalgae by minimizing the requirement for energy intensive harvesting and dewatering of the biomass. The results should be applicable to outdoor culture, where seasonal changes resulting in variable solar flux and precipitation and evaporation rates are anticipated.

  5. Transcriptional and metabolic flux profiling of triadimefon effects on cultured hepatocytes

    SciTech Connect (OSTI)

    Iyer, Vidya V.; Ovacik, Meric A.; Androulakis, Ioannis P.; Roth, Charles M.; Ierapetritou, Marianthi G.

    2010-11-01

    Conazoles are a class of azole fungicides used to prevent fungal growth in agriculture, for treatment of fungal infections, and are found to be tumorigenic in rats and/or mice. In this study, cultured primary rat hepatocytes were treated to two different concentrations (0.3 and 0.15 mM) of triadimefon, which is a tumorigenic conazole in rat and mouse liver, on a temporal basis with daily media change. Following treatment, cells were harvested for microarray data ranging from 6 to 72 h. Supernatant was collected daily for three days, and the concentrations of various metabolites in the media and supernatant were quantified. Gene expression changes were most significant following exposure to 0.3 mM triadimefon and were characterized mainly by metabolic pathways related to carbohydrate, lipid and amino acid metabolism. Correspondingly, metabolic network flexibility analysis demonstrated a switch from fatty acid synthesis to fatty acid oxidation in cells exposed to triadimefon. It is likely that fatty acid oxidation is active in order to supply energy required for triadimefon detoxification. In 0.15 mM triadimefon treatment, the hepatocytes are able to detoxify the relatively low concentration of triadimefon with less pronounced changes in hepatic metabolism.

  6. Utilisation of single added fatty acids by consortia of digester sludge in batch culture

    SciTech Connect (OSTI)

    Wagner, Andreas Otto; Gstrauntaler, Gudrun; Illmer, Paul

    2010-10-15

    Inocula derived from an anaerobic digester were used to study (i) their potential for methane production and (ii) the utilisation rates of different short chain fatty acids (SCFAs) by the microbial community in defined media with mono-carbon sources (formic-, acetetic-, propionic-, butyric acid) in batch culture. It could be demonstrated that the microbial reactor population could be transferred successfully to the lab, and its ability to build up methane was present even with deteriorating biogas plant performance. Therefore, this reduction in performance of the biogas plant was not due to a decrease in abundance, but due to an inactivity of the microbial community. Generally, the physico-chemical properties of the biogas plant seemed to favour hydrogenotrophic methanogens, as seen by the high metabolisation rates of formate compared with all other carbon sources. In contrast, acetoclastic methanogenesis could be shown to play a minor role in the methane production of the investigated biogas plant, although the origin of up to 66% of methane is generally suggested to be generated through acetoclastic pathway.

  7. Molecular Predictors of 3D Morphogenesis by Breast Cancer Cell Lines in 3D Culture

    SciTech Connect (OSTI)

    Han, Ju; Chang, Hang; Giricz, Orsi; Lee, Genee; Baehner, Frederick; Gray, Joe; Bissell, Mina; Kenny, Paraic; Parvin, Bahram

    2010-02-01

    Correlative analysis of molecular markers with phenotypic signatures is the simplest model for hypothesis generation. In this paper, a panel of 24 breast cell lines was grown in 3D culture, their morphology was imaged through phase contrast microscopy, and computational methods were developed to segment and represent each colony at multiple dimensions. Subsequently, subpopulations from these morphological responses were identified through consensus clustering to reveal three clusters of round, grape-like, and stellate phenotypes. In some cases, cell lines with particular pathobiological phenotypes clustered together (e.g., ERBB2 amplified cell lines sharing the same morphometric properties as the grape-like phenotype). Next, associations with molecular features were realized through (i) differential analysis within each morphological cluster, and (ii) regression analysis across the entire panel of cell lines. In both cases, the dominant genes that are predictive of the morphological signatures were identified. Specifically, PPAR? has been associated with the invasive stellate morphological phenotype, which corresponds to triple-negative pathobiology. PPAR? has been validated through two supporting biological assays.

  8. Estrogen inhibits cell cycle progression and retinoblastoma phosphorylation in rhesus ovarian surface epithelial cell culture

    SciTech Connect (OSTI)

    Wright, Jay W.; Stouffer, Richard L.; Rodland, Karin D.

    2003-10-31

    Estrogen promotes the growth of some ovarian cancer cells at nanomolar concentrations, but has been shown to inhibit growth of normal ovarian surface epithelial (OSE) cells at micromolar concentrations (1?g/ml). OSE cells express the estrogen receptor (ER)-?, and are the source of 90% of various cancers. The potential sensitivity of OSE cells to estrogen stresses the importance of understanding the estrogen-dependent mechanisms at play in OSE proliferation and transformation, as well as in anticancer treatment. We investigated the effects of estradiol on cell proliferation in vitro, and demonstrate an intracellular locus of action of estradiol in cultured rhesus ovarian surface epithelial (RhOSE) cells. We show that ovarian and breast cells are growth-inhibited by micromolar concentration of estradiol and that this inhibition correlates with estrogen receptor expression. We further show that normal rhesus OSE cells do not activate ERK or Akt in response to estradiol nor does estradiol block the ability of serum to stimulate ERK or induce cyclin D expression. Contrarily, estradiol inhibits serum-dependent retinoblastoma protein (Rb) phosphorylation and blocks DNA synthesis. This inhibition does not formally arrest cells and is reversible within hours of estrogen withdrawal. Our data are consistent with growth inhibition by activation of Rb and indicate that sensitivity to hormone therapy in anticancer treatment can be modulated by cell cycle regulators downstream of the estrogen receptor.

  9. Towards breaking the silence between the two cultures: Engineering and the other humanities

    SciTech Connect (OSTI)

    Prausnitz, John M.

    2003-01-01

    Over the years, I have attended numerous meetings like this one at the Center for the Study of Higher Education. I have noticed that most of the attendees, and certainly the speakers, tend to come from the social sciences or humanities. Only rarely do I see anyone here from Berkeley's College of Chemistry or College of Engineering. I come from the College of Chemistry that includes Berkeley's Department of Chemical Engineering. I mention this background to indicate that my remarks here are necessarily less abstract, less theoretical and less philosophical than those of most previous seminar speakers. My remarks are probably somewhat simplistic because, as a result of my engineering background, I tend to focus less on generalities and principles, giving more attention to possible solutions of limited practical problems. About seven weeks ago, I was invited to attend a conference sponsored by the Berlin Academy of Sciences where ''Sciences'' is not confined to natural sciences but includes also humanities and social sciences. The topic of the Conference was ''Sprachlosigkeit'', a German word that roughly translated means inability to speak. The subtitle was ''Silence Between the Disciplines''. The German universities are worried about the increasing gulf between what is often called ''the two cultures''. This gulf is a problem everywhere, including Berkeley, but it is my impression that it is much worse in Europe than in America. The International Conference in Berlin was attended by some big names including the presidents of the Humboldt University in Berlin, the University of Uppsala in Sweden and the Central European University of Budapest, as well as some distinguished academics from a variety of institutions including Harvard and Stanford, and the presidents of three major funding organizations: The Volkswagen Foundation, The German National Science Foundation and the Max Planck Society. The speakers were primarily from the humanities and social sciences but there also were two physicists, two biologists and one mathematician. I was the only speaker from Engineering. Following Karl Pister's generous invitation to present a seminar here, I would like to tell you in a severely revised form some of what I tried to say at the Conference in Berlin. When talking to colleagues in the Humanities and Social Sciences, one of my most difficult tasks is to persuade them that those who practice science and engineering are not confined to cold logic and bloodless experiments but that instead, science and engineering is a human enterprise, subject to all the paradoxes, inconsistencies and aesthetic judgments that characterize the human condition. When scientists and engineers are at their best, they suffer the same frustrations, self-doubt, and delights common to artists or novelists or literary critics, or to anyone who creates to extend knowledge and awareness. Like all other members of a university, scientists and engineers strive to make a better world; in participating in this common activity, they necessarily operate within the borders set by our common human nature. I stress this common activity and this common purpose because ultimately, it is this commonality that provides the only sound basis for overcoming the alienation, this Sprachlosigkeit, that under another name, is known as the silence between the cultures. I can best illustrate what I have just tried to say with a quotation and a cartoon. The quotation is a famous one, from Theodor Adorno: ''The most successful artistic creations are those that are lucky at their most dubious places''. Adorno was referring to painting, sculpture, literature and especially to music. However, what he said also holds for science and engineering. All students of history know that without occasional miracles, there would be little progress. Along with all the other humanities, sciences and engineering could not succeed without them. I would like to discuss three topics and again, I want to apologize for my simplistic views. (1) Two structural reasons that contribute to poor communicatio

  10. Recent developments in atomic/nuclear methodologies used for the study of cultural heritage objects

    SciTech Connect (OSTI)

    Appoloni, Carlos Roberto

    2013-05-06

    Archaeometry is an area established in the international community since the 60s, with extensive use of atomic-nuclear methods in the characterization of art, archaeological and cultural heritage objects in general. In Brazil, however, until the early '90s, employing methods of physics, only the area of archaeological dating was implemented. It was only after this period that Brazilian groups became involved in the characterization of archaeological and art objects with these methodologies. The Laboratory of Applied Nuclear Physics, State University of Londrina (LFNA/UEL) introduced, pioneered in 1994, Archaeometry and related issues among its priority lines of research, after a member of LFNA has been involved in 1992 with the possibilities of tomography in archaeometry, as well as the analysis of ancient bronzes by EDXRF. Since then, LFNA has been working with PXRF and Portable Raman in several museums in Brazil, in field studies of cave paintings and in the laboratory with material sent by archaeologists, as well as carrying out collaborative work with new groups that followed in this area. From 2003/2004 LAMFI/DFN/IFUSP and LIN/COPPE/UFRJ began to engage in the area, respectively with methodologies using ion beams and PXRF, then over time incorporating other techniques, followed later by other groups. Due to the growing number of laboratories and institutions/archaeologists/conservators interested in these applications, in may 2012 was created a network of available laboratories, based at http://www.dfn.if.usp.br/lapac. It will be presented a panel of recent developments and applications of these methodologies by national groups, as well as a sampling of what has been done by leading groups abroad.

  11. Effect of acetic acid on lipid accumulation by glucose-fed activated sludge cultures

    SciTech Connect (OSTI)

    Mondala, Andro; Hernandez, Rafael; French, Todd; McFarland, Linda; Sparks, Darrell; Holmes, William; Haque, Monica

    2012-01-01

    The effect of acetic acid, a lignocellulose hydrolysis by-product, on lipid accumulation by activated sludge cultures grown on glucose was investigated. This was done to assess the possible application of lignocellulose as low-cost and renewable fermentation substrates for biofuel feedstock production. Results: Biomass yield was reduced by around 54% at a 2 g L -1 acetic acid dosage but was increased by around 18% at 10 g L -1 acetic acid dosage relative to the control run. The final gravimetric lipid contents at 2 and 10 g L -1 acetic acid levels were 12.5 ???± 0.7% and 8.8 ???± 3.2% w/w, respectively, which were lower than the control (17.8 ???± 2.8% w/w). However, biodiesel yields from activated sludge grown with acetic acid (5.6 ???± 0.6% w/w for 2 g L -1 acetic acid and 4.2 ???± 3.0% w/w for 10 g L -1 acetic acid) were higher than in raw activated sludge (1-2% w/w). The fatty acid profiles of the accumulated lipids were similar with conventional plant oil biodiesel feedstocks. Conclusions: Acetic acid enhanced biomass production by activated sludge at high levels but reduced lipid production. Further studies are needed to enhance acetic acid utilization by activated sludge microorganisms for lipid biosynthesis.

  12. Breckinridge Project, initial effort. Report VII, Volume III. Cultural resource assessment socioeconomic background data

    SciTech Connect (OSTI)

    Macfarlane, Heather; Janzen, Donald E.

    1980-11-26

    This report has been prepared in conjunction with an environmental baseline study for a commercial coal conversion facility being conducted by Ashland Synthetic Fuels, Inc. (ASFI) and Airco Energy Company (AECO). This report represents a cultural resource assessment for the proposed plant site and two potential solid waste disposal areas. This assessment presents data collected by Dames and Moore during a recent archaeological reconnaissance of the unsurveyed southeastern portion of the proposed plant site and two potential solid waste disposal areas. Also, results of two previous surveys on the northern and southwestern portion of the plant site for American Smelting and Refining Company (ASARCO) and Kentucky Utilities are included. The Dames and Moore survey of the southeastern portion of the plant site identified one archaeological site, three standing structures and one historic cemetery. In addition 47 archaeological sites and six standing structures are known from two previous surveys of the remainder of the plant site (Cowan 1975 and Turnbow et al 1980). Eleven of the previously recorded archaeological sites were recommended for further assessment to evaluate their potential for inclusion within the Holt Bottoms Archaeological District currently listed on the National Register of Historic Places. None of the archaeological sites or standing structures located within the plant site during the Dames and Moore survey were recommended for further assessment. A total of eight archaeological sites were located during the Dames and Moore survey of the two potential solid waste disposal areas. Of this total only two sites were recommended for further assessment. Also, one previously unknown historic cemetry was located in the southernmost potential waste disposal area.

  13. FROM POLLUTER TO PROTECTOR: THE CHALLENGES OF CHANGING CULTURE, OPERATIONS AND IMAGE

    SciTech Connect (OSTI)

    ZIMMERMAN,E.A.

    2000-07-25

    Brookhaven National Laboratory is a US Department of Energy (DOE) multi-program research facility, located in Suffolk County in Long Island, New York. In 1997, groundwater monitoring revealed significant levels of tritium contamination from a reactor fuel pool. The public reaction was immediate and intense. In an unprecedented move, DOE terminated the contractor and rebid the Laboratory management contract. Brookhaven Science Associates (BSA), a partnership between Battelle and the State University of New York at Stony Brook, won the contract. BSA faced enormous challenges in the environmental area. One was changing the culture and mindset of staff and management with regard to environmental protection. Another was changing operations to fully integrate environmental stewardship into all facets of the Laboratory's missions. And finally, BSA needed to change the Laboratory's public image. This paper describes how BSA faced those challenges. DOE and BSA entered into a voluntary agreement with the US Environmental Protection Agency to conduct an in-depth evaluation of the environmental aspects and impacts of all activities onsite. A project was initiated to explore environmental problems associated with historical activities. BSA also has made significant investments in developing and implementing an Environmental Management System that is consistent with the ISO 14001 standard, with enhancements in the area of compliance assurance. Finally, BSA improved its community involvement program to develop and maintain a positive, proactive and constructive relationship with stakeholders. This paper discusses the approach and results of these efforts. For example, one of major facilities at Brookhaven National Laboratory was recently certified to the ISO 14001 standard, becoming the first Long Island-based organization and the first DOE Office of Science facility to achieve registration.

  14. Cultural Resource Investigation for the Materials and Fuels Complex Wastewater System Upgrade at the Idaho National Laboratory

    SciTech Connect (OSTI)

    Brenda R. Pace; Julie B raun Williams; Hollie Gilbert; Dino Lowrey; Julie Brizzee

    2010-05-01

    The Materials and Fuels Complex (MFC) located in Bingham County at the Idaho National Laboratory (INL) in southeastern Idaho is considering several alternatives to upgrade wastewater systems to meet future needs at the facility. In April and May of 2010, the INL Cultural Resource Management Office conducted archival searches, archaeological field surveys, and coordination with the Shoshone-Bannock Tribes to identify cultural resources that may be adversely affected by the proposed construction and to provide recommendations to protect any resources listed or eligible for listing on the National Register of Historic Places. These investigations showed that one National Register-eligible archaeological site is located on the boundary of the area of potential effects for the wastewater upgrade. This report outlines protective measures to help ensure that this resource is not adversely affected by construction.

  15. Adaptive Management and Planning Models for Cultural Resources in Oil and Gas Fields in New Mexico and Wyoming

    SciTech Connect (OSTI)

    Eckerle, William; Hall, Stephen

    2005-12-30

    In 2002, Gnomon, Inc., entered into a cooperative agreement with the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) for a project entitled, Adaptive Management and Planning Models for Cultural Resources in Oil and Gas Fields in New Mexico and Wyoming (DE-FC26-02NT15445). This project, funded through DOE’s Preferred Upstream Management Practices grant program, examined cultural resource management practices in two major oil- and gas-producing areas, southeastern New Mexico and the Powder River Basin of Wyoming (Figure 1). The purpose of this project was to examine how cultural resources have been investigated and managed and to identify more effective management practices. The project also was designed to build information technology and modeling tools to meet both current and future management needs. The goals of the project were described in the original proposal as follows: Goal 1. Create seamless information systems for the project areas. Goal 2. Examine what we have learned from archaeological work in the southeastern New Mexico oil fields and whether there are better ways to gain additional knowledge more rapidly or at a lower cost. Goal 3. Provide useful sensitivity models for planning, management, and as guidelines for field investigations. Goal 4. Integrate management, investigation, and decision- making in a real-time electronic system. Gnomon, Inc., in partnership with the Wyoming State Historic Preservation Office (WYSHPO) and Western GeoArch Research, carried out the Wyoming portion of the project. SRI Foundation, in partnership with the New Mexico Historic Preservation Division (NMHPD), Statistical Research, Inc., and Red Rock Geological Enterprises, completed the New Mexico component of the project. Both the New Mexico and Wyoming summaries concluded with recommendations how cultural resource management (CRM) processes might be modified based on the findings of this research.

  16. Toxicity of polychlorinated diphenyl ethers in hydra attenuata and in rat whole-embryo culture. Master's thesis

    SciTech Connect (OSTI)

    Becker, M.C.

    1991-05-01

    Polychlorinated diphenyl ethers (PCDEs) are a class of biaryl compounds that have little commercial application, but appear to be widespread in the environment. They have been found in wood preservative waste dumpsites and in fly ash from municipal waste incinerators. They have been detected in bird eggs and tissues, fish, and other edible marine organisms in the United States, Canada, and Europe. There are limited reports in the extant literature on the toxicity of PCDEs. This study was designed to evaluate the toxicity of selected PCDEs in cultures of Hydra attenuata and post-implantation rat whole embryos. The toxicity of several closely related polychlorinated biphenyls (PCBs) was evaluated in both cultures and 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) was evaluated in whole embryo culture. Embryonic growth and development parameters (yolk sac diameter, crown-rump length, somite count, and DNA and protein content) and gross morphology were determined. Findings indicated that these chemicals were neither embryotoxic nor teratogenic. Thus, the PCDEs, which elicit other diverse toxic and biochemical responses in rodents, are relatively inactive in these bioassays for developmental toxicity.

  17. Top Crop Wind Farm | Open Energy Information

    Open Energy Info (EERE)

    In Service Owner Horizon-EDPR Developer Horizon-EDPR Location GrundyLivingstonLa Salle Counties IL Coordinates 41.159826, -88.637381 Show Map Loading map......

  18. Regional Feedstock Partnership: Woody Crops Presentation for...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    ... is informing policy and science with data created through its innovative protocol. * The coordinated national structure offers one-of-a-kind data, information, and knowledge on ...

  19. The usefulness of three-dimensional cell culture in induction of cancer stem cells from esophageal squamous cell carcinoma cell lines

    SciTech Connect (OSTI)

    Fujiwara, Daisuke; Kato, Kazunori; Department of Atopy Research Center, Juntendo University School of Medicine, 2-1-1 Hongo, Bunkyo-ku, Tokyo 113-8421 ; Nohara, Shigeo; Iwanuma, Yoshimi; Kajiyama, Yoshiaki

    2013-05-17

    Highlights: Spheroids were created from esophageal carcinoma cells using NanoCulture Plates. The proportion of strongly ALDH-positive cells increased in 3-D culture. Expression of cancer stem cell-related genes was enhanced in 3-D culture. CA-9 expression was enhanced, suggesting hypoxia had been induced in 3-D culture. Drug resistance was increased. 3-D culture is useful for inducing cancer stem cells. -- Abstract: In recent years, research on resistance to chemotherapy and radiotherapy in cancer treatment has come under the spotlight, and researchers have also begun investigating the relationship between resistance and cancer stem cells. Cancer stem cells are assumed to be present in esophageal cancer, but experimental methods for identification and culture of these cells have not yet been established. To solve this problem, we created spheroids using a NanoCulture Plate (NCP) for 3-dimensional (3-D) cell culture, which was designed as a means for experimentally reproducing the 3-D structures found in the body. We investigated the potential for induction of cancer stem cells from esophageal cancer cells. Using flow cytometry we analyzed the expression of surface antigen markers CD44, CD133, CD338 (ABCG2), CD318 (CDCP1), and CD326 (EpCAM), which are known cancer stem cell markers. None of these surface antigen markers showed enhanced expression in 3-D cultured cells. We then analyzed aldehyde dehydrogenase (ALDH) enzymatic activity using the ALDEFLUOR reagent, which can identify immature cells such as stem cells and precursor cells. 3-D-cultured cells were strongly positive for ALDH enzyme activity. We also analyzed the expression of the stem cell-related genes Sox-2, Nanog, Oct3/4, and Lin28 using RT-PCR. Expression of Sox-2, Nanog, and Lin28 was enhanced. Analysis of expression of the hypoxic surface antigen marker carbonic anhydrase-9 (CA-9), which is an indicator of cancer stem cell induction and maintenance, revealed that CA-9 expression was enhanced, suggesting that hypoxia had been induced. Comparison of cancer drug resistance using cisplatin and doxorubicin in 3-D-cultured esophageal cancer cells showed that cancer drug resistance had increased. These results indicate that 3-D culture of esophageal squamous cell carcinoma lines is a useful method for inducing cancer stem cells.

