Powered by Deep Web Technologies
Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Nucleic Acid Standards | Base Pair Geometry  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

A Standard Reference Frame for the Description A Standard Reference Frame for the Description of Nucleic Acid Base-pair Geometry Table 1. Cartesian coordinates of non-hydrogen atoms in the standard reference frames of the five common nitrogenous bases Atom Base x(Å) y(Å) z(Å) Adenine ATOM 1 C1' A A 1 -2.479 5.346 0.000 ATOM 2 N9 A A 1 -1.291 4.498 0.000 ATOM 3 C8 A A 1 0.024 4.897 0.000 ATOM 4 N7 A A 1 0.877 3.902 0.000 ATOM 5 C5 A A 1 0.071 2.771 0.000 ATOM 6 C6 A A 1 0.369 1.398 0.000 ATOM 7 N6 A A 1 1.611 0.909 0.000 ATOM 8 N1 A A 1 -0.668 0.532 0.000 ATOM 9 C2 A A 1 -1.912 1.023 0.000 ATOM 10 N3 A A 1 -2.320 2.290 0.000

2

Nucleic Acid Standards - Standard Ref. Frame  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Standard Reference Standard Reference Standard Reference Frame Supplemental Information Ideal Geometries X-PLOR Parameters Valence Geometries RNA Ontology Consortium mmCIF Resources PDBML Resources A Standard Reference Frame for the Description of Nucleic Acid Base-pair Geometry A common point of reference is needed to describe the three-dimensional arrangements of bases and base pairs in nucleic acid structures. [1]. For example, parts of a structure, which appear "normal" according to one computational scheme, may be highly unusual according to another and vice versa. It is thus difficult to carry out comprehensive comparisons of nucleic acid structures and to pinpoint unique conformational features in individual structures. In order to resolve these issues, a group of

3

Experimental Investigation for the Effects of the Core Geometry on the Optimum Acid Flux in Carbonate Acidizing  

E-Print Network [OSTI]

Previous matrix acidizing experimental research showed that there exists an optimum acid interstitial velocity (Vi-opt) that results in the minimum volume of acid used while providing the best stimulation results. There are already several...

Jin, Xiao

2013-11-21T23:59:59.000Z

4

Altering the Electrostatic Potential in the Major Groove: Thermodynamic and Structural Characterization of 7-Deaza-2;#8242;-deoxyadenosine:dT Base Pairing in DNA  

SciTech Connect (OSTI)

As part of an ongoing effort to explore the effect of major groove electrostatics on the thermodynamic stability and structure of DNA, a 7-deaza-2'-deoxyadenosine:dT (7-deaza-dA:dT) base pair in the Dickerson-Drew dodecamer (DDD) was studied. The removal of the electronegative N7 atom on dA and the replacement with an electropositive C-H in the major groove was expected to have a significant effect on major groove electrostatics. The structure of the 7-deaza-dA:dT base pair was determined at 1.1 {angstrom} resolution in the presence of Mg{sup 2+}. The 7-deaza-dA, which is isosteric for dA, had minimal effect on the base pairing geometry and the conformation of the DDD in the crystalline state. There was no major groove cation association with the 7-deaza-dA heterocycle. In solution, circular dichroism showed a positive Cotton effect centered at 280 nm and a negative Cotton effect centered at 250 nm that were characteristic of a right-handed helix in the B-conformation. However, temperature-dependent NMR studies showed increased exchange between the thymine N3 imino proton of the 7-deaza-dA:dT base pair and water, suggesting reduced stacking interactions and an increased rate of base pair opening. This correlated with the observed thermodynamic destabilization of the 7-deaza-dA modified duplex relative to the DDD. A combination of UV melting and differential scanning calorimetry experiments were conducted to evaluate the relative contributions of enthalpy and entropy in the thermodynamic destabilization of the DDD. The most significant contribution arose from an unfavorable enthalpy term, which probably results from less favorable stacking interactions in the modified duplex, which was accompanied by a significant reduction in the release of water and cations from the 7-deaza-dA modified DNA.

Kowal, Ewa A.; Ganguly, Manjori; Pallan, Pradeep S.; Marky, Luis A.; Gold, Barry; Egli, Martin; Stone, Michael P. (Pitt); (Vanderbilt); (Nebraska-Med)

2012-02-15T23:59:59.000Z

5

B-DNA structure is intrinsically polymorphic: even at the level of base pair positions  

SciTech Connect (OSTI)

Increasingly exact measurement of single crystal X-ray diffraction data offers detailed characterization of DNA conformation, hydration and electrostatics. However, instead of providing a more clear and unambiguous image of DNA, highly accurate diffraction data reveal polymorphism of the DNA atomic positions and conformation and hydration. Here we describe an accurate X-ray structure of B-DNA, painstakingly fit to a multistate model that contains multiple competing positions of most of the backbone and of entire base pairs. Two of ten base-pairs of CCAGGCCTGG are in multiple states distinguished primarily by differences in slide. Similarly, all the surrounding ions are seen to fractionally occupy discrete competing and overlapping sites. And finally, the vast majority of water molecules show strong evidence of multiple competing sites. Conventional resolution appears to give a false sense of homogeneity in conformation and interactions of DNA. In addition, conventional resolution yields an average structure that is not accurate, in that it is different from any of the multiple discrete structures observed at high resolution. Because base pair positional heterogeneity has not always been incorporated into model-building, even some high and ultrahigh-resolution structures of DNA do not indicate the full extent of conformational polymorphism.

Maehigashi, Tatsuya; Hsiao, Chiaolong; Woods, Kristen Kruger; Moulaei, Tinoush; Hud, Nicholas V.; Williams, Loren Dean (GIT)

2012-10-23T23:59:59.000Z

6

Nucleic Acid Standards - Program List  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

List of Programs and References List of Programs and References CEHS M. A. El Hassan & C. R. Calladine (1995). ``The Assessment of the Geometry of Dinucleotide Steps in Double-Helical DNA: A New Local Calculation Scheme.'' J. Mol. Biol. 251, 648-664. X. J. Lu, M. A. El Hassan & C. A. Hunter (1997). ``Structure and Conformation of Helical Nucleic Acids: Analysis Program (SCHNAaP).''J. Mol. Biol. 273, 668-680. CompDNA (Please refer to Dr. Andrey A. Gorin: agor@sbnmr1.ski.mskcc.org OR Dr. Victor B. Zhurkin: zhurkin@lmmb.nci.nih.gov) A. A. Gorin, V. B. Zhurkin & W. K. Olson (1995). ``B-DNA Twisting Correlates with Base-pair Morphology.'' J. Mol. Biol. 247, 34-48. K. M. Kosikov, A. A. Gorin, V. B. Zhurkin & W. K. Olson (1999). ``DNA Stretching and Compression: Large-scale Simulations of Double Helical

7

Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides  

Science Journals Connector (OSTI)

A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3?-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We st...

Yuko Ito; Yumiko Sone; Takaharu Mizutani

2004-03-01T23:59:59.000Z

8

Electron Attachment to the GuanineCytosine Nucleic Acid Base Pair and the Effects of Monohydration and Proton Transfer  

Science Journals Connector (OSTI)

Ashutosh Gupta , Heather M. Jaeger , Katherine R. Compaan , and Henry F. Schaefer , III* ... Wheeler, S. E.; Allen, W. D.; Schaefer, H. F. J. Chem. ...

Ashutosh Gupta; Heather M. Jaeger; Katherine R. Compaan; Henry F. Schaefer; III

2012-04-24T23:59:59.000Z

9

acid  

Office of Legacy Management (LM)

Acid/Pueblo Canyon, New Mexico, Site is Acid/Pueblo Canyon, New Mexico, Site is located near the town of Los Alamos, New Mexico, approximately 25 miles northwest of Santa Fe and 60 miles north-northeast of Albuquerque. The site is accessible from Canyon Road, which runs just south of the former waste treatment plant. The plant was situated on a mesa that forms the south rim of Acid Canyon. Acid Canyon is a small tributary near the head

10

acid  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Acid/Pueblo Canyon, New Mexico, Site. Acid/Pueblo Canyon, New Mexico, Site. This site is managed by the U.S. Department of Energy Office of Legacy Management. Site Description and History The Acid/Pueblo Canyon, New Mexico, Site is located near the town of Los Alamos, New Mexico, approximately 25 miles northwest of Santa Fe and 60 miles north-northeast of Albuquerque. The site is accessible from Canyon Road, which runs just south

11

Nucleic Acid Standards - Standard Ref. Frame  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

A Standard Reference Frame for the Description A Standard Reference Frame for the Description of Nucleic Acid Base-pair Geometry Supplementary Material The report is available at Journal of Molecular Biology (2001) 313: 229 - 237 and The Nucleic Acid Cartesian coordinates for A, C, G, T, and U in the optimized reference frame Adenine, Cytosine, Guanine, Thymine, Uracil Standard chemical structures taken from Clowney et al. (1996), J. Am. Chem. Soc., 118, 509-518). These data do not include C1' atoms, which are placed here in the least-squares plane of the base atoms, with the purine C1'-N9 bond length and C1'-N9-C4 valence angle set respectively to 1.46 Å and 126.5° and the pyrimidine C1'-N1 bond and C1-N1-C2 angle to 1.47 Å and 118.1°. These distances and angles are based on the average glycosyl

12

Mimicry of the Backbone and Side-Chain Geometry of Peptide Turns: Synthesis of Novel 4-Substituted Indolizidin-9-one Amino Acids  

Science Journals Connector (OSTI)

Indolizidinone amino acids have served as -turn mimics for exploring conformation-activity relationships in natural peptides [1]. Focus has been particularly placed on mirnicry of peptides containing aromatic...

Jrme Cluzeau; William D. Lubell

2001-01-01T23:59:59.000Z

13

Advanced Review Geometry optimization  

E-Print Network [OSTI]

Advanced Review Geometry optimization H. Bernhard Schlegel Geometry optimization is an important part of most quantum chemical calcu- lations. This article surveys methods for optimizing equilibrium geometries, lo- cating transition structures, and following reaction paths. The emphasis is on optimizations

Schlegel, H. Bernhard

14

Nucleic Acid Softwars  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Nucleic Acid Software Nucleic Acid Software FR3D, a software for finding local and composite recurrent structural motifs in RNA 3D structures. Sarver, M., Zirbel, C.L., Stombaugh, J., Mokdad, A. and Leontis, N.B. (2008) FR3D: finding local and composite recurrent structural motifs in RNA 3D structures. J Math Biol, 56, 215-252. RNAView, a program for quickly generating a display of RNA/DNA secondary structures with tertiary interactions. Yang, H., Jossinet, F., Leontis, N., Chen, L., Westbrook, J., Berman, H.M. and Westhof, E. (2003) Tools for the automatic identification and classification of RNA base pairs. Nucleic Acids Res, 31, 3450-3460. RNAMLview, a program to display and/or edit RNAView 2-dimensional diagrams. 3DNA, a software package for the analysis, rebuilding and visualization of three-dimensional nucleic acid structures.

15

Noncommutative geometry and quantization  

E-Print Network [OSTI]

We examine some recent developments in noncommutative geometry, including spin geometries on noncommutative tori and their quantization by the Shale-Stinespring procedure, as well as the emergence of Hopf algebras as a tool linking index theory and renormalization calculations

Varilly, J C

2000-01-01T23:59:59.000Z

16

Induced geometry from disformal transformation  

E-Print Network [OSTI]

In this note, we use the disformal transformation to induce a geometry from the manifold which is originally Riemannian. The new geometry obtained here can be considered as a generalization of Weyl integrable geometry. Based on these results, we further propose a geometry which is naturally a generalization of Weyl geometry.

Yuan, Fang-Fang

2015-01-01T23:59:59.000Z

17

Induced geometry from disformal transformation  

E-Print Network [OSTI]

In this note, we use the disformal transformation to induce a geometry from the manifold which is originally Riemannian. The new geometry obtained here can be considered as a generalization of Weyl integrable geometry. Based on these results, we further propose a geometry which is naturally a generalization of Weyl geometry.

Fang-Fang Yuan; Peng Huang

2015-02-08T23:59:59.000Z

18

Research Article: Error compensation of tRNA misacylation by codon-anticodon mismatch prevents translational amino acid misinsertion  

Science Journals Connector (OSTI)

Codon-anticodon mismatches and tRNA misloadings cause translational amino acid misinsertions, producing dysfunctional proteins. Here I explore the original hypothesis whether mismatches tend to compensate misacylation, so as to insert the amino acid ... Keywords: Alignment, Base pairings, Developmental stability, Homology, Post-transcriptional tRNA transformation, RNA duplex stability, Wobble position, tRNA synthetase

Herv Seligmann

2011-04-01T23:59:59.000Z

19

Turtle-Geometrie  

Science Journals Connector (OSTI)

Grundidee der Turtle-Geometrie ist die Vorstellung, da eine mechanische Schildkrte -die sogenannte Turtle -vom Computer ferngesteuert wird. Mit Hilfe eines an der Turtle befestigten Schreibstiftes lassen si...

Univ.-Prof. Dipl-Ing. Dr. techn. Helmut Schauer

1988-01-01T23:59:59.000Z

20

Spacetime and Euclidean Geometry  

E-Print Network [OSTI]

Using only the principle of relativity and Euclidean geometry we show in this pedagogical article that the square of proper time or length in a two-dimensional spacetime diagram is proportional to the Euclidean area of the corresponding causal domain. We use this relation to derive the Minkowski line element by two geometric proofs of the "spacetime Pythagoras theorem".

Dieter Brill; Ted Jacobson

2004-08-04T23:59:59.000Z

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Sliding vane geometry turbines  

SciTech Connect (OSTI)

Various systems and methods are described for a variable geometry turbine. In one example, a turbine nozzle comprises a central axis and a nozzle vane. The nozzle vane includes a stationary vane and a sliding vane. The sliding vane is positioned to slide in a direction substantially tangent to an inner circumference of the turbine nozzle and in contact with the stationary vane.

Sun, Harold Huimin; Zhang, Jizhong; Hu, Liangjun; Hanna, Dave R

2014-12-30T23:59:59.000Z

22

Cylindrical geometry hall thruster  

DOE Patents [OSTI]

An apparatus and method for thrusting plasma, utilizing a Hall thruster with a cylindrical geometry, wherein ions are accelerated in substantially the axial direction. The apparatus is suitable for operation at low power. It employs small size thruster components, including a ceramic channel, with the center pole piece of the conventional annular design thruster eliminated or greatly reduced. Efficient operation is accomplished through magnetic fields with a substantial radial component. The propellant gas is ionized at an optimal location in the thruster. A further improvement is accomplished by segmented electrodes, which produce localized voltage drops within the thruster at optimally prescribed locations. The apparatus differs from a conventional Hall thruster, which has an annular geometry, not well suited to scaling to small size, because the small size for an annular design has a great deal of surface area relative to the volume.

Raitses, Yevgeny (Princeton, NJ); Fisch, Nathaniel J. (Princeton, NJ)

2002-01-01T23:59:59.000Z

23

Sequence Design for a Test Tube of Interacting Nucleic Acid Strands  

Science Journals Connector (OSTI)

Sequence Design for a Test Tube of Interacting Nucleic Acid Strands ... We describe an algorithm for designing the equilibrium base-pairing properties of a test tube of interacting nucleic acid strands. ... A target test tube is specified as a set of desired on-target complexes, each with a target secondary structure and target concentration, and a set of undesired off-target complexes, each with vanishing target concentration. ...

Brian R. Wolfe; Niles A. Pierce

2014-10-20T23:59:59.000Z

24

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus  

SciTech Connect (OSTI)

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

Yeo, Hyun Koo; Lee, Jae Young (Dongguk)

2012-04-18T23:59:59.000Z

25

Optical geometry across the horizon  

E-Print Network [OSTI]

In a companion paper (Jonsson and Westman, Class. Quantum Grav. 23 (2006) 61), a generalization of optical geometry, assuming a non-shearing reference congruence, is discussed. Here we illustrate that this formalism can be applied to a finite four-volume of any spherically symmetric spacetime. In particular we apply the formalism, using a non-static reference congruence, to do optical geometry across the horizon of a static black hole. While the resulting geometry in principle is time dependent, we can choose the reference congruence in such a manner that an embedding of the geometry always looks the same. Relative to the embedded geometry the reference points are then moving. We discuss the motion of photons, inertial forces and gyroscope precession in this framework.

Rickard Jonsson

2007-08-19T23:59:59.000Z

26

Integrated 3D Acid Fracturing Model for Carbonate Reservoir Stimulation  

E-Print Network [OSTI]

in integrating fracture propagation, acid transport and dissolution, and well performance models in a seamless fashion for acid fracturing design. In this new approach, the fracture geometry data of a hydraulic fracture is first obtained from commercial models...

Wu, Xi

2014-06-23T23:59:59.000Z

27

JORDAN GEOMETRIES BY INVERSIONS WOLFGANG BERTRAM  

E-Print Network [OSTI]

JORDAN GEOMETRIES BY INVERSIONS WOLFGANG BERTRAM Abstract. Jordan geometries are defined as spaces equipped with point reflections Sx fixing x, and therefore the theories of Jordan geometries actions of torsors and of symmetric spaces is introduced. Jordan geometries give rise both to symmetry

28

Differential geometry of equilibrium thermodynamics  

Science Journals Connector (OSTI)

In the present paper, extending the Weinhold theory, we obtain some differential-geometry properties of the ideal gas and the ideal paramagnetic gas. In particular, we show that the scalar curvature of the ideal paramagnetic gas can be a function of temperature.

Mijat Mijatovi?; Valentina Veselinovi?; Kostadin Trenevski

1987-02-15T23:59:59.000Z

29

Capillary instability in nanowire geometries  

E-Print Network [OSTI]

The vapor-liquid-solid (VLS) mechanism has been applied extensively as a framework for growing single-crystal semiconductor nanowires for applications spanning optoelectronic, sensor and energy-related technologies. Recent experiments have demonstrated that subtle changes in VLS growth conditions produce a diversity of nanowire morphologies, and result in intricate kinked structures that may yield novel properties. These observations have motivated modeling studies that have linked kinking phenomena to processes at the triple line between vapor, liquid and solid phases that cause spontaneous "tilting" of the growth direction. Here we present atomistic simulations and theoretical analyses that reveal a tilting instability that is intrinsic to nanowire geometries, even in the absence of pronounced anisotropies in solid-liquid interface properties. The analysis produces a very simple conclusion: the transition between axisymmetric and tilted triple lines is shown to occur when the triple line geometry satisfies Young's force-balance condition. The intrinsic nature of the instability may have broad implications for the design of experimental strategies for controlled growth of crystalline nanowires with complex geometries.

T. Frolov; W. C. Carter; M. Asta

2014-03-02T23:59:59.000Z

30

Towards a Nano Geometry? Geometry and Dynamics on Nano Scale  

E-Print Network [OSTI]

This paper applies I.M. Gelfand's distinction between adequate and non-adequate use of mathematical language in different contexts to the newly opened window of model-based measurements of intracellular dynamics. The specifics of geometry and dynamics on the mesoscale of cell physiology are elaborated - in contrast to the familiar Newtonian mechanics and the more recent, but by now also rather well established quantum field theories. Examples are given originating from the systems biology of insulin secreting pancreatic beta-cells and the mathematical challenges of an envisioned non-invasive control of magnetic nanoparticles.

Bernhelm Booss-Bavnbek

2012-02-23T23:59:59.000Z

31

Quantum Geometry and Black Holes  

E-Print Network [OSTI]

We present an overall picture of the advances in the description of black hole physics from the perspective of loop quantum gravity. After an introduction that discusses the main conceptual issues we present some details about the classical and quantum geometry of isolated horizons and their quantum geometry and then use this scheme to give a natural definition of the entropy of black holes. The entropy computations can be neatly expressed in the form of combinatorial problems solvable with the help of methods based on number theory and the use of generating functions. The recovery of the Bekenstein-Hawking law and corrections to it is explained in some detail. After this, due attention is paid to the discussion of semiclassical issues. An important point in this respect is the proper interpretation of the horizon area as the energy that should appear in the statistical-mechanical treatment of the black hole model presented here. The chapter ends with a comparison between the microscopic and semiclassical app...

G., J Fernando Barbero

2015-01-01T23:59:59.000Z

32

Some Progress in Conformal Geometry  

E-Print Network [OSTI]

This is a survey paper of our current research on the theory of partial differential equations in conformal geometry. Our intention is to describe some of our current works in a rather brief and expository fashion. We are not giving a comprehensive survey on the subject and references cited here are not intended to be complete. We introduce a bubble tree structure to study the degeneration of a class of Yamabe metrics on Bach flat manifolds satisfying some global conformal bounds on compact manifolds of dimension 4. As applications, we establish a gap theorem, a finiteness theorem for diffeomorphism type for this class, and diameter bound of the $\\sigma_2$-metrics in a class of conformal 4-manifolds. For conformally compact Einstein metrics we introduce an eigenfunction compactification. As a consequence we obtain some topological constraints in terms of renormalized volumes.

Chang, Sun-Yung A; Yang, Paul

2007-01-01T23:59:59.000Z

33

THE GEOMETRIES OF 3-MANIFOLDS PETER SCOTT  

E-Print Network [OSTI]

that each smooth path on S2 has a length, namely its length as a path in £3 . (I shall consistently use ETHE GEOMETRIES OF 3-MANIFOLDS PETER SCOTT Page §1. The 2-dimensional geometries 405 §2. Geometric. The eight 3-dimensional geometries 441 E3 443 H3 448 S3 449 S2 x U 457 fPxM 459 SL2U 462 Nil 467 Sol 470 §5

Schleimer, Saul

34

Matlab Geometry Builder and Mlfma Modeler.  

E-Print Network [OSTI]

??Development of MATLAB graphical user interface (GUI) to facilitate building and modification of discretized geometries for use in moment method (MM) and multilevel fast multipole (more)

Carrero, Christopher

2011-01-01T23:59:59.000Z

35

Hydraulic Geometry: Empirical Investigations and Theoretical Approaches  

E-Print Network [OSTI]

Hydraulic Geometry: Empirical Investigations and Theoretical Approaches B.C. Eatona, a Department are determined by the channel shape, gradient and a flow resistance parameter. A review of the literature Geomorphology April 21, 2010 #12;the research on downstream hydraulic geometry has focussed on the factors

Eaton, Brett

36

MACDONALD POLYNOMIALS AND GEOMETRY MARK HAIMAN  

E-Print Network [OSTI]

MACDONALD POLYNOMIALS AND GEOMETRY MARK HAIMAN Contents 1. Introduction 2. Symmetric functions and Macdonald polynomials 3. The n! conjecture 4. The Hilbert scheme and Xn 5. Frobenius series 6. The ideals J by Macdonald [26], and the geometry of certain algebraic varieties, notably the Hilbert scheme Hilbn (C2

Haiman, Mark D.

37

MACDONALD POLYNOMIALS AND GEOMETRY MARK HAIMAN  

E-Print Network [OSTI]

MACDONALD POLYNOMIALS AND GEOMETRY MARK HAIMAN Contents 1. Introduction 2. Symmetric functions and Macdonald polynomials 3. The n! conjecture 4. The Hilbert scheme and X n 5. Frobenius series 6. The ideals J by Macdonald [26], and the geometry of certain algebraic varieties, notably the Hilbert scheme Hilb n (C 2

Haiman, Mark D.

38

Line geometry and electromagnetism I: basic structures  

E-Print Network [OSTI]

Some key notions of line geometry are recalled, along with their application to mechanics. It is then shown that most of the basic structures that one introduces in the pre-metric formulation of electromagnetism can be interpreted directly in terms of corresponding concepts in line geometry. The results are summarized in a table.

D. H. Delphenich

2013-09-11T23:59:59.000Z

39

FINAL REPORT: GEOMETRY AND ELEMENTARY PARTICLE PHYSICS  

SciTech Connect (OSTI)

The effect on mathematics of collaborations between high-energy theoretical physics and modern mathematics has been remarkable. Mirror symmetry has revolutionized enumerative geometry, and Seiberg-Witten invariants have greatly simplified the study of four manifolds. And because of their application to string theory, physicists now need to know cohomology theory, characteristic classes, index theory, K-theory, algebraic geometry, differential geometry, and non-commutative geometry. Much more is coming. We are experiencing a deeper contact between the two sciences, which will stimulate new mathematics essential to the physicists quest for the unification of quantum mechanics and relativity. Our grant, supported by the Department of Energy for twelve years, has been instrumental in promoting an effective interaction between geometry and string theory, by supporting the Mathematical Physics seminar, postdoc research, collaborations, graduate students and several research papers.

Singer, Isadore M.

2008-03-04T23:59:59.000Z

40

The Geometry of Soft Materials: A Primer  

E-Print Network [OSTI]

We present an overview of the differential geometry of curves and surfaces using examples from soft matter as illustrations. The presentation requires a background only in vector calculus and is otherwise self-contained.

Randall D. Kamien

2002-03-06T23:59:59.000Z

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

The geometry of unfolding tree leaves  

Science Journals Connector (OSTI)

...opening|deployable structure|solar panel| The geometry of unfolding tree...opening, deployable structure, solar panel 1. INTRODUCTION The leaves of...of deployable structures such as solar panels and light- weight antennae of...

1998-01-01T23:59:59.000Z

42

Topology to geometry in protein folding: -Lactoglobulin  

E-Print Network [OSTI]

Topology to geometry in protein folding: -Lactoglobulin Ariel Ferna´ndez* , Andre´s Colubri , and R angles and at the -carbon atoms of the peptide backbone dominate protein folding. Next in importance

Berry, R. Stephen

43

Kerr geometry in f(T) gravity  

E-Print Network [OSTI]

Null tetrads are shown to be a valuable tool in teleparallel theories of modified gravity. We use them to prove that Kerr geometry remains a solution for a wide family of f(T) theories of gravity.

Cecilia Bejarano; Rafael Ferraro; Mara Jos Guzmn

2014-12-01T23:59:59.000Z

44

The geometry of modified Riemannian extensions  

Science Journals Connector (OSTI)

...given by . This connection is Ricci flat, but not flat. We set phi=0 and take c=1...survey on paracomplex geometry. Rocky Mount. J. Math. 26, 83-115...and W. Roter2007Projectively flat surfaces, null parallel distributions...

2009-01-01T23:59:59.000Z

45

Crystallization of carbon tetrachloride in confined geometries  

E-Print Network [OSTI]

1 Crystallization of carbon tetrachloride in confined geometries Adil Meziane1 , Jean-Pierre E 40 71 08 #12;2 Abstract The thermal behaviour of carbon tetrachloride confined in silica gels

Paris-Sud XI, Université de

46

JORDAN GEOMETRIES AN APPROACH VIA INVERSIONS WOLFGANG BERTRAM  

E-Print Network [OSTI]

JORDAN GEOMETRIES ­ AN APPROACH VIA INVERSIONS WOLFGANG BERTRAM Abstract. Jordan geometries]) as spaces equipped with point reflections Sx fixing x, and therefore the theories of Jordan geometries action of torsors and of symmetric spaces is introduced. Jordan geometries give rise both to inversive

Paris-Sud XI, Université de

47

Build A Recreation Center Using Geometry Project  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

BUILD A RECREATION CENTER USING GEOMETRY BUILD A RECREATION CENTER USING GEOMETRY Project Description The city of West Chicago has recently acquired a small island on a nearby lake. The island is roughly circular with a radius of approximately two acres. Our geometry class is being asked to design a recreation center for the children of West Chicago. Our class has a very unique opportunity. Because of an anonymous donor, money is no object. The class will be divided into groups of approximately four students. The first task of each group is to decide which portion of the project your group will be responsible for designing. Below are your possible choices. Possible Topics Architecture Landscape Architecture Computer Games Bridges Art Other Finished Product Following is what your team is responsible for turning in at the end of the

48

Spheromak tilting instability in cylindrical geometry  

Science Journals Connector (OSTI)

The internal tilting instability in a force?free spheromak plasma in cylindrical geometry is examined. It is found that this instability originally found in spherical geometry also occurs in cylindrical geometry. The analysis proceeds by first demonstrating that if no mode rational surface is present in the plasma a necessary and sufficient condition for ideal magnetohydrodynamic instability is that there exist a solution to ?B m = ? m B m where B m ?exp(i m?) with ? m

John M. Finn; Wallace M. Manheimer; Edward Ott

1981-01-01T23:59:59.000Z

49

Quantum Geometry Phenomenology: Angle and Semiclassical States  

E-Print Network [OSTI]

The phenomenology for the deep spatial geometry of loop quantum gravity is discussed. In the context of a simple model of an atom of space, it is shown how purely combinatorial structures can affect observations. The angle operator is used to develop a model of angular corrections to local, continuum flat-space 3-geometries. The physical effects involve neither breaking of local Lorentz invariance nor Planck scale suppression, but rather reply on only the combinatorics of SU(2) recouping theory. Bhabha scattering is discussed as an example of how the effects might be observationally accessible.

Seth A. Major

2011-12-19T23:59:59.000Z

50

Congruent gridding for developable geometries using NURBS  

SciTech Connect (OSTI)

This paper discusses recent progress in developing an interactive system built upon NURBS geometry modeling to ensure congruence of surface grids and surface geometries for structured and unstructured gridders. The code system is being developed as part of a collaborative effort among Nausea/Carderock Division, NASA/Lewis, Boeing Computer Services, and SAIC/Ship Technology Division, and uses the Navy library of NURBS FORTRAN subroutines, DT-NURBS, to allow incorporation into a wide variety of gridding codes and flow solvers. Although this paper will present examples relevant to the design of ship hulls only, the code system is being developed to support the design and manufacture of complex mechanical systems.

Fritts, M.; Weems, K. [Science Applications International Corp., Annapolis, MD (United States)

1996-12-31T23:59:59.000Z

51

Spectroscopic Study of the Simultaneous Adsorption of PVP and Azelaic Acid on ?-Alumina  

Science Journals Connector (OSTI)

A 180 backscattering geometry and an indium gallium arsenide detector were applied. ... The azelaic acid concentration was not equal in the two solvents, due to the limited solubility in water. ...

Ildik Szraz; Willis Forsling

2001-05-23T23:59:59.000Z

52

ACCELERATION INDUCED SPIN ITS GAUGE GEOMETRY  

E-Print Network [OSTI]

@math.ohio­state.edu ABSTRACT Does there exist a purely quantum mechanical characterization of gravitation? To this end at each event. A unique and natural law of parallel transport of quantum states between different events conclusion that gravitation is to be identified with the gauge geometry of the group [SU(1; 1)] 1 . #12

Gerlach, Ulrich

53

Mobile Robot Geometry Initialization from Single Camera  

E-Print Network [OSTI]

Mobile Robot Geometry Initialization from Single Camera Daniel Pizarro1 , Manuel Mazo1 , Enrique to achieve robot localization has been widely proposed in the area of Intelligent Spaces. Recently, an online approach that simul- taneously obtains robot's pose and its 3D structure using a single external camera has

Paris-Sud XI, Université de

54

Threedimensional numerical simulation for various geometries  

E-Print Network [OSTI]

Three­dimensional numerical simulation for various geometries of solid oxide fuel cells J.R. Ferguson 1 , J.M. Fiard 2 , and R. Herbin 3 Abstract A 3D mathematical model of a Solid Oxide Fuel Cell modelling and numerical simulation of natural gas­fed solid oxide cells (Solid Oxide Fuel Cell, SOFC

Herbin, Raphaèle

55

Optimal distillation using thermodynamic geometry Bjarne Andresen  

E-Print Network [OSTI]

Optimal distillation using thermodynamic geometry Bjarne Andresen ?rsted Laboratory, University of a distillation column may be improved by permitting heat exchange on every tray rather than only in the reboiler (temperature, pressure, etc.) define successive states in a sequence of equilibria. Fractional distillation [2

Salamon, Peter

56

Quantum Field Theory and Differential Geometry  

E-Print Network [OSTI]

We introduce the historical development and physical idea behind topological Yang-Mills theory and explain how a physical framework describing subatomic physics can be used as a tool to study differential geometry. Further, we emphasize that this phenomenon demonstrates that the interrelation between physics and mathematics have come into a new stage.

W. F. Chen

2008-03-10T23:59:59.000Z

57

Method for high-volume sequencing of nucleic acids: random and directed priming with libraries of oligonucleotides  

DOE Patents [OSTI]

Random and directed priming methods for determining nucleotide sequences by enzymatic sequencing techniques, using libraries of primers of lengths 8, 9 or 10 bases, are disclosed. These methods permit direct sequencing of nucleic acids as large as 45,000 base pairs or larger without the necessity for subcloning. Individual primers are used repeatedly to prime sequence reactions in many different nucleic acid molecules. Libraries containing as few as 10,000 octamers, 14,200 nonamers, or 44,000 decamers would have the capacity to determine the sequence of almost any cosmid DNA. Random priming with a fixed set of primers from a smaller library can also be used to initiate the sequencing of individual nucleic acid molecules, with the sequence being completed by directed priming with primers from the library. In contrast to random cloning techniques, a combined random and directed priming strategy is far more efficient.

Studier, F. William (Stony Brook, NY)

1995-04-18T23:59:59.000Z

58

Damage experiments in a cylindrical geometry  

SciTech Connect (OSTI)

Studying spallation damage with a cylindrical configuration allows for a natural recollection of the damaged material under proper driving conditions. Additionally, the damaged material can come to a complete rest without the application of further stopping forces. Specific areas of research include the damage initiation regime in convergent geometry, behavior of material recollected after damage, and effects of convergent geometry on the material response. Such experiments produce unique strain and shear stress states, motivating improvements in existing computational material models and increasing the predictive capabilities of codes. A LANL/VNIIEF joint experimental series has produced cylindrical aluminum failure initiation data and studied the behavior of material recollected after damage initiation and after complete failure. In addition to post-shot collection of the damaged target material for subsequent metallographic analysis, dynamic in-situ experimental diagnostics include velocimetry and transverse radial radiography. This paper will discuss the current experimental status.

Kaul, Ann M [Los Alamos National Laboratory

2010-09-21T23:59:59.000Z

59

Field-Particle Dynamics in Spacetime Geometries  

E-Print Network [OSTI]

With the aid of a Fermi-Walker chart associated with an orthonormal frame attached to a time-like curve in spacetime, a discussion is given of relativistic balance laws that may be used to construct models of massive particles with spin, electric charge and a magnetic moment,interacting with background electromagnetic fields and gravitation described by non-Riemannian geometries. A natural generalisation to relativistic Cosserat media is immediate.

Robin W. Tucker

2003-08-26T23:59:59.000Z

60

Inhabiting the square; a geometry for path and space  

E-Print Network [OSTI]

Geometries and geometric systems are not architecture, though architecture is geometric. Geometries and geometric systems, because of their autonomous nature, are generally understandable and can serve as the basis of ...

Joslin, Alan Royal

1982-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

An Overview of Geometry Representation in Monte Carlo Codes  

National Nuclear Security Administration (NNSA)

Geometry Representation Geometry Representation in Monte Carlo Codes R.P. Kensek, * B.C. Franke, * T.W. Laub * , L.J. Lorence, * M. R. Martin, * S. Warren † * Sandia National Laboratories, P.O. Box 5800, MS 1179, Albuquerque, NM 87185 † Kansas State University, Manhattan, KS 66506 Geometry representations in production Monte Carlo radiation transport codes used for linear-transport simulations are traditionally limited to combinatorial geometry (CG) topologies. While CG representations of input geometries are efficient to query, they are difficult to construct. In the Integrated-TIGER-Series (ITS) Monte Carlo code suite, a new approach for radiation transport geometry engines has been implemented that allows for Computer Aided Design (CAD), facetted approximations, and other geometry types to simultaneously define an input geometry.

62

Physics on a circle and geometry Balazs Szendroi, Oxford  

E-Print Network [OSTI]

Physics on a circle and geometry Balazs Szendroi, Oxford The 1st Strathmore University Mathematics Conference 18-20 August 2011 Physics on a circle and geometry Balazs Szendroi University of Oxford #12;Physics on a circle and geometry Balazs Szendroi, Oxford The 1st Strathmore University Mathematics

Szendröi, Balázs

63

Geodesic Reduction via Frame Bundle Geometry  

E-Print Network [OSTI]

A manifold with an arbitrary affine connection is considered and the geodesic spray associated with the connection is studied in the presence of a Lie group action. In particular, results are obtained that provide insight into the structure of the reduced dynamics associated with the given invariant affine connection. The geometry of the frame bundle of the given manifold is used to provide an intrinsic description of the geodesic spray. A fundamental relationship between the geodesic spray, the tangent lift and the vertical lift of the symmetric product is obtained, which provides a key to understanding reduction in this formulation.

Ajit Bhand

2010-02-22T23:59:59.000Z

64

Differential geometry, Palatini gravity and reduction  

SciTech Connect (OSTI)

The present article deals with a formulation of the so called (vacuum) Palatini gravity as a general variational principle. In order to accomplish this goal, some geometrical tools related to the geometry of the bundle of connections of the frame bundle LM are used. A generalization of Lagrange-Poincar reduction scheme to these types of variational problems allows us to relate it with the Einstein-Hilbert variational problem. Relations with some other variational problems for gravity found in the literature are discussed.

Capriotti, S., E-mail: santiago.capriotti@uns.edu.ar [Departamento de Matemtica, Universidad Nacional del Sur, 8000 Baha Blanca (Argentina)

2014-01-15T23:59:59.000Z

65

The Casimir Effect for Generalized Piston Geometries  

E-Print Network [OSTI]

In this paper we study the Casimir energy and force for generalized pistons constructed from warped product manifolds of the type $I\\times_{f}N$ where $I=[a,b]$ is an interval of the real line and $N$ is a smooth compact Riemannian manifold either with or without boundary. The piston geometry is obtained by dividing the warped product manifold into two regions separated by the cross section positioned at $R\\in(a,b)$. By exploiting zeta function regularization techniques we provide formulas for the Casimir energy and force involving the arbitrary warping function $f$ and base manifold $N$.

Guglielmo Fucci; Klaus Kirsten

2012-03-29T23:59:59.000Z

66

Massless Flavor in Geometry and Matrix Models  

SciTech Connect (OSTI)

The proper inclusion of flavor in the Dijkgraaf-Vafa proposal for the solution of N=1 gauge theories through matrix models has been subject of debate in the recent literature. We here reexamine this issue by geometrically engineering fundamental matter with type IIB branes wrapped on non-compact cycles in the resolved geometry, and following them through the geometric transition. Our approach treats massive and massless flavor fields on equal footing, including the mesons. We also study the geometric transitions and superpotentials for finite mass of the adjoint field. All superpotentials we compute reproduce the field theory results. Crucial insights come from T-dual brane constructions in type IIA.

Roiban, Radu; Tatar, Radu; Walcher, Johannes

2003-01-27T23:59:59.000Z

67

On the geometry of cosmological model building  

E-Print Network [OSTI]

This article analyzes the present anomalies of cosmology from the point of view of integrable Weyl geometry. It uses P.A.M. Dirac's proposal for a weak extension of general relativity, with some small adaptations. Simple models with interesting geometrical and physical properties, not belonging to the Friedmann-Lema\\^{\\i}tre class, are studied in this frame. Those with positive spatial curvature (Einstein-Weyl universes) go well together with observed mass density $\\Omega_m$, CMB, supernovae Ia data, and quasar frequencies. They suggest a physical role for an equilibrium state of the Maxwell field proposed by I.E. Segal in the 1980s (Segal background) and for a time invariant balancing condition of vacuum energy density. The latter leads to a surprising agreement with the BF-theoretical calculation proposed by C. Castro (2002).

Erhard Scholz

2005-11-21T23:59:59.000Z

68

Plasma Instabilities in an Anisotropically Expanding Geometry  

SciTech Connect (OSTI)

We study (3+1)D kinetic (Boltzmann-Vlasov) equations for relativistic plasma particles in a one dimensionally expanding geometry motivated by ultrarelativistic heavy-ion collisions. We set up local equations in terms of Yang-Mills potentials and auxiliary fields that allow simulations of hard- (expanding-) loop dynamics on a lattice. We determine numerically the evolution of plasma instabilities in the linear (Abelian) regime and also derive their late-time behavior analytically, which is consistent with recent numerical results on the evolution of the so-called melting color-glass condensate. We also find a significant delay in the onset of growth of plasma instabilities which are triggered by small rapidity fluctuations, even when the initial state is highly anisotropic.

Romatschke, Paul [Fakultaet fuer Physik, Universitaet Bielefeld, D-33501 Bielefeld (Germany); Rebhan, Anton [Institut fuer Theoretische Physik, Technische Universitaet Wien, Wiedner Hauptstrasse 8-10, A-1040 Vienna (Austria)

2006-12-22T23:59:59.000Z

69

Collisional drift waves in a spheromak geometry  

Science Journals Connector (OSTI)

An eigenmode equation for collisional electrostatic drift waves in general axisymmetric toroidal geometry is derived and solved numerically for a low?? spheromak. In the calculation of the density responses the ions are treated as a cold fluid and the electrons are assumed to be isothermal. The electronion collision operator is approximated by a friction term in the parallel component of the electron momentum equation and the perturbation analysis includes the self?consistent equilibrium electron current dynamics. Large toroidal mode numbers are assumed and use is made of the simplifying ballooning mode representation. The main destabilizing mechanism found here comes from electronion collisions. For the parameters considered the mode frequency and growth rate are hardly affected by the equilibrium current driving terms.

R. Marchand; P. N. Guzdar

1982-01-01T23:59:59.000Z

70

Satellite Multiangle Cumulus Geometry Retrieval: Case Study  

SciTech Connect (OSTI)

Most satellite-based analyses have been conducted using near nadir-viewing sensors. The Multi-angle Imaging SpectroRadiometer (MISR), recently launched on the National Aeronautics and Space Administration (NASA) Terra platform, provides high-resolution measurements of reflectance at nine different viewing angles. In this study, we examine the possible retrieval of detailed cumulus geometry using the new and unique MISR datasets. We suggested one approach and apply it to an early MISR dataset of small marine cumulus clouds. This paper also presents validation analysis of this technique with both independent ground-based radar measurements and a model-output inverse problem. Collocated and coincident MISR data and ground-based observations at the Atmospheric Radiation Measurement (ARM) Tropical Western Pacific (TWP) site form the basis of this validation. Future work will attempt to test the suggested approach with additional MISR scenes.

Kassianov, Evgueni I.; Ackerman, Thomas P.; Marchand, Roger T.; Ovtchinnikov, Mikhail

2003-02-08T23:59:59.000Z

71

Complex geometry and pre-metric electromagnetism  

E-Print Network [OSTI]

The intimate link between complex geometry and the problem of the pre-metric formulation of electromagnetism is explored. In particular, the relationship between 3+1 decompositions of R4 and the decompositions of the vector space of bivectors over R4 into real and imaginary subspaces relative to a choice of complex structure is emphasized. The role of the various scalar products on the space of bivectors that are defined in terms of a volume element on R4 and a complex structure on the space of bivectors that makes it C-linear isomorphic to C3 is discussed in the context of formulation of a theory of electromagnetism in which the Lorentzian metric on spacetime follows as a consequence of the existence of electromagnetic waves, not a prior assumption.

