Powered by Deep Web Technologies
Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Experimental Investigation for the Effects of the Core Geometry on the Optimum Acid Flux in Carbonate Acidizing  

E-Print Network [OSTI]

Previous matrix acidizing experimental research showed that there exists an optimum acid interstitial velocity (Vi-opt) that results in the minimum volume of acid used while providing the best stimulation results. There are already several...

Jin, Xiao

2013-11-21T23:59:59.000Z

2

Altering the Electrostatic Potential in the Major Groove: Thermodynamic and Structural Characterization of 7-Deaza-2;#8242;-deoxyadenosine:dT Base Pairing in DNA  

SciTech Connect (OSTI)

As part of an ongoing effort to explore the effect of major groove electrostatics on the thermodynamic stability and structure of DNA, a 7-deaza-2'-deoxyadenosine:dT (7-deaza-dA:dT) base pair in the Dickerson-Drew dodecamer (DDD) was studied. The removal of the electronegative N7 atom on dA and the replacement with an electropositive C-H in the major groove was expected to have a significant effect on major groove electrostatics. The structure of the 7-deaza-dA:dT base pair was determined at 1.1 {angstrom} resolution in the presence of Mg{sup 2+}. The 7-deaza-dA, which is isosteric for dA, had minimal effect on the base pairing geometry and the conformation of the DDD in the crystalline state. There was no major groove cation association with the 7-deaza-dA heterocycle. In solution, circular dichroism showed a positive Cotton effect centered at 280 nm and a negative Cotton effect centered at 250 nm that were characteristic of a right-handed helix in the B-conformation. However, temperature-dependent NMR studies showed increased exchange between the thymine N3 imino proton of the 7-deaza-dA:dT base pair and water, suggesting reduced stacking interactions and an increased rate of base pair opening. This correlated with the observed thermodynamic destabilization of the 7-deaza-dA modified duplex relative to the DDD. A combination of UV melting and differential scanning calorimetry experiments were conducted to evaluate the relative contributions of enthalpy and entropy in the thermodynamic destabilization of the DDD. The most significant contribution arose from an unfavorable enthalpy term, which probably results from less favorable stacking interactions in the modified duplex, which was accompanied by a significant reduction in the release of water and cations from the 7-deaza-dA modified DNA.

Kowal, Ewa A.; Ganguly, Manjori; Pallan, Pradeep S.; Marky, Luis A.; Gold, Barry; Egli, Martin; Stone, Michael P. (Pitt); (Vanderbilt); (Nebraska-Med)

2012-02-15T23:59:59.000Z

3

B-DNA structure is intrinsically polymorphic: even at the level of base pair positions  

SciTech Connect (OSTI)

Increasingly exact measurement of single crystal X-ray diffraction data offers detailed characterization of DNA conformation, hydration and electrostatics. However, instead of providing a more clear and unambiguous image of DNA, highly accurate diffraction data reveal polymorphism of the DNA atomic positions and conformation and hydration. Here we describe an accurate X-ray structure of B-DNA, painstakingly fit to a multistate model that contains multiple competing positions of most of the backbone and of entire base pairs. Two of ten base-pairs of CCAGGCCTGG are in multiple states distinguished primarily by differences in slide. Similarly, all the surrounding ions are seen to fractionally occupy discrete competing and overlapping sites. And finally, the vast majority of water molecules show strong evidence of multiple competing sites. Conventional resolution appears to give a false sense of homogeneity in conformation and interactions of DNA. In addition, conventional resolution yields an average structure that is not accurate, in that it is different from any of the multiple discrete structures observed at high resolution. Because base pair positional heterogeneity has not always been incorporated into model-building, even some high and ultrahigh-resolution structures of DNA do not indicate the full extent of conformational polymorphism.

Maehigashi, Tatsuya; Hsiao, Chiaolong; Woods, Kristen Kruger; Moulaei, Tinoush; Hud, Nicholas V.; Williams, Loren Dean (GIT)

2012-10-23T23:59:59.000Z

4

Structure of the 2-Aminopurine-Cytosine Base Pair Formed in the Polymerase Active Site of the RB69 Y567A-DNA Polymerase  

SciTech Connect (OSTI)

The adenine base analogue 2-aminopurine (2AP) is a potent base substitution mutagen in prokaryotes because of its enhanceed ability to form a mutagenic base pair with an incoming dCTP. Despite more than 50 years of research, the structure of the 2AP-C base pair remains unclear. We report the structure of the 2AP-dCTP base pair formed within the polymerase active site of the RB69 Y567A-DNA polymerase. A modified wobble 2AP-C base pair was detected with one H-bond between N1 of 2AP and a proton from the C4 amino group of cytosine and an apparent bifurcated H-bond between a proton on the 2-amino group of 2-aminopurine and the ring N3 and O2 atoms of cytosine. Interestingly, a primer-terminal region rich in AT base pairs, compared to GC base pairs, facilitated dCTP binding opposite template 2AP. We propose that the increased flexibility of the nucleotide binding pocket formed in the Y567A-DNA polymerase and increased 'breathing' at the primer-terminal junction of A+T-rich DNA facilitate dCTP binding opposite template 2AP. Thus, interactions between DNA polymerase residues with a dynamic primer-terminal junction play a role in determining base selectivity within the polymerase active site of RB69 DNA polymerase.

Reha-Krantz, Linda J.; Hariharan, Chithra; Subuddhi, Usharani; Xia, Shuangluo; Zhao, Chao; Beckman, Jeff; Christian, Thomas; Konigsberg, William (Yale); (Alberta)

2011-11-21T23:59:59.000Z

5

Advanced Review Geometry optimization  

E-Print Network [OSTI]

Advanced Review Geometry optimization H. Bernhard Schlegel Geometry optimization is an important part of most quantum chemical calcu- lations. This article surveys methods for optimizing equilibrium geometries, lo- cating transition structures, and following reaction paths. The emphasis is on optimizations

Schlegel, H. Bernhard

6

Noncommutative geometry and quantization  

E-Print Network [OSTI]

We examine some recent developments in noncommutative geometry, including spin geometries on noncommutative tori and their quantization by the Shale-Stinespring procedure, as well as the emergence of Hopf algebras as a tool linking index theory and renormalization calculations

Varilly, J C

2000-01-01T23:59:59.000Z

7

harmonic analysis and geometry  

E-Print Network [OSTI]

Faculty listing for "harmonic analysis and geometry". vCard of Nicola Garofalo Garofalo, Nicola [bio] [homepage] Adjunct Professor of Mathematics

8

Induced geometry from disformal transformation  

E-Print Network [OSTI]

In this note, we use the disformal transformation to induce a geometry from the manifold which is originally Riemannian. The new geometry obtained here can be considered as a generalization of Weyl integrable geometry. Based on these results, we further propose a geometry which is naturally a generalization of Weyl geometry.

Yuan, Fang-Fang

2015-01-01T23:59:59.000Z

9

Induced geometry from disformal transformation  

E-Print Network [OSTI]

In this note, we use the disformal transformation to induce a geometry from the manifold which is originally Riemannian. The new geometry obtained here can be considered as a generalization of Weyl integrable geometry. Based on these results, we further propose a geometry which is naturally a generalization of Weyl geometry.

Fang-Fang Yuan; Peng Huang

2015-02-08T23:59:59.000Z

10

The Geometry Of War The Geometry Of War  

E-Print Network [OSTI]

The Geometry Of War 1 #12;The Geometry Of War GEM1518K Mathematics in Arts &Architecture Presenting : The Geometry Of War Prepared by: 1) Linda Tjoe Matriculation number: U017984E 2) Lince Salim Matriculation017997 2 #12;The Geometry Of War Contents Page(s) Introduction 1 1.1 Early Canon 2 1.2 The Triumph

Aslaksen, Helmer

11

Forschungsschwerpunkt S92 Industrial Geometry  

E-Print Network [OSTI]

Forschungsschwerpunkt S92 Industrial Geometry http://www.ig.jku.at Computational Geometry Robot Kinematics Computer Aided Geometric Design Image Processing INDUSTRIAL GEOMETRY Classical Geometry Computer unwanted branches of the implicitly defined curves. Moreover, it is required for many applications, e

Jüttler, Bert

12

Spacetime and Euclidean Geometry  

E-Print Network [OSTI]

Using only the principle of relativity and Euclidean geometry we show in this pedagogical article that the square of proper time or length in a two-dimensional spacetime diagram is proportional to the Euclidean area of the corresponding causal domain. We use this relation to derive the Minkowski line element by two geometric proofs of the "spacetime Pythagoras theorem".

Dieter Brill; Ted Jacobson

2004-08-04T23:59:59.000Z

13

Noncommutative Geometry for Pedestrians  

E-Print Network [OSTI]

A short historical review is made of some recent literature in the field of noncommutative geometry, especially the efforts to add a gravitational field to noncommutative models of space-time and to use it as an ultraviolet regulator. An extensive bibliography has been added containing reference to recent review articles as well as to part of the original literature.

J. Madore

1999-07-25T23:59:59.000Z

14

Sliding vane geometry turbines  

DOE Patents [OSTI]

Various systems and methods are described for a variable geometry turbine. In one example, a turbine nozzle comprises a central axis and a nozzle vane. The nozzle vane includes a stationary vane and a sliding vane. The sliding vane is positioned to slide in a direction substantially tangent to an inner circumference of the turbine nozzle and in contact with the stationary vane.

Sun, Harold Huimin; Zhang, Jizhong; Hu, Liangjun; Hanna, Dave R

2014-12-30T23:59:59.000Z

15

Cylindrical geometry hall thruster  

DOE Patents [OSTI]

An apparatus and method for thrusting plasma, utilizing a Hall thruster with a cylindrical geometry, wherein ions are accelerated in substantially the axial direction. The apparatus is suitable for operation at low power. It employs small size thruster components, including a ceramic channel, with the center pole piece of the conventional annular design thruster eliminated or greatly reduced. Efficient operation is accomplished through magnetic fields with a substantial radial component. The propellant gas is ionized at an optimal location in the thruster. A further improvement is accomplished by segmented electrodes, which produce localized voltage drops within the thruster at optimally prescribed locations. The apparatus differs from a conventional Hall thruster, which has an annular geometry, not well suited to scaling to small size, because the small size for an annular design has a great deal of surface area relative to the volume.

Raitses, Yevgeny (Princeton, NJ); Fisch, Nathaniel J. (Princeton, NJ)

2002-01-01T23:59:59.000Z

16

$E_8$ geometry  

E-Print Network [OSTI]

We investigate exceptional generalised diffeomorphisms based on $E_{8(8)}$ in a geometric setting. The transformations include gauge transformations for the dual gravity field. The surprising key result, which allows for a development of a tensor formalism, is that it is possible to define field-dependent transformations containing connection, which are covariant. We solve for the spin connection and construct a curvature tensor. A geometry for the Ehlers symmetry SL(n+1) is sketched. Some related issues are discussed.

Cederwall, Martin

2015-01-01T23:59:59.000Z

17

ARM - Measurement - Hydrometeor Geometry  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsruc Documentation RUC : XDCResearch Related InformationAciddroplet sizeGeometry ARM Data Discovery

18

JOURNAL FOR GEOMETRY AND GRAPHICS  

E-Print Network [OSTI]

JOURNAL FOR GEOMETRY AND GRAPHICS . . . the journal for graphics educators AIMS AND SCOPE methodology in the field of graphics and graphics-related geometry by the dissemination of new results. JGG is the journal of the International Society for Geometry and Graphics FREQUENCY One volume per year, consisting

Stachel, Hellmuth

19

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus  

SciTech Connect (OSTI)

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

Yeo, Hyun Koo; Lee, Jae Young (Dongguk)

2012-04-18T23:59:59.000Z

20

A prediction for bubbling geometries  

E-Print Network [OSTI]

We study the supersymmetric circular Wilson loops in N=4 Yang-Mills theory. Their vacuum expectation values are computed in the parameter region that admits smooth bubbling geometry duals. The results are a prediction for the supergravity action evaluated on the bubbling geometries for Wilson loops.

Takuya Okuda

2008-02-11T23:59:59.000Z

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Optical geometry across the horizon  

E-Print Network [OSTI]

In a companion paper (Jonsson and Westman, Class. Quantum Grav. 23 (2006) 61), a generalization of optical geometry, assuming a non-shearing reference congruence, is discussed. Here we illustrate that this formalism can be applied to a finite four-volume of any spherically symmetric spacetime. In particular we apply the formalism, using a non-static reference congruence, to do optical geometry across the horizon of a static black hole. While the resulting geometry in principle is time dependent, we can choose the reference congruence in such a manner that an embedding of the geometry always looks the same. Relative to the embedded geometry the reference points are then moving. We discuss the motion of photons, inertial forces and gyroscope precession in this framework.

Rickard Jonsson

2007-08-19T23:59:59.000Z

22

Hertz Potentials and Differential Geometry  

E-Print Network [OSTI]

I review the construction of Hertz potentials in vector calculus starting from Maxwell's equations. From here, I lay the minimal foundations of differential geometry to construct Hertz potentials for a general (spatially compact) Lorentzian...

Bouas, Jeffrey David

2011-08-08T23:59:59.000Z

23

Tensor network states and geometry  

E-Print Network [OSTI]

Tensor network states are used to approximate ground states of local Hamiltonians on a lattice in D spatial dimensions. Different types of tensor network states can be seen to generate different geometries. Matrix product states (MPS) in D=1 dimensions, as well as projected entangled pair states (PEPS) in D>1 dimensions, reproduce the D-dimensional physical geometry of the lattice model; in contrast, the multi-scale entanglement renormalization ansatz (MERA) generates a (D+1)-dimensional holographic geometry. Here we focus on homogeneous tensor networks, where all the tensors in the network are copies of the same tensor, and argue that certain structural properties of the resulting many-body states are preconditioned by the geometry of the tensor network and are therefore largely independent of the choice of variational parameters. Indeed, the asymptotic decay of correlations in homogeneous MPS and MERA for D=1 systems is seen to be determined by the structure of geodesics in the physical and holographic geometries, respectively; whereas the asymptotic scaling of entanglement entropy is seen to always obey a simple boundary law -- that is, again in the relevant geometry. This geometrical interpretation offers a simple and unifying framework to understand the structural properties of, and helps clarify the relation between, different tensor network states. In addition, it has recently motivated the branching MERA, a generalization of the MERA capable of reproducing violations of the entropic boundary law in D>1 dimensions.