  20. Hepatocyte-derived cultured cells with unusual cytoplasmic keratin-rich spheroid bodies

    SciTech Connect (OSTI)

    Delavalle, Pierre-Yves; Alsaleh, Khaled; Pillez, Andre; Cocquerel, Laurence; Universite Lille Nord de France, F-59000 Lille; Institut Pasteur de Lille, F-59019 Lille ; Allet, Cecile; Dumont, Patrick; Institut Pasteur de Lille, F-59019 Lille; CNRS UMR 8161, F-59021 Lille ; Loyens, Anne; Leteurtre, Emmanuelle; Omary, M. Bishr; Dubuisson, Jean; Rouille, Yves; Universite Lille Nord de France, F-59000 Lille; Institut Pasteur de Lille, F-59019 Lille ; Wychowski, Czeslaw; Universite Lille Nord de France, F-59000 Lille; Institut Pasteur de Lille, F-59019 Lille

    2011-11-01

    Cytoplasmic inclusions are found in a variety of diseases that are characteristic morphological features of several hepatic, muscular and neurodegenerative disorders. They display a predominantly filamentous ultrastructure that is also observed in malignant rhabdoid tumor (MRT). A cellular clone containing an intracytoplasmic body was isolated from hepatocyte cell culture, and in the present study we examined whether this body might be related or not to Mallory-Denk body (MDB), a well characterized intracytoplasmic inclusion, or whether this cellular clone was constituted by malignant rhabdoid tumor cells. The intracytoplasmic body was observed in electron microscopy (EM), confocal immunofluorescence microscopy and several proteins involved in the formation of its structure were identified. Using light microscopy, a spheroid body (SB) described as a single regular-shaped cytoplasmic body was observed in cells. During cytokinesis, the SB was disassembled and reassembled in a way to reconstitute a unique SB in each progeny cell. EM examination revealed that the SB was not surrounded by a limiting membrane. However, cytoplasmic filaments were concentrated in a whorled array. These proteins were identified as keratins 8 and 18 (K8/K18), which formed the central core of the SB surrounded by a vimentin cage-like structure. This structure was not related to Mallory-Denk body or aggresome since no aggregated proteins were located in SB. Moreover, the structure of SB was not due to mutations in the primary sequence of K8/K18 and vimentin since no difference was observed in the mRNA sequence of their genes, isolated from Huh-7 and Huh-7w7.3 cells. These data suggested that cellular factor(s) could be responsible for the SB formation process. Aggregates of K18 were relocated in the SB when a mutant of K18 inducing disruption of K8/K18 IF network was expressed in the cellular clone. Furthermore, the INI1 protein, a remodeling-chromatin factor deficient in rhabdoid cells, which contain a spheroid perinuclear inclusion body, was found in our cellular clone. In conclusion, our data suggest that Huh-7w7.3 cells constitute an excellent model for determining the cellular factor(s) involved in the process of spheroid perinuclear body formation.

  1. Supplemnental Volume - Independent Oversight Assessment of the Nuclear Safety Culture and Management of Nuclear Safety Concerns at the Hanford Site Waste Treatment and Immobilization Plant, January 2012

    Energy Savers [EERE]

    Supplemental Volume Independent Oversight Assessment of Nuclear Safety Culture and Management of Nuclear Safety Concerns at the Hanford Site Waste Treatment and Immobilization Plant January 2012 Office of Enforcement and Oversight Office of Health, Safety and Security U.S. Department of Energy Office of Health, Safety and Security HSS i Independent Oversight Assessment of Safety Culture and Management of Nuclear Safety Concerns at the Hanford Site Waste Treatment and Immobilization Plant

  2. Independent Oversight Assessment of the Nuclear Safety Culture and Management of Nuclear Safety Concerns at the Hanford Site Waste Treatment and Immobilization Plant, January 2012

    Office of Environmental Management (EM)

    Health, Safety and Security HSS Independent Oversight Assessment of Nuclear Safety Culture and Management of Nuclear Safety Concerns at the Hanford Site Waste Treatment and Immobilization Plant January 2012 Office of Enforcement and Oversight Office of Health, Safety and Security U.S. Department of Energy Enforcement and Oversight Abbreviations Used in this Report i Executive Summary iii Recommendations xi 1.0 Introduction 1 1.1 Background 2 1.2 Scope and Methodology 6 2.0 Current Safety Culture

  3. Class I cultural resource overview for oil shale and tar sands areas in Colorado, Utah and Wyoming.

    SciTech Connect (OSTI)

    O'Rourke, D.; Kullen, D.; Gierek, L.; Wescott, K.; Greby, M.; Anast, G.; Nesta, M.; Walston, L.; Tate, R.; Azzarello, A.; Vinikour, B.; Van Lonkhuyzen, B.; Quinn, J.; Yuen, R.; Environmental Science Division

    2007-11-01

    In August 2005, the U.S. Congress enacted the Energy Policy Act of 2005, Public Law 109-58. In Section 369 of this Act, also known as the 'Oil Shale, Tar Sands, and Other Strategic Unconventional Fuels Act of 2005', Congress declared that oil shale and tar sands (and other unconventional fuels) are strategically important domestic energy resources that should be developed to reduce the nation's growing dependence on oil from politically and economically unstable foreign sources. The Bureau of Land Management (BLM) is developing a Programmatic Environmental Impact Statement (PEIS) to evaluate alternatives for establishing commercial oil shale and tar sands leasing programs in Colorado, Wyoming, and Utah. This PEIS evaluates the potential impacts of alternatives identifying BLM-administered lands as available for application for commercial leasing of oil shale resources within the three states and of tar sands resources within Utah. The scope of the analysis of the PEIS also includes an assessment of the potential effects of future commercial leasing. This Class I cultural resources study is in support of the Draft Oil Shale and Tar Sands Resource Management Plan Amendments to Address Land Use Allocations in Colorado, Utah, and Wyoming and Programmatic Environmental Impact Statement and is an attempt to synthesize archaeological data covering the most geologically prospective lands for oil shale and tar sands in Colorado, Utah, and Wyoming. This report is based solely on geographic information system (GIS) data held by the Colorado, Utah, and Wyoming State Historic Preservation Offices (SHPOs). The GIS data include the information that the BLM has provided to the SHPOs. The primary purpose of the Class I cultural resources overview is to provide information on the affected environment for the PEIS. Furthermore, this report provides recommendations to support planning decisions and the management of cultural resources that could be impacted by future oil shale and tar sands resource development.

  4. Effects of FGF-2 on human adipose tissue derived adult stem cells morphology and chondrogenesis enhancement in Transwell culture

    SciTech Connect (OSTI)

    Kabiri, Azadeh; Esfandiari, Ebrahim; Hashemibeni, Batool; Kazemi, Mohammad; Mardani, Mohammad; Esmaeili, Abolghasem

    2012-07-27

    Highlights: Black-Right-Pointing-Pointer We investigated effects of FGF-2 on hADSCs. Black-Right-Pointing-Pointer We examine changes in the level of gene expressions of SOX-9, aggrecan and collagen type II and type X. Black-Right-Pointing-Pointer FGF-2 induces chondrogenesis in hADSCs, which Bullet Increasing information will decrease quality if hospital costs are very different. Black-Right-Pointing-Pointer The result of this study may be beneficial in cartilage tissue engineering. -- Abstract: Injured cartilage is difficult to repair due to its poor vascularisation. Cell based therapies may serve as tools to more effectively regenerate defective cartilage. Both adult mesenchymal stem cells (MSCs) and human adipose derived stem cells (hADSCs) are regarded as potential stem cell sources able to generate functional cartilage for cell transplantation. Growth factors, in particular the TGF-b superfamily, influence many processes during cartilage formation, including cell proliferation, extracellular matrix synthesis, maintenance of the differentiated phenotype, and induction of MSCs towards chondrogenesis. In the current study, we investigated the effects of FGF-2 on hADSC morphology and chondrogenesis in Transwell culture. hADSCs were obtained from patients undergoing elective surgery, and then cultured in expansion medium alone or in the presence of FGF-2 (10 ng/ml). mRNA expression levels of SOX-9, aggrecan and collagen type II and type X were quantified by real-time polymerase chain reaction. The morphology, doubling time, trypsinization time and chondrogenesis of hADSCs were also studied. Expression levels of SOX-9, collagen type II, and aggrecan were all significantly increased in hADSCs expanded in presence of FGF-2. Furthermore FGF-2 induced a slender morphology, whereas doubling time and trypsinization time decreased. Our results suggest that FGF-2 induces hADSCs chondrogenesis in Transwell culture, which may be beneficial in cartilage tissue engineering.

  5. International School of Innovative Technology for Cleaning the Environment, Ettore Majorana Centre for Scientific Culture: Erice, Sicily, Italy

    SciTech Connect (OSTI)

    Ragaini, R.C.

    1994-06-01

    The International School of Innovative Technology for Cleaning the Environment was founded at the Ettore Majorana Centre for Scientific Culture (EMCSC), the seat of the World Laboratory Mediterranean Branch, in 1989. The School primarily organizes and hosts training courses and advanced study courses addressing state-of-the-art technologies to clean the environment, minimize waste generation, prevent pollution, and identify strategies to choose environmentally resilient sites and processes for new industrial installations. The School also participates in facilitating multi-national research projects for developing countries under the auspices of the World Laboratory and other sponsoring agencies.

  6. Changing Safety Culture, One Step at a Time: The Value of the DOE-VPP Program at PNNL

    SciTech Connect (OSTI)

    Wright, Patrick A.; Isern, Nancy G.

    2005-02-01

    The primary value of the Pacific Northwest National Laboratory (PNNL) Voluntary Protection Program (VPP) is the ongoing partnership between management and staff committed to change Laboratory safety culture one step at a time. VPP enables PNNL's safety and health program to transcend a top-down, by-the-book approach to safety, and it also raises grassroots safety consciousness by promoting a commitment to safety and health 24 hours a day, 7 days a week. PNNL VPP is a dynamic, evolving program that fosters innovative approaches to continuous improvement in safety and health performance at the Laboratory.

  7. Predictivity of dog co-culture model, primary human hepatocytes and HepG2 cells for the detection of hepatotoxic drugs in humans

    SciTech Connect (OSTI)

    Atienzar, Franck A.; Novik, Eric I.; Gerets, Helga H.; Parekh, Amit; Delatour, Claude; Cardenas, Alvaro; MacDonald, James; Yarmush, Martin L.; Dhalluin, Stphane

    2014-02-15

    Drug Induced Liver Injury (DILI) is a major cause of attrition during early and late stage drug development. Consequently, there is a need to develop better in vitro primary hepatocyte models from different species for predicting hepatotoxicity in both animals and humans early in drug development. Dog is often chosen as the non-rodent species for toxicology studies. Unfortunately, dog in vitro models allowing long term cultures are not available. The objective of the present manuscript is to describe the development of a co-culture dog model for predicting hepatotoxic drugs in humans and to compare the predictivity of the canine model along with primary human hepatocytes and HepG2 cells. After rigorous optimization, the dog co-culture model displayed metabolic capacities that were maintained up to 2 weeks which indicates that such model could be also used for long term metabolism studies. Most of the human hepatotoxic drugs were detected with a sensitivity of approximately 80% (n = 40) for the three cellular models. Nevertheless, the specificity was low approximately 40% for the HepG2 cells and hepatocytes compared to 72.7% for the canine model (n = 11). Furthermore, the dog co-culture model showed a higher superiority for the classification of 5 pairs of close structural analogs with different DILI concerns in comparison to both human cellular models. Finally, the reproducibility of the canine system was also satisfactory with a coefficient of correlation of 75.2% (n = 14). Overall, the present manuscript indicates that the dog co-culture model may represent a relevant tool to perform chronic hepatotoxicity and metabolism studies. - Highlights: Importance of species differences in drug development. Relevance of dog co-culture model for metabolism and toxicology studies. Hepatotoxicity: higher predictivity of dog co-culture vs HepG2 and human hepatocytes.

  8. Characterization and response of newly developed high-grade glioma cultures to the tyrosine kinase inhibitors, erlotinib, gefitinib and imatinib

    SciTech Connect (OSTI)

    Kinsella, Paula; Howley, Rachel; Doolan, Padraig; Clarke, Colin; Madden, Stephen F.; Clynes, Martin; Farrell, Michael; Amberger-Murphy, Verena; All Ireland Co-operative, Oncology Research Group, 60 Fitzwilliam Square, Dublin 2

    2012-03-10

    High-grade gliomas (HGG), are the most common aggressive brain tumours in adults. Inhibitors targeting growth factor signalling pathways in glioma have shown a low clinical response rate. To accurately evaluate response to targeted therapies further in vitro studies are necessary. Growth factor pathway expression using epidermal growth factor receptor (EGFR), mutant EGFR (EGFRvIII), platelet derived growth factor receptor (PDGFR), C-Kit and C-Abl together with phosphatase and tensin homolog (PTEN) expression and downstream activation of AKT and phosphorylated ribosomal protein S6 (P70S6K) was analysed in 26 primary glioma cultures treated with the tyrosine kinase inhibitors (TKIs) erlotinib, gefitinib and imatinib. Response to TKIs was assessed using 50% inhibitory concentrations (IC{sub 50}). Response for each culture was compared with the EGFR/PDGFR immunocytochemical pathway profile using hierarchical cluster analysis (HCA) and principal component analysis (PCA). Erlotinib response was not strongly associated with high expression of the growth factor pathway components. PTEN expression did not correlate with response to any of the three TKIs. Increased EGFR expression was associated with gefitinib response; increased PDGFR-{alpha} expression was associated with imatinib response. The results of this in vitro study suggest gefitinib and imatinib may have therapeutic potential in HGG tumours with a corresponding growth factor receptor expression profile. -- Highlights: Black-Right-Pointing-Pointer Non-responders had low EGFR expression, high PDGFR-{beta}, and a low proliferation rate. Black-Right-Pointing-Pointer PTEN is not indicative of response to a TKI. Black-Right-Pointing-Pointer Erlotinib response was not associated with expression of the proteins examined. Black-Right-Pointing-Pointer Imatinib-response correlated with expression of PDGFR-{alpha}. Black-Right-Pointing-Pointer Gefitinib response correlated with increased expression of EGFR.

  9. A long-term three dimensional liver co-culture system for improved prediction of clinically relevant drug-induced hepatotoxicity

    SciTech Connect (OSTI)

    Kostadinova, Radina; Boess, Franziska; Suter, Laura; Weiser, Thomas; Singer, Thomas; Roth, Adrian

    2013-04-01

    Drug-induced liver injury (DILI) is the major cause for liver failure and post-marketing drug withdrawals. Due to species-specific differences in hepatocellular function, animal experiments to assess potential liabilities of drug candidates can predict hepatotoxicity in humans only to a certain extent. In addition to animal experimentation, primary hepatocytes from rat or human are widely used for pre-clinical safety assessment. However, as many toxic responses in vivo are mediated by a complex interplay among different cell types and often require chronic drug exposures, the predictive performance of hepatocytes is very limited. Here, we established and characterized human and rat in vitro three-dimensional (3D) liver co-culture systems containing primary parenchymal and non-parenchymal hepatic cells. Our data demonstrate that cells cultured on a 3D scaffold have a preserved composition of hepatocytes, stellate, Kupffer and endothelial cells and maintain liver function for up to 3 months, as measured by the production of albumin, fibrinogen, transferrin and urea. Additionally, 3D liver co-cultures maintain cytochrome P450 inducibility, form bile canaliculi-like structures and respond to inflammatory stimuli. Upon incubation with selected hepatotoxicants including drugs which have been shown to induce idiosyncratic toxicity, we demonstrated that this model better detected in vivo drug-induced toxicity, including species-specific drug effects, when compared to monolayer hepatocyte cultures. In conclusion, our results underline the importance of more complex and long lasting in vitro cell culture models that contain all liver cell types and allow repeated drug-treatments for detection of in vivo-relevant adverse drug effects. - Highlights: ? 3D liver co-cultures maintain liver specific functions for up to three months. ? Activities of Cytochrome P450s remain drug- inducible accross three months. ? 3D liver co-cultures recapitulate drug-induced liver toxicity observed in vivo. ? 3D liver co-cultures can detect species-specific drug toxicity observed in vivo. ? This in vitro model may improve assessment of human relevance of preclinical findings.

  10. Annual report on the U.S. Department of Energy`s cultural resource activities at Colorado UMTRA Project sites for October 1995--September 1996

    SciTech Connect (OSTI)

    1996-09-01

    This report summarizes the results of cultural resource activities conducted by the U.S. Department of Energy (DOE) at Uranium Mill Tailings Remedial Action (UMTRA) Project sites in Colorado for the period of October 1, 1995 through September 30, 1996. The inactive uranium mill tailings sites in Colorado are at Durango, Grand Junction, Gunnison, Maybell, Naturita, Rifle, and Slick Rock. On December 6, 1984, the DOE, the Advisory Council on Historic Preservation, and the Colorado State Historic Preservation Officer (SHPO) entered into a programmatic memorandum of understanding (PMOU). This PMOU requires the DOE to fulfillment of its obligations under various state and federal regulations for the protection and preservation of cultural resources. This report provides the state of Colorado with an annual report on the cultural resource activities performed for all UMTRA Project sites in Colorado. Due to the completion of surface activities at the UMTRA Project sites, this will be the last annual report to the state of Colorado. Cultural resources activities subsequent to this report will be reported to the state through site-specific correspondence.

  11. Growth of Chlamydomonas reinhardtii in acetate-free medium when co-cultured with alginate-encapsulated, acetate-producing strains of Synechococcus sp. PCC 7002

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Therien, Jesse B.; Zadvornyy, Oleg A.; Posewitz, Matthew C.; Bryant, Donald A.; Peters, John W.

    2014-10-18

    The model alga Chlamydomonas reinhardtii requires acetate as a co-substrate for optimal production of lipids, and the addition of acetate to culture media has practical and economic implications for algal biofuel production. We demonstrate the growth of C. reinhardtii on acetate provided by mutant strains of the cyanobacterium Synechococcus sp. PCC7002.

  12. Induction of stable p53 oncoprotein and of c-myc overexpression in cultured normal human uroepithelium by radiation and N-nitrosodiethanolamine

    SciTech Connect (OSTI)

    Mothersill, C.; Seymour, C.B. ); Harney, J. )

    1994-04-01

    Uroepithelium cultured from normal patients without cancer (60 individuals) was found to segregate into four subtypes based on the level of carcinogen treatment needed to induce abnormal p53 and c-myc. Twenty-two percent of patient cultures never showed abnormal p53 expression, even after chronic exposure to nitrosamines, while a further 26% required only a single dose of radiation to induce the abnormal protein. The remaining patients had tissues which, while initially negative for stable p53, became positive when put into culture and stimulated to grow. The c-myc protein was overexpressed in all cultures with abnormal p53. It would appear that elevated expression of conformationally inactive p53 and of high levels of c-myc represents an early response of normal uroepithelial cells to carcinogen challenge. It also appears that a relatively high number of patients without cancer express these proteins when their cells are challenged to grow; a pre-exposure to environmental carcinogens such as nitrosamines in cigarette smoke is likely to be involved. 30 refs., 3 figs., 3 tabs.

  13. High density culture of white bass X striped bass fingerlings in raceways using power plant heated effluent

    SciTech Connect (OSTI)

    Collins, C.M.; Burton, G.L.; Schweinforth, R.L.

    1983-06-01

    White bass (Morone chrysops) X striped bass (M. saxatilis) hybrids weighing 1691/lb were initially stocked in five 24 ft/sup 3/ floating screen cages for 20 days. Hybrids averaging one inch in total length and 361 fish/lb were released in four 614 ft/sup 3/ concrete raceways. Two stocking densities, 2.6 and 5.1 fish/ft/sup 3/, were evaluated in the 94-day study using a flow rate of 300 gpm/raceway. Water temperatures averaged 79/sup 0/F and water quality was adequate throughout the production period. Fish were hand fed to satiation daily. Columnaris and Aeromonas hydrophila caused the most serious disease problems. Gas supersaturation was suspect in high mortality levels during cage culture of hybrid bass fry. Cannibalism may have been responsible for unaccountable losses prior to raceway stocking and at harvest. The study yielded 5773 hybrids weighing 658 lb. The high density treatment showed greater weight gain, average weight, average length and percent survival as well as improved food conversion. Results suggest that higher stocking densities and periodic grading may increase production and suppress cannibalism. 10 references, 3 figures, 3 tables.

  14. Cell culture compositions

    DOE Patents [OSTI]

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yiao, Jian

    2014-03-18

    The present invention provides a novel endoglucanase nucleic acid sequence, designated egl6 (SEQ ID NO:1 encodes the full length endoglucanase; SEQ ID NO:4 encodes the mature form), and the corresponding endoglucanase VI amino acid sequence ("EGVI"; SEQ ID NO:3 is the signal sequence; SEQ ID NO:2 is the mature sequence). The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVI, recombinant EGVI proteins and methods for producing the same.

  15. Semi-synthetic preparation of 1-O-(1'-/sup 14/C)hexadecyl-2-acetyl-sn-glycero-3-phosphocholine (platelet activating factor) using plant cell cultures

    SciTech Connect (OSTI)

    Weber, N.; Mangold, H.K.