D. H. Delphenich

2004-12-10T23:59:59.000Z

72

Black Hole Initial Data with a Horizon of Prescribed Geometry  

E-Print Network [OSTI]

The purpose of this work is to construct asymptotically flat, time symmetric initial data with an apparent horizon of prescribed intrinsic geometry. To do this, we use the parabolic partial differential equation for prescribing scalar curvature. In this equation the horizon geometry is contained within the freely specifiable part of the metric. This contrasts with the conformal method in which the geometry of the horizon can only be specified up to a conformal factor.

Brian Smith

2007-10-04T23:59:59.000Z

73

Is there a Jordan geometry underlying quantum physics?  

E-Print Network [OSTI]

There have been several propositions for a geometric and essentially non-linear formulation of quantum mechanics. From a purely mathematical point of view, the point of view of Jordan algebra theory might give new strength to such approaches: there is a ``Jordan geometry'' belonging to the Jordan part of the algebra of observables, in the same way as Lie groups belong to the Lie part. Both the Lie geometry and the Jordan geometry are well-adapted to describe certain features of quantum theory. We concentrate here on the mathematical description of the Jordan geometry and raise some questions concerning possible relations with foundational issues of quantum theory.

Wolfgang Bertram

2008-01-20T23:59:59.000Z

74

Information Geometry and Primal-Dual Interior-point Algorithms  

E-Print Network [OSTI]

May 14, 2010 ... Abstract: In this paper, we study polynomial-time interior-point algorithms in view of information geometry. We introduce an information...

Satoshi Kakihara

2010-05-14T23:59:59.000Z

75

MISR-Derived Statistics of Cumulus Geometry at TWP Site  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Statistics of Cumulus Geometry at TWP Site E. I. Kassianov, T. P. Ackerman, and R. T. Marchand Pacific Northwest National Laboratory Richland, Washington Introduction The...

76

What kind of noncommutative geometry for quantum gravity ?  

E-Print Network [OSTI]

We give a brief account of the description of the standard model in noncommutative geometry as well as the thermal time hypothesis, questioning their relevance for quantum gravity.

Pierre Martinetti

2005-01-07T23:59:59.000Z

77

Evaluation of subsurface fracture geometry using fluid pressure...  

Open Energy Info (EERE)

subsurface fracture geometry using fluid pressure response to solid earth tidal strain Jump to: navigation, search OpenEI Reference LibraryAdd to library Report: Evaluation of...

78

Topologies to geometries in protein folding: Hierarchical and nonhierarchical scenarios  

E-Print Network [OSTI]

Topologies to geometries in protein folding: Hierarchical and nonhierarchical scenarios Ariel Ferna presents a method to portray protein folding dynamics at a coarse resolution, based on a pattern

Berry, R. Stephen

79

Remarks on Hamiltonian structures in G{sub 2}-geometry  

SciTech Connect (OSTI)

In this article, we treat G{sub 2}-geometry as a special case of multisymplectic geometry and make a number of remarks regarding Hamiltonian multivector fields and Hamiltonian differential forms on manifolds with an integrable G{sub 2}-structure; in particular, we discuss existence and make a number of identifications of the spaces of Hamiltonian structures associated to the two multisymplectic structures associated to an integrable G{sub 2}-structure. Along the way, we prove some results in multisymplectic geometry that are generalizations of results from symplectic geometry.

Cho, Hyunjoo, E-mail: cho@math.rochester.edu; Salur, Sema, E-mail: salur@math.rochester.edu [Department of Mathematics, University of Rochester, Rochester, New York 14627 (United States)] [Department of Mathematics, University of Rochester, Rochester, New York 14627 (United States); Todd, A. J., E-mail: ajtodd@math.ucr.edu [Department of Mathematics, University of California-Riverside, Riverside, California 92521 (United States)

2013-12-15T23:59:59.000Z

80

Scientist Finds Nature and Geometry Dancing to the Same Tune...  

Office of Science (SC) Website

geometry and physics," Torquato said. While mathematics often explains physics, his work exemplifies the way in which the fundamental physics of the universe can...

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Supersymmetry and noncommutative geometry Part I: Supersymmetric almost-commutative geometries  

E-Print Network [OSTI]

Noncommutative geometry has seen remarkable applications for high energy physics, viz. the geometrical interpretation of the Standard Model. The question whether it also allows for supersymmetric theories has so far not been answered in a conclusive way. In this first of three papers we do a systematic analysis of the possibilities for almost-commutative geometries on a 4-dimensional, flat background to exhibit not only a particle content that is eligible for supersymmetry but also have a supersymmetric action. We come up with an approach in which we identify the basic 'building blocks' of potentially supersymmetric theories and the demands for their action to be supersymmetric. Examples that satisfy these demands turn out to be sparse.

Wim Beenakker; Walter D. van Suijlekom; Thijs van den Broek

2014-09-21T23:59:59.000Z

82

Supersymmetry and noncommutative geometry Part I: Supersymmetric almost-commutative geometries  

E-Print Network [OSTI]

Noncommutative geometry has seen remarkable applications for high energy physics, viz. the geometrical interpretation of the Standard Model. The question whether it also allows for supersymmetric theories has so far not been answered in a conclusive way. In this first of three papers we do a systematic analysis of the possibilities for almost-commutative geometries on a 4-dimensional, flat background to exhibit not only a particle content that is eligible for supersymmetry but also have a supersymmetric action. We come up with an approach in which we identify the basic 'building blocks' of potentially supersymmetric theories and the demands for their action to be supersymmetric. Examples that satisfy these demands turn out to be sparse.

Beenakker, Wim; Broek, Thijs van den

2014-01-01T23:59:59.000Z

83

Visibility in Discrete Geometry: an application to discrete geodesic paths  

E-Print Network [OSTI]

Visibility in Discrete Geometry: an application to discrete geodesic paths David Coeurjolly that are visible from a source pixel. Based on these definitions, we define discrete geodesic paths in dis- crete domain with obstacles. This allows us to introduce a new geodesic metric in discrete geometry

Paris-Sud XI, Université de

84

Is there a Jordan geometry underlying quantum physics?  

E-Print Network [OSTI]

Is there a Jordan geometry underlying quantum physics? Wolfgang Bertram January 19, 2008 Abstract of Jordan algebra theory might give new strength to such approaches: there is a "Jordan geometry" belonging to the Jordan part of the algebra of observables, in the same way as Lie groups belong to the Lie part. Both

85

Is there a Jordan geometry underlying quantum physics?  

E-Print Network [OSTI]

Is there a Jordan geometry underlying quantum physics? Wolfgang Bertram # January 19, 2008 Abstract of Jordan algebra theory might give new strength to such approaches: there is a ``Jordan geometry'' belonging to the Jordan part of the algebra of observables, in the same way as Lie groups belong to the Lie

86

Control of Variable Geometry Turbocharged Diesel Engines for Reduced Emissions  

E-Print Network [OSTI]

in a Diesel engine equipped with a variable geometry tur- bocharger (VGT) and an external exhaust gas INJECTION EXHAUST MANIFOLD EGR VALVE EGR COOLER AIR EXHAUST Figure 1: Schematic representation of the DieselControl of Variable Geometry Turbocharged Diesel Engines for Reduced Emissions A.G. Stefanopoulouz

Stefanopoulou, Anna

87

An Evolutionary Geometry Parametrization for Aerodynamic Shape Optimization  

E-Print Network [OSTI]

An Evolutionary Geometry Parametrization for Aerodynamic Shape Optimization Xiaocong Han and David, M3H 5T6, Canada An evolutionary geometry parametrization is presented for aerodynamic shape optimiza, unconventional aerodynamic configurations. Based on improvements in computational fluid dynamics (CFD) and high

Zingg, David W.

88

Friedmann Thermodynamics and the Geometry of the Universe  

E-Print Network [OSTI]

In a recent article we have introduced Friedmann thermodynamics, where certain geometric parameters in Friedmann models are treated like their thermodynamic counterparts (temperature, entropy, Gibbs potential etc.). This model has the advantage of allowing us to determine the geometry of the universe by thermodynamic stability arguments. In this article we review connections between thermodynamics, geometry and cosmology.

Selcuk S. Bayin

2008-04-01T23:59:59.000Z

89

Line geometry and electromagnetism III: groups of transformations  

E-Print Network [OSTI]

The role of linear and projective groups of transformations in line geometry and electromagnetism is examined in accordance with Klein's Erlanger Programm for geometries. The group of collineations of real projective space is chosen as the most general group, and reductions to some of its various subgroups are then detailed according to their relevance to electromagnetic fields, and especially wave-like ones.

D. H. Delphenich

2014-04-16T23:59:59.000Z

90

Argonne TTRDC - Engines - Multi-Dimensional Modeling - Orifice Geometry  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Multi-Dimensional Modeling: Multi-Dimensional Modeling: Effect of Nozzle Orifice Geometry fuel vapor volume fractions Fig 1. Fuel vapor volume fractions for the three nozzles Nozzle orifice geometry is known to influence the flow inside the nozzle, which in turn affects the spray development, thus impacting combustion and emission processes. In the past, modeling studies have focused on the influence of nozzle orifice geometry on the flow inside the orifice only. This is mainly due to the lack of a suitable primary breakup model. Argonne engineers, with the help of the KH-ACT model, investigated the influence of nozzle orifice geometry not only on nozzle flow, but on spray, combustion and emission characteristics. Three different nozzle geometries were investigated (Fig. 1): Cylindrical (K=0, r/R=0)

91

Statistics and geometry of cosmic voids  

SciTech Connect (OSTI)

We introduce new statistical methods for the study of cosmic voids, focusing on the statistics of largest size voids. We distinguish three different types of distributions of voids, namely, Poisson-like, lognormal-like and Pareto-like distributions. The last two distributions are connected with two types of fractal geometry of the matter distribution. Scaling voids with Pareto distribution appear in fractal distributions with box-counting dimension smaller than three (its maximum value), whereas the lognormal void distribution corresponds to multifractals with box-counting dimension equal to three. Moreover, voids of the former type persist in the continuum limit, namely, as the number density of observable objects grows, giving rise to lacunar fractals, whereas voids of the latter type disappear in the continuum limit, giving rise to non-lacunar (multi)fractals. We propose both lacunar and non-lacunar multifractal models of the cosmic web structure of the Universe. A non-lacunar multifractal model is supported by current galaxy surveys as well as cosmological N-body simulations. This model suggests, in particular, that small dark matter halos and, arguably, faint galaxies are present in cosmic voids.

Gaite, Jos, E-mail: jose.gaite@upm.es [Instituto de Microgravedad IDR, ETS Ingenieros Aeronuticos, Universidad Politcnica de Madrid, E-28040 Madrid (Spain)

2009-11-01T23:59:59.000Z

92

Geometry of the Infalling Causal Patch  

E-Print Network [OSTI]

The firewall paradox states that an observer falling into an old black hole must see a violation of unitarity, locality, or the equivalence principle. Motivated by this remarkable conflict, we analyze the causal structure of black hole spacetimes in order to determine whether all the necessary ingredients for the paradox fit within a single observer's causal patch. We particularly focus on the question of whether the interior partner modes of the outgoing Hawking quanta can, in principle, be measured by an infalling observer. Since the relevant modes are spread over the entire sphere, we answer a simple geometrical question: can any observer see an entire sphere behind the horizon? We find that for all static black holes in 3+1 and higher dimensions, with any value of the cosmological constant, no single observer can see both the early Hawking radiation and the interior modes. We present a detailed description of the causal patch geometry of the Schwarzschild black hole in 3+1 dimensions, where an infalling o...

Freivogel, Ben; Kabir, Laurens; Yang, I-Sheng

2014-01-01T23:59:59.000Z

93

NA Standards | Valence Geometries | Table 1 Ref.  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

1: References for Mononucleoside and Mononucleotide Structures 1: References for Mononucleoside and Mononucleotide Structures used in Anke Gelbin, Bohdan Schneider, Lester Clowney, Shu-Hsin Hsieh, Wilma K. Olson, and Helen M. Berman. "Geometric Parameters in Nucleic Acids: Sugar and Phosphate Constituents. (1996) J. Am. Chem. Soc. 118, 519-529. -------------------------------------------------------------------------- CSD ID Compound Reference -------------------------------------------------------------------------- fikhai 3',5'-Di-O-acetyl-2'-deoxyadenosine Koole, L. H., et al. Can. J. Chem., 1987, 65, 326 fikhai01 3',5'-Di-O-acetyl-2'-deoxyadenosine Low, J. N., et al. Acta Cryst., 1988, C44, 2202 foylua 3'-O-acetyl-2'-deoxyadenosine Low, J. N., et al.

94

Thermal techniques for characterizing magma body geometries | Open Energy  

Open Energy Info (EERE)

techniques for characterizing magma body geometries techniques for characterizing magma body geometries Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Journal Article: Thermal techniques for characterizing magma body geometries Details Activities (1) Areas (1) Regions (0) Abstract: The surface heat flux distribution resulting from emplaced magma bodies can be used to help characterize the magma source. Closed-form analytical solutions for the conduction heat transfer from various idealized magma geometries (dikes, sills, and spheres) are obtained using either the Schwarz-Christoffel transformation theorem (dikes and sills) or the 'method of images' with superposition (spheres). Comparison of these analytically determined heat flux distributions with field data from active geothermal areas at Yellowstone, Avachinsky volcano, Kilauea Iki,

95

Quantitative Analysis of Reaction Front Geometry in Detonations  

E-Print Network [OSTI]

Quantitative Analysis of Reaction Front Geometry in Detonations F. Pintgen, and J.E. Shepherd Previous observations (Pintgen et al., 2003b, Pintgen, 2000) on the reaction zone struc- ture

Shepherd, Joe

96

Investigation of Created Fracture Geometry through Hydraulic Fracture Treatment Analysis  

E-Print Network [OSTI]

Successful development of shale gas reservoirs is highly dependent on hydraulic fracture treatments. Many questions remain in regards to the geometry of the created fractures. Production data analysis from some shale gas wells quantifies a much...

Ahmed, Ibraheem 1987-

2012-11-30T23:59:59.000Z

97

NOTES ON MACDONALD POLYNOMIALS AND THE GEOMETRY OF HILBERT SCHEMES  

E-Print Network [OSTI]

NOTES ON MACDONALD POLYNOMIALS AND THE GEOMETRY OF HILBERT SCHEMES MARK HAIMAN (mhaiman words: Symmetric functions, Macdonald polynomials, Hilbert schemes 2000 Mathematics Subject combinatorial problems we solve are (1) we prove the positivity conjecture for Macdonald polynomials, and (2) we

Haiman, Mark D.

98

Dimensions of Bivariate Spline Spaces and Algebraic Geometry  

E-Print Network [OSTI]

geometry. This dissertation follows the works of Lau and Stiller. They introduced the conformality conditions which lead to the machinery of sheaves and cohomology which provided a powerful type of generalization of linear algebra. First, we try to analyze...

Ko, Youngdeug

2010-07-14T23:59:59.000Z

99

Thermodynamics and Thermodynamic geometry of Park black hole  

E-Print Network [OSTI]

We study the thermodynamics and thermodynamic geometry of Park black hole in Ho\\v{r}ava gravity. By incorporating the ideas of differential geometry, we have investigated the thermodynamics using Weinhold geometry and Ruppeiner geometry. We have also analyzed it in the context of newly developed geometrothermodynamics(GTD). Divergence of specific heat is associated with the second order phase transition of black hole. Here in the context of Park black hole, both Weinhold's metric and Ruppeiner's metric well explain this phase transition. But these explanations depend on the choice of potential. Hence the Legendre invariant GTD is used, and with the true singularities in the curvature scalar, GTD well explain the second order phase transition. All these methods together give an exact idea of all the behaviors of the Park black hole thermodynamics.

Jishnu Suresh; Tharanath R; Nijo Varghese; V C Kuriakose

2014-03-19T23:59:59.000Z

100

Mechanical Equations on Bi-Para Conformal Geometry  

E-Print Network [OSTI]

This study is an extented analogue to conformal geometry of the paper given by [14]. Also, the geometric and physical results related to bi-para-conformal-dynamical systems are also presented.

Zeki Kasap; Mehmet Tekkoyun

2012-09-22T23:59:59.000Z

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

Geometry and Physics of Wrinkling E. Cerda1,2  

E-Print Network [OSTI]

elementary geometry and the physics of bending and stretching. Our main result is a set of simple scaling of the wrinkles by using the linearized in-plane elastic response and neglecting the bending resistance

Mahadevan, L.

102

Quantum phases of dipolar bosons in bilayer geometry  

E-Print Network [OSTI]

We investigate the quantum phases of hard-core dipolar bosons confined to a square lattice in a bilayer geometry. Using exact theoretical techniques, we discuss the many-body effects resulting from the pairing of particles ...

Safavi-Naini, Arghavan

103

Searching for higher-dimensional wormholes with noncommutative geometry  

Science Journals Connector (OSTI)

Noncommutative geometry, an offshoot of string theory, replaces pointlike structures with smeared objects and has recently been extended to higher dimensions. The purpose of this paper is to obtain wormhole solutions with this extended noncommutative geometry as a background. It is found through this investigation that wormhole solutions exist in the usual four, as well as in five dimensions, but they do not exist in higher-dimensional spacetimes.

Farook Rahaman; Safiqul Islam; P. K. F. Kuhfittig; Saibal Ray

2012-11-27T23:59:59.000Z

104

Transforming BIM to BEM: Generation of Building Geometry for the NASA Ames Sustainability Base BIM  

E-Print Network [OSTI]

Building Geometry for the NASA Ames Sustainability Base BIMBuilding Geometry for the NASA Ames Sustainability Base BIMusing the recently constructed NASA Ames Sustainability Base

O'Donnell, James T.

2014-01-01T23:59:59.000Z

105

Radio-frequency quadrupole vane-tip geometries  

SciTech Connect (OSTI)

Radio-frequency quadrupole (RFQ) linacs are becoming widely accepted in the accelerator community. They have the remarkable capability of simultaneously bunching low-energy ion beams and accelerating them to energies at which conventional accelerators can be used, accomplishing this with high-transmission efficiencies and low-emittance growths. The electric fields, used for radial focusing, bunching, and accelerating, are determined by the geometry of the vane tips. The choice of the best vane-tip geometry depends on considerations such as the peak surface electric field, per cent of higher multipole components, and ease of machining. We review the vane-tip geometry based on the ideal two-term potential function and briefly describe a method for calculating the electric field components in an RFQ cell with arbitrary vane-tip geometry. We describe five basic geometries and use the prototype RFQ design for the Fusion Materials Irradiation Test (FMIT) accelerator as an example to compare the characteristics of the various geometries.

Crandall, K.R.; Mills, R.S.; Wangler, T.P.

1983-01-01T23:59:59.000Z

106

Fatty acid analogs  

DOE Patents [OSTI]

In one aspect, a radioactively labeled analog of a fatty acid which is capable of being taken up by mammalian tissue and which exhibits an in vivo beta-oxidation rate below that with a corresponding radioactively labeled fatty acid.

Elmaleh, David R. (Newton Center, MA); Livni, Eli (Brookline, MA)

1985-01-01T23:59:59.000Z

107

Nucleic acid detection compositions  

DOE Patents [OSTI]

The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

Prudent, James R. (Madison, WI); Hall, Jeff G. (Madison, WI); Lyamichev, Victor I. (Madison, WI); Brow, Mary Ann (Madison, WI); Dahlberg, James L. (Madison, WI)

2008-08-05T23:59:59.000Z

108

Cleavage of nucleic acids  

DOE Patents [OSTI]

The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

Prudent, James R. (Madison, WI); Hall, Jeff G. (Madison, WI); Lyamichev, Victor L. (Madison, WI); Brow, Mary Ann D. (Madison, WI); Dahlberg, James E. (Madison, WI)

2007-12-11T23:59:59.000Z

109

Wiley 1977, pp. 267311. [25] H. Abelson and A. di Sessa, Turtle Geometry, MIT Press, 1980.  

E-Print Network [OSTI]

­ 12 ­ Wiley 1977, pp. 267­311. [25] H. Abelson and A. di Sessa, Turtle Geometry, MIT Press, 1980. It should also be a good antidote for mathophobia. Readers familiar with Turtle Geometry [25] may have. In fact Turtle Geometry is a computational geometry and the moving turtle is clearly a kinesthetic

Toussaint, Godfried T.

110

STANDARD OPERATING PROCEDURE ACIDS CONTAINING PHOSPHOROUS  

E-Print Network [OSTI]

12.1 STANDARD OPERATING PROCEDURE for ACIDS CONTAINING PHOSPHOROUS Location(s): ___________________________________________________ Chemical(s): Hypophosphorous acid, methylphosphonic acid, phosphonic acid, phosphoric acid, phosphorous

Pawlowski, Wojtek

111

Microorganisms for producing organic acids  

DOE Patents [OSTI]

Organic acid-producing microorganisms and methods of using same. The organic acid-producing microorganisms comprise modifications that reduce or ablate AcsA activity or AcsA homolog activity. The modifications increase tolerance of the microorganisms to such organic acids as 3-hydroxypropionic acid, acrylic acid, propionic acid, lactic acid, and others. Further modifications to the microorganisms increase production of such organic acids as 3-hydroxypropionic acid, lactate, and others. Methods of producing such organic acids as 3-hydroxypropionic acid, lactate, and others with the modified microorganisms are provided. Methods of using acsA or homologs thereof as counter-selectable markers are also provided.

Pfleger, Brian Frederick; Begemann, Matthew Brett

2014-09-30T23:59:59.000Z

112

Separation Nanotechnology of Diethylenetriaminepentaacetic Acid...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Nanotechnology of Diethylenetriaminepentaacetic Acid Bonded Magnetic Nanoparticles for Spent Nuclear Fuel. Separation Nanotechnology of Diethylenetriaminepentaacetic Acid Bonded...

113

Geometry of Cenozoic extensional faulting: Dixie Valley, Nevada | Open  

Open Energy Info (EERE)

Geometry of Cenozoic extensional faulting: Dixie Valley, Nevada Geometry of Cenozoic extensional faulting: Dixie Valley, Nevada Jump to: navigation, search OpenEI Reference LibraryAdd to library Journal Article: Geometry of Cenozoic extensional faulting: Dixie Valley, Nevada Abstract Precise definition of geometric relationships between individual basins and ranges may help to reveal the mechanical processes of Basin and Range Cenozoic extensional faulting at depth. Previous studies have attempted to identify simple horsts and grabens, tilted crustal blocks with planar faulting, or tilted crustal blocks with listric faulting in the shallow crust. Normal faults defining these crustal blocks may root (1) individually in the ductile lower crust, (2) in regional or local low-angle detachment faults, or (3) in igneous intrusions or decoupling surfaces

114

Evaluation of subsurface fracture geometry using fluid pressure response to  

Open Energy Info (EERE)

subsurface fracture geometry using fluid pressure response to subsurface fracture geometry using fluid pressure response to solid earth tidal strain Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Report: Evaluation of subsurface fracture geometry using fluid pressure response to solid earth tidal strain Details Activities (1) Areas (1) Regions (0) Abstract: The nature of solid earth tidal strain and surface load deformation due to the influence of gravitational forces and barometric pressure loading are discussed. The pore pressure response to these types of deformation is investigated in detail, including the cases of a confined aquifer intersected by a well and a discrete fracture intersected by a well. The integration of the tidal response method with conventional pump tests in order to independently calculate the hydraulic parameters of the

115

Optical reference geometry of the Kerr-Newman spacetimes  

E-Print Network [OSTI]

Properties of the optical reference geometry related to Kerr-Newman black-hole and naked-singularity spacetimes are illustrated using embedding diagrams of their equatorial plane. Among all inertial forces defined in the framework of the optical geometry, just the centrifugal force plays a fundamental role in connection to the embedding diagrams because it changes sign at the turning points of the diagrams. The limits of embeddability are given, and it is established which of the photon circular orbits hosted the by Kerr-Newman spacetimes appear in the embeddable regions. Some typical embedding diagrams are constructed, and the Kerr-Newman backgrounds are classified according to the number of embeddable regions of the optical geometry as well as the number of their turning points. Embedding diagrams are closely related to the notion of the radius of gyration which is useful for analyzing fluid rotating in strong gravitational fields.

Zden?k Stuchlk; Stanislav Hledk; Josef Jur?

2008-03-17T23:59:59.000Z

116

Torsional Newton-Cartan Geometry and Lifshitz Holography  

E-Print Network [OSTI]

We obtain the Lifshitz UV completion in a specific model for z=2 Lifshitz geometries. We use a vielbein formalism which enables identification of all the sources as leading components of well-chosen bulk fields. We show that the geometry induced from the bulk onto the boundary is a novel extension of Newton-Cartan geometry with a specific torsion tensor. We explicitly compute all the vevs including the boundary stress-energy tensor and their Ward identities. After using local symmetries/Ward identities the system exhibits 6+6 sources and vevs. The FG expansion exhibits, however, an additional free function which is related to an irrelevant operator whose source has been turned off. We show that this is related to a second UV completion.

Morten H. Christensen; Jelle Hartong; Niels A. Obers; Blaise Rollier

2014-09-19T23:59:59.000Z

117

On the isothermal geometry of corrugated graphene sheets  

E-Print Network [OSTI]

Variational geometries describing corrugated graphene sheets are proposed. The isothermal thermomechanical properties of these sheets are described by a 2-dimensional Weyl space. The equation that couples the Weyl geometry with isothermal distributions of the temperature of graphene sheets, is formulated. This material space is observed in a 3-dimensional orthogonal configurational point space as regular surfaces which are endowed with a thermal state vector field fulfilling the isothermal thermal state equation. It enables to introduce a non-topological dimensionless thermal shape parameter of non-developable graphene sheets. The properties of the congruence of lines generated by the thermal state vector field are discussed.

Andrzej Trzesowski

2013-12-17T23:59:59.000Z

118

On the material geometry of continuously defective corrugated graphene sheets  

E-Print Network [OSTI]

Geometrical objects describing the material geometry of continuously defective graphene sheets are introduced and their compatibility conditions are formulated. Effective edge dislocations embedded in the Riemann-Cartan material space and defined by their scalar density and by local Burgers vectors, are considered. The case of secondary curvature-type defects created by this distribution of dislocations is analysed in terms of the material space. The variational geometry of the material space closely related with the existence of a characteristic length parameter is proposed. The formula which describes, in a reference temperature, the influence of dislocations on the material Riemannian metric, is given.

Andrzej Trzesowski

2014-07-05T23:59:59.000Z

119

Revisiting galactic rotation curves given a noncommutative-geometry background  

E-Print Network [OSTI]

It was shown earlier by Rahaman et al. that a noncommutative-geometry background can account for galactic rotation curves without the need for dark matter. The smearing effect that characterizes noncommutative geometry is described by means of a Gaussian distribution intended to replace the Dirac delta function. The purpose of this paper is two-fold: (1) to account for the galactic rotation curves in a more transparent and intuitively more appealing way by replacing the Gaussian function by the simpler Lorentzian distribution proposed by Nozari and Mehdipour and (2) to show that the smearing effect is both a necessary and sufficient condition for meeting the stability criterion.

Kuhfittig, Peter K F

2014-01-01T23:59:59.000Z

120

On the isothermal geometry of corrugated graphene sheets  

E-Print Network [OSTI]

Variational geometries describing corrugated graphene sheets are proposed. The isothermal thermomechanical properties of these sheets are described by a 2-dimensional Weyl space. The equation that couples the Weyl geometry with isothermal distributions of the temperature of graphene sheets, is formulated. This material space is observed in a 3-dimensional orthogonal configurational point space as regular surfaces which are endowed with a thermal state vector field fulfilling the isothermal thermal state equation. It enables to introduce a non-topological dimensionless thermal shape parameter of non-developable graphene sheets. The properties of the congruence of lines generated by the thermal state vector field are discussed.

Andrzej Trzesowski

2014-12-22T23:59:59.000Z

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Reversible Acid Gas Capture  

SciTech Connect (OSTI)

Pacific Northwest National Laboratory scientist David Heldebrant demonstrates how a new process called reversible acid gas capture works to pull carbon dioxide out of power plant emissions.

Dave Heldebrant

2009-08-01T23:59:59.000Z

122

Reversible Acid Gas Capture  

ScienceCinema (OSTI)

Pacific Northwest National Laboratory scientist David Heldebrant demonstrates how a new process called reversible acid gas capture works to pull carbon dioxide out of power plant emissions.

Dave Heldebrant

2012-12-31T23:59:59.000Z

123

Stochastic Geometry of Classical and Quantum Ising Models  

E-Print Network [OSTI]

Stochastic Geometry of Classical and Quantum Ising Models Dmitry Ioffe Faculty of Industrial) and to the random current (RC) representation of classical and quantum Ising models via path integrals. No background in quantum statistical mechanics was assumed. In Section 1 familiar classical Ising models

124

Geometry of Singularities for the Steady Boussinesq Equations  

E-Print Network [OSTI]

Geometry of Singularities for the Steady Boussinesq Equations Russel E. Caflisch \\Lambda for singularities in the solution of the steady Boussinesq equations for two­dimensional, strat­ ified flow, singularities are analyzed for a related, but much simpler, system, the steady Boussinesq equations: u \\Delta

Soatto, Stefano

125

Some illustrations of information geometry in biology and physics  

E-Print Network [OSTI]

Some illustrations of information geometry in biology and physics C.T.J. Dodson School, is unstable in the formal sense, but it is passed through or hovered about by the observed process of the methodology through case studies: inhomogeneous statistical evolutionary rate processes for epidemics, amino

Dodson, C.T.J.

126

Connections on statistical manifolds of density operators by geometry of  

E-Print Network [OSTI]

of statistical manifolds, that is of manifolds whose points can be identified with density functions with respect to a certain measure µ. The classical references for the theory can be found in the books [1, 2, 4Connections on statistical manifolds of density operators by geometry of noncommutative Lp -spaces

Isola, Tommaso

127

Stroke Fragmentation based on Geometry Features and Hidden Markov Model  

E-Print Network [OSTI]

1 Stroke Fragmentation based on Geometry Features and Hidden Markov Model Guihuan Feng, Christian Viard-Gaudin, Technical Report, IRCCyN Nantes/IVC ABSTRACT Stroke fragmentation is one of the key steps in pen-based interaction. In this letter, we present a unified HMM-based stroke fragmentation technique

Paris-Sud XI, Université de

128

Computational analysis and the geometry of intracranial saccular aneurysms  

E-Print Network [OSTI]

Engineering ABSTRACT Computational Analysis and the Geometry of intracranial Saccular Aneurysms. (December 2001) Marissa Zainuddin Banatwala, B. S. , Texas AAM University Chair of Advisory Committee: Dr. Jay D. Humphrey intracranial saccular aneurysms... REVIEW. 2. 1. Clinical Indicators . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2. 2. Three-Dimensional Reconstruction. . . 2. 3. Curvature Calculations . . . . . . . . . . . . . . . . . . . . . , . . . . . . . . . . 5 . 7...

Banatwala, Marissa Zainuddin

2012-06-07T23:59:59.000Z

129

A Connection for Product Manifolds in Noncommutative Geometry  

Science Journals Connector (OSTI)

......4):351-9. 13 Dubois-Violette M. , Masson T. On the first-order...one hand, Joachim Cuntz and Daniel Quillen, in their seminal...463546. [11] Dubois-Violette, M. "Lectures on graded...Geometry 25 [12] Dubois-Violette, M., J. Madore, T. Masson......

Javier Lpez Pea

2008-01-01T23:59:59.000Z

130

Modelling and geometry optimisation of wave energy converters  

E-Print Network [OSTI]

Modelling and geometry optimisation of wave energy converters Adi Kurniawan Supervisors: Prof DIY Riding radical wave power" #12;#12;Any device will deliver some energyAny device will deliver some energy #12;What matters is the cost of energy Ultimate problem Given the waves, design a device

Nørvåg, Kjetil

131

Induction Generation Ostrowski Recognition Discrete geometry and numeration  

E-Print Network [OSTI]

Induction Generation Ostrowski Recognition Discrete geometry and numeration V. Berth´e LIRMM;Induction Generation Ostrowski Recognition A classical problem in Diophantine approximation How to approximate a line in R3 by points in Z3 ? How to define a discrete line in R3? #12;Induction Generation

132

Project Gutenberg's The Foundations of Geometry, by David Hilbert  

E-Print Network [OSTI]

Project Gutenberg's The Foundations of Geometry, by David Hilbert This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of the Project Gutenberg License included with this eBook or online at www

Corry, Scott

133

Functional Geometry Alignment and Localization of Brain Areas  

E-Print Network [OSTI]

Functional Geometry Alignment and Localization of Brain Areas Georg Langs, Polina Golland Computer@bwh.harvard.edu, lrigolo@bwh.harvard.edu agolby@bwh.harvard.edu Abstract Matching functional brain regions across. It is particularly difficult, but highly relevant, for patients with pathologies such as brain tumors, which can

Golland, Polina

134

Lane departure detection for improved road geometry estimation  

E-Print Network [OSTI]

vehicles is mea- sured using a vision system and a radar, whereas the shape of the road is measured using1 Lane departure detection for improved road geometry estimation Thomas B. Sch¨on Andreas Eidehall Fredrik Gustafsson Division of Automatic Control Vehicle Dynamics and Active Safety Link¨oping University

Schön, Thomas

135

The Siwaliks of western Nepal I. Geometry and kinematics  

E-Print Network [OSTI]

The Siwaliks of western Nepal I. Geometry and kinematics J.L. Mugniera, *, P. Leturmya , G. Masclea-western Nepal, and beneath 14.6 Ma sediments in mid-western Nepal, i.e., above the base of the Siwalik Group. Unconformities have been observed in the upper Siwalik member of western Nepal both on satellite images

Husson, Laurent

136

BUILDING COSMOLOGICAL MODELS VIA NONCOMMUTATIVE GEOMETRY MATILDE MARCOLLI  

E-Print Network [OSTI]

of theoretical high energy physics models that are capable of producing a range of predictions, bothBUILDING COSMOLOGICAL MODELS VIA NONCOMMUTATIVE GEOMETRY MATILDE MARCOLLI and cosmology to formulate testable predictions that can be confronted with the data. While model building

Marcolli, Matilde

137

Study of Influence of Electrode Geometry on Impedance Spectroscopy  

SciTech Connect (OSTI)

Electrochemical Impedance Spectroscopy (EIS) is a powerful and proven tool for analyzing AC impedance response. A conventional three electrode EIS method was used to perform the investigation in the present study. Saturated potassium chloride solution was used as the electrolyte and three different material rods were used as working electrodes. Different configurations of electrode area were exposed to the electrolyte as an active area to investigate electrode geometry effects. Counter to working electrode distance was also altered while keeping the working electrode effective area constant to explore the AC response dependence on the variation of ion travel distance. Some controlled experiments were done to validate the experimental setup and to provide a control condition for comparison with experimental results. A frequency range of 100 mHz to 1 MHz was used for all experiments. In our analysis, we have found a noteworthy influence of electrode geometry on AC impedance response. For all electrodes, impedance decreases with the increase of effective area of the electrolyte. High frequency impedance is not as dependent on geometry as low frequency response. The observed phase shift angle drops in the high frequency region with increased working electrode area, whereas at low frequency the reverse is true. Resistance and capacitive reactance both decrease with an increase of area, but resistance response is more pronounce than reactance. For lower frequencies, small changes in working area produce very distinctive EIS variations. Electrode material as well as geometry was systematically varied in the present study. From these and other studies, we hope to develop a fundamental foundation for understanding specific changes in local geometry in fuel cell (and other) electrodes as a method of designing local morphology for specific performance.

Ahmed, Riaz; Reifsnider, Kenneth L

2011-01-01T23:59:59.000Z

138

Controlling acid rain  

E-Print Network [OSTI]

High concentrations of sulfuric and nitric acid in raTn fn the northeastern USA are caused by the large scale combustion of fossil fuels within this region. Average precipitation acidity is pH 4.2, but spatial and temporal ...

Fay, James A.

1983-01-01T23:59:59.000Z

139

Geometry of non-supersymmetric three-charge bound states  

SciTech Connect (OSTI)

We study the smooth non-supersymmetric three-charge microstatesof Jejjala, Madden, Ross and Titchener using Kaluza-Klein reductions of the solutions to five and four dimensions. Our aim is to improve our understanding of the relation between these non-supersymmetric solutions and the well-studied supersymmetric cases. We find some surprising qualitative differences. In the five-dimensional description, the solution has orbifold fixed points which break supersymmetry locally, so the geometries cannot be thought of as made up of separate half-BPS centers. In the four-dimensional description, the two singularities in the geometry are connected by a conical singularity, which makes it impossible to treat them independently and assign unambiguous brane charges to these centers.

Gimon, Eric; Gimon, Eric G.; Levi, Thomas S.; Ross, Simon F.

2007-05-14T23:59:59.000Z

140

Interoperable mesh and geometry tools for advanced petascale simulations  

SciTech Connect (OSTI)

SciDAC applications have a demonstrated need for advanced software tools to manage the complexities associated with sophisticated geometry, mesh, and field manipulation tasks, particularly as computer architectures move toward the petascale. The Center for Interoperable Technologies for Advanced Petascale Simulations (ITAPS) will deliver interoperable and interchangeable mesh, geometry, and field manipulation services that are of direct use to SciDAC applications. The premise of our technology development goal is to provide such services as libraries that can be used with minimal intrusion into application codes. To develop these technologies, we focus on defining a common data model and datastructure neutral interfaces that unify a number of different services such as mesh generation and improvement, front tracking, adaptive mesh refinement, shape optimization, and solution transfer operations. We highlight the use of several ITAPS services in SciDAC applications.

Diachin, L; Bauer, A; Fix, B; Kraftcheck, J; Jansen, K; Luo, X; Miller, M; Ollivier-Gooch, C; Shephard, M; Tautges, T; Trease, H

2007-07-04T23:59:59.000Z

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

How effective is graphene nanopore geometry on DNA sequencing?  

E-Print Network [OSTI]

In this paper we investigate the effects of graphene nanopore geometry on homopolymer ssDNA pulling process through nanopore using steered molecular dynamic (SMD) simulations. Different graphene nanopores are examined including axially symmetric and asymmetric monolayer graphene nanopores as well as five layer graphene polyhedral crystals (GPC). The pulling force profile, moving fashion of ssDNA, work done in irreversible DNA pulling and orientations of DNA bases near the nanopore are assessed. Simulation results demonstrate the strong effect of the pore shape as well as geometrical symmetry on free energy barrier, orientations and dynamic of DNA translocation through graphene nanopore. Our study proposes that the symmetric circular geometry of monolayer graphene nanopore with high pulling velocity can be used for DNA sequencing.

Satarifard, Vahid; Ejtehadi, Mohammad Reza

2015-01-01T23:59:59.000Z

142

3D turtle geometry: artwork, theory, program equivalence and symmetry  

Science Journals Connector (OSTI)

We define a 3D variant of turtle graphics and present the theoretical foundations of 3D turtle geometry. This theory enables one to reason about open and closed 3D polygonal paths by means of algebraic calculations. In particular, we introduce several equivalence relations on turtle programs and theorems that define corresponding standard forms. Also we express the relationship between the symmetries of a 3D polygonal path and the symmetries of a generating turtle program in a suitable standard form. Finally, we discuss software tool support for 3D turtle geometry. Along the way, we present some artworks designed through 3D turtle graphics. These artworks have never been described in the literature before.

Tom Verhoeff

2010-01-01T23:59:59.000Z

143

A mechanical mode-stirred reverberation chamber with chaotic geometry  

E-Print Network [OSTI]

A previous research on multivariate approach to the calculation of reverberation chamber correlation matrices is used to calculate the number of independent positions in a mode-stirred reverberation chamber. Anomalies and counterintuitive behavior are observed in terms of number of correlated matrix elements with respect to increasing frequency. This is ascribed to the regular geometry forming the baseline cavity (screened room) of a reverberation chamber, responsible for localizing energy and preserving regular modes (bouncing ball modes). Smooth wall deformations are introduced in order to create underlying Lyapunov instability of rays and then destroy survived regular modes. Numerical full-wave simulations are performed for a reverberation chamber with corner hemispheres and (off-)center wall spherical caps. Field sampling is performed by moving a mechanical carousel stirrer. It is found that wave-chaos inspired baseline geometries improve chamber performances in terms of lowest usable frequencies and number of independent cavity realizations of mechanical stirrers.

Gabriele Gradoni; Franco Moglie; Valter Mariani Primiani

2014-07-06T23:59:59.000Z

144

Generalized quantum gravity condensates for homogeneous geometries and cosmology  

E-Print Network [OSTI]

We construct a generalized class of quantum gravity condensate states, that allows the description of continuum homogeneous quantum geometries within the full theory. They are based on similar ideas already applied to extract effective cosmological dynamics from the group field theory formalism, and thus also from loop quantum gravity. However, they represent an improvement over the simplest condensates used in the literature, in that they are defined by an infinite superposition of graph-based states encoding in a precise way the topology of the spatial manifold. The construction is based on the definition of refinement operators on spin network states, written in a second quantized language. The construction lends itself easily to be applied also to the case of spherically symmetric quantum geometries.

Daniele Oriti; Daniele Pranzetti; James P. Ryan; Lorenzo Sindoni

2015-01-05T23:59:59.000Z

145

Icosadeltahedral geometry of fullerenes, viruses and geodesic domes  

E-Print Network [OSTI]

I discuss the symmetry of fullerenes, viruses and geodesic domes within a unified framework of icosadeltahedral representation of these objects. The icosadeltahedral symmetry is explained in details by examination of all of these structures. Using Euler's theorem on polyhedra, it is shown how to calculate the number of vertices, edges, and faces in domes, and number of atoms, bonds and pentagonal and hexagonal rings in fullerenes. Caspar-Klug classification of viruses is elaborated as a specific case of icosadeltahedral geometry.

Antonio Siber

2007-11-22T23:59:59.000Z

146

2DBTOR: a toroidal geometry neutron diffusion code  

E-Print Network [OSTI]

particles, might lead to energy conversion efficiencies approaching 100%, since charged particles can possibly be directly converted to electricity. I. A The Fusion Process Fusion is essentially the process of two nuclei coming together to form one...; this can lead to costly and time consuming computations. More recently, computer programs have been developed to perform neutron transport calculations that are more suitable for toroidal geometry. One example of such a code is TRISMs, a two...

Hrabal, Craig Anthony

2012-06-07T23:59:59.000Z

147

A study of a cooling tower with variable packing geometries  

E-Print Network [OSTI]

of the Meohanioal Engineering Department~ for giving generously of his time, advioey and experi ense. STMKRY Three redwood packing styles -- rectangular~ square and triangular, having the same projected, area ? were tested under the same controlled conditions... of this wozk is to study the influence of the paoking geometries on water cooling tower performance oh raoteristics. To fulfill the purpose, thz ee different redwood paoking , . eometz'ies were tested and oompared. These ere z ectangular, square...