G. Evenbly; G. Vidal

2011-06-06T23:59:59.000Z

24

Supplementary Materials: A Partition Function Algorithm for Interacting Nucleic Acid Strands  

E-Print Network [OSTI]

nucleic acid strands by R and S. Strand R is indexed from 1 to LR, and S is indexed from 1 to LS both in 5 to 3 direction. Note that the two strands interact in opposite directions, e.g. R in 5 3 with S in 3 to the ith nucleotide in R and S by iR and iS respectively. An intramolecular base pair between

Will, Sebastian

25

Geometry is a verb Workshop @ 2009 NCTM  

E-Print Network [OSTI]

Geometry is a verb Workshop @ 2009 NCTM Tad Watanabe Kennesaw State University e-mail: twatanab@kennesaw.edu "Geometry" Is A Verb: Making Elementary School Geometry Come Alive Tad Watanabe Kennesaw State University://science.kennesaw.edu/~twatanab/ #12;Geometry is a verb Workshop @ 2009 NCTM Tad Watanabe Kennesaw State University http

Watanabe, Tad

26

Geometry, topology, and string theory  

SciTech Connect (OSTI)

A variety of scenarios are considered which shed light upon the uses and limitations of classical geometric and topological notions in string theory. The primary focus is on situations in which D-brane or string probes of a given classical space-time see the geometry quite differently than one might naively expect. In particular, situations in which extra dimensions, non-commutative geometries as well as other non-local structures emerge are explored in detail. Further, a preliminary exploration of such issues in Lorentzian space-times with non-trivial causal structures within string theory is initiated.

Varadarajan, Uday

2003-07-10T23:59:59.000Z

27

Lighting and GeometryLighting and Geometry Prof. Michael Misha Kazhdan  

E-Print Network [OSTI]

Lighting and GeometryLighting and Geometry Prof. Michael Misha Kazhdan misha· The viewer · The lights N Viewer · The lights · The geometry · The surface properties N L2 V Viewer L1Outline · Surface Properties (Review) · Lighting· Lighting · Geometry· Geometry #12;Surface Properties (Review

Fröhlich, Peter

28

Capillary instability in nanowire geometries  

E-Print Network [OSTI]

The vapor-liquid-solid (VLS) mechanism has been applied extensively as a framework for growing single-crystal semiconductor nanowires for applications spanning optoelectronic, sensor and energy-related technologies. Recent experiments have demonstrated that subtle changes in VLS growth conditions produce a diversity of nanowire morphologies, and result in intricate kinked structures that may yield novel properties. These observations have motivated modeling studies that have linked kinking phenomena to processes at the triple line between vapor, liquid and solid phases that cause spontaneous "tilting" of the growth direction. Here we present atomistic simulations and theoretical analyses that reveal a tilting instability that is intrinsic to nanowire geometries, even in the absence of pronounced anisotropies in solid-liquid interface properties. The analysis produces a very simple conclusion: the transition between axisymmetric and tilted triple lines is shown to occur when the triple line geometry satisfies Young's force-balance condition. The intrinsic nature of the instability may have broad implications for the design of experimental strategies for controlled growth of crystalline nanowires with complex geometries.

T. Frolov; W. C. Carter; M. Asta

2014-03-02T23:59:59.000Z

29

Towards a Nano Geometry? Geometry and Dynamics on Nano Scale  

E-Print Network [OSTI]

This paper applies I.M. Gelfand's distinction between adequate and non-adequate use of mathematical language in different contexts to the newly opened window of model-based measurements of intracellular dynamics. The specifics of geometry and dynamics on the mesoscale of cell physiology are elaborated - in contrast to the familiar Newtonian mechanics and the more recent, but by now also rather well established quantum field theories. Examples are given originating from the systems biology of insulin secreting pancreatic beta-cells and the mathematical challenges of an envisioned non-invasive control of magnetic nanoparticles.

Bernhelm Booss-Bavnbek

2012-02-23T23:59:59.000Z

30

Quantum Geometry and Quantum Gravity  

E-Print Network [OSTI]

The purpose of this contribution is to give an introduction to quantum geometry and loop quantum gravity for a wide audience of both physicists and mathematicians. From a physical point of view the emphasis will be on conceptual issues concerning the relationship of the formalism with other more traditional approaches inspired in the treatment of the fundamental interactions in the standard model. Mathematically I will pay special attention to functional analytic issues, the construction of the relevant Hilbert spaces and the definition and properties of geometric operators: areas and volumes.

J. Fernando Barbero G.

2008-04-23T23:59:59.000Z

31

Quantum Geometry and Black Holes  

E-Print Network [OSTI]

We present an overall picture of the advances in the description of black hole physics from the perspective of loop quantum gravity. After an introduction that discusses the main conceptual issues we present some details about the classical and quantum geometry of isolated horizons and their quantum geometry and then use this scheme to give a natural definition of the entropy of black holes. The entropy computations can be neatly expressed in the form of combinatorial problems solvable with the help of methods based on number theory and the use of generating functions. The recovery of the Bekenstein-Hawking law and corrections to it is explained in some detail. After this, due attention is paid to the discussion of semiclassical issues. An important point in this respect is the proper interpretation of the horizon area as the energy that should appear in the statistical-mechanical treatment of the black hole model presented here. The chapter ends with a comparison between the microscopic and semiclassical app...

G., J Fernando Barbero

2015-01-01T23:59:59.000Z

32

Changing the Structure Boundary Geometry  

SciTech Connect (OSTI)

Analysis of previously obtained results shows that hexagonal crystal lattice is the dominant type of ordering, in particular, in striated glow discharges. We explore the possibility for changing the dust distribution in horizontal cross sections of relatively highly ordered structures in a glow-discharge. Presuming that boundary geometry can affect dust distribution, we used cylindrical coolers held at 0 deg. C and placed against a striation containing a structure, to change the geometry of its outer boundary. By varying the number of coolers, their positions, and their separations from the tube wall, azimuthally asymmetric thermophoretic forces can be used to form polygonal boundaries and vary the angles between their segments (in a horizontal cross section). The corner in the structure's boundary of 60 deg. stimulates formation of hexagonal cells. The structure between the supported parallel boundaries is also characterized by stable hexagonal ordering. We found that a single linear boundary segment does not give rise to any sizable domain, but generates a lattice extending from the boundary (without edge defects). A square lattice can be formed by setting the angle equal to 90 deg. . However, angles of 45 deg. and 135 deg. turned out easier to form. Square lattice was created by forming a near-135 deg. corner with four coolers. It was noted that no grain ordering is observed in the region adjacent to corners of angles smaller than 30 deg. , which do not promote ordering into cells of any shape. Thus, manipulation of a structure boundary can be used to change dust distribution, create structures free of the ubiquitous edge defects that destroy orientation order, and probably change the crystal lattice type.

Karasev, Viktor; Dzlieva, Elena; Ivanov, Artyom [St.-Petersburg State University, Physics Faculty, Ulianovskaya 1, Peterhof, St. Petersburg, 198504 (Russian Federation)

2008-09-07T23:59:59.000Z

33

THE GEOMETRIES OF 3-MANIFOLDS PETER SCOTT  

E-Print Network [OSTI]

that each smooth path on S2 has a length, namely its length as a path in £3 . (I shall consistently use ETHE GEOMETRIES OF 3-MANIFOLDS PETER SCOTT Page §1. The 2-dimensional geometries 405 §2. Geometric. The eight 3-dimensional geometries 441 E3 443 H3 448 S3 449 S2 x U 457 fPxM 459 SL2U 462 Nil 467 Sol 470 §5

Schleimer, Saul

34

Matlab Geometry Builder and Mlfma Modeler.  

E-Print Network [OSTI]

??Development of MATLAB graphical user interface (GUI) to facilitate building and modification of discretized geometries for use in moment method (MM) and multilevel fast multipole (more)

Carrero, Christopher

2011-01-01T23:59:59.000Z

35

Equivalence of Convex Problem Geometry and Computational ...  

E-Print Network [OSTI]

Equivalence of Convex Problem Geometry and Computational Complexity in the Separation Oracle Model?. Robert M. Freundand Jorge Vera. January 2009.

2009-01-19T23:59:59.000Z

36

MACDONALD POLYNOMIALS AND GEOMETRY MARK HAIMAN  

E-Print Network [OSTI]

MACDONALD POLYNOMIALS AND GEOMETRY MARK HAIMAN Contents 1. Introduction 2. Symmetric functions and Macdonald polynomials 3. The n! conjecture 4. The Hilbert scheme and Xn 5. Frobenius series 6. The ideals J by Macdonald [26], and the geometry of certain algebraic varieties, notably the Hilbert scheme Hilbn (C2

Haiman, Mark D.

37

MACDONALD POLYNOMIALS AND GEOMETRY MARK HAIMAN  

E-Print Network [OSTI]

MACDONALD POLYNOMIALS AND GEOMETRY MARK HAIMAN Contents 1. Introduction 2. Symmetric functions and Macdonald polynomials 3. The n! conjecture 4. The Hilbert scheme and X n 5. Frobenius series 6. The ideals J by Macdonald [26], and the geometry of certain algebraic varieties, notably the Hilbert scheme Hilb n (C 2

Haiman, Mark D.

38

Hydraulic Geometry: Empirical Investigations and Theoretical Approaches  

E-Print Network [OSTI]

Hydraulic Geometry: Empirical Investigations and Theoretical Approaches B.C. Eatona, a Department of Geography, The University of British Columbia 1984 West Mall, Vancouver, BC, V6T 1Z2 Abstract Hydraulic. One approach to hydraulic geometry considers temporal changes at a single location due to variations

Eaton, Brett

39

A Note on Real Tunneling Geometries  

E-Print Network [OSTI]

In the Hartle-Hawking ``no boundary'' approach to quantum cosmology, a real tunneling geometry is a configuration that represents a transition from a compact Riemannian spacetime to a Lorentzian universe. I complete an earlier proof that in three spacetime dimensions, such a transition is ``probable,'' in the sense that the required Riemannian geometry yields a genuine maximum of the semiclassical wave function.

S. Carlip

2005-08-17T23:59:59.000Z

40

Line geometry and electromagnetism I: basic structures  

E-Print Network [OSTI]

Some key notions of line geometry are recalled, along with their application to mechanics. It is then shown that most of the basic structures that one introduces in the pre-metric formulation of electromagnetism can be interpreted directly in terms of corresponding concepts in line geometry. The results are summarized in a table.

D. H. Delphenich

2013-09-11T23:59:59.000Z

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

NATURAL CONVECTION IN ROOM GEOMETRIES  

SciTech Connect (OSTI)

Computer programs have been developed to numerically simulate natural convection in room geometries in two and three dimensions. The programs have been validated using published data from the literature, results from a full-scale experiment performed at Massachusetts Institute of Technology, and results from a small-scale experiment reported here. One of the computer programs has been used to study the influence of natural convection on the thermal performance of a single thermal zone in a direct-gain passive solar building. The results indicate that the building heating loads calculated by standard building energy analysis methods may be in error by as much as 50% as a result of their use of common assumptions regarding the convection processes which occur in an enclosure. It is also found that the convective heat transfer coefficients between the air and the enclosure surfaces can be substantially different from the values assumed in the standard building energy analysis methods, and can exhibit significant variations across a given surface.

Gadgil, A.; Bauman, Fred; Kammerud, R.; Ruberg, K.

1980-06-01T23:59:59.000Z

42

FINAL REPORT: GEOMETRY AND ELEMENTARY PARTICLE PHYSICS  

SciTech Connect (OSTI)

The effect on mathematics of collaborations between high-energy theoretical physics and modern mathematics has been remarkable. Mirror symmetry has revolutionized enumerative geometry, and Seiberg-Witten invariants have greatly simplified the study of four manifolds. And because of their application to string theory, physicists now need to know cohomology theory, characteristic classes, index theory, K-theory, algebraic geometry, differential geometry, and non-commutative geometry. Much more is coming. We are experiencing a deeper contact between the two sciences, which will stimulate new mathematics essential to the physicists quest for the unification of quantum mechanics and relativity. Our grant, supported by the Department of Energy for twelve years, has been instrumental in promoting an effective interaction between geometry and string theory, by supporting the Mathematical Physics seminar, postdoc research, collaborations, graduate students and several research papers.

Singer, Isadore M.

2008-03-04T23:59:59.000Z

43

The Geometry of Soft Materials: A Primer  

E-Print Network [OSTI]

We present an overview of the differential geometry of curves and surfaces using examples from soft matter as illustrations. The presentation requires a background only in vector calculus and is otherwise self-contained.

Randall D. Kamien

2002-03-06T23:59:59.000Z

44

Topology to geometry in protein folding: -Lactoglobulin  

E-Print Network [OSTI]

Topology to geometry in protein folding: -Lactoglobulin Ariel Ferna´ndez* , Andre´s Colubri , and R angles and at the -carbon atoms of the peptide backbone dominate protein folding. Next in importance

Berry, R. Stephen

45

Fractal Geometry and Spatial Phenomena A Bibliography  

E-Print Network [OSTI]

Fractal Geometry and Spatial Phenomena A Bibliography January 1991 Mark MacLennan, A. Stewart. MEASUREMENT ISSUES........................................................... 8 II.1 ESTIMATION OF FRACTAL DIMENSION - GENERAL ISSUES .......... 8 II.2 ESTIMATION OF FRACTAL DIMENSION FOR CURVES/PROFILES ... 9 II.3

California at Santa Barbara, University of

46

Crystallization of carbon tetrachloride in confined geometries  

E-Print Network [OSTI]

1 Crystallization of carbon tetrachloride in confined geometries Adil Meziane1 , Jean-Pierre E 40 71 08 #12;2 Abstract The thermal behaviour of carbon tetrachloride confined in silica gels

Paris-Sud XI, Université de

47

A combinatorial approach to discrete geometry  

E-Print Network [OSTI]

We present a paralell approach to discrete geometry: the first one introduces Voronoi cell complexes from statistical tessellations in order to know the mean scalar curvature in term of the mean number of edges of a cell. The second one gives the restriction of a graph from a regular tessellation in order to calculate the curvature from pure combinatorial properties of the graph. Our proposal is based in some epistemological pressupositions: the macroscopic continuous geometry is only a fiction, very usefull for describing phenomena at certain sacales, but it is only an approximation to the true geometry. In the discrete geometry one starts from a set of elements and the relation among them without presuposing space and time as a background.

L. Bombelli; M. Lorente

2005-12-23T23:59:59.000Z

48

The geometry of sound rays in a wind  

E-Print Network [OSTI]

We survey the close relationship between sound and light rays and geometry. In the case where the medium is at rest, the geometry is the classical geometry of Riemann. In the case where the medium is moving, the more general geometry known as Finsler geometry is needed. We develop these geometries ab initio, with examples, and in particular show how sound rays in a stratified atmosphere with a wind can be mapped to a problem of circles and straight lines.

G. W. Gibbons; C. M. Warnick

2011-02-11T23:59:59.000Z

49

Two-Parameter Dynamics and Geometry  

E-Print Network [OSTI]

In this paper we present the two-parameter dynamics which is implied by the law of inertia in flat spacetime. A remarkable perception is that (A)dS4 geometry may emerge from the two-parameter dynamics, which exhibits some phenomenon of dynamics/ geometry correspondence. We also discuss the Unruh effects within the context of two-parameter dynamics. In the last section we construct various invariant actions with respect to the broken symmetry groups.