    1985-04-01

    Incubation of photomixotrophic cell suspension cultures of rape (Brassica napus) and heterotrophic cell suspension cultures of soya (Glycine max) with 1-O-(1'-/sup 14/C)hexadecyl-sn-glycerol or rac-1-O-(1'-/sup 14/C)hexadecylglycerol leads in high yield (up to 78%) to labeled 1-O-hexadecyl-2-acyl-sn-glycero-3-phosphocholines. Alkaline hydrolysis of the choline glycerophospholipids yields pure 1-O-(1'-/sup 14/C)hexadecyl-sn-glycero-3-phosphocholine. 1-O-(1'-14C)Hexadecyl-2-acetyl-sn-glycero-3-phosphocholine (platelet activating factor) is obtained by acetylating the lyso compound. The semi-synthetic preparation described leads to labeled platelet activating factor in an overall yield of 50-60% without loss of specific activity.

  16. A Cultural Resources Inventory and Historical Evaluation of the Smoky Atmospheric Nuclear Test, Areas 8, 9, and 10, Nevada National Security Site, Nye County, Nevada

    SciTech Connect (OSTI)

    Jones, Robert C.; King, Maureen L.; Beck, Colleen M.; Falvey, Lauren W.; Menocal, Tatianna M.

    2014-09-01

    This report presents the results of a National Historic Preservation Act Section 106 cultural resources inventory and historical evaluation of the 1957 Smoky atmospheric test location on the Nevada National Security Site (NNSS). The Desert Research Institute (DRI) was tasked to conduct a cultural resources study of the Smoky test area as a result of a proposed undertaking by the Department of Energy Environmental Management. This undertaking involves investigating Corrective Action Unit (CAU) 550 for potential contaminants of concern as delineated in a Corrective Action Investigation Plan. CAU 550 is an area that spatially overlaps portions of the Smoky test location. Smoky, T-2c, was a 44 kt atmospheric nuclear test detonated at 5:30 am on August 31, 1957, on top of a 213.4 m (700 ft) 200 ton tower (T-2c) in Area 8 of the NNSS. Smoky was a weapons related test of the Plumbbob series (number 19) and part of the Department of Defense Exercise Desert Rock VII and VIII. The cultural resources effort involved the development of a historic context based on archival documents and engineering records, the inventory of the cultural resources in the Smoky test area and an associated military trench location in Areas 9 and 10, and an evaluation of the National Register eligibility of the cultural resources. The inventory of the Smoky test area resulted in the identification of structures, features, and artifacts related to the physical development of the test location and the post-test remains. The Smoky test area was designated historic district D104 and coincides with a historic archaeological site recorded as 26NY14794 and the military trenches designed for troop observation, site 26NY14795. Sites 26NY14794 and 26NY14795 are spatially discrete with the trenches located 4.3 km (2.7 mi) southeast of the Smoky ground zero. As a result, historic district D104 is discontiguous and in total it covers 151.4 hectares (374 acres). The Smoky test location, recorded as historic district D104 and historic sites 26NY14794 and 26NY14795, is the best preserved post-shot atmospheric nuclear tower test at the NNSS and possibly in the world. It is of local, national, and international importance due to nuclear testing’s pivotal role in the Cold War between the United States and the former Soviet Union. The district and sites are linked to the historic theme of atmospheric nuclear testing. D104 retains aspects of the engineering plan and design for the Smoky tower, instrument stations used to measure test effects, German and French personnel shelters, and military trenches. A total of 33 structures contribute to the significance of D104. Artifacts and features provide significant post-test information. Historic district D104 (discontiguous) and historic site 26NY14794 (the Smoky test area) are eligible for listing on the NRHP under Criteria A, B, C, and D. The historic site 26NY14795 (the Smoky military trenches) is eligible for listing under Criteria A, C, and D. Several items have been identified for removal by the CAU 550 investigation. However, none of them is associated with the Smoky atmospheric test, but with later activities in the area. The military trenches are not part of CAU 550 and no actions are planned there. A proposed closure of the Smoky test area with restrictions will limit access and contribute to the preservation of the cultural resources. It is recommended that the Smoky historic district and sites be included in the NNSS cultural resources monitoring program.

  17. Word Pro - S2

    Gasoline and Diesel Fuel Update (EIA)

    0 U.S. Energy Information Administration / Monthly Energy Review February 2016 Table 2.7 U.S. Government Energy Consumption by Agency, Fiscal Years (Trillion Btu) Fiscal Year a Agri- culture Defense Energy GSA b HHS c Interior Justice NASA d Postal Service Trans- portation Veterans Affairs Other e Total 1975 .............. 9.5 1,360.2 50.4 22.3 6.5 9.4 5.9 13.4 30.5 19.3 27.1 10.5 1,565.0 1976 .............. 9.3 1,183.3 50.3 20.6 6.7 9.4 5.7 12.4 30.0 19.5 25.0 11.2 1,383.4 1977 ..............

  18. Thyroid organotypic rat and human cultures used to investigate drug effects on thyroid function, hormone synthesis and release pathways

    SciTech Connect (OSTI)

    Vickers, Alison E.M.; Heale, Jason; Sinclair, John R.; Morris, Stephen; Rowe, Josh M.; Fisher, Robyn L.

    2012-04-01

    Drug induced thyroid effects were evaluated in organotypic models utilizing either a rat thyroid lobe or human thyroid slices to compare rodent and human response. An inhibition of thyroid peroxidase (TPO) function led to a perturbation in the expression of key genes in thyroid hormone synthesis and release pathways. The clinically used thiourea drugs, methimazole (MMI) and 6-n-propyl-2-thioruacil (PTU), were used to evaluate thyroid drug response in these models. Inhibition of TPO occurred early as shown in rat thyroid lobes (2 h) and was sustained in both rat (2448 h) and human (24 h) with ? 10 ?M MMI. Thyroid from rats treated with single doses of MMI (301000 mg/kg) exhibited sustained TPO inhibition at 48 h. The MMI in vivo thyroid concentrations were comparable to the culture concentrations (? 1584 ?M), thus demonstrating a close correlation between in vivo and ex vivo thyroid effects. A compensatory response to TPO inhibition was demonstrated in the rat thyroid lobe with significant up-regulation of genes involved in the pathway of thyroid hormone synthesis (Tpo, Dio1, Slc5a5, Tg, Tshr) and the megalin release pathway (Lrp2) by 24 h with MMI (? 10 ?M) and PTU (100 ?M). Similarly, thyroid from the rat in vivo study exhibited an up-regulation of Dio1, Slc5a5, Lrp2, and Tshr. In human thyroid slices, there were few gene expression changes (Slc5a5, ? 2-fold) and only at higher MMI concentrations (? 1500 ?M, 24 h). Extended exposure (48 h) resulted in up-regulation of Tpo, Dio1 and Lrp2, along with Slc5a5 and Tshr. In summary, TPO was inhibited by similar MMI concentrations in rat and human tissue, however an increased sensitivity to drug treatment in rat is indicated by the up-regulation of thyroid hormone synthesis and release gene pathways at concentrations found not to affect human tissue. -- Highlights: ? Novel model of rat thyroid or human thyroid slices to evaluate pathways of injury. ? TPO inhibition by MMI or PTU altered hormone synthesis and release genes. ? Rat thyroid was more sensitive to the drug effects than human tissue.

  19. Renville County, Minnesota: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    Falls Energy Minnesota Energy Sunrise Agri Fuels Places in Renville County, Minnesota Bird Island, Minnesota Buffalo Lake, Minnesota Danube, Minnesota Fairfax, Minnesota...

  20. Tennessee's 5th congressional district: Energy Resources | Open...

    Open Energy Info (EERE)

    Tennessee's 5th congressional district Agri Energy Inc Nashville Electric Service NES Universal Lighting Technologies Retrieved from "http:en.openei.orgwindex.php?titleTenness...

  1. Davidson County, Tennessee: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    in Davidson County, Tennessee Agri Energy Inc Nashville Electric Service NES Universal Lighting Technologies Energy Generation Facilities in Davidson County, Tennessee MM...

  2. Nashville, Tennessee: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    Companies in Nashville, Tennessee Agri Energy Inc Nashville Electric Service NES Universal Lighting Technologies References US Census Bureau Incorporated place and minor...

  3. Minnesota's 1st congressional district: Energy Resources | Open...

    Open Energy Info (EERE)

    1st congressional district Agra Resources Cooperative EXOL Agri Energy LLC Corn Plus High Country Energy Juhl Wind Inc MinnErgy LLC Minwind Energy LLC Next Generation...

  4. Escambia County, Florida: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    County, Florida Agri Source Fuels Places in Escambia County, Florida Bellview, Florida Brent, Florida Century, Florida Ensley, Florida Ferry Pass, Florida Gonzalez, Florida...

  5. Colorado's 5th congressional district: Energy Resources | Open...

    Open Energy Info (EERE)

    Energy Companies in Colorado's 5th congressional district AC Solar Inc American Agri diesel LLC American Electric Vehicles Inc American Solar Technology BBI International Diamond...

  6. El Paso County, Colorado: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    Zone Subtype B. Registered Energy Companies in El Paso County, Colorado American Agri diesel LLC American Electric Vehicles Inc American Solar Technology Diamond Wire Technology...

  7. Colorado Springs, Colorado: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    Registered Energy Companies in Colorado Springs, Colorado American Agri diesel LLC American Solar Technology Diamond Wire Technology LLC Larankelo Mobile Energy...

  8. Nebraska's 3rd congressional district: Energy Resources | Open...

    Open Energy Info (EERE)

    Nebraska. Registered Energy Companies in Nebraska's 3rd congressional district Chief Ethanol Fuels Chief Ethanol Fuels Inc Husker Ag LLC Kaapa Ethanol LLC Mid America Agri...

  9. Christian County, Kentucky: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    Commonwealth AgriEnergy Places in Christian County, Kentucky Crofton, Kentucky Fort Campbell North, Kentucky Hopkinsville, Kentucky LaFayette, Kentucky Oak Grove, Kentucky...

  10. Kansas's 1st congressional district: Energy Resources | Open...

    Open Energy Info (EERE)

    district Conestoga Energy Partners LLC ESE Alcohol Gateway Ethanol LLC formerly Wildcat Bio Energy LLC Kansas Ethanol LLC Nesika Energy LLC Orion Ethanol Reeve Agri Energy Inc...

  11. West Central Cooperative | Open Energy Information

    Open Energy Info (EERE)

    Cooperative Jump to: navigation, search Name: West Central Cooperative Place: Ralston, Iowa Zip: 51459 Product: Iowa-based agri-business with operations across the United States....

  12. Tennessee's 7th congressional district: Energy Resources | Open...

    Open Energy Info (EERE)

    Companies in Tennessee's 7th congressional district Agri Energy Inc Biofuels America Inc Eco Energy Inc Memphis Biofuels LLC Nashville Electric Service NES Ocean Motion...

  13. Mono-hydroxy methoxychlor alters levels of key sex steroids and steroidogenic enzymes in cultured mouse antral follicles

    SciTech Connect (OSTI)

    Craig, Zelieann R., E-mail: zelieann@gmail.co [Department of Comparative Biosciences, University of Illinois, Urbana, IL (United States); Leslie, Traci C., E-mail: traci.leslie@gmail.co [Department of Comparative Biosciences, University of Illinois, Urbana, IL (United States); Hatfield, Kimberly P., E-mail: kpm9786@yahoo.co [Program in Toxicology and Department of Epidemiology and Preventive Medicine, University of Maryland School of Medicine, Baltimore, MD 21201 (United States); Gupta, Rupesh K., E-mail: drrupesh@illinois.ed [Department of Comparative Biosciences, University of Illinois, Urbana, IL (United States); Flaws, Jodi A., E-mail: jflaws@illinois.ed [Department of Comparative Biosciences, University of Illinois, Urbana, IL (United States)

    2010-12-01

    Methoxychlor (MXC) is an organochlorine pesticide that reduces fertility in female rodents by decreasing antral follicle numbers and increasing follicular death. MXC is metabolized in the body to mono-hydroxy MXC (mono-OH). Little is known about the effects of mono-OH on the ovary. Thus, this work tested the hypothesis that mono-OH exposure decreases production of 17{beta}-estradiol (E{sub 2}) by cultured mouse antral follicles. Antral follicles were isolated from CD-1 mice (age 35-39 days) and exposed to dimethylsulfoxide (DMSO), or mono-OH (0.1-10 {mu}g/mL) for 96 h. Media and follicles were collected for analysis of sex steroid levels and mRNA expression, respectively. Mono-OH treatment (10 {mu}g/mL) decreased E{sub 2} (DMSO: 3009.72 {+-} 744.99 ng/mL; mono-OH 0.1 {mu}g/mL: 1679.66 {+-} 461.99 ng/mL; 1 {mu}g/mL: 1752.72 {+-} 532.41 ng/mL; 10 {mu}g/mL: 45.89 {+-} 33.83 ng/mL), testosterone (DMSO: 15.43 {+-} 2.86 ng/mL; mono-OH 0.1 {mu}g/mL: 17.17 {+-} 4.71 ng/mL; 1 {mu}g/mL: 13.64 {+-} 3.53 ng/mL; 10 {mu}g/mL: 1.29 {+-} 0.23 ng/mL), androstenedione (DMSO: 1.92 {+-} 0.34 ng/mL; mono-OH 0.1 {mu}g/mL: 1.49 {+-} 0.43 ng/mL; 1 {mu}g/mL: 0.64 {+-} 0.31 ng/mL; 10 {mu}g/mL: 0.12 {+-} 0.06 ng/mL) and progesterone (DMSO: 24.11 {+-} 4.21 ng/mL; mono-OH 0.1 {mu}g/mL: 26.77 {+-} 4.41 ng/mL; 1 {mu}g/mL: 20.90 {+-} 3.75 ng/mL; 10 {mu}g/mL: 9.44 {+-} 2.97 ng/mL) levels. Mono-OH did not alter expression of Star, Hsd3b1, Hsd17b1 and Cyp1b1, but it did reduce levels of Cyp11a1, Cyp17a1 and Cyp19a1 mRNA. Collectively, these data suggest that mono-OH significantly decreases levels of key sex steroid hormones and the expression of enzymes required for steroidogenesis.

  14. Utility of four strains of white-rot fungi for the detoxification of 2,4,6-trinitrotoluene in liquid culture

    SciTech Connect (OSTI)

    Donnelly, K.C.; Chen, J.C.; Huebner, H.J.; Brown, K.W.; Autenrieth, R.L.; Bonner, J.S.

    1997-06-01

    The purpose of this study was to investigate the potential of four different strains of white-rot fungi (Phanerochaete chrysosporium, Phanerochaete sordida, Phlebia brevispora, and Cyathus stercoreus) to degrade 2,4,6-trinitrotoluene (TNT) in liquid medium. Loss of TNT from the culture medium was determined using high-performance liquid chromatography (HPLC), while the mutagenicity of the medium residues were evaluated using the Salmonella/microsome bioassay. The data indicate that within 21 d of incubation, all fungi were able to reduce the TNT concentration in the liquid medium to below detection limits. In this study, P. sordida showed a relatively high growth rate and the fastest rate of TNT degradation. The fungal treatment also produced a significant reduction of TNT mutagenicity. Treatment with C. stercoreus, P. brevispora, P. sordida, and P. chrysosporium resulted in the elimination of 94%, 90%, 87%, and 67% of the initial TNT-amended medium mutagenicity, respectively. The data also demonstrate that during incubation, TNT was eliminated from the culture medium two to eight times faster than the reduction in mutagenic potential. These results suggest that TNT disappearance alone cannot be used as the sole criterion in TNT remediation. Chemical analysis revealed that the major metabolites in the initial transformation of TNT were the monoamino-dinitrotoluenes, which were also degraded by the selected white-rot fungi. The study demonstrated that the white-rot fungi are capable of metabolizing and detoxifying TNT under aerobic conditions in nonligninolytic liquid medium.

  15. Biomass Crop Assistance Program (BCAP) | Open Energy Information

    Open Energy Info (EERE)

    United States Department of Agriculture Partner: Farm Service Agency Sector: Energy, Land Focus Area: Biomass, - Biomass Combustion, - Biomass Gasification, - Biomass...

  16. Bical Biomass Industrial Crops Ltd | Open Energy Information

    Open Energy Info (EERE)

    Devon, United Kingdom Zip: EX15 1BJ Product: Developer and supplier of Miscanthus for electricity generation in Europe. Coordinates: 40.04563, -75.423824 Show Map Loading...

  17. Crops reap benefits of Pantex irrigation system | National Nuclear...

    National Nuclear Security Administration (NNSA)

    fields of wheat and lush tracts of corn stretch across Pantex land soaking up the Texas sun. Invisible to the eye is what else they're soaking up - an estimated 900,000 gallons a...

  18. Opportunities for Energy Crop Production Based on Subfield Scale...

    Office of Scientific and Technical Information (OSTI)

    where corn (Zea mays L.) grain is modeled to operate at a net economic loss. The results of this analysis show that switchgrass integration has the potential to increase ...

  19. Gamma greenhouse: A chronic facility for crops improvement and agrobiotechnology

    SciTech Connect (OSTI)

    Azhar, M. Ahsanulkhaliqin, A. W.

    2014-02-12

    Gamma irradiation is one of the most common procedures in plant mutagenesis and agrobiotechnology activities. The procedures consist of chronic and acute gamma radiation. Generally, {sup 60}Co and {sup 137}Cs are gamma radiation sources for radiation processing with relatively high energy (half-life 5.27 years for {sup 60}Co and 30.1 years for {sup 137}Cs). The energy associated with gamma radiation is high enough to break the molecular bonds and ionize atoms without affecting structure of the atomic nucleus (avoiding induction of radioactivity). The Gamma Green House (GGH) is the only chronic irradiation facility in Malaysia, located at Malaysian Nuclear Agency (Nuclear Malaysia). GGH is used for induction of mutation in plants and other biological samples at low dose radiation over period of time depending on the nature and sensitivity of the plant species. The GGH consist of circular green house with 30 meters radius, control room and irradiator with interlock system. The irradiator produces low dose gamma radiation derived from Caesium-137 radioactive source. The biological samples can be exposed to low dose radiation in days, weeks, months or years. The current irradiation rate for GGH is 2.67 Gy/hr at 1 meter from the source. Chronic gamma irradiation produces a wider mutation spectrum and useful for minimizing radiation damages towards obtaining new improved traits for research and commercial values. The prospect of the gamma greenhouse is its uses in research, educations and services on induced mutation techniques for the improvement of plant varieties and microbes. In generating awareness and attract users to the facility, Nuclear Malaysia provides wide range of irradiation services for plant species and mutagenesis consultancies to academicians, students scientists, and plant breeders, from local universities, other research institutes, and growers. Charges for irradiation and consultancy services are at nominal rates. The utilization activities of the gamma greenhouse mainly cover Research and Development, Research Collaboration, Exchange of Information, Irradiation Services, Training Programs, Education, Exchange of Scientists and Seminars/ Conferences.

  20. Weekly Weather and Crop Bulletin | Open Energy Information

    Open Energy Info (EERE)

    United States Department of Agriculture, National Oceanic and Atmospheric Administration (NOAA) Sector: Land Focus Area: Agriculture Topics: GHG inventory, Resource...

  1. Cover crops for erosion control in bioenergy hardwood plantations...

    Office of Scientific and Technical Information (OSTI)

    with complete competition control. Small berms were built to direct runoff to a sediment fence installed at the down slope ends of each plot. Soil erosion is measured by...

  2. Top Crop Wind Farm (Phase II) | Open Energy Information

    Open Energy Info (EERE)

    (MW) 198198 MW 198,000 kW 198,000,000 W 198,000,000,000 mW 0.198 GW Number of Units 132 Commercial Online Date 2010 Wind Turbine Manufacturer GE Energy References WENDI1...

  3. Energy Crops Engineered for Increased Sugar Extraction through...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    a superior biofuel feedstock. Until now, plants with decreased lignin content have exhibited defects such as reduced size or sturdiness that made them unsuitable biofuel ...

  4. The outlook for crops (and biofuels and policy and...)

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    biofuel markets Stochastic process to account for different assumptions in oil price, weather patterns, etc. Cellulosic model basics Key assumptions in the biofuel ...

  5. Transposable Elements and Genetic Instabilities in Crop Plants

    DOE R&D Accomplishments [OSTI]

    Burr, B.; Burr, F.

    1981-04-10

    Transposable elements have long been associated with certain unstable loci in maize and have been intensively studied by McClintock and others. It is known that a transposable element can control the expression of the structural genes at the locus where it resides. These controlling elements in maize are now beginning to be studied at the molecular level. Using recombinant molecular probes we have been able to describe the changes induced by the controlling element Ds at the shrunken locus. Ds elements appear to be large and dissimilar insertions into the wild-type locus - two elements actually map within the transcribed region of the gene. Genetic instabilities have been described in other economically important plants but the bases for these phenomena have not been understood. We believe that it is likely that some of these instabilities are the result of transposable element activity much as in the case of maize.