Azad, Abul Kalam

2012-06-07T23:59:59.000Z

148

Vehicle Technologies Office: 3-D Animation Shows Complex Geometry of Diesel  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

3-D Animation Shows 3-D Animation Shows Complex Geometry of Diesel Particulates to someone by E-mail Share Vehicle Technologies Office: 3-D Animation Shows Complex Geometry of Diesel Particulates on Facebook Tweet about Vehicle Technologies Office: 3-D Animation Shows Complex Geometry of Diesel Particulates on Twitter Bookmark Vehicle Technologies Office: 3-D Animation Shows Complex Geometry of Diesel Particulates on Google Bookmark Vehicle Technologies Office: 3-D Animation Shows Complex Geometry of Diesel Particulates on Delicious Rank Vehicle Technologies Office: 3-D Animation Shows Complex Geometry of Diesel Particulates on Digg Find More places to share Vehicle Technologies Office: 3-D Animation Shows Complex Geometry of Diesel Particulates on AddThis.com... 3-D Animation Shows Complex Geometry of Diesel Particulates

149

Structural Topology Optimization Using a Genetic Algorithm and a Morphological Representation of Geometry  

E-Print Network [OSTI]

This paper describes an intuitive way of defining geometry design variables for solving structural topology optimization problems using a genetic algorithm (GA). The geometry representation scheme works by defining a ...

Tai, Kang

150

An idealized molecular geometry library for refinement of poorly behaved molecular fragments with constraints  

Science Journals Connector (OSTI)

An idealized molecular geometry library has been created as a web site to be used for refinement of difficult structures with constrained fragment geometries. The library application is illustrated with a practical example.

Guzei, I.A.

2014-03-28T23:59:59.000Z

151

Numerical Investigation of the Effect of the Cathode Geometry on the Characteristics of an Electric Arc  

Science Journals Connector (OSTI)

The effect of the cathode geometry on the characteristics of an electric arc is treated. It is found that the characteristics of plasma in discharges with cathodes of different geometry (cone, ... . It is assumed...

R. M. Urusov; T. E. Urusova

152

Unification of Electromagnetism and Gravitation in the Framework of General Geometry  

E-Print Network [OSTI]

A new geometry, called General geometry, is constructed. It is proven that its the most simplest special case is geometry underlying Electromagnetism. Another special case is Riemannian geometry. Action for electromagnetic field and Maxwell equations are derived from curvature function of geometry underlying Electromagnetism. It is shown that equation of motion for a particle interacting with electromagnetic field coincides exactly with equation for geodesics of geometry underlying Electromagnetism. It is also shown that Electromagnetism can not be geometrized in the framework of Riemannian geometry. Using General Geometry we propose a unified model of electromagnetism and gravitation which reproduces Electromagnetism and Gravitation and predicts that electromagnetic field is a source for gravitational field. This theory is formulated in four dimensional spacetime and does not contain additional fields.

Shervgi Shahverdiyev

2005-07-05T23:59:59.000Z

153

Chlorophyll and acid rain  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Chlorophyll and acid rain Chlorophyll and acid rain Name: beachbum Status: N/A Age: N/A Location: N/A Country: N/A Date: Around 1993 Question: A while ago I read an article that stated that after a plant received acid rain, there seemed to be less of chlorophyll a and b in the plant. I was wondering where does the chlorophyll go and what is the actual process (cell structure affected?). Replies: I think that less chlorophyll being present would be more likely a result of less being produced. Plant cell constantly turn over cell material, it will also constantly produce more. So if one compares a plant not exposed to acid rain (presumably producing a normal amount of chlorophyll and the exposed plant then one sees that the exposed plant has less chlorophyll than the unexposed plant. I do not think I can answer the rest of your question.

154

Reactivity of Acid Generators  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Reactivity of Acid Generators for Chemically Amplified Resists with Reactivity of Acid Generators for Chemically Amplified Resists with Low-Energy Electrons Atsuro Nakano, Takahiro Kozawa, Seiichi Tagawa, Tomasz Szreder, James F. Wishart, Toshiyuki Kai and Tsutomu Shimokawa Jpn. J. Appl. Phys., 45, L197-L200 (2006). [Find paper at the Japanese Journal of Applied Physics] Abstract: In chemically amplified resists for ionizing radiations such as electron beams and extreme ultraviolet (EUV), low-energy electrons play an important role in the pattern formation processes. The reactivity of acid generators with low-energy electrons was evaluated using solvated electrons in tetrahydrofuran, which were generated by a pulsed electron beam. The rate constants of acid generators with the solvated electrons ranged from 0.6 to 1.9 x 1011 M-1s-1

155

(Acid rain workshop)  

SciTech Connect (OSTI)

The traveler presented a paper entitled Susceptibility of Asian Ecosystems to Soil-Mediated Acid Rain Damage'' at the Second Workshop on Acid Rain in Asia. The workshop was organized by the Asian Institute of Technology (Bangkok, Thailand), Argonne National Laboratory (Argonne, Illinois), and Resource Management Associates (Madison, Wisconsin) and was sponsored by the US Department of Energy, the United Nations Environment Program, the United Nations Economic and Social Commission for Asia and the Pacific, and the World Bank. Papers presented on the first day discussed how the experience gained with acid rain in North America and Europe might be applied to the Asian situation. Papers describing energy use projections, sulfur emissions, and effects of acid rain in several Asian countries were presented on the second day. The remaining time was allotted to discussion, planning, and writing plans for a future research program.

Turner, R.S.

1990-12-05T23:59:59.000Z

156

Fatty Acid Carcass Mapping  

E-Print Network [OSTI]

FATTY ACID CARCASS MAPPING A Thesis by STACEY NICOLE TURK Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE May 2008... Major Subject: Animal Science FATTY ACID CARCASS MAPPING A Thesis by STACEY NICOLE TURK Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE...

Turk, Stacey N.

2010-01-14T23:59:59.000Z

157

Geometry Optimization of Kringle 1 of Plasminogen Using the PM3  

E-Print Network [OSTI]

Geometry Optimization of Kringle 1 of Plasminogen Using the PM3 Semiempirical Method ANDREW D July 1999 ABSTRACT: The results of a geometry optimization on the 1226 atom Kringle 1 of plasminogen with a conjugate gradient density matrix search replacing the diagonalization step. The geometry was optimized

Schlegel, H. Bernhard

158

Integration of LED chip within patch antenna geometry for hybrid FSO/RF communication  

E-Print Network [OSTI]

Integration of LED chip within patch antenna geometry for hybrid FSO/RF communication J. Liao, A mode communi- cation transmitter using a LED integrated within the geometry of a planar patch antenna the geometry of the patch antenna to create a miniaturised LED/RF package. The RF channel can either work

Huang, Zhaoran "Rena"

159

The utilization of tricarboxylic acid cycle acids and the uptake of succinic acid by Neurospora crassa  

E-Print Network [OSTI]

THE UTILIZATION OF TRICARBOXYLIC ACID CYCLE ACIDS AND THE UPTAKE OF SUCCINIC ACID BY NEUROSPORA CRASSA A Thesis by PATTI LYNN GILLILAND Submitted to the Graduate College of Texas A&M University in partial fulfillment of the requirement... for the degree of MASTER OF SCIENCE August 1978 Ma) or Subject: Microbiology THE UTILIZATION OF TRICARBOXYLIC ACID CYCLE ACIDS AND THE UPTAKE OF SUCCINIC ACID BY NEUROSPORA CRASSA A Thesis by PATTI LYNN GILLILAND Approved as to style and content by...

Gilliland, Patti Lynn

2012-06-07T23:59:59.000Z

160

Focus Sheet | Hydrofluoric Acid Health hazards of hydrofluoric acid  

E-Print Network [OSTI]

Focus Sheet | Hydrofluoric Acid Health hazards of hydrofluoric acid Hydrofluoric acid (HF characterized by weight loss, brittle bones, anemia, and general ill health. Safe use If possible, avoid working to exposures. #12;Focus Sheet | Hydrofluoric Acid Environmental Health and Safety Environmental Programs Office

Wilcock, William

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

Implementing NCNP's 21st century geometry capability: requirements, issues, and problems  

SciTech Connect (OSTI)

A new geometry capability has been implemented in MCNP that permits the existence of an unstructured mesh with its legacy Constructive Solid Geometry (CSG) capability to form a hybrid geometry. This new feature enables the user to build complex 3-D models with Computer Aided Engineering (CAE) tools, such as Abaqus, and perform a neutronics analysis on the same geometry mesh that is used for thermo-mechanical analyses. This paper will present an overview of the issues and problems encountered in implementing the requirements for the hybrid geometry capability in MCNP.

Martz, Roger L [Los Alamos National Laboratory; Goorley, John T [Los Alamos National Laboratory

2009-01-01T23:59:59.000Z

162

Optical high acidity sensor  

DOE Patents [OSTI]

An apparatus and method for determining acid concentrations in solutions having acid concentrations of from about 0.1 Molar to about 16 Molar is disclosed. The apparatus includes a chamber for interrogation of the sample solution, a fiber optic light source for passing light transversely through the chamber, a fiber optic collector for receiving the collimated light after transmission through the chamber, a coating of an acid resistant polymeric composition upon at least one fiber end or lens, the polymeric composition in contact with the sample solution within the chamber and having a detectable response to acid concentrations within the range of from about 0.1 Molar to about 16 Molar, a measurer for the response of the polymeric composition in contact with the sample solution, and, a comparer of the measured response to predetermined standards whereby the acid molarity of the sample solution within the chamber can be determined. Preferably, a first lens is attached to the end of the fiber optic light source, the first lens adapted to collimate light from the fiber optic light source, and a second lens is attached to the end of the fiber optic collector for focusing the collimated light after transmission through the chamber.

Jorgensen, Betty S. (Jemez Springs, NM); Nekimken, Howard L. (Los Alamos, NM); Carey, W. Patrick (Lynnwood, WA); O'Rourke, Patrick E. (Martinez, GA)

1997-01-01T23:59:59.000Z

163

Quantum Corrections in String Compactifications on SU(3) Structure Geometries  

E-Print Network [OSTI]

We investigate quantum corrections to the classical four-dimensional low-energy effective action of type II string theory compactified on SU(3) structure geometries. Various methods previously developed for Calabi-Yau compactifications are adopted to determine - under some simple assumptions about the low-energy degrees of freedom - the leading perturbative corrections to the moduli space metrics in both alpha' and the string coupling constant. We find - in complete analogy to the Calabi-Yau case - that the corrections take a universal form dependent only on the Euler characteristic of the six-dimensional compact space.

Mariana Grana; Jan Louis; Ulrich Theis; Daniel Waldram

2014-12-05T23:59:59.000Z

164

Weak and Repulsive Casimir Force in Piston Geometries  

E-Print Network [OSTI]

We study the Casimir force in piston-like geometries semiclassically. The force on the piston is finite and physical, but to leading semiclassical approximation depends strongly on the shape of the surrounding cavity. Whereas this force is attractive for pistons in a parallelepiped with flat cylinder head, for which the semiclassical approximation by periodic orbits is exact, this approximation to the force on the piston vanishes for a semi-cylindrical head and becomes repulsive for a cylinder of circular cross section with a hemispherical head. In leading semiclassical approximation the sign of the force is related to the generalized Maslov index of short periodic orbits between the piston and its casing.

Martin Schaden; Liviu Mateescu

2007-05-23T23:59:59.000Z

165

Nucleic Acid Tools  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Nucleic Acid Tools Nucleic Acid Tools RNA 3D Motif Atlas, a representative collection of RNA 3D internal and hairpin loop motifs. Petrov, A.I., Zirbel, C.L., Leontis, N.B. (2013) Automated classification of RNA 3D motifs and the RNA 3D motif atlas. RNA. Non-redundant List of RNA-containing 3D structures. Leontis, N.B., & Zirbel, C.L. (2012) In Leontis, N. B., Westhof. E. (ed.), RNA 3D structure analysis and prediction. Springer Berlin Heidelberg Vol. 27, pp. 281-298. RNA Base Triple Atlas, a collection of motifs consisting of two RNA basepairs. Abu Almakarem, A.S., Petrov, A.I., Stombaugh, J., Zirbel, C.L. and Leontis, N.B. (2012) Comprehensive survey and geometric classification of base triples in RNA structures. Nucleic Acids Res, 40, 1407-1423. R3D Align, an application for detailed nucleotide to nucleotide

166

A Direct, Biomass-Based Synthesis of Benzoic Acid: Formic Acid-Mediated Deoxygenation of the Glucose-Derived Materials Quinic Acid and Shikimic Acid  

SciTech Connect (OSTI)

An alternative biomass-based route to benzoic acid from the renewable starting materials quinic acid and shikimic acid is described. Benzoic acid is obtained selectively using a highly efficient, one-step formic acid-mediated deoxygenation method.

Arceo, Elena; Ellman, Jonathan; Bergman, Robert

2010-05-03T23:59:59.000Z

167

Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters  

DOE Patents [OSTI]

A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

Moens, Luc (Lakewood, CO)

2003-06-24T23:59:59.000Z

168

Entanglement entropy and D1-D5 geometries  

Science Journals Connector (OSTI)

In conformal field theories (CFTs) with a gravitational antide Sitter (AdS) dual it is possible to calculate the entanglement entropy of a region A holographically by using the Ryu-Takayanagi formula. In this work we consider systems that are in a pure state that is not the vacuum. We study in particular the two-dimensional conformal field theory dual to type IIB string theory on AdS3S3T4 and focus on the 1/4-BPS states described holographically by the two-charge microstate geometries. We discuss a general prescription for the calculation of the entanglement entropy in these geometries that are asymptotically AdS3S3. In particular we study analytically the perturbative expansion for a single, short interval: we show that the first nontrivial terms in this expansion are consistent with the expected CFT structure and with previous results on the vacuum expectation values of chiral primary operators for the 1/4-BPS configurations.

Stefano Giusto and Rodolfo Russo

2014-09-04T23:59:59.000Z

169

Improving FAIMS Sensitivity using a Planar Geometry with Slit Interfaces  

SciTech Connect (OSTI)

Differential mobility spectrometry or field asymmetric waveform ion mobility spectrometry (FAIMS) is gaining broad acceptance for analyses of gas-phase ions, especially in conjunction with largely orthogonal separation methods such as mass spectrometry (MS) and/or conventional (drift tube) ion mobility spectrometry. In FAIMS, ions are filtered while passing through a gap between two electrodes that may have planar or curved (in particular, cylindrical) geometry. Despite substantial inherent advantages of the planar configuration and its universal acceptance in stand-alone FAIMS devices, commercial FAIMS/MS systems have employed curved FAIMS geometries that could be interfaced to MS more effectively. Here we report a new planar (p-) FAIMS design with slit-shaped entrance and exit apertures that substantially increase ion transmission in and out of the analyzer. The front slit interface effectively couples p-FAIMS to multi-emitter electrospray ionization (ESI) sources, improving greatly the ion current introduced to the device. The back slit interface increases the transmission of ribbon-shaped ion beams output by the p-FAIMS to downstream stages such as a MS. Overall, the ion signal in ESI/FAIMS/MS analyses is raised by over an order of magnitude without affecting the FAIMS resolution.

Mabrouki, Ridha B.; Kelly, Ryan T.; Prior, David C.; Shvartsburg, Alexandre A.; Tang, Keqi; Smith, Richard D.

2009-09-01T23:59:59.000Z

170

Variable trim compressor a new approach to variable compressor geometry  

Science Journals Connector (OSTI)

ABSTRACT Variable compressor geometry can be employed irrespective of the combustion process selected. It provides the capability of improving response behavior, reducing fuel consumption or cutting exhaust emissions from exhaust-gas turbocharged engines. Previous concepts on variable compressor geometries have been based on using inlet guide vanes to impart a swirl motion to the air that is fed to the compressor with the ultimate aim of enhancing the angle at which the flow of air enters the blade channel. This paper shows an inlet guide configuration that is based on a different operating principle. The inlet guide assembly shown here is designed in a way that minimizes any pressure losses even at high flow rates. Numerical studies were carried out using CFD to test the system's sensitivity. Based on these studies, a rigid conical element was then produced and the potential for increasing efficiency (up to 7% points) and shifting the surge line (up to 33%) verified on a turbocharger test bench. Finally, a design configuration is presented for a variable system.

P. Grigoriadis; S. Mller; A. Benz; M. Sens

2012-01-01T23:59:59.000Z

171

Pauli graph and finite projective lines/geometries  

E-Print Network [OSTI]

The commutation relations between the generalized Pauli operators of N-qudits (i. e., N p-level quantum systems), and the structure of their maximal sets of commuting bases, follow a nice graph theoretical/geometrical pattern. One may identify vertices/points with the operators so that edges/lines join commuting pairs of them to form the so-called Pauli graph P_{p^N} . As per two-qubits (p = 2, N = 2) all basic properties and partitionings of this graph are embodied in the geometry of the symplectic generalized quadrangle of order two, W(2). The structure of the two-qutrit (p = 3, N = 2) graph is more involved; here it turns out more convenient to deal with its dual in order to see all the parallels with the two-qubit case and its surmised relation with the geometry of generalized quadrangle Q(4, 3), the dual of W(3). Finally, the generalized adjacency graph for multiple (N > 3) qubits/qutrits is shown to follow from symplectic polar spaces of order two/three. The relevance of these mathematical concepts to mutually unbiased bases and to quantum entanglement is also highlighted in some detail.

Michel R. P. Planat; Metod Saniga

2007-03-16T23:59:59.000Z

172

Nucleotide and deduced amino acid sequence of the nonstructural phosphoprotein, NS2, of bluetongue virus serotype 17: comparison to two isolates of serotype 10  

Science Journals Connector (OSTI)

The nucleotide sequence of bluetongue virus (BTV) serotype 17 segment 8 from North America (NA) coding for the nonstructural phosphoprotein, NS2, was determined. This segment contains 1125 base pairs and codes for a protein of 40,581 daltons containing 354 amino acids with a net charge of ?8.5 at pH 7.0. The carboxyl terminal portion of the protein is very hydrophilic and has a high degree of potential ?-helix. Serine is the major, if not the exclusive, phosphorylated amino acid residue and ten of the twenty serine residues present in NS2 are found in consensus phosphorylation sites. Comparison of the nucleotide sequence of BTV-17NA segment 8 with the sequence of BTV-10NA and BTV-10 South Africa (SA) revealed a greater degree of homology between different serotypes within the same geographical area i.e., 17NA and 10NA, than between isolates of the same serotype located in different areas i.e., 10NA and 10SA. The same homology relationship as above was found at the amino acid level.

Marvin J. Grubman; Marla Zellner; Siba Samal

1990-01-01T23:59:59.000Z

173

Acidizing of Sandstone Reservoirs Using HF and Organic Acids  

E-Print Network [OSTI]

Mud acid, which is composed of HCl and HF, is commonly used to remove the formation damage in sandstone reservoirs. However, many problems are associated with HCl, especially at high temperatures. Formic-HF acids have served as an alternative...

Yang, Fei

2012-10-19T23:59:59.000Z

174

Creating geometry and mesh models for nuclear reactor core geometries using a lattice hierarchy-based approach.  

SciTech Connect (OSTI)

Nuclear reactor cores are constructed as rectangular or hexagonal lattices of assemblies, where each assembly is itself a lattice of fuel, control, and instrumentation pins, surrounded by water or other material that moderates neutron energy and carries away fission heat. We describe a system for generating geometry and mesh for these systems. The method takes advantage of information about repeated structures in both assembly and core lattices to simplify the overall process. The system allows targeted user intervention midway through the process, enabling modification and manipulation of models for meshing or other purposes. Starting from text files describing assemblies and core, the tool can generate geometry and mesh for these models automatically as well. Simple and complex examples of tool operation are given, with the latter demonstrating generation of meshes with 12 million hexahedral elements in less than 30 minutes on a desktop workstation, using about 4 GB of memory. The tool is released as open source software as part of the MeshKit mesh generation library.

Tautges, T. J.; Jain, R.; Mathematics and Computer Science

2010-01-01T23:59:59.000Z

175

Acid Placement in Acid Jetting Treatments in Long Horizontal Wells  

E-Print Network [OSTI]

In the Middle East, extended reach horizontal wells (on the order of 25,000 feet of horizontal displacement) are commonly acid stimulated by jetting acid out of drill pipe. The acid is jetted onto the face of the openhole wellbore as the drill pipe...

Sasongko, Hari

2012-07-16T23:59:59.000Z

176

Acid placement and coverage in the acid jetting process  

E-Print Network [OSTI]

Many open-hole acid treatments are being conducted by pumping acid through jetting ports placed at the end of coiled tubing or drill pipe. The filter-cake on the bore-hole is broken by the jet; the acid-soluble material is dissolved, creating...

Mikhailov, Miroslav I.

2009-05-15T23:59:59.000Z

177

The Standard Model in Noncommutative Geometry and Morita equivalence  

E-Print Network [OSTI]

We discuss some properties of the spectral triple $(A_F,H_F,D_F,J_F,\\gamma_F)$ describing the internal space in the noncommutative geometry approach to the Standard Model, with $A_F=\\mathbb{C}\\oplus\\mathbb{H}\\oplus M_3(\\mathbb{C})$. We show that, if we want $H_F$ to be a Morita equivalence bimodule between $A_F$ and the associated Clifford algebra, two terms must be added to the Dirac operator; we then study its relation with the orientability condition for a spectral triple. We also illustrate what changes if one considers a spectral triple with a degenerate representation, based on the complex algebra $B_F=\\mathbb{C}\\oplus M_2(\\mathbb{C})\\oplus M_3(\\mathbb{C})$.

Francesco D'Andrea; Ludwik Dabrowski

2014-12-31T23:59:59.000Z

178

Electricity as a Natural Property of Riemannian Geometry  

Science Journals Connector (OSTI)

Field equations of a Riemannian geometry which can be deduced from a Hamiltonian principle have the following general property: Due to the conservation law of Einstein's curvature tensor Rik there appears in the integration of the field equations a free vectorial function ?i, determined, however, by the conservation law. This has been shown by applying a mathematical formulation of Mach's principle to the extremely weak deformation of a given arbitrary metric. Specifying the Hamiltonian function by the evident condition of gauge invariance this free vectorial function ?i has all the fundamental properties of the electro-magnetic vector potential: the law of continuity is strictly fulfilled everywhere, the potential equation is to be deduced in first approximation and also the Lorentz' ponderomotive force of a particle. In this theory the material particle is to be considered as a proper solution of the field equations.

Cornelius Lanczos

1932-02-15T23:59:59.000Z

179

Continuously proportional variable geometry turbocharger system and method of control  

SciTech Connect (OSTI)

This patent describes a system for performing closed loop control of a variable geometry turbocharger (VGT) utilized in an internal combustion engine. It comprises VGT actuator means for changing the geometric configuration of the VGT in response to an actuator control signal; sensor means for detecting selected engine operating parameters including a VGT actuator parameter and an engine intake manifold parameter, and generating output signals representative thereof; means for outputting a target VGT actuator parameter value and a target intake manifold parameter valve based on the values of selected sensor means output signals; means for determining whether the engine is in a steady state or a transient state of operation based on the values of selected sensor means output signals; and means for developing an actuator control signal based on one of the target parameter values as a function of the determined engine operating state.

Younessi, R.; Rini, G.T.

1992-06-23T23:59:59.000Z

180

Gyrokinetic treatment of GAE modes in cylindrical geometry  

SciTech Connect (OSTI)

Global Alfven eigenmodes (GAEs) are investigated in cylindrical geometry both analytically and numerically. These modes are of particular importance in low-shear magnetic configurations, such as modern stellarators. Analytical treatment starts from the linearised equations of gyrokinetics and yields a generalized dispersion relation for GAE with FLR and kinetic effects taken into account, which is demonstrated to reduce to the well-known MHD counterpart in the appropriate limit. An eigenvalue code is developed to solve the dispersion relation, which is used to investigate the kinetic analogs of GAE modes in various regimes with different beta. On the other hand, GAE modes are simulated with global linear particle-in-cell (PIC) electromagnetic gyrokinetic code following self-consistent time evolution of electromagnetic fields and plasma. GAE modes are observed and their damping rate agrees with predictions made by the eigenvalue code.

Eremin, D. [Max-Plank-Institut fuer Plasmaphysik, EUROATOM-Association, D-17491 Greifswald (Germany)

2006-11-30T23:59:59.000Z

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Black hole initial data with a horizon of prescribed intrinsic and extrinsic geometry  

E-Print Network [OSTI]

The purpose of this work is to construct asymptotically flat, time symmetric initial data with an apparent horizon of prescribed intrinsic and extrinsic geometry. To do this, we use the parabolic partial differential equation for prescribing scalar curvature. In this equation the horizon geometry is contained within the freely specifiable part of the metric. This contrasts with the conformal method in which the geometry of the horizon can only be specified up to a conformal factor.

Brian Smith

2010-06-14T23:59:59.000Z

182

Transforming BIM to BEM: Generation of Building Geometry for the NASA Ames Sustainability Base BIM  

E-Print Network [OSTI]

requirements for modeling of building geometry for energyrequired by building energy modeling (BEM) tools. This isbe applied to all building energy modeling tools but to date

O'Donnell, James T.

2014-01-01T23:59:59.000Z

183

Pantothenic acid biosynthesis in zymomonas  

DOE Patents [OSTI]

Zymomonas is unable to synthesize pantothenic acid and requires this essential vitamin in growth medium. Zymomonas strains transformed with an operon for expression of 2-dehydropantoate reductase and aspartate 1-decarboxylase were able to grow in medium lacking pantothenic acid. These strains may be used for ethanol production without pantothenic acid supplementation in seed culture and fermentation media.

Tao, Luan; Tomb, Jean-Francois; Viitanen, Paul V.

2014-07-01T23:59:59.000Z

184

Carboxylic acid sorption regeneration process  

DOE Patents [OSTI]

Carboxylic acids are sorbed from aqueous feedstocks into an organic liquid phase or onto a solid adsorbent. The acids are freed from the sorbent phase by treating it with aqueous alkylamine thus forming an alkylammonium carboxylate which is dewatered and decomposed to the desired carboxylic acid and the alkylamine.

King, C. Judson (Kensington, CA); Poole, Loree J. (Baton Rouge, LA)

1995-01-01T23:59:59.000Z

185

Carboxylic acid sorption regeneration process  

DOE Patents [OSTI]

Carboxylic acids are sorbed from aqueous feedstocks into an organic liquid phase or onto a solid adsorbent. The acids are freed from the sorbent phase by treating it with aqueous alkylamine thus forming an alkylammonium carboxylate which is dewatered and decomposed to the desired carboxylic acid and the alkylamine. 10 figs.

King, C.J.; Poole, L.J.

1995-05-02T23:59:59.000Z

186

SIMULATION OF GEOMETRY AND SHADOW EFFECTS IN 3D ORGANIC POLYMER SOLAR CELLS  

E-Print Network [OSTI]

levels of Solar panels and new production capacity is driving solar PV prices lower and thereby, bringingSIMULATION OF GEOMETRY AND SHADOW EFFECTS IN 3D ORGANIC POLYMER SOLAR CELLS OF THE THESIS Simulation of Geometry and Shadow Effects in 3D Organic Polymer Solar Cells by Mihir Prakashbhai

Kassegne, Samuel Kinde

187

2D and 3D Visibility in Discrete Geometry: an application to discrete geodesic paths  

E-Print Network [OSTI]

1 2D and 3D Visibility in Discrete Geometry: an application to discrete geodesic paths D discrete geodesic paths in discrete domain with obstacles. This allows us to introduce a new geodesic metric in discrete geometry. Keywords: discrete visibility, geodesic path, distance transform, discrete

Boyer, Edmond

188

Turtle Geometry in Computer Graphics and Computer Aided Design Ron Goldman, Scott Schaefer, Tao Ju  

E-Print Network [OSTI]

Turtle Geometry in Computer Graphics and Computer Aided Design Ron Goldman, Scott Schaefer, Tao Ju@cs.rice.edu, sschaefe@rice.edu, jutao@cs.rice.edu Abstract: LOGO is a programming language incorporating turtle graphics, relaxation methods and subdivision schemes from elementary notions in turtle geometry and turtle programming

Schaefer, Scott

189

BRUHAT-TITS BUILDINGS AND ANALYTIC GEOMETRY BERTRAND RMY, AMAURY THUILLIER AND ANNETTE WERNER  

E-Print Network [OSTI]

BRUHAT-TITS BUILDINGS AND ANALYTIC GEOMETRY BERTRAND R?MY, AMAURY THUILLIER AND ANNETTE WERNER Abstract: This paper provides an overview of the theory of Bruhat-Tits buildings. Besides, we explain how Bruhat-Tits buildings can be realized inside Berkovich spaces. In this way, Berkovich analytic geometry

Paris-Sud XI, Université de

190

Adsorptive Membranes vs. Resins for Acetic Acid Removal from Biomass Hydrolysates  

SciTech Connect (OSTI)

Acetic acid is a compound commonly found in hemicellulosic hydrolysates. This weak acid strongly influences the bioconversion of sugar containing hydrolysates. Previous investigators have used anion exchange resins for acetic acid removal from different hemicellulosic hydrolysates. In this study, the efficiency of an anion exchange membrane was compared to that of an anion exchange resin, for acetic acid removal from a DI water solution and an acidic hemicellulose hydrolysate pretreated using two different methods. Ion exchange membranes and resins have very different geometries. Here the performance of membranes and resins is compared using two dimensionless parameters, the relative mass throughput and chromatographic bed number. The relative mass throughput arises naturally from the Thomas solution for ion exchange. The results show that the membrane exhibit better performance in terms of capacity, and loss of the desired sugars. In addition acetic acid may be eluted at a higher concentration from the membrane thus leading to the possibility of recovery and re-use of the acetic acid.

Han, B.; Carvalho, W.; Canilha, L.; da Silva, S. S.; e Silva, J. B. A.; McMillan, J. D.; Wickramasinghe, S. R.

2006-01-01T23:59:59.000Z

191

Collision Geometry and Flow in Uranium+Uranium Collisions  

E-Print Network [OSTI]

Using event-by-event viscous fluid dynamics to evolve fluctuating initial density profiles from the Monte-Carlo Glauber model for U+U collisions, we report a "knee"-like structure in the elliptic flow as a function of collision centrality, located near 0.5% centrality as measured by the final charged multiplicity. This knee is due to the preferential selection of tip-on-tip collision geometries by a high-multiplicity trigger. Such a knee structure is not seen in the STAR data. This rules out the two-component MC-Glauber model for initial energy and entropy production. An enrichment of tip-tip configurations by triggering solely on high-multiplicity in the U+U collisions thus does not work. On the other hand, using the Zero Degree Calorimeters (ZDCs) coupled with event-shape engineering, we identify the selection purity of body-body and tip-tip events in the full-overlap U+U collisions. With additional constraints on the asymmetry of the ZDC signals one can further increases the probability of selecting tip-tip events in U+U collisions.

Andy Goldschmidt; Zhi Qiu; Chun Shen; Ulrich Heinz

2015-02-02T23:59:59.000Z

192

Collision Geometry and Flow in Uranium+Uranium Collisions  

E-Print Network [OSTI]

Using event-by-event viscous fluid dynamics to evolve fluctuating initial density profiles from the Monte-Carlo Glauber model for U+U collisions, we report a "knee"-like structure in the elliptic flow as a function of collision centrality, located near 0.5% centrality as measured by the final charged multiplicity. This knee is due to the preferential selection of tip-on-tip collision geometries by a high-multiplicity trigger. Such a knee structure is not seen in the STAR data. This rules out the two-component MC-Glauber model for initial energy and entropy production. An enrichment of tip-tip configurations by triggering solely on high-multiplicity in the U+U collisions thus does not work. On the other hand, using the Zero Degree Calorimeters (ZDCs) coupled with event-shape engineering, we identify the selection purity of body-body and tip-tip events in the full-overlap U+U collisions. With additional constraints on the asymmetry of the ZDC signals one can further increases the probability of selecting tip-ti...

Goldschmidt, Andy; Shen, Chun; Heinz, Ulrich

2015-01-01T23:59:59.000Z

193

Nucleic acid detection methods  

DOE Patents [OSTI]

The invention relates to methods for rapidly determining the sequence and/or length a target sequence. The target sequence may be a series of known or unknown repeat sequences which are hybridized to an array of probes. The hybridized array is digested with a single-strand nuclease and free 3{prime}-hydroxyl groups extended with a nucleic acid polymerase. Nuclease cleaved heteroduplexes can be easily distinguish from nuclease uncleaved heteroduplexes by differential labeling. Probes and target can be differentially labeled with detectable labels. Matched target can be detected by cleaving resulting loops from the hybridized target and creating free 3-hydroxyl groups. These groups are recognized and extended by polymerases added into the reaction system which also adds or releases one label into solution. Analysis of the resulting products using either solid phase or solution. These methods can be used to detect characteristic nucleic acid sequences, to determine target sequence and to screen for genetic defects and disorders. Assays can be conducted on solid surfaces allowing for multiple reactions to be conducted in parallel and, if desired, automated. 18 figs.

Smith, C.L.; Yaar, R.; Szafranski, P.; Cantor, C.R.

1998-05-19T23:59:59.000Z

194

NA Standards | Valence Geometries | Nitrog. Bases Table 1  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Table 1: References for Nitrogenous Base Structures Table 1: References for Nitrogenous Base Structures used in Lester Clowney, Shri C. Jain, A. R. Srinivasan, John Westbrook, Wilma K. Olson, and Helen M. Berman. "Geometric Parameters in Nucleic Acids: Nitrogenous Bases. (1996) J. Am. Chem. Soc. 118, 519-529. Cytosine -------------------------------------------------------------------------- CSD ID Compound Reference -------------------------------------------------------------------------- acytid alpha-cytidine Post, M.L., et al. Biochim. Biophys. Acta, 1977, 479, 133 bivvil 2',3'-O-(tetraisopropyl-1,3-disiloxanediyl)-cytidine Hoogendorp J.D and Romers, C Acta Cryst., 1982, B38, 2738 bofwoi 2'-deoxy-2'-fluorocytidine dihydrate Marck, C., et al. J. Mol. Struct., 1982, 82, 77

195

Acidic gas capture by diamines  

DOE Patents [OSTI]

Compositions and methods related to the removal of acidic gas. In particular, the present disclosure relates to a composition and method for the removal of acidic gas from a gas mixture using a solvent comprising a diamine (e.g., piperazine) and carbon dioxide. One example of a method may involve a method for removing acidic gas comprising contacting a gas mixture having an acidic gas with a solvent, wherein the solvent comprises piperazine in an amount of from about 4 to about 20 moles/kg of water, and carbon dioxide in an amount of from about 0.3 to about 0.9 moles per mole of piperazine.

Rochelle, Gary (Austin, TX); Hilliard, Marcus (Missouri City, TX)

2011-05-10T23:59:59.000Z

196

Geometry and development of relay ramps in normal fault systems  

SciTech Connect (OSTI)

Normal fault zones play a major role in the development of basins and in the migration and trapping of hydrocarbons. The mapping of normal fault systems using seismic data requires careful correlation of faults on adjacent sections, a procedure that often leads to the interpretation of faults as having long, continuous, sinuous traces. Recent work involving detailed mapping of fault traces, first by using land exposures but more recently using three-dimensional seismics, has demonstrated that faults are usually made up of many overstepping segments, linked by areas of complex deformation, termed transfer zones or relay ramps. Relay ramps occur between normal fault segments that overstep in map view. The geometry and evolution of exposure-scale relay ramps are described from the Somerset coast, England, and are compared with larger scale ramps from elsewhere. Relay ramps can be classified into four groups based on the degree of interaction and linkage between the overstepping segments; these groups are interpreted as being evolutionary stages. In stage 1, the segments do not interact. Stage 2 involves the reorientation of bedding between two interacting faults to produce a relay ramp. In stage 3, connecting fractures start to break the relay ramp. Stage 4 is when the relay ramp is destroyed to produce a single fault that has an along-strike bend. These evolutionary stages can develop through time, but they can also be seen spatially. A branch line between normal faults or an along-strike bend may represent a stage 4 relay, with progressively earlier stages occurring updip or downdip. Characteristic variability in displacement-distance profiles for fault segments and linked faults accompanies the interaction and linkage processes. Displacement transfer by relay ramps is accompanied by steep displacement gradients along fault segments at oversteps. Relay ramps often contribute to a minimum in total fault displacement at a linkage point. 47 refs., 16 figs.

Peacock, D.C.P. (Univ. of Southampton (United Kingdom) Univ. of Plymouth, Devon (United Kingdom)); Sanderson, D.J. (Univ. of Southampton (United Kingdom))

1994-02-01T23:59:59.000Z

197

Movable geometry and eigenvalue search capability in the MC21 Monte Carlo code  

SciTech Connect (OSTI)

A description of a robust and flexible movable geometry implementation in the Monte Carlo code MC21 is described along with a search algorithm that can be used in conjunction with the movable geometry capability to perform eigenvalue searches based on the position of some geometric component. The natural use of the combined movement and search capability is searching to critical through variation of control rod (or control drum) position. The movable geometry discussion provides the mathematical framework for moving surfaces in the MC21 combinatorial solid geometry description. A discussion of the interface between the movable geometry system and the user is also described, particularly the ability to create a hierarchy of movable groups. Combined with the hierarchical geometry description in MC21 the movable group framework provides a very powerful system for inline geometry modification. The eigenvalue search algorithm implemented in MC21 is also described. The foundations of this algorithm are a regula falsi search though several considerations are made in an effort to increase the efficiency of the algorithm for use with Monte Carlo. Specifically, criteria are developed to determine after each batch whether the Monte Carlo calculation should be continued, the search iteration can be rejected, or the search iteration has converged. These criteria seek to minimize the amount of time spent per iteration. Results for the regula falsi method are shown, illustrating that the method as implemented is indeed convergent and that the optimizations made ultimately reduce the total computational expense. (authors)

Gill, D. F.; Nease, B. R.; Griesheimer, D. P. [Bettis Atomic Power Laboratory, PO Box 79, West Mifflin, PA 15122 (United States)

2013-07-01T23:59:59.000Z

198

Separation of americium and europium from solutions of nitric and perchloric acid using dipicolinic acid diamides  

Science Journals Connector (OSTI)

Extraction of nitric acid, perchloric acid, americium, and europium with dialkyldiarylamides of 2,6-pyridinecarboxylic (dipicolinic) acid in polar fluorinated solvents (diluents) was analysed. Among the extrac...

M.Yu. Alyapyshev; V. A. Babain; I. V. Smirnov

2006-01-01T23:59:59.000Z

199

Separation of americium and europium from solutions of nitric and perchloric acid using dipicolinic acid diamides  

Science Journals Connector (OSTI)

Extraction of nitric acid, perchloric acid, americium, and europium with dialkyldiarylamides of 2,6-pyridinecarboxylic (dipicolinic) acid in polar fluorinated solvents (diluents) was analysed. Among the extrac...

M. Yu. Alyapyshev; V. A. Babain; I. V. Smirnov

2006-12-01T23:59:59.000Z

200

TABASCO: A single molecule, base-pair resolved gene expression simulator  

E-Print Network [OSTI]

Background Experimental studies of gene expression have identified some of the individual molecular components and elementary reactions that comprise and control cellular behavior. Given our current understanding of gene ...

Kosuri, Sriram

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Ethylene Production from Linolenic Acid  

Science Journals Connector (OSTI)

... and Mapson1 have shown that linolenic 1 J acid may serve as a precursor of ethylene. The possi -bility that the ... . The possi -bility that the ethylene that is evolved from plants arises from linolenic acid was investigated by determining the relationship ...

F. B. ABELES

1966-04-02T23:59:59.000Z

202

Photochemical Studies on Xanthurenic Acid  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Photochemical Studies on Xanthurenic Acid Photochemical Studies on Xanthurenic Acid J. E. Roberts, J. F. Wishart, L. Martinez, C. F. Chignell Photochem.Photobiol. 72, 467-471 (2000) Abstract: The tryptophan metabolite xanthurenic acid has been isolated from aged human cataractous lenses. The photophysical properties of xanthurenic acid were examined to determine if it is a potential chromophore for age-related cataractogenesis. We found that xanthurenic acid produces singlet oxygen (F*= 0.17; CD3OD) with the same efficiency as the lenticular chromophore N-formyl kynurenine and quenches singlet oxygen at a rate similar to other tryptophan metabolites (2.1 x 107 M-1 s-1; CD3OD) found in the eye. As the mechanisms of induction of cataracts may also involve redox reactions, the interactions of hydrated electrons (e-aq), the azide radical

203

Simulation and visualization of fields and energy flows in electric circuits with idealized geometries  

E-Print Network [OSTI]

This thesis develops a method to simulate and visualize the fields and energy flows in electric circuits, using a simplified physical model based on an idealized geometry. The physical models combine and extend previously ...

Ohannessian, Mesrob I., 1981-

2005-01-01T23:59:59.000Z

204

THE StageTools PACKAGE FOR CREATING GEOMETRY FOR THE WEB  

E-Print Network [OSTI]

THE StageTools PACKAGE FOR CREATING GEOMETRY FOR THE WEB DAVIDE P. CERVONE Abstract. A number- ically for use on the web, or recorded on traditional video tape. Together, these modules form a powerful

Cervone, Davide P.

205

Fracturing pressures and near-well fracture geometry of arbitrarily oriented and horizontal wells  

SciTech Connect (OSTI)

The hydraulic fracturing of arbitrarily oriented and horizontal wells is made challenging by the far more complicated near-well fracture geometry compared to that of conventional vertical wells. This geometry is important both for hydraulic fracture propagation and the subsequent post-treatment well performance. Fracture tortuosity of arbitrarily oriented and horizontal wells is likely to cause large initiation pressures and reduction in the fracture widths. This paper presents a comprehensive study of the effects of important variables, including the principal stresses, wellbore orientation, and perforation configuration on fracture geometry. Initiation pressures, the contact between arbitrarily oriented wells and the fracture plane, and the near-well fracture geometry are determined and discussed. This study also shows that because of the near-well stress concentration the fracture width at the wellbore is always smaller than the maximum fracture width. This can have important consequences during hydraulic fracturing.

Chen, Z.; Economides, M.J.

1995-12-31T23:59:59.000Z

206

Variable geometry exhaust manifold turbocharging system for an 8-cylinder marine diesel engine  

Science Journals Connector (OSTI)

The variable geometry exhaust manifold (VGEM) turbocharging system can realize the switch between two charging modes by the switching valve, and it can give a good performance both at the high load operation and ...

Lei Shi; Shaoming Wang; Kangyao Deng; Yi Cui

2012-06-01T23:59:59.000Z

207

The applicability and accuracy of computer modeling in regards to acoustical scattering by a complex geometry  

E-Print Network [OSTI]

The intent of the investigation is to try to characterize the nature of scattered acoustical energy off of the face of a concrete masonry unit with an atypical geometry. The nature of the tests conducted would be in ...

Elliot, William J., S.B. Massachusetts Institute of Technology

2005-01-01T23:59:59.000Z

208

Automatically Recovering Geometry and Texture from Large Sets of Calibrated Images  

E-Print Network [OSTI]

Three-dimensional models which contain both geometry and texture have numerous applications such as urban planning, physical simulation, and virtual environments. A major focus of computer vision (and recently graphics) ...

Mellor, J.P.

1999-10-22T23:59:59.000Z

209

Finite-geometry models of electric field noise from patch potentials in ion traps  

E-Print Network [OSTI]

We model electric field noise from fluctuating patch potentials on conducting surfaces by taking into account the finite geometry of the ion trap electrodes to gain insight into the origin of anomalous heating in ion traps. ...