Zhi Hu; Mulin Yan; Sen Hu

2015-01-10T23:59:59.000Z

50

Effect of Compression Ratio and Piston Geometry on RCCI load...  

Broader source: Energy.gov (indexed) [DOE]

Compression Ratio and Piston Geometry on RCCI load limit Effect of Compression Ratio and Piston Geometry on RCCI load limit Explores the effect of compression ratio and piston...

51

Beam geometry selection using sequential beam addition  

SciTech Connect (OSTI)

Purpose: The selection of optimal beam geometry has been of interest since the inception of conformal radiotherapy. The authors report on sequential beam addition, a simple beam geometry selection method, for intensity modulated radiation therapy. Methods: The sequential beam addition algorithm (SBA) requires definition of an objective function (score) and a set of candidate beam geometries (pool). In the first iteration, the optimal score is determined for each beam in the pool and the beam with the best score selected. In the next iteration, the optimal score is calculated for each beam remaining in the pool combined with the beam selected in the first iteration, and the best scoring beam is selected. The process is repeated until the desired number of beams is reached. The authors selected three treatment sites, breast, lung, and brain, and determined beam arrangements for up to 11 beams from a pool comprised of 25 equiangular transverse beams. For the brain, arrangements were additionally selected from a pool of 22 noncoplanar beams. Scores were determined for geometries comprised equiangular transverse beams (EQA), as well as two tangential beams for the breast case. Results: In all cases, SBA resulted in scores superior to EQA. The breast case had the strongest dependence on beam geometry, for which only the 7-beam EQA geometry had a score better than the two tangential beams, whereas all SBA geometries with more than two beams were superior. In the lung case, EQA and SBA scores monotonically improved with increasing number of beams; however, SBA required fewer beams to achieve scores equivalent to EQA. For the brain case, SBA with a coplanar pool was equivalent to EQA, while the noncoplanar pool resulted in slightly better scores; however, the dose-volume histograms demonstrated that the differences were not clinically significant. Conclusions: For situations in which beam geometry has a significant effect on the objective function, SBA can identify arrangements equivalent to equiangular geometries but using fewer beams. Furthermore, SBA provides the value of the objective function as the number of beams is increased, allowing the planner to select the minimal beam number that achieves the clinical goals. The method is simple to implement and could readily be incorporated into an existing optimization system.

Popple, Richard A., E-mail: rpopple@uabmc.edu; Brezovich, Ivan A.; Fiveash, John B. [Department of Radiation Oncology, The University of Alabama at Birmingham, 1720 2nd Avenue South, Birmingham, Alabama 35294 (United States)] [Department of Radiation Oncology, The University of Alabama at Birmingham, 1720 2nd Avenue South, Birmingham, Alabama 35294 (United States)

2014-05-15T23:59:59.000Z

52

Quantum Geometry Phenomenology: Angle and Semiclassical States  

E-Print Network [OSTI]

The phenomenology for the deep spatial geometry of loop quantum gravity is discussed. In the context of a simple model of an atom of space, it is shown how purely combinatorial structures can affect observations. The angle operator is used to develop a model of angular corrections to local, continuum flat-space 3-geometries. The physical effects involve neither breaking of local Lorentz invariance nor Planck scale suppression, but rather reply on only the combinatorics of SU(2) recouping theory. Bhabha scattering is discussed as an example of how the effects might be observationally accessible.

Seth A. Major

2011-12-19T23:59:59.000Z

53

Information Geometry and the Renormalization Group  

E-Print Network [OSTI]

Information theoretic geometry near critical points in classical and quantum systems is well understood for exactly solvable systems. Here we show that real space renormalization group equations can be used to construct the information metric and its associated quantities near criticality, even for systems that cannot be exactly solved. We study this metric in various cases and establish its scaling properties in several generic examples. Scaling relations on the parameter manifold involving scalar quantities are studied, and scaling exponents are identified. The meaning of the scalar curvature and the invariant geodesic distance in information geometry is established and substantiated from a renormalization group perspective.

Reevu Maity; Subhash Mahapatra; Tapobrata Sarkar

2015-03-13T23:59:59.000Z

54

Intrinsic Geometry of a Null Hypersurface  

E-Print Network [OSTI]

We apply Cartan's method of equivalence to construct invariants of a given null hypersurface in a Lorentzian space-time. This enables us to fully classify the internal geometry of such surfaces and hence solve the local equivalence problem for null hypersurface structures in 4-dimensional Lorentzian space-times.

Pawe? Nurowski; David C. Robinson

2000-06-13T23:59:59.000Z

55

ON DIFFERENCE SCHEMES AND SYMPLECTIC GEOMETRY \\Gamma  

E-Print Network [OSTI]

ON DIFFERENCE SCHEMES AND SYMPLECTIC GEOMETRY \\Gamma \\Sigma \\Delta \\Theta \\Lambda \\Upsilon \\Psi solution of the canonical system of equations dp i dt = \\Gamma @H @q i ; dq i dt = @H @P i ; i = 1; \\Delta introduced by Hamilton in 1824 as a general mathematical scheme for problems of geometrical optics

Li, Tiejun

56

Optimal distillation using thermodynamic geometry Bjarne Andresen  

E-Print Network [OSTI]

(temperature, pressure, etc.) define successive states in a sequence of equilibria. Fractional distillation [2Optimal distillation using thermodynamic geometry Bjarne Andresen rsted Laboratory, University of a distillation column may be improved by permitting heat exchange on every tray rather than only in the reboiler

Salamon, Peter

57

March 23, 1997 GEOMETRY OPTIMIZATION \\Lambda  

E-Print Network [OSTI]

March 23, 1997 GEOMETRY OPTIMIZATION \\Lambda Tamar Schlick The Howard Hughes Medical Institute algorithm, large­scale optimization, line search, Newton's method, nonlinear optimization, quasi; Contents 1 Introduction 5 2 Basic Definitions of Optimization Problems 6 2.1 Problem Formulation

Schlick, Tamar

58

ACCELERATION INDUCED SPIN ITS GAUGE GEOMETRY  

E-Print Network [OSTI]

@math.ohio­state.edu ABSTRACT Does there exist a purely quantum mechanical characterization of gravitation? To this end at each event. A unique and natural law of parallel transport of quantum states between different events conclusion that gravitation is to be identified with the gauge geometry of the group [SU(1; 1)] 1 . #12

Gerlach, Ulrich

59

Damage experiments in a cylindrical geometry  

SciTech Connect (OSTI)

Studying spallation damage with a cylindrical configuration allows for a natural recollection of the damaged material under proper driving conditions. Additionally, the damaged material can come to a complete rest without the application of further stopping forces. Specific areas of research include the damage initiation regime in convergent geometry, behavior of material recollected after damage, and effects of convergent geometry on the material response. Such experiments produce unique strain and shear stress states, motivating improvements in existing computational material models and increasing the predictive capabilities of codes. A LANL/VNIIEF joint experimental series has produced cylindrical aluminum failure initiation data and studied the behavior of material recollected after damage initiation and after complete failure. In addition to post-shot collection of the damaged target material for subsequent metallographic analysis, dynamic in-situ experimental diagnostics include velocimetry and transverse radial radiography. This paper will discuss the current experimental status.

Kaul, Ann M [Los Alamos National Laboratory

2010-09-21T23:59:59.000Z

60

Method for high-volume sequencing of nucleic acids: random and directed priming with libraries of oligonucleotides  

DOE Patents [OSTI]

Random and directed priming methods for determining nucleotide sequences by enzymatic sequencing techniques, using libraries of primers of lengths 8, 9 or 10 bases, are disclosed. These methods permit direct sequencing of nucleic acids as large as 45,000 base pairs or larger without the necessity for subcloning. Individual primers are used repeatedly to prime sequence reactions in many different nucleic acid molecules. Libraries containing as few as 10,000 octamers, 14,200 nonamers, or 44,000 decamers would have the capacity to determine the sequence of almost any cosmid DNA. Random priming with a fixed set of primers from a smaller library can also be used to initiate the sequencing of individual nucleic acid molecules, with the sequence being completed by directed priming with primers from the library. In contrast to random cloning techniques, a combined random and directed priming strategy is far more efficient. 2 figs.

Studier, F.W.

1995-04-18T23:59:59.000Z

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

Method for high-volume sequencing of nucleic acids: random and directed priming with libraries of oligonucleotides  

DOE Patents [OSTI]

Random and directed priming methods for determining nucleotide sequences by enzymatic sequencing techniques, using libraries of primers of lengths 8, 9 or 10 bases, are disclosed. These methods permit direct sequencing of nucleic acids as large as 45,000 base pairs or larger without the necessity for subcloning. Individual primers are used repeatedly to prime sequence reactions in many different nucleic acid molecules. Libraries containing as few as 10,000 octamers, 14,200 nonamers, or 44,000 decamers would have the capacity to determine the sequence of almost any cosmid DNA. Random priming with a fixed set of primers from a smaller library can also be used to initiate the sequencing of individual nucleic acid molecules, with the sequence being completed by directed priming with primers from the library. In contrast to random cloning techniques, a combined random and directed priming strategy is far more efficient.

Studier, F. William (Stony Brook, NY)

1995-04-18T23:59:59.000Z

62

Principles of algebraic geometry' (Griffiths and Harris).pdf  

E-Print Network [OSTI]

like a supernova. His conceptions of intrinsic geometry on a manifold, topology, function theory on a Riemann surface, birational transformations,.

63

Physics on a circle and geometry Balazs Szendroi, Oxford  

E-Print Network [OSTI]

Physics on a circle and geometry Balazs Szendroi, Oxford The 1st Strathmore University Mathematics Conference 18-20 August 2011 Physics on a circle and geometry Balazs Szendroi University of Oxford #12;Physics on a circle and geometry Balazs Szendroi, Oxford The 1st Strathmore University Mathematics

Szendröi, Balázs

64

Differential geometry, Palatini gravity and reduction  

SciTech Connect (OSTI)

The present article deals with a formulation of the so called (vacuum) Palatini gravity as a general variational principle. In order to accomplish this goal, some geometrical tools related to the geometry of the bundle of connections of the frame bundle LM are used. A generalization of Lagrange-Poincar reduction scheme to these types of variational problems allows us to relate it with the Einstein-Hilbert variational problem. Relations with some other variational problems for gravity found in the literature are discussed.

Capriotti, S., E-mail: santiago.capriotti@uns.edu.ar [Departamento de Matemtica, Universidad Nacional del Sur, 8000 Baha Blanca (Argentina)

2014-01-15T23:59:59.000Z

65

Geodesic Reduction via Frame Bundle Geometry  

E-Print Network [OSTI]

A manifold with an arbitrary affine connection is considered and the geodesic spray associated with the connection is studied in the presence of a Lie group action. In particular, results are obtained that provide insight into the structure of the reduced dynamics associated with the given invariant affine connection. The geometry of the frame bundle of the given manifold is used to provide an intrinsic description of the geodesic spray. A fundamental relationship between the geodesic spray, the tangent lift and the vertical lift of the symmetric product is obtained, which provides a key to understanding reduction in this formulation.

Ajit Bhand

2010-02-22T23:59:59.000Z

66

The Casimir Effect for Generalized Piston Geometries  

E-Print Network [OSTI]

In this paper we study the Casimir energy and force for generalized pistons constructed from warped product manifolds of the type $I\\times_{f}N$ where $I=[a,b]$ is an interval of the real line and $N$ is a smooth compact Riemannian manifold either with or without boundary. The piston geometry is obtained by dividing the warped product manifold into two regions separated by the cross section positioned at $R\\in(a,b)$. By exploiting zeta function regularization techniques we provide formulas for the Casimir energy and force involving the arbitrary warping function $f$ and base manifold $N$.

Guglielmo Fucci; Klaus Kirsten

2012-03-29T23:59:59.000Z

67

Geometry of Majorana neutrino and new symmetries  

E-Print Network [OSTI]

Experimental observation of Majorana fermion matter gives a new impetus to the understanding of the Lorentz symmetry and its extension, the geometrical properties of the ambient space-time structure, matter--antimatter symmetry and some new ways to understand the baryo-genesis problem in cosmology. Based on the primordial Majorana fermion matter assumption, we discuss a possibility to solve the baryo-genesis problem through the the Majorana-Diraco genesis in which we have a chance to understand creation of Q(em) charge and its conservation in our D=1+3 Universe after the Big Bang. In the Majorana-Diraco genesis approach there appears a possibility to check the proton and electron non-stability on the very low energy scale. In particle physics and in our space-time geometry, the Majorana nature of the neutrino can be related to new types of symmetries which are lying beyond the binary Cartan-Killing-Lie algebras/superalgebras. This can just support a conjecture about the non-completeness of the SM in terms of binary Cartan--Killing--Lie symmetries/supersymmetries. As one of the very important applications of such new ternary symmetries could be related with explanation of the nature of the three families and three colour symmetry. The Majorana neutrino can directly indicate the existence of a new extra-dimensional geometry and thanks to new ternary space-time symmetries, could lead at high energies to the unextraordinary phenomenological consequences.

G. G. Volkov

2006-07-30T23:59:59.000Z

68

Surveying Diffusion in Complex Geometries. An Essay  

E-Print Network [OSTI]

The surrounding world surprises us by the beauty and variety of complex shapes that emerge from nanometric to macroscopic scales. Natural or manufactured materials (sandstones, sedimentary rocks and cement), colloidal solutions (proteins and DNA), biological cells, tissues and organs (lungs, kidneys and placenta), they all present irregularly shaped "scenes" for a fundamental transport "performance", that is, diffusion. Here, the geometrical complexity, entangled with the stochastic character of diffusive motion, results in numerous fascinating and sometimes unexpected effects like diffusion screening or localization. These effects control many diffusion-mediated processes that play an important role in heterogeneous catalysis, biochemical mechanisms, electrochemistry, growth phenomena, oil recovery, or building industry. In spite of a long and rich history of academic and industrial research in this field, it is striking to see how little we know about diffusion in complex geometries, especially the one which occurs in three dimensions. We present our recent results on restricted diffusion. We look into the role of geometrical complexity at different levels, from boundary microroughness to hierarchical structure and connectivity of the whole diffusion-confining domain. We develop a new approach which consists in combining fast random walk algorithms with spectral tools. The main focus is on studying diffusion in model complex geometries (von Koch boundaries, Kitaoka acinus, etc.), as well as on developing and testing spectral methods. We aim at extending this knowledge and at applying the accomplished arsenal of theoretical and numerical tools to structures found in nature and industry.

Denis Grebenkov

2009-09-08T23:59:59.000Z

69

E-Print Network 3.0 - affine geometry approached Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

geometry Spherical geometry Affine ... Source: Choi, Suhyoung - Department of Mathematics, Korea Advanced Institute of Science and Technology Collection: Mathematics 2...