  6. ABSTRACT: Bioenergy Harvesting Technologies to Supply Crop Residues In a

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Densified Large Square Bale Format | Department of Energy abstract

  7. ABSTRACT: Bioenergy Harvesting Technologies to Supply Crop Residues In a

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Densified Large Square Bale Format | Department of Energy abstract_1

  8. Potential role of 20S proteasome in maintaining stem cell integrity of human bone marrow stromal cells in prolonged culture expansion

    SciTech Connect (OSTI)

    Lu, Li; Song, Hui-Fang; Zhang, Wei-Guo; Liu, Xue-Qin; Zhu, Qian; Cheng, Xiao-Long; Yang, Gui-Jiao; Li, Ang; Xiao, Zhi-Cheng; Monash Immunology and Stem Cell Laboratories, Monash University, Clayton, Melbourne 3800

    2012-05-25

    Highlights: Black-Right-Pointing-Pointer Prolonged culture expansion retards proliferation and induces senescence of hBMSCs. Black-Right-Pointing-Pointer Reduced 20S proteasomal activity and expression potentially contribute to cell aging. Black-Right-Pointing-Pointer MG132-mediated 20S proteasomal inhibition induces senescence-like phenotype. Black-Right-Pointing-Pointer 18{alpha}-GA stimulates proteasomal activity and restores replicative senescence. Black-Right-Pointing-Pointer 18{alpha}-GA retains differentiation without affecting stem cell characterizations. -- Abstract: Human bone marrow stromal cells (hBMSCs) could be used in clinics as precursors of multiple cell lineages following proper induction. Such application is impeded by their characteristically short lifespan, together with the increasing loss of proliferation capability and progressive reduction of differentiation potential after the prolonged culture expansion. In the current study, we addressed the possible role of 20S proteasomes in this process. Consistent with prior reports, long-term in vitro expansion of hBMSCs decreased cell proliferation and increased replicative senescence, accompanied by reduced activity and expression of the catalytic subunits PSMB5 and PSMB1, and the 20S proteasome overall. Application of the proteasome inhibitor MG132 produced a senescence-like phenotype in early passages, whereas treating late-passage cells with 18{alpha}-glycyrrhetinic acid (18{alpha}-GA), an agonist of 20S proteasomes, delayed the senescence progress, enhancing the proliferation and recovering the capability of differentiation. The data demonstrate that activation of 20S proteasomes assists in counteracting replicative senescence of hBMSCs expanded in vitro.

  9. Breast Cancer Cells in Three-dimensional Culture Display an Enhanced Radioresponse after Coordinate Targeting of Integrin ?5?1 and Fibronectin

    SciTech Connect (OSTI)

    Nam, Jin-Min; Onodera, Yasuhito; Bissell, Mina J; Park, Catherine C

    2010-04-07

    Tactics to selectively enhance cancer radioresponse are of great interest. Cancer cells actively elaborate and remodel their extracellular matrix (ECM) to aid in survival and progression. Previous work has shown that {beta}1-integrin inhibitory antibodies can enhance the growth-inhibitory and apoptotic responses of human breast cancer cell lines to ionizing radiation, either when cells are cultured in three-dimensional laminin-rich ECM (3D lrECM) or grown as xenografts in mice. Here, we show that a specific {alpha} heterodimer of {beta}1-integrin preferentially mediates a prosurvival signal in human breast cancer cells that can be specifically targeted for therapy. 3D lrECM culture conditions were used to compare {alpha}-integrin heterodimer expression in malignant and nonmalignant cell lines. Under these conditions, we found that expression of {alpha}5{beta}1-integrin was upregulated in malignant cells compared with nonmalignant breast cells. Similarly, we found that normal and oncofetal splice variants of fibronectin, the primary ECM ligand of {alpha}5{beta}1-integrin, were also strikingly upregulated in malignant cell lines compared with nonmalignant acini. Cell treatment with a peptide that disrupts the interactions of {alpha}5{beta}1-integrin with fibronectin promoted apoptosis in malignant cells and further heightened the apoptotic effects of radiation. In support of these results, an analysis of gene expression array data from breast cancer patients revealed an association of high levels of {alpha}5-integrin expression with decreased survival. Our findings offer preclinical validation of fibronectin and {alpha}5{beta}1-integrin as targets for breast cancer therapy.

  10. The generation of 4-hydroxynonenal, an electrophilic lipid peroxidation end product, in rabbit cornea organ cultures treated with UVB light and nitrogen mustard

    SciTech Connect (OSTI)

    Zheng, Ruijin; Po, Iris; Mishin, Vladimir; Black, Adrienne T.; Heck, Diane E.; Laskin, Debra L.; Sinko, Patrick J.; Gerecke, Donald R.; Gordon, Marion K.; Laskin, Jeffrey D.

    2013-10-15

    The cornea is highly sensitive to oxidative stress, a process that can lead to lipid peroxidation. Ultraviolet light B (UVB) and nitrogen mustard (mechlorethamine) are corneal toxicants known to induce oxidative stress. Using a rabbit air-lifted corneal organ culture model, the oxidative stress responses to these toxicants in the corneal epithelium was characterized. Treatment of the cornea with UVB (0.5 J/cm{sup 2}) or nitrogen mustard (100 nmol) resulted in the generation of 4-hydroxynonenal (4-HNE), a reactive lipid peroxidation end product. This was associated with increased expression of the antioxidant, heme oxygenase-1 (HO-1). In human corneal epithelial cells in culture, addition of 4-HNE or 9-nitrooleic acid, a reactive nitrolipid formed during nitrosative stress, caused a time-dependent induction of HO-1 mRNA and protein; maximal responses were evident after 10 h with 30 ?M 4-HNE or 6 h with 10 ?M 9-nitrooleic acid. 4-HNE and 9-nitrooleic acid were also found to activate Erk1/2, JNK and p38 MAP kinases, as well as phosphoinositide-3-kinase (PI3)/Akt. Inhibition of p38 blocked 4-HNE- and 9-nitrooleic acid-induced HO-1 expression. Inhibition of Erk1/2, and to a lesser extent, JNK and PI3K/Akt, suppressed only 4-HNE-induced HO-1, while inhibition of JNK and PI3K/Akt, but not Erk1/2, partly reduced 9-nitrooleic acid-induced HO-1. These data indicate that the actions of 4-HNE and 9-nitrooleic acid on corneal epithelial cells are distinct. The sensitivity of corneal epithelial cells to oxidative stress may be an important mechanism mediating tissue injury induced by UVB or nitrogen mustard. - Highlights: UVB or nitrogen mustard causes rabbit corneal epithelial injury. 4-Hydroxynonenal (4-HNE) was formed and heme oxygenase-1 (HO-1) was increased. 4-HNE induced HO-1 mRNA and protein expression in human corneal epithelial cells. The induction of HO-1 by 4-HNE was through MAP kinase activation.

  11. Leaders Influence Culture and Performance

    Broader source: Energy.gov [DOE]

    Presenter: Melvin G. Williams, Jr., Vice Admiral, US Navy (retired), Associate Deputy Secretary, US Department of Energy

  12. Cultural Alimentation in Latin America

    ScienceCinema (OSTI)

    None

    2011-04-25

    Le Prof. Paolo Freire(nom?) a dirigé en Brésil un plan national d'alphabétisatation d'adultes. La base de sa méthode est d'essayer de ne pas rester sur la mécanique du mot, mais de le relier avec la réalité sociale et donner un réveillement critique de la conscience populaire en face de la réalité historique du pays. Il était professeur d'histoire et de philosophie de Récife, puis exilé et depuis il était prof. à Harvard, a travaillé à l'Unesco et est maintenant conseiller spécial à l'Office d'Education du centre oecuménique des églises

  13. "The Success of Captive Broodstock Programs Depends on High In-Culture Survival, ..." [from the Abstract], 2006-2007 Progress Report.

    SciTech Connect (OSTI)

    Berejikian, Barry A.

    2009-04-08

    The success of captive broodstock programs depends on high in-culture survival, appropriate development of the reproductive system, and the behavior and survival of cultured salmon after release, either as adults or juveniles. Continuing captive broodstock research designed to improve technology is being conducted to cover all major life history stages of Pacific salmon. Accomplishments detailed in this report are listed below by major objective. Objective 1: This study documented that captively reared Chinook exhibited spawn timing similar to their founder anadromous population. An analysis of spawn timing data of captively reared Chinook salmon that had received different levels of antibiotic treatment did not suggest that antibiotic treatments during the freshwater or seawater phase of the life cycle affects final maturation timing. No effect of rearing density was found with respect to spawn timing or other reproductive behaviors. Objective 2: This study investigated the critical period(s) for imprinting for sockeye salmon by exposing juvenile salmon to known odorants at key developmental stages. Molecular assessments of imprinting-induced changes in odorant receptor gene expression indicated that regulation of odorant expression differs between coho and sockeye salmon. While temporal patterns differ between these species, exposure to arginine elicited increases in odorant receptor mRNA expression in sockeye salmon. Objective 3: This study: (i) identified the critical period when maturation is initiated in male spring Chinook salmon and when body growth affects onset of puberty, (ii) described changes in the reproductive endocrine system during onset of puberty and throughout spermatogenesis in male spring Chinook salmon, (iii) found that the rate of oocyte development prior to vitellogenesis is related to body growth in female spring Chinook, and (iv) demonstrated that growth regimes which reduce early (age 2) male maturation slow the rate of primary and early secondary oocyte growth, but do not alter number of oocytes at these stages of development. Objective 4 : This study, (1) determined that infected fish treated with oxytetracycline-medicated feed (as fry or as presmolts) had improved survival compared to nonmedicated fish, (2) determined that a single 14-day course of oral azithromycin at first feeding or at the start of smoltification is sufficient for significant azithromycin retention in internal tissues for at least a year, and (3) established that Renibacterium salmoninarum with an azithromycin-resistant phenotype can be isolated from Chinook salmon receiving macrolide antibiotic treatment. Objective 5: This study determined that for Chinook salmon rearing in similar, 'common environment' regimes in seawater, control fish have survived at a higher rate since seawater transfer than have experimentally inbred fish. However, in all groups, the variation among families in survival has been substantial, ranging from 0% to 100% over the entire year and from 0% to 40% since seawater transfer. The highly significant effect of variation among families within both stocks indicates that substantial genetic variation for size remains in these populations.

  14. Comparison of 20 nm silver nanoparticles synthesized with and without a gold core. Structure, dissolution in cell culture media, and biological impact on macrophages

    SciTech Connect (OSTI)

    Munusamy, Prabhakaran; Wang, Chongmin; Engelhard, Mark H.; Baer, Donald R.; Smith, Jordan N.; Liu, Chongxuan; Kodali, Vamsi K.; Thrall, Brian D.; Chen, Shu; Porter, Alexandra E.; Ryan, Mary P.

    2015-07-15

    Widespread use of silver nanoparticles raises questions of environmental impact and toxicity. Both silver particles and silver ions formed by particle dissolution may impact biological systems. Therefore it is important to understand the characteristics of silver nanoparticles and their stability in relevant media. The synthesis route can impact physical and chemical characteristics of the particles and we report the characterization and solution stability of three types of silver nanoparticles (20 nm particles with and without gold cores and 110 nm particles with gold cores) in cell culture media with serum proteins: FBS10%/RPMI. These nanoparticles were synthesized in aqueous solution and characterized using both in situ and ex situ analysis methods. Dissolution studies were carried at particle concentrations from 1 g/ml to 50 g/ml. Particles with gold cores had smaller crystallite size and higher apparent solubility than pure silver particles. A dissolution model was found to describe the time variation of particle size and amount of dissolved silver for particle loadings above 9 g/ml. An effective solubility product obtained from fitting the data was higher for the 20 nm gold core particles in comparison to the pure silver or 110 nm particles. Dissolution of the nanoparticles was enhanced by presence of serum proteins contained in fetal bovine serum. In addition, the protocol of the dispersion in the medium was found to influence particle agglomeration and dissolution. Results show that particle structure can impact the concentration of dissolved silver and the dose to which cells would be exposed during in vitro studies.

  15. Immunosuppressive effect of the anti-IL-2-receptor monoclonal antibody, AMT-13, on organ-cultured fetal pancreas allograft survival

    SciTech Connect (OSTI)

    Burkhardt, K.; Loughnan, M.S.; Diamantstein, T.; Mandel, T.E.

    1988-11-01

    Recently, prolongation of cardiac allograft survival in mice was reported using a rat anti-IL-2R mAb (AMT-13). However, its immunosuppressive action in vivo, alone and in combination with other immunosuppressants, and its effect on other organ transplants has not been extensively studied. We grafted cultured fetal pancreas from CBA (H-2k) donors to Balb/c (H-2d) mice. Recipients were treated with 10 consecutive daily injections each of 20 micrograms AMT-13 only, or with an additional mild immunosuppression of 350 rads irradiation. Control groups received rat immunoglobulin or 350 rads irradiation. Graft survival and the phenotype of infiltrating cells were assessed histologically and immunocytochemically on days 12, 17, and 21, and soluble IL-2R levels were measured in the serum with a quantitative ELISA in all recipients. Two of five grafts in the AMT-13-treated group had islets on day 12 posttransplantation despite lymphocytic infiltration in all grafts, while at this time all grafts of rat Ig treated control mice were completely rejected with only scar tissue and a few lymphocytes remaining. Additional immunosuppression with 350 rads irradiation had a marked additive effect with AMT-13. Soluble IL-2R levels in the serum of untreated recipients were not elevated compared with normal serum levels, but recipients injected with AMT-13 had multifold increased soluble IL-2R levels. The percentage of IL-2R+ cells in the grafts of AMT-13-treated animals was either normal (less than 5%) or increased (20%) in the additionally irradiated mice, providing strong evidence that the immunosuppressive effect of AMT-13 is not due to a depletion of activated IL-2R+ lymphocytes.

  16. Improving in vitro Sertoli cell/gonocyte co-culture model for assessing male reproductive toxicity: Lessons learned from comparisons of cytotoxicity versus genomic responses to phthalates

    SciTech Connect (OSTI)

    Yu Xiaozhong; Hong, Sung Woo; Moreira, Estefania G.; Faustman, Elaine M.

    2009-09-15

    Gonocytes exist in the neonatal testis and represent a transient population of male germ-line stem cells. It has been shown that stem cell self-renewal and progeny production is probably controlled by the neighboring differentiated cells and extracellular matrix (ECM) in vivo known as niches. Recently, we developed an in vitro three-dimensional (3D) Sertoli cell/gonocyte co-culture (SGC) model with ECM overlay, which creates an in vivo-like niche and supports germ-line stem cell functioning within a 3D environment. In this study, we applied morphological and cytotoxicity evaluations, as well as microarray-based gene expression to examine the effects of different phthalate esters (PE) on this model. Known in vivo male developmentally toxic PEs (DTPE) and developmentally non-toxic PEs (DNTPE) were evaluated. We observed that DTPE induced significantly greater dose-dependent morphological changes, a decrease in cell viability and an increase in cytotoxicity compared to those treated with DNTPE. Moreover, the gene expression was more greatly altered by DTPE than by DNTPE and non-supervised cluster analysis allowed the discrimination of DTPE from the DNTPE. Our systems-based GO-Quant analysis showed significant alterations in the gene pathways involved in cell cycle, phosphate transport and apoptosis regulation with DTPE but not with DNTPE treatment. Disruptions of steroidogenesis related-gene expression such as Star, Cyp19a1, Hsd17b8, and Nr4a3 were observed in the DTPE group, but not in the DNTPE group. In summary, our observation on cell viability, cytotoxicity, and microarray-based gene expression analysis induced by PEs demonstrate that our in vitro 3D-SGC system mimicked in vivo responses for PEs and suggests that the 3D-SGC system might be useful in identifying developmental reproductive toxicants.

  17. Comparison of 20 nm silver nanoparticles synthesized with and without a gold core. Structure, dissolution in cell culture media, and biological impact on macrophages

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Munusamy, Prabhakaran; Wang, Chongmin; Engelhard, Mark H.; Baer, Donald R.; Smith, Jordan N.; Liu, Chongxuan; Kodali, Vamsi K.; Thrall, Brian D.; Chen, Shu; Porter, Alexandra E.; et al

    2015-07-15

    Widespread use of silver nanoparticles raises questions of environmental impact and toxicity. Both silver particles and silver ions formed by particle dissolution may impact biological systems. Therefore it is important to understand the characteristics of silver nanoparticles and their stability in relevant media. The synthesis route can impact physical and chemical characteristics of the particles and we report the characterization and solution stability of three types of silver nanoparticles (20 nm particles with and without gold cores and 110 nm particles with gold cores) in cell culture media with serum proteins: FBS10%/RPMI. These nanoparticles were synthesized in aqueous solution andmore » characterized using both in situ and ex situ analysis methods. Dissolution studies were carried at particle concentrations from 1 µg/ml to 50 µg/ml. Particles with gold cores had smaller crystallite size and higher apparent solubility than pure silver particles. A dissolution model was found to describe the time variation of particle size and amount of dissolved silver for particle loadings above 9 µg/ml. An effective solubility product obtained from fitting the data was higher for the 20 nm gold core particles in comparison to the pure silver or 110 nm particles. Dissolution of the nanoparticles was enhanced by presence of serum proteins contained in fetal bovine serum. In addition, the protocol of the dispersion in the medium was found to influence particle agglomeration and dissolution. Results show that particle structure can impact the concentration of dissolved silver and the dose to which cells would be exposed during in vitro studies.« less

  18. Growth of Chlamydomonas reinhardtii in acetate-free medium when co-cultured with alginate-encapsulated, acetate-producing strains of Synechococcus sp. PCC 7002

    SciTech Connect (OSTI)

    Therien, Jesse B.; Zadvornyy, Oleg A.; Posewitz, Matthew C.; Bryant, Donald A.; Peters, John W.

    2014-10-18

    The model alga Chlamydomonas reinhardtii requires acetate as a co-substrate for optimal production of lipids, and the addition of acetate to culture media has practical and economic implications for algal biofuel production. We demonstrate the growth of C. reinhardtii on acetate provided by mutant strains of the cyanobacterium Synechococcus sp. PCC7002.

  19. Bisphenol A down-regulates rate-limiting Cyp11a1 to acutely inhibit steroidogenesis in cultured mouse antral follicles

    SciTech Connect (OSTI)

    Peretz, Jackye, E-mail: peretz@illinois.edu [2001 South Lincoln Ave, 3211 VMBSB, University of Illinois, Urbana, IL 61802 (United States); Flaws, Jodi A., E-mail: jflaws@illinois.edu [2001 South Lincoln Ave, 3223 VMBSB, University of Illinois, Urbana, IL 61802 (United States)

    2013-09-01

    Bisphenol A (BPA) is the backbone of polycarbonate plastic products and the epoxy resin lining of aluminum cans. Previous studies have shown that exposure to BPA decreases sex steroid hormone production in mouse antral follicles. The current study tests the hypothesis that BPA first decreases the expression levels of the steroidogenic enzyme cytochrome P450 side-chain cleavage (Cyp11a1) and steroidogenic acute regulatory protein (StAR) in mouse antral follicles, leading to a decrease in sex steroid hormone production in vitro. Further, the current study tests the hypothesis that these effects are acute and reversible after removal of BPA. Exposure to BPA (10 ?g/mL and 100 ?g/mL) significantly decreased expression of Cyp11a1 and StAR beginning at 18 h and 72 h, respectively, compared to controls. Exposure to BPA (10 ?g/mL and 100 ?g/mL) significantly decreased progesterone levels beginning at 24 h and decreased androstenedione, testosterone, and estradiol levels at 72 h and 96 h compared to controls. Further, after removing BPA from the culture media at 20 h, expression of Cyp11a1 and progesterone levels were restored to control levels by 48 h and 72 h, respectively. Additionally, expression of StAR and levels of androstenedione, testosterone, and estradiol never decreased compared to controls. These data suggest that BPA acutely decreases expression of Cyp11a1 as early as 18 h and this reduction in Cyp11a1 may lead to a decrease in progesterone production by 24 h, followed by a decrease in androstenedione, testosterone, and estradiol production and expression of StAR at 72 h. Therefore, BPA exposure likely targets Cyp11a1 and steroidogenesis, but these effects are reversible with removal of BPA exposure. - Highlights: BPA may target Cyp11a1 to inhibit steroidogenesis in antral follicles. BPA may decrease the expression of Cyp11a1 prior to inhibiting steroidogenesis. The adverse effects of BPA on steroidogenesis in antral follicles are reversible.

  20. GS Global Biodiesel JV | Open Energy Information

    Open Energy Info (EERE)

    Global Biodiesel JV Jump to: navigation, search Name: GS Global Biodiesel JV Place: Iowa Product: JV between GS AgriFuels and Global Ethanol set-up to develop a plant that will...

  1. Kentucky's 1st congressional district: Energy Resources | Open...

    Open Energy Info (EERE)

    in Kentucky's 1st congressional district Commonwealth AgriEnergy Four Rivers BioEnergy Retrieved from "http:en.openei.orgwindex.php?titleKentucky%27s1stcongressiona...

  2. Rose Energy | Open Energy Information

    Open Energy Info (EERE)

    Kingdom Sector: Biomass Product: Backed by a consortium of three players in our agri-food industry, Rose Energy has proposed a 30MW biomass plant in Northern Ireland....

  3. ESV Group | Open Energy Information

    Open Energy Info (EERE)

    ESV Group Jump to: navigation, search Name: ESV Group Place: London, England, United Kingdom Zip: W1K 4QH Sector: Biofuels Product: UK-based investment agri-business involved in...

  4. CX-001910: Categorical Exclusion Determination

    Broader source: Energy.gov [DOE]

    Lincolnland Agri-Energy, LLCCX(s) Applied: B5.1Date: 03/12/2010Location(s): Palestine, IllinoisOffice(s): Energy Efficiency and Renewable Energy, Golden Field Office

  5. Biochemical Process Improvements & Synthetic Biology Validation...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    ... Laboratory (PNNL) 5) Texas AgriLife Research Partners Total Costs FY 10 -FY 12 FY 13 ... in each project's mid-award Stage Gate review (after intermediate validation) ...