Low, Guang Hao

210

Finite-geometry models of electric field noise from patch potentials in ion traps  

SciTech Connect (OSTI)

We model electric field noise from fluctuating patch potentials on conducting surfaces by taking into account the finite geometry of the ion trap electrodes to gain insight into the origin of anomalous heating in ion traps. The scaling of anomalous heating rates with surface distance d is obtained for several generic geometries of relevance to current ion trap designs, ranging from planar to spheroidal electrodes. The influence of patch size is studied both by solving Laplace's equation in terms of the appropriate Green's function as well as through an eigenfunction expansion. Scaling with surface distance is found to be highly dependent on the choice of geometry and the relative scale between the spatial extent of the electrode, the ion-electrode distance, and the patch size. Our model generally supports the d{sup -4} dependence currently found by most experiments and models, but also predicts geometry-driven deviations from this trend.

Low, Guang Hao [MIT-Harvard Center for Ultracold Atoms, Department of Physics, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139 (United States); Department of Physics, Cavendish Laboratory, J. J. Thomson Avenue, Cambridge, CB3 0HE (United Kingdom); Herskind, Peter F.; Chuang, Isaac L. [MIT-Harvard Center for Ultracold Atoms, Department of Physics, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139 (United States)

2011-11-15T23:59:59.000Z

211

Transverse electrokinetic and microfluidic effects in micro-patterned channels: lubrication analysis for slab geometries  

E-Print Network [OSTI]

Off-diagonal (transverse) effects in micro-patterned geometries are predicted and analyzed within the general frame of linear response theory, relating applied presure gradient and electric field to flow and electric current. These effects could contribute to the design of pumps, mixers or flow detectors. Shape and charge density modulations are proposed as a means to obtain sizeable transverse effects, as demonstrated by focusing on simple geometries and using the lubrication approximation.

Armand Ajdari

2001-01-29T23:59:59.000Z

212

Integration-by-parts identities from the viewpoint of differential geometry  

E-Print Network [OSTI]

We present a new method to construct integration-by-part (IBP) identities from the viewpoint of differential geometry. Vectors for generating IBP identities are reformulated as differential forms, via Poincar\\'{e} duality. Using the tools of differential geometry and commutative algebra, we can efficiently find differential forms which generate on-shell IBP relation without doubled propagator. Various $D=4$ two-loop examples are presented.

Yang Zhang

2014-08-18T23:59:59.000Z

213

Effect of pore geometry in porous media on the miscibility of crude oil and carbon dioxide  

E-Print Network [OSTI]

EFFECT OF PORE GEOMETRY IN POROUS MEDIA ON THE MISCIBILITY OF CRUDE OIL AND CARBON DIOXIDE A Thesis by HAMED SARKHOSH Submitted to the Graduate College of Texas AIM University in partial fulfillment of the requirement for the degree... of MASTER OF SCIENCE May 1977 Major Subject: Petroleum Engineering EFFECT OF PORE GEOMETRY IN POROUS MEDIA ON THE MISCIBILITY OF CRUDE OIL AND CARBON DIOXIDE A Thesis by HAMED SARKHOSH Approved as to styie and content by Chai, an of Committee Head...

Sarkhosh, Hamed

1977-01-01T23:59:59.000Z

214

Supersymmetry and noncommutative geometry Part III: The noncommutative supersymmetric Standard Model  

E-Print Network [OSTI]

In a previous paper we developed a formalism to construct (potentially) supersymmetric theories in the context of noncommutative geometry. We apply this formalism to explore the existence of a noncommutative version of the minimal supersymmetric Standard Model (MSSM). We obtain the exact particle content of the MSSM and identify (in form) its interactions but conclude that their coefficients are such that the standard action functional used in noncommutative geometry is in fact not supersymmetric.

Wim Beenakker; Walter D. van Suijlekom; Thijs van den Broek

2014-09-21T23:59:59.000Z

215

Resonance and fractal geometry Johann Bernoulli Institute for Mathematics and Computer Science  

E-Print Network [OSTI]

;Devil's staircase -0.6 -0.4 -0.2 0 0.2 0.4 0.6 -0.4 -0.2 0 0.2 0.4 rotation number mean rotationResonance and fractal geometry Henk Broer Johann Bernoulli Institute for Mathematics and Computer space non-resonance fractal geometry Cantor set, topologically small (nowhere dense) positive Lebesgue

Broer, H.W.

216

Treatment of acid mine wastewaters  

SciTech Connect (OSTI)

Acid mine drainage often results from the oxidation sulfide minerals to form sulfuric acid. As a consequence, high concentrations of metals in the both the suspended and dissolved state result from the low pH water. This paper discusses several of the more common treatment methods for acid mine drainage including the use of chemical precipitation agents, pH correction agents, filtration methods, and biodegradation methods. Advanced treatment technologies are also briefly described and include microfiltration, reverse osmosis, ion exchange, and electrodialysis.

Hayward, D.; Barnard, R.

1993-06-01T23:59:59.000Z

217

Naphthenic acid corrosion literature survey  

SciTech Connect (OSTI)

Naphthenic acid corrosion is a growing concern for refineries processing crudes containing high levels of naphthenic acid. Due to this concern initiatives in place to better understand the mechanism of corrosion for mitigating the corrosion. During the 1996 Fall Corrosion Group, organized existing literature relevant to the literature search. Committee Week, NACE International many refineries have and evaluate methods T-8 Refining Industry a task group, T-8-22, to perform a review and compilation of naphthenic acid corrosion. This paper provides a summary of the literature research.

Babaian-Kibala, E. [Nalco/Exxon Energy Chemicals, Sugar Land, TX (United States); Nugent, M.J. [Tosco Refining Co., Linden, NJ (United States)

1999-11-01T23:59:59.000Z

218

Geometry of hydrogen bonds formed by lipid bilayer nitroxide probes : A high frequency pulsed ENDOR/EPR study.  

SciTech Connect (OSTI)

Solvent effects on magnetic parameters of nitroxide spin labels in combination with side-directed spin-labeling EPR methods provide very useful means for elucidating polarity profiles in lipid bilayers and mapping local electrostatic effects in complex biomolecular systems. One major contributor to these solvent effects is the hydrogen bonds that could be formed between the nitroxide moiety and water and/or the available hydroxyl groups. Here, formation of hydrogen bonds between a lipid bilayer spin probe 5-doxyl stearic acid, 5DSA and hydrogen-bond donors has been studied using high-frequency (HF) pulsed ENDOR and EPR. A hydrogen-bonded deuteron was directly detected in HF ENDOR (130 GHz) spectra of 5DSA dissolved in several deuterated alcohols, while the characteristic signal was absent in nonpolar toluene-d{sub 8}. The length of the hydrogen bond, 1.74 {+-} 0.06 {angstrom}, and its geometry were found to be essentially the same for all four alcohols studied, indicating that nearly identical hydrogen bonds have been formed regardless of the solvent dielectric constant. This strengthens a hypothesis that HF EPR spectra are exclusively sensitive to formation of hydrogen bonds and could be used for probing the hydrogen-bond network in complex biomolecular assemblies and lipid bilayers with site-directed spin-labeling methods.

Smirnova, T. I.; Smirnov, A. I.; Pachtchenko, S.; Poluektov, O. G.; Chemistry; North Carolina State Univ.

2007-01-01T23:59:59.000Z

219

Asphaltene damage in matrix acidizing  

E-Print Network [OSTI]

This work addresses the problem of asphaltene deposition that occurs during acid treatments of oil reservoirs. Asphaltenes are present to some degree in most hydrocarbons. Due to the molecular weight of the components these asphaltenes are more...

Hinojosa, Roberto Antonio

2012-06-07T23:59:59.000Z

220

Factors controlling naphthenic acid corrosion  

SciTech Connect (OSTI)

A laboratory study was conducted to elucidate the influence of chemical and physical parameters on corrosion of type 1018 carbon steel (CS, UNS G10180) and 5% Cr-0.5% Mo steel in oils containing naphthenic acids (NAs) for application to crude oil refinery systems. Effects of test duration, temperature, and acid concentration were assessed for a range of single acids of varying carbon numbers and for NA mixtures in mineral oil (MO) and in heavy vacuum gas oil (HGVO). In addition, a limited study of the effect of hydrogen sulfide (H{sub 2}S) addition to the acid-oil mixture was conducted. Use of the total acid number (TAN) as a measure of corrosiveness of a crude oil was discredited further. For the same TAN value, molecular size and structure of the acid were shown to have an important influence. Tests conducted in HGVO showed lower corrosion rates than in MO, suggesting inhibition caused by S species in the oil or the steric hindrance of naphtheno-aromatic acids. In oil containing the mixture of NAs, the corrosion rate of type 1018 CS was lower than that for 5% Cr-0.5% Mo steel. The 0.1% H{sub 2}S that passed through the acid-oil mixtures had an inhibiting effect on corrosion. Predicting corrosiveness of a crude oil from the measurement of TAN, distribution of NA composition, and S content and form was particularly challenging. The simple tests used were informative, but further work will be required to establish a standard test method that can provide an adequate ranking of crudes.

Turnbull, A. [National Physical Lab., Teddington (United Kingdom); Slavcheva, E. [Bulgarian Academy of Sciences, Sofia (Bulgaria); Shone, B. [Ty Isa, Nr Mold (United Kingdom)

1998-11-01T23:59:59.000Z

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

NDB Site Map  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Site map NDB Home Search Structures Search DNA Search RNA Advanced Search Nucleic acid tools RNA 3D motif atlas Non-redundant lists RNA base triples atlas WebFR3D R3D Align Contact NDB Mailing Address About NDB NDB Members Goal References Publications Site map Tools Software Standards Standard Reference Supplementary Information Ideal Geometries X-PLOR Parameters Valence Geometries RNA Ontology Consortium mmCIF Resources PDBML Resources Education Introduction to Nucleic Acids: DNA Definition of terms RNA Base Pair Families RNA Base-Phosphate Families Base Stacking Interactions Non Redundant list Equivalence classes RNA 3D Motifs Relative Frequency Introduction to Nucleic Acids: RNA Nucleic Acid Highlight (PDB): DNA DNA Polymerase Nucleosome Transfer RNA RNA Polymerase Self-splicing RNA

222

October 2001 NDB Newsletter  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

THE NUCLEIC ACID DATABASE NEWSLETTER THE NUCLEIC ACID DATABASE NEWSLETTER October 2001, Volume 5, Number 1 1. A Standard Reference Frame for the Description of Nucleic Acid Base-Pair Geometry Published 2. NDB Chapter in International Tables Published 1. Standard Reference Frame Published The paper "A Standard Reference Frame for the Description of Nucleic Acid Base-Pair Geometry" has been published in the Journal of Molecular Biology (2001; 313, pp. 229 - 237). This document is available from the NDB at http://ndbserver.rutgers.edu/NDB_news/ and from the Journal of Molecular Biology. The standardization of these parameters was the subject of the Tsukuba Workshop on Nucleic Acid Structure and Interactions that was organized by the NDB and the Structural Biology Centre and held at the Structural Biology Centre in Tsukuba, Japan on January 12-14, 1999. The meeting was funded by the COE program of the Science and Technology Agency, Japan and the CREST program of the Japan Science and Technology Corporation. The meeting was organized by Masashi Suzuki of the National Institute of Bioscience and Human-Technology and Helen M. Berman and Wilma K. Olson of the Nucleic Acid Database Project (supported by National Science Foundation (USA).

223

Fault and joint geometry at Raft River geothermal area, Idaho | Open Energy  

Open Energy Info (EERE)

and joint geometry at Raft River geothermal area, Idaho and joint geometry at Raft River geothermal area, Idaho Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Report: Fault and joint geometry at Raft River geothermal area, Idaho Details Activities (1) Areas (1) Regions (0) Abstract: Raft River geothermal reservoir is formed by fractures in sedimentary strata of the Miocene and Pliocene Salt Lake Formation. The fracturing is most intense at the base of the Salt Lake Formation, along a decollement that dips eastward at less than 5 0 on top of metamorphosed Precambrian and Lower Paleozoic rocks. Core taken from less than 200 m above the decollement contains two sets of normal faults. The major set of faults dips between 50 0 and 70 0. These faults occur as conjugate pairs that are bisected by vertical extension fractures. The second set of faults

224

Overview of Geometry Representation in Monte Carlo Codes Ronald P. Kensek  

National Nuclear Security Administration (NNSA)

Overview of Geometry Representation Overview of Geometry Representation in Monte Carlo Codes Ronald P. Kensek Brian C. Franke Thomas W. Laub Leonard J. Lorence Matthew R. Martin Sandia National Laboratories Steve Warren Kansas State University Joint Russian-American Five-Laboratory Conference on Computational Mathematics / Physics Vienna, Austria June 19-23, 2005 Sandia is a multiprogram laboratory operated by Sandia Corporation, a Lockheed Martin Company, for the United States National Nuclear Security Administration and the Department of Energy under contract DE-AC04-94AL85000. 2 Problem Setup: Engineering designs CG vs. CAD Combinatorial Geometry (CG) * Engineering designs are not typically created in this format * No general automatic translation from CAD to CG yet exists * Problem setup is difficult: Creation

225

Influence of geometry and topology of quantum graphs on their nonlinear optical properties  

Science Journals Connector (OSTI)

We analyze the nonlinear optics of quasi-one-dimensional quantum graphs and manipulate their topology and geometry to generate nonlinearities in a simple system approaching the fundamental limits of the first and second hyperpolarizabilities. We explore a huge configuration space in order to determine whether the fundamental limits may be approached for specific topologies, independent of molecular details, when the geometry is manipulated to maximize the intrinsic response. Changes in geometry result in smooth variations of the nonlinearities. Topological changes between geometrically similar systems cause profound changes in the nonlinear susceptibilities that include a discontinuity due to abrupt changes in the boundary conditions. We demonstrate the same universal scaling behavior for quantum graphs that is predicted for general quantum nonlinear optical systems near their fundamental limits, indicating that our results for quantum graphs may reflect general structure-property relationships for globally optimized nonlinear optical systems.

Rick Lytel; Shoresh Shafei; Julian H. Smith; Mark G. Kuzyk

2013-04-17T23:59:59.000Z

226

Rheological control on the initial geometry of the Raft River detachment  

Open Energy Info (EERE)

Rheological control on the initial geometry of the Raft River detachment Rheological control on the initial geometry of the Raft River detachment fault and shear zone, western United States Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Journal Article: Rheological control on the initial geometry of the Raft River detachment fault and shear zone, western United States Details Activities (1) Areas (1) Regions (0) Abstract: The strain, exhumation history, and field orientation of a well-exposed shear zone and detachment fault in the Raft River Mountains of northwestern Utah, a Cordilleran metamorphic core complex, have been studied to determine the kinematics of ductile shearing and initial orientations of the shear zone and detachment fault. Mapping and strain and kinematic analysis indicate that the top-to-the-east Raft River shear zone

227

Specific amino acid substitutions in bacterioopsin: replacement of a restriction fragment in the structural gene by synthetic DNA fragments containing altered codons  

SciTech Connect (OSTI)

To study the mechanism of light-dependent proton translocation by bacteriorhodopsin, we have introduced single-codon changes in the gene so as to produce the following specific amino acid substitutions in the protein: Tyr-185 to Phe, Pro-186 to Leu, Trp-189 to Phe, Ser-193 to Ala, and Glu-194 to Gln. The strategy involved replacement of a 62-base-pair restriction fragment by synthetic DNA duplexes containing the modified nucleotide sequences. This required a unique restriction site (Xho I) at Ile-203 which was created by oligonucleotide-directed point mutagenesis. The six DNA duplexes corresponding to the modified native and mutant restriction fragments were all prepared by DNA ligase-catalyzed joining of chemically synthesized deoxyribooligonucleotides. The bacterioopsin expression plasmids reconstructed by using the synthetic DNA fragments were characterized by restriction analysis and DNA sequence determination. An extremely rapid, efficient, and general method for purification of the synthetic oligonucleotides and of DNA fragments was developed. 32 references, 6 figures.

Lo, K.M.; Jones, S.S.; Hackett, N.R.; Khorana, H.G.

1984-04-01T23:59:59.000Z

228

Method for production of petroselinic acid and OMEGA12 hexadecanoic acid in transgenic plants  

DOE Patents [OSTI]

The present invention relates to a process for producing lipids containing the fatty acid, petroselinic acid, in plants. The production of petroselinic acid is accomplished by genetically transforming plants which do not normally accumulate petroselinic acid with a gene for a {omega}12 desaturase from another species which does normally accumulate petroselinic acid. 19 figs.

Ohlrogge, J.B.; Cahoon, E.B.; Shanklin, J.; Somerville, C.R.

1995-07-04T23:59:59.000Z

229

Method for production of petroselinic acid and OMEGA12 hexadecanoic acid in transgenic plants  

DOE Patents [OSTI]

The present invention relates to a process for producing lipids containing the fatty acid petroselinic acid in plants. The production of petroselinic acid is accomplished by genetically transforming plants which do not normally accumulate petroselinic acid with a gene for a .omega.12 desaturase from another species which does normally accumulate petroselinic acid.

Ohlrogge, John B. (Okemos, MI); Cahoon, Edgar B. (Lansing, MI); Shanklin, John (Upton, NY); Somerville, Christopher R. (Okemos, MI)

1995-01-01T23:59:59.000Z

230

Sandstone Acidizing Using Chelating Agents and their Interaction with Clays  

E-Print Network [OSTI]

Sandstone acidizing has been carried out with mud acid which combines hydrochloric acid and hydrofluoric acid at various ratios. The application of mud acid in sandstone formations has presented quite a large number of difficulties like corrosion...

George, Noble Thekkemelathethil 1987-

2013-01-09T23:59:59.000Z

231

Canonical transformation for trapped/passing guiding-center orbits in axisymmetric tokamak geometry  

E-Print Network [OSTI]

The generating function for the canonical transformation from the parallel canonical coordinates $(p_{\\|},s)$ to the action-angle coordinates $(J,\\zeta)$ for trapped/passing guiding-center orbits in axisymmetric tokamak geometry is presented. Drawing on the analogy between the phase-space portraits of the librating/rotating pendulum and the trapped/passing guiding-center orbits, the generating function is expressed in terms of the Jacobi zeta function, which can then readily be used to obtain an explicit expression for the bounce-center transformation for trapped-particles in axisymmetric tokamak geometry.

Brizard, Alain J

2014-01-01T23:59:59.000Z

232

Geometry and Electronic Structure of Cl on the Cu {001} Surface  

Science Journals Connector (OSTI)

The atomic geometry of Cu{001}c(22)-Cl has been determined by surface extended x-ray-absorption fine structure to consist of a simple Cl overlayer in fourfold Cu hollows with a (2.37 0.02)- bond length. With use of this geometry, self-consistent electronic structure calculations were performed and compared with angle-resolved photoemission data, giving excellent agreement for the position and dispersion of several Cl-induced surface states and resonances. These results have resolved previously reported discrepancies for the Ag{001}c(22)-Cl system.

P. H. Citrin, D. R. Hamann, L. F. Mattheiss, and J. E. Rowe

1982-12-06T23:59:59.000Z

233

New syntheses of aminoalkylphosphonic acids  

E-Print Network [OSTI]

NEW SYNTHESES OF AMINOALKYLPHOSPHON1C ACIDS A Thesis by John Frederick DeBardeleben, Jr. Su'bmitted to the Graduate School of the Agricultural and Mechanical College of Texas in partial fulfillment of the requirements for the degree of MASTER... OF SCIENCE August 196$ Major Subject: Chemistry NEW SYNTHESES OF AMINOALKYLPHOSPHONIC ACIDS A Thesis BY John Frederick DeBardeleben, Jr. Approved as to style and content hy: (Chairman of Committee) iJ C wc+'. A-c-~-' & (Head of Department...

DeBardeleben, John Frederick

2012-06-07T23:59:59.000Z

234

Kinetic Study on the Acid-Catalyzed Hydrolysis of Cellulose to Levulinic Acid  

Science Journals Connector (OSTI)

A variety of interesting bulk chemicals is accessible by the acid-catalyzed hydrolysis of cellulose. An interesting example is levulinic acid, a versatile precursor for fuel additives, polymers, and resins. A detailed kinetic study on the acid-catalyzed ...

B. Girisuta; L. P. B. M. Janssen; H. J. Heeres

2007-02-13T23:59:59.000Z

235

Acid Catalysis in Modern Organic  

E-Print Network [OSTI]

catalyst for organic synthesis". That is the starting sentence of this book by Yamamoto and Ishihara, which follows their earlier book "Lewis Acids in Organic Synthesis (2000)", and covers the new developments book that should be available in every well-equipped chemistry library. It will certainly be helpful

Snyder, Scott A.

236

PEMFC ELECTROCHEMISTRY: SIMULATION OF NONEQUILIBRIUM SURFACE CHEMISTRY ON 3-DIMENSIONAL GEOMETRIES  

E-Print Network [OSTI]

based catalysts are investigated to provide a better understanding of the cathode overpotential. We in transportation [1]. Carbon-supported platinum catalysts are com- monly used in the catalyst layer of PEMFC duePEMFC ELECTROCHEMISTRY: SIMULATION OF NONEQUILIBRIUM SURFACE CHEMISTRY ON 3-DIMENSIONAL GEOMETRIES

Pitsch, Heinz

237

Kerr-Schild geometry from cosmology to microworld and space-time structure  

Science Journals Connector (OSTI)

The Kerr-Schild KS geometry is linked tightly with the auxiliary flat Minkowski background. Nevertheless, it describes many curved space-times and the related physical models, starting from cosmology and black holes to the microworld of the spinning ... Keywords: Bubble Models, Extended Electron, Higgs Field, Kerr-Schild Metric, Semi-Closed Universe, Solitons, Twistors, Vacuum

Alexander Burinskii

2013-01-01T23:59:59.000Z

238

A comparative study of the i-mode in stellarator and tokamak geometries  

E-Print Network [OSTI]

A comparative study of the i-mode in stellarator and tokamak geometries J. Anderson, T. Rafiq, M the anomalous transport in present tokamaks. An advanced fluid model is applied for the ion physics whereas and the perpendicular wavenumber( )k on different magnetic surfaces in stellarator and tokamak equilibria. Quantitative

239

Differential Geometry and its Applications 3 (1993) 265-284 North-Holland  

E-Print Network [OSTI]

of Lagrangian and Legendrian 2-web Serge Tabachnikov Department of Mathematical Sciences, University of Arkansas Tabachnikov S., Geometry of Lagrangian and Legendrian 2-web, Diff. Geom. Appl. 3 (1993) 265-284. Abstract: Four types of web structures are considered: a I-web with Lagrangian leaves in a symplectic manifold

Tabachnikov, Sergei

240

Neutron Noise Calculations in Hexagonal Geometry and Comparison with Analytical Solutions  

E-Print Network [OSTI]

Neutron Noise Calculations in Hexagonal Geometry and Comparison with Analytical Solutions Hoai Nam Abstract ­ This paper presents the development of a neutronic and kinetic solver for neutron noise cal and several groups of delayed neutron precursors allowing the solutions of forward and adjoint problems

Demazière, Christophe

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Long time evolution of train dynamics with respect to track geometry  

E-Print Network [OSTI]

Long time evolution of train dynamics with respect to track geometry N. Lestoillea,b , C. Soizea to maintain a high level of safety and comfort in the high speed trains. We propose a computational stochastic experimental data basis. The nonlinear stochastic dynamics of the train excited by track irregularities

Paris-Sud XI, Université de

242

A focusing-geometry small-angle neutron scattering instrument with a magnetic neutron lens  

Science Journals Connector (OSTI)

A focusing-geometry small-angle neutron scattering (FSANS) instrument with a magnetic neutron lens based on an extended Halbach-type sextupole magnet has been constructed and tested. A minimum value of the measurable range, , of ?-1 could be achieved by the FSANS instrument using a neutron wavelength ? with for the full width at half maximum.

Oku, T.

2007-02-23T23:59:59.000Z

243

Compact fluorescent lamp using horizontal and vertical insulating septums and convective venting geometry  

DOE Patents [OSTI]

A novel design is described for a compact fluorescent lamp, including a lamp geometry which will increase light output and efficacy of the lamp in a base down operating position by providing horizontal and vertical insulating septums positioned in the ballast compartment of the lamp to provide a cooler coldspot. Selective convective venting provides additional cooling of the ballast compartment. 9 figs.

Siminovitch, M.

1998-02-10T23:59:59.000Z

244

Non-Commutative Geometry in Higher Dimensional Quantum Hall Effect as A-Class Topological Insulator  

E-Print Network [OSTI]

We clarify relations between the higher dimensional quantum Hall effect and A-class topological insulator. In particular, we elucidate physical implications of the higher dimensional non-commutative geometry in the context of A-class topological insulator. This presentation is based on arXiv:1403.5066.

Kazuki Hasebe

2014-08-04T23:59:59.000Z

245

Non-Commutative Geometry in Higher Dimensional Quantum Hall Effect as A-Class Topological Insulator  

E-Print Network [OSTI]

We clarify relations between the higher dimensional quantum Hall effect and A-class topological insulator. In particular, we elucidate physical implications of the higher dimensional non-commutative geometry in the context of A-class topological insulator. This presentation is based on arXiv:1403.5066.

Hasebe, Kazuki

2014-01-01T23:59:59.000Z

246

Simulation of Biological Flow and Transport in Complex Geometries using Embedded Boundary /  

E-Print Network [OSTI]

multiscale flow and transport in complex biological systems based on algorithms and software infrastructure developed under the SciDAC APDEC CET. The foundation of this work is a new hybrid fluid-particle method the constitutive behavior of polymer fluids. Complex flow environment geometries are represented on Cartesian grids

247

Measuring the Influence of Grain-Boundary Misorientation on Thermal Groove Geometry in Ceramic Polycrystals  

E-Print Network [OSTI]

Measuring the Influence of Grain-Boundary Misorientation on Thermal Groove Geometry in Ceramic. The width and depth of the thermal grooves formed by these same grain bound- aries were also measured of the grain-boundary misorientation and thermal groove ge- ometry leads to the observation that grain

Rohrer, Gregory S.

248

A PRIMER ON RIEMANNIAN GEOMETRY AND STOCHASTIC ANALYSIS ON PATH SPACES  

E-Print Network [OSTI]

A PRIMER ON RIEMANNIAN GEOMETRY AND STOCHASTIC ANALYSIS ON PATH SPACES BRUCE K. DRIVER Abstract for the first lecture which was held at University of Zürich. Contents 1. Summary of ETH talk contents 2 2 of California, San Diego . La Jolla, CA 92093-0112 . 1 #12;2 BRUCE K. DRIVER 5.1. Tangent spaces and Riemannian

Driver, Bruce

249

Homogenization of a Catalyst Layer Model for Periodically Distributed Pore Geometries in PEM Fuel Cells  

Science Journals Connector (OSTI)

......Distributed Pore Geometries in PEM Fuel Cells Markus Schmuck 1 Peter Berg 2 Correspondence...particular, polymer electrolyte fuel cells might become future power sources...research, see [3]. The CL in PEM fuel cells is comprised of a complex multiphase......

Markus Schmuck; Peter Berg

2013-01-01T23:59:59.000Z

250

USE OF VARIOUS DEVICE GEOMETRIES TO IMPROVE THE PERFORMANCE OF CdTe DETECTORS (*)  

E-Print Network [OSTI]

343 USE OF VARIOUS DEVICE GEOMETRIES TO IMPROVE THE PERFORMANCE OF CdTe DETECTORS (*) K. ZANIO. - The most direct method of increasing the resolution of CdTe gamma ray and x-ray detectors is to increase of Environmental and Biomedical Research. doped CdTe. Devices do not polarize as those having blocking contacts

Paris-Sud XI, Université de

251

Turbulent Flow Analysis and Coherent Structure Identification in Experimental Models with Complex Geometries  

E-Print Network [OSTI]

through the core of an annular pebble bed VHTR. The complex geometry of the core and the highly turbulent nature of the coolant flow passing through the gaps of fuel pebbles make this case quite challenging. In this experiment, a high frequency Hot Wire...

Amini, Noushin

2012-02-14T23:59:59.000Z

252

Ionospheric Threat Mitigation by Geometry Screening in Ground-Based Augmentation Systems  

E-Print Network [OSTI]

Ionospheric Threat Mitigation by Geometry Screening in Ground-Based Augmentation Systems Jiyun Lee observed during severe ionospheric storms pose potential threats to the integrity of the Ground threats, because ionospheric gradients are not observable to the ground monitor if they impact

Stanford University

253

Jet-like circulations occur in the `simple' geometries of gas planets and Earth's  

E-Print Network [OSTI]

#12;Jet-like circulations occur in the `simple' geometries of gas planets and Earth's liquid The Jet Stream Conundrum Baldwin, Rhines, Huang & McIntyre, Nature 2007 #12;For Earth's oceans, density reverses upscale cascade of 2DT breaks momentum conservation by exchange with solid earth via pressure drag

254

Vector Geometry Mapping 1 Job: Vogel 2 689-8 (MiMB) Operator: Sean Murdock  

E-Print Network [OSTI]

24 Vector Geometry Mapping: A Method to Characterize the Conformation of Helix-Loop-Helix Calcium Members of the EF-hand protein superfamily (1) share a common calcium- binding helix-loop-helix motif 44 45 46 47 48 49 50 51 52 53 54 1 From: Methods in Molecular Biology, vol. 173: Calcium

Ikura, Mitsuhiko

255

AN APPROACH FOR INTERSUBJECT ANALYSIS OF 3D BRAIN IMAGES BASED ON CONFORMAL GEOMETRY  

E-Print Network [OSTI]

AN APPROACH FOR INTERSUBJECT ANALYSIS OF 3D BRAIN IMAGES BASED ON CONFORMAL GEOMETRY Guangyu Zou Emission Tomography (PET) and Diffusion Tensor Imaging (DTI) have accelerated brain research in many aspects. In order to better understand the synergy of the many processes involved in normal brain function

Hua, Jing

256

Constraints on backstop geometry of the southwest Ryukyu subduction based on reection seismic data  

E-Print Network [OSTI]

Constraints on backstop geometry of the southwest Ryukyu subduction based on re¯ection seismic data 1999; revised 10 May 2000 Abstract Based on the analysis of 45 seismic re¯ection pro®les, the top from the frontal part (southernmost extremity) of the Ryukyu margin. From seismic re¯ection pro®les, we

Demouchy, Sylvie

257

Computational Geometry On The OTIS-Mesh Optoelectronic Computer Chih-fang Wang Sartaj Sahni  

E-Print Network [OSTI]

Computational Geometry On The OTIS-Mesh Optoelectronic Computer Chih-fang Wang Sartaj Sahni: optoelectronic computer, OTIS- Mesh, convex hull, smallest enclosing box, ECDF, two-set dominance, maximal points within the group. The OTIS-Mesh optoelectronic computer is a class of OTIS computers in which

Sahni, Sartaj K.

258

On the nonexistence of a Lobachevsky geometry model of an isotropic and homogeneous universe  

Science Journals Connector (OSTI)

According to the Einstein cosmological principle, our universe is homogeneous and isotropic, i.e. its curvature is constant at any point and in any direction. On large scales, when all local irregularities are ignored, this assumption has been confirmed ... Keywords: Gauss-Kronecker curvature, Lobachevsky and Riemannian geometry, geometric cosmology, manifolds, modelling, umbilic points

Michal K?ek; Jana Pradlov

2003-01-01T23:59:59.000Z

259

The Prediction of Coating Geometry from Main Processing Parameters in Laser Cladding  

Science Journals Connector (OSTI)

Abstract Based on a recently published recursive model describing the geometry of laser clad coatings and on experimental track characteristics we propose specific functions to describe the geometry of laser clad coatings formed by overlap of individual tracks depending on the processing parameters. The recursive model provides a very good description ofthe whole geometry of the coating from the Height H and width w of a single laser track for any overlap ratio OR. We have shown in the past that the height and width of a single track are well correlated with the main laser cladding processing parameters for both coaxial and side cladding set-ups. Combining these two approaches leads to prediction of the complete geometry of laser clad coatings from basic processing parameters. These parameters are: Feeding rate F, Laser beam scanning speed S and overlap ratio OR. The character of the functions that describe the height and waviness of the final coating is the same for both coaxial and side cladding set-ups.

Ond?ej Nenadl; Vclav Ocelk; Armin Palavra; Jeff Th.M. De Hosson

2014-01-01T23:59:59.000Z

260

Algebra and Geometry of Rough Logic Controllers T. Y. Lin 1 tylin@cs.susu.edu  

E-Print Network [OSTI]

for intelligent controls, is a mathematical formalism that integrates fuzzy logic, rough sets , evolutionary: control, fuzzy logic, evolutionary computing, modal logic, rough logic, rough set. 1 IntroductionAlgebra and Geometry of Rough Logic Controllers T. Y. Lin 1 tylin@cs.susu.edu Martin Wildberger 2

Lin, Tsau Young

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

Scroll waves in spherical shell geometries Francisco Chavez and Raymond Kapral  

E-Print Network [OSTI]

Scroll waves in spherical shell geometries Francisco Cha´vez and Raymond Kapral Chemical Physics Received 25 April 2001; accepted 21 July 2001; published 4 October 2001 The evolution of scroll waves. The motion of scroll wave filaments that are the locii of phaseless points in the medium and organize

Glass, Leon

262

Curved carbon nanotubes: From unique geometries to novel properties and peculiar applications  

E-Print Network [OSTI]

Curved carbon nanotubes: From unique geometries to novel properties and peculiar applications Incorporating pentagons and heptagons into the hexagonal networks of pristine carbon nanotubes (CNTs) can form are discussed. 1 Introduction The discovery of carbon nanotubes (CNTs) can be considered a prominent landmark

Simons, Jack

263

Exciton coherence-size and phonon-mediated optical nonlinearities in restricted geometries  

E-Print Network [OSTI]

Exciton coherence-size and phonon-mediated optical nonlinearities in restricted geometries Oleg(x'~`) of a one- dimensionalmolecular crystal or a polymer. We show that the coherence-lengthis determined, the optical responseof molecular clusters, monolayers, and crystals is related to the dynamics of delocalized~coherent

Mukamel, Shaul

264

Learning 3D Object Templates by Hierarchical Quantization of Geometry and Appearance Spaces  

E-Print Network [OSTI]

Learning 3D Object Templates by Hierarchical Quantization of Geometry and Appearance Spaces Wenze for learning 3D object tem- plates from view labeled object images. The 3D template is defined in a joint-sampled discrete space. Using information gain as a criterion, the best 3D template can be searched through the AND

Zhu, Song Chun

265

Surface heating of wire plasmas using laser-irradiated cone geometries  

E-Print Network [OSTI]

constructed (National Ignition Facility and Laser M´egaJoule). The energy can be transported over surprisinglyLETTERS Surface heating of wire plasmas using laser-irradiated cone geometries J. S. GREEN1,2 , K Graduate School of Engineering, Osaka University, Suita, 565-0871 Osaka, Japan 9 Institute of Laser

Loss, Daniel

266

Single molecule simulations in complex geometries with embedded dynamic one-dimensional structures  

E-Print Network [OSTI]

Single molecule simulations in complex geometries with embedded dynamic one-dimensional structures and shrink. In this paper we present a simulation algorithm that combines single molecule simula- tions in three-dimensional space with single molecule simulations on one-dimensional structures of arbitrary

Flener, Pierre

267

Geometry and Stability of Bubbles with Gravity MIYUKI KOISO & BENNETT PALMER  

E-Print Network [OSTI]

as geometric mod- els for bubbles; they minimize the surface tension of a homogeneous membrane, subjectGeometry and Stability of Bubbles with Gravity MIYUKI KOISO & BENNETT PALMER ABSTRACT. We study conditions for the stability of PMC surfaces with planar boundaries. A height estimate is obtained for stable

Palmer, Bennett

268

ON THE INFLUENCE OF THE GEOMETRY ON SKIN EFFECT IN ELECTROMAGNETISM  

E-Print Network [OSTI]

ON THE INFLUENCE OF THE GEOMETRY ON SKIN EFFECT IN ELECTROMAGNETISM GABRIEL CALOZ, MONIQUE DAUGE, ERWAN FAOU, VICTOR P´ERON ABSTRACT. We consider the equations of electromagnetism set on a domain made in electromagnetism. This effect describes the rapid decay of electromagnetic fields with depth inside a metallic

Dauge, Monique

269

arXiv:condmat/0002194 Geometry, Statistics and Asymptotics of Quantum Pumps  

E-Print Network [OSTI]

arXiv:cond­mat/0002194 v2 31 May 2000 Geometry, Statistics and Asymptotics of Quantum Pumps J. E¨uttiker et. al. (BPT) relating the adiabatically pumped current to the S matrix and its (time) derivatives. We relate the charge in BPT to Berry's phase and the corresponding Brouwer pumping formula

270

On bicycle tire tracks geometry, hatchet planimeter, Menzin's conjecture and oscillation  

E-Print Network [OSTI]

On bicycle tire tracks geometry, hatchet planimeter, Menzin's conjecture and oscillation of unicycle tracks Mark Levi and Serge Tabachnikov April 13, 2008 Abstract The model of a bicycle is a unit wheel is fixed on the bicycle frame); the same model describes the hatchet planimeter. The trajectory

Tabachnikov, Sergei

271

E-Print Network 3.0 - acid linoleic acid Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

FAs (linolenic, linoleic) - - monounsaturated FAs (oleic acid) - olive, canola - hydrogenation... Biol 458 Lecture 6 & 7 Fatty Acids 1 A. Introduction to acyl lipids...

272

Numerical Simulation of Two-Phase Flow in Severely Damaged Core Geometries  

SciTech Connect (OSTI)

In the event of a severe accident in a nuclear reactor, the oxidation, dissolution and collapse of fuel rods is likely to change dramatically the geometry of the core. A large part of the core would be damaged and would look like porous medium made of randomly distributed pellet fragments, broken claddings and relocated melts. Such a complex medium must be cooled in order to stop the accident progression. IRSN investigates the effectiveness of the water re-flooding mechanism in cooling this medium where complex two-phase flows are likely to exist. A macroscopic model for the prediction of the cooling sequence was developed for the ICARE/CATHARE code (IRSN mechanistic code for severe accidents). It still needs to be improved and assessed. It appears that a better understanding of the flow at the pore scale is necessary. As a result, a direct numerical simulation (DNS) code was developed to investigate the local features of a two-phase flow in complex geometries. In this paper, the Cahn-Hilliard model is used to simulate flows of two immiscible fluids in geometries representing a damaged core. These geometries are synthesized from experimental tomography images (PHEBUS-FP project) in order to study the effects of each degradation feature, such as displacement and fragmentation of the fuel rods and claddings, on the two-phase flow. For example, the presence of fragmented fuel claddings is likely to enhance the trapping of the residual phase (either steam or water) within the medium which leads to less flow fluctuations in the other phase. Such features are clearly shown by DNS calculations. From a series of calculations where the geometry of the porous medium is changed, conclusions are drawn for the impact of rods damage level on the characteristics of two-phase flow in the core. (authors)

Meekunnasombat, Phongsan; Fichot, Florian [Institute of Radioprotection and Nuclear Safety - IRSN, BP 17 - 92262 Fontenay-aux-Roses Cedex 31, avenue de la Division Leclerc 92260 Fontenay-aux-Roses (France); Quintard, Michel [Institut de Mecanique des Fluides de Toulouse, 1 Allee du Professeur Camille Soula, 31400 Toulouse (France)

2006-07-01T23:59:59.000Z

273

Performance of late sown wheat crop under different planting geometries and irrigation regimes in arid climate  

Science Journals Connector (OSTI)

Proper orientation of plants in the field and management of soil moisture for appropriate utilization of land, water and environmental resources plays a significant role in the optimum development and functioning of vital plant organs. A two factor field experiment was conducted for two consecutive crop growth seasons viz. 200607 and 200708 at Research and Demonstration Farm, Regional Agricultural Economic Development Centre (RAEDC), Vehari, Pakistan to make a comparison of four different planting geometries viz. planting in 22cm apart rows under conventional, minimum and zero tillage, respectively and planting in 11cm apart rows under conventional tillage system. Wheat cultivar, Inqlab-91 was planted late in December. Crop was subjected to five irrigation levels in which irrigation was applied equivalent to 120%, 100%, 80%, 60% or 40% of ETo. Lower soil bulk density and penetration resistances at 1020cm soil depth were recorded with conventional tillage with either narrow or wider row spacing as compared to other planting geometries. The maximum values for LAI, LAD, TDM, productive tillers (m?2), 1000-grain weight and grain yield were recorded with planting geometry having 11cm apart rows under conventional tillage system along with irrigation level of 120% \\{ETo\\} that remained statistically at par with the same planting geometry subjected to the irrigation regime of 100% ETo. This planting geometry also resulted in minimum weed fresh biomass. It is concluded that late planted wheat crop planted in 11cm wide rows under conventional tillage irrigated @ 100% \\{ETo\\} may serve as an appropriate technology for enhancing the wheat productivity of late sown wheat crop under limited water supplies.

Hakoomat Ali; Nadeem Iqbal; Shakeel Ahmad; Ahmad Naeem Shahzad; Naeem Sarwar

2013-01-01T23:59:59.000Z

274

A cell-centered Lagrangian finite volume approach for computing elasto-plastic response of solids in cylindrical axisymmetric geometries  

Science Journals Connector (OSTI)

A finite volume cell-centered Lagrangian formulation is presented for solving large deformation problems in cylindrical axisymmetric geometries. Since solid materials can sustain significant shear deformation, evolution equations for stress and strain ... Keywords: Axisymmetric geometries, Cell-centered, Elasto-plastic, Finite volume, Hydrodynamics, Hypo-elastic, Lagrangian, Material strength, Mimetic, Solid mechanics

Shiv Kumar Sambasivan; Mikhail J. Shashkov; Donald E. Burton

2013-03-01T23:59:59.000Z

275

Poster presented at the OCEANS'11 Conference, September, 2011 Seeking Optimal Geometry of a Heaving Body for Improved Wave Power  

E-Print Network [OSTI]

1 Poster presented at the OCEANS'11 Conference, September, 2011 Seeking Optimal Geometry of a Heaving Body for Improved Wave Power Absorption Efficiency Rachael Hager, Nelson Fernandez and Michelle H power absorption efficiency with various shaped bodies. The goal is to optimize the geometry of a two

276

Recovery of mercury from acid waste residues  

DOE Patents [OSTI]

Mercury can be recovered from nitric acid-containing fluids by reacting the fluid with aluminum metal to produce mercury metal, and then quenching the reactivity of the nitric acid prior to nitration of the mercury metal.

Greenhalgh, Wilbur O. (Richland, WA)

1989-01-01T23:59:59.000Z

277

Studies On Advanced Lead-Acid Batteries.  