70

Satellite Multiangle Cumulus Geometry Retrieval: Case Study  

SciTech Connect (OSTI)

Most satellite-based analyses have been conducted using near nadir-viewing sensors. The Multi-angle Imaging SpectroRadiometer (MISR), recently launched on the National Aeronautics and Space Administration (NASA) Terra platform, provides high-resolution measurements of reflectance at nine different viewing angles. In this study, we examine the possible retrieval of detailed cumulus geometry using the new and unique MISR datasets. We suggested one approach and apply it to an early MISR dataset of small marine cumulus clouds. This paper also presents validation analysis of this technique with both independent ground-based radar measurements and a model-output inverse problem. Collocated and coincident MISR data and ground-based observations at the Atmospheric Radiation Measurement (ARM) Tropical Western Pacific (TWP) site form the basis of this validation. Future work will attempt to test the suggested approach with additional MISR scenes.

Kassianov, Evgueni I.; Ackerman, Thomas P.; Marchand, Roger T.; Ovtchinnikov, Mikhail

2003-02-08T23:59:59.000Z

71

Surveying Diffusion in Complex Geometries. An Essay  

E-Print Network [OSTI]

The surrounding world surprises us by the beauty and variety of complex shapes that emerge from nanometric to macroscopic scales. Natural or manufactured materials (sandstones, sedimentary rocks and cement), colloidal solutions (proteins and DNA), biological cells, tissues and organs (lungs, kidneys and placenta), they all present irregularly shaped "scenes" for a fundamental transport "performance", that is, diffusion. Here, the geometrical complexity, entangled with the stochastic character of diffusive motion, results in numerous fascinating and sometimes unexpected effects like diffusion screening or localization. These effects control many diffusion-mediated processes that play an important role in heterogeneous catalysis, biochemical mechanisms, electrochemistry, growth phenomena, oil recovery, or building industry. In spite of a long and rich history of academic and industrial research in this field, it is striking to see how little we know about diffusion in complex geometries, especially the one whic...

Grebenkov, Denis

2009-01-01T23:59:59.000Z

72

Complex geometry and pre-metric electromagnetism  

E-Print Network [OSTI]

The intimate link between complex geometry and the problem of the pre-metric formulation of electromagnetism is explored. In particular, the relationship between 3+1 decompositions of R4 and the decompositions of the vector space of bivectors over R4 into real and imaginary subspaces relative to a choice of complex structure is emphasized. The role of the various scalar products on the space of bivectors that are defined in terms of a volume element on R4 and a complex structure on the space of bivectors that makes it C-linear isomorphic to C3 is discussed in the context of formulation of a theory of electromagnetism in which the Lorentzian metric on spacetime follows as a consequence of the existence of electromagnetic waves, not a prior assumption.

D. H. Delphenich

2004-12-10T23:59:59.000Z

73

On the geometry of cosmological model building  

E-Print Network [OSTI]

This article analyzes the present anomalies of cosmology from the point of view of integrable Weyl geometry. It uses P.A.M. Dirac's proposal for a weak extension of general relativity, with some small adaptations. Simple models with interesting geometrical and physical properties, not belonging to the Friedmann-Lema\\^{\\i}tre class, are studied in this frame. Those with positive spatial curvature (Einstein-Weyl universes) go well together with observed mass density $\\Omega_m$, CMB, supernovae Ia data, and quasar frequencies. They suggest a physical role for an equilibrium state of the Maxwell field proposed by I.E. Segal in the 1980s (Segal background) and for a time invariant balancing condition of vacuum energy density. The latter leads to a surprising agreement with the BF-theoretical calculation proposed by C. Castro (2002).

Erhard Scholz

2005-11-21T23:59:59.000Z

74

Influence of geometry on liquid oxygen magnetohydrodynamics  

SciTech Connect (OSTI)

Magnetic fluid actuators have performed well in industrial applications, but have a limited temperature range due to the freezing point of the carrier fluid. Liquid oxygen (LOX) presents a pure, paramagnetic fluid suitable for use in a cryogenic magnetic fluid system; therefore, it is a potential solution to increasing the thermal range of magnetic fluid technology without the need for magnetic particles. The current study presents experimental work regarding the influence of geometry on the dynamics of a LOX slug in a 1.9 mm quartz tube when pulsed by a solenoid in a closed volume. A numerical analysis calculated the optimal solenoid geometry and balanced the magnetic, damping, and pressure forces to determine optimal slug lengths. Three configurations comprised the experiment: (1) a 24-gauge wire solenoid with an optimized 2.7 cm length slug, (2) a 30-gauge wire solenoid with an optimized 1.3 cm length slug, and (3) a 30-gauge wire solenoid with a nonoptimized 2.5 cm length slug. Typically, the hydrodynamic breakdown limit is calculated and used to determine the system range; however the experiment showed that the hydrodynamic breakdown limit was never reached by the slug. This implied that, instead, the system range should factor in a probabilistic risk of failure calculated as a function of the induced pressure change from its oscillations. The experimental data were also used to establish a nondimensional relationship between the maximum displacement and initial magnetic pressure on the slug. The average initial velocity of the slug was found to be proportional to the initial magnetic pressure, Mason number, and slug length. The results of this study can be used in the design and optimization of a LOX fluid system for space or low-temperature applications. (author)

Boulware, Jeffrey C.; Ban, Heng [Department of Mechanical and Aerospace Engineering, Utah State University, 4130 Old Main Hill, Logan, UT 84322-4130 (United States); Jensen, Scott; Wassom, Steve [Space Dynamics Laboratory, Utah State University Research Foundation, 1695 North Research Park Way, North Logan, UT 84341 (United States)

2010-11-15T23:59:59.000Z

75

Black Hole Initial Data with a Horizon of Prescribed Geometry  

E-Print Network [OSTI]

The purpose of this work is to construct asymptotically flat, time symmetric initial data with an apparent horizon of prescribed intrinsic geometry. To do this, we use the parabolic partial differential equation for prescribing scalar curvature. In this equation the horizon geometry is contained within the freely specifiable part of the metric. This contrasts with the conformal method in which the geometry of the horizon can only be specified up to a conformal factor.

Brian Smith

2007-10-04T23:59:59.000Z

76

Remarks on Hamiltonian structures in G{sub 2}-geometry  

SciTech Connect (OSTI)

In this article, we treat G{sub 2}-geometry as a special case of multisymplectic geometry and make a number of remarks regarding Hamiltonian multivector fields and Hamiltonian differential forms on manifolds with an integrable G{sub 2}-structure; in particular, we discuss existence and make a number of identifications of the spaces of Hamiltonian structures associated to the two multisymplectic structures associated to an integrable G{sub 2}-structure. Along the way, we prove some results in multisymplectic geometry that are generalizations of results from symplectic geometry.

Cho, Hyunjoo, E-mail: cho@math.rochester.edu; Salur, Sema, E-mail: salur@math.rochester.edu [Department of Mathematics, University of Rochester, Rochester, New York 14627 (United States)] [Department of Mathematics, University of Rochester, Rochester, New York 14627 (United States); Todd, A. J., E-mail: ajtodd@math.ucr.edu [Department of Mathematics, University of California-Riverside, Riverside, California 92521 (United States)

2013-12-15T23:59:59.000Z

77

Evaluation of subsurface fracture geometry using fluid pressure...  

Open Energy Info (EERE)

subsurface fracture geometry using fluid pressure response to solid earth tidal strain Jump to: navigation, search OpenEI Reference LibraryAdd to library Report: Evaluation of...

78

Topologies to geometries in protein folding: Hierarchical and nonhierarchical scenarios  

E-Print Network [OSTI]

Topologies to geometries in protein folding: Hierarchical and nonhierarchical scenarios Ariel Ferna presents a method to portray protein folding dynamics at a coarse resolution, based on a pattern

Berry, R. Stephen

79

analytic geometries: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Phase Mask rejects all on-axis light for an unaberrated Lloyd, James P. 18 FINER FRACTAL GEOMETRY FOR ANALYTIC FAMILIES Mathematics Websites Summary: of meromorphic functions...

80

assembling process geometry: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

mental images, and IBM Research for their ongoing and contin Polthier, Konrad 3 3D fractal DNA assembly from coding, geometry and ALESSANDRA CARBONE1, Mathematics Websites...

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Direct Numerical Simulations in Engine-like Geometries | Argonne...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Direct Numerical Simulations in Engine-like Geometries Event Sponsor: Mathematics and Computing ScienceArgonne Leadership Computing Facility Seminar Start Date: Nov 14 2014 -...

82

Information Geometry and Interior-Point Algorithms in SDP and ...  

E-Print Network [OSTI]

Sep 30, 2011 ... Page 1 ... Interplay between interior-point methods and differential geometry is an interesting topic studied by several authors. It was shown in...

Satoshi Kakihara, Atsumi Ohara, Takashi Tsuchiya

2011-10-11T23:59:59.000Z

83

Electrostatic precipitation of condensed acid mist  

SciTech Connect (OSTI)

Southern Research Institute is developing a compact, wet electrostatic precipitator (WESP) to control acid mist missions from high-sulfur coal combustion. The WESP is being developed as a retrofit technology for existing coal-fired power plants, particularly those equipped with wet flue gas desulfurization (FGD) scrubbers. Acid mist emissions can be a significant problem at these facilities because the sulfuric acid vapor in the flue gas is converted to a very fine mist that is not collected in the scrubber system. Conventional mist eliminators are not adequate in this application due to the very fine size of the mist droplets. The potential for corrosion also makes it difficult to use a fabric filter or a conventional, dry ESP in this application. Therefore, this research project has been structured around the development of a compact WESP that could be retrofit on top of an existing scrubber or within an existing flue gas duct. This paper describes the development and testing of a prototype WESP for the utility acid mist application. Testing was conducted with combustion of sulfur-doped gas to simulate the acid mist alone, and with a combination of coal and sulfur-doped gas to simulate the mixture of acid mist and fly ash downstream from a scrubber. The performance of the WESP test unit was modeled using two different cylindrical-geometry computer models: a current-seeking'' model and a current-specific'' model. 8 refs., 15 figs., 7 tabs.

Dahlin, R.S.

1989-11-01T23:59:59.000Z

84

Supersymmetry and noncommutative geometry Part I: Supersymmetric almost-commutative geometries  

E-Print Network [OSTI]

Noncommutative geometry has seen remarkable applications for high energy physics, viz. the geometrical interpretation of the Standard Model. The question whether it also allows for supersymmetric theories has so far not been answered in a conclusive way. In this first of three papers we do a systematic analysis of the possibilities for almost-commutative geometries on a 4-dimensional, flat background to exhibit not only a particle content that is eligible for supersymmetry but also have a supersymmetric action. We come up with an approach in which we identify the basic 'building blocks' of potentially supersymmetric theories and the demands for their action to be supersymmetric. Examples that satisfy these demands turn out to be sparse.

Wim Beenakker; Walter D. van Suijlekom; Thijs van den Broek

2014-09-21T23:59:59.000Z

85

An Evolutionary Geometry Parametrization for Aerodynamic Shape Optimization  

E-Print Network [OSTI]

An Evolutionary Geometry Parametrization for Aerodynamic Shape Optimization Xiaocong Han and David, M3H 5T6, Canada An evolutionary geometry parametrization is presented for aerodynamic shape optimiza, unconventional aerodynamic configurations. Based on improvements in computational fluid dynamics (CFD) and high

Zingg, David W.

86

Visibility in Discrete Geometry: an application to discrete geodesic paths  

E-Print Network [OSTI]

Visibility in Discrete Geometry: an application to discrete geodesic paths David Coeurjolly that are visible from a source pixel. Based on these definitions, we define discrete geodesic paths in dis- crete domain with obstacles. This allows us to introduce a new geodesic metric in discrete geometry

Paris-Sud XI, Université de

87

Friedmann Thermodynamics and the Geometry of the Universe  

E-Print Network [OSTI]

In a recent article we have introduced Friedmann thermodynamics, where certain geometric parameters in Friedmann models are treated like their thermodynamic counterparts (temperature, entropy, Gibbs potential etc.). This model has the advantage of allowing us to determine the geometry of the universe by thermodynamic stability arguments. In this article we review connections between thermodynamics, geometry and cosmology.

Selcuk S. Bayin

2008-04-01T23:59:59.000Z

88

Statistics and Differential Geometry 18-466 Mathematical Statistics  

E-Print Network [OSTI]

Statistics and Differential Geometry 18-466 Mathematical Statistics Jerome Le Ny December 14, 2005 of statistical curvature [Efr75], that most of the main concepts and methods of differ- ential geometry are of substantial interest in connection with the theory of statistical inference. This report describes in simple

Le Ny, Jerome

89

UNCORRECTED Grid geometry effects on convection in ocean climate models  

E-Print Network [OSTI]

UNCORRECTED PROOF Grid geometry effects on convection in ocean climate models: a conceptual study is the 12 improvement of convection parameterization schemes, but the question of grid geometry also plays to an at- 14 mosphere model. Such ocean climate models have mostly structured, coarsely resolved grids. 15

Kuhlbrodt, Till

90

Proceedings of 13th Geometry-Topology Conference  

E-Print Network [OSTI]

. Proposition 1 (Cromwell [Cro]). The map G K sending grid diagrams to topological knots induces a bijection KProceedings of 13th G¨okova Geometry-Topology Conference pp. 1 ­ 17 Grid Diagrams, Braids, and Contact Geometry Lenhard Ng and Dylan Thurston Abstract. We use grid diagrams to present a unified picture

Ng, Lenny

91

Mesh Geometry Compression for Mobile Graphics Jongseok Lee  

E-Print Network [OSTI]

technology has not caught up with the energy requirement of 3D graphics processing. Data compression canMesh Geometry Compression for Mobile Graphics Jongseok Lee POSTECH thirdeye@postech.ac.kr Sungyul--This paper presents a compression scheme for mesh geometry, which is suitable for mobile graphics. The main

Lee, Seungyong

92

Line geometry and electromagnetism III: groups of transformations  

E-Print Network [OSTI]

The role of linear and projective groups of transformations in line geometry and electromagnetism is examined in accordance with Klein's Erlanger Programm for geometries. The group of collineations of real projective space is chosen as the most general group, and reductions to some of its various subgroups are then detailed according to their relevance to electromagnetic fields, and especially wave-like ones.