  6. CX-003880: Categorical Exclusion Determination

    Broader source: Energy.gov [DOE]

    Energy Independent Agri-Business OutreachCX(s) Applied: A9, B5.1Date: 09/01/2010Location(s): Cortland County, New YorkOffice(s): Energy Efficiency and Renewable Energy, Golden Field Office

  7. FORMERLY UTILIZED SITES REMEDIAL ACTION PROGRAM ELIMINATION REPORT

    Office of Legacy Management (LM)

    - ELIMINATION REPORT FOR USS AGRI-CHEMICALS (THE FORMER ARMOUR FERTILIZER ' WORKS) BARTOW, FLORIDA NOv 26 1985 Department of Energy Office of Nuclear Energy Office of Remedial Action and Waste Technology Division of Facility and Site Decommissioning Projects -.. ." __.-__.._ ..- --- CONTENTS INTRODUCTION BACKGROUND Site Function Site Description Radiological History and Status ELIMINATION ANALYSIS REFERENCES ii Page 4 _ 5 _-_".-. .-.. ELIMINATION REPORT USS AGRI-CHEMICALS (THE FORMER

  8. Cultural Resources Review for Closure of the nonradioactive Dangerous Waste Landfill and Solid Waste Landfill in the 600 Area, Hanford Site, Benton County, Washington, HCRC# 2010-600-018R

    SciTech Connect (OSTI)

    Gutzeit, Jennifer L.; Kennedy, Ellen P.; Bjornstad, Bruce N.; Sackschewsky, Michael R.; Sharpe, James J.; DeMaris, Ranae; Venno, M.; Christensen, James R.

    2011-02-02

    The U.S. Department of Energy Richland Operations Office is proposing to close the Nonradioactive Dangerous Waste Landfill (NRDWL) and Solid Waste Landfill (SWL) located in the 600 Area of the Hanford Site. The closure of the NRDWL/SWL entails the construction of an evapotranspiration cover over the landfill. This cover would consist of a 3-foot (1-meter) engineered layer of fine-grained soil, modified with 15 percent by weight pea gravel to form an erosion-resistant topsoil that will sustain native vegetation. The area targeted for silt-loam borrow soil sits in Area C, located in the northern central portion of the Fitzner/Eberhardt Arid Lands Ecology (ALE) Reserve Unit. The pea gravel used for the mixture will be obtained from both off-site commercial sources and an active gravel pit (Pit #6) located just west of the 300 Area of the Hanford Site. Materials for the cover will be transported along Army Loop Road, which runs from Beloit Avenue (near the Rattlesnake Barricade) east-northeast to the NRDWL/SWL, ending at State Route 4. Upgrades to Army Loop Road are necessary to facilitate safe bidirectional hauling traffic. This report documents a cultural resources review of the proposed activity, conducted according to Section 106 of the National Historic Preservation Act of 1966.

  9. External Assessment of Nuclear Safety Culture

    Broader source: Energy.gov [DOE]

    Presenter: Ward Sproat, Principal Vice President and Deputy Project Director for Design and Operations Waste Treatment Plant Project Bechtel National, Inc.

  10. Creating a Culture of Risk Assessment

    Broader source: Energy.gov [DOE]

    OE’s Energy Infrastructure Modeling and Analysis Division is leading a State Energy Risk Assessment Initiative to better understand potential impacts to energy infrastructure. The initiative is a collaborative effort with the National Association of State Energy Officials (NASEO), the National Association of Regulatory Utility Commissioners (NARUC), the National Conference of State Legislatures (NCSL), and the National Governors Association (NGA). Below is a brochure describing the initiative.

  11. Culturing photosynthetic bacteria through surface plasmon resonance

    SciTech Connect (OSTI)

    Ooms, Matthew D.; Bajin, Lauren; Sinton, David

    2012-12-17

    In this work, cultivation of photosynthetic microbes in surface plasmon enhanced evanescent fields is demonstrated. Proliferation of Synechococcus elongatus was obtained on gold surfaces excited with surface plasmons. Excitation over three days resulted in 10 {mu}m thick biofilms with maximum cell volume density of 20% vol/vol (2% more total accumulation than control experiments with direct light). Collectively, these results indicate the ability to (1) excite surface-bound cells using plasmonic light fields, and (2) subsequently grow thick biofilms by coupling light from the surface. Plasmonic light delivery presents opportunities for high-density optofluidic photobioreactors for microalgal analysis and solar fuel production.

  12. Cultural Resource Conservation | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    that contain archaeological and historical sites, threatened and endangered species, marine mammals, Native American burial and sacred sites, historic buildings, and wetlands. ...

  13. Fermilab Cultural Events in Batavia, IL

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2015 - 2016 Fermilab Arts & Lecture Series Tickets Available Now! Click here! - Purchase with no additional fees! SOLD OUT - Fermilab/WGN Tornado & Severe Storm Seminar April 2, 2016 @ noon Each year WGN weather superstar Tom Skilling hosts an extended peek into the methods meteorologists use to track tornados and severe weather, and the ways you can be prepared for serious storms. This event is sold out but will be simulcast on WGN's website. SATURDAY! Dervish from Ireland - Saturday,

  14. Conversion of crop seed oils to jet fuel and associated methods

    DOE Patents [OSTI]

    Ginosar, Daniel M.; Petkovic, Lucia M.; Thompson, David N.

    2010-05-18

    Aspects of the invention include methods to produce jet fuel from biological oil sources. The method may be comprised of two steps: hydrocracking and reforming. The process may be self-sufficient in heat and hydrogen.

  15. Rising atmospheric CO{sub 2} and crops: Research methodology and direct effects

    SciTech Connect (OSTI)

    Rogers, H.; Acock, B.

    1993-12-31

    Carbon dioxide is the food of trees and grass. Our relentless pursuit of a better life has taken us down a traffic jammed road, past smoking factories and forests. This pursuit is forcing a rise in the atmospheric CO{sub 2} level, and no one know when and if flood stage will be reached. Some thinkers have suggested that this increase of CO{sub 2} in the atmosphere will cause warming. No matter whether this prediction is realized or not, more CO{sub 2} will directly affect plants. Data from controlled observations have usually, but not always, shown benefits. Our choices of scientific equipment for gathering CO{sub 2} response data are critical since we must see what is happening through the eye of the instrument. The signals derived from our sensors will ultimately determine the truth of our conclusions, conclusion which will profoundly influence our policy decisions. Experimental gear is selected on the basis of scale of interest and problem to be addressed. Our imaginations and our budgets interact to set bounds on our objectives and approaches. Techniques run the gamut from cellular microprobes through whole-plant controlled environment chambers to field-scale exposure systems. Trade-offs exist among the various CO{sub 2} exposure techniques, and many factors impinge on the choice of a method. All exposure chambers are derivatives of three primary types--batch, plug flow, and continuous stirred tank reactor. Systems for the generation of controlled test atmospheres of CO{sub 2} vary in two basic ways--size and degree of control. Among the newest is free-air CO{sub 2} enrichment which allows tens of square meters of cropland to be studied.

  16. Genes and Genomics for Improving Energy Crops (Keynote Address - 2010 JGI User Meeting)

    ScienceCinema (OSTI)

    Pennell, Roger

    2011-04-28

    Roger Pennell, Vice President of Trait Development at Ceres, Inc., delivers a keynote address at the 5th Annual DOE JGI User Meeting on March 25, 2010

  17. Accelerating Biofuel Feedstock Crop Improvement with Miscanthus Genomics (2014 DOE JGI Genomics of Energy & Environment Meeting)

    SciTech Connect (OSTI)

    Swaminathan, Kankshita

    2014-03-20

    Kankshita Swaminathan of the Energy Biosciences Institute speaks at the 9th Annual Genomics of Energy & Environment Meeting on March 20, 2014 in Walnut Creek, Calif.

  18. USDA and DOE Fund 10 Research Projects to Accelerate Bioenergy Crop Production and Spur Economic Impact

    Broader source: Energy.gov [DOE]

    WASHINGTON, DC -- The U.S. Departments of Energy and Agriculture have awarded 10 grants totaling $12.2 million to spur research into improving the efficiency and cost-effectiveness of growing...

  19. Assessing the Economic Viability of Bio-based Products for Missouri Value-added Crop Production

    SciTech Connect (OSTI)

    Nicholas Kalaitzandonakes

    2005-11-30

    While research and development on biobased products has continued strong over the years, parallel attention on the economics and management of such product innovation has been lacking. With the financial support of the Department of Energy, the Economics and Management of Agrobiotechnology Center at the University of Missouri-Columbia has launched a pilot graduate education program that seeks to fill the gap. Within this context, a multi-disciplinary research and teaching program has been structured with an emphasis on new product and innovation economics and management. More specifically, this pilot graduate education program has the following major objectives: (1) To provide students with a strong background in innovation economics, management, and strategy. (2) To diversify the students academic background with coursework in science and technology. (3) To familiarize the student with biobased policy initiatives through interaction with state and national level organizations and policymakers. (4) To facilitate active collaboration with industry involved in the development and production of biobased products. The pilot education program seeks to develop human capital and research output. Although the research is, initially, focused on issues related to the State of Missouri, the results are expected to have national implications for the economy, producers, consumers and environment.

  20. DOE - Office of Legacy Management -- Armour Fertilizer Works - FL 01

    Office of Legacy Management (LM)

    Fertilizer Works - FL 01 FUSRAP Considered Sites Site: Armour Fertilizer Works (FL.01 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: U. S. S. Agri-Chemical U.S. Steel Corporation--Agri-Chemical FL.01-1 FL.01-2 Location: Bartow , Florida FL.01-2 Evaluation Year: 1985 FL.01-3 Site Operations: Conducted research and development on uranium recovery from phosphoric acid. FL.01-1 Site Disposition: Eliminated - No Authority FL.01-3 Radioactive Materials

  1. EIS-0300: Withdrawal of Notice of Intent to Prepare an Environmental Impact

    Broader source: Energy.gov (indexed) [DOE]

    Statement | Department of Energy Proposed Minnesota Agri-Power Plant and Associated Facilities PDF icon EIS-0300-WdNOI-1999.pdf More Documents & Publications EIS-0238: Withdrawal of Notice of Intent to Prepare an Environmental Impact Statement EIS-0300: Notice of Intent to Prepare an Environmental Impact Statement EIS-0238: Record of Decision

  2. Fermilab Cultural Events in Chicago's Far West Side

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    influenced by her son's research. A physicist, his current work involves the search for gravitational waves. As he tries to better understand the universe, she is trying to share...

  3. Maximizing Light Utilization Efficiency and Hydrogen Production in Microalgal Cultures

    SciTech Connect (OSTI)

    Melis, Anastasios

    2014-12-31

    The project addressed the following technical barrier from the Biological Hydrogen Production section of the Fuel Cell Technologies Program Multi-Year Research, Development and Demonstration Plan: Low Sunlight Utilization Efficiency in Photobiological Hydrogen Production is due to a Large Photosystem Chlorophyll Antenna Size in Photosynthetic Microorganisms (Barrier AN: Light Utilization Efficiency).

  4. Indiana Jonesing at BPA: an archaeologist's passion for cultural...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    l significance that continues for people today. Transmission archaeologist Kurt Perkins demonstrates flint knapping at the April 29 managers' meeting. Using an elk antler...

  5. BLM - Information on Cultural Resource Use Permits webpage |...

    Open Energy Info (EERE)

    of Land Management. cited 20140917. Available from: http:www.blm.govcostenBLMProgramsculturalresourcesculturalresource.html Retrieved from "http:en.openei.orgw...

  6. Fermilab Cultural Events in Chicago's Far West Side

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    around an aggregate of online videos, but are people watching more than just music and cat videos? The Brain Scoop is an educational YouTube channel based at The Field...

  7. Fermilab Cultural Events in Chicago's Far West Side

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    of Chicago, invited her to draw and paint at the pre-history excavation in Eastern Turkey. In the 1970's she created a series of works inspired by electric circuitry and...

  8. Northern New Mexican pueblo preserves cultural history through...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    to bring the youth academic enrichment through emphasis on science, math and language arts in addition to honoring tradition. Through the program, which offers Tewa classes in...

  9. Fermilab Cultural Events in Chicago's Far West Side

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2814 for ages 18 and under Volume Plus Discount (adult priced tickets for 5 or more Arts Series events) - 23.80 Volume Discount (adult priced tickets for 3 - 4 Arts Series...

  10. Fermilab Cultural Events in Chicago's Far West Side

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Art Series presents: The Adventures of Sherlock Holmes - Aquila Theatre Saturday, October 24, 2015 @ 8 pm Tickets - 3518 for ages 18 and under Volume Plus Discount (adult priced...

  11. Fermilab Cultural Events in Chicago's Far West Side

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    among guitar virtuosi. For all its technical brilliance, wicked syncopation and harmonic sophistication, Kottkes music is eminently accessible. At heart hes a populist....

  12. Transcript, Keeping the Edge: Enhancing Performance by Managing Culture

    Broader source: Energy.gov [DOE]

    Transcript: 2003 INPO CEO Conference, Keeping the Edge: “Enhancing Performance by Managing Culture” Edgar H. Schein, Ph.D. Professor Emeritis, Massachusetts Institute of Technology November 7, 2003

  13. Fermilab Cultural Events in Chicago's Far West Side

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    few years I have begun to branch out to other "bridge cities" including Boston, New York City and Pittsburgh. In 2011 I explored the bridges in Berlin, Germany. I select...

  14. Fermilab Cultural Events in Chicago's Far West Side

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    on Sesame Street to the chief juggler in Barnum on Broadway, from tumbling for the New York City Opera to performing with the famed MoMix Dance Company. Daielma Santos, a native...

  15. Fermilab Cultural Events in Chicago's Far West Side

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    I carry daily and those I experience in the present, blend to create a rich infusion of memory and desire. It is an alchemy that compels me to express them in images. My...

  16. 7th Workshop on Risk Informed Regulation and Safety Culture ...

    Energy Savers [EERE]

    their PRA. However, Qinshan will hire two U.S. PRA firms to develop its "Generation Risk Analysis" model. This summer, a team of Qinshan PSA personnel will visit South Texas...

  17. Fermilab Cultural Events in Chicago's Far West Side

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    beams to generate huge electric waves in plasma that are 10,000 times larger than the radio waves used in an accelerator like the Tevatron at Fermilab. So the natural question...

  18. EM Contractor Reaps Benefits of Continuous Improvement Culture

    Broader source: Energy.gov [DOE]

    AIKEN, S.C. – Continuous Improvement (CI) at Savannah River Nuclear Solutions (SRNS), EM’s management and operations contractor at the Savannah River Site (SRS), focuses on eliminating wasteful steps in processes, making little changes that result in significant savings.

  19. Fermilab Cultural Events in Chicago's Far West Side

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2012 Artist Reception April 27, 2012 * Waterstreet Studios will present work referencing kinetic energy, the energy possessed by an object due to its motion.on display April 20,...

  20. Fermilab Cultural Events in Chicago's Far West Side

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Spektral Quartet January 24, 2016 Alliance Brass February 28, 2016 Jennifer Gunn & Tim Munro March 20, 2016 $42 for three concerts, $17 for single tickets Free on-line ticketing now available! Click here to purchase tickets or call our box office at 630/840.ARTS (2787). All Chamber Series concerts begin at 2:30 p.m. in the 2nd Floor Art Gallery Spektral Quartet January 24, 2016 @ 2:30 pm Founded in 2010, the Spektral Quartet is widely regarded as one of Chicago's most magnetic and

  1. Fermilab Cultural Events in Chicago's Far West Side

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    General Information Fermilab Arts & Lecture Series Kirk Road & Pine Street, P.O. Box 500, MS 111, Batavia, IL 60510 - 0500 Phone: Voice - 630.840.ARTS(2787), Fax - 630.840.5501 E-Mail: audweb@fnal.gov Tickets are sold on a first-come, first-served basis. Tickets may be charged on MasterCard, Visa, or Discover or paid for by check. Mail Order. Send a check (payable to Fermilab) or charge authorization with a self-addressed, stamped envelope to Fermilab Arts Series, P.O. Box 500, MS111,

  2. Fermilab Cultural Events in Chicago's Far West Side

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    "I have always felt that science, technology, and art are importantly connected, indeed science and technology seem to many scholars to have grown out of art." -Robert Rathbun Wilson This convergence of art and science occurs daily in the Fermilab Art Gallery. It is a space for art exhibitions, chamber music concerts and where the top quark and big bang are debated over coffee. It is also a quiet space for contemplation and beauty. Current Status of Access to Fermilab Current

  3. Fermilab Cultural Events in Chicago's Far West Side

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Fermilab Arts Series Presents: July 11, 2009 Ashley Lewis and Ashton Gap $16 ($8 ages 18 and under) August 1, 2009 Ma Xiaohui Magic Erhu Recital $18 ($9 ages 18 and under) September 19, 2009 Mosaico Hispanico: Celebrating Hispanic Heritage with Las Guitarras de Espana, Mexican Folkloric Dance Ensemble and Willie Gomez t.b.d. ($t.b.d. ages 18 and under) October 24, 2009 Hot Buttered Rum $25 ($13 ages 18 and under) November 7, 2009 Fred Garbo Inflatable Theater Company $26 ($13 ages 18 and under)

  4. Fermilab Cultural Events in Chicago's Far West Side

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Film Series Update The Fermilab International Film Society has come to an end. Many thanks to all who have shown their support and donated their time throughout the years.

  5. Fermilab Cultural Events in Chicago's Far West Side

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Lecture Series: Fermilab offers a public lecture series on a wide range of topics presented by experts in their respective fields. Generally 6 to 8 lectures are offered each year ranging from astrophysics and cosmology to cancer. Lectures cost $5.00 and are usually on Friday evenings beginning at 8 p.m. in Ramsey Auditorium. For information, call 630-840-ARTS (630-840-2787). Upcoming Lectures Surfing on Plasma Waves Dr. Thomas C. Katsouleas, Professor and Dean, Duke University, Pratt School of

  6. Fermilab Cultural Events in Chicago's Far West Side

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Art of Darkness Images from the Dark Energy Survey On Display: February 19, 2016 -April 29, 2016 Reception - Friday, March 18 5-7pm Fermilab Art Gallery, Wilson Hall The universe has been expanding since the Big Bang almost 14 billion years ago. Now, the expansion of the universe is accelerating, driven by a new fundamental form of energy called dark energy. The Dark Energy Survey (DES) is a collaboration of more than 400 scientists from over 30 institutions across 7 countries. DES aims to find

  7. CHANGING THE SAFETY CULTURE IN HANFORD TANK FARMS

    SciTech Connect (OSTI)

    BERRIOCHOA MV; ALCALA LJ

    2009-01-06

    In 2000 the Hanford Tank Farms had one of the worst safety records in the Department of Energy Complex. By the end of FY08 the safety performance of the workforce had turned completely around, resulting in one of the best safety records in the DOE complex for operations of its kind. This paper describes the variety of programs and changes that were put in place to accomplish such a dramatic turn-around. The U.S. Department of Energy's 586-square-mile Hanford Site in Washington State was established during World War II as part of the Manhattan Project to develop nuclear materials to end the war. For the next several decades it continued to produce plutonium for the nation's defense, leaving behind vast quantities of radioactive and chemical waste. Much of this waste, 53,000,000 gallons, remains stored in 149 aging single-shell tanks and 28 newer double-shell tanks. One of the primary objectives at Hanford is to safely manage this waste until it can be prepared for disposal, but this has not always been easy. These giant underground tanks, many of which date back to the beginning of the Manhattan Project, range in size from 55,000 gallons up to 1.1 million gallons, and are buried beneath 10 feet of soil near the center of the site. Up to 67 of the older single-shell tanks have leaked as much as one million gallons into the surrounding soil. Liquids from the single-shell tanks were removed by 2003 but solids remain in the form of saltcake, sludges and a hardened heel at the bottom of some tanks. The Department of Energy's Office of River Protection was established to safely manage this waste until it could be prepared for disposal. For most of the last seven years the focus has been on safely retrieving waste from the 149 aging single-shell and moving it to the newer double-shell tanks. Removing waste from the tanks is a difficult and complex task. The tanks were made to put waste in, not take it out. Because of the toxic nature of the waste, both chemically as well as radiologically, all retrieval operations must be performed using remote-controlled equipment which has to be installed in each tank, then removed when retrieval is completed. This process involves a variety of potentially hazardous construction activities including crane and rigging, excavation, electrical and piping work. It also requires strong attention to safety to avoid injuries to personnel and contamination of the environment.

  8. Characterization of Residual Medium Peptides from Yersinia pestis Cultures

    SciTech Connect (OSTI)

    Clowers, Brian H.; Wunschel, David S.; Kreuzer, Helen W.; Engelmann, Heather E.; Valentine, Nancy B.; Wahl, Karen L.

    2013-04-03

    Using a range of common microbial medium formulations (TSB, BHI, LB, and G-media), two attenuated strains of Y. pestis (KIM D27 (pgm-) and KIMD1 lcr-) were cultivated in triplicate. These cellular suspensions were used to develop a method of extracting residual medium peptides from the final microbial preparation to assess their relative abundance and identity. Across the conditions examined, which included additional cellular washing and different forms of microbial inactivation, residual medium peptides were detected. Despite the range of growth medium sources used and the associated manufacturing processes used in their production, a high degree of peptide similarity was observed for a given medium recipe. These results demonstrate that residual medium peptides are retained using traditional microbial cultivation techniques and may be used to inform forensic investigations with respect to production deduction.

  9. Safety Culture Best Practices agenda/presentations | Y-12 National...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Standards Organization) Jim Merrigan LLNL 5:00 Wrap Up and Adjourn Rizwan Shah Teresa Robbins Paul Wasilko DOE NPO CNS Wed. 1021 Topic Responsibility Organization Best Practices...