E-Print Network [OSTI]

??Subsequent to the studies on precursor lead-acid systems by Daniel, Grove and Sindesten, practical lead-acid batteries began with the research and inventions of Raymond Gaston (more)

Martha, Surendra Kumar

2005-01-01T23:59:59.000Z

278

Modeling of Acid Fracturing in Carbonate Reservoirs  

E-Print Network [OSTI]

The acid fracturing process is a thermal, hydraulic, mechanical, and geochemical (THMG)-coupled phenomena in which the behavior of these variables are interrelated. To model the flow behavior of an acid into a fracture, mass and momentum balance...

Al Jawad, Murtada s

2014-06-05T23:59:59.000Z

279

Recovery of mercury from acid waste residues  

DOE Patents [OSTI]

Mercury can be recovered from nitric acid-containing fluids by reacting the fluid with aluminum metal to produce mercury metal, and thence quenching the reactivity of the nitric acid prior to nitration of the mercury metal. 1 fig.

Greenhalgh, W.O.

1987-02-27T23:59:59.000Z

280

Synthesis of Biodiesel via Acid Catalysis  

Science Journals Connector (OSTI)

Synthesis of Biodiesel via Acid Catalysis ... Biodiesel is synthesized via the transesterification of lipid feedstocks with low molecular weight alcohols. ... Nonetheless, acid-catalyzed processes could produce biodiesel from low-cost feedstocks, lowering production costs. ...

Edgar Lotero; Yijun Liu; Dora E. Lopez; Kaewta Suwannakarn; David A. Bruce; James G. Goodwin, Jr.

2005-01-25T23:59:59.000Z

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Chemical Additive Selection in Matrix Acidizing  

E-Print Network [OSTI]

critical detail of weak acid chemistry. One concern when using any acid in oilfield operations is the corrosion of well tubulars. Thus operators often choose to pump corrosion inhibitor, a chemical additive electrostatically attracted... in oilfield operations, each of which protects well tubulars using the same mechanism: by impeding the acid?s ability to diffuse to the tubing surface. Because of the unique attraction of corrosion inhibitor to the metal surface, and the corrosion inhibitor...

Weidner, Jason 1981-

2011-05-09T23:59:59.000Z

282

Reactions Between Water Soluble Organic Acids and Nitrates in...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Between Water Soluble Organic Acids and Nitrates in Atmospheric Aerosols: Recycling of Nitric Acid and Formation of Reactions Between Water Soluble Organic Acids and Nitrates in...

283

Sandia National Laboratories: Due Diligence on Lead Acid Battery...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Due Diligence on Lead Acid Battery Recycling March 23, 2011 Lead Acid Batteries on secondary containment pallet Lead Acid Batteries on secondary containment pallet In 2004, the US...

284

Hydrogen-Bond Acidic Polymers for Chemical Vapor Sensing. | EMSL  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Acidic Polymers for Chemical Vapor Sensing. Hydrogen-Bond Acidic Polymers for Chemical Vapor Sensing. Abstract: A review with 171 references. Hydrogen-bond acidic polymers for...

285

Unnatural reactive amino acid genetic code additions  

DOE Patents [OSTI]

This invention provides compositions and methods for producing translational components that expand the number of genetically encoded amino acids in eukaryotic cells. The components include orthogonal tRNAs, orthogonal aminoacyl-tRNA synthetases, orthogonal pairs of tRNAs/synthetases and unnatural amino acids. Proteins and methods of producing proteins with unnatural amino acids in eukaryotic cells are also provided.

Deiters, Alexander; Cropp, T. Ashton; Chin, Jason W.; Anderson, J. Christopher; Schultz, Peter G.

2014-08-26T23:59:59.000Z

286

Thermal Stability Of Formohydroxamic Acid  

SciTech Connect (OSTI)

The thermal stability of formohydroxamic acid (FHA) was evaluated to address the potential for exothermic decomposition during storage and its use in the uranium extraction process. Accelerating rate calorimetry showed rapid decomposition at a temperature above 65 {degree}?C; although, the rate of pressure rise was greater than two orders of magnitude less than the lower bound for materials which have no explosive properties with respect to transportation. FHA solutions in water and nitric acid did not reach runaway conditions until 150 {degree}?C. Analysis by differential scanning calorimetry showed that FHA melted at 67 {degree}?C and thermally decomposed at 90 {degree}?C with an enthalpy of -1924 J/g. The energics of the FHA thermal decomposition are comparable to those measured for aqueous solutions of hydroxylamine nitrate. Solid FHA should be stored in a location where the temperature does not exceed 20-25 {degree}?C. As a best practice, the solid material should be stored in a climate-controlled environment such as a refrigerator or freezer. FHA solutions in water are not susceptible to degradation by acid hydrolysis and are the preferred way to handle FHA prior to use.

Fondeur, F. F.; Rudisill, T. S.

2011-10-21T23:59:59.000Z

287

Radioiodinated fatty acid analogs for myocardial imaging  

SciTech Connect (OSTI)

Fatty acids are the preferred substrate for the normoxic heart. About sixty percent of the energy required by the myocardium is provided by fatty acid [beta]-oxidation. Many scientists have focused on the alterations in fatty acid metabolism in the ischemic heart for the development of radiolabelled fatty acids for functional imaging of the heart. Three main categories of compounds were synthesized: tetrazoles (1 and 2), glycidic and [alpha]-methylene acids (3-5), and analogs of oleic acid (6,7 and 7A). The tetrazole group has a similar pKa and size to that of a carboxyl group; however, such fatty acid analogs cannot undergo normal fatty acid metabolism. Glycidic and [alpha]-methylene analogs are potential irreversible inhibitors of fatty acid metabolism. Oleic acid analogs were investigated to assess the affect of stereochemical consequences on biodistribution. The key intermediates in the synthesis of the target compounds were [omega]-nitrophenyl alkylcarboxylic acids and alcohols, which were made using a variety of cross-coupling reactions. The Wittig reaction, which was used in the synthesis of tetrazole 1 and glycidic acid 3, gave low yields of the cross-coupled products. The remaining target compounds were synthesized by condensation of appropriate RCu (CN) ZnI and substituted benzyl bromides or by Pd[sup II] catalyzed cross-coupling of substituted arylhalides with suitable alkynes. The latter two reactions produced much higher yields of the desired products. All of the target compounds were radiolabeled with [sup 125]I by various Cu(I) catalyzed radioiodine exchange procedures and were then subjected to tissue biodistribution (TD) studies in rats. Except for the 15-(4-iodophenyl)-2-methylene-pentadecanoic acid (5), all of the fatty acid analogs failed to surpass clinically-used 15-(4-iodophenyl)pentadecanoic acid (IPPA) in their ability to be taken up and retained by the rat myocardium.

Ruyan, M.K.

1993-01-01T23:59:59.000Z

288

Electromagnetic Geometry  

E-Print Network [OSTI]

We show that Maxwell's electromagnetism can be mapped into the Born-Infeld theory in a curved space-time, which depends only on the electromagnetic field in a specific way. This map is valid for any value of the two lorentz invariants $F$ and $G$ confirming that we have included all possible solutions of Maxwell's equations. Our result seems to show that specifying the dynamics and the space-time structure of a given theory can be viewed merely as a choice of representation to describe the physical system.

M. Novello; F. T. Falciano; E. Goulart

2011-11-08T23:59:59.000Z

289

Condensed Geometry  

E-Print Network [OSTI]

A spin (dependent) system treatment of gravity is adopted akin to the Sen-Ashtekar treatment. Time is reinserted into the space ``fluid'' at the quantum Level. This time - the Lorentzian one- is shown to be a vorticity of a ``fluid particle'' of the space and the effect is integrated over all the fluid particles to incorporate time in quantum gravity. This spacetime is viewed as a fluid of future light cones called the SU(2) dipoles of causality here in the paper.The future light cone structure is soldered internally to the new variables derived in this paper to accomodate a background free physics of quantum strings. The emergence of spacetime is shown to be a first order phase transition and that of separation of gravity from the unified field to be a second order phase transition. For the former case the cosmic time is chosen as the order parameter and for the latter case the angular momentum is chosen as the order parameter. A quantum blackhole thus nucleates at transition temperature which is the Planck temperature, $\\tau_{pl}$. Then the SU(2) dipoles enable interpretation of this black hole as a gravity gauge SL(2,$\\mathbb{C}$) dual of the U(1) gauge ferromagnetic phase. The usual QFT interpretation of this effect is the existence of locally Lorentzian spacetimes.

Koustubh Kabe

2010-02-10T23:59:59.000Z

290

Cumulus Geometry from Satellite and Surface Data at the ARM TWP Site  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Cumulus Geometry from Satellite and Surface Data Cumulus Geometry from Satellite and Surface Data at the ARM TWP Site E. I. Kassianov, T. P. Ackerman, and R. T. Marchand Pacific Northwest National Laboratory Richland, Washington Introduction The multi-angle imaging spectrometer (MISR), a sensor on board the earth observing system (EOS) Terra satellite platform, observes reflected radiation in nine directions with high resolution (~0.275 km). The overall mission of the MISR is to provide continuous, global multi-angle measurements of the reflected radiation from the earth's atmosphere and surface, and thereby create a valuable resource for studying their physical properties (Diner et al. 1999). For single-layer marine cumulus clouds, we have demonstrated that satellite-derived basic statistics (mean, variance) of vertical cloud size match closely

291

Two and Three-Qubits Geometry, Quaternionic and Octonionic Conformal maps, and Intertwining Hopf Fibration  

E-Print Network [OSTI]

In this paper the geometry of two and three-qubit states under local unitary groups is discussed. We first review the one qubit geometry and its relation with Riemanian sphere under the action of group $SU(2)$. We show that the second Hopf fiberation intertwines between local unitary group $SU(2)\\otimes SU(2)$ and quaternionic M\\"obius transformation. The invariant term appearing in this operation is related to concurrence measure. Yet, there exists the same intertwining Hopf map for much more global group $Sp(2)$, generalizing the familiar Bloch sphere in 2-level systems. Subsequently, we introduce third Hopf fiberation and octonionic conformal map (or octonionic M\\"obius maps) for three-qubit states and find evidence that they may have invariant terms under local unitary operations which shows that both maps have entanglement sensitive.

G. Najarbashi; B. Seifi; S. Mirzaei

2015-01-24T23:59:59.000Z

292

The Non-Commutative Geometry of the Complex Classes of Topological Insulators  

E-Print Network [OSTI]

Alain Connes' Non-Commutative Geometry program [Connes 1994] has been recently carried out [Prodan, Leung, Bellissard 2013, Prodan, Schulz-Baldes 2014] for the entire A- and AIII-symmetry classes of topological insulators, in the regime of strong disorder where the insulating gap is completely filled with dense localized spectrum. This is a short overview of these results, whose goal is to highlight the methods of Non-Commutative Geometry involved in these studies. The exposition proceeds gradually through the cyclic cohomology, quantized calculus with Fredholm-modules, local formulas for the odd and even Chern characters and index theorems for the odd and even Chern numbers. The characterization of the A- and AIII-symmetry classes in the presence of strong disorder and magnetic fields emerges as a natural application of these tools.

Emil Prodan

2014-02-28T23:59:59.000Z

293

Quasilinear theory of collisionless Fermi acceleration in a multicusp magnetic confinement geometry  

E-Print Network [OSTI]

Particle motion in a cylindrical multiple-cusp magnetic field configuration is shown to be highly (though not completely) chaotic, as expected by analogy with the Sinai billiard. This provides a collisionless, linear mechanism for phase randomization during monochromatic wave heating. A general quasilinear theory of collisionless energy diffusion is developed for particles with a Hamiltonian of the form $H_0+H_1$, motion in the \\emph{unperturbed} Hamiltonian $H_0$ being assumed chaotic, while the perturbation $H_1$ can be coherent (i.e. not stochastic). For the multicusp geometry, two heating mechanisms are identified --- cyclotron resonance heating of particles temporarily mirror-trapped in the cusps, and nonresonant heating of nonadiabatically reflected particles (the majority). An analytically solvable model leads to an expression for a transit-time correction factor, exponentially decreasing with increasing frequency. The theory is illustrated using the geometry of a typical laboratory experiment.

Robert L. Dewar; Carmen I. Ciubotariu

1999-05-10T23:59:59.000Z

294

Online measurement of bead geometry in GMAW-based additive manufacturing using passive vision  

Science Journals Connector (OSTI)

Additive manufacturing based on gas metal arc welding is an advanced technique for depositing fully dense components with low cost. Despite this fact, techniques to achieve accurate control and automation of the process have not yet been perfectly developed. The online measurement of the deposited bead geometry is a key problem for reliable control. In this work a passive vision-sensing system, comprising two cameras and composite filtering techniques, was proposed for real-time detection of the bead height and width through deposition of thin walls. The nozzle to the top surface distance was monitored for eliminating accumulated height errors during the multi-layer deposition process. Various image processing algorithms were applied and discussed for extracting feature parameters. A calibration procedure was presented for the monitoring system. Validation experiments confirmed the effectiveness of the online measurement system for bead geometry in layered additive manufacturing.

Jun Xiong; Guangjun Zhang

2013-01-01T23:59:59.000Z

295

Variable-geometry turbocharger with asymmetric divided volute for engine exhaust gas pulse optimization  

DOE Patents [OSTI]

A turbine assembly for a variable-geometry turbocharger includes a turbine housing defining a divided volute having first and second scrolls, wherein the first scroll has a substantially smaller volume than the second scroll. The first scroll feeds exhaust gas to a first portion of a turbine wheel upstream of the throat of the wheel, while the second scroll feeds gas to a second portion of the wheel at least part of which is downstream of the throat. Flow from the second scroll is regulated by a sliding piston. The first scroll can be optimized for low-flow conditions such that the turbocharger can operate effectively like a small fixed-geometry turbocharger when the piston is closed. The turbine housing defines an inlet that is divided by a dividing wall into two portions respectively feeding gas to the two scrolls, a leading edge of the dividing wall being downstream of the inlet mouth.

Serres, Nicolas (Epinal, FR)

2010-11-09T23:59:59.000Z

296

Simulating higher-dimensional geometries in GADRAS using approximate one-dimensional solutions.  

SciTech Connect (OSTI)

The Gamma Detector Response and Analysis Software (GADRAS) software package is capable of simulating the radiation transport physics for one-dimensional models. Spherical shells are naturally one-dimensional, and have been the focus of development and benchmarking. However, some objects are not spherical in shape, such as cylinders and boxes. These are not one-dimensional. Simulating the radiation transport in two or three dimensions is unattractive because of the extra computation time required. To maintain computational efficiency, higher-dimensional geometries require approximations to simulate them in one-dimension. This report summarizes the theory behind these approximations, tests the theory against other simulations, and compares the results to experimental data. Based on the results, it is recommended that GADRAS users always attempt to approximate reality using spherical shells. However, if fissile material is present, it is imperative that the shape of the one-dimensional model matches the fissile material, including the use of slab and cylinder geometry.

Thoreson, Gregory G.; Mitchell, Dean James; Harding, Lee T.

2013-02-01T23:59:59.000Z

297

Geometry of the Ag{001}-c (22)Cl structure as determined by He diffraction  

Science Journals Connector (OSTI)

The structure of the Ag{001}-c (22)Cl surface has been studied with He-atom diffraction. Two proposed Cl binding geometries have been considered as structural alternatives: the fourfold-hollow simple overlayer model and a mixed layer of coplanar Ag and Cl. We have calculated the repulsive He potential, based on self-consistent charge densities of the target, for both configurations. The two geometries are easily distinguished. The charge densities for the overlayer structure yield a corrugation which is in good agreement with the scattering data and lead to an unambiguous selection between the two structural models. We have further examined the possibility that the Cl overlayer undergoes a structural phase transition or irreversibly disorders at elevated temperatures. We find no change in the structure for temperatures up to 650 K, at which point Cl leaves the surface.

M. J. Cardillo, G. E. Becker, D. R. Hamann, J. A. Serri, L. Whitman, and L. F. Mattheiss

1983-07-15T23:59:59.000Z

298

Cl chemisorption on the Ag(001) surface: Geometry and electronic structure  

Science Journals Connector (OSTI)

Simple overlayer and mixed-layer geometries are studied for the observed c(22) structure of atomic Cl adsorbed on the Ag(001) surface. A self-consistent, Gaussian, linear-combination-of-atomic-orbitals technique with a local exchange-correlation potential is used. Reference calculations are performed for bulk Ag, the clean Ag(001) surface, and an isolated c(22)Cl layer. The calculated total and partial density of states for the two geometries are compared with angle-integrated and angle-resolved photoemission experiments. The mixed-layer model gives close agreement with experiment while the overlayer model predicts a single Cl feature above the Ag d band, contrary to the photoemission data. Discrepancies between these calculations and a low-energy electron diffraction study of this system are discussed.

H. S. Greenside and D. R. Hamann

1981-05-15T23:59:59.000Z

299

Effect of geometry on concentration polarization in realistic heterogeneous permselective systems  

E-Print Network [OSTI]

This study extends previous analytical solutions of concentration-polarization occurring solely in the depleted region, to the more realistic geometry consisting of a three dimensional (3D) heterogeneous ion-permselective medium connecting two opposite microchambers (i.e. 3 layers system). Under the local electro-neutrality approximation, the separation of variable methods is used to derive an analytical solution of the electro-diffusive problem for the two opposing asymmetric microchambers. Assuming an ideal permselective medium allows for the analytic calculation of the 3D concentration and electric potential distributions as well as a current-voltage relation. It is shown that any asymmetry in the microchamber geometries will result in current rectification. Moreover, it is demonstrated that for non-negligible microchamber resistances the conductance does not exhibit the expected saturation at low concentrations but instead shows a continuous decrease. The results are intended to facilitate a more direct c...

Green, Yoav; Yossifon, Gilad

2014-01-01T23:59:59.000Z

300

Intensity-interferometric test of nuclear collision geometries obtained from the Boltzmann-Uehling-Uhlenbeck equation  

SciTech Connect (OSTI)

Two-proton correlation functions measured for the {sup 14}N+{sup 27}Al reaction at {ital E}/{ital A}=75 MeV are compared to correlation functions predicted for collision geometries obtained from numerical solutions of the Boltzmann-Uehling-Uhlenbeck (BUU) equation. The calculations are in rather good agreement with the experimental correlation function, indicating that the BUU equation gives a reasonable description of the space-time evolution of the reaction.

Gong, W.G.; Bauer, W.; Gelbke, C.K.; Carlin, N.; de Souza, R.T.; Kim, Y.D.; Lynch, W.G.; Murakami, T.; Poggi, G.; Sanderson, D.P.; Tsang, M.B.; Xu, H.M. (National Superconducting Cyclotron Laboratory, Michigan State University, East Lansing, MI (USA) Department of Physics Astronomy, Michigan State University, East Lansing, MI (USA)); Pratt, S. (Department of Physics, University of Wisconsin, Madison, WI (USA)); Fields, D.E.; Kwiatkowski, K.; Planeta, R.; Viola, V.E. Jr.; Yennello, S.J. (Indiana University Cyclotron Facility, Indiana University, Bloomington, IN (USA))

1990-10-22T23:59:59.000Z

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

Final Technical Report: Global Field Aligned Mesh and Gyrokinetic Field Solver in a Tokamak Edge Geometry  

SciTech Connect (OSTI)

This project was a collaboration between researchers at the California Institute of Technology and the University of California, Irvine to investigate the utility of a global field-aligned mesh and gyrokinetic field solver for simulations of the tokamak plasma edge region. Mesh generation software from UC Irvine was tested with specific tokamak edge magnetic geometry scenarios and the quality of the meshes and the solutions to the gyrokinetic Poisson equation were evaluated.

Cummings, Julian C. [California Institute of Technology

2013-05-15T23:59:59.000Z

302

Teaching, Learning, and Modeling with Geometry in the Middle and High School  

E-Print Network [OSTI]

, such as Geometer's Sketchpad, Cabri, and GeoGebra SketchUp POV-Ray (ray tracer) Blender (has features akin to both SketchUp and POV-Ray) -- used in some High School design classes Carl Lee (UK) MS and HS Geometry Fields InstituteAugust 2014 10 / 26 #12;Second Project: SketchUp in Middle School Partner and Project Initiator: Dr

Lee, Carl

303

G'eom'etrie (Maitrise) novembre 2004 T.D. feuille 6  

E-Print Network [OSTI]

G'eom'etrie (Ma??itrise) novembre 2004 2004/2005 T.D. ­ feuille 6 Compl'etude, comp'etude g'eod recouvrement par des ouverts isom'etriques `a des ouverts de R 2 (pourquoi?). D'autre part (M; g) est­elle g'eod'ecessairement un voisinage point'e de 0. En consid'erant par exemple les g'eod'esiques issues de p, montrez que l

304

Extinction of a bacterial colony under forced convection in pie geometry  

Science Journals Connector (OSTI)

The extinction of a bacterial colony, as it is forced to migrate into a hostile environment, is analyzed in pie geometry. Under convection, separation of the radial and the azimuthal degrees of freedom is not possible, so the linearized evolution operator is diagonalized numerically. Some characteristic scales are compared with the results of recent experiments, and the integrable limit of the theory in the narrow growth region is studied.

Nadav M. Shnerb

2000-12-21T23:59:59.000Z

305

Acid Fracture and Fracture Conductivity Study of Field Rock Samples  

E-Print Network [OSTI]

Acid fracturing is a well stimulation strategy designed to increase the productivity of a producing well. The parameters of acid fracturing and the effects of acid interaction on specific rock samples can be studied experimentally. Acid injection...

Underwood, Jarrod

2013-11-15T23:59:59.000Z

306

Micro-electro-mechanical systems phosphoric acid fuel cell  

DOE Patents [OSTI]

A phosphoric acid fuel cell system comprising a porous electrolyte support, a phosphoric acid electrolyte in the porous electrolyte support, a cathode electrode contacting the phosphoric acid electrolyte, and an anode electrode contacting the phosphoric acid electrolyte.

Sopchak, David A. (Livermore, CA); Morse, Jeffrey D. (Martinez, CA); Upadhye, Ravindra S. (Pleasanton, CA); Kotovsky, Jack (Oakland, CA); Graff, Robert T. (Modesto, CA)

2010-12-21T23:59:59.000Z

307

Micro-electro-mechanical systems phosphoric acid fuel cell  

DOE Patents [OSTI]

A phosphoric acid fuel cell system comprising a porous electrolyte support, a phosphoric acid electrolyte in the porous electrolyte support, a cathode electrode contacting the phosphoric acid electrolyte, and an anode electrode contacting the phosphoric acid electrolyte.

Sopchak, David A. (Livermore, CA); Morse, Jeffrey D. (Martinez, CA); Upadhye, Ravindra S. (Pleasanton, CA); Kotovsky, Jack (Oakland, CA); Graff, Robert T. (Modesto, CA)

2010-08-17T23:59:59.000Z

308

Common amino acid domain among endopolygalacturonases of ascomycete fungi.  

Science Journals Connector (OSTI)

...How- ever, amino acid compositions of homogeneous PGs appear...Mugnier (Rhone-Poulenc Agrochemical Co., France). C. lindemuthianum...Pharmacia). Amino acid composition. Amino acid analysis was...chromatography. amino acid compositions of the three purified materials...

J P Keon; G Waksman

1990-08-01T23:59:59.000Z

309

THE EFFECT OF DUST GEOMETRY ON THE Lyalpha OUTPUT OF GALAXIES  

SciTech Connect (OSTI)

We present the optical spectroscopic follow-up of 31 z = 0.3 Lyalpha emitters, previously identified by Deharveng et al. We find that 17% of the Lyalpha emitters have line ratios that require the hard ionizing continuum produced by an active galactic nucleus. The uniform dust screen geometry traditionally used in studies similar to ours is not able to simultaneously reproduce the observed high Lyalpha/Halpha and Halpha/Hbeta line ratios. We consider different possibilities for the geometry of the dust around the emitting sources. We find that also a uniform mixture of sources and dust does not reproduce the observed line ratios. Instead, these are well reproduced by a clumpy dust screen. This more realistic treatment of the geometry results in extinction corrected (Lyalpha/Halpha) {sub C} values consistent with case B recombination theory, whereas a uniform dust screen model would imply values (Lyalpha/Halpha) {sub C} higher than 8.7. Our analysis shows that there is no need to invoke ad hoc multiphase media in which the Lyalpha photons only scatter between the dusty clouds and eventually escape.

Scarlata, C.; Colbert, J.; Teplitz, H. I.; Caon, A.; Bridge, C. [Spitzer Science Center, California Institute of Technology, 314-6, Pasadena, CA-91125 (United States); Panagia, N. [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Hayes, M. [Observatoire de Geneve, 51, Ch. des Maillettes, CH-1290, Sauverny (Switzerland); Siana, B.; Rau, A. [California Institute of Technology, MS 105-24, Pasadena, CA 91125 (United States); Francis, P. [Research School of Astronomy and Astrophysics, the Australian National University, Canberra 0200 (Australia); Pizzella, A. [Department of Astronomy, University of Padova, Vicolo dell'Osservatorio 3, I-35122, Padova (Italy)

2009-10-20T23:59:59.000Z

310

Design and Simulation for Architectural Geometry Figure 1: Daytime and nighttime scenes of designed roof by using the developed computational tools  

E-Print Network [OSTI]

roof by using the developed computational tools 031.PDF Keywords: Architectural Geometry, Procedural an innovative computational design tool used to edit architectural geometry interactively and demonstratesDesign and Simulation for Architectural Geometry Figure 1: Daytime and nighttime scenes of designed

311

Effects of Combustor Geometry on the Flowfields and Flame Properties of A  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Effects of Combustor Geometry on the Flowfields and Flame Properties of A Effects of Combustor Geometry on the Flowfields and Flame Properties of A Low-Swirl Injector Title Effects of Combustor Geometry on the Flowfields and Flame Properties of A Low-Swirl Injector Publication Type Journal Article Year of Publication 2008 Authors Cheng, Robert K., and David Littlejohn Journal Proceedings of the Combustion Institute Type of Article Conference Paper Abstract The Low-swirl injector (LSI) is a novel dry-low NOx combustion method that is being developed for gas turbines to burn a variety of gaseous fuels including natural gas, low-Btu fuels, syngases and hydrogen. Its basic principle is described by a top level analytical model that relates the flame position to the flowfield similarity parameters and the turbulent flame speed correlation. The model was based on experimental measurements in open laboratory flames. It has been useful for guiding hardware development. As the LSI is being adapted to different engine configurations, one open question is how the combustor geometry and size affect its basic operating principle. The objective of this paper is to investigate these effects by conducting Particle Image Velocimetry (PIV) measurements in open and enclosed flames produced by a 6.35 cm diameter LSI using two quartz cylinders of 15.5 and 20 cm diameter to simulate the combustor casing. Results from 18 methane-air flames show that the enclosures do not alter the flame properties or the nearfield flow structures. The differences occur mostly in the farfield where the tighter enclosure deters the formation of a weak recirculation zone. The enclosure effects on hydrogen and hydrogen-methane flames were studies using the 20 cm cylinder. The results show that the outer recirculation zone generated at the corner of the dump plane promotes the formation of attached flames. However, the properties and nearfield flow features of the attached flames are similar to those of the lifted flames. At higher stoichiometries, the attached flame collapses to form a compact disc shaped flame that has very different flowfield structures. These results show that the enclosure effects on the LSI are strongly coupled to the fuel type and dump plane geometry but are less dependent on the enclosure size. These observations will provide the basis for developing computational methods that can be used as design tools for LSI adaptation

312

Acid-catalytic decomposition of peracetic acid in the liquid phase  

SciTech Connect (OSTI)

This paper elucidates the kinetic relationships of peracetic acid (PAA) decomposition in the presence of mineral acids and their heterogeneous analogs, polystyrene-di-vinylbenzene cation-exchangers, differing in physicochemical and morphological parameters. It is shown that the thermal decomposition of PAA in acetic acid is an acid-catalyzed reaction. The controlling step of the reaction is protonation of the substrate with formation of an active intermediate form. Sulfonated cation-exchangers are twice as effective as sulfuric acid in this process. Polystyrene-divinylbenzene sulfonated cation-exchangers can be used with success as acid catalysts in oxidation processes involving PAA, because of their high effectiveness, stability, and availability.

Kharchuk, V.G.; Kolenko, I.P.; Petrov, L.A.

1985-12-01T23:59:59.000Z

313

Effects of geometry/dimensions of gas flow channels and operating conditions on high-temperature PEM fuel cells  

Science Journals Connector (OSTI)

In order to accomplish the objective of studying and optimizing the flow channel geometries and dimensions for high-temperature proton-exchange-membrane (PEM) fuel cells (with operating temperatures above 120C)...

Hong Liu; Peiwen Li; Alexandra Hartz

2014-11-01T23:59:59.000Z

314

Nd:GdVO4 in Face-Cooled Geometries: Thin-Disk and High-Power Microchip Lasers  

Science Journals Connector (OSTI)

The potential of Nd:GdVO4 for face-cooled geometries is discussed. Particular emphasis is given to experimental and finite element studies of thin-disk and high-power, monolithic,...

Kemp, Alan J; Valentine, Gareth J; Burns, David

315

Nd:GdVO4 in face-cooled geometries: thin-disk and high-power microchip lasers  

Science Journals Connector (OSTI)

The potential of Nd:GdVO4 for face-cooled geometries is discussed. Particular emphasis is given to experimental and finite element studies of thin-disk and...

Kemp, Alan J; Valentine, Gareth J; Burns, David

316

Extensive distance geometry calculations with different NOE calibrations: New criteria for structure selection applied to Sandostatin and BPTI  

Science Journals Connector (OSTI)

To generate structures efficiently, a version of the distance geometry program DIANA for a parallel computer was developed, new objective criteria for the selection of NMR solution structures are presented, an...

Hans Widmer; Armin Widmer; Werner Braun

1993-05-01T23:59:59.000Z

317

Self-assembling multimeric nucleic acid constructs  

DOE Patents [OSTI]

The invention is directed to constructs and compositions containing multimeric forms of nucleic acid. Multimeric nucleic acids comprise single-stranded nucleic acids attached via biotin to streptavidin and bound with a functional group. These constructs can be utilized in vivo to treat or identify diseased tissue or cells. Repeated administrations of multimeric nucleic acid compositions produce a rapid and specific amplification of nucleic acid constructs and their attached functional groups. For treatment purposes, functional groups may be toxins, radioisotopes, genes or enzymes. Diagnostically, labeled multimeric constructs may be used to identify specific targets in vivo or in vitro. Multimeric nucleic acids may also be used in nanotechnology and to create self-assembling polymeric aggregates such as membranes of defined porosity, microcircuits and many other products.

Cantor, Charles R. (Boston, MA); Niemeyer, Christof M. (Bremen, DE); Smith, Cassandra L. (Boston, MA); Sano, Takeshi (Boston, MA); Hnatowich, Donald J. (Brookline, MA); Rusckowski, Mary (Southborough, MA)

1996-01-01T23:59:59.000Z

318

Self-assembling multimeric nucleic acid constructs  

DOE Patents [OSTI]

The invention is directed to constructs and compositions containing multimeric forms of nucleic acid. Multimeric nucleic acids comprise single-stranded nucleic acids attached via biotin to streptavidin and bound with a functional group. These constructs can be utilized in vivo to treat or identify diseased tissue or cells. Repeated administrations of multimeric nucleic acid compositions produce a rapid and specific amplification of nucleic acid constructs and their attached functional groups. For treatment purposes, functional groups may be toxins, radioisotopes, genes or enzymes. Diagnostically, labeled multimeric constructs may be used to identify specific targets in vivo or in vitro. Multimeric nucleic acids may also be used in nanotechnology and to create self-assembling polymeric aggregates such as membranes of defined porosity, microcircuits and many other products.

Cantor, Charles R. (Boston, MA); Niemeyer, Christof M. (Bremen, DE); Smith, Cassandra L. (Boston, MA); Sano, Takeshi (Boston, MA); Hnatowich, Donald J. (Brookline, MA); Rusckowski, Mary (Southborough, MA)

1999-10-12T23:59:59.000Z

319

Testing of organic acids in engine coolants  

SciTech Connect (OSTI)

The effectiveness of 30 organic acids as inhibitors in engine coolants is reported. Tests include glassware corrosion of coupled and uncoupled metals. FORD galvanostatic and cyclic polarization electrochemistry for aluminum pitting, and reserve alkalinity (RA) measurements. Details of each test are discussed as well as some general conclusions. For example, benzoic acid inhibits coupled metals well but is ineffective on cast iron when uncoupled. In benzoic acid inhibits coupled metals well but is ineffective on cast iron when uncoupled. In general, the organic acids provide little RA when titrated to a pH of 5.5, titration to a pH of 4.5 can result in precipitation of the acid. Trends with respect to acid chain length are reported also.

Weir, T.W. [ARCO Chemical Co., Newtown Square, PA (United States)

1999-08-01T23:59:59.000Z

320

Waste acid recycling via diffusion dialysis  

SciTech Connect (OSTI)

Inorganic acids are commonly used for surface cleaning and finishing of metals. The acids become unuseable due to contamination with metals or diluted and weakened. Diffusion dialysis has become a way to recover the useable acid and allow separation of the metals for recovery and sale to refineries. This technique is made possible by the use of membranes that are strong enough to withstand low ph and have long service life.

Steffani, C.

1995-05-26T23:59:59.000Z

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Organic Phosphoric Acid of the Soil.  

E-Print Network [OSTI]

TEXAS AGRICULTURAL EXPERIMENT STATIONS BULLETIN NO. +6CT /36 CHEMICAL SECTION, FEBRUARY, 191 1 I TECHNICAL BULLETIN Organic Phosphoric Acid of the Soil BY G. S. FRAPS, Chemist POSTOFFICE College Station, Brazos County, 'Texas. ,\\ustin... . ................................................ introduction 5 .............................. hmmonia-Soluble Phosphoric Acid 5 ................ Solubility of Phosphates in Ammonia 6 I Fixation of Phosphoric Acid from Ammonia .......... 7 Effect of Ratio of Soil to Solvent in Extraction of Phos- I I...

Fraps, G. S. (George Stronach)

1911-01-01T23:59:59.000Z

322

Carboxylic acid accelerated formation of diesters  

DOE Patents [OSTI]

This invention pertains to accelerating the rate of formation of 1,1-dicarboxylic esters from the reaction of an aldehyde with a carboxylic acid anhydride or a ketene in the presence of a non-iodide containing a strong Bronsted acid catalyst by the addition of a carboxylic acid at about one bar pressure and between about 0 and 80 C in the substantial absence of a hydrogenation or carbonylation catalyst.

Tustin, G.C.; Dickson, T.J.

1998-04-28T23:59:59.000Z

323

Acid Doped Membranes for High Temperature PEMFC  

Broader source: Energy.gov [DOE]

Presentation on Acid Doped Membranes for High Temperature PEMFC to the High Temperature Membrane Working Group, May 25, 2004 in Philadelphia, PA.

324

Biomedical Application of Hyaluronic Acid Nanoparticles  

E-Print Network [OSTI]

Hyaluronic acid (HA) is a naturally occurring biodegradable polymer with a variety of applications in medicine including tissue engineering, dermatological fillers, and viscosupplementation for osteoarthritis treatment. ...

Fakhari, Amir

2012-05-31T23:59:59.000Z

325

Nucleic Acid Standards - Refinement Parameters  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Refinement Parameters Refinement Parameters The DNA/RNA topology and parameter files for X-PLOR are shown below. These were tested with DNA structures and with protein-DNA complexes. X-PLOR topology file X-PLOR parameter files: X-PLOR parameter file For the refinement of high resolution structures (< 1.7 Angstroms) the parameter file with distinct bond distances and bond angles for both C2'-endo and C3'-endo conformations should be considered: X-PLOR parameter file for high resolution structures "New Parameters for the Refinement of Nucleic Acid Containing Structures." Gary Parkinson, Jaroslav Vojtechovsky, Lester Clowney, Axel Brunger*, and Helen M. Berman. (1996) Acta Cryst. D 52, 57-64 Rutgers University, Department of Chemistry, Piscataway, NJ 08855-0939; *The Howard Hughes Medical Institute and Departments of Molecular and

326

E-Print Network 3.0 - acid eicosapentaenoic acid Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sample search results for: acid eicosapentaenoic acid Page: << < 1 2 3 4 5 > >> 1 Fish or Fish Oil in the Diet and Heart Attacks MAURICE E. STANSBY Summary: . Further...

327

E-Print Network 3.0 - acids eicosapentaenoic acid Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sample search results for: acids eicosapentaenoic acid Page: << < 1 2 3 4 5 > >> 1 Fish or Fish Oil in the Diet and Heart Attacks MAURICE E. STANSBY Summary: . Further...

328

Organic acid-tolerant microorganisms and uses thereof for producing organic acids  

DOE Patents [OSTI]

Organic acid-tolerant microorganisms and methods of using same. The organic acid-tolerant microorganisms comprise modifications that reduce or ablate AcsA activity or AcsA homolog activity. The modifications increase tolerance of the microorganisms to such organic acids as 3-hydroxypropionic acid (3HP), acrylic acid, and propionic acid. Further modifications to the microorganisms such as increasing expression of malonyl-CoA reductase and/or acetyl-CoA carboxylase provide or increase the ability of the microorganisms to produce 3HP. Methods of generating an organic acid with the modified microorganisms are provided. Methods of using acsA or homologs thereof as counter-selectable markers include replacing acsA or homologs thereof in cells with genes of interest and selecting for the cells comprising the genes of interest with amounts of organic acids effective to inhibit growth of cells harboring acsA or the homologs.

Pfleger, Brian Frederick; Begemann, Matthew Brett

2014-05-06T23:59:59.000Z

329

Catalytic transformations of cellulose and its derived carbohydrates into 5-hydroxymethylfurfural, levulinic acid, and lactic acid  

Science Journals Connector (OSTI)

The catalytic transformation of cellulose into key building-block or platform chemicals such as 5-hydoxymethylfurfural (HMF), levulinic acid, and lactic acid under mild conditions, has attracted much attention...

Weiping Deng; Qinghong Zhang; Ye Wang

2014-12-01T23:59:59.000Z

330

Yeast display evolution of a kinetically efficient 13-amino acid substrate for lipoic acid ligase  

E-Print Network [OSTI]

Escherichia coli lipoic acid ligase (LplA) catalyzes ATP-dependent covalent ligation of lipoic acid onto specific lysine side chains of three acceptor proteins involved in oxidative metabolism. Our lab has shown that LplA ...

Puthenveetil, Sujiet

331

2006 DOE Hydrogen Program Poly (p-phenylene Sulfonic Acid)s with...  

Broader source: Energy.gov (indexed) [DOE]

2006 DOE Hydrogen Program Poly (p-phenylene Sulfonic Acid)s with Frozen-in Free Volume for use in High Temperature Fuel Cells 2006 DOE Hydrogen Program Poly (p-phenylene Sulfonic...

332

The Arabidopsis hrl1 mutation reveals novel overlapping roles for salicylic acid, jasmonic acid and ethylene  

E-Print Network [OSTI]

and ethylene signalling in cell death and defence against pathogens Sendil K. Devadas1 , Alexander Enyedi2 molecules: salicylic acid (SA), jasmonic acid (JA) and ethylene (ET). The hrl1 (hypersensitive response

Raina, Ramesh

333

Analytic solutions for seismic travel time and ray path geometry through simple velocity models.  

SciTech Connect (OSTI)

The geometry of ray paths through realistic Earth models can be extremely complex due to the vertical and lateral heterogeneity of the velocity distribution within the models. Calculation of high fidelity ray paths and travel times through these models generally involves sophisticated algorithms that require significant assumptions and approximations. To test such algorithms it is desirable to have available analytic solutions for the geometry and travel time of rays through simpler velocity distributions against which the more complex algorithms can be compared. Also, in situations where computational performance requirements prohibit implementation of full 3D algorithms, it may be necessary to accept the accuracy limitations of analytic solutions in order to compute solutions that satisfy those requirements. Analytic solutions are described for the geometry and travel time of infinite frequency rays through radially symmetric 1D Earth models characterized by an inner sphere where the velocity distribution is given by the function V (r) = A-Br{sup 2}, optionally surrounded by some number of spherical shells of constant velocity. The mathematical basis of the calculations is described, sample calculations are presented, and results are compared to the Taup Toolkit of Crotwell et al. (1999). These solutions are useful for evaluating the fidelity of sophisticated 3D travel time calculators and in situations where performance requirements preclude the use of more computationally intensive calculators. It should be noted that most of the solutions presented are only quasi-analytic. Exact, closed form equations are derived but computation of solutions to specific problems generally require application of numerical integration or root finding techniques, which, while approximations, can be calculated to very high accuracy. Tolerances are set in the numerical algorithms such that computed travel time accuracies are better than 1 microsecond.

Ballard, Sanford

2007-12-01T23:59:59.000Z

334

Optimization approach for the computation of magnetohydrostatic coronal equilibria in spherical geometry  

E-Print Network [OSTI]

Context: This paper presents a method which can be used to calculate models of the global solar corona from observational data. Aims: We present an optimization method for computing nonlinear magnetohydrostatic equilibria in spherical geometry with the aim to obtain self-consistent solutions for the coronal magnetic field, the coronal plasma density and plasma pressure using observational data as input. Methods: Our code for the self-consistent computation of the coronal magnetic fields and the coronal plasma solves the non-force-free magnetohydrostatic equilibria using an optimization method. Previous versions of the code have been used to compute non-linear force-free coronal magnetic fields from photospheric measurements in Cartesian and spherical geometry, and magnetostatic-equilibria in Cartesian geometry. We test our code with the help of a known analytic 3D equilibrium solution of the magnetohydrostatic equations. The detailed comparison between the numerical calculations and the exact equilibrium solutions is made by using magnetic field line plots, plots of density and pressure and some of the usual quantitative numerical comparison measures. Results: We find that the method reconstructs the equilibrium accurately, with residual forces of the order of the discretisation error of the analytic solution. The correlation with the reference solution is better than 99.9% and the magnetic energy is computed accurately with an error of <0.1%. Conclusions: We applied the method so far to an analytic test case. We are planning to use this method with real observational data as input as soon as possible.

T. Wiegelmann; T. Neukirch; P. Ruan; B. Inhester

2008-01-18T23:59:59.000Z

335

Optimization of numerical weather/wave prediction models based on information geometry and computational techniques  

Science Journals Connector (OSTI)

The last years a new highly demanding framework has been set for environmental sciences and applied mathematics as a result of the needs posed by issues that are of interest not only of the scientific community but of today's society in general: global warming renewable resources of energy natural hazards can be listed among them. Two are the main directions that the research community follows today in order to address the above problems: The utilization of environmental observations obtained from in situ or remote sensing sources and the meteorological-oceanographic simulations based on physical-mathematical models. In particular trying to reach credible local forecasts the two previous data sources are combined by algorithms that are essentially based on optimization processes. The conventional approaches in this framework usually neglect the topological-geometrical properties of the space of the data under study by adopting least square methods based on classical Euclidean geometry tools. In the present work new optimization techniques are discussed making use of methodologies from a rapidly advancing branch of applied Mathematics the Information Geometry. The latter prove that the distributions of data sets are elements of non-Euclidean structures in which the underlying geometry may differ significantly from the classical one. Geometrical entities like Riemannian metrics distances curvature and affine connections are utilized in order to define the optimum distributions fitting to the environmental data at specific areas and to form differential systems that describes the optimization procedures. The methodology proposed is clarified by an application for wind speed forecasts in the Kefaloniaisland Greece.