D. H. Delphenich

2014-04-16T23:59:59.000Z

93

Statistics and geometry of cosmic voids  

SciTech Connect (OSTI)

We introduce new statistical methods for the study of cosmic voids, focusing on the statistics of largest size voids. We distinguish three different types of distributions of voids, namely, Poisson-like, lognormal-like and Pareto-like distributions. The last two distributions are connected with two types of fractal geometry of the matter distribution. Scaling voids with Pareto distribution appear in fractal distributions with box-counting dimension smaller than three (its maximum value), whereas the lognormal void distribution corresponds to multifractals with box-counting dimension equal to three. Moreover, voids of the former type persist in the continuum limit, namely, as the number density of observable objects grows, giving rise to lacunar fractals, whereas voids of the latter type disappear in the continuum limit, giving rise to non-lacunar (multi)fractals. We propose both lacunar and non-lacunar multifractal models of the cosmic web structure of the Universe. A non-lacunar multifractal model is supported by current galaxy surveys as well as cosmological N-body simulations. This model suggests, in particular, that small dark matter halos and, arguably, faint galaxies are present in cosmic voids.

Gaite, Jos, E-mail: jose.gaite@upm.es [Instituto de Microgravedad IDR, ETS Ingenieros Aeronuticos, Universidad Politcnica de Madrid, E-28040 Madrid (Spain)

2009-11-01T23:59:59.000Z

94

The moduli space of local homogeneous 3-geometries  

E-Print Network [OSTI]

For a canonical formulation of quantum gravity, the superspace of all possible 3-geometries on a Cauchy hypersurface of a 3+1-dimensional Lorentzian manifold plays a key role. While in the analogous 2+1-dimensional case the superspace of all Riemannian 2-geometries is well known, the structure of the superspace of all Riemannian 3-geometries has not yet been resolved at present. In this paper, an important subspace of the latter is disentangled: The superspace of local homogenous Riemannian 3-geometries. It is finite dimensional and can be factored by conformal scale dilations, with the flat space as the center of projection. The corresponding moduli space can be represented by homothetically normalized 3-geometries. By construction, this moduli space of the local homogenous 3-geometries is an algebraic variety. An explicit parametrization is given by characteristic scalar invariants of the Riemannian 3-geometry. Although the moduli space is not locally Euclidean, it is a Hausdorff space. Nevertheless, its topology is compatible with the non-Hausdorffian topology of the space of all Bianchi-Lie algebras, which characterize the moduli modulo differences in their anisotropy.

M. Rainer

1996-07-26T23:59:59.000Z

95

The impact of grid geometry on displacement calculations  

E-Print Network [OSTI]

Reservoir simulation models are becoming increasingly sophisticated in tandem with the rapid development of geological modeling methods. Widely used commercial simulators usually model flow through heavily faulted and structurally complex geometries...

Jimenez Arismendi, Eduardo A.

2004-11-15T23:59:59.000Z

96

NOTES ON MACDONALD POLYNOMIALS AND THE GEOMETRY OF HILBERT SCHEMES  

E-Print Network [OSTI]

NOTES ON MACDONALD POLYNOMIALS AND THE GEOMETRY OF HILBERT SCHEMES MARK HAIMAN (mhaiman words: Symmetric functions, Macdonald polynomials, Hilbert schemes 2000 Mathematics Subject combinatorial problems we solve are (1) we prove the positivity conjecture for Macdonald polynomials, and (2) we

Haiman, Mark D.

97

ARRANGEMENTS OF HYPERPLANES Algebra, Combinatorics, Geometry and Topology  

E-Print Network [OSTI]

ARRANGEMENTS OF HYPERPLANES Algebra, Combinatorics, Geometry and Topology Centro Stefano Franscini Islands, or panorama hike in the hills above Ascona. 19.00 Departure for the conference dinner from Monte

Feichtner, Eva Maria - Fachbereich 3

98

Mechanical Equations on Bi-Para Conformal Geometry  

E-Print Network [OSTI]

This study is an extented analogue to conformal geometry of the paper given by [14]. Also, the geometric and physical results related to bi-para-conformal-dynamical systems are also presented.

Zeki Kasap; Mehmet Tekkoyun

2012-09-22T23:59:59.000Z

99

Fractal geometry predicts varying body size scaling relationships  

E-Print Network [OSTI]

.............................................................. Fractal geometry predicts varying scaling based on fractal resource distributions, in which resource encounter rates are a function of body that are multiples of 1/4, which have been recently explained from the fractal branching architecture of organisms4

Minnesota, University of

100

Optimized Cross-Slot Flow Geometry for Microfluidic Extensional Rheometry  

E-Print Network [OSTI]

A precision-machined cross-slot flow geometry with a shape that has been optimized by numerical simulation of the fluid kinematics is fabricated and used to measure the extensional viscosity of a dilute polymer solution. ...

Haward, Simon J.

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

Computer-assisted proofs in geometry and physics  

E-Print Network [OSTI]

In this dissertation we apply computer-assisted proof techniques to two problems, one in discrete geometry and one in celestial mechanics. Our main tool is an effective inverse function theorem which shows that, in favorable ...

Minton, Gregory T. (Gregory Thomas)

2013-01-01T23:59:59.000Z

102

active site geometries: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

hydrodynamics, is finally introduced to account for the equilibrium probability distribution of the vortex sizes. Luca Giomi 2014-09-04 5 The Accretion Geometry in Radio-Loud...

103

active site geometry: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

hydrodynamics, is finally introduced to account for the equilibrium probability distribution of the vortex sizes. Luca Giomi 2014-09-04 5 The Accretion Geometry in Radio-Loud...

104

Investigation of Created Fracture Geometry through Hydraulic Fracture Treatment Analysis  

E-Print Network [OSTI]

Successful development of shale gas reservoirs is highly dependent on hydraulic fracture treatments. Many questions remain in regards to the geometry of the created fractures. Production data analysis from some shale gas wells quantifies a much...

Ahmed, Ibraheem 1987-

2012-11-30T23:59:59.000Z

105

Geometry-Based Sampling of Conformational Transitions in Proteins  

E-Print Network [OSTI]

Structure Article Geometry-Based Sampling of Conformational Transitions in Proteins Daniel Seeliger of the binding site when using a holo structure, or by not identifying the correct binding pose when using an apo

de Groot, Bert

106

Layer-by-layer assembly in confined geometries  

E-Print Network [OSTI]

The fundamental nature of layer-by-layer (LbL) assembly in confined geometries was investigated for a number of different chemical systems. The first part of this thesis concerns the modification of microfluidic and ...

DeRocher, Jonathan P

2011-01-01T23:59:59.000Z

107

Influence of geometry on natural convection in buildings  

SciTech Connect (OSTI)

Strong free convection airflows occur within passive solar buildings resulting from elevated temperatures of surfaces irradiated by solar energy compared with the cooler surfaces not receiving radiation. The geometry of a building has a large influence on the directions and magnitudes of natural airflows, and thus heat transfer between zones. This investigation has utilized a variety of reduced-scale building configurations to study the effects of geometry on natural convection heat transfer. Similarity between the reduced-scale model and a full-scale passive solar building is achieved by having similar geometries and by replacing air with Freon-12 gas as the model's working fluid. Filling the model with Freon-12 gas results in similarity in Prandtl numbers and Rayleigh numbers based on temperature differences in the range from 10/sup 9/ to 10/sup 11/. Results from four geometries are described with an emphasis placed on the effects of heat loss on zone temperature stratification shifts.

White, M.D.; Winn, C.B.; Jones, G.F.; Balcomb, J.D.

1985-01-01T23:59:59.000Z

108

Quantum phases of dipolar bosons in bilayer geometry  

E-Print Network [OSTI]

We investigate the quantum phases of hard-core dipolar bosons confined to a square lattice in a bilayer geometry. Using exact theoretical techniques, we discuss the many-body effects resulting from the pairing of particles ...

Safavi-Naini, Arghavan

109

Triangle geometry processing for surface modeling and cartesian grid generation  

DOE Patents [OSTI]

Cartesian mesh generation is accomplished for component based geometries, by intersecting components subject to mesh generation to extract wetted surfaces with a geometry engine using adaptive precision arithmetic in a system which automatically breaks ties with respect to geometric degeneracies. During volume mesh generation, intersected surface triangulations are received to enable mesh generation with cell division of an initially coarse grid. The hexagonal cells are resolved, preserving the ability to directionally divide cells which are locally well aligned.

Aftosmis, Michael J. (San Mateo, CA) [San Mateo, CA; Melton, John E. (Hollister, CA) [Hollister, CA; Berger, Marsha J. (New York, NY) [New York, NY

2002-09-03T23:59:59.000Z

110

Radio-frequency quadrupole vane-tip geometries  

SciTech Connect (OSTI)

Radio-frequency quadrupole (RFQ) linacs are becoming widely accepted in the accelerator community. They have the remarkable capability of simultaneously bunching low-energy ion beams and accelerating them to energies at which conventional accelerators can be used, accomplishing this with high-transmission efficiencies and low-emittance growths. The electric fields, used for radial focusing, bunching, and accelerating, are determined by the geometry of the vane tips. The choice of the best vane-tip geometry depends on considerations such as the peak surface electric field, per cent of higher multipole components, and ease of machining. We review the vane-tip geometry based on the ideal two-term potential function and briefly describe a method for calculating the electric field components in an RFQ cell with arbitrary vane-tip geometry. We describe five basic geometries and use the prototype RFQ design for the Fusion Materials Irradiation Test (FMIT) accelerator as an example to compare the characteristics of the various geometries.

Crandall, K.R.; Mills, R.S.; Wangler, T.P.

1983-01-01T23:59:59.000Z

111

Plant fatty acid hydroxylases  

DOE Patents [OSTI]

This invention relates to plant fatty acyl hydroxylases. Methods to use conserved amino acid or nucleotide sequences to obtain plant fatty acyl hydroxylases are described. Also described is the use of cDNA clones encoding a plant hydroxylase to produce a family of hydroxylated fatty acids in transgenic plants. In addition, the use of genes encoding fatty acid hydroxylases or desaturases to alter the level of lipid fatty acid unsaturation in transgenic plants is described.

Somerville, Chris (Portola Valley, CA); Broun, Pierre (Burlingame, CA); van de Loo, Frank (Lexington, KY)

2001-01-01T23:59:59.000Z

112

Cleavage of nucleic acids  

DOE Patents [OSTI]

The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

Prudent, James R. (Madison, WI); Hall, Jeff G. (Waunakee, WI); Lyamichev, Victor I. (Madison, WI); Brow; Mary Ann D. (Madison, WI); Dahlberg, James E. (Madison, WI)

2010-11-09T23:59:59.000Z

113

Cleavage of nucleic acids  

DOE Patents [OSTI]

The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

Prudent, James R. (Madison, WI); Hall, Jeff G. (Madison, WI); Lyamichev, Victor L. (Madison, WI); Brow, Mary Ann D. (Madison, WI); Dahlberg, James E. (Madison, WI)

2007-12-11T23:59:59.000Z

114

Nucleic acid detection compositions  

DOE Patents [OSTI]

The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

Prudent, James R. (Madison, WI); Hall, Jeff G. (Madison, WI); Lyamichev, Victor I. (Madison, WI); Brow, Mary Ann (Madison, WI); Dahlberg, James L. (Madison, WI)

2008-08-05T23:59:59.000Z

115

Downstream Hydraulic Geometry of Alluvial Channels Jong-Seok Lee, A.M.ASCE1  

E-Print Network [OSTI]

Downstream Hydraulic Geometry of Alluvial Channels Jong-Seok Lee, A.M.ASCE1 ; and Pierre Y. Julien. A larger database for the downstream hydraulic geometry of alluvial channels is examined through with meandering to braided planform geometry. The five parameters describing downstream hydraulic geometry are

Julien, Pierre Y.

116

Process for the preparation of lactic acid and glyceric acid  

DOE Patents [OSTI]

Hexose and pentose monosaccharides are degraded to lactic acid and glyceric acid in an aqueous solution in the presence of an excess of a strongly anionic exchange resin, such as AMBERLITE IRN78 and AMBERLITE IRA400. The glyceric acid and lactic acid can be separated from the aqueous solution. Lactic acid and glyceric acid are staple articles of commerce.

Jackson, James E [Haslett, MI; Miller, Dennis J [Okemos, MI; Marincean, Simona [Dewitt, MI

2008-12-02T23:59:59.000Z

117

STANDARD OPERATING PROCEDURE ACIDS CONTAINING PHOSPHOROUS  

E-Print Network [OSTI]

12.1 STANDARD OPERATING PROCEDURE for ACIDS CONTAINING PHOSPHOROUS Location(s): ___________________________________________________ Chemical(s): Hypophosphorous acid, methylphosphonic acid, phosphonic acid, phosphoric acid, phosphorous

Pawlowski, Wojtek

118

Optical reference geometry of the Kerr-Newman spacetimes  

E-Print Network [OSTI]

Properties of the optical reference geometry related to Kerr-Newman black-hole and naked-singularity spacetimes are illustrated using embedding diagrams of their equatorial plane. Among all inertial forces defined in the framework of the optical geometry, just the centrifugal force plays a fundamental role in connection to the embedding diagrams because it changes sign at the turning points of the diagrams. The limits of embeddability are given, and it is established which of the photon circular orbits hosted the by Kerr-Newman spacetimes appear in the embeddable regions. Some typical embedding diagrams are constructed, and the Kerr-Newman backgrounds are classified according to the number of embeddable regions of the optical geometry as well as the number of their turning points. Embedding diagrams are closely related to the notion of the radius of gyration which is useful for analyzing fluid rotating in strong gravitational fields.

Zden?k Stuchlk; Stanislav Hledk; Josef Jur?

2008-03-17T23:59:59.000Z

119

Torsional Newton-Cartan Geometry and Lifshitz Holography  

E-Print Network [OSTI]

We obtain the Lifshitz UV completion in a specific model for z=2 Lifshitz geometries. We use a vielbein formalism which enables identification of all the sources as leading components of well-chosen bulk fields. We show that the geometry induced from the bulk onto the boundary is a novel extension of Newton-Cartan geometry with a specific torsion tensor. We explicitly compute all the vevs including the boundary stress-energy tensor and their Ward identities. After using local symmetries/Ward identities the system exhibits 6+6 sources and vevs. The FG expansion exhibits, however, an additional free function which is related to an irrelevant operator whose source has been turned off. We show that this is related to a second UV completion.

Morten H. Christensen; Jelle Hartong; Niels A. Obers; Blaise Rollier

2014-09-19T23:59:59.000Z

120

Mind the Gap: Supersymmetry Breaking in Scaling, Microstate Geometries  

E-Print Network [OSTI]

We use a multi-species supertube solution to construct an example of a scaling microstate geometry for non-BPS black rings in five dimensions. We obtain the asymptotic charges of the microstate geometry and show how the solution is related to the corresponding non-BPS black ring. The supersymmetry is broken in a very controlled manner using holonomy and this enables a close comparison with a scaling, BPS microstate geometry. Requiring that there are no closed time-like curves near the supertubes places additional restrictions on the moduli space of physical, non-BPS solutions when compared to their BPS analogs. For large holonomy the scaling non-BPS solution always has closed time-like curves while for smaller holonomy there is a "gap" in the non-BPS moduli space relative to the BPS counterpart.