  10. The Resource Identification Initiative: A cultural shift in publishing

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Bandrowski, Anita; Brush, Matthew; Grethe, Jeffery S.; Haendel, Melissa A.; Kennedy, David N.; Hill, Sean; Hof, Patrick R.; Martone, Maryann E.; Pols, Maaike; Tan, Serena; et al

    2015-05-29

    A central tenet in support of research reproducibility is the ability to uniquely identify research resources, i.e., reagents, tools, and materials that are used to perform experiments. However, current reporting practices for research resources are insufficient to allow humans and algorithms to identify the exact resources that are reported or answer basic questions such as “What other studies used resource X?” To address this issue, the Resource Identification Initiative was launched as a pilot project to improve the reporting standards for research resources in the methods sections of papers and thereby improve identifiability and reproducibility. The pilot engaged over 25more » biomedical journal editors from most major publishers, as well as scientists and funding officials. Authors were asked to include Research Resource Identifiers (RRIDs) in their manuscripts prior to publication for three resource types: antibodies, model organisms, and tools (including software and databases). RRIDs represent accession numbers assigned by an authoritative database, e.g., the model organism databases, for each type of resource. To make it easier for authors to obtain RRIDs, resources were aggregated from the appropriate databases and their RRIDs made available in a central web portal (www.scicrunch.org/resources). RRIDs meet three key criteria: they are machine readable, free to generate and access, and are consistent across publishers and journals. The pilot was launched in February of 2014 and over 300 papers have appeared that report RRIDs. The number of journals participating has expanded from the original 25 to more than 40. Here, we present an overview of the pilot project and its outcomes to date. We show that authors are generally accurate in performing the task of identifying resources and supportive of the goals of the project. We also show that identifiability of the resources pre- and post-pilot showed a dramatic improvement for all three resource types, suggesting that the project has had a significant impact on reproducibility relating to research resources.« less

  11. The Resource Identification Initiative: A cultural shift in publishing

    SciTech Connect (OSTI)

    Bandrowski, Anita; Brush, Matthew; Grethe, Jeffery S.; Haendel, Melissa A.; Kennedy, David N.; Hill, Sean; Hof, Patrick R.; Martone, Maryann E.; Pols, Maaike; Tan, Serena; Washington, Nicole; Zudilova-Seinstra, Elena; Vasilevsky, Nicole

    2015-05-29

    A central tenet in support of research reproducibility is the ability to uniquely identify research resources, i.e., reagents, tools, and materials that are used to perform experiments. However, current reporting practices for research resources are insufficient to allow humans and algorithms to identify the exact resources that are reported or answer basic questions such as What other studies used resource X? To address this issue, the Resource Identification Initiative was launched as a pilot project to improve the reporting standards for research resources in the methods sections of papers and thereby improve identifiability and reproducibility. The pilot engaged over 25 biomedical journal editors from most major publishers, as well as scientists and funding officials. Authors were asked to include Research Resource Identifiers (RRIDs) in their manuscripts prior to publication for three resource types: antibodies, model organisms, and tools (including software and databases). RRIDs represent accession numbers assigned by an authoritative database, e.g., the model organism databases, for each type of resource. To make it easier for authors to obtain RRIDs, resources were aggregated from the appropriate databases and their RRIDs made available in a central web portal (www.scicrunch.org/resources). RRIDs meet three key criteria: they are machine readable, free to generate and access, and are consistent across publishers and journals. The pilot was launched in February of 2014 and over 300 papers have appeared that report RRIDs. The number of journals participating has expanded from the original 25 to more than 40. Here, we present an overview of the pilot project and its outcomes to date. We show that authors are generally accurate in performing the task of identifying resources and supportive of the goals of the project. We also show that identifiability of the resources pre- and post-pilot showed a dramatic improvement for all three resource types, suggesting that the project has had a significant impact on reproducibility relating to research resources.

  12. Independent Oversight Follow-up Assessment of Safety Culture...

    Office of Environmental Management (EM)

    PIRB Performance Improvement Review Board PT Pretreatment PTF Pretreatment Facility QA Quality Assurance SCWE Safety Conscious Work Environment STARRT Safety Task Analysis and Risk...

  13. Fermilab Cultural Events in Chicago's Far West Side

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    for more than 25 years. Their unique programming of works for both 19th century and modern guitars provides rare insight into the evolution of this captivating art....

  14. Enterprise Assessments Follow-up Assessment of Safety Culture...

    Broader source: Energy.gov (indexed) [DOE]

    learned on this topic from other sites. - The ORP response to the DNFSB regarding the approach to addressing the consequences of ashfall from a postulated volcano was a recent...

  15. CULTURAL RESOURCES MANAGEMENT PLAN FOR THE NEVADA TEST SITE

    National Nuclear Security Administration (NNSA)

    i R y R y R d i n f n n s t i o 6 1 . 2 o r a E C u 1 n f 1 . 2 . E . . . . . . . . . . . . . . . . . . . . . . . . . . . . R. . 7 .1 1 o C ff S NN s SNA f OM N RO N . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . i n viii 3.8 American Indian Program . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25 3.8.1 Consultation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25 3.8.1.1

  16. EIS-0238: Withdrawal of Notice of Intent to Prepare an Environmental Impact

    Broader source: Energy.gov (indexed) [DOE]

    Statement | Department of Energy Proposed Minnesota Agri-Power Plant and Associated Facilities On October 7, 1998 (63 FR 53885), U.S. Department of Energy (DOE) and the Minnesota Environmental Quality Board [MEQB, a Minnesota State agency] announced its intent to prepare a joint Environmental Impact Statement (EIS) regarding a proposal by the Minnesota Valley Alfalfa Producers (MnVAP) to construct and operate a 75-103 megawatt biomass fueled gasifier and electric generating facility, known

  17. STTR Phase 1 Final Technical Report for Project Entitled "Developing a

    Office of Scientific and Technical Information (OSTI)

    Mobile Torrefaction Machine" (Technical Report) | SciTech Connect STTR Phase 1 Final Technical Report for Project Entitled "Developing a Mobile Torrefaction Machine" Citation Details In-Document Search Title: STTR Phase 1 Final Technical Report for Project Entitled "Developing a Mobile Torrefaction Machine" The goal of this project, sponsored by Agri-Tech Producers, LLC (ATP), the small business grantee, was to determine if the torrefaction technology, developed by

  18. Des Moines Area Community College | OSTI, US Dept of Energy, Office of

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Scientific and Technical Information Des Moines Area Community College Spotlights Home DOE Applauds DMACC Science and Technical Programs Des Moines Area Community College Des Moines Area Community College Des Moines, Iowa Agri/Natural Resources Biology Biomass Operations Biotechnology Environmental Science Information Technology Manufacturing Technology Microcomputers Civil Engineering Pre-Medical Telecommunications Wind Turbines Ames Laboratory Ames Laboratory is one of DOE's 10 Office of

  19. Mesalands Community College | OSTI, US Dept of Energy, Office of Scientific

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    and Technical Information Mesalands Community College Spotlights Home DOE Applauds Mesalands Science and Technical Programs Agri-Business Automotive Technology Beef Science Diesel Technology Equine Science Farrier Science Wind Energy Technology Building Trades Geology Paleontology Pre-Dentistry Pre-Medicine Pre-Veterinary Pre-Engineering North American Wind Research & Training Center On April 14, 2009, Mesalands Community College and Sandia National Laboratories signed a Memorandum of

  20. Alternative Fuels Data Center

    Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

    Improvement and Extension Act of 2008 Enacted October 3, 2008 The Energy Improvement and Extension Act of 2008 is Division B of the Emergency Economic Stabilization Act (Public Law 110-343). Title II of Division B of the law includes several provisions related to tax credits and exemptions for alternative fuels and fuel-efficient technologies. The table below provides a summary of the relevant provisions. Reference Description Section 202 Amends the existing biodiesel mixture and agri-biodiesel

  1. Sub-crop geologic map of pre-Tertiary rocks in the Yucca Flat and northern Frenchman Flat areas, Nevada Test Site, southern Nevada

    SciTech Connect (OSTI)

    Cole, J.C.; Harris, A.G.; Wahl, R.R.

    1997-10-02

    This map displays interpreted structural and stratigraphic relations among the Paleozoic and older rocks of the Nevada Test Site region beneath the Miocene volcanic rocks and younger alluvium in the Yucca Flat and northern Frenchman Flat basins. These interpretations are based on a comprehensive examination and review of data for more than 77 drillholes that penetrated part of the pre-Tertiary basement beneath these post-middle Miocene structural basins. Biostratigraphic data from conodont fossils were newly obtained for 31 of these holes, and a thorough review of all prior microfossil paleontologic data is incorporated in the analysis. Subsurface relationships are interpreted in light of a revised regional geologic framework synthesized from detailed geologic mapping in the ranges surrounding Yucca Flat, from comprehensive stratigraphic studies in the region, and from additional detailed field studies on and around the Nevada Test Site. All available data indicate the subsurface geology of Yucca Flat is considerably more complicated than previous interpretations have suggested. The western part of the basin, in particular, is underlain by relics of the eastward-vergent Belted Range thrust system that are folded back toward the west and thrust by local, west-vergent contractional structures of the CP thrust system. Field evidence from the ranges surrounding the north end of Yucca Flat indicate that two significant strike-slip faults track southward beneath the post-middle Miocene basin fill, but their subsurface traces cannot be closely defined from the available evidence. In contrast, the eastern part of the Yucca Flat basin is interpreted to be underlain by a fairly simple north-trending, broad syncline in the pre-Tertiary units. Far fewer data are available for the northern Frenchman Flat basin, but regional analysis indicates the pre-Tertiary structure there should also be relatively simple and not affected by thrusting. This new interpretation has implications for ground water flow through pre-Tertiary rocks beneath the Yucca Flat and northern Frenchman Flat areas, and has consequences for ground water modeling and model validation. Our data indicate that the Mississippian Chainman Shale is not laterally extensive confining unit in the western part of the basin because it is folded back onto itself by the convergent structures of the Belted Range and CP thrust systems. Early and Middle Paleozoic limestone and dolomite are present beneath most of both basins and, regardless of structural complications, are interpreted to form a laterally continuous and extensive carbonate aquifer. Structural culmination that marks the French Peak accommodation zone along the topographic divide between the two basins provides a lateral pathway through highly fractured rock between the volcanic aquifers of Yucca Flat and the regional carbonate aquifer. This pathway may accelerate the migration of ground-water contaminants introduced by underground nuclear testing toward discharge areas beyond the Nevada Test Site boundaries. Predictive three-dimensional models of hydrostratigraphic units and ground-water flow in the pre-Tertiary rocks of subsurface Yucca Flat are likely to be unrealistic due to the extreme structural complexities. The interpretation of hydrologic and geochemical data obtained from monitoring wells will be difficult to extrapolate through the flow system until more is known about the continuity of hydrostratigraphic units. 1 plate

  2. Creating a Multi-functional Library of Grass Transcription Factors for the Energy Crop Model System Brachypodium Distachyon (2014 DOE JGI Genomics of Energy & Environment Meeting)

    SciTech Connect (OSTI)

    Coomey, Joshua [University of Massashusetts Amherst

    2014-03-20

    Joshua Coomey of the University of Massachusetts Amherst, speaks at the 9th Annual Genomics of Energy & Environment Meeting on March 20, 2014 in Walnut Creek, Calif.

  3. Selenium Accumulation, Distribution, and Speciation in Spineless Prickly Pear Cactus: A Drought- and Salt-Tolerant, Selenium-Enriched Nutraceutical Fruit Crop for Biofortified Foods

    SciTech Connect (OSTI)

    Banuelos, Gary S.; Fakra, Sirine C.; Walse, Spencer S.; Marcus, Matthew A.; Yang, Soo In; Pickering, Ingrid J.; Pilon-Smits, Elizabeth A.H.; Freeman, John L.

    2011-07-01

    The organ-specific accumulation, spatial distribution, and chemical speciation of selenium (Se) were previously unknown for any species of cactus. We investigated Se in Opuntia ficus-indica using inductively coupled plasma mass spectrometry, microfocused x-ray fluorescence elemental and chemical mapping ({micro}XRF), Se K-edge x-ray absorption near-edge structure (XANES) spectroscopy, and liquid chromatography-mass spectrometry (LC-MS). {micro}XRF showed Se concentrated inside small conic, vestigial leaves (cladode tips), the cladode vasculature, and the seed embryos. Se K-edge XANES demonstrated that approximately 96% of total Se in cladode, fruit juice, fruit pulp, and seed is carbon-Se-carbon (C-Se-C). Micro and bulk XANES analysis showed that cladode tips contained both selenate and C-Se-C forms. Inductively coupled plasma mass spectrometry quantification of Se in high-performance liquid chromatography fractions followed by LC-MS structural identification showed selenocystathionine-to-selenomethionine (SeMet) ratios of 75:25, 71:29, and 32:68, respectively in cladode, fruit, and seed. Enzymatic digestions and subsequent analysis confirmed that Se was mainly present in a 'free' nonproteinaceous form inside cladode and fruit, while in the seed, Se was incorporated into proteins associated with lipids. {micro}XRF chemical mapping illuminated the specific location of Se reduction and assimilation from selenate accumulated in the cladode tips into the two LC-MS-identified C-Se-C forms before they were transported into the cladode mesophyll. We conclude that Opuntia is a secondary Se-accumulating plant whose fruit and cladode contain mostly free selenocystathionine and SeMet, while seeds contain mainly SeMet in protein. When eaten, the organic Se forms in Opuntia fruit, cladode, and seed may improve health, increase Se mineral nutrition, and help prevent multiple human cancers.

  4. Interaction of carbon nanohorns with plants: Uptake and biological effects

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Lahiani, Mohamed H.; Chen, Jihua; Irin, Fahmida; Puretzky, Alexander A.; Green, Micah J.; Khodakovskaya, Mariya V.

    2014-10-07

    Single-Walled Carbon Nanohorns (SWCNHs) are a unique carbon-based nanomaterial with promising application in different fields including, medicine, genetic engineering and horticulture. Here, we investigated the biological response of six crop species (barley, corn, rice, soybean, switchgrass, tomato) and tobacco cell culture to the exposure of SWCNHs. We found that SWCNHs can activate seed germination of selected crops and enhance growth of different organs of corn, tomato, rice and soybean. At cellular level, growth of tobacco cells was increased in response to exposure of SWCNHs (78% increase compared to control). Uptake of SWCNHs by exposed crops and tobacco cells was confirmedmore » by transmission electron microscopy (TEM) and quantified by microwave induced heating (MIH) technique. At genetic level, SWCNHs were able to affect expression of a number of tomato genes that are involved in stress responses, cellular responses and metabolic processes. Our conclusion is that SWCNHs can be used as plant growth regulators and have the potential for plant-related applications.« less

  5. Interaction of carbon nanohorns with plants: Uptake and biological effects

    SciTech Connect (OSTI)

    Lahiani, Mohamed H.; Chen, Jihua; Irin, Fahmida; Puretzky, Alexander A.; Green, Micah J.; Khodakovskaya, Mariya V.

    2014-10-07

    Single-Walled Carbon Nanohorns (SWCNHs) are a unique carbon-based nanomaterial with promising application in different fields including, medicine, genetic engineering and horticulture. Here, we investigated the biological response of six crop species (barley, corn, rice, soybean, switchgrass, tomato) and tobacco cell culture to the exposure of SWCNHs. We found that SWCNHs can activate seed germination of selected crops and enhance growth of different organs of corn, tomato, rice and soybean. At cellular level, growth of tobacco cells was increased in response to exposure of SWCNHs (78% increase compared to control). Uptake of SWCNHs by exposed crops and tobacco cells was confirmed by transmission electron microscopy (TEM) and quantified by microwave induced heating (MIH) technique. At genetic level, SWCNHs were able to affect expression of a number of tomato genes that are involved in stress responses, cellular responses and metabolic processes. Our conclusion is that SWCNHs can be used as plant growth regulators and have the potential for plant-related applications.

  6. Radon Laboratory: A Proposal for Scientific Culture Dissemination Among Young Students in Italy

    SciTech Connect (OSTI)

    Groppi, Flavia; Manenti, Simone; Gini, Luigi; Bonardi, Mauro L.; Bazzocchi, Anna

    2009-08-19

    In Italy the 'nuclear issue' was for a long time a taboo. A way to approach this theme to make the public more trusting of nuclear issues is to discuss radioactivity and ionizing radiation starting from young students. An experimental activity that involves secondary school students has been developed. The approach is to have students engaged in activities that will allow them to understand how natural radioactivity is a part of our everyday environment. This would include how radiation enters our lives in different ways, to demonstrate that natural radioactive sources found in soil, water, and air contribute to our exposure to natural ionizing radiation and how this exposure effects human health. Another objective is to develop a new technique for teaching physics which will enhance scientific interest of students in applications of nuclear physics in both environmental and physical sciences.

  7. What Does Self-Assessment of Safety Culture Look Like? Discussion from the Pantex Plant Perspective

    Broader source: Energy.gov [DOE]

    Presenter: Dr. Suzanne Helfinstine, Staff Engineer High Reliability Operations B&W Pantex Pantex Plant

  8. Safety Culture in the US Nuclear Regulatory Commission's Reactor Oversight Process

    Broader source: Energy.gov [DOE]

    Presenter: Undine Shoop, Chief, Health Physics and Human Performance Branch, Office of Nuclear Reactor Regulation, U.S. Nuclear Regulatory Commission

  9. NMAC 4.10.15 Cultural Properties and Historic Preservation Standards...

    Open Energy Info (EERE)

    Preservation Standards for Survey and InventoryLegal Abstract These rules outline procedures to conduct surveys to identify, record and evaluate archaeological sites, isolates,...

  10. Instrument for the application of controlled mechanical loads to tissues in sterile culture

    DOE Patents [OSTI]

    Lintilhac, P.M.; Vesecky, T.B.

    1995-04-18

    Apparatus and methods are disclosed facilitating the application of forces and measurement of dimensions of a test subject. In one arrangement the test subject is coupled to a forcing frame and controlled forces applied thereto by a series of guideways and sliders. The sliders, which contact the test subject are in force transmitting relation to a forcing frame. Tension, compression and bending forces can be applied to the test subject. Force applied to the test subject is measured and controlled. A dimensional characteristic of the test subject, such as growth, is measured by a linear variable differential transformer. The growth measurement data can be used to control the force applied. Substantially uniaxial stretching is achieved by placing the test subject on an elastic membrane stretched by an arrangement of members securing the elastic member to the forcing frame. 8 figs.

  11. Instrument for the application of controlled mechanical loads to tissues in sterile culture

    DOE Patents [OSTI]

    Lintilhac, Phillip M.; Vesecky, Thompson B.

    1995-01-01

    Apparatus and methods are disclosed facilitating the application of forces and measurement of dimensions of a test subject. In one arrangement the test subject is coupled to a forcing frame and controlled forces applied thereto by a series of guideways and sliders. The sliders, which contact the test subject are in force transmitting relation to a forcing frame. Tension, compression and bending forces can be applied to the test subject. Force applied to the test subject is measured and controlled. A dimensional characteristic of the test subject, such as growth, is measured by a linear variable differential transformer. The growth measurement data can be used to control the force applied. Substantially uniaxial stretching is achieved by placing the test subject on an elastic membrane stretched by an arrangement of members securing the elastic member to the forcing frame.

  12. Improving Scientific Communication and Publication Output in a Multidisciplinary Laboratory: Changing Culture Through Staff Development Workshops

    SciTech Connect (OSTI)

    Noonan, Christine F.; Stratton, Kelly G.

    2015-07-13

    Communication plays a fundamental role in science and engineering disciplines. However, many higher education programs provide little, if any, technical communication coursework. Without strong communication skills scientists and engineers have less opportunity to publish, obtain competitive research funds, or grow their careers. This article describes the role of scientific communication training as an innovative staff development program in a learning-intensive workplace a national scientific research and development laboratory. The findings show that involvement in the workshop has increased overall participating staff annual publications by an average of 61 percent compared to their pre-workshop publishing performance as well as confidence level in their ability to write and publish peer-reviewed literature. Secondary benefits include improved information literacy skills and the development of informal communities of practice. This work provides insight into adult education in the workplace.

  13. Long-term in-vivo tumorigenic assessment of human culture-expanded...

    Office of Scientific and Technical Information (OSTI)

    Journal Volume: 318; Journal Issue: 4; Other Information: Copyright (c) 2011 Elsevier Science B.V., Amsterdam, The Netherlands, All rights reserved.; Country of input:...

  14. 2012_0112_Safety_Culture_FocusAreas_Attachment9.pdf

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

  15. Cyanobacterium sp. host cell and vector for production of chemical compounds in cyanobacterial cultures

    DOE Patents [OSTI]

    Piven, Irina; Friedrich, Alexandra; Duhring, Ulf; Uliczka, Frank; Baier, Kerstin; Inaba, Masami; Shi, Tuo; Wang, Kui; Enke, Heike; Kramer, Dan

    2014-09-30

    A cyanobacterial host cell, Cyanobacterium sp., that harbors at least one recombinant gene for the production of a chemical compounds is provided, as well as vectors derived from an endogenous plasmid isolated from the cell.

  16. Nevada National Security Site Nuclear Testing Artifacts Become Part of U.S. Cultural Archive

    Broader source: Energy.gov [DOE]

    LAS VEGAS – The Nevada National Security Site’s (NNSS) historic Smoky site may soon join a long list of former nuclear testing locations eligible for inclusion in the National Register of Historic Places. The Desert Research Institute (DRI) is currently working alongside the Nevada Site Office (NSO) to determine the eligibility of Smoky and a number of other EM sites slated for cleanup and closure.

  17. Hanford’s Robust Safety Culture Gains One More Site-Wide Safety Standard

    Broader source: Energy.gov [DOE]

    RICHLAND, Wash. – The safety of the Hanford Site workforce has been bolstered with another program added to the list of Site-wide Safety Standards. The latest Site-wide Safety Standard covers Fall Protection.

  18. Nissan Showcases the Results of an Energy-Wise Corporate Culture

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    ... This tactic, known as Behavioral Based Sustainability, reinforces good habits and also ... Nissan 2010 Employee Earth Day Fair 4 PROGRAM NAME EERE Information Center 1-877-EERE-INF ...