2014-01-01T23:59:59.000Z

336

Effect of dietary cysteine, methionine, and sterculic acid on fatty acid distribution in rat adipose tissue  

E-Print Network [OSTI]

EFFECT OF DIETARY CYSTEINE, MFTHIONINE, AND STERCULIC ACID ON FATTY ACID DISTRIBUTION IN RAT ADIPOSE TISSUE A Thesis By MARY FRANCES BROTZE Submitted to the Graduate College of the Texas A(M University in partial fulfillment... of the requirements for the degree of MASTER OF SCIENCE January 1968 Major Subject: BIOCHEMISTRY EFFECT OF DIETARY CYSTEINE, METHIONINE, AND STERCULIC ACID ON FATTY ACID DISTRIBUTION IN RAT ADIPOSE TISSUE A Thesis MAaY FRANCES BRC ~ '!E Approved as to style...

Brotze, Mary Frances

2012-06-07T23:59:59.000Z

337

Compact formulas for bounce/transit averaging in axisymmetric tokamak geometry  

E-Print Network [OSTI]

Compact formulas for bounce and transit orbit averaging of the fluctuation-amplitude eikonal factor in axisymmetric tokamak geometry, which is frequently encountered in bounce-gyrokinetic description of microturbulence, are given in terms of the Jacobi elliptic functions and elliptic integrals. These formulas are readily applicable to the calculation of the neoclassical susceptibility in the framework of modern bounce-gyrokinetic theory. In the long-wavelength limit, we recover the expression for the Rosenbluth-Hinton residual zonal flow [Rosenbluth and Hinton, Phys.~Rev.~Lett.~{\\bf 80}, 724 (1998)] accurately.

Duthoit, F -X; Hahm, T S

2014-01-01T23:59:59.000Z

338

Layered reactive particles with controlled geometries, energies, and reactivities, and methods for making the same  

DOE Patents [OSTI]

An energetic composite having a plurality of reactive particles each having a reactive multilayer construction formed by successively depositing reactive layers on a rod-shaped substrate having a longitudinal axis, dividing the reactive-layer-deposited rod-shaped substrate into a plurality of substantially uniform longitudinal segments, and removing the rod-shaped substrate from the longitudinal segments, so that the reactive particles have a controlled, substantially uniform, cylindrically curved or otherwise rod-contoured geometry which facilitates handling and improves its packing fraction, while the reactant multilayer construction controls the stability, reactivity and energy density of the energetic composite.

Fritz, Gregory M; Knepper, Robert Allen; Weihs, Timothy P; Gash, Alexander E; Sze, John S

2013-04-30T23:59:59.000Z

339

Nonsupersymmetric smooth geometries and D1-D5-P bound states  

Science Journals Connector (OSTI)

We construct smooth nonsupersymmetric soliton solutions with D1-brane, D5-brane, and momentum charges in type IIB supergravity compactified on T4S1, with the charges along the compact directions. This generalizes previous studies of smooth supersymmetric solutions. The solutions are obtained by considering a known family of U(1)U(1) invariant metrics, and studying the conditions imposed by requiring smoothness. We discuss the relation of our solutions to states in the CFT describing the D1-D5 system and describe various interesting features of the geometry.

Vishnu Jejjala; Owen Madden; Simon F. Ross; Georgina Titchener

2005-06-24T23:59:59.000Z

340

New method for computing ideal MHD normal modes in axisymmetric toroidal geometry  

SciTech Connect (OSTI)

Analytic elimination of the two magnetic surface components of the displacement vector permits the normal mode ideal MHD equations to be reduced to a scalar form. A Galerkin procedure, similar to that used in the PEST codes, is implemented to determine the normal modes computationally. The method retains the efficient stability capabilities of the PEST 2 energy principle code, while allowing computation of the normal mode frequencies and eigenfunctions, if desired. The procedure is illustrated by comparison with earlier various of PEST and by application to tilting modes in spheromaks, and to stable discrete Alfven waves in tokamak geometry.

Wysocki, F.; Grimm, R.C.

1984-11-01T23:59:59.000Z

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

The effect of geometry on the design of filament-wound fiberglass tension lugs  

E-Print Network [OSTI]

carrying capa- b1lity and the location of failure or1g1nation due to static loads applied uniaxially to 52/E773 glass/epoxy specimens is considered. Three configurations are studied, each having ident1cal cross-sectional areas. They d1ffer only... Chairman of Adv1sory Comm1ttee: Dr. Richard M. Alexander Finite element analys1s is employed to characterize the mechanical behav1or of f1lament-wound f1berglass racetrack style tens1on lugs as a function of lug geometry. The effect on ultimate load...

Braswell, James Lee

2012-06-07T23:59:59.000Z

342

Performance and emission enhancements of a variable geometry turbocharger on a heavy-duty diesel engine  

Science Journals Connector (OSTI)

Variable Geometry Turbochargers (VGTs) have emerged in the heavy-duty diesel market with the simultaneous introduction of Exhaust Gas Recirculation (EGR) in meeting emission standards. From a military perspective, VGTs offer considerable promise of improving low speed torque and overall fuel economy. Despite these gains, nitric oxides (NOx) emissions generally increase with increased boost. During times when the military can reduce its environmental impact, VGTs can drive EGR and counter the increase in NOx emissions with relatively minor penalty in particulate matter (PM) emissions. This study highlights the performance and emission enhancements enabled by a VGT on a heavy-duty diesel engine.

Timothy J. Jacobs; Chad Jagmin; Wesley J. Williamson; Zoran S. Filipi; Dennis N. Assanis; Walter Bryzik

2008-01-01T23:59:59.000Z

343

Equilibrium Geometries, Reaction Pathways, and Electronic Structures of Ethanol Adsorbed on the Si (111) Surface  

E-Print Network [OSTI]

Equilibrium atomic configurations and electron energy structure of ethanol adsorbed on the Si (111) surface are studied by the first-principles density functional theory. Geometry optimization is performed by the total energy minimization method. Several equilibrium atomic configurations of ethanol, both undissociated and dissociated, on the Si (111) surface are found. Reaction pathways and predicted transition states are discussed in comparison with available experimental data in terms of the feasibility of the reactions occurring. Analysis of atom and orbital resolved projected density of states indicate substantial modifications of the Si surface valence and conduction bands due to the adsorption of ethanol affecting the electrical properties of the surface.

Gavrilenko, A V; Gavrilenko, V I

2008-01-01T23:59:59.000Z

344

Further Investigation of Fluoboric Acid in Sandstone Acidizing Using ^(11)B and ^(19)F NMR  

E-Print Network [OSTI]

Although fluoboric acid (HBF_(4)) has long been known as one of the low-damaging acid treatments for clayey sandstone formations, little is known of its chemistry which could explain the mixed results of fluoboric acid in actual field application. A...

Pituckchon, Arpajit

2014-05-01T23:59:59.000Z

345

Effect of defaunation and amino acid supplementation on growth and amino acid balance in growing sheep  

E-Print Network [OSTI]

, and the wool growth. The supplementation with protected amino acids may increase the growth rate and may lead and the addition of protected methionine and lysine on animal growth and amino acids digestibility in the body week for 9 weeks. Amino acids were determined in feed, blood, wool and feces in order to calculate

Paris-Sud XI, Université de

346

Nitrates and Prussic Acid in Forages  

E-Print Network [OSTI]

When nitrates and prussic acid accumulate in forage, the feed may not be safe for livestock consumption. Learn the symptoms of nitrate and prussic acid poisoning and which plants are most likely to pose a risk to livestock. Also learn sampling...

Provin, Tony; Pitt, John L.

2003-01-06T23:59:59.000Z

347

Naphthenic acid corrosion by Venezuelan crudes  

SciTech Connect (OSTI)

Venezuelan crudes can contain levels of naphthenic acids that cause corrosion in distillation units designed for sweet crudes. This naphthenic acid corrosion can be mitigated in several ways, the most common of which is selective alloying. This paper will provide information from field experience on how various refineries worldwide have upgraded materials to run Venezuelan crudes in a cost effective way.

Hopkinson, B.E.; Penuela, L.E. [Lagoven, S.A., Judibana (Venezuela). Amuay Refinery

1997-09-01T23:59:59.000Z

348

Naphthenic acid corrosion in crude distillation units  

SciTech Connect (OSTI)

This paper summarizes corrosion experience in crude distillation units processing highly naphthenic California crude oils. Correlations have been developed relating corrosion rates to temperature and total acid number. There is a threshold acid number in the range of 1.5 to 2 mg KOH/g below which corrosion is minimal. High concentrations of hydrogen sulfide may raise this threshold value.

Piehl, R.L.

1988-01-01T23:59:59.000Z

349

CP violation, massive neutrinos, and its chiral condensate: new results from Snyder noncommutative geometry  

E-Print Network [OSTI]

The Snyder model of a noncommutative geometry due to a minimal scale $\\ell$, e.g. the Planck or the Compton scale, yields $\\ell^2$-shift within the Einstein Hamiltonian constraint, and $\\gamma^5$-term in the free Dirac equation violating CP symmetry manifestly. In this paper the Dirac equation is reconsidered. In fact, there is no any reasonable cause for modification of the Minkowski hyperbolic geometry of a momentum space. It is the consistency -- in physics phase space, spacetime (coordinates), and momentum space (dynamics) are independent mathematical structures. It is shown that the modified Dirac equation yields the kinetic mass generation mechanism for the left- and right-handed Weyl chiral fields, and realizes the idea of neutrinos receiving mass due to CP violation. It is shown that the model is equivalent to the gauge field theory of composed two 2-flavor massive fields. The global chiral symmetry spontaneously broken into the isospin group leads to the chiral condensate of massive neutrinos. This result is beyond the Standard Model, but in general can be included into the theory of elementary particles and fundamental interactions.

L. A. Glinka

2009-02-27T23:59:59.000Z

350

THE EFFECTS OF MAGNETIC-FIELD GEOMETRY ON LONGITUDINAL OSCILLATIONS OF SOLAR PROMINENCES  

SciTech Connect (OSTI)

We investigate the influence of the geometry of the solar filament magnetic structure on the large-amplitude longitudinal oscillations. A representative filament flux tube is modeled as composed of a cool thread centered in a dipped part with hot coronal regions on either side. We have found the normal modes of the system and establish that the observed longitudinal oscillations are well described with the fundamental mode. For small and intermediate curvature radii and moderate to large density contrast between the prominence and the corona, the main restoring force is the solar gravity. In this full wave description of the oscillation a simple expression for the oscillation frequencies is derived in which the pressure-driven term introduces a small correction. We have also found that the normal modes are almost independent of the geometry of the hot regions of the tube. We conclude that observed large-amplitude longitudinal oscillations are driven by the projected gravity along the flux tubes and are strongly influenced by the curvature of the dips of the magnetic field in which the threads reside.

Luna, M. [CRESST and Space Weather Laboratory NASA/GSFC, Greenbelt, MD 20771 (United States); Diaz, A. J. [Instituto de Astrofisica de Canarias, E-38200 La Laguna, Tenerife (Spain); Karpen, J. [NASA/GSFC, Greenbelt, MD 20771 (United States)

2012-09-20T23:59:59.000Z

351

Chip fractal geometry and loading characteristics of sinusoidal multi-cutters in hack-sawing process  

Science Journals Connector (OSTI)

This work proposed a sinusoidal-type discrete analytic geometry model and derives sinusoidal serrated chip loading characteristics equation for the simulation of the hack-saw reciprocating mechanism by the cutter analytic geometry. The chip loading with different wavelength units in hack-sawing process are studied. The factors affecting chip loading of unit wave, namely the length of the wavelength, the cutters numbers of unit wavelength, saw blade thickness, the equivalent cutting depth per tooth, the cutting overlap-area ratio per cutter edge, the pitch per each cutter, the cutting overlap-area factor, and the proportional factor of sinusoidal amplitude are investigated. The effects of sinusoidal cutter arrangement on chip loading are simulated by the chip loading equations. It is found that the maximum chip loading is always in the front of the cutters, which is at either the peak or the trough of different phase, while the numbers of wavelength unit is 3, 5, 7 and 40, respectively. The chip loading characteristics depend on the convolution of chip loading function, the cutter order window function and the cutter interval function. The simulated results from the established cutting force model for sinusoidal multi-cutters agree well with the experimental measurements. The wear location and failure types of cutters could be predicted for in hack-sawing process.

J.-J. Junz Wang; Sung-Hua Wu; Rong-Shean Lee

2012-01-01T23:59:59.000Z

352

Minimizing manganin/system noise for potential use in small geometry experiments  

SciTech Connect (OSTI)

Manganin gauges are piezo resistive devices often used for pressure measurements on larger, planer impact experiments. These gauges function in this capacity as a result of their ability to change resistance in a consistent fashion relative to the pressure exerted against them. Pressures to 400 kbar have been reliably recorded (H.C. Vantine et al.[1]). Because the mini-manganin is significantly physically smaller than other types, there has been interest in the ability to place these gauges on small geometry (detonator) type experiments. Of primary concern is that the detonator shock front has significant curvature associated with it--especially at small geometries--and that this curvature will cause unknown distortion (stretching) of the manganin gauge and therefore may indicate erroneous data. A problem encountered while configuring this experiment was noise as a result of the proximity and high current levels of the fireset to the manganin gauge. Initial results indicate noise on the order of 130 mV peak-to-peak (p-p) and running as long as the CVR signal from the ringdown charge voltage of 775 V. These noise problems significantly worsened while discharging the full charge voltage of 1500 V on the fireset through the chip slapper.

Phillips, D; May, C; Vandersall, K; Garcia, F

2008-10-02T23:59:59.000Z

353

Magnetoimpedance effect at the high frequency range for the thin film geometry: Numerical calculation and experiment  

E-Print Network [OSTI]

The magnetoimpedance effect is a versatile tool to investigate ferromagnetic materials, revealing aspects on the fundamental physics associated to magnetization dynamics, broadband magnetic properties, important issues for current and emerging technological applications for magnetic sensors, as well as insights on ferromagnetic resonance effect at non-saturated magnetic states. Here, we perform a theoretical and experimental investigation of the magnetoimpedance effect for the thin film geometry in a wide frequency range. We calculate the longitudinal magnetoimpedance for single layered, multilayered or exchange biased systems from an approach that considers a magnetic permeability model for planar geometry and the appropriate magnetic free energy density for each structure. From numerical calculations and experimental results found in literature, we analyze the magnetoimpedance behavior, and discuss the main features and advantages of each structure. To test the robustness of the approach, we directly compare theoretical results with experimental magnetoimpedance measurements obtained in a wide range of frequencies for an exchange biased multilayered film. Thus, we provide experimental evidence to confirm the validity of the theoretical approach employed to describe the magnetoimpedance in ferromagnetic films, revealed by the good agreement between numerical calculations and experimental results.

M. A. Corra; F. Bohn; R. B. da Silva; R. L. Sommer

2014-11-04T23:59:59.000Z

354

Critical Parameters of Complex Geometries of Intersecting Cylinders Containing Uranyl Nitrate Solution  

SciTech Connect (OSTI)

About three dozen previously unreported critical configurations are presented for very complex geometries filled with high concentration enriched uranyl nitrate solution. These geometries resemble a tall, thin Central Column (or trunk of a ''tree'') having long, thin arms (or ''branches'') extending up to four directions off the column. Arms are equally spaced from one another in vertical planes, and that spacing ranges from arms in contact to quite wide spacings. Both the Central Column and the many different arms are critically safe by themselves with each, alone, is filled with fissile solution; but, in combination, criticality occurs due to the interactions between arms and the column. Such neutronic interactions formed the principal focus of this study. While these results are fresh to the nuclear criticality safety industry and to those seeking novel experiments against which to validate computer codes, the experiments, themselves, are not recent. Over 100 experiments were performed at the Rocky Flats Critical Mass Laboratory between September, 1967, and February of the following year.

J. B. Briggs (INEEL POC); R. E. Rothe

1999-06-14T23:59:59.000Z

355

Effect of geometry on concentration polarization in realistic heterogeneous permselective systems  

E-Print Network [OSTI]

This study extends previous analytical solutions of concentration-polarization occurring solely in the depleted region, to the more realistic geometry consisting of a three dimensional (3D) heterogeneous ion-permselective medium connecting two opposite microchambers (i.e. 3 layers system). Under the local electro-neutrality approximation, the separation of variable methods is used to derive an analytical solution of the electro-diffusive problem for the two opposing asymmetric microchambers. Assuming an ideal permselective medium allows for the analytic calculation of the 3D concentration and electric potential distributions as well as a current-voltage relation. It is shown that any asymmetry in the microchamber geometries will result in current rectification. Moreover, it is demonstrated that for non-negligible microchamber resistances the conductance does not exhibit the expected saturation at low concentrations but instead shows a continuous decrease. The results are intended to facilitate a more direct comparison between theory and experiments as now the voltage drop is across a realistic 3D and 3-layer system.

Yoav Green; Shahar Shloush; Gilad Yossifon

2014-06-18T23:59:59.000Z

356

Arginine and Conjugated Linoleic Acid Reduce Fat Mass in Rats  

E-Print Network [OSTI]

????????????????????.. 3 Nitric oxide (NO)????????????????????... 3 NOS synthesis by iNOS and obesity?????????????. 4 Stearoyl CoA desaturase?????????????????? 5 Conjugated linoleic acid?????????????????? 5 MATERIALS... on a liquid scintillation counter. 12 Fatty acid analysis Fatty acid composition in liver and plasma was determined using a fatty acid methylation procedure (FAME). Fatty acids were extracted using Folch et al (38) methods. Methylation...

Nall, Jennifer L.

2010-10-12T23:59:59.000Z

357

A base pair between tRNA and 235 rRNA in the peptidyl transferase centre of the ribosome  

Science Journals Connector (OSTI)

... 235 rRNA in the peptidyl transferase centre of the ribosome Raymond R.SamahaR. R.RachelGreenR.Harry F.NollerH. F. Nature 377, 309-314(1995)

Raymond R. Samaha; Rachel Green; Harry F. Noller

1995-11-23T23:59:59.000Z

358

NMR and molecular modeling evidence for a G.A mismatch base pair in a purine-rich DNA duplex  

Science Journals Connector (OSTI)

...group is critical. Nuclear Overhauser effect...ATGAGC)]. The energy-minimized duplex...group is critical. Nuclear Overhauser effect...ATGAGC)]. The energy-minimized duplex...recycle delay. 1D nuclear Overhauser effect...Still (24) and energy minimizations were...

Y Li; G Zon; W D Wilson

1991-01-01T23:59:59.000Z

359

Combined Monte Carlo and quantum mechanics study of the hydration of the guanine-cytosine base pair  

Science Journals Connector (OSTI)

We present a computer simulation study of the hydration of the guanine-cytosine (GC) hydrogen-bonded complex. Using first principles density-functional theory, with gradient-corrected exchange-correlation and Monte Carlo simulation, we include thermal contribution, structural effects, solvent polarization, and the water-water and water-GC hydrogen bond interaction to show that the GC interaction in an aqueous environment is weakened to about 70% of the value obtained for an isolated complex. We also analyze in detail the preferred hydration sites of the GC pair and show that on the average it makes around five hydrogen bonds with water.

Kaline Coutinho; Valdemir Ludwig; Sylvio Canuto

2004-06-01T23:59:59.000Z

360

Geometry and symmetry presculpt the free-energy landscape of proteins  

Science Journals Connector (OSTI)

...Hoang Antonio Trovato Flavio Seno Jayanth R. Banavar Amos Maritan * Institute of...acids. The local radius of curvature r is defined as the radius of the circle...Chem . 23 , 283 438. 4882249 12 Pappu, R. V., Srinivasan, R. & Rose, G. D...

Trinh Xuan Hoang; Antonio Trovato; Flavio Seno; Jayanth R. Banavar; Amos Maritan

2004-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Experimental Study of Acid Fracture Conductivity of Austin Chalk Formation  

E-Print Network [OSTI]

Acid fracture conductivity and the effect of key variables in the etching process during acid fracturing can be assessed at the laboratory scale. This is accomplished by using an experimental apparatus that simulates acid injection fluxes comparable...

Nino Penaloza, Andrea

2013-05-01T23:59:59.000Z

362

Experimental High Velocity Acid Jetting in Limestone Carbonates  

E-Print Network [OSTI]

Acid jetting is a well stimulation technique that is used in carbonate reservoirs. It typically involves injecting acid down hole at high flow rates through small orifices which cause high velocities of acid to strike the borehole wall...

Holland, Christopher

2014-04-30T23:59:59.000Z

363

Investigations of amino acid-based surfactants at liquid interfaces  

E-Print Network [OSTI]

Herein are presented collective studies of amino acid-based surfactants, also known as lipoamino acids, at liquid interfaces. Chapter III describes an investigation of domain morphology of N-Stearoylglutamic acid (N-SGA) Langmuir monolayers...

Yang, Dengliang

2005-11-01T23:59:59.000Z

364

A COMPARISON OF MEASURED AND CALCULATED GAMMA RAY ATTENUATION FOR A COMMON COUNTING GEOMETRY  

SciTech Connect (OSTI)

In order to perform quantitative gamma spectroscopy, it is necessary to know the sample-specific detection efficiency for photons as a function of energy. The detection efficiency, along with the branching ratio for the isotope and gamma ray of interest, is used to convert observed counts/second to actual disintegrations/second, and, hence, has a large effect on the accuracy of the measurement. In cases where the geometry of the source is simple and reproducible, such as a point source, small vial of solid, or jar of liquid, geometry-specific standards may be counted to determine the detection efficiency. In cases where the samples are large, irregular, or unique, this method generally cannot be used. For example, it is impossible to obtain a NIST-traceable standard glovebox or 55-gallon drum. In these cases, a combination of measured absolute detector efficiency and calculated sample-specific correction factors is commonly used. The correction factors may be calculated via Monte Carlo simulation of the item (the method used by Canberra's ISOCS system), or via semi-empirical calculation of matrix and container attenuations based on the thickness and composition of the container and radioactive matrix (ISOTOPIC by EG&G Ortec uses this method). The accuracy of these correction factors for specific geometries is often of vital interest when assessing the quality of gamma spectroscopy data. During the Building 251 Risk-Reduction Project, over 100 samples of high activity actinides will be characterized via gamma spectroscopy, typically without removing the material from the current storage containers. Most of the radioactive materials in B-251 are stored in cylindrical stainless steel canisters (called USV containers, after the Underground Storage Vaults they are commonly stored in), 13 cm in diameter, by 28 cm high, with walls that are 1.8 mm thick. While the actual samples have a variety of configurations inside the USV container, a very common configuration is the material (usually as an oxide powder pellet of approximately 2 cm diameter by {approx}2 mm thick) in a squat glass jar, with the jar placed in a thin steel food-pack can, which is then placed in the bottom of the USV canister. During data acquisition, the USV containers are typically rotated at approximately 4 rpm on a turntable to eliminate errors due to the material not being centered in the can, or attenuation not being isotropic. An aluminum plate is placed over the container, secured by three vertical rods, to securely hold the container. Pictures of both the containers, and this typical counting configuration are shown below.

Gaylord, R F

2004-02-26T23:59:59.000Z

365

Naphthenic acid corrosion in refinery settings  

SciTech Connect (OSTI)

Naphthenic acid corrosion has been a problem in the refining industry for many years. Recently interest in this problem has grown because crudes that contain naphthenic acid are being recovered from areas which were not known to produce this type of crude, such as china, India, and Africa. New techniques for identifying naphthenic acid corrosion and chemical treatments for preventing this attack are presented. Refinery case studies include stream analysis, failure analysis, and inhibitor use. Laboratory tests to show the effect of hydrogen sulfide and phosphorus-based inhibitors are discussed.

Babaian-Kibala, E. (Nalco Chemical Co., Sugar Land, TX (United States)); Craig, H.L. Jr. (Mobil Research and Development Corp., Paulsboro, NJ (United States)); Rusk, G.L. (Mobil Oil Co., Torrance, CA (United States)); Blanchard, K.V.; Rose, T.J.; Uehlein, B.L. (Nalco Chemical Co., Paulsboro, NJ (United States)); Quinter, R.C. (Sun Co., Newtown Square, PA (United States)); Summers, M.A. (Sun Co., Marcus Hook, PA (United States))

1993-04-01T23:59:59.000Z

366

Aerobic Heterotrophic Bacteria Indigenous to pH 2.8 Acid Mine Water: Microscopic Examination of Acid Streamers  

Science Journals Connector (OSTI)

...streamers" found in acid coal mine drainage consist of bacteria...than one species. Acidic coal mine drainage is characterized...of 11 states that comprise Appalachia and includes numerous other coal mining areas ofthe world. The acidic...

Patrick R. Dugan; Carol B. MacMillan; Robert M. Pfister

1970-03-01T23:59:59.000Z

367

Studying Cellulose Fiber Structure by SEM, XRD, NMR and Acid...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Studying Cellulose Fiber Structure by SEM, XRD, NMR and Acid Hydrolysis. Abstract: Cotton linters were partially hydrolyzed in dilute acid and the morphology of remaining...

368

adenylic acid: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

preservation A Rauramaa A Tommila J Ltd, Espoo Reseach Centre, PO Box 44, 02271 Espoo, Finland Formic acid is known to improve silage hygienic quality. Formic acid based...

369

acid rain program: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

preservation A Rauramaa A Tommila J Ltd, Espoo Reseach Centre, PO Box 44, 02271 Espoo, Finland Formic acid is known to improve silage hygienic quality. Formic acid based...

370

Formation of iron complexs from trifluoroacetic acid based liquid...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of iron complexs from trifluoroacetic acid based liquid chromatography mobile phases as interference ions in liquid Formation of iron complexs from trifluoroacetic acid based...

371

Copper isotope fractionation in acid mine drainage. | EMSL  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Copper isotope fractionation in acid mine drainage. Copper isotope fractionation in acid mine drainage. Abstract: We surveyed the Cu isotopic composition of primary minerals and...

372

Hydrogen-bond acidic functionalized carbon nanotubes (CNTs) with...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Hydrogen-bond acidic functionalized carbon nanotubes (CNTs) with covalently-bound hexafluoroisopropanol groups. Hydrogen-bond acidic functionalized carbon nanotubes (CNTs) with...

373

AVTA: 2010 Honda Civic HEV with Experimental Ultra Lead Acid...  

Broader source: Energy.gov (indexed) [DOE]

2010 Honda Civic HEV with Experimental Ultra Lead Acid Battery Testing Results AVTA: 2010 Honda Civic HEV with Experimental Ultra Lead Acid Battery Testing Results The Vehicle...

374

Effects of Continuous Triiodothyronine Infusion on Citric Acid...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Continuous Triiodothyronine Infusion on Citric Acid Cycle in the Normal Immature Swine Heart under Extracorporeal Effects of Continuous Triiodothyronine Infusion on Citric Acid...

375

Acid Initiation of Ammonia-Borane Dehydrogenation for Hydrogen...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Acid Initiation of Ammonia-Borane Dehydrogenation for Hydrogen Storage. Acid Initiation of Ammonia-Borane Dehydrogenation for Hydrogen Storage. Abstract: An abstract for this...

376

Optical characterization of a reference instrument for gloss measurements in both a collimated and a converging beam geometry  

SciTech Connect (OSTI)

A reference instrument has been developed at the National Research Council of Canada for rapid, reproducible specular gloss measurements. The design and validation of this instrument for specular gloss measurements in accordance with standard methods for paints and plastics at 20 deg., 60 deg., and 85 deg. geometries [American Society for Testing and Materials (ASTM) D523 and the International Organization for Standards (ISO) 2813] have been recently reported. These standard methods require a collimated beam geometry. Here we present the optical design considerations and characterization of this instrument to extend its gloss measurement capabilities to specular gloss measurements of paper samples at 75 deg. geometry in accordance with standard test methods requiring a converging beam geometry (ASTM D1223 and TAPPI T480). This is, to the best of our knowledge, the first reported reference instrument that provides direct traceability for both types of standard gloss method and applications. The design challenge was to convert from a collimated beam to converging beam geometry while meeting the rigorous requirements of beam uniformity at the sample and receptor apertures specified in the 75 deg. geometry test methods. We describe the innovative design to achieve this degree of functionality and reference instrument performance. The instrument's optical performance has been characterized theoretically and by comparison with measurement results. The light collection and detection systems have been analyzed via Monte Carlo simulation and ray tracing. The instrument validation includes comparison of the measurement results with theoretical gloss values for quartz, black glass, Vitrolite, and mirror gloss working standards, giving agreement of better than 0.32%. Measurement validation also involved participation in the Collaborative Testing Services program interlaboratory comparison measurements of 75 deg. gloss for white papers.

Noel, Mario; Zwinkels, Joanne; Liu Jian

2006-06-01T23:59:59.000Z

377

Geometry, Heat Removal and Kinetics Scoping Models for Hydrogen Storage Systems  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

WSRC-TR-2007-00439, REVISION 0 WSRC-TR-2007-00439, REVISION 0 Keywords: Hydrogen Kinetics, Hydrogen Storage Vessel Metal Hydride Retention: Permanent Geometry, Heat Removal and Kinetics Scoping Models for Hydrogen Storage Systems Bruce J. Hardy November 16, 2007 Washington Savannah River Company Savannah River Site Aiken, SC 29808 Prepared for the U.S. Department of Energy Under Contract Number DEAC09-96-SR18500 DISCLAIMER This report was prepared for the United States Department of Energy under Contract No. DE-AC09-96SR18500 and is an account of work performed under that contract. Neither the United States Department of Energy, nor WSRC, nor any of their employees makes any warranty, expressed or implied, or assumes any legal liability or responsibility for accuracy, completeness, or

378

Surprising Coordination Geometry Differences in Ce(IV)- and Pu(IV)-Maltol Complexes  

SciTech Connect (OSTI)

As part of a study to characterize the detailed coordination behavior of Pu(IV), single crystal X-ray diffraction structures have been determined for Pu(IV) and Ce(IV) complexes with the naturally-occurring ligand maltol (3-hydroxy-2-methyl-pyran-4-one) and its derivative bromomaltol (5-bromo-3-hydroxy-2-methyl-pyran-4-one). Although Ce(IV) is generally accepted as a structural analog for Pu(IV), and the maltol complexes of these two metals are isostructural, the corresponding bromomaltol complexes are strikingly different with respect to ligand orientation about the metal ion: All complexes exhibit trigonal dodecahedral coordination geometry but the Ce(IV)-bromomaltol complex displays an uncommon ligand arrangement not mirrored in the Pu(IV) complex, although the two metal species are generally accepted to be structural analogs.

Lawrence Berkeley National Laboratory; Raymond, Kenneth; Szigethy, Geza; Xu, Jide; Gorden, Anne E.V.; Teat, Simon J.; Shuh, David K.; Raymond, Kenneth N.

2008-02-12T23:59:59.000Z

379

The Wasserstein geometry of non-linear sigma models and the Hamilton-Perelman Ricci flow  

E-Print Network [OSTI]

Non linear sigma models are quantum field theories describing, in the large deviations sense, random fluctuations of harmonic maps between a Riemann surface and a Riemannian manifold. Via their formal renormalization group analysis, they provide a framework for possible generalizations of the Hamilton-Perelman Ricci flow. By exploiting the heat kernel embedding introduced by N. Gigli and C. Mantegazza, we show that the Wasserstein geometry of the space of probability measures over Riemannian metric measure spaces provides a natural setting for discussing the relation between non-linear sigma models and Ricci flow theory. This approach provides a rigorous model for the embedding of Ricci flow into the renormalization group flow for non linear sigma models, and characterizes a non-trivial generalization of the Hamilton-Perelman version of the Ricci flow. We discuss in detail the monotonicity and gradient flow properties of this extended flow.

Mauro Carfora

2014-05-05T23:59:59.000Z

380

A comparison of four direct geometry time-of-flight spectrometers at the Spallation Neutron Source  

SciTech Connect (OSTI)

The Spallation Neutron Source at Oak Ridge National Laboratory now hosts four direct geometry time-of-flight chopper spectrometers. These instruments cover a range of wave-vector and energy transfer space with varying degrees of neutron flux and resolution. The regions of reciprocal and energy space available to measure at these instruments are not exclusive and overlap significantly. We present a direct comparison of the capabilities of this instrumentation, conducted by data mining the instrument usage histories, and specific scanning regimes. In addition, one of the common science missions for these instruments is the study of magnetic excitations in condensed matter systems. We have measured the powder averaged spin wave spectra in one particular sample using each of these instruments, and use these data in our comparisons.

Stone, M. B.; Abernathy, D. L.; Ehlers, G.; Garlea, O.; Podlesnyak, A.; Winn, B. [Quantum Condensed Matter Science Division, Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States)] [Quantum Condensed Matter Science Division, Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States); Niedziela, J. L.; DeBeer-Schmitt, L.; Graves-Brook, M. [Instrument and Source Division, Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States)] [Instrument and Source Division, Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States); Granroth, G. E. [Neutron Data Analysis and Visualization Division, Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States)] [Neutron Data Analysis and Visualization Division, Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States); Kolesnikov, A. I. [Chemical and Engineering Materials Division, Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States)] [Chemical and Engineering Materials Division, Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States)

2014-04-15T23:59:59.000Z

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

A comparison of four direct geometry time-of-flight spectrometers at the Spallation Neutron Source  

SciTech Connect (OSTI)

The Spallation Neutron Source at Oak Ridge National Laboratory now hosts four direct geometry time-of-flight chopper spectrometers. These instruments cover a range of wave vector and energy transfer space with varying degrees of neutron flux and resolution. The regions of reciprocal and energy space available to measure at these instruments is not exclusive and overlaps significantly. We present a direct comparison of the capabilities of this instrumentation, conducted by data mining the instrument usage histories, and specific scanning regimes. In addition, one of the common science missions for these instruments is the study of magnetic excitations in condensed matter systems. We have measured the powder averaged spin wave spectra in one particular sample using each of these instruments, and use these data in our comparisons.

Stone, Matthew B [ORNL] [ORNL; Niedziela, Jennifer L [ORNL] [ORNL; Abernathy, Douglas L [ORNL] [ORNL; Debeer-Schmitt, Lisa M [ORNL] [ORNL; Garlea, Vasile O [ORNL] [ORNL; Granroth, Garrett E [ORNL] [ORNL; Graves-Brook, Melissa K [ORNL] [ORNL; Ehlers, Georg [ORNL] [ORNL; Kolesnikov, Alexander I [ORNL] [ORNL; Podlesnyak, Andrey A [ORNL] [ORNL; Winn, Barry L [ORNL] [ORNL

2014-01-01T23:59:59.000Z

382

Lattice Boltzmann method for heat diffusion in axis-symmetric geometries  

Science Journals Connector (OSTI)

Lattice Boltzmann Methods (LBM) have been used to solve momentum, heat and mass transport equations mainly in Cartesian coordinate system. In the present work, the LBM is extended to solve transports in axis-symmetric geometries, such as pipes and spheres. Heat diffusion and conduction in solids without and with heat generation were tested. The heat diffusion equation for axis-symmetric problem is reduced to diffusion equation as in Cartesian coordinate with an extra term due to the surface area variation along the radial direction. The extra term is treated as a source term (forcing term) in LBM. The extra term can be approximated by using finite difference or more accurately as a flux term. The results predicted by LBM are well compared with analytical solutions and finite volume method.

A.A. Mohamad

2009-01-01T23:59:59.000Z

383

On-engine evaluation of emission characteristics of a variable geometry lean-premixed combustor  

SciTech Connect (OSTI)

The design and on-engine testing of a lean-premixed, low-NO{sub x} combustor for a simple-cycle, single-shaft, 250-kW gas turbine engine of a pressure ratio of eight are described. A variable-geometry system composed of butterfly air valves was used to control the combustor air split between combustion and dilution. Fuel was staged to a direct-injection pilot burner, and a lean-premixed main burner was fitted to the combustor liner. The NO{sub x} emissions with natural gas fueling were found to be less than 20 ppm (at 5% O{sub 2}) at and near full-load conditions with combustion efficiencies greater than 99.8%. Emissions data from early high-pressure rig tests of the combustor hardware are also presented.

Yamada, H.; Shimodaira, K.; Hayashi, S. [National Aerospace Lab., Tokyo (Japan). Thermofluid Dynamics Div.

1997-01-01T23:59:59.000Z

384

Impact of geometry on light collection efficiency of scintillation detectors for cryogenic rare event searches  

E-Print Network [OSTI]

Simulations of photon propagation in scintillation detectors were performed with the aim to find the optimal scintillator geometry, surface treatment, and shape of external reflector in order to achieve maximum light collection efficiency for detector configurations that avoid direct optical coupling, a situation that is commonly found in cryogenic scintillating bolometers in experimental searches for double beta decay and dark matter. To evaluate the light collection efficiency of various geometrical configurations we used the ZEMAX ray-tracing software. It was found that scintillators in the shape of a triangular prism with an external mirror shaped as truncated cone gives the highest light collection efficiency. The results of the simulations were confirmed by carrying out measurements of the light collection efficiencies of CaWO4 crystal scintillators. A comparison of simulated and measured values of light output shows good agreement

F. A. Danevich; V. V. Kobychev; R. V. Kobychev; H. Kraus; V. B. Mikhailik; V. M. Mokina; I. M. Solsky

2014-04-30T23:59:59.000Z

385

Impact of geometry on light collection efficiency of scintillation detectors for cryogenic rare event searches  

E-Print Network [OSTI]

Simulations of photon propagation in scintillation detectors were performed with the aim to find the optimal scintillator geometry, surface treatment, and shape of external reflector in order to achieve maximum light collection efficiency for detector configurations that avoid direct optical coupling, a situation that is commonly found in cryogenic scintillating bolometers in experimental searches for double beta decay and dark matter. To evaluate the light collection efficiency of various geometrical configurations we used the ZEMAX ray-tracing software. It was found that scintillators in the shape of a triangular prism with an external mirror shaped as truncated cone gives the highest light collection efficiency. The results of the simulations were confirmed by carrying out measurements of the light collection efficiencies of CaWO4 crystal scintillators. A comparison of simulated and measured values of light output shows good agreement

Danevich, F A; Kobychev, R V; Kraus, H; Mikhailik, V B; Mokina, V M; Solsky, I M

2014-01-01T23:59:59.000Z

386

Studies of Low-Current Back-Discharge in Point-Plane Geometry with Dielectric Layer  

SciTech Connect (OSTI)

The paper presents results of spectroscopic investigations of back-discharges generated in the point-plane electrode geometry in ambient air at atmospheric pressure, with the plane electrode covered with a dielectric layer. Fly ash from an electrostatic precipitator of a coal-fired power plant was used as the dielectric layer in these investigations. The discharges for positive and negative polarities of the needle electrode were studied by measuring optical emission spectra at two regions of the discharge: near the needle electrode and dielectric layer surface. The visual forms of the discharge were recorded and correlated with the current-voltage characteristics and optical emission spectra. The back-arc discharge was of particular interest in these studies due to its detrimental effects it causes in electrostatic precipitators.

Jaworek, Anatol; Rajch, Eryk [Institute of Physics Pomeranian Pedagogical Academy, Arciszewskiego 22b, 76-200 Slupsk (Poland); Krupa, Andrzej; Czech, Tadeusz; Lackowski, Marcin [Institute of Fluid Flow Machinery, Polish Academy of Sciences, Fiszera 14, 80-952 Gdansk (Poland)

2006-01-15T23:59:59.000Z

387

Steam-Methane Reformer Kinetic Computer Model with Heat Transfer and Geometry Options  

SciTech Connect (OSTI)

A kinetic computer model of a steam/methane reformer has been developed as a design and analytical tool for a fuel cell system's fuel conditioner. This model has reaction, geometry, flow arrangement, and heat transfer options. Model predictions have been compared to previous experimental data, and close agreement was obtained. Initially, the Leva-type, packed-bed, heat transfer correlations were used. However, calculations based upon the reacting, reformer gases indicate a considerably higher heat transfer coefficient for this reforme design. Data analysis from similar designs in the literature also shows this phenomenon. This is thought to be reaction-induced effect, brought about by the changing of gas composition, the increased gas velocity, the lower catalyst temperature during reaction, and the higher thermal and reaction gradients involved in compact fuel cell reformer designs. Future experimental work is planned to verify the model's predictions further.

Murray, A.P.; Snyder, T.S.

1985-04-01T23:59:59.000Z

388

IBIS: An inverse geometry Brillouin inelastic neutron spectrometer for the SNS  

SciTech Connect (OSTI)

The high power target station at the Spallation Neutron Source (SNS) currently has about 20 completed neutron scattering instruments. With a broad coverage of the momentum transfer (Q)-energy (E) space, these instruments serve an extensive user community. In an effort to further expand the scientific capabilities of the SNS instrument suites, we propose a low background, inverse geometry Brillouin inelastic spectrometer for the SNS which will expand the Q-E coverage of the current instrument suite and facilitate the study of inelastic and quasi-elastic scatterings at low Q values. The possible location for the proposed instrument is either beamline 8 which views the decoupled water moderator, or beamline 14A, which views a cold, coupled super critical hydrogen moderator. The instrument parameters, optimizations, and performances at these two beamline locations are discussed.

Zhao, J. K.; Robertson, Lee; Herwig, Kenneth W. [Instrument and Source Development Division, Spallation Neutron Source, Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States); Wildgruber, Christoph U. [Chemical and Engineering Division, Spallation Neutron Source, Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States)

2013-02-15T23:59:59.000Z

389

Casimir Forces in a Piston Geometry at Zero and Finite Temperatures  

E-Print Network [OSTI]

We study Casimir forces on the partition in a closed box (piston) with perfect metallic boundary conditions. Related closed geometries have generated interest as candidates for a repulsive force. By using an optical path expansion we solve exactly the case of a piston with a rectangular cross section, and find that the force always attracts the partition to the nearest base. For arbitrary cross sections, we can use an expansion for the density of states to compute the force in the limit of small height to width ratios. The corrections to the force between parallel plates are found to have interesting dependence on the shape of the cross section. Finally, for temperatures in the range of experimental interest we compute finite temperature corrections to the force (again assuming perfect boundaries).

M. P. Hertzberg; R. L. Jaffe; M. Kardar; A. Scardicchio

2007-11-18T23:59:59.000Z

390

Multiple-Stripe Lithiation Mechanism of Individual SnO2 Nanowires in a Flooding Geometry  

Science Journals Connector (OSTI)

The atomic scale lithiation mechanism of individual SnO2 nanowires in a flooding geometry was revealed by insitu transmission electron microscopy. The lithiation was initiated by the formation of multiple stripes with a width of a few nanometers parallel to the (020) plane traversing the entire wires, serving as multiple reaction fronts for later stages of lithiation. Inside the stripes, we identified a high density of dislocations and enlarged interplanar spacing, which provided an effective path for lithium ion transport. The density of the stripes increased with further lithiation, and eventually they merged with one another, causing a large elongation, volume expansion, and the crystalline-to-amorphous phase transformation. This lithiation mechanism characterized by multiple stripes and multiple reaction fronts was unexpected and differed completely from the expected core-shell lithiation mechanism.