Orestis Vasilakis; Nicholas P. Warner

2011-06-30T23:59:59.000Z

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Microorganisms for producing organic acids  

DOE Patents [OSTI]

Organic acid-producing microorganisms and methods of using same. The organic acid-producing microorganisms comprise modifications that reduce or ablate AcsA activity or AcsA homolog activity. The modifications increase tolerance of the microorganisms to such organic acids as 3-hydroxypropionic acid, acrylic acid, propionic acid, lactic acid, and others. Further modifications to the microorganisms increase production of such organic acids as 3-hydroxypropionic acid, lactate, and others. Methods of producing such organic acids as 3-hydroxypropionic acid, lactate, and others with the modified microorganisms are provided. Methods of using acsA or homologs thereof as counter-selectable markers are also provided.

Pfleger, Brian Frederick; Begemann, Matthew Brett

2014-09-30T23:59:59.000Z

122

Separation Nanotechnology of Diethylenetriaminepentaacetic Acid...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Nanotechnology of Diethylenetriaminepentaacetic Acid Bonded Magnetic Nanoparticles for Spent Nuclear Fuel. Separation Nanotechnology of Diethylenetriaminepentaacetic Acid Bonded...

123

PROPOSAL: SIAM ACTIVITY GROUP ON ALGEBRAIC GEOMETRY We propose to create a SIAM Activity Group on the topic of Algebraic Geometry. While  

E-Print Network [OSTI]

, machine learning, opti- mization, robotics, computational geometry, and statistics. We will welcome of this proposal. 3. Overlap with ot

Sottile, Frank

124

Shape in an Atom of Space: Exploring quantum geometry phenomenology  

E-Print Network [OSTI]

A phenomenology for the deep spatial geometry of loop quantum gravity is introduced. In the context of a simple model, an atom of space, it is shown how purely combinatorial structures can affect observations. The angle operator is used to develop a model of angular corrections to local, continuum flat-space 3-geometries. The physical effects involve neither breaking of local Lorentz invariance nor Planck scale suppression, but rather reply on only the combinatorics of SU(2) recoupling. Bhabha scattering is discussed as an example of how the effects might be observationally accessible.

Seth A. Major

2010-06-01T23:59:59.000Z

125

On the material geometry of continuously defective corrugated graphene sheets  

E-Print Network [OSTI]

Geometrical objects describing the material geometry of continuously defective graphene sheets are introduced and their compatibility conditions are formulated. Effective edge dislocations embedded in the Riemann-Cartan material space and defined by their scalar density and by local Burgers vectors, are considered. The case of secondary curvature-type defects created by this distribution of dislocations is analysed in terms of the material space. The variational geometry of the material space closely related with the existence of a characteristic length parameter is proposed. The formula which describes, in a reference temperature, the influence of dislocations on the material Riemannian metric, is given.

Andrzej Trzesowski

2014-12-22T23:59:59.000Z

126

On the isothermal geometry of corrugated graphene sheets  

E-Print Network [OSTI]

Variational geometries describing corrugated graphene sheets are proposed. The isothermal thermomechanical properties of these sheets are described by a 2-dimensional Weyl space. The equation that couples the Weyl geometry with isothermal distributions of the temperature of graphene sheets, is formulated. This material space is observed in a 3-dimensional orthogonal configurational point space as regular surfaces which are endowed with a thermal state vector field fulfilling the isothermal thermal state equation. It enables to introduce a non-topological dimensionless thermal shape parameter of non-developable graphene sheets. The properties of the congruence of lines generated by the thermal state vector field are discussed.

Andrzej Trzesowski

2014-12-22T23:59:59.000Z

127

Stroke Fragmentation based on Geometry Features and Hidden Markov Model  

E-Print Network [OSTI]

1 Stroke Fragmentation based on Geometry Features and Hidden Markov Model Guihuan Feng, Christian Viard-Gaudin, Technical Report, IRCCyN Nantes/IVC ABSTRACT Stroke fragmentation is one of the key steps in pen-based interaction. In this letter, we present a unified HMM-based stroke fragmentation technique

Paris-Sud XI, Université de

128

Computational analysis and the geometry of intracranial saccular aneurysms  

E-Print Network [OSTI]

Engineering ABSTRACT Computational Analysis and the Geometry of intracranial Saccular Aneurysms. (December 2001) Marissa Zainuddin Banatwala, B. S. , Texas AAM University Chair of Advisory Committee: Dr. Jay D. Humphrey intracranial saccular aneurysms... REVIEW. 2. 1. Clinical Indicators . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2. 2. Three-Dimensional Reconstruction. . . 2. 3. Curvature Calculations . . . . . . . . . . . . . . . . . . . . . , . . . . . . . . . . 5 . 7...

Banatwala, Marissa Zainuddin

2012-06-07T23:59:59.000Z

129

Project Gutenberg's The Foundations of Geometry, by David Hilbert  

E-Print Network [OSTI]

Project Gutenberg's The Foundations of Geometry, by David Hilbert This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of the Project Gutenberg License included with this eBook or online at www

Corry, Scott

130

From string theory to algebraic geometry and back  

SciTech Connect (OSTI)

We describe some facts in physics which go up to the modern string theory and the related concepts in algebraic geometry. Then we present some recent results on moduli-spaces of vector bundles on non-Kaehler Calabi-Yau 3-folds and their consequences for heterotic string theory.

Brinzanescu, Vasile ['Simion Stoilow' Institute of Mathematics of the Romanian Academy, P.O.Box 1-764, Bucharest (Romania)

2011-02-10T23:59:59.000Z

131

Study of particle pumping characteristics for different pumping geometries in  

E-Print Network [OSTI]

Study of particle pumping characteristics for different pumping geometries in JT-60U and DIII, Princeton, New Jersey, United States of America Abstract. Particle pumping characteristics were compared between pumping from the inner side private flux region (IPP) and pumping from both sides of the private

Karney, Charles

132

Control of Variable Geometry Turbocharged Diesel Engines for Reduced Emissions  

E-Print Network [OSTI]

torque output as compared to (non-turbocharged) naturally aspirated engines 13]. The power generated- ifold pressure, increased power generation by the turbine and increased ow of air from compressorControl of Variable Geometry Turbocharged Diesel Engines for Reduced Emissions A.G. Stefanopoulouz

Stefanopoulou, Anna

133

Functional Geometry Alignment and Localization of Brain Areas  

E-Print Network [OSTI]

Functional Geometry Alignment and Localization of Brain Areas Georg Langs, Polina Golland Computer@bwh.harvard.edu, lrigolo@bwh.harvard.edu agolby@bwh.harvard.edu Abstract Matching functional brain regions across. It is particularly difficult, but highly relevant, for patients with pathologies such as brain tumors, which can

Golland, Polina

134

Connections on statistical manifolds of density operators by geometry of  

E-Print Network [OSTI]

of statistical manifolds, that is of manifolds whose points can be identified with density functions with respect to a certain measure µ. The classical references for the theory can be found in the books [1, 2, 4Connections on statistical manifolds of density operators by geometry of noncommutative Lp -spaces

Isola, Tommaso

135

The Geometry of Stochastic Reduction of an Entangled System  

E-Print Network [OSTI]

We show that the method of stochastic reduction of linear superpositions can be applied to the process of disentanglement for the spin-0 state of two spin-1/2 particles. We describe the geometry of this process in the framework of the complex projective space

Ari Belenkiy; Steve Shnider; Lawrence Horwitz

2006-09-19T23:59:59.000Z

136

Decay Rates for Spherical Scalar Waves in the Schwarzschild Geometry  

E-Print Network [OSTI]

The Cauchy problem is considered for the scalar wave equation in the Schwarzschild geometry. Using an integral spectral representation we derive the exact decay rate for solutions of the Cauchy problem with spherical symmetric initial data, which is smooth and compactly supported outside the event horizon.

Johann Kronthaler

2007-09-24T23:59:59.000Z

137

A Brain-Switch using Riemannian Geometry A. Barachant1  

E-Print Network [OSTI]

A Brain-Switch using Riemannian Geometry A. Barachant1 , S. Bonnet1 , M. Congedo2 , C. Jutten2 1 the issue of asynchronous brain-switch. The detection of a specific brain pattern from the ongoing EEG-time EEG segments contain all the desired information. Such a brain-switch is valuable as it is easy to set

Paris-Sud XI, Université de

138

The Siwaliks of western Nepal I. Geometry and kinematics  

E-Print Network [OSTI]

The Siwaliks of western Nepal I. Geometry and kinematics J.L. Mugniera, *, P. Leturmya , G. Masclea-western Nepal, and beneath 14.6 Ma sediments in mid-western Nepal, i.e., above the base of the Siwalik Group. Unconformities have been observed in the upper Siwalik member of western Nepal both on satellite images

Husson, Laurent

139

Fractal geometry of spinglass models J. F. Fontanari  

E-Print Network [OSTI]

Fractal geometry of spin­glass models J. F. Fontanari Instituto de F??�sica de S?ao Carlos through saddle s, and D is the fractal dimension of the phase space. PACS 75.10.Nr (principal), 87.23.Kg

Stadler, Peter F.

140

Fractal geometry of spin-glass models J. F. Fontanari  

E-Print Network [OSTI]

Fractal geometry of spin-glass models J. F. Fontanari Instituto de F´isica de S~ao Carlos saddle s, and D is the fractal dimension of the phase space. PACS 75.10.Nr (principal), 87.23.Kg

Stadler, Peter F.

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

Transferability of cleavage fracture parameters between notched and cracked geometries  

E-Print Network [OSTI]

and specimen geometry dependence of cleavage fracture micromechanisms of a French pressure vessel steel (A508 that only NT tests with a mean fracture strain lower than 25% have to be considered to make sure ; ¢ 50 £ C ]. Also a unique set of Weibull parameters was found to describe all the NT tests over

Boyer, Edmond

142

Load Alleviation on Wind Turbine Blades using Variable Airfoil Geometry  

E-Print Network [OSTI]

Load Alleviation on Wind Turbine Blades using Variable Airfoil Geometry Peter Bjrn Andersen, Mac Loads, Trailing Edge Flaps, PID control, Signal Noise. 1 Introduction Wind turbine blades are subject to 40% when signal noise is added to the control. Keywords: Wind Turbine, Load Alleviation, Fatigue

143

Optical geometry analysis of the electromagnetic self-force  

E-Print Network [OSTI]

We present an analysis of the behaviour of the electromagnetic self-force for charged particles in a conformally static spacetime, interpreting the results with the help of optical geometry. Some conditions for the vanishing of the local terms in the self-force are derived and discussed.

Sebastiano Sonego; Marek A. Abramowicz

2006-02-17T23:59:59.000Z

144

BUILDING COSMOLOGICAL MODELS VIA NONCOMMUTATIVE GEOMETRY MATILDE MARCOLLI  

E-Print Network [OSTI]

of theoretical high energy physics models that are capable of producing a range of predictions, bothBUILDING COSMOLOGICAL MODELS VIA NONCOMMUTATIVE GEOMETRY MATILDE MARCOLLI and cosmology to formulate testable predictions that can be confronted with the data. While model building

Marcolli, Matilde

145

Reversible Acid Gas Capture  

ScienceCinema (OSTI)

Pacific Northwest National Laboratory scientist David Heldebrant demonstrates how a new process called reversible acid gas capture works to pull carbon dioxide out of power plant emissions.

Dave Heldebrant

2012-12-31T23:59:59.000Z

146

EMSL - Nuclei acid structure  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

conditions showed a temporary pH decrease, with a concomitant increase in formic acid during exponential growth. Fermentation experiments performed outside of the magnet...

147

Nuclei acid structure | EMSL  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

conditions showed a temporary pH decrease, with a concomitant increase in formic acid during exponential growth. Fermentation experiments performed outside of the magnet...

148

Study of Influence of Electrode Geometry on Impedance Spectroscopy  

SciTech Connect (OSTI)

Electrochemical Impedance Spectroscopy (EIS) is a powerful and proven tool for analyzing AC impedance response. A conventional three electrode EIS method was used to perform the investigation in the present study. Saturated potassium chloride solution was used as the electrolyte and three different material rods were used as working electrodes. Different configurations of electrode area were exposed to the electrolyte as an active area to investigate electrode geometry effects. Counter to working electrode distance was also altered while keeping the working electrode effective area constant to explore the AC response dependence on the variation of ion travel distance. Some controlled experiments were done to validate the experimental setup and to provide a control condition for comparison with experimental results. A frequency range of 100 mHz to 1 MHz was used for all experiments. In our analysis, we have found a noteworthy influence of electrode geometry on AC impedance response. For all electrodes, impedance decreases with the increase of effective area of the electrolyte. High frequency impedance is not as dependent on geometry as low frequency response. The observed phase shift angle drops in the high frequency region with increased working electrode area, whereas at low frequency the reverse is true. Resistance and capacitive reactance both decrease with an increase of area, but resistance response is more pronounce than reactance. For lower frequencies, small changes in working area produce very distinctive EIS variations. Electrode material as well as geometry was systematically varied in the present study. From these and other studies, we hope to develop a fundamental foundation for understanding specific changes in local geometry in fuel cell (and other) electrodes as a method of designing local morphology for specific performance.

Ahmed, Riaz; Reifsnider, Kenneth L

2011-01-01T23:59:59.000Z

149

Controlling acid rain  

E-Print Network [OSTI]

High concentrations of sulfuric and nitric acid in raTn fn the northeastern USA are caused by the large scale combustion of fossil fuels within this region. Average precipitation acidity is pH 4.2, but spatial and temporal ...

Fay, James A.

1983-01-01T23:59:59.000Z

150

Chiral Topological Insulator on Nambu 3-Algebraic Geometry  

E-Print Network [OSTI]

Chiral topological insulator (AIII-class) with Landau levels is constructed based on the Nambu 3-algebraic geometry. We clarify the geometric origin of the chiral symmetry of the AIII-class topological insulator in the context of non-commutative geometry of 4D quantum Hall effect. The many-body groundstate wavefunction is explicitly derived as a $(l,l,l-1)$ Laughlin-Halperin type wavefunction with unique $K$-matrix structure. Fundamental excitation is identified with anyonic string-like object with fractional charge ${1}/({1+2(l-1)^2})$. The Hall effect of the chiral topological insulators turns out be a color version of Hall effect, which exhibits a dual property of the Hall and spin-Hall effects.

Kazuki Hasebe

2014-08-02T23:59:59.000Z

151

Generalized quantum gravity condensates for homogeneous geometries and cosmology  

E-Print Network [OSTI]

We construct a generalized class of quantum gravity condensate states, that allows the description of continuum homogeneous quantum geometries within the full theory. They are based on similar ideas already applied to extract effective cosmological dynamics from the group field theory formalism, and thus also from loop quantum gravity. However, they represent an improvement over the simplest condensates used in the literature, in that they are defined by an infinite superposition of graph-based states encoding in a precise way the topology of the spatial manifold. The construction is based on the definition of refinement operators on spin network states, written in a second quantized language. The construction lends itself easily to be applied also to the case of spherically symmetric quantum geometries.