  19. An Independent Evaluation of Safety Culture at the U.S. Department...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Building in Washington, DC and telephone interviews with HSS employees working at the National Training Center in Albuquerque, NM. PDF icon An Independent Evaluation of Safety...

  20. How fair is safe enough. The cultural approach to societal technology choice

    SciTech Connect (OSTI)

    Rayner, S.; Cantor, R.

    1987-03-01

    This paper consists of an argument and a pilot study. First is a general, perhaps philosophical, argument against the National Academy's viewpoint that dealing with risk is a two-stage process consisting of (a) assessment of facts, and (b) evaluation of facts in sociopolitical context. They argue that societal risk intrinsically revolves around social relations as much as around evaluations of probability. Second, they outline one particular approach to analyzing societal risk management styles. They call this the fairness hypothesis. Rather than focusing on probabilities and magnitudes of undesired events, this approach emphasizes societal preferences for principles of achieving consent to a technology, distributing liabilities, and investing trust in institutions. Conflict rather than probability is the chief focus of this approach to societal risk management. This view is illustrated by a recent empirical pilot study that explored the fairness hypothesis in the context of new nuclear technologies.

  1. Comparative proteomic analysis of outer membrane vesicles from Shigella flexneri under different culture conditions

    SciTech Connect (OSTI)

    Chen, Yong; Liu, Liguo; Fu, Hua; Wei, Candong Jin, Qi

    2014-10-31

    Highlights: We utilized mTRAQ-based quantification to study protein changes in Congo red-induced OMVs. A total of 148 proteins were identified in S. flexneri-derived OMVs. Twenty-eight and five proteins are significantly up- and down-regulated in the CR-induced OMV, respectively. The result implied that a special sorting mechanism of particular proteins into OMVs may exist. Key node proteins in the protein interaction network might be important for pathogenicity. - Abstract: The production of outer membrane vesicles (OMVs) is a common and regulated process of gram-negative bacteria. Nonetheless, the processes of Shigella flexneri OMV production still remain unclear. S. flexneri is the causative agent of endemic shigellosis in developing countries. The Congo red binding of strains is associated with increased infectivity of S. flexneri. Therefore, understanding the modulation pattern of OMV protein expression induced by Congo red will help to elucidate the bacterial pathogenesis. In the present study, we investigated the proteomic composition of OMVs and the change in OMV protein expression induced by Congo red using mTRAQ-based quantitative comparative proteomics. mTRAQ labelling increased the confidence in protein identification, and 148 total proteins were identified in S. flexneri-derived OMVs. These include a variety of important virulence factors, including Ipa proteins, TolC family, murein hydrolases, and members of the serine protease autotransporters of Enterobacteriaceae (SPATEs) family. Among the identified proteins, 28 and five proteins are significantly up- and down-regulated in the Congo red-induced OMV, respectively. Additionally, by comprehensive comparison with previous studies focused on DH5a-derived OMV, we identified some key node proteins in the proteinprotein interaction network that may be involved in OMV biogenesis and are common to all gram-negative bacteria.

  2. NNSS Nuclear Testing Artifacts Become Part of U.S. Cultural Archive.pdf

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

  3. Inventory of Sources of Available Saline Waters for Microalgae Mass Culture in the State of Arizona

    SciTech Connect (OSTI)

    Wilson, L. G.; Olson, K. L.; Wallace, M. G.; Osborn, M. D.

    1986-06-25

    The Solar Energy Research Institute (SERI) is conducting research on the development of microalgae biomass systems for the production of liquid fuels. Particularly appealing at this time, is the idea of using indigenous resources of the Southwest for large-scale production of microalgae.

  4. Annual review of cultural resource investigations by the Savannah River Archaeological Research Program. Fiscal year 1993

    SciTech Connect (OSTI)

    Not Available

    1993-10-01

    A cooperative agreement with the United States Department of Energy provides the necessary funding for the Savannah River Archaeological Research Program (SRARP) of the South Carolina Institute of Archaeology and Anthropology, University of South Carolina, to render services required under federal law for the protection and management of archaeological resources on the Savannah River Site (SRS). Because the significance of archaeological resources is usually determined by research potential, the SRARP is guided by research objectives. An ongoing research program provides the theoretical, methodological, and empirical basis for assessing site significance within the compliance process specified by law. In accordance with the spirit of the law, the SRARP maintains an active public education program for disseminating knowledge about prehistory and history, and for enhancing awareness of historic preservation. This report summarizes the management, research, and public education activities of the SRARP during Fiscal Year 1993.

  5. Low oxygen levels contribute to improve photohydrogen production in mixotrophic non-stressed Chlamydomonas cultures

    SciTech Connect (OSTI)

    Jurado-Oller, Jose Luis; Dubini, Alexandra; Galvan, Aurora; Fernandez, Emilio; Gonzalez-Ballester, David

    2015-09-17

    Currently, hydrogen fuel is derived mainly from fossil fuels, but there is an increasing interest in clean and sustainable technologies for hydrogen production. In this context, the ability of some photosynthetic microorganisms, particularly cyanobacteria and microalgae, to produce hydrogen is a promising alternative for renewable, clean-energy production. Among a diverse array of photosynthetic microorganisms able to produce hydrogen, the green algae Chlamydomonas reinhardtii is the model organism widely used to study hydrogen production. Furthermore, the well-known fact that acetate-containing medium enhances hydrogen production in this algae, little is known about the precise role of acetate during this process.

  6. Annual review of cultural resource investigations by the Savannah River Archaeological Research Program: Fiscal year 1991

    SciTech Connect (OSTI)

    Brooks, Mark J.; Brooks, Richard D.; Sassaman, Kenneth E.; Crass, David C.; Stephenson, D. Keith; Green, William; Rinehart, Charles J.; Lewis, George S.; Fuglseth, Ty; Krawczynski, Keith; Warnock, D. Mark

    1991-10-01

    A cooperative agreement with the United States Department of Energy provides the necessary funding for the Savannah River Archaeological Research Program (SRARP) of the South Carolina Institute of Archaeology and Anthropology, University of South Carolina, to render services required under federal law for the protection and management of archaeological resources on the Savannah River Site (SRS). Because the significance of archaeological resources is usually determined by research potential, the SRARP is guided by research objectives. An ongoing research program provides the theoretical, methodological and empirical basis for assessing site significance within the compliance process specified by law. In accordance with the spirit of the law, the SRARP maintains an active public education program for disseminating knowledge about prehistory and history, and for enhancing awareness of historic preservation. This report summarizes the management, research and public education activities of the SRARP during Fiscal Year 1991.

  7. ‘One EM Team’ Concept Among Team’s Recommendations to Improve Work Culture

    Broader source: Energy.gov [DOE]

    WASHINGTON, D.C. – EM headquarters employees enjoy their work, put in extra effort to get a job done, and feel encouraged to find new ways of doing things. But they also believe EM can do more to recognize and reward those behaviors.

  8. Cultural Resource Investigations for a Multipurpose Haul Road on the Idaho National Laboratory

    SciTech Connect (OSTI)

    Brenda R. Pace; Cameron Brizzee; Hollie Gilbert; Clayton Marler; Julie Braun Williams

    2010-08-01

    The U. S. Department of Energy, Idaho Operations Office is considering options for construction of a multipurpose haul road to transport materials and wastes between the Materials and Fuels Complex (MFC) and other Idaho National Laboratory (INL) Site facilities. The proposed road will be closed to the public and designed for limited year-round use. Two primary options are under consideration: a new route south of the existing T-25 power line road and an upgrade to road T-24. In the Spring of 2010, archaeological field surveys and initial coordination and field reconnaissance with representatives from the Shoshone-Bannock Tribes were completed to identify any resources that may be adversely affected by the proposed road construction and to develop recommendations to protect any listed or eligible for listing on the National Register of Historic Places. The investigations showed that 24 archaeological resources and one historic marker are located in the area of potential effects for road construction and operation south of the T-25 powerline road and 27archaeological resources are located in the area of potential effects for road construction and operation along road T-24. Generalized tribal concerns regarding protection of natural resources were also documented in both road corridors. This report outlines recommendations for additional investigations and protective measures that can be implemented to minimize adverse impacts to the identified resources.

  9. Low oxygen levels contribute to improve photohydrogen production in mixotrophic non-stressed Chlamydomonas cultures

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Jurado-Oller, Jose Luis; Dubini, Alexandra; Galvan, Aurora; Fernandez, Emilio; Gonzalez-Ballester, David

    2015-09-17

    Currently, hydrogen fuel is derived mainly from fossil fuels, but there is an increasing interest in clean and sustainable technologies for hydrogen production. In this context, the ability of some photosynthetic microorganisms, particularly cyanobacteria and microalgae, to produce hydrogen is a promising alternative for renewable, clean-energy production. Among a diverse array of photosynthetic microorganisms able to produce hydrogen, the green algae Chlamydomonas reinhardtii is the model organism widely used to study hydrogen production. Furthermore, the well-known fact that acetate-containing medium enhances hydrogen production in this algae, little is known about the precise role of acetate during this process.

  10. An Independent Evaluation of Safety Culture at the U. S. Department...

    Office of Environmental Management (EM)

    also been effectively implemented in non-nuclear organizations, such as mining, health care, research, engineering, and transportation. The 3 methodology entails collecting a...

  11. Co-cultured Synechococcus and Shewanella Produce Hydrocarbons without Cellulosic Feedstock

    Energy Innovation Portal (Marketing Summaries) [EERE]

    2012-03-06

    The Shewanella bacteria naturally produce hydrocarbons but the University of Minnesota clarified the key protein responsible for fuel production, OleA and recently obtained the proteins’s crystal structure. Based on this knowledge, experiments are currently in process to optimize fuel production through both metabolic engineering and optimization of OleA....

  12. Annual review of cultural resource investigations by the Savannah River Archaeological Research Program. Fiscal year 1994

    SciTech Connect (OSTI)

    1994-10-01

    The Savannah River Archaeological Research Program (SRARP) of the South Carolina Institute of Archaeology and Anthropology, University of South Carolina, manages archaeological resources on the Savannah River Site (SRS). An ongoing research program provides the theoretical, methodological, and empirical basis for assessing site significance within the compliance process specified by law. The SRARP maintains an active public education program for disseminating knowledge about prehistory and history, and for enhancing awareness of historic preservation. This report summarizes the management, research, and public education activities of the SRARP during Fiscal Year 1994.

  13. Letter: Cultural Resources Evaluations of the Weldon Spring Site Remedial Action Project (WSSRAP) Southeast Drainage.

    Office of Legacy Management (LM)

  14. 1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Biagro's phosphite fertilizer products. Primarily for cereals, oil crops, sugar crops, cotton, and forage crops, Take-Off(tm) was launched in 2007 in Europe for use on wheat. By...

  15. Biomass/Biogas | Open Energy Information

    Open Energy Info (EERE)

    may include: * Municipal solid waste located adjacent to urban centers * Dedicated energy crops * Manure * Vegetable crops * Liquid food processing wastes Retrieved from...

  16. Chimeric enzymes with improved cellulase activities - Energy...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    a strong desire to produce bio-based fuels from renewable cellulosic materials from non-food based feedstocks such as crop residues, woodchips, dedicated energy crops, industrial...

  17. Development of a Single-Pass Cut-and-Chip Harvest System for...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Abstract: Development and Deployment of a Short Rotation Woody Crops Harvesting System Based on a Case New Holland Forage Harvester and SRC Woody Crop Header High Tonnage Forest ...

  18. Abstract: Development and Deployment of a Short Rotation Woody...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    New Holland Forage Harvester and SRC Woody Crop Header Abstract: Development and Deployment of a Short Rotation Woody Crops Harvesting System Based on a Case New Holland Forage ...

  19. Search for: All records | SciTech Connect

    Office of Scientific and Technical Information (OSTI)

    the large-scale deployment of bioenergy crops. The rapid increase in use of models for energy crop simulation is encouraging; however, detailed information on the influence of...

  20. Alternative Fuels Data Center

    Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

    Mixture Excise Tax Credit NOTE: This incentive was retroactively extended multiple times, most recently through December 31, 2016, by H.R. 2029. A biodiesel blender that is registered with the Internal Revenue Service (IRS) may be eligible for a tax incentive in the amount of $1.00 per gallon of pure biodiesel, agri-biodiesel, or renewable diesel blended with petroleum diesel to produce a mixture containing at least 0.1% diesel fuel. Only blenders that have produced and sold or used the

  1. Alternative Fuels Data Center

    Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

    Income Tax Credit NOTE: This incentive was retroactively extended multiple times, most recently through December 31, 2016, by H.R. 2029. A taxpayer that delivers pure, unblended biodiesel (B100) into the tank of a vehicle or uses B100 as an on-road fuel in their trade or business may be eligible for an incentive in the amount of $1.00 per gallon of biodiesel, agri-biodiesel, or renewable diesel. If the biodiesel was sold at retail, only the person that sold the fuel and placed it into the tank

  2. Evaluation of the potential for agricultural development at the Hanford Site

    SciTech Connect (OSTI)

    RG Evans; MJ Hattendorf; CT Kincaid

    2000-02-25

    By 2050, when cleanup of the Hanford Site is expected to be completed, large worldwide demands to increase the global production of animalhlish protein, food, and fiber are anticipated, despite advancements in crop breeding, genetic engineering, and other technologies. World population is projected to double to more than 12 billion people, straining already stressed worldwide agricultural resources. The current world surpluses in many commodities will not last when faced with increasing population, decreasing ocean fisheries, and rapid loss of productive lands from soil salivation and erosion. The production of pharmaceuticals from bioengineered plants and animals will undoubtedly add more pressure on the already limited (and declining) arable land base. In addition there will be pressure to produce crops that can help reduce the world's dependence on petroleum and be used for chemical plant feedstock. These external, formidable pressures will necessitate increasing investments in irrigation infi-a-structures in many areas of the world to increase productivity. Intensive greenhouse culture and aqua-culture also will be greatly expanded. There will be large economic and social pressures to expand production in areas such as the Pacific Northwest. Agricultural exports will continue to be important The most likely large areas for expanded irrigation in the Pacific Northwest are the undeveloped East High areas of the Columbia Basin Project and non-restricted areas within the Hanford Site in south-central Washington State. Both of these are potentially highly productive area: for producing food and export capital. The environmental concerns will be large however, the favorable growing conditions, high-quality (low-salinity) abundant water supplies and minimal problems with salivation of soils make the Pacific Northwest a very desirable region for economically sustainable expansion from a world perspective.

  3. Biomass Resource Basics | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Biomass Resource Basics Biomass Resource Basics August 14, 2013 - 1:22pm Addthis Biomass resources include any plant-derived organic matter that is available on a renewable basis. These materials are commonly referred to as feedstocks. Biomass Feedstocks Biomass feedstocks include dedicated energy crops, agricultural crops, forestry residues, aquatic crops, biomass processing residues, municipal waste, and animal waste. Dedicated energy crops Herbaceous energy crops are perennials that are

  4. RENEWABLE ENERGY AND ENVIRONMENTAL SUSTAINABILITY USING BIOMASS FROM DAIRY AND BEEF ANIMAL PRODUCTION

    SciTech Connect (OSTI)

    Sweeten, John M; Annamalai, Kalyan; Auvermann, Brent; Mukhtar, Saqib; Capareda, Sergio C.; Engler, Cady; Harman, Wyatte; Reddy, J N; DeOtte, Robert; Parker, David B.; Stewart, B. A.

    2012-05-03

    The Texas Panhandle is regarded as the "Cattle Feeding Capital of the World", producing 42% of the fed beef cattle in the United States within a 200-mile radius of Amarillo generating more than 5 million tons of feedlot manure/year. Apart from feedlots, the Bosque River Region in Erath County, just north of Waco, Texas with about 110,000 dairy cattle in over 250 dairies, produces 1.8 million tons of manure biomass (excreted plus bedding) per year. While the feedlot manure has been used extensively for irrigated and dry land crop production, most dairies, as well as other concentrated animal feeding operations (CAFO's), the dairy farms utilize large lagoon areas to store wet animal biomass. Water runoff from these lagoons has been held responsible for the increased concentration of phosphorus and other contaminates in the Bosque River which drains into Lake Waco -- the primary source of potable water for Waco's 108,500 people. The concentrated animal feeding operations may lead to land, water, and air pollution if waste handling systems and storage and treatment structures are not properly managed. Manure-based biomass (MBB) has the potential to be a source of green energy at large coal-fired power plants and on smaller-scale combustion systems at or near confined animal feeding operations. Although MBB particularly cattle biomass (CB) is a low quality fuel with an inferior heat value compared to coal and other fossil fuels, the concentration of it at large animal feeding operations can make it a viable source of fuel. The overall objective of this interdisciplinary proposal is to develop environmentally benign technologies to convert low-value inventories of dairy and beef cattle biomass into renewable energy. Current research expands the suite of technologies by which cattle biomass (CB: manure, and premature mortalities) could serve as a renewable alternative to fossil fuel. The work falls into two broad categories of research and development. Category 1 -- Renewable Energy Conversion. This category addressed mostly in volume I involves developing. Thermo-chemical conversion technologies including cofiring with coal, reburn to reduce nitrogen oxide (NO, N2O, NOx, etc.) and Hg emissions and gasification to produce low-BTU gas for on-site power production in order to extract energy from waste streams or renewable resources. Category 2 -- Biomass Resource Technology. This category, addressed mostly in Volume II, deals with the efficient and cost-effective use of CB as a renewable energy source (e.g. through and via aqueous-phase, anaerobic digestion or biological gasification). The investigators formed an industrial advisory panel consisting fuel producers (feedlots and dairy farms) and fuel users (utilities), periodically met with them, and presented the research results; apart from serving as dissemination forum, the PIs used their critique to re-direct the research within the scope of the tasks. The final report for the 5 to 7 year project performed by an interdisciplinary team of 9 professors is arranged in three volumes: Vol. I (edited by Kalyan Annamalai) addressing thermo-chemical conversion and direct combustion under Category 1 and Vol. II and Vol. III ( edited by J M Sweeten) addressing biomass resource Technology under Category 2. Various tasks and sub-tasks addressed in Volume I were performed by the Department of Mechanical Engineering (a part of TEES; see Volume I), while other tasks and sub-tasks addressed in Volume II and IIII were conducted by Texas AgriLife Research at Amarillo; the TAMU Biological & Agricultural Engineering Department (BAEN) College Station; and West Texas A&M University (WTAMU) (Volumes II and III). The three volume report covers the following results: fuel properties of low ash and high ash CB (particularly DB) and MB (mortality biomass and coals, non-intrusive visible infrared (NVIR) spectroscopy techniques for ash determination, dairy energy use surveys at 14 dairies in Texas and California, cofiring of low quality CB with high quality coal, emission results and ash fouling behavior, using CB as reburn fuel for NOx and Hg reduction, gasification of fuels to produce low quality gases, modeling of reburn, pilot scale test results, synthesis of engineering characterization, geographical mapping, a transportation cost study to determine potential handling and transportation systems for co-firing with coal at regional coal-fired power plants, software analyses for the design of off-site manure, pre-processing and storage systems for a typical dairy farm or beef cattle feedlot, recursive production functions/systems models for both cattle feedlots, systems modeling, stocks and flows of energy involved in the CAFO system, feedback from an Industry Advisory Committee (IAC) to the investigators on project direction and task emphasis and economics of using CB as cofiring and reburn fuel.