Li Zhong; Xiao Hua Liu; Guo Feng Wang; Scott X. Mao; Jian Yu Huang

2011-06-15T23:59:59.000Z

391

New Dimensions for Wound Strings:The Modular Transform of Geometry to Topology  

SciTech Connect (OSTI)

We show, using a theorem of Milnor and Margulis, that string theory on compact negatively curved spaces grows new effective dimensions as the space shrinks, generalizing and contextualizing the results in [1]. Milnor's theorem relates negative sectional curvature on a compact Riemannian manifold to exponential growth of its fundamental group, which translates in string theory to a higher effective central charge arising from winding strings. This exponential density of winding modes is related by modular invariance to the infrared small perturbation spectrum. Using self-consistent approximations valid at large radius, we analyze this correspondence explicitly in a broad set of time-dependent solutions, finding precise agreement between the effective central charge and the corresponding infrared small perturbation spectrum. This indicates a basic relation between geometry, topology, and dimensionality in string theory.

McGreevy, John; Silverstein, Eva; Starr, David

2006-12-18T23:59:59.000Z

392

Development of a general method for obtaining the geometry of microfluidic networks  

SciTech Connect (OSTI)

In the present study, a general method for geometry of fluidic networks is developed with emphasis on pressure-driven flows in the microfluidic applications. The design method is based on general features of network's geometry such as cross-sectional area and length of channels. Also, the method is applicable to various cross-sectional shapes such as circular, rectangular, triangular, and trapezoidal cross sections. Using constructal theory, the flow resistance, energy loss and performance of the network are optimized. Also, by this method, practical design strategies for the fabrication of microfluidic networks can be improved. The design method enables rapid prediction of fluid flow in the complex network of channels and is very useful for improving proper miniaturization and integration of microfluidic networks. Minimization of flow resistance of the network of channels leads to universal constants for consecutive cross-sectional areas and lengths. For a Y-shaped network, the optimal ratios of consecutive cross-section areas (A{sub i+1}/A{sub i}) and lengths (L{sub i+1}/L{sub i}) are obtained as A{sub i+1}/A{sub i} = 2{sup ?2/3} and L{sub i+1}/L{sub i} = 2{sup ?1/3}, respectively. It is shown that energy loss in the network is proportional to the volume of network. It is also seen when the number of channels is increased both the hydraulic resistance and the volume occupied by the network are increased in a similar manner. Furthermore, the method offers that fabrication of multi-depth and multi-width microchannels should be considered as an integral part of designing procedures. Finally, numerical simulations for the fluid flow in the network have been performed and results show very good agreement with analytic results.

Razavi, Mohammad Sayed, E-mail: m.sayedrazavi@gmail.com; Salimpour, M. R. [Department of Mechanical Engineering, Isfahan University of Technology, Isfahan 84156-83111 (Iran, Islamic Republic of)] [Department of Mechanical Engineering, Isfahan University of Technology, Isfahan 84156-83111 (Iran, Islamic Republic of); Shirani, Ebrahim [Department of Engineering, Foolad Institute of Technology, FooladShahr 84916-63763, Isfahan (Iran, Islamic Republic of)] [Department of Engineering, Foolad Institute of Technology, FooladShahr 84916-63763, Isfahan (Iran, Islamic Republic of)

2014-01-15T23:59:59.000Z

393

Fraud in the acid rain debate  

SciTech Connect (OSTI)

Electric utility executives, according to the author, and millions of other Americans are the victims of a gigantic fraud being carried on in the name of controlling acid rain. This fraud, states the author, involves the distorted, dire image of acidity in nature being created by environmental groups, politicians and others - to gain public sympathy for their legislative goals. The alleged fraud involves the very nature of the legislation being promoted as a low-cost cure for acid rain. On the basis of scientific evidence to date there is no assurance it will reduce acidity by any appreciable amount, but on the other hand it most certainly will cost users of electricity hundreds of billions of dollars in new costs. What has already happened to the nuclear industry is also meant for coal.

Bagge, C.

1984-06-01T23:59:59.000Z

394

Ascorbic Acid and Cancer: A Review  

Science Journals Connector (OSTI)

...groups, together with the formation of hydrogen bonds, offer a probable explanation...and Landeau, B. R. Ascorbic acid economy in surgical patients. Ann. N. Y...Culver, P. L. Horseradish peroxidase/ hydrogen peroxide-catalyzed oxidation of the...

Ewan Cameron; Linus Pauling; and Brian Leibovitz

1979-03-01T23:59:59.000Z

395

Lactic acid fermentation of crude sorghum extract  

SciTech Connect (OSTI)

Crude extract from sweet sorghum supplemented with vetch juice was utilized as the carbohydrate source for fermentative production of lactic acid. Fermentation of media containing 7% (w/v) total sugar was completed in 60-80 hours by Lactobacillus plantarum, product yield averaging 85%. Maximum acid production rates were dependent on pH, initial substrate distribution, and concentration, the rates varying from 2 to 5 g/liter per hour. Under limited medium supplementation the lactic acid yield was lowered to 67%. The fermented ammoniated product contained over eight times as much equivalent crude protein (N x 6.25) as the original medium. Unstructured kinetic models were developed for cell growth, lactic acid formation, and substrate consumption in batch fermentation. With the provision of experimentally determined kinetic parameters, the proposed models accurately described the fermentation process. 15 references.

Samuel, W.A.; Lee, Y.Y.; Anthony, W.B.

1980-04-01T23:59:59.000Z

396

A Direct, Biomass-Based Synthesis of Benzoic Acid: Formic Acid-Mediated Deoxygenation of the Glucose-Derived Materials Quinic Acid and Shikimic Acid  

E-Print Network [OSTI]

R.G.B and J.A.E. ). Keywords: biomass carboxylic acids 10.1002/cssc.201000111 A Direct, Biomass-Based Synthesis ofaro- matic compounds from biomass resources could provide a

2010-01-01T23:59:59.000Z

397

Heterogeneous Reactions of Epoxides in Acidic Media  

E-Print Network [OSTI]

on sulfuric acid using Ion drift-Chemical Ionization Mass Spectrometry (ID-CIMS) showed an irreversible uptake of epoxides at room temperature resulting in the formation of less volatile products like diols, organosulfates and acetals. However, at lower...

Lal, Vinita

2012-02-14T23:59:59.000Z

398

Ascorbic Acid and Cancer: A Review  

Science Journals Connector (OSTI)

...skinned individuals resident in areas of high solar intensity, such as the southern United States, South Africa, and Australia. Experimentally, the...Effects of Ascorbic Acid Ascorbate and Energy Production. Cytochromes P-450 and b5are...

Ewan Cameron; Linus Pauling; and Brian Leibovitz

1979-03-01T23:59:59.000Z

399

Physical modeling and numerical simulation of subcooled boiling in one- and three-dimensional representation of bundle geometry  

SciTech Connect (OSTI)

Numerical simulation of subcooled boiling in one-dimensional geometry with the Homogeneous Equilibrium Model (HEM) may yield difficulties related to the very low sonic velocity associated with the HEM. These difficulties do not arise with subcritical flow. Possible solutions of the problem include introducing a relaxation of the vapor production rate. Three-dimensional simulations of subcooled boiling in bundle geometry typical of fast reactors can be performed by using two systems of conservation equations, one for the HEM and the other for a Separated Phases Model (SPM), with a smooth transition between the two models.

Bottoni, M.; Lyczkowski, R.; Ahuja, S.

1995-07-01T23:59:59.000Z

400

PREDICTING TEMPERATURE BEHAVIOR IN CARBONATE ACIDIZING TREATMENTS  

E-Print Network [OSTI]

PREDICTING TEMPERATURE BEHAVIOR IN CARBONATE ACIDIZING TREATMENTS A Thesis by XUEHAO TAN Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree... of MASTER OF SCIENCE May 2009 Major Subject: Petroleum Engineering PREDICTING TEMPERATURE BEHAVIOR IN CARBONATE ACIDIZING TREATMENTS A Thesis by XUEHAO TAN Submitted to the Office of Graduate Studies of Texas A&M University...

Tan, Xuehao

2010-01-16T23:59:59.000Z

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Primer on lead-acid storage batteries  

SciTech Connect (OSTI)

This handbook was developed to help DOE facility contractors prevent accidents caused during operation and maintenance of lead-acid storage batteries. Major types of lead-acid storage batteries are discussed as well as their operation, application, selection, maintenance, and disposal (storage, transportation, as well). Safety hazards and precautions are discussed in the section on battery maintenance. References to industry standards are included for selection, maintenance, and disposal.

NONE

1995-09-01T23:59:59.000Z

402

Amplification of trace amounts of nucleic acids  

DOE Patents [OSTI]

Methods of reducing background during amplification of small amounts of nucleic acids employ careful analysis of sources of low level contamination. Ultraviolet light can be used to reduce nucleic acid contaminants in reagents and equipment. "Primer-dimer" background can be reduced by judicious design of primers. We have shown clean signal-to-noise with as little as starting material as one single human cell (.about.6 picogram), E. coli cell (.about.5 femtogram) or Prochlorococcus cell (.about.3 femtogram).

Church, George M. (Brookline, MA); Zhang, Kun (Brighton, MA)

2008-06-17T23:59:59.000Z

403

Biologically produced acid precipitable polymeric lignin  

DOE Patents [OSTI]

A water soluble, acid precipitable polymeric degraded lignin (APPL), having a molecular weight of at least 12,000 daltons, and comprising, by percentage of total weight, at least three times the number of phenolic hydroxyl groups and carboxylic acid groups present in native lignin. The APPL may be modified by chemical oxidation and reduction to increase its phenolic hydroxyl content and reduce the number of its antioxidant inhibitory side chains, thereby improving antioxidant properties.

Crawford, Don L. (Moscow, ID); Pometto, III, Anthony L. (Moscow, ID)

1984-01-01T23:59:59.000Z

404

Catalytic oxidative conversion of cellulosic biomass to formic acid and acetic acid with exceptionally high yields  

Science Journals Connector (OSTI)

Abstract Direct conversion of raw biomass materials to fine chemicals is of great significance from both economic and ecological perspectives. In this paper, we report that a Keggin-type vanadium-substituted phosphomolybdic acid catalyst, namely H4PVMo11O40, is capable of converting various biomass-derived substrates to formic acid and acetic acid with high selectivity in a water medium and oxygen atmosphere. Under optimized reaction conditions, \\{H4PVMo11O40\\} gave an exceptionally high yield of formic acid (67.8%) from cellulose, far exceeding the values achieved in previous catalytic systems. Our study demonstrates that heteropoly acids are generally effective catalysts for biomass conversion due to their strong acidities, whereas the composition of metal addenda atoms in the catalysts has crucial influence on the reaction pathway and the product selectivity.

Jizhe Zhang; Miao Sun; Xin Liu; Yu Han

2014-01-01T23:59:59.000Z

405

Humic Acid Metal Cation Interaction Studied by Spectromicroscopy Techniques in Combination with Quantum Chemical Calculations  

SciTech Connect (OSTI)

Humic acids (HA) have a high binding capacity towards traces of toxic metal cations, thus affecting their transport in aquatic systems. Eu(III)-HA aggregates are studied by synchrotron-based scanning transmission X-ray microscopy (STXM) at the carbon K-edge and laser scanning luminescence microscopy (LSLM) at the {sup 5}D{sub 0} {yields} {sup 7}F{sub 1,2} fluorescence emission lines. Both methods provide the necessary spatial resolution in the sub-micrometre range to resolve characteristic aggregate morphologies: optically dense zones embedded in a matrix of less dense material in STXM images correspond to areas with increased Eu(III) luminescence yield in the LSLM micrographs. In the C 1s-NEXAFS of metal-loaded polyacrylic acid (PAA), used as a HA model compound, a distinct complexation effect is identified. This effect is similar to trends observed in the dense fraction of HA/metal cation aggregates. The strongest complexation effect is observed for the Zr(IV)-HA/PAA system. This effect is confirmed by quantum chemical calculations performed at the ab initio level for model complexes with different metal centres and complex geometries. Without the high spatial resolution of STXM and LSLM and without the combination of molecular modelling with experimental results, the different zones indicating a 'pseudo'-phase separation into strong complexing domains and weaker complexing domains of HA would never have been identified. This type of strategy can be used to study metal interaction with other organic material.

Plaschke, M.; Rothe, J; Armbruster, M; Denecke, M; Naber, A; Geckeis, H

2010-01-01T23:59:59.000Z

406

The inability of rats to synthesize linoleic acid from cis-2-octenoic acid  

E-Print Network [OSTI]

THE INABILITY OF RATS TO SYNTHESI2E LINOLEIC ACID FROM CIS-2-OCTENOIC ACID A Thesis Robert Eugene Anderson Submitted to the Graduate College of the Texas A g: M University in partia1 fulfillment of the requirerents for the degree of MASTER... OF SCIENCE January 1965 Major Subjeot: Bioohemistry THE INABILITY OF RATS TQ SYNTHESIEE LINOLEIC ACID FROM CIS-2E)CTENOIC ACID A Thesis Robert, Eugene Anderson Approved as to style and content by: Chair n of Committee)~ (Head of Depart~ant, Member...

Anderson, Robert Eugene

2012-06-07T23:59:59.000Z

407

E-Print Network 3.0 - acids amino acids Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

State University Collection: Biology and Medicine 77 CHE 427627 THE ORGANIC CHEMISTRY OF BIOLOGICAL MOLECULES Summary: macromolecules: carbohydrates, amino acids, nucleic...

408

E-Print Network 3.0 - acid amino acid Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

State University Collection: Biology and Medicine 77 CHE 427627 THE ORGANIC CHEMISTRY OF BIOLOGICAL MOLECULES Summary: macromolecules: carbohydrates, amino acids, nucleic...

409

E-Print Network 3.0 - acid docosahexaenoic acid Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

SAGE-Hindawi Access to Research International Journal of Alzheimer's Disease Summary: APP secretion 19. 2.2. Fatty Acids on Membrane Physical Properties and APP Processing. Fatty...

410

E-Print Network 3.0 - acid-amino acid conjugates Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

amino acids is reported with the incorporation of one example into a ... Source: Beal, Peter A. - Department of Chemistry, University of Utah Collection: Chemistry 13 An...

411

Figure 2: The mercury jet target geometry. The proton beam and mercury jet cross at z=-37.5 cm.  

E-Print Network [OSTI]

Figure 2: The mercury jet target geometry. The proton beam and mercury jet cross at z=-37.5 cm. Figure 3: The layout of multiple proton beam entry directions relative to mercury jet at z=-75 cm. A PION of a free liquid mercury jet with an intense proton beam. We study the variation of meson production

McDonald, Kirk

412

Ab Initio Geometry and Bright Excitation of Carotenoids: Quantum Monte Carlo and Many Body Green's Function Theory Calculations  

E-Print Network [OSTI]

Ab Initio Geometry and Bright Excitation of Carotenoids: Quantum Monte Carlo and Many Body Green state. Many Body Green's Function Theory (MBGFT) calculations of the vertical excitation energy and coupling with Qy of the chlorophyll.8-13 Measurements in several solvents have been reported

Guidoni, Leonardo

413

The influence of the curvature dependence of the surface tension on the geometry of electrically charged menisci  

E-Print Network [OSTI]

The influence of the curvature dependence of the surface tension on the geometry of electrically, Roio Poggio, I-67040 L'Aquila, Italy We evaluate how the curvature dependence of surface tension of surface tension on curvature becomes important when the "nucle- ation radius" is comparable

Paris-Sud XI, Université de

414

Thick-mode resonance of a PZT/Si wafer stack investigated by X-ray diffraction in Bragg geometry  

Science Journals Connector (OSTI)

X-ray diffraction in Bragg geometry was used to investigate the effects of longitudinal standing waves on an Si(111) wafer, constructing a PZT/Si(111) stack with a resonant frequency of 2.34 MHz. In addition to the ultrasonic vibration, a thermal effect is evident, which has been mostly ignored or avoided in previous reports.

Souza, P.E.N; de

2003-09-08T23:59:59.000Z

415

Modulational instability of two-component Bose-Einstein condensates in a quasi-one-dimensional geometry  

Science Journals Connector (OSTI)

A simple treatment is presented to analyze the modulational instability of two-component Bose-Einstein condensates, described within the Gross-Pitaevskii approximation, in a quasi-one-dimensional geometry. An explicit expression for the growth rate of a purely growing modulational instability is presented and analyzed analytically.

T. Soloman Raju; Prasanta K. Panigrahi; K. Porsezian

2005-03-28T23:59:59.000Z

416

Estimation of exhaust gas aerodynamic force on the variable geometry turbocharger actuator: 1D flow model approach  

Science Journals Connector (OSTI)

Abstract This paper provides a reliable tool for simulating the effects of exhaust gas flow through the variable turbine geometry section of a variable geometry turbocharger (VGT), on flow control mechanism. The main objective is to estimate the resistive aerodynamic force exerted by the flow upon the variable geometry vanes and the controlling actuator, in order to improve the control of vane angles. To achieve this, a 1D model of the exhaust flow is developed using NavierStokes equations. As the flow characteristics depend upon the volute geometry, impeller blade force and the existing viscous friction, the related source terms (losses) are also included in the model. In order to guarantee stability, an implicit numerical solver has been developed for the resolution of the NavierStokes problem. The resulting simulation tool has been validated through comparison with experimentally obtained values of turbine inlet pressure and the aerodynamic force as measured at the actuator shaft. The simulator shows good compliance with experimental results.

Fayez Shakil Ahmed; Salah Laghrouche; Adeel Mehmood; Mohammed El Bagdouri

2014-01-01T23:59:59.000Z

417

The mechanics of unrest at Long Valley caldera, California: 1. Modeling the geometry of the source using GPS,  

E-Print Network [OSTI]

The mechanics of unrest at Long Valley caldera, California: 1. Modeling the geometry of the source 44 existing leveling monuments in Long Valley caldera in July 1999, using dual frequency global in the Long Valley area and computed the vertical deformation by differencing GPS-based and leveled

Segall, Paul

418

C. R. Acad. Sci. Paris, t. 325, Serie I, p. 871-876, 1997 CGom&ie/Geometry  

E-Print Network [OSTI]

C. R. Acad. Sci. Paris, t. 325, Serie I, p. 871-876, 1997 CGom&ie/Geometry Artin groups, projective SciencesElsevier. Paris 871 #12;M. Kapovich and J. J. Millson attachons un groupe d'Artin (resp. de

Kapovich, Misha

419

The Role of Magnesium for Geometry and Charge in GTP Hydrolysis, Revealed by Quantum Mechanics/Molecular Mechanics Simulations  

E-Print Network [OSTI]

The Role of Magnesium for Geometry and Charge in GTP Hydrolysis, Revealed by Quantum Mechanics, People's Republic of China ABSTRACT The coordination of the magnesium ion in proteins by triphosphates conversion. For example, in Ras the magnesium ion contributes to the catalysis of GTP hydrolysis

Gerwert, Klaus

420

Final version Submitted to special issue "Geometry in Robotics and Sensing" of ROBOTICA 08/02/10 P. Wenger 1  

E-Print Network [OSTI]

Final version Submitted to special issue "Geometry in Robotics and Sensing" of ROBOTICA 08/02/10 P the "elbow up" to the "elbow down" hal-00454562,version1-8Feb2010 Author manuscript, published in "Robotica" of ROBOTICA 08/02/10 P. Wenger 2 posture. Modification in the link arrangement is very likely to result

Paris-Sud XI, Université de

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

How air influences radiation dose deposition in multiwell culture plates: a Monte Carlo simulation of radiation geometry  

Science Journals Connector (OSTI)

......that this underdosage does not have a significant...related to a lack of electronic equilibrium. This is...Fig. 5b). MC calculations of the same plate geometry...Oncology Physics: A Handbook for Teachers and Students-Podgorsak...Comparison of dose calculation algorithms in slab phantoms......

Sebastia Sabater; Roberto Berenguer; Paloma Honrubia-Gomez; Miguel Rivera; Ana Nuez; Esther Jimenez-Jimenez; Ana Martos; Carmen Ramirez-Castillejo

2014-09-01T23:59:59.000Z

422

Influence of Droplet Geometry on the Coalescence of Low Viscosity Drops A. Eddi, K. G. Winkels, and J. H. Snoeijer  

E-Print Network [OSTI]

Influence of Droplet Geometry on the Coalescence of Low Viscosity Drops A. Eddi, K. G. Winkels involving sprays and print- ing [4,5]. Breakup and coalescence are singular events during which the liquid-off is universal in the sense that it is completely independent of initial conditions. In this regime, viscosity

Snoeijer, Jacco

423

IEEE TRANS. ON AUDIO, SPEECH AND LANGUAGE PROC., 2010 1 On the Information Geometry of Audio Streams  

E-Print Network [OSTI]

IEEE TRANS. ON AUDIO, SPEECH AND LANGUAGE PROC., 2010 1 On the Information Geometry of Audio Abstract--This paper proposes methods for information pro- cessing of audio streams using methods information as information entities, suitable for similarity and symbolic computing on audio signals

Paris-Sud XI, Université de

424

Correlation between Fibroin Amino Acid Sequence and Physical Silk Properties*  

E-Print Network [OSTI]

moth (Ephe- stia kuehniella), and Indian meal moth (Plodia inter- punctella). The amino acid repeats

?urovec, Michal

425

Transcription factor-based biosensors for detecting dicarboxylic acids  

DOE Patents [OSTI]

The invention provides methods and compositions for detecting dicarboxylic acids using a transcription factor biosensor.

Dietrich, Jeffrey; Keasling, Jay

2014-02-18T23:59:59.000Z

426

Purification Or Organic Acids Using Anion Exchange Chromatography.  

DOE Patents [OSTI]

Disclosed is a cost-effective method for purifying and acidifying carboxylic acids, including organic acids and amino acids. The method involves removing impurities by allowing the anionic form of the carboxylic acid to bind to an anion exchange column and washing the column. The carboxylic anion is displaced as carboxylic acid by washing the resin with a strong inorganic anion. This method is effective in removing organic carboxylic acids and amino acids from a variety of industrial sources, including fermentation broths, hydrolysates, and waste streams.

Ponnampalam; Elankovan (Okemos, MI)

2001-09-04T23:59:59.000Z

427

Synergy of Lewis and Brnsted Acids on Catalytic Hydrothermal Decomposition of Hexose to Levulinic Acid  

Science Journals Connector (OSTI)

Levulinic acid (LA), an important platform chemical, is regarded as one of top 12 block chemicals. ... Phosphate standard concentrate (85%), glucose (99%), and levulinic acid (99%) were purchased from Aladdin Chemistry Co., Ltd. ... Fructose, chromium(III) chloride hexahydrate, and 5-HMF (purities of these chemicals ? 98%) were purchased from J&K Chemica, Ltd. ...

Fan Yang; Jie Fu; Jing Mo; Xiuyang Lu

2013-10-15T23:59:59.000Z

428

Acid Diversion in Carbonate Reservoirs Using Polymer-Based In-Situ Gelled Acids  

E-Print Network [OSTI]

Diversion in carbonates is more difficult than in sandstones because of the ability of acid to significantly increase the permeability in carbonates as it reacts in the pore spaces and flow channels of matrix. In-situ gelled acids that are based...

Gomaa, Ahmed Mohamed Mohamed

2012-07-16T23:59:59.000Z

429

Sum Frequency Generation Vibrational Spectroscopy of Adsorbed Amino Acids, Peptides and Proteins of Hydrophilic and Hydrophobic Solid-Water Interfaces  

SciTech Connect (OSTI)

Sum frequency generation (SFG) vibrational spectroscopy was used to investigate the interfacial properties of several amino acids, peptides, and proteins adsorbed at the hydrophilic polystyrene solid-liquid and the hydrophobic silica solid-liquid interfaces. The influence of experimental geometry on the sensitivity and resolution of the SFG vibrational spectroscopy technique was investigated both theoretically and experimentally. SFG was implemented to investigate the adsorption and organization of eight individual amino acids at model hydrophilic and hydrophobic surfaces under physiological conditions. Biointerface studies were conducted using a combination of SFG and quartz crystal microbalance (QCM) comparing the interfacial structure and concentration of two amino acids and their corresponding homopeptides at two model liquid-solid interfaces as a function of their concentration in aqueous solutions. The influence of temperature, concentration, equilibration time, and electrical bias on the extent of adsorption and interfacial structure of biomolecules were explored at the liquid-solid interface via QCM and SFG. QCM was utilized to quantify the biological activity of heparin functionalized surfaces. A novel optical parametric amplifier was developed and utilized in SFG experiments to investigate the secondary structure of an adsorbed model peptide at the solid-liquid interface.

Holinga IV, G.H.

2010-08-01T23:59:59.000Z

430

Solar2014: The 52nd Annual Conference of the Australian Solar Council 1 Open cavity receiver geometry influence on radiative losses  

E-Print Network [OSTI]

of the aperture in cavity losses mitigation and highlight the flux distribution variation on geometries driven by heat conduction. Convective losses, not considered here, are hard to model with confidence due Actually, the geometry has a strong influence on the heat flux distribution on the absorbing walls

431

Water and UV degradable lactic acid polymers  

DOE Patents [OSTI]

A water and UV light degradable copolymer of monomers of lactic acid and a modifying monomer were selected from the class consisting of ethylene and polyethylene glycols, propylene and polypropylene glycols, P-dioxanone, 1,5 dioxepan-2-one, 1,4 -oxathialan-2-one, 1,4-dioxide and mixtures. These copolymers are useful for waste disposal and agricultural purposes. Also disclosed is a water degradable blend of polylactic acid or modified polylactic acid and high molecular weight polyethylene oxide where the high molecular weight polyethylene oxide is present in the range of from about 2% by weight to about 50% by weight, suitable for films. A method of applying an active material selected from the class of seeds, seedlings, pesticides, herbicides, fertilizers and mixtures to an agricultural site is also disclosed.

Bonsignore, P.V.; Coleman, R.D.

1994-11-01T23:59:59.000Z

432

Water and UV degradable lactic acid polymers  

DOE Patents [OSTI]

A water and UV light degradable copolymer of monomers of lactic acid and a modifying monomer selected from the class consisting of ethylene and polyethylene glycols, propylene and polypropylene glycols, P-dioxanone, 1,5 dioxepan-2-one, 1,4 -oxathialan-2-one, 1,4-dioxide and mixtures thereof. These copolymers are useful for waste disposal and agricultural purposes. Also disclosed is a water degradable blend of polylactic acid or modified polylactic acid and high molecular weight polyethylene oxide wherein the high molecular weight polyethylene oxide is present in the range of from about 2% by weight to about 50% by weight, suitable for films. A method of applying an active material selected from the class of seeds, seedlings, pesticides, herbicides, fertilizers and mixtures thereof to an agricultural site is also disclosed.

Bonsignore, Patrick V. (Joliet, IL); Coleman, Robert D. (Wheaton, IL)

1994-01-01T23:59:59.000Z

433

Water and UV degradable lactic acid polymers  

DOE Patents [OSTI]

A water and UV light degradable copolymer is described made from monomers of lactic acid and a modifying monomer selected from the class consisting of ethylene glycol, propylene glycol, P-dioxanone, 1,5 dioxepan-2-one, 1,4-oxathialan-2-one, 1,4-dioxide and mixtures thereof. These copolymers are useful for waste disposal and agricultural purposes. Also disclosed is a water degradable blend of polylactic acid or modified polylactic acid and high molecular weight polyethylene oxide wherein the high molecular weight polyethylene oxide is present in the range of from about 2 by weight to about 50% by weight, suitable for films. A method of applying an active material selected from the class of seeds, seedlings, pesticides, herbicides, fertilizers and mixtures thereof to an agricultural site is also disclosed.

Bonsignore, P.V.; Coleman, R.D.

1996-10-08T23:59:59.000Z

434

Water and UV degradable lactic acid polymers  

DOE Patents [OSTI]

A water and UV light degradable copolymer of monomers of lactic acid and a modifying monomer selected from the class consisting of ethylene glycol, propylene glycol, P-dioxanone, 1,5 dioxepan-2-one, 1,4-oxathialan-2-one, 1,4-dioxide and mixtures thereof. These copolymers are useful for waste disposal and agricultural purposes. Also disclosed is a water degradable blend of polylactic acid or modified polylactic acid and high molecular weight polyethylene oxide wherein the high molecular weight polyethylene oxide is present in the range of from about 2 by weight to about 50% by weight, suitable for films. A method of applying an active material selected from the class of seeds, seedlings, pesticides, herbicides, fertilizers and mixtures thereof to an agricultural site is also disclosed.

Bonsignore, Patrick V. (Joliet, IL); Coleman, Robert D. (Wheaton, IL)

1996-01-01T23:59:59.000Z

435

Photoenhanced anaerobic digestion of organic acids  

DOE Patents [OSTI]

A process is described for rapid conversion of organic acids and alcohols anaerobic digesters into hydrogen and carbon dioxide, the optimal precursor substrates for production of methane. The process includes addition of photosynthetic bacteria to the digester and exposure of the bacteria to radiant energy (e.g., solar energy). The process also increases the pH stability of the digester to prevent failure of the digester. Preferred substrates for photosynthetic bacteria are the organic acid and alcohol waste products of fermentative bacteria. In mixed culture with methanogenic bacteria or in defined co-culture with non-aceticlastic methanogenic bacteria, photosynthetic bacteria are capable of facilitating the conversion or organic acids and alcohols into methane with low levels of light energy input.

Weaver, Paul F. (Golden, CO)

1990-01-01T23:59:59.000Z

436

E-Print Network 3.0 - acid analysis including Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

predict the relative acid strength of a set... section. Findings Our analysis led to the identification of four distinct mental models of acid and acid... models of acid and acid...

437

Extension of NORSOK CO2 corrosion prediction model for elbow geometry  

Science Journals Connector (OSTI)

Internal corrosion of flowlines and pipelines is inevitable when transporting oil and gas that contains corrosive species. The consequences of corrosion such as material failure, loss of production, plant shutdown, and environmental pollution result in extra cost that negatively affect the project economics. Early prediction of corrosion severity is, therefore, very important to propose proper measures to avoid or eliminate corrosion. The prediction is normally carried on using a selected model for corrosion prediction. One of these models is NORSOK model, an empirical model developed by NORSOK for CO2 corrosion prediction in straight pipes. Norsk Sokkels Konkuranseposisjon or, in English, The Competitive Standing of the Norwegian Offshore Sector (NORSOK) is number of standards developed by Norwegian industry groups covering different topics that related to offshore industry. In this paper, NORSOK model has been modified to make it applicable to elbows geometries by introducing the equivalent length concept. A friendly graphical user interface computational package is developed for corrosion prediction in both straight pipes and elbows. The package is validated against measured data and acceptable accuracy is attained.

Mysara Eissa Mohyaldin; Noaman Elkhatib; Mokhtar Che Ismail

2013-01-01T23:59:59.000Z

438

Ab-initio molecular geometry and normal coordinate analysis of tetrahydrothiophene molecule  

Science Journals Connector (OSTI)

The molecular geometry of tetrahydrothiophene (THT) was quantum mechanically calculated using the split valence 631G** basis set. Electron correlation energy has been computed employing MP2 method. The molecule showed a twist form puckered structure with a twist torsion angle of 13 and has a total energy of ?347?877.514 kcal/mol of which a 436.715 kcal/mol electron correlation energy. The envelope form of the molecule showed an inter-plane angle of 22 and has a total energy of ?347?974.430 kcal/mol involving ?436.558 kcal/mol electron correlation energy. The normal coordinates of the molecule were theoretically analyzed and the fundamental vibrational frequencies were calculated. The IR and laser Raman spectra of THT molecule was measured. All the observed vibrational bands including combination bands and overtones were assigned to normal modes with the aid of the potential energy distribution values obtained from normal coordinate calculations. The molecular force field was determined by refining the initial set of force constants using the least square fit method instead of using the less accurate scaling factor methods. The determined molecular force field has produced simulated frequencies which best match the observed values. The lowest-energy modes of vibration were two molecular out-of-plane deformations, observed at 114 and 166 cm?1. The barrier of ring twisting estimated from the observed ring out-of-plane vibrational mode at 114 cm?1 was estimated.

Tarek M El-Gogary

2001-01-01T23:59:59.000Z

439

Weakly regular T2 symmetric spacetimes. The future causal geometry of Gowdy spaces  

E-Print Network [OSTI]

We investigate the future asymptotic behavior of Gowdy spacetimes on T3, when the metric satisfies weak regularity conditions, so that the metric coefficients (in suitable coordinates) are only in the Sobolev space H1 or have even weaker regularity. The authors recently introduced this class of spacetimes in the broader context of T2 symmetric spacetimes and established the existence of a global foliation by spacelike hypersurfaces when the time function is chosen to be the area of the surfaces of symmetry. In the present paper, we identify the global causal geometry of these spacetimes and, in particular, establish that weakly regular Gowdy spacetimes are future causally geodesically complete. This result extends a theorem by Ringstr\\"om for metrics with sufficiently high regularity. We emphasize that our proof of the energy decay is based on an energy functional inspired by the Gowdy-to-Ernst transformation. In order to establish the geodesic completeness property, we prove a higher regularity property concerning the metric coefficients along timelike curves and we provide a novel analysis of the geodesic equation for Gowdy spacetimes, which does not require high-order regularity estimates. Even when sufficient regularity is assumed, our proof provides an alternative and shorter proof of the energy decay and of the geodesic completeness property for Gowdy spacetimes.

Philippe G. LeFloch; Jacques Smulevici

2014-03-25T23:59:59.000Z

440

Pattern formation and dynamics in Rayleigh-Benard convection : numerical simulations of experimentally realistic geometries.  

SciTech Connect (OSTI)

Rayleigh-Benard convection is studied and quantitative comparisons are made, where possible, between theory and experiment by performing numerical simulations of the Boussinesq equations for a variety of experimentally realistic situations. Rectangular and cylindrical geometries of varying aspect ratios for experimental boundary conditions, including fins and spatial ramps in plate separation, are examined with particular attention paid to the role of the mean flow. A small cylindrical convection layer bounded laterally either by a rigid wall, fin, or a ramp is investigated and our results suggest that the mean flow plays an important role in the observed wavenumber. Analytical results are developed quantifying the mean flow sources, generated by amplitude gradients, and its effect on the pattern wavenumber for a large-aspect-ratio cylinder with a ramped boundary. Numerical results are found to agree well with these analytical predictions. We gain further insight into the role of mean flow in pattern dynamics by employing a novel method of quenching the mean flow numerically. Simulations of a spiral defect chaos state where the mean flow is suddenly quenched is found to remove the time dependence, increase the wavenumber and make the pattern more angular in nature.

Paul, M. R.; Chiarn, K.-H.; Cross, M. C.; Fischer, P. F.; Greenside, H. S.; Mathematics and Computer Science; California Inst. of Tech.; Duke University

2003-10-01T23:59:59.000Z

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

Variable magnetic field geometry of the young sun HN Peg (HD 206860)  

E-Print Network [OSTI]

The large-scale magnetic field of solar-type stars reconstructed from their spectropolarimetric observations provide important insight into their underlying dynamo processes.We aim to investigate the temporal variability of the large-scale surface magnetic field and chromospheric activity of a young solar analogue, the G0 dwarf HN Peg.The large-scale surface magnetic field topology is reconstructed using Zeeman Doppler Imaging at six observational epochs covering seven years.We also investigated the chromospheric activity variations by measuring the flux in the line cores of the three chromospheric activity indicators: Ca II H&K, H alpha, and the Ca II IRT lines.The magnetic topology of HN Peg shows a complex and variable geometry. While the radial field exhibits a stable positive polarity magnetic region at the poles at each observational epoch, the azimuthal field is strongly variable in strength, where a strong band of positive polarity magnetic field is present at equatorial latitudes. This field disa...

Saikia, S Boro; Petit, P; Marsden, S; Morin, J; Folsom, C P

2014-01-01T23:59:59.000Z

442

Gamma ray burst delay times probe the geometry of momentum space  

E-Print Network [OSTI]

We study the application of the recently proposed framework of relative locality to the problem of energy dependent delays of arrival times of photons that are produced simultaneously in distant events such as gamma ray bursts. Within this framework, possible modifications of special relativity are coded in the geometry of momentum space. The metric of momentum space codes modifications in the energy momentum relation, while the connection on momentum space describes possible non-linear modifications in the laws of conservation of energy and momentum. In this paper, we study effects of first order in the inverse Planck scale, which are coded in the torsion and non-metricity of momentum space. We find that time delays of order Distance * Energies/m_p are coded in the non-metricity of momentum space. Current experimental bounds on such time delays hence bound the components of this tensor of order 1/m_p. We also find a new effect, whereby photons from distant sources can appear to arrive from angles slightly off the direction to the sources, which we call gravitational lensing. This is found to be coded into the torsion of momentum space.

Laurent Freidel; Lee Smolin

2011-03-29T23:59:59.000Z

443

Neutronic Assessment of Transmutation Target Compositions in Heterogeneous Sodium Fast Reactor Geometries  

SciTech Connect (OSTI)

The sodium fast reactor is under consideration for consuming the transuranic waste in the spent nuclear fuel generated by light water reactors. This work is concerned with specialized target assemblies for an oxide-fueled sodium fast reactor that are designed exclusively for burning the americium and higher mass actinide component of light water reactor spent nuclear fuel (SNF). The associated gamma and neutron radioactivity, as well as thermal heat, associated with decay of these actinides may significantly complicate fuel handling and fabrication of recycled fast reactor fuel. The objective of using targets is to isolate in a smaller number of assemblies these concentrations of higher actinides, thus reducing the volume of fuel having more rigorous handling requirements or a more complicated fabrication process. This is in contrast to homogeneous recycle where all recycled actinides are distributed among all fuel assemblies. Several heterogeneous core geometries were evaluated to determine the fewest target assemblies required to burn these actinides without violating a set of established fuel performance criteria. The DIF3D/REBUS code from Argonne National Laboratory was used to perform the core physics and accompanying fuel cycle calculations in support of this work. Using the REBUS code, each core design was evaluated at the equilibrium cycle condition.

Samuel E. Bays; Rodolfo M. Ferrer; Michael A. Pope; Benoit Forget; Mehdi Asgari

2008-02-01T23:59:59.000Z

444

Consideration of a ultracold neutron source in two-dimensional cylindrical geometry by taking simulated boundaries  

SciTech Connect (OSTI)

A new idea to calculate ultracold neutron (UCN) production by using Monte Carlo simulation method to calculate the cold neutron (CN) flux and an analytical approach to calculate the UCN production from the simulated CN flux was given. A super-thermal source (UCN source) was modeled based on an arrangement of D{sub 2}O and solid D{sub 2} (sD{sub 2}). The D{sub 2}O was investigated as the neutron moderator, and sD{sub 2} as the converter. In order to determine the required parameters, a two-dimensional (2D) neutron balance equation written in Matlab was combined with the MCNPX simulation code. The 2D neutron-transport equation in cylindrical (? ? z) geometry was considered for 330 neutron energy groups in the sD{sub 2}. The 2D balance equation for UCN and CN was solved using simulated CN flux as boundary value. The UCN source dimensions were calculated for the development of the next UCN source. In the optimal condition, the UCN flux and the UCN production rate (averaged over the sD{sub 2} volume) equal to 6.79??10{sup 6} cm{sup ?2}s{sup ?1} and 2.20 10{sup 5} cm{sup ?3}s{sup ?1}, respectively.

Gheisari, R., E-mail: gheisari@pgu.ac.ir [Physics Department, Persian Gulf University, Bushehr 75169 (Iran, Islamic Republic of); Nuclear Energy Research Center, Persian Gulf University, Bushehr 75169 (Iran, Islamic Republic of); Firoozabadi, M. M.; Mohammadi, H. [Department of Physics, University of Birjand, Birjand 97175 (Iran, Islamic Republic of)] [Department of Physics, University of Birjand, Birjand 97175 (Iran, Islamic Republic of)

2014-01-15T23:59:59.000Z

445

Robust volume calculations for Constructive Solid Geometry (CSG) components in Monte Carlo transport calculations  

SciTech Connect (OSTI)

In this paper we consider a new generalized algorithm for the efficient calculation of component object volumes given their equivalent constructive solid geometry (CSG) definition. The new method relies on domain decomposition to recursively subdivide the original component into smaller pieces with volumes that can be computed analytically or stochastically, if needed. Unlike simpler brute-force approaches, the proposed decomposition scheme is guaranteed to be robust and accurate to within a user-defined tolerance. The new algorithm is also fully general and can handle any valid CSG component definition, without the need for additional input from the user. The new technique has been specifically optimized to calculate volumes of component definitions commonly found in models used for Monte Carlo particle transport simulations for criticality safety and reactor analysis applications. However, the algorithm can be easily extended to any application which uses CSG representations for component objects. The paper provides a complete description of the novel volume calculation algorithm, along with a discussion of the conjectured error bounds on volumes calculated within the method. In addition, numerical results comparing the new algorithm with a standard stochastic volume calculation algorithm are presented for a series of problems spanning a range of representative component sizes and complexities. (authors)

Millman, D. L. [Dept. of Computer Science, Univ. of North Carolina at Chapel Hill (United States); Griesheimer, D. P.; Nease, B. R. [Bechtel Marine Propulsion Corporation, Bertis Atomic Power Laboratory (United States); Snoeyink, J. [Dept. of Computer Science, Univ. of North Carolina at Chapel Hill (United States)

2012-07-01T23:59:59.000Z

446

Neutronics code VALE for two-dimensional triagonal (hexagonal) and three-dimensional geometries  

SciTech Connect (OSTI)

This report documents the computer code VALE designed to solve multigroup neutronics problems with the diffusion theory approximation to neutron transport for a triagonal arrangement of mesh points on planes in two- and three-dimensional geometry. This code parallels the VENTURE neutronics code in the local computation system, making exposure and fuel management capabilities available. It uses and generates interface data files adopted in the cooperative effort sponsored by Reactor Physics RRT Division of the US DOE. The programming in FORTRAN is straightforward, although data is transferred in blocks between auxiliary storage devices and main core, and direct access schemes are used. The size of problems which can be handled is essentially limited only by cost of calculation since the arrays are variably dimensioned. The memory requirement is held down while data transfer during iteration is increased only as necessary with problem size. There is provision for the more common boundary conditions including the repeating boundary, 180/sup 0/ rotational symmetry, and the rotational symmetry conditions for the 30/sup 0/, 60/sup 0/, and 120/sup 0/ triangular grids on planes. A variety of types of problems may be solved: the usual neutron flux eignevalue problem, or a direct criticality search on the buckling, on a reciprocal velocity absorber (prompt mode), or on nuclide concentrations. The adjoint problem and fixed source problem may be solved, as well as the dominating higher harmonic, or the importance problem for an arbitrary fixed source.

Vondy, D.R.; Fowler, T.B.