Daniele Oriti; Daniele Pranzetti; James P. Ryan; Lorenzo Sindoni

2015-01-05T23:59:59.000Z

152

REALITY AND GEOMETRY OF STATES AND OBSERVABLES IN QUANTUM THEORY  

E-Print Network [OSTI]

The determination of the quantum state of a single system by protective observation is used to justify operationally a formulation of quantum theory on the quantum state space (projective Hilbert space) $\\cal P$. Protective observation is extended to a more general quantum theory in which the Schrodinger evolution is generalized so that it preserves the symplectic structure but not necessarily the metric in $\\cal P$. The relevance of this more general evolution to the apparant collapse of the state vector during the usual measurement, and its possible connection to gravity is suggested. Some criticisms of protective observation are answered. A comparison is made between the determination of quantum states using the geometry of $\\cal P$ by protective measurements, via a reconstruction theorem, and the determination of space-time points by means of the space-time geometry, via Einstein's hole argument. It is argued that a protective measurement may not determine a time average.

J. Anandan

1995-05-10T23:59:59.000Z

153

A mechanical mode-stirred reverberation chamber with chaotic geometry  

E-Print Network [OSTI]

A previous research on multivariate approach to the calculation of reverberation chamber correlation matrices is used to calculate the number of independent positions in a mode-stirred reverberation chamber. Anomalies and counterintuitive behavior are observed in terms of number of correlated matrix elements with respect to increasing frequency. This is ascribed to the regular geometry forming the baseline cavity (screened room) of a reverberation chamber, responsible for localizing energy and preserving regular modes (bouncing ball modes). Smooth wall deformations are introduced in order to create underlying Lyapunov instability of rays and then destroy survived regular modes. Numerical full-wave simulations are performed for a reverberation chamber with corner hemispheres and (off-)center wall spherical caps. Field sampling is performed by moving a mechanical carousel stirrer. It is found that wave-chaos inspired baseline geometries improve chamber performances in terms of lowest usable frequencies and number of independent cavity realizations of mechanical stirrers.

Gabriele Gradoni; Franco Moglie; Valter Mariani Primiani

2014-07-06T23:59:59.000Z

154

How effective is graphene nanopore geometry on DNA sequencing?  

E-Print Network [OSTI]

In this paper we investigate the effects of graphene nanopore geometry on homopolymer ssDNA pulling process through nanopore using steered molecular dynamic (SMD) simulations. Different graphene nanopores are examined including axially symmetric and asymmetric monolayer graphene nanopores as well as five layer graphene polyhedral crystals (GPC). The pulling force profile, moving fashion of ssDNA, work done in irreversible DNA pulling and orientations of DNA bases near the nanopore are assessed. Simulation results demonstrate the strong effect of the pore shape as well as geometrical symmetry on free energy barrier, orientations and dynamic of DNA translocation through graphene nanopore. Our study proposes that the symmetric circular geometry of monolayer graphene nanopore with high pulling velocity can be used for DNA sequencing.

Satarifard, Vahid; Ejtehadi, Mohammad Reza

2015-01-01T23:59:59.000Z

155

2DBTOR: a toroidal geometry neutron diffusion code  

E-Print Network [OSTI]

particles, might lead to energy conversion efficiencies approaching 100%, since charged particles can possibly be directly converted to electricity. I. A The Fusion Process Fusion is essentially the process of two nuclei coming together to form one...; this can lead to costly and time consuming computations. More recently, computer programs have been developed to perform neutron transport calculations that are more suitable for toroidal geometry. One example of such a code is TRISMs, a two...

Hrabal, Craig Anthony

2012-06-07T23:59:59.000Z

156

Icosadeltahedral geometry of fullerenes, viruses and geodesic domes  

E-Print Network [OSTI]

I discuss the symmetry of fullerenes, viruses and geodesic domes within a unified framework of icosadeltahedral representation of these objects. The icosadeltahedral symmetry is explained in details by examination of all of these structures. Using Euler's theorem on polyhedra, it is shown how to calculate the number of vertices, edges, and faces in domes, and number of atoms, bonds and pentagonal and hexagonal rings in fullerenes. Caspar-Klug classification of viruses is elaborated as a specific case of icosadeltahedral geometry.

Antonio Siber

2007-11-22T23:59:59.000Z

157

E-Print Network 3.0 - adiponectin cardiac geometry Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

How can we best image, quantify and model changes of cardiac geometry... can we best image, quantify and model changes of cardiac geometry and micro-anatomic structure... that...

158

Unification of Electromagnetism and Gravitation in the Framework of General Geometry  

E-Print Network [OSTI]

A new geometry, called General geometry, is constructed. It is proven that its the most simplest special case is geometry underlying Electromagnetism. Another special case is Riemannian geometry. Action for electromagnetic field and Maxwell equations are derived from curvature function of geometry underlying Electromagnetism. It is shown that equation of motion for a particle interacting with electromagnetic field coincides exactly with equation for geodesics of geometry underlying Electromagnetism. It is also shown that Electromagnetism can not be geometrized in the framework of Riemannian geometry. Using General Geometry we propose a unified model of electromagnetism and gravitation which reproduces Electromagnetism and Gravitation and predicts that electromagnetic field is a source for gravitational field. This theory is formulated in four dimensional spacetime and does not contain additional fields.

Shervgi Shahverdiyev

2005-07-05T23:59:59.000Z

159

E-Print Network 3.0 - algebraic geometry approach Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

, Differential Geometry, Commutative ... Source: Totaro, Burt - Department of Pure Mathematics and Mathematical Statistics, University of Cambridge Collection: Mathematics 2...

160

E-Print Network 3.0 - algebraic geometry Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

, Differential Geometry, Commutative ... Source: Totaro, Burt - Department of Pure Mathematics and Mathematical Statistics, University of Cambridge Collection: Mathematics 2...

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

TUGboat, Volume 0 (2060), No. 0 1001 A complex drawing in descriptive geometry  

E-Print Network [OSTI]

TUGboat, Volume 0 (2060), No. 0 1001 Graphics A complex drawing in descriptive geometry Denis Roegel Abstract This article describes the reproduction of a complex drawing in descriptive geometry be in descriptive geometry. In this article, I go into the details of the con- struction of a complex drawing, taken

Roegel, Denis

2060-01-01T23:59:59.000Z

162

Simulation of Biological Flow and Transport in Complex Geometries using Embedded Boundary /  

E-Print Network [OSTI]

Simulation of Biological Flow and Transport in Complex Geometries using Embedded Boundary / Volume for modeling polymer fluids in irregular microscale geometries that enables long-time simulation of validation the constitutive behavior of polymer fluids. Complex flow environment geometries are represented on Cartesian grids

163

Geometry Optimization of Kringle 1 of Plasminogen Using the PM3  

E-Print Network [OSTI]

Geometry Optimization of Kringle 1 of Plasminogen Using the PM3 Semiempirical Method ANDREW D July 1999 ABSTRACT: The results of a geometry optimization on the 1226 atom Kringle 1 of plasminogen with a conjugate gradient density matrix search replacing the diagonalization step. The geometry was optimized

Schlegel, H. Bernhard

164

(Acid rain workshop)  

SciTech Connect (OSTI)

The traveler presented a paper entitled Susceptibility of Asian Ecosystems to Soil-Mediated Acid Rain Damage'' at the Second Workshop on Acid Rain in Asia. The workshop was organized by the Asian Institute of Technology (Bangkok, Thailand), Argonne National Laboratory (Argonne, Illinois), and Resource Management Associates (Madison, Wisconsin) and was sponsored by the US Department of Energy, the United Nations Environment Program, the United Nations Economic and Social Commission for Asia and the Pacific, and the World Bank. Papers presented on the first day discussed how the experience gained with acid rain in North America and Europe might be applied to the Asian situation. Papers describing energy use projections, sulfur emissions, and effects of acid rain in several Asian countries were presented on the second day. The remaining time was allotted to discussion, planning, and writing plans for a future research program.

Turner, R.S.

1990-12-05T23:59:59.000Z

165

Fatty Acid Carcass Mapping  

E-Print Network [OSTI]

FATTY ACID CARCASS MAPPING A Thesis by STACEY NICOLE TURK Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE May 2008... Major Subject: Animal Science FATTY ACID CARCASS MAPPING A Thesis by STACEY NICOLE TURK Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE...

Turk, Stacey N.

2010-01-14T23:59:59.000Z

166

The utilization of tricarboxylic acid cycle acids and the uptake of succinic acid by Neurospora crassa  

E-Print Network [OSTI]

THE UTILIZATION OF TRICARBOXYLIC ACID CYCLE ACIDS AND THE UPTAKE OF SUCCINIC ACID BY NEUROSPORA CRASSA A Thesis by PATTI LYNN GILLILAND Submitted to the Graduate College of Texas A&M University in partial fulfillment of the requirement... for the degree of MASTER OF SCIENCE August 1978 Ma) or Subject: Microbiology THE UTILIZATION OF TRICARBOXYLIC ACID CYCLE ACIDS AND THE UPTAKE OF SUCCINIC ACID BY NEUROSPORA CRASSA A Thesis by PATTI LYNN GILLILAND Approved as to style and content by...

Gilliland, Patti Lynn

2012-06-07T23:59:59.000Z

167

Focus Sheet | Hydrofluoric Acid Health hazards of hydrofluoric acid  

E-Print Network [OSTI]

Focus Sheet | Hydrofluoric Acid Health hazards of hydrofluoric acid Hydrofluoric acid (HF characterized by weight loss, brittle bones, anemia, and general ill health. Safe use If possible, avoid working to exposures. #12;Focus Sheet | Hydrofluoric Acid Environmental Health and Safety Environmental Programs Office

Wilcock, William

168

Implementing NCNP's 21st century geometry capability: requirements, issues, and problems  

SciTech Connect (OSTI)

A new geometry capability has been implemented in MCNP that permits the existence of an unstructured mesh with its legacy Constructive Solid Geometry (CSG) capability to form a hybrid geometry. This new feature enables the user to build complex 3-D models with Computer Aided Engineering (CAE) tools, such as Abaqus, and perform a neutronics analysis on the same geometry mesh that is used for thermo-mechanical analyses. This paper will present an overview of the issues and problems encountered in implementing the requirements for the hybrid geometry capability in MCNP.

Martz, Roger L [Los Alamos National Laboratory; Goorley, John T [Los Alamos National Laboratory

2009-01-01T23:59:59.000Z

169

The Bryant-Salamon G_2 manifolds and hypersurface geometry  

E-Print Network [OSTI]

We show that two of the Bryant-Salamon G_2-manifolds have a simple topology ; homeomorphic to the complement of some submanifolds of the 7-dimensional sphere. In this connection, we show there exists a complete Ricci-flat (non-flat) metric on the complement of an m-dimensional sphere in an n-dimensional sphere for some n-1>m. We also give many examples of special Lagrangian submanifolds of the cotangent bundle of the sphere with the Stenzel metric. Hypersurface geometry is essential in the argument.

Reiko Miyaoka

2006-06-02T23:59:59.000Z

170

Quantum Corrections in String Compactifications on SU(3) Structure Geometries  

E-Print Network [OSTI]

We investigate quantum corrections to the classical four-dimensional low-energy effective action of type II string theory compactified on SU(3) structure geometries. Various methods previously developed for Calabi-Yau compactifications are adopted to determine - under some simple assumptions about the low-energy degrees of freedom - the leading perturbative corrections to the moduli space metrics in both alpha' and the string coupling constant. We find - in complete analogy to the Calabi-Yau case - that the corrections take a universal form dependent only on the Euler characteristic of the six-dimensional compact space.

Mariana Grana; Jan Louis; Ulrich Theis; Daniel Waldram

2014-12-05T23:59:59.000Z

171

Weak and Repulsive Casimir Force in Piston Geometries  

E-Print Network [OSTI]

We study the Casimir force in piston-like geometries semiclassically. The force on the piston is finite and physical, but to leading semiclassical approximation depends strongly on the shape of the surrounding cavity. Whereas this force is attractive for pistons in a parallelepiped with flat cylinder head, for which the semiclassical approximation by periodic orbits is exact, this approximation to the force on the piston vanishes for a semi-cylindrical head and becomes repulsive for a cylinder of circular cross section with a hemispherical head. In leading semiclassical approximation the sign of the force is related to the generalized Maslov index of short periodic orbits between the piston and its casing.

Martin Schaden; Liviu Mateescu

2007-05-23T23:59:59.000Z

172

Global geometry of space-time with the charged shell  

E-Print Network [OSTI]

It is elaborated the complete classification of the possible types of the spherically symmetric global geometries for two types of electrically charged shells: (1) The charged shell as a single source of the gravitational field, when internal space-time is flat, and external space-time is the Reissner--Nordstr\\"om metric; (2) The neutralizing shell with an electric charge opposite to the charge of the internal source with the Reissner--Nordstr\\"om metric and with the Schwarzschild metric outside the shell.

V. A. Berezin; V. I. Dokuchaev

2014-04-10T23:59:59.000Z

173

Geometry of Cenozoic extensional faulting: Dixie Valley, Nevada | Open  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6TheoreticalFuelCellGeminiEnergy Information Geometry of

174

Optical high acidity sensor  

DOE Patents [OSTI]

An apparatus and method for determining acid concentrations in solutions having acid concentrations of from about 0.1 Molar to about 16 Molar is disclosed. The apparatus includes a chamber for interrogation of the sample solution, a fiber optic light source for passing light transversely through the chamber, a fiber optic collector for receiving the collimated light after transmission through the chamber, a coating of an acid resistant polymeric composition upon at least one fiber end or lens, the polymeric composition in contact with the sample solution within the chamber and having a detectable response to acid concentrations within the range of from about 0.1 Molar to about 16 Molar, a measurer for the response of the polymeric composition in contact with the sample solution, and, a comparer of the measured response to predetermined standards whereby the acid molarity of the sample solution within the chamber can be determined. Preferably, a first lens is attached to the end of the fiber optic light source, the first lens adapted to collimate light from the fiber optic light source, and a second lens is attached to the end of the fiber optic collector for focusing the collimated light after transmission through the chamber.

Jorgensen, Betty S. (Jemez Springs, NM); Nekimken, Howard L. (Los Alamos, NM); Carey, W. Patrick (Lynnwood, WA); O'Rourke, Patrick E. (Martinez, GA)

1997-01-01T23:59:59.000Z

175

A Direct, Biomass-Based Synthesis of Benzoic Acid: Formic Acid-Mediated Deoxygenation of the Glucose-Derived Materials Quinic Acid and Shikimic Acid  

SciTech Connect (OSTI)

An alternative biomass-based route to benzoic acid from the renewable starting materials quinic acid and shikimic acid is described. Benzoic acid is obtained selectively using a highly efficient, one-step formic acid-mediated deoxygenation method.

Arceo, Elena; Ellman, Jonathan; Bergman, Robert

2010-05-03T23:59:59.000Z

176

Improving FAIMS Sensitivity using a Planar Geometry with Slit Interfaces  

SciTech Connect (OSTI)

Differential mobility spectrometry or field asymmetric waveform ion mobility spectrometry (FAIMS) is gaining broad acceptance for analyses of gas-phase ions, especially in conjunction with largely orthogonal separation methods such as mass spectrometry (MS) and/or conventional (drift tube) ion mobility spectrometry. In FAIMS, ions are filtered while passing through a gap between two electrodes that may have planar or curved (in particular, cylindrical) geometry. Despite substantial inherent advantages of the planar configuration and its universal acceptance in stand-alone FAIMS devices, commercial FAIMS/MS systems have employed curved FAIMS geometries that could be interfaced to MS more effectively. Here we report a new planar (p-) FAIMS design with slit-shaped entrance and exit apertures that substantially increase ion transmission in and out of the analyzer. The front slit interface effectively couples p-FAIMS to multi-emitter electrospray ionization (ESI) sources, improving greatly the ion current introduced to the device. The back slit interface increases the transmission of ribbon-shaped ion beams output by the p-FAIMS to downstream stages such as a MS. Overall, the ion signal in ESI/FAIMS/MS analyses is raised by over an order of magnitude without affecting the FAIMS resolution.

Mabrouki, Ridha B.; Kelly, Ryan T.; Prior, David C.; Shvartsburg, Alexandre A.; Tang, Keqi; Smith, Richard D.

2009-09-01T23:59:59.000Z

177

Pauli graph and finite projective lines/geometries  

E-Print Network [OSTI]

The commutation relations between the generalized Pauli operators of N-qudits (i. e., N p-level quantum systems), and the structure of their maximal sets of commuting bases, follow a nice graph theoretical/geometrical pattern. One may identify vertices/points with the operators so that edges/lines join commuting pairs of them to form the so-called Pauli graph P_{p^N} . As per two-qubits (p = 2, N = 2) all basic properties and partitionings of this graph are embodied in the geometry of the symplectic generalized quadrangle of order two, W(2). The structure of the two-qutrit (p = 3, N = 2) graph is more involved; here it turns out more convenient to deal with its dual in order to see all the parallels with the two-qubit case and its surmised relation with the geometry of generalized quadrangle Q(4, 3), the dual of W(3). Finally, the generalized adjacency graph for multiple (N > 3) qubits/qutrits is shown to follow from symplectic polar spaces of order two/three. The relevance of these mathematical concepts to mutually unbiased bases and to quantum entanglement is also highlighted in some detail.

Michel R. P. Planat; Metod Saniga

2007-03-16T23:59:59.000Z

178

Lorentzian AdS geometries, wormholes, and holography  

SciTech Connect (OSTI)

We investigate the structure of two-point functions for the quantum field theory dual to an asymptotically Lorentzian Anti de Sitter (AdS) wormhole. The bulk geometry is a solution of five-dimensional second-order Einstein-Gauss-Bonnet gravity and causally connects two asymptotically AdS spacetimes. We revisit the Gubser-Klebanov-Polyakov-Witten prescription for computing two-point correlation functions for dual quantum field theories operators O in Lorentzian signature and we propose to express the bulk fields in terms of the independent boundary values {phi}{sub 0}{sup {+-}} at each of the two asymptotic AdS regions; along the way we exhibit how the ambiguity of normalizable modes in the bulk, related to initial and final states, show up in the computations. The independent boundary values are interpreted as sources for dual operators O{sup {+-}} and we argue that, apart from the possibility of entanglement, there exists a coupling between the degrees of freedom living at each boundary. The AdS{sub 1+1} geometry is also discussed in view of its similar boundary structure. Based on the analysis, we propose a very simple geometric criterion to distinguish coupling from entanglement effects among two sets of degrees of freedom associated with each of the disconnected parts of the boundary.

Arias, Raul E.; Silva, Guillermo A. [IFLP-CONICET and Departamento de Fisica Facultad de Ciencias Exactas, Universidad Nacional de La Plata , CC 67, 1900, La Plata (Argentina); Botta Cantcheff, Marcelo [Theory Division, CERN, 1211 Geneva 23 (Switzerland); IFLP-CONICET and Departamento de Fisica Facultad de Ciencias Exactas, Universidad Nacional de La Plata , CC 67, 1900, La Plata (Argentina)

2011-03-15T23:59:59.000Z

179

Using Surface Impedance for Calculating Wakefields in Flat Geometry  

DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

Beginning with Maxwell's equations and assuming only that the wall interaction can be approximated by a surface impedance, we derive formulas for the generalized longitudinal and transverse impedance in flat geometry, from which the wakefields can also be obtained. From the generalized impedances, by taking the proper limits, we obtain the normal longitudinal, dipole, and quad impedances in flat geometry. These equations can be applied to any surface impedance, such as the known dc, ac, and anomalous skin models of wall resistance, a model of wall roughness, or one for a pipe with small, periodic corrugations. We show that, for the particular case of dc wall resistance, the longitudinal impedance obtained here agrees with a known result in the literature, a result that was derived from a very general formula by Henke and Napoly. As concrete example, we apply our results to representative beam and machine parameters in the undulator region of LCLS-II and estimate the impact of the transverse wakes on the machine performance.

Bane, Karl; Stupakov, Gennady

2015-03-01T23:59:59.000Z

180

Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters  

DOE Patents [OSTI]

A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

Moens, Luc (Lakewood, CO)

2003-06-24T23:59:59.000Z

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Creating geometry and mesh models for nuclear reactor core geometries using a lattice hierarchy-based approach.  

SciTech Connect (OSTI)

Nuclear reactor cores are constructed as rectangular or hexagonal lattices of assemblies, where each assembly is itself a lattice of fuel, control, and instrumentation pins, surrounded by water or other material that moderates neutron energy and carries away fission heat. We describe a system for generating geometry and mesh for these systems. The method takes advantage of information about repeated structures in both assembly and core lattices to simplify the overall process. The system allows targeted user intervention midway through the process, enabling modification and manipulation of models for meshing or other purposes. Starting from text files describing assemblies and core, the tool can generate geometry and mesh for these models automatically as well. Simple and complex examples of tool operation are given, with the latter demonstrating generation of meshes with 12 million hexahedral elements in less than 30 minutes on a desktop workstation, using about 4 GB of memory. The tool is released as open source software as part of the MeshKit mesh generation library.

Tautges, T. J.; Jain, R.; Mathematics and Computer Science

2010-01-01T23:59:59.000Z

182

Plant fatty acid hydroxylase  

DOE Patents [OSTI]

The present invention relates to the identification of nucleic acid sequences and constructs, and methods related thereto, and the use of these sequences and constructs to produce genetically modified plants for the purpose of altering the composition of plant oils, waxes and related compounds.

Somerville, Chris (Portola Valley, CA); van de Loo, Frank (Lexington, KY)

2000-01-01T23:59:59.000Z

183

Oxidation of ferrocene by thiocyanic acid in the presence of ammonium oxalate  

SciTech Connect (OSTI)

A flake-like crystalline salt was obtained from the reaction of ferrocene, oxalic acid and ammonium thiocyanate in ethanol The elemental analysis and spectroscopic data were in agreement with the preliminary X-ray molecular structure. The compound consists of four ferrocenium moieties and a counter anion consisting of two (tetraisothiocyanato)iron(III) linked by an oxalato bridging group in such a way that both iron central atoms adopt octahedral geometries.

Ruslin, Farah bt; Yamin, Bohari M. [School of Chemical Science and Food Technology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia (Malaysia)

2014-09-03T23:59:59.000Z

184

Fatty acid-producing hosts  

DOE Patents [OSTI]

Described are hosts for overproducing a fatty acid product such as a fatty acid. The hosts include an exogenous nucleic acid encoding a thioesterase and, optionally, an exogenous nucleic acid encoding an acetyl-CoA carboxylase, wherein an acyl-CoA synthetase in the hosts are functionally delected. The hosts prefereably include the nucleic acid encoding the thioesterase at an intermediate copy number. The hosts are preferably recominantly stable and growth-competent at 37.degree. C. Methods of producing a fatty acid product comprising culturing such hosts at 37.degree. C. are also described.

Pfleger, Brian F; Lennen, Rebecca M

2013-12-31T23:59:59.000Z

185

Acidizing of Sandstone Reservoirs Using HF and Organic Acids  

E-Print Network [OSTI]

Mud acid, which is composed of HCl and HF, is commonly used to remove the formation damage in sandstone reservoirs. However, many problems are associated with HCl, especially at high temperatures. Formic-HF acids have served as an alternative...

Yang, Fei

2012-10-19T23:59:59.000Z

186

acid docosahexaenoic acid: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 38 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

187

acid aspartic acid: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 20 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

188

acid caffeic acid: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 11 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

189

acid succinic acid: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

simulated the laser heating of the succinic acid (this data is still simulation is that infrared heating generates about 10-15 more succinic acid molecules bound to the analyte...

190

acid benzoic acid: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 24 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

191

acid propanoic acid: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 9 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

192

acid oleic acid: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 31 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

193

The Standard Model in Noncommutative Geometry and Morita equivalence  

E-Print Network [OSTI]

We discuss some properties of the spectral triple $(A_F,H_F,D_F,J_F,\\gamma_F)$ describing the internal space in the noncommutative geometry approach to the Standard Model, with $A_F=\\mathbb{C}\\oplus\\mathbb{H}\\oplus M_3(\\mathbb{C})$. We show that, if we want $H_F$ to be a Morita equivalence bimodule between $A_F$ and the associated Clifford algebra, two terms must be added to the Dirac operator; we then study its relation with the orientability condition for a spectral triple. We also illustrate what changes if one considers a spectral triple with a degenerate representation, based on the complex algebra $B_F=\\mathbb{C}\\oplus M_2(\\mathbb{C})\\oplus M_3(\\mathbb{C})$.

Francesco D'Andrea; Ludwik Dabrowski

2014-12-31T23:59:59.000Z

194

Oscillation modes of dc microdischarges with parallel-plate geometry  

E-Print Network [OSTI]

Two different oscillation modes in microdischarge with parallel-plate geometry has been observed: relaxation oscillations with frequency range between 1.23 and 2.1 kHz and free-running oscillations with 7 kHz frequency. The oscillation modes are induced by increasing power supply voltage or discharge current. For a given power supply voltage, there is a spontaneous transition from one to other oscillation mode and vice versa. Before the transition from relaxation to free-running oscillations, the spontaneous increase of oscillation frequency of relaxation oscillations form 1.3 kHz to 2.1 kHz is measured. Fourier Transform Spectra of relaxation oscillations reveal chaotic behaviour of microdischarge. Volt-Ampere characteristics associated with relaxation oscillations describes periodical transition between low current, diffuse discharge and normal glow. However, free-running oscillations appear in subnormal glow only.

Stefanovi?, Ilija; koro, Nikola; Mari?, Dragana; Petrovi?, Zoran Lj; Winter, Jrg

2011-01-01T23:59:59.000Z

195

Electric field geometries dominate quantum transport coupling in silicon nanoring  

SciTech Connect (OSTI)

Investigations on the relation between the geometries of silicon nanodevices and the quantum phenomenon they exhibit, such as the AharonovBohm (AB) effect and the Coulomb blockade, were conducted. An arsenic doped silicon nanoring coupled with a nanowire by electron beam lithography was fabricated. At 1.47?K, Coulomb blockade oscillations were observed under modulation from the top gate voltage, and a periodic AB oscillation of ?B?=?0.178?T was estimated for a ring radius of 86?nm under a high sweeping magnetic field. Modulating the flat top gate and the pointed side gate was performed to cluster and separate the many electron quantum dots, which demonstrated that quantum confinement and interference effects coexisted in the doped silicon nanoring.

Lee, Tsung-Han, E-mail: askaleeg@gmail.com, E-mail: sfhu.hu@gmail.com; Hu, Shu-Fen, E-mail: askaleeg@gmail.com, E-mail: sfhu.hu@gmail.com [Department of Physics, National Taiwan Normal University, Taipei 116, Taiwan (China)

2014-03-28T23:59:59.000Z

196

The Discrete Geometry of a Small Causal Diamond  

E-Print Network [OSTI]

We study the discrete causal set geometry of a small causal diamond in a curved spacetime using the average abundance of k-element chains or total orders in the underlying causal set C. We begin by obtaining the first order curvature corrections to the flat spacetime expression for the abundance using Riemann normal coordinates. For fixed spacetime dimension this allows us to find a new expression for the discrete scalar curvature of C as well as the time-time component of its Ricci tensor in terms of the abundances of k-chains. We also find a new dimension estimator for C which replaces the flat spacetime Myrheim-Meyer estimator in generic curved spacetimes.

Mriganko Roy; Debdeep Sinha; Sumati Surya

2012-12-04T23:59:59.000Z

197

Gyrokinetic treatment of GAE modes in cylindrical geometry  

SciTech Connect (OSTI)

Global Alfven eigenmodes (GAEs) are investigated in cylindrical geometry both analytically and numerically. These modes are of particular importance in low-shear magnetic configurations, such as modern stellarators. Analytical treatment starts from the linearised equations of gyrokinetics and yields a generalized dispersion relation for GAE with FLR and kinetic effects taken into account, which is demonstrated to reduce to the well-known MHD counterpart in the appropriate limit. An eigenvalue code is developed to solve the dispersion relation, which is used to investigate the kinetic analogs of GAE modes in various regimes with different beta. On the other hand, GAE modes are simulated with global linear particle-in-cell (PIC) electromagnetic gyrokinetic code following self-consistent time evolution of electromagnetic fields and plasma. GAE modes are observed and their damping rate agrees with predictions made by the eigenvalue code.

Eremin, D. [Max-Plank-Institut fuer Plasmaphysik, EUROATOM-Association, D-17491 Greifswald (Germany)

2006-11-30T23:59:59.000Z

198

The generation of hexahedral meshes for assembly geometries: A survey  

SciTech Connect (OSTI)

The finite element method is being used today to model component assemblies in a wide variety of application areas, including structural mechanics, fluid simulations, and others. Generating hexahedral meshes for these assemblies usually requires the use of geometry decomposition, with different meshing algorithms applied to different regions. While the primary motivation for this approach remains the lack of an automatic, reliable all-hexahedral meshing algorithm, requirements in mesh quality and mesh configuration for typical analyses are also factors. For these reasons, this approach is also sometimes required when producing other types of unstructured meshes. This paper will