  5. RENEWABLE ENERGY AND ENVIRONMENTAL SUSTAINABILITY USING BIOMASS FROM DAIRY AND BEEF ANIMAL PRODUCTION

    SciTech Connect (OSTI)

    John M. Sweeten, Kalyan Annamalai Brent Auvermann Saqib Mukhtar Sergio C. Capareda Cady Engler Wyatte Harman J.N. Reddy, Robert DeOtte David B. Parker Dr. B.A. Stewart

    2012-05-03

    The Texas Panhandle is regarded as the 'Cattle Feeding Capital of the World', producing 42% of the fed beef cattle in the United States within a 200-mile radius of Amarillo generating more than 5 million tons of feedlot manure/year. Apart from feedlots, the Bosque River Region in Erath County, just north of Waco, Texas with about 110,000 dairy cattle in over 250 dairies, produces 1.8 million tons of manure biomass (excreted plus bedding) per year. While the feedlot manure has been used extensively for irrigated and dry land crop production, most dairies, as well as other concentrated animal feeding operations (CAFO's), the dairy farms utilize large lagoon areas to store wet animal biomass. Water runoff from these lagoons has been held responsible for the increased concentration of phosphorus and other contaminates in the Bosque River which drains into Lake Waco - the primary source of potable water for Waco's 108,500 people. The concentrated animal feeding operations may lead to land, water, and air pollution if waste handling systems and storage and treatment structures are not properly managed. Manure-based biomass (MBB) has the potential to be a source of green energy at large coal-fired power plants and on smaller-scale combustion systems at or near confined animal feeding operations. Although MBB particularly cattle biomass (CB) is a low quality fuel with an inferior heat value compared to coal and other fossil fuels, the concentration of it at large animal feeding operations can make it a viable source of fuel. The overall objective of this interdisciplinary proposal is to develop environmentally benign technologies to convert low-value inventories of dairy and beef cattle biomass into renewable energy. Current research expands the suite of technologies by which cattle biomass (CB: manure, and premature mortalities) could serve as a renewable alternative to fossil fuel. The work falls into two broad categories of research and development. Category 1 - Renewable Energy Conversion. This category addressed mostly in volume I involves developing. Thermo-chemical conversion technologies including cofiring with coal, reburn to reduce nitrogen oxide (NO, N2O, NOx, etc.) and Hg emissions and gasification to produce low-BTU gas for on-site power production in order to extract energy from waste streams or renewable resources. Category 2 - Biomass Resource Technology. This category, addressed mostly in Volume II, deals with the efficient and cost-effective use of CB as a renewable energy source (e.g. through and via aqueous-phase, anaerobic digestion or biological gasification). The investigators formed an industrial advisory panel consisting fuel producers (feedlots and dairy farms) and fuel users (utilities), periodically met with them, and presented the research results; apart from serving as dissemination forum, the PIs used their critique to red-direct the research within the scope of the tasks. The final report for the 5 to 7 year project performed by an interdisciplinary team of 9 professors is arranged in three volumes: Vol. I (edited by Kalyan Annamalai) addressing thermo-chemical conversion and direct combustion under Category 1 and Vol. II and Vol. III ( edited by J M Sweeten) addressing biomass resource Technology under Category 2. Various tasks and sub-tasks addressed in Volume I were performed by the Department of Mechanical Engineering (a part of TEES; see Volume I), while other tasks and sub-tasks addressed in Volume II and IIII were conducted by Texas AgriLife Research at Amarillo; the TAMU Biological and Agricultural Engineering Department (BAEN) College Station; and West Texas A and M University (WTAMU) (Volumes II and III). The three volume report covers the following results: fuel properties of low ash and high ash CB (particularly DB) and MB (mortality biomass) and coals, non-intrusive visible infrared (NVIR) spectroscopy techniques for ash determination, dairy energy use surveys at 14 dairies in Texas and California, cofiring of low quality CB with high quality coal, emission results and ash fouling beh

  6. RENEWABLE ENERGY AND ENVIRONMENTAL SUSTAINABILITY USING BIOMASS FROM DAIRY AND BEEF ANIMAL PRODUCTION

    SciTech Connect (OSTI)

    Kalyan Annamalai, John M. Sweeten, Brent W. Auvermann, Saqib Mukhtar, Sergio Caperada Cady R. Engler, Wyatte Harman Reddy JN Robert Deotte

    2012-05-03

    The Texas Panhandle is regarded as the 'Cattle Feeding Capital of the World', producing 42% of the fed beef cattle in the United States within a 200-mile radius of Amarillo generating more than 5 million tons of feedlot manure/year. Apart from feedlots, the Bosque River Region in Erath County, just north of Waco, Texas with about 110,000 dairy cattle in over 250 dairies, produces 1.8 million tons of manure biomass (excreted plus bedding) per year. While the feedlot manure has been used extensively for irrigated and dry land crop production, most dairies, as well as other concentrated animal feeding operations (CAFO's), the dairy farms utilize large lagoon areas to store wet animal biomass. Water runoff from these lagoons has been held responsible for the increased concentration of phosphorus and other contaminates in the Bosque River which drains into Lake Waco - the primary source of potable water for Waco's 108,500 people. The concentrated animal feeding operations may lead to land, water, and air pollution if waste handling systems and storage and treatment structures are not properly managed. Manure-based biomass (MBB) has the potential to be a source of green energy at large coal-fired power plants and on smaller-scale combustion systems at or near confined animal feeding operations. Although MBB particularly cattle biomass (CB) is a low quality fuel with an inferior heat value compared to coal and other fossil fuels, the concentration of it at large animal feeding operations can make it a viable source of fuel. The overall objective of this interdisciplinary proposal is to develop environmentally benign technologies to convert low-value inventories of dairy and beef cattle biomass into renewable energy. Current research expands the suite of technologies by which cattle biomass (CB: manure, and premature mortalities) could serve as a renewable alternative to fossil fuel. The work falls into two broad categories of research and development. Category 1 - Renewable Energy Conversion. This category addressed mostly in volume I involves developing. Thermo-chemical conversion technologies including cofiring with coal, reburn to reduce nitrogen oxide (NO, N2O, NOx, etc.) and Hg emissions and gasification to produce low-BTU gas for on-site power production in order to extract energy from waste streams or renewable resources. Category 2 - Biomass Resource Technology. This category, addressed mostly in Volume II, deals with the efficient and cost-effective use of CB as a renewable energy source (e.g. through and via aqueous-phase, anaerobic digestion or biological gasification). The investigators formed an industrial advisory panel consisting fuel producers (feedlots and dairy farms) and fuel users (utilities), periodically met with them, and presented the research results; apart from serving as dissemination forum, the PIs used their critique to red-direct the research within the scope of the tasks. The final report for the 5 to 7 year project performed by an interdisciplinary team of 9 professors is arranged in three volumes: Vol. I (edited by Kalyan Annamalai) addressing thermo-chemical conversion and direct combustion under Category 1 and Vol. II and Vol. III ( edited by J M Sweeten) addressing biomass resource Technology under Category 2. Various tasks and sub-tasks addressed in Volume I were performed by the Department of Mechanical Engineering (a part of TEES; see Volume I), while other tasks and sub-tasks addressed in Volume II and IIII were conducted by Texas AgriLife Research at Amarillo; the TAMU Biological and Agricultural Engineering Department (BAEN) College Station; and West Texas A and M University (WTAMU) (Volumes II and III). The three volume report covers the following results: fuel properties of low ash and high ash CB (particularly DB) and MB (mortality biomass) and coals, non-intrusive visible infrared (NVIR) spectroscopy techniques for ash determination, dairy energy use surveys at 14 dairies in Texas and California, cofiring of low quality CB with high quality coal, emission results and ash fouling behavior, using CB as reburn fuel for NOx and Hg reduction, gasification of fuels to produce low quality gases, modeling of reburn, pilot scale test results, synthesis of engineering characterization, geographical mapping, a transportation cost study to determine potential handling and transportation systems for co-firing with coal at regional coal-fired power plants, software analyses for the design of off-site manure, pre-processing and storage systems for a typical dairy farm or beef cattle feedlot, recursive production functions/systems models for both cattle feedlots, systems modeling, stocks and flows of energy involved in the CAFO system, feedback from an Industry Advisory Committee (IAC) to the investigators on project direction and task emphasis and economics of using CB as cofiring and reburn fuel.

  7. RENEWABLE ENERGY AND ENVIRONMENTAL SUSTAINABILITY USING BIOMASS FROM DAIRY AND BEEF ANIMAL PRODUCTION

    SciTech Connect (OSTI)

    Sweeten, John; Annamalai, Kalyan; Auvermann, Brent; Mukhtar, Saqib; Capareda, Sergio C; Engler, Cady; Harman, Wyatte; Reddy, J N; DeOtte, Robert; Parker, David B; Stewart, B A

    2012-05-02

    The Texas Panhandle is regarded as the "Cattle Feeding Capital of the World", producing 42% of the fed beef cattle in the United States within a 200-mile radius of Amarillo generating more than 5 million tons of feedlot manure /year. Apart from feedlots, the Bosque River Region in Erath County, just north of Waco, Texas with about 110,000 dairy cattle in over 250 dairies, produces 1.8 million tons of manure biomass (excreted plus bedding) per year. While the feedlot manure has been used extensively for irrigated and dry land crop production, most dairies, as well as other concentrated animal feeding operations (CAFO's), the dairy farms utilize large lagoon areas to store wet animal biomass. Water runoff from these lagoons has been held responsible for the increased concentration of phosphorus and other contaminates in the Bosque River which drains into Lake Waco—the primary source of potable water for Waco's 108,500 people. The concentrated animal feeding operations may lead to land, water, and air pollution if waste handling systems and storage and treatment structures are not properly managed. Manure-based biomass (MBB) has the potential to be a source of green energy at large coal-fired power plants and on smaller-scale combustion systems at or near confined animal feeding operations. Although MBB particularly cattle biomass (CB) is a low quality fuel with an inferior heat value compared to coal and other fossil fuels, the concentration of it at large animal feeding operations can make it a viable source of fuel. The overall objective of this interdisciplinary proposal is to develop environmentally benign technologies to convert low-value inventories of dairy and beef cattle biomass into renewable energy. Current research expands the suite of technologies by which cattle biomass (CB: manure, and premature mortalities) could serve as a renewable alternative to fossil fuel. The work falls into two broad categories of research and development. Category 1 – Renewable Energy Conversion. This category addressed mostly in volume I involves developing. Thermo-chemical conversion technologies including cofiring with coal, reburn to reduce nitrogen oxide (NO, N2O, NOx, etc.) and Hg emissions and gasification to produce low-BTU gas for on-site power production in order to extract energy from waste streams or renewable resources. Category 2 – Biomass Resource Technology. This category, addressed mostly in Volume II, deals with the efficient and cost-effective use of CB as a renewable energy source (e.g. through and via aqueous-phase, anaerobic digestion or biological gasification). The investigators formed an industrial advisory panel consisting fuel producers (feedlots and dairy farms) and fuel users (utilities), periodically met with them, and presented the research results; apart from serving as dissemination forum, the PIs used their critique to red-direct the research within the scope of the tasks. The final report for the 5 to 7 year project performed by an interdisciplinary team of 9 professors is arranged in three volumes: Vol. I (edited by Kalyan Annamalai) addressing thermo-chemical conversion and direct combustion under Category 1 and Vol. II and Vol. III ( edited by J M Sweeten) addressing biomass resource Technology under Category 2. Various tasks and sub-tasks addressed in Volume I were performed by the Department of Mechanical Engineering (a part of TEES; see Volume I), while other tasks and sub-tasks addressed in Volume II and IIII were conducted by Texas AgriLife Research at Amarillo; the TAMU Biological & Agricultural Engineering Department (BAEN) College Station; and West Texas A&M University (WTAMU) (Volumes II and III). The three volume report covers the following results: fuel properties of low ash and high ash CB (particularly DB) and MB (mortality biomass and coals, non-intrusive visible infrared (NVIR) spectroscopy techniques for ash determination, dairy energy use surveys at 14 dairies in Texas and California, cofiring of low quality CB with high quality coal, emission results and ash fouling behavior, using CB as reburn fuel for NOx and Hg reduction, gasification of fuels to produce low quality gases, modeling of reburn, pilot scale test results, synthesis of engineering characterization, geographical mapping, a transportation cost study to determine potential handling and transportation systems for co-firing with coal at regional coal-fired power plants, software analyses for the design of off-site manure, pre-processing and storage systems for a typical dairy farm or beef cattle feedlot, recursive production functions/systems models for both cattle feedlots, systems modeling, stocks and flows of energy involved in the CAFO system, feedback from an Industry Advisory Committee (IAC) to the investigators on project direction and task emphasis and economics of using CB as cofiring and reburn fuel.

  8. How Much Do We Understand About the Role of Organizational Safety Culture in the Fukushima Nuclear Accident?

    Broader source: Energy.gov [DOE]

    Presenter: Dr. Sonja B. Haber, President and Executive Consultant, Human Performance Analysis Corporation

  9. Unusual Application Of Ion Beam Analysis For The Study Of Surface Layers On Materials Relevant To Cultural Heritage

    SciTech Connect (OSTI)

    Mathis, F.; Salomon, J.; Aucouturier, M.; Trocellier, P.

    2006-12-01

    Recently a new thematic of research -- intentional patinas on antic copper-base objects -- lead the AGLAE (Accelerateur Grand Louvre pour l'Analyse Elementaire) team of the C2RMF (Centre de Recherche et de Restauration des Musees de France) to improve its methods of analyzing thin surface layers both in their elemental composition and in-depth elemental distribution. A new beam extraction set-up containing a particle detector has been developed in order to use a 6 MeV alpha beam both in PIXE and RBS mode and to monitor precisely the ion dose received by the sample. Both RBS and ionization cross sections were assessed in order to make sure that the analysis can be quantitative. This set up allows great progresses in the understanding of both nature and structure of this very particular oxide layer obtained in the antiquity by chemical treatment on copper alloys, containing gold and/or silver and presenting very interesting properties of color and stability.Besides the non destructive properties of the IBA in external beam mode, this method of analyzing allows the study of samples in interaction with its environment. This was used to study the high temperature oxidation of Cu-Sn alloys using a furnace developed in order to heat a sample and analyze it in RBS mode at the same time. This new way of studying the growth of oxide layers permits to understand the oxidation mechanism of this system and to propose an experimental model for the identification of oxide layers due to an exposition to a high temperature, model needed for a long time by curators in charge of the study and the conservation of archaeological bronzes.

  10. Uptake and Retention of Cs137 by a Blue-Green Alga in Continuous Flow and Batch Culture Systems

    SciTech Connect (OSTI)

    Watts, J.R.

    2003-02-18

    Since routine monitoring data show that blue-green algae concentrate radioactivity from water by factors as great as 10,000, this study was initiated to investigate the uptake and retention patterns of specific radionuclides by the dominant genera of blue-green algae in the reactor effluents. Plectonema purpureum was selected for this study.

  11. Comparative Iron Oxide Nanoparticle Cellular Dosimetry and Response in Mice by the Inhalation and Liquid Cell Culture Exposure Routes

    SciTech Connect (OSTI)

    Teeguarden, Justin G.; Mikheev, Vladimir B.; Minard, Kevin R.; Forsythe, William C.; Wang, Wei; Sharma, Gaurav; Karin, Norman J.; Tilton, Susan C.; Waters, Katrina M.; Asgharian, Bahman; Price, Owen; Pounds, Joel G.; Thrall, Brian D.

    2014-01-01

    testing the rapidly growing number of nanomaterials requires large scale use of in vitro systems under the presumption that these systems are sufficiently predictive or descriptive of responses in in vivo systems for effective use in hazard ranking. We hypothesized that improved relationships between in vitro and in vivo models of experimental toxicology for nanomaterials would result from placing response data in vitro and in vivo on the same dose scale, the amount of material associated with cells (target cell dose). Methods: Balb/c mice were exposed nose-only to an aerosol of 12.8 nm (68.6 nm CMD, 19.9 mg/m3, 4 hours) super paramagnetic iron oxide particles, target cell doses were calculated and biomarkers of response anchored with histological evidence were identified by global transcriptomics. Representative murine epithelial and macrophage cell types were exposed in vitro to the same material in liquid suspension for four hours and levels nanoparticle regulated cytokine transcripts identified in vivo were quantified as a function of measured nanoparticle cellular dose. Results. Target tissue doses of 0.009-0.4 μg SPIO/cm2 lung led to an inflammatory response in the alveolar region characterized by interstitial inflammation and macrophage infiltration. In vitro, higher target tissue doses of ~1.2-4 μg SPIO/ cm2 of cells were required to induce transcriptional regulation of markers of inflammation, CXCL2 CCL3, in C10 lung epithelial cells. Estimated in vivo macrophage SPIO nanoparticle doses ranged from 1-100 pg/cell, and induction of inflammatory markers was observed in vitro in macrophages at doses of 8-35 pg/cell. Conclusions: Application of target tissue dosimetry revealed good correspondence between target cell doses triggering inflammatory processes in vitro and in vivo in the alveolar macrophage population, but not in the epithelial cells of the alveolar region. These findings demonstrate the potential for target tissue dosimetry to enable the more quantitative comparison of in vitro and in vivo systems advance their use for hazard assessment and extrapolation to humans. The mildly inflammogentic cellular doses experienced by mice were similar those calculated for humans exposed to the same at the existing permissible exposure limit of 10 mg/m3 iron oxide (as Fe).

  12. Phase I Archaeological Investigation Cultural Resources Survey, Hawaii Geothermal Project, Makawao and Hana Districts, South Shore of Maui, Hawaii (DRAFT )

    SciTech Connect (OSTI)

    Erkelens, Conrad

    1994-03-01

    This report details the archaeological investigation of a 200 foot wide sample corridor extending approximately 9 miles along the southern portion of Maui within the present districts of Hana and Makawao. A total of 51 archaeological sites encompassing 233 surface features were documented. A GPS receiver was used to accurately and precisely plot locations for each of the documented sites. Analysis of the locational information suggests that archaeological sites are abundant throughout the region and only become scarce where vegetation has been bulldozed for ranching activities. At the sea-land transition points for the underwater transmission cable, both Ahihi Bay and Huakini Bay are subjected to seasonal erosion and redeposition of their boulder shorelines. The corridor at the Ahihi Bay transition point runs through the Moanakala Village Complex which is an archaeological site on the State Register of Historic Places within a State Natural Area Reserve. Numerous other potentially significant archaeological sites lie within the project corridor. It is likely that rerouting of the corridor in an attempt to avoid known sites would result in other undocumented sites located outside the sample corridor being impacted. Given the distribution of archaeological sites, there is no alternative route that can be suggested that is likely to avoid encountering sites. A total of twelve charcoal samples were obtained for potential taxon identification and radiocarbon analysis. Four of these samples were subsequently submitted for dating and species identification. Bird bone from various locations within a lava tube were collected for identification. Sediment samples for subsequent pollen analysis were obtained from within two lava tubes. With these three sources of information it is hoped that paleoenvironmental data can be recovered that will enable a better understanding of the setting for Hawaiian habitation of the area. A small test unit was excavated at one habitation site. Charcoal, molluscan and fish remains, basalt tools, and other artifacts were recovered. This material, while providing an extremely small sample, will greatly enhance our understanding of the use of the area. Recommendations regarding the need for further investigation and the preservation of sites within the project corridor are suggested. All sites within the project corridor must be considered potentially significant at this juncture. Further archaeological investigation consisting of a full inventory survey will be required prior to a final assessment of significance for each site and the development of a mitigation plan for sites likely to be impacted by the Hawaii Geothermal Project.

  13. Phase 1 archaeological investigation, cultural resources survey, Hawaii Geothermal Project, Makawao and Hana districts, south shore of Maui, Hawaii

    SciTech Connect (OSTI)

    Erkelens, C.

    1995-04-01

    This report details the archaeological investigation of a 200 foot wide sample corridor extending approximately 9 miles along the southern portion of Maui within the present districts of Hana and Makawao. The survey team documented a total of 51 archaeological sites encompassing 233 surface features. Archaeological sites are abundant throughout the region and only become scarce where vegetation has been bulldozed for ranching activities. At the sea-land transition points for the underwater transmission cable, both Ahihi Bay and Huakini Bay are subjected to seasonal erosion and redeposition of their boulder shorelines. The corridor at the Ahihi Bay transition point runs through the Maonakala Village Complex which is an archaeological site on the State Register of Historic Places within a State Natural Area Reserve. Numerous other potentially significant archaeological sites lie within the project corridor. It is likely that rerouting of the corridor in an attempt to avoid known sites would result in other undocumented sites located outside the sample corridor being impacted. Given the distribution of archaeological sites, there is no alternative route that can be suggested that is likely to avoid encountering sites. Twelve charcoal samples were obtained for potential taxon identification and radiocarbon analysis. Four of these samples were subsequently submitted for dating and species identification. Bird bones from various locations within a lava tube were collected for identification. Sediment samples for subsequent pollen analysis were obtained from within two lava tubes. With these three sources of information it is hoped that paleoenvironmental data can be recovered that will enable a better understanding of the setting for Hawaiian habitation of the area.

  14. Development of Na/sup +/-dependent hexose transport in cultured renal epithelial cells (LLC-PK/sub 1/)

    SciTech Connect (OSTI)

    Weiss, E.R.; Amsler, K.; Dawson, W.D.; Cook, J.S.

    1984-01-01

    A number of factors were explored to analyze how they interact to yield the increasing transport capacity in differentiating cell populations. These factors include the number of functional transporters in the population, the distribution of these transporters among the individual cells, the Na/sup +/ chemical gradient, the transmembrane potential, the pathways and activities of these pathways for efflux of glucoside, and cell-cell coupling between accumulating and non-accumulating cells. 35 references, 9 figures, 2 tables. (ACR)

  15. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOE Patents [OSTI]

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  16. Proliferation of rhesus ovarian surface epithelial cells in culture: Lack of mitogenic response to steroid or gonadotropic hormones

    SciTech Connect (OSTI)

    Wright, Jay W.; Toth-Fejel, Suellen; Stouffer, Richard L.; Rodland, Karin D.

    2002-06-30

    Ovarian cancer is the most lethal gynecological cancer and approximately 90% of ovarian cancers derive from the ovarian surface epithelium (OSE), yet the biology of the OSE is poorly understood. Factors associated with increased risk of non-hereditary ovarian cancer include the formation of inclusion cysts, effects of reproductive hormones cytokeratin, vimentin, N-cadherin, E-cadherin, estrogen receptor-a, and progesterone receptor. We show that these cells activate MAP Kinase and proliferate in response to extracellular calcium, as do human and rat OSE. In contrast, the gonadotropic hormones FSH (4-400 IU/L), LH (8.5-850 IU/l), and hCG (10-1000 IU/l) fail to stimulate proliferation. We find that concentrations of progesterone and estrogen normally present in follicles just prior to ovulation ( ~1000 ng/ml) significantly decrease the number of mitotically active RhOSE cells as determined by PCNA labelling, total cell count, and 3H-thymidine uptake, while lower steroid concentrations have no effect.

  17. Energy Department Announces Five-Year Renewal of Funding for...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    for engineering non-food crops for biofuel production; reengineering of microbes to ... grow non-food biofuel crops on marginal lands so as not to compete with food production. ...

  18. Iowa Switchgrass Project

    SciTech Connect (OSTI)

    2006-09-01

    This fact sheet provides information about developing markets for switchgrass as an alternative energy crop in southern Iowa.

  19. Tax Credits, Rebates & Savings | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    energy, photovoltaics, dedicated crops grown for energy production and organic waste biomass, hydropower th... Eligibility: Commercial, Industrial, Investor-Owned...

  20. Microsoft Word - report in template 08052012_lo.docx

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    PRODUCTION Density - increase production density through increased biomass yields Sustainability - develop dedicated energy crops Develop genetically modified organisms...