1981-08-01T23:59:59.000Z

447

Tokamap:?A Hamiltonian twist map for magnetic field lines in a toroidal geometry  

Science Journals Connector (OSTI)

A Hamiltonian twist map (tokamap) is constructed as a representation of the stroboscopic plot of magnetic field lines in a toroidal confinement device as used in fusion physics. This tokamap is compatible with minimal toroidal geometry requirements (in particular, the polar axis cannot be crossed upon iteration). It depends on two parameters: the stochasticity parameter K and the winding number on axis, w. With increasing values of K, chaotic regions appear mostly near the edge of the torus, while the zone near the magnetic axis remains very robust. The number and nature of the fixed points are studied in detail, as they determine the appearance of the phase portraits near the axis. It is shown that the topology undergoes several bifurcations as K and/or w are varied. The various phase portraits reproduce the qualitative features known in tokamak physics. The time series exhibit a typical behavior describable by a continuous time random walk, as found in previous works on the standard map.

R. Balescu; M. Vlad; F. Spineanu

1998-07-01T23:59:59.000Z

448

Optimisation of transient response of a gasoline engine with variable geometry turbine turbocharger  

Science Journals Connector (OSTI)

ABSTRACT Maintaining transient torque response is challenging on turbocharged engines because of the period of time required to accelerate the turbocharger. Variable Geometry Turbine (VGT) turbochargers offer a route to improve the transient response. In order to explore the transient operation without any limitation imposed by the production control strategy, an on line search was conducted using a series of open loop actuator trajectories applied to a VGT turbocharger installed on a gasoline engine. The trade-off between the responses in different stages in the transient event has been illustrated. The time required to reach 50% of maximum torque rise (T50) was improved by up to 0.54s (35.5%) whilst the turbocharger acceleration was maintained. Fully closing the VGT resulted in high exhaust back pressure and low volumetric efficiency. This suggests that a simple boost pressure feedback control will likely not deliver optimised performance due to the excessive exhaust back pressure, reducing the available brake torque during the early part of the transient. Therefore, a model based control strategy may be required.

H. Tang; S. Akehurst; C.J. Brace; S. Garrett; L. Smith

2014-01-01T23:59:59.000Z

449

THE GEOMETRY OF MASS OUTFLOWS AND FUELING FLOWS IN THE SEYFERT 2 GALAXY MRK 3  

SciTech Connect (OSTI)

We present a study of the resolved emission-line regions and an inner dust/gas disk in the Seyfert 2 galaxy Mrk 3, based on Hubble Space Telescope observations. We show that the extended narrow-line region (ENLR), spanning {approx}4 kpc, is defined by the intersection of the ionizing bicone of radiation from the active galactic nucleus (AGN) and the inner disk, which is not coplanar with the large-scale stellar disk. This intersection leads to different position and opening angles of the ENLR compared to the narrow-line region (NLR). A number of emission-line arcs in the ENLR appear to be continuations of dust lanes in the disk, supporting this geometry. The NLR, which consists of outflowing emission-line knots spanning the central {approx}650 pc, is in the shape of a backward S. This shape may arise from rotation of the gas, or it may trace the original fueling flow close to the nucleus that was ionized after the AGN turned on.

Crenshaw, D. M.; Fischer, T. C. [Department of Physics and Astronomy, Georgia State University, Astronomy Offices, One Park Place South SE, Suite 700, Atlanta, GA 30303 (United States); Kraemer, S. B. [Institute for Astrophysics and Computational Sciences, Department of Physics, Catholic University of America, Washington, DC 20064 (United States); Schmitt, H. R. [Remote Sensing Division, Naval Research Laboratory, Washington, DC 20375 (United States); Jaffe, Y. L. [School of Physics and Astronomy, University of Nottingham, University Park, Nottingham NG7 2RD (United Kingdom); Deo, R. P. [Department of Physics, Drexel University, 3141 Chestnut Street, Philadelphia, PA 19104 (United States); Collins, N. R. [Astrophysics Science Division, Code 667, Goddard Space Flight Center, Greenbelt, MD 20771 (United States)], E-mail: crenshaw@chara.gsu.edu

2010-03-15T23:59:59.000Z

450

Characteristics of low-energy ion beams extracted from a wire electrode geometry  

SciTech Connect (OSTI)

Beams of argon ions with energies less than 50 eV were extracted from an ion source through a wire electrode extractor geometry. A retarding potential energy analyzer (RPEA) was constructed in order to characterize the extracted ion beams. The single aperture RPEA was used to determine the ion energy distribution function, the mean ion energy and the ion beam energy spread. The multi-cusp hot cathode ion source was capable of producing a low electron temperature gas discharge to form quiescent plasmas from which ion beam energy as low as 5 eV was realized. At 50 V extraction potential and 0.1 A discharge current, the ion beam current density was around 0.37 mA/cm{sup 2} with an energy spread of 3.6 V or 6.5% of the mean ion energy. The maximum ion beam current density extracted from the source was 0.57 mA/cm{sup 2} for a 50 eV ion beam and 1.78 mA/cm{sup 2} for a 100 eV ion beam.

Vasquez, M. Jr.; Tokumura, S.; Kasuya, T. [Graduate School of Engineering, Doshisha University, Kyotanabe, Kyoto 610-0321 (Japan); Maeno, S. [Novelion Systems Co. Ltd., Kyotanabe, Kyoto 610-0332 (Japan); Wada, M. [Faculty of Life and Medical Sciences, Doshisha University, Kyotanabe, Kyoto 610-0321 (Japan)

2012-02-15T23:59:59.000Z

451

GBL-2D Version 1.0: a 2D geometry boolean library.  

SciTech Connect (OSTI)

This report describes version 1.0 of GBL-2D, a geometric Boolean library for 2D objects. The library is written in C++ and consists of a set of classes and routines. The classes primarily represent geometric data and relationships. Classes are provided for 2D points, lines, arcs, edge uses, loops, surfaces and mask sets. The routines contain algorithms for geometric Boolean operations and utility functions. Routines are provided that incorporate the Boolean operations: Union(OR), XOR, Intersection and Difference. A variety of additional analytical geometry routines and routines for importing and exporting the data in various file formats are also provided. The GBL-2D library was originally developed as a geometric modeling engine for use with a separate software tool, called SummitView [1], that manipulates the 2D mask sets created by designers of Micro-Electro-Mechanical Systems (MEMS). However, many other practical applications for this type of software can be envisioned because the need to perform 2D Boolean operations can arise in many contexts.

McBride, Cory L. (Elemental Technologies, American Fort, UT); Schmidt, Rodney Cannon; Yarberry, Victor R.; Meyers, Ray J. (Elemental Technologies, American Fort, UT)

2006-11-01T23:59:59.000Z

452

Gas conversion impedance: A test geometry effect in characterization of solid oxide fuel cell anodes  

SciTech Connect (OSTI)

The appearance of an extra arc in impedance spectra obtained on high performance solid oxide fuel cell (SOFC) anodes is recognized when experiments are conducted in a test setup where the working and reference electrodes are placed in separate atmospheres. A simple continuously stirred tank reactor (CSTR) model is used to illustrate how anodes measured with the reference electrode in an atmosphere separate from the working electrode are subject to an impedance contribution from gas conversion. The gas conversion impedance is split into a resistive and a capacitive part, and the dependences of these parameters on gas composition, temperature, gas flow rate, and rig geometry are quantified. The fuel gas flow rate per unit of anode area is decisive for the resistivity, whereas the capacitance is proportional to the CSTR volume of gas over the anode. The model predictions are compared to actual measurements on Ni/yttria stabilized zirconia cermet anodes for SOFC. The contribution of the gas conversion overpotential to dc current-voltage characteristics is deduced for H{sub 2}/H{sub 2}O and shown to have a slope of RT/2F in a Tafel plot.

Primdahl, S.; Mogensen, M. [Risoe National Lab., Roskilde (Denmark). Materials Research Dept.

1998-07-01T23:59:59.000Z

453

On a Bipolar Model of Hyperbolic Geometry and its Relation to Hyperbolic Robertson-Walker Space  

E-Print Network [OSTI]

Negatively curved, or hyperbolic, regions of space in an FRW universe are a realistic possibility. These regions might occur in voids where there is no dark matter with only dark energy present. Hyperbolic space is strange and various "models" of hyperbolic space have been introduced, each offering some enlightened view. In the present work we develop a new bipolar model of hyperbolic geometry, closely related to an existing model - the band model - and show that it provides new insights toward an understanding of hyperbolic as well as elliptic Robertson-Walker space and the meaning of its isometries. In particular, we show that the circular geodesics of a hyperbolic Robertson-Walker space can be referenced to two real centers - a Euclidean center and an offset hyperbolic center. These are not the Euclidean center or poles of the bipolar coordinate system but rather refer to two distinct centers for circular orbits of particles in such systems. Considering the physics of elliptic RW space is so well confirmed in the Lambda-CDM model with respect to Euclidean coordinates from a Euclidean center, it is likely that the hyperbolic center plays a physical role in regions of hyperbolic space.

Harry I. Ringermacher; Lawrence R. Mead

2012-01-25T23:59:59.000Z

454

Electronic properties of corrugated graphene, the Heisenberg principle and wormhole geometry in solid state  

E-Print Network [OSTI]

Adopting a purely two dimensional relativistic equation for graphene's carriers contradicts the Heisenberg uncertainty principle since it requires setting off-the-surface coordinate of a three-dimensional wavefunction to zero. Here we present a theoretical framework for describing graphene's massless relativistic carriers in accordance with this most fundamental of all quantum principles. A gradual confining procedure is used to restrict the dynamics onto a surface and normal to the surface parts and in the process the embedding of this surface into the three dimensional world is accounted for. As a result an invariant geometric potential arises in the surface part which scales linearly with the Mean curvature and shifts the Fermi energy of the material proportional to bending. Strain induced modification of the electronic properties or "straintronics" is clearly an important field of study in graphene. This opens a venue to producing electronic devices, MEMS and NEMS where the electronic properties are controlled by geometric means and no additional alteration of graphene is necessary. The appearance of this geometric potential also provides us with clues as to how quantum dynamics looks like in the curved space-time of general relativity. In this context, we explore a two-dimensional cross-section of the wormhole geometry realized with graphene as a solid state thought experiment.

Victor Atanasov; Avadh Saxena

2011-01-27T23:59:59.000Z

455

Relative reactivities of solid benzoic acids  

E-Print Network [OSTI]

was always the acid salt, (RBZA) HK. For the reaction, RBZAH + Z R'BZAK, where R g R', the products were those predicted from Hammett o-constants for R and R'. Observations on the mode of reaction and free energy changes are given. The desirability... reaction series chosen was that. one most directly related to the Hammett substituent constants; namely, the reactions of various m- or p- monosubstituted benzoic acids with m- or p-monosubstituted potas- sium benzoate salts. CHAPTER Il RES ULTS...

Warwas, Edwin James

2012-06-07T23:59:59.000Z

456

Acid mine water aeration and treatment system  

DOE Patents [OSTI]

An in-line system is provided for treating acid mine drainage which basically comprises the combination of a jet pump (or pumps) and a static mixer. The jet pump entrains air into the acid waste water using a Venturi effect so as to provide aeration of the waste water while further aeration is provided by the helical vanes of the static mixer. A neutralizing agent is injected into the suction chamber of the jet pump and the static mixer is formed by plural sections offset by 90 degrees.

Ackman, Terry E. (Finleyville, PA); Place, John M. (Bethel Park, PA)

1987-01-01T23:59:59.000Z

457

Effect of Conjugated Linoleic Acid or Oleic Acid Addition on Fatty Acid Composition Profiles of Poultry Meat  

E-Print Network [OSTI]

on the omega-6 fatty acid accumulation in broiler chicken breast and thigh meat. Eight broilers from each treatment were processed at 4 and 6 weeks of age, respectively. Regarding the diets containing five different fat sources, broiler chickens fed CLA...

Shin, Dae Keun

2011-08-08T23:59:59.000Z

458

A method to attenuate U(VI) mobility in acidic waste plumes using humic acids  

SciTech Connect (OSTI)

Acidic uranium (U) contaminated plumes have resulted from acid-extraction of plutonium during the Cold War and from U mining and milling operations. A sustainable method for in-situ immobilization of U under acidic conditions is not yet available. Here, we propose to use humic acids (HAs) for in-situ U immobilization in acidic waste plumes. Our laboratory batch experiments show that HA can adsorb onto aquifer sediments rapidly, strongly and practically irreversibly. Adding HA greatly enhanced U adsorption capacity to sediments at pH below 5.0. Our column experiments using historically contaminated sediments from the Savannah River Site under slow flow rates (120 and 12 m/y) show that desorption of U and HA were non-detectable over 100 pore-volumes of leaching with simulated acidic groundwaters. Upon HA-treatment, 99% of the contaminant [U] was immobilized at pH < 4.5, compared to 5% and 58% immobilized in the control columns at pH 3.5 and 4.5, respectively. These results demonstrated that HA-treatment is a promising in-situ remediation method for acidic U waste plumes. As a remediation reagent, HAs are resistant to biodegradation, cost effective, nontoxic, and easily introducible to the subsurface.

Wan, J.; Dong, W.; Tokunaga, T.K.

2011-02-01T23:59:59.000Z

459

X-ray photoelectron spectroscopy study of para-substituted benzoic acids chemisorbed to aluminum oxide thin films  

SciTech Connect (OSTI)

A series of para-substituted, halogenated (F, Cl, Br, and I) benzoic acid monolayers were prepared on the native oxide of aluminum surfaces by solution self-assembly and spin-coating techniques. The monolayers were characterized by x-ray photoelectron spectroscopy (XPS) and water contact angles. Several general trends are apparent. First, the polarity of the solvent is critical to monolayer formation. Protic polar solvents produced low coverage monolayers; in contrast, nonpolar solvents produced higher coverage monolayers. Second, solution deposition yields a higher surface coverage than spin coating. Third, the thickness of the monolayers determined from XPS suggests the plane of the aromatic ring is perpendicular to the surface with the carboxylate functional group most likely binding in a bidentate chelating geometry. Fourth, the saturation coverage (?2.7 10{sup 14} molecules cm{sup ?2}) is independent of the para-substituent.

Kreil, Justin; Ellingsworth, Edward; Szulczewski, Greg [Department of Chemistry, The University of Alabama, Shelby Hall, 250 Hackberry Lane, Tuscaloosa, Alabama 35487 (United States)] [Department of Chemistry, The University of Alabama, Shelby Hall, 250 Hackberry Lane, Tuscaloosa, Alabama 35487 (United States)

2013-11-15T23:59:59.000Z

460

Preparation of Some Substituted Terephthalic Acids  

E-Print Network [OSTI]

, with the dilithiation of 2,5-dibromotoluene with t-BuLi at ­78 8C, followed by reaction with dry ice and subsequent acid (3) is esterified,[9] then side-chain brominated with NBS, to produce dimethyl 2

Benin, Vladimir

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

Acid dyes removal using low cost adsorbents  

Science Journals Connector (OSTI)

Dyestuff production units and dyeing units have always had pressing need techniques that allow economical pre-treatment for colour in the effluent. The effectiveness of adsorption for dye removal from wastewaters has made it an ideal alternative to other expensive treatment options. Removal of acid green

A.H. Aydin; Y. Bulut; O. Yavuz

2004-01-01T23:59:59.000Z

462

Heterogeneous organic acid uptake on soot surfaces  

E-Print Network [OSTI]

observed the interaction between a number of carboxylic acids and soot from different fuel sources and formation mechanisms. A low pressure fast flow reactor was used to control the contact between the solid phase soot and gas phase organics, while chemical...

Levitt, Nicholas Paul

2009-05-15T23:59:59.000Z

463

Peer review plan muddies acid rain talks  

Science Journals Connector (OSTI)

Bilateral U.S./Canadian talks on an acid rain treaty are being buffeted by bitter winds of national politics and uncertain science. The latest ill wind to blow north, as far as the Canadians are concerned, is the U.S. plan to have peer reviewed all ...

1982-05-10T23:59:59.000Z

464

MFR PAPER 1339 Phosphonoacetic Acid Inhibition of  

E-Print Network [OSTI]

phosphonoace- tic acid (PAA), functions specifically by inhibiting the herpesvirus coded DNA dependent DNA polymerase in its process of replicating virus DNA (Mao and Robishaw, [975). In tissue culture systems, PAA and Overby, 1975). In all cases, the effec- tive tissue culture dose of PAA which inhibited herpesvirus

465

Corrosion free phosphoric acid fuel cell  

DOE Patents [OSTI]

A phosphoric acid fuel cell with an electrolyte fuel system which supplies electrolyte via a wick disposed adjacent a cathode to an absorbent matrix which transports the electrolyte to portions of the cathode and an anode which overlaps the cathode on all sides to prevent corrosion within the cell.

Wright, Maynard K. (Bethel Park, PA)

1990-01-01T23:59:59.000Z

466

Cost Effective Open Geometry HTS MRI System amended to BSCCO 2212 Wire for High Field Magnets  

SciTech Connect (OSTI)

The original goal of this Phase II Superconductivity Partnership Initiative project was to build and operate a prototype Magnetic Resonance Imaging (MRI) system using high temperature superconductor (HTS) coils wound from continuously processed dip-coated BSCCO 2212 tape conductor. Using dip-coated tape, the plan was for MRI magnet coils to be wound to fit an established commercial open geometry, 0.2 Tesla permanent magnet system. New electronics and imaging software for a prototype higher field superconducting system would have added significantly to the cost. However, the use of the 0.2 T platform would allow the technical feasibility and the cost issues for HTS systems to be fully established. Also it would establish the energy efficiency and savings of HTS open MRI compared with resistive and permanent magnet systems. The commercial goal was an open geometry HTS MRI running at 0.5 T and 20 K. This low field open magnet was using resistive normal metal conductor and its heat loss was rather high around 15 kolwatts. It was expected that an HTS magnet would dissipate around 1 watt, significantly reduce power consumption. The SPI team assembled to achieve this goal was led by Oxford Instruments, Superconducting Technology (OST), who developed the method of producing commercial dip coated tape. Superconductive Components Inc. (SCI), a leading US supplier of HTS powders, supported the conductor optimization through powder optimization, scaling, and cost reduction. Oxford Magnet Technology (OMT), a joint venture between Oxford Instruments and Siemens and the worlds leading supplier of MRI magnet systems, was involved to design and build the HTS MRI magnet and cryogenics. Siemens Magnetic Resonance Division, a leading developer and supplier of complete MRI imaging systems, was expected to integrate the final system and perform imaging trials. The original MRI demonstration project was ended in July 2004 by mutual consent of Oxford Instruments and Siemens. Between the project start and that date a substantial shift in the MRI marketplace occurred, with rapid growth for systems at higher fields (1.5 T and above) and a consequent decline in the low field market (<1.0 T). While the project aim appeared technically attainable at that time, the conclusion was reached that the system and market economics do not warrant additional investment. The program was redirected to develop BSCCO 2212 multifilament wire development for high field superconducting magnets for NMR and other scientific research upon an agreement between DOE and Oxford Instruments, Superconducting Technology. The work t took place between September, 2004 and the project end in early 2006 was focused on 2212 multifilamentary wire. This report summarizes the technical achievements both in 2212 dip coated for an HTS MRI system and in BSCCO 2212 multifilamentary wire for high field magnets.

Kennth Marken

2006-08-11T23:59:59.000Z

467

Detection of nucleic acid sequences by invader-directed cleavage  

DOE Patents [OSTI]

The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The 5' nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof. The present invention further relates to methods and devices for the separation of nucleic acid molecules based by charge.

Brow, Mary Ann D. (Madison, WI); Hall, Jeff Steven Grotelueschen (Madison, WI); Lyamichev, Victor (Madison, WI); Olive, David Michael (Madison, WI); Prudent, James Robert (Madison, WI)

1999-01-01T23:59:59.000Z

468

Producing a trimethylpentanoic acid using hybrid polyketide synthases  

DOE Patents [OSTI]

The present invention provides for a polyketide synthase (PKS) capable of synthesizing trimethylpentanoic acid. The present invention also provides for a host cell comprising the PKS and when cultured produces the trimethylpentanoic acid. The present invention also provides for a method of producing the trimethylpentanoic acid, comprising: providing a host cell of the present invention, and culturing said host cell in a suitable culture medium such that the trimethylpentanoic acid is produced, optionally isolating the trimethylpentanoic acid, and optionally, reducing the isolated trimethylpentanoic acid into a trimethylpentanol or an iso-octane.

Katz, Leonard; Fortman, Jeffrey L; Keasling, Jay D

2014-10-07T23:59:59.000Z

469

Investigations of Alternative Steam Generator Location and Flatter Core Geometry for Lead-Cooled Fast Reactors  

SciTech Connect (OSTI)

This paper concerns two independent safety investigations on critical and sub-critical heavy liquid metal cooled fast reactors using simple flow paths. The first investigation applies to locating the steam generators in the risers instead of the down-comers of a simple flow path designed sub-critical reactor of 600 MW{sub th} power. This was compared to a similar design, but with the steam generators located in the downcomers. The transients investigated were Total-Loss-of-Power and unprotected Loss-Of-Flow. It is shown that this reactor peaks at 1041 K after 29 hours during a Total-Loss-Of-Power accident. The difference between locating the steam generators in the risers and the downcomers is insignificant for this accident type. During an unprotected Loss-Of-Flow accident at full power, the core outlet temperature stabilizes at 1010 K, which is 337 K above nominal outlet temperature. The second investigation concerns a 1426 MW{sub th} critical reactor where the influence of the core height versus the core outlet temperature is studied during an unprotected Loss-Of-Flow and Total-Loss-Of-Power accident. A pancake type core geometry of 1.0 m height and 5.8 m diameter, is compared to a compact core of 2 m height and 4.5 m diameter. Moderators, like BeO and hydrides, and their influence on safety coefficients and burnup swings are also presented. Both cores incinerate transuranics from spent LWR fuel with minor actinide fraction of 5%. We show that LFRs can be designed both to breed and burn transuranics from LWRs. It is shown that the hydrides lead to the most favorable reactivity feedbacks, but the poorest reactivity swing. The computational fluid dynamics code STAR-CD was used for all thermal hydraulic calculations, and the MCNP and MCB for neutronics, and burn-up calculations. (authors)

Carlsson, Johan; Tucek, Kamil; Wider, Hartmut [Joint Research Centre, Institute for Energy, P.O. Box 2, NL-1755 ZG Petten (Netherlands)

2006-07-01T23:59:59.000Z

470

FACET: a radiation view factor computer code for axisymmetric, 2D planar, and 3D geometries with shadowing  

SciTech Connect (OSTI)

The computer code FACET calculates the radiation geometric view factor (alternatively called shape factor, angle factor, or configuration factor) between surfaces for axisymmetric, two-dimensional planar and three-dimensional geometries with interposed third surface obstructions. FACET was developed to calculate view factors for input to finite-element heat-transfer analysis codes. The first section of this report is a brief review of previous radiation-view-factor computer codes. The second section presents the defining integral equation for the geometric view factor between two surfaces and the assumptions made in its derivation. Also in this section are the numerical algorithms used to integrate this equation for the various geometries. The third section presents the algorithms used to detect self-shadowing and third-surface shadowing between the two surfaces for which a view factor is being calculated. The fourth section provides a user's input guide followed by several example problems.

Shapiro, A.B.

1983-08-01T23:59:59.000Z

471

Effects of self-heating and phase change on the thermal profile of hydrogen isotopes in confined geometries  

SciTech Connect (OSTI)

Growth of high-quality single-crystal hydrogen in confined geometries relies on the in situ formation of seed crystals. Generation of deuterium-tritium seed crystals in a confined geometry is governed by three effects: self-heating due to tritium decay, external thermal environment, and latent heat of phase change at the boundary between hydrogen liquid and vapor. A detailed computation of the temperature profile for liquid hydrogen inside a hollow shell, as is found in inertial confinement fusion research, shows that seeds are likely to form at the equatorial plane of the shell. Radioactive decay of tritium to helium slowly alters the composition of the hydrogen vapor, resulting in a modified temperature profile that encourages seed formation at the top of the shell. We show that the computed temperature profile is consistent with a variety of experimental observations.

Baxamusa, S., E-mail: baxamusa1@llnl.gov; Field, J.; Dylla-Spears, R.; Kozioziemski, B.; Suratwala, T.; Sater, J. [Lawrence Livermore National Laboratory, 7000 East Avenue, Livermore, California 94550 (United States)

2014-03-28T23:59:59.000Z

472

Radion stability and induced, on-brane geometries in an effective scalar-tensor theory of gravity II  

E-Print Network [OSTI]

In our earlier article (Phys.Rev. {\\bf D 88} 083506,(2013)) we had obtained spherically symmetric, static on-brane geometries in the Kanno-Soda effective scalar-tensor theory of gravity. The solution found was the extremal Reissner--Nordstrom black hole (the Majumdar-Papapetrou solution). In this article, we extend our analysis to more general, spherically symmetric, static geometries which are non-extremal in nature. The solution is nothing other than the well-known Reissner--Nordstrom solution. We find the radion field profiles for the various cases and also look into the issue of radion stability. Finally, the energy-momentum tensor for the effective on-brane matter is obtained and we observe that it can satisfy all energy conditions for a certain region of the parameter space of the solution.

Kar, Sayan; SenGupta, Soumitra

2015-01-01T23:59:59.000Z

473

Tracing the geometry around a massive, axisymmetric body to measure, through gravitational waves, its mass moments and electromagnetic moments  

E-Print Network [OSTI]

The geometry around a rotating massive body, which carries charge and electrical currents, could be described by its multipole moments (mass moments, mass-current moments, electric moments, and magnetic moments). When a small body is orbiting this massive body, it will move on geodesics, at least for a time interval that is short with respect to the characteristic time of the binary due to gravitational radiation. By monitoring the waves emitted by the small body we are actually tracing the geometry of the central object, and hence, in principle, we can infer all its multipole moments. This paper is a generalization of previous similar results by Ryan. The fact that the electromagnetic moments of spacetime can be measured demonstrates that one can obtain information about the electromagnetic field purely from gravitational wave analysis. Additionally, these measurements could be used as a test of the no-hair theorem for black holes.

T. P. Sotiriou; T. A. Apostolatos

2004-10-25T23:59:59.000Z

474

On the approximate albedo boundary conditions for two-energy group X,Y-geometry discrete ordinates eigenvalue problems  

SciTech Connect (OSTI)

We discuss in this paper the computational efficiency of approximate discrete ordinates (SN) albedo boundary conditions for two-energy group eigenvalue problems in X,Y-geometry. The non-standard SN albedo substitutes approximately the reflector system around the active domain, as we neglect the transverse leakage terms within the non-multiplying reflector region. Should the problem have no transverse leakage terms, i.e., one-dimensional slab geometry, then the offered albedo boundary conditions are exact. By computational efficiency we mean analyzing the accuracy of the numerical results versus the CPU execution time of each run for a given model problem. Numerical results to a typical test problem are shown to illustrate this efficiency analysis. (authors)

Nunes, C. E. A.; Alves Filho, H.; Barros, R. C. [Programa de Pos-graduacao em Modelagem Computacional, Instituto Politecnico, Universidade do Estado do Rio de Janeiro, Rua Alberto Rangel s/n, 28630-050 Nova Friburgo, RJ (Brazil)

2012-07-01T23:59:59.000Z

475

Investigating the Effect of Oil Saturation on Acid Propagation during Matrix Acidization of Carbonate Rocks  

E-Print Network [OSTI]

The existence of an optimum injection rate for wormhole propagation, and face dissolution at low injection rates during matrix acidizing are well established. However, little has been documented that describes how the presence of residual oil...

Kumar, Rahul Pradeep

2014-01-02T23:59:59.000Z

476

Effects of Acid Additives on Spent Acid Flowback through Carbonate Cores  

E-Print Network [OSTI]

Matrix acidizing is a well stimulation technique used to remove formation damage in the near wellbore region. But it comes with an associated set of challenges such as corrosion of the tubulars and iron precipitation in the formation. To counter...

Nasir, Ehsaan Ahmad

2012-07-16T23:59:59.000Z

477

Modeling Acid Transport and Non-Uniform Etching in a Stochastic Domain in Acid Fracturing  

E-Print Network [OSTI]

Success of acid fracturing depends on uneven etching along the fracture surfaces caused by heterogeneities such as variations in local mineralogy and variations in leakoff behavior. The heterogeneities tend to create channeling characteristics...

Mou, Jianye

2010-10-12T23:59:59.000Z

478

Reduction of pertechnetate by acetohydroxamic acid: Formation of [TcNO(AHA)2(H2O)]+ and implications for the UREX process.  

SciTech Connect (OSTI)

Reductive nitrosylation and complexation of ammonium pertechnetate by acetohydroxamic acid has been achieved in aqueous nitric and perchloric acid solutions. The kinetics of the reaction depend on the relative concentrations of the reaction components and are accelerated at higher temperatures. The reaction does not occur unless conditions are acidic. Analysis of the x-ray absorption fine structure spectroscopic data is consistent with a pseudo-octahedral geometry with the linear Tc-N-O bond typical of technetium nitrosyl compounds, and electron spin resonance spectroscopy is consistent with a the d{sup 5} Tc(II) nitrosyl complex. The nitrosyl source is generally AHA, but may be augmented by products of reaction with nitric acid. The resulting low-valency trans-aquonitrosyl(diacetohydroxamic)-technetium(II) complex (1) is highly soluble in water, extremely hydrophilic, and is not extracted by tri-n-butylphosphate in a dodecane diluent. Its extraction properties are not pH-dependent; titration studies indicate a single species from pH 4.5 down to -0.6 (calculated). This molecule is resistant to oxidation by H{sub 2}O{sub 2}, even at high pH, and can undergo substitution to form other technetium nitrosyl complexes. The formation of 1 may strongly impact the fate of technetium in the nuclear fuel cycle.

1Harry Reid Center for Environmental Studies, Nuclear Science and Technology Division, University of Nevada, Las Vegas, Las Vegas, NV, 89154-4006; Gong, Cynthia-May S; Poineau, Frederic; Lukens, Wayne W; Czerwinski, Kenneth R.

2008-02-26T23:59:59.000Z

479

A study of the distribution of fatty acids in the system: cottonseed oil-oleic acid-isopropanol-water  

E-Print Network [OSTI]

A STDDY OF THI' DISTBIRliTION OF FATTY ACIDS IN THE SYSTEM: COTTONSFED OIL - OLEIC ACID - ISOPBOPANOL - YlATEB A Thesis Frank E. Lomb January 1948 Approval as to style and content recommended: Head ' t Te epartm nt of hem cal Engineer ng A... STUDY OF THE DISTHIBUTION OF FATTY ACIDS IN THE SYSTEM: COTTONSEED OIL - OLEIC ACID - ISOFHOPANOL - WATER A Thesis By Frank E. Lamb January 1948 A STUDY QF TNE DISTRIBUTION OF FATTY ACIDS IN TRE SYSTEM: COTTONSEED OII, - OIEIC ACID - ISOPROPANOL...

Lamb, Frank E

2012-06-07T23:59:59.000Z

480

A First Look at Yeast Fatty Acid Synthase  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

A First Look at Yeast Fatty Acid Synthase Print A First Look at Yeast Fatty Acid Synthase Print Fatty acids are the major constituents of eukaryotic and bacterial cellular membranes. They are used for functionally important post-translational protein modifications, and chains of fatty acids are the main storage compartments of an organism's chemical energy. Fatty acid synthesis is carried out by fatty acid sythase (FAS), which catalyzes cycles of multistep chemical reactions that are essentially the same in all organisms. FAS uses one acetyl-coenzyme A (CoA) and seven malonyl-CoA molecules to synthesize the 16-carbon palmitic acid, the most abundant fatty acid in eukaryotes. Now, for the first time, a group of researchers has determined the atomic structure of yeast Saccharomyces cerevisiae FAS derived from two crystals of the enzyme, using data collected at ALS Beamlines 8.2.1 and 8.2.2, as well as other synchrotron facilities.

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

Acid-catalyzed dehydrogenation of amine-boranes  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Acid-catalyzed dehydrogenation of amine-boranes Acid-catalyzed dehydrogenation of amine-boranes Acid-catalyzed dehydrogenation of amine-boranes A method of dehydrogenating an amine-borane using an acid-catalyzed reaction. June 25, 2013 Acid-catalyzed dehydrogenation of amine-boranes A method of dehydrogenating an amine-borane using an acid-catalyzed reaction. Available for thumbnail of Feynman Center (505) 665-9090 Email Acid-catalyzed dehydrogenation of amine-boranes A method of dehydrogenating an amine-borane using an acid-catalyzed reaction. The method generates hydrogen and produces a solid polymeric product. The method of dehydrogenating amine-boranes may be used to generate hydrogen for power generation sources such as fuel cells. U.S. Patent No.: 7,645,902 (DOE S-104,909) Patent Application Filing Date: June 22, 2006

482

A First Look at Yeast Fatty Acid Synthase  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

A First Look at Yeast Fatty Acid Synthase Print A First Look at Yeast Fatty Acid Synthase Print Fatty acids are the major constituents of eukaryotic and bacterial cellular membranes. They are used for functionally important post-translational protein modifications, and chains of fatty acids are the main storage compartments of an organism's chemical energy. Fatty acid synthesis is carried out by fatty acid sythase (FAS), which catalyzes cycles of multistep chemical reactions that are essentially the same in all organisms. FAS uses one acetyl-coenzyme A (CoA) and seven malonyl-CoA molecules to synthesize the 16-carbon palmitic acid, the most abundant fatty acid in eukaryotes. Now, for the first time, a group of researchers has determined the atomic structure of yeast Saccharomyces cerevisiae FAS derived from two crystals of the enzyme, using data collected at ALS Beamlines 8.2.1 and 8.2.2, as well as other synchrotron facilities.

483

Mid-ultraviolet Light-Emitting Diode Detects Dipicolinic Acid  

Science Journals Connector (OSTI)

Dipicolinic acid (DPA, 2,6-pyridinedicarboxylic acid) is a substance uniquely present in bacterial spores such as that from anthrax (B. anthracis). It is known that DPA can be...

Li, Qingyang; Dasgupta, Purnendu K; Temkin, Henryk; Crawford, M H; Fischer, A J; Allerman, A A; Bogart, K H A; Lee, S R

2004-01-01T23:59:59.000Z

484

TRL Acid and Solvent Wet Processing Rules and Guidelines  

E-Print Network [OSTI]

: General rules and guidelines for wet chemical processing in TRL. Author: KFlo hood and when transporting or handling chemicals. An acid-proof apron, sleeveTRL Acid and Solvent Wet Processing Rules and Guidelines Purpose

Reif, Rafael

485

Development and testing of an advanced acid fracture conductivity apparatus  

E-Print Network [OSTI]

wells. Acid fracturing is a standard practice to increase the production rate and to improve ultimate recovery in carbonate reservoirs. There have been successful cases in most carbonate reservoirs around the world. However acid fracture performance...

Zou, ChunLei

2006-08-16T23:59:59.000Z

486

Choline for neutralizing naphthenic acid in fuel and lubricating oils  

SciTech Connect (OSTI)

A method is described of neutralizing at least a portion of the naphthenic acids present in fuel and lubricating oils which contain naphthenic acids which comprises treating these oils with a neutralizing amount of choline.

Ries, D.G.; Roof, G.L.

1986-07-15T23:59:59.000Z

487

Identification of petroleum acids in Liaohe super-heavy oil  

Science Journals Connector (OSTI)

In this study, petroleum acids were extracted from the super-heavy oil of Liaohe oilfield, North-east China, by using acetic acid, and their structural components and properties were investigated by using FT-I...

Bencheng Wu; Jianhua Zhu

2009-12-01T23:59:59.000Z

488

High Temperature Fuel Cell (Phosphoric Acid) Manufacturing R...  

Broader source: Energy.gov (indexed) [DOE]

Fuel Cell (Phosphoric Acid) Manufacturing R&D High Temperature Fuel Cell (Phosphoric Acid) Manufacturing R&D Presented at the NREL Hydrogen and Fuel Cell Manufacturing R&D Workshop...

489

Nucleic acid based fluorescent sensor for copper detection  

DOE Patents [OSTI]

A nucleic acid enzyme responsive to copper, comprising an oligonucleotide comprising a nucleotide sequence of SEQ ID NO:1, wherein the nucleic acid enzyme is not self-cleaving.

Lu, Yi; Liu, Juewen

2013-04-02T23:59:59.000Z

490

Conversion of carboxylate salts to carboxylic acids via reactive distillation.  

E-Print Network [OSTI]

??The purpose of this study is to convert carboxylate salts (e.g. calcium acetate, propionate, and butyrate) into carboxylic acids (e.g., acetic, propionic, and butyric acids). (more)

Williamson, Shelly Ann

2012-01-01T23:59:59.000Z

491

Influence of boric acid additive size on green lubricant performance  

Science Journals Connector (OSTI)

...towards green manufacturing processes, there...boric acid powder additives with canola oil...change present manufacturing process lines...powder-based lubricant additives As conceptually...of boric acid additive size on green...towards green manufacturing processes, there...

2010-01-01T23:59:59.000Z

492

The Effect of Heterogeneity on Matrix Acidizing of Carbonate Rocks  

E-Print Network [OSTI]

In matrix acidizing, the goal is to dissolve minerals in the rock to increase well productivity. This is accomplished by injecting an application-specific solution of acid into the formation at a pressure between the pore pressure and fracture...

Keys, Ryan S.

2010-07-14T23:59:59.000Z

493

Kinetic evaluation of the esterification of fatty acids to biodiesel  

Science Journals Connector (OSTI)

The free fatty acids of cotton seed oil were processed with methanol and ethanol into the corresponding alkyl fatty esters in the presence of diluted sulfuric acid. The products characterized as biodiesels pre...

Frederico A. D. Arajo; Sonia V. Pereira

2012-10-01T23:59:59.000Z

494

The determination of potential acidity in overburden sediments  

E-Print Network [OSTI]

Weathered Overburden Samples. Determination of Total Sulfur by LECO. Determination of Non-Sulfate Sulfur by LECO. Pyritic Iron Using the ASTM Method Potential Acidity Using a Rapid Oxidation Technique - Original Method. Potential Acidity Using a Rapid... the Sample. The Addition of Excess H 02. Catalysing the Decomposition of Excess H202. Leaching the Oxidized Sample with CaC12. Comparison of Potential Acidity Methods. F and T Tests. Potential Acidity of Weathered vs. Unweathered Samples. Total S...

O'Shay, Tracey Ann

2012-06-07T23:59:59.000Z

495

The biodegradation of organic acids by a heterogeneous bacterial culture  

E-Print Network [OSTI]

- tion of fatty acids results in multiple cleavage of the molecules to form shorter chain acids. It has been found (1I) that ethanoic and butanoic are the principle volatile acids present during digestion of sewage sludge while propanoic and pentanoic... was developed from a heterogeneous culture found in a sewage plant effluent. The culture was developed in a bench scale continuous flow activated. sludge reactor, and individual studies were made in a bench scale aerated batch reactor. The acids used were...

Tyer, Bobby Ray

1968-01-01T23:59:59.000Z

496

Nucleic Acid Standards - Sugar and Phosphate Constituents  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sugar and Phosphate Constituents Sugar and Phosphate Constituents The following tables contain the complete references for the structures used in a statistical survey of well-refined mononucleoside, mononucleotide, dinucleoside monophosphate, and trinucleoside diphosphate crystal structures found in the Cambridge Structural Database and the Nucleic Acid Database that appeared in The Journal of the American Chemical Society (Anke Gelbin, Bohdan Schneider, Lester Clowney, Shu-Hsin Hsieh, Wilma K. Olson, and Helen M. Berman. "Geometric Parameters in Nucleic Acids: Sugar Phosphate Constituents" (1996) 118, 519-529.) Table 1: References for Mononucleoside and Mononucleotide Structures Table 2: References for Dinucleoside Monophosphate and Trinucleoside Diphosphate Structures The following tables are summaries of the bond lengths, angles, and torsion

497

Improved Processes to Remove Naphthenic Acids  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Improved Processes to Remove Naphthenic Acids Improved Processes to Remove Naphthenic Acids Final Technical Report (From October 1, 2002 to September 30, 2005) Principle Authors Aihua Zhang, Qisheng Ma, Kangshi Wang, Yongchun Tang (co-PI), William A. Goddard (PI), Date Report was issued: December 9, 2005 DOE Award number: DE-FC26-02NT15383 Name and Address of Submitting Organization California Institute of Technology 1200 East California Blvd., Pasadena, CA91125 Disclaimer This report was prepared as an account of work sponsored by an agency of the United States Government. Neither the United States Government nor any agency thereof, nor any of their employees, makes any warranty, express or implied, or assumes any legal liability or responsibility for the accuracy, completeness, or usefulness of any

498

Critical review of naphthenic acid corrosion  

SciTech Connect (OSTI)

Naphthenic acid corrosion continues to be a reliability issue in refinery distillation units. A review of the subject is presented herein with special focus on field and laboratory data and on areas where research is needed. The review shows that several parameters are known to affect the corrosion process and their individual effect on crude corrosivity are somewhat understood. However, their combined effect is still subject to much controversy. The determination of a critical factor--naphthenic acid content--is still not standardized. It is shown herein that, by arranging the literature findings into three groups (1) furnace tubes and transfer lines, (2) vacuum column and (3) side cut piping, a better agreement of the literature data is achieved.

Tebbal, S. [SET Labs., Inc., Stafford, TX (United States)

1999-11-01T23:59:59.000Z

499

Sulfate and acid resistant concrete and mortar  

DOE Patents [OSTI]

The present invention relates to concrete, mortar and other hardenable mixtures comprising cement and fly ash for use in construction and other applications, which hardenable mixtures demonstrate significant levels of acid and sulfate resistance while maintaining acceptable compressive strength properties. The acid and sulfate hardenable mixtures of the invention containing fly ash comprise cementitious materials and a fine aggregate. The cementitous materials may comprise fly ash as well as cement. The fine aggregate may comprise fly ash as well as sand. The total amount of fly ash in the hardenable mixture ranges from about 60% to about 120% of the total amount of cement, by weight, whether the fly ash is included as a cementious material, fine aggregate, or an additive, or any combination of the foregoing. In specific examples, mortar containing 50% fly ash and 50% cement in cementitious materials demonstrated superior properties of corrosion resistance. 6 figs.

Liskowitz, J.W.; Wecharatana, M.; Jaturapitakkul, C.; Cerkanowicz, A.E.

1998-06-30T23:59:59.000Z

500

Sulfate and acid resistant concrete and mortar  

DOE Patents [OSTI]

The present invention relates to concrete, mortar and other hardenable mixtures comprising cement and fly ash for use in construction and other applications, which hardenable mixtures demonstrate significant levels of acid and sulfate resistance while maintaining acceptable compressive strength properties. The acid and sulfate hardenable mixtures of the invention containing fly ash comprise cementitious materials and a fine aggregate. The cementitous materials may comprise fly ash as well as cement. The fine aggregate may comprise fly ash as well as sand. The total amount of fly ash in the hardenable mixture ranges from about 60% to about 120% of the total amount of cement, by weight, whether the fly ash is included as a cementious material, fine aggregate, or an additive, or any combination of the foregoing. In specific examples, mortar containing 50% fly ash and 50% cement in cementitious materials demonstrated superior properties of corrosion resistance.

Liskowitz, John W. (Belle Mead, NJ); Wecharatana, Methi (Parsippany, NJ); Jaturapitakkul, Chai (Bangkok, TH); Cerkanowicz, deceased, Anthony E. (late of Livingston, NJ)

1998-01-01T23:59:59.000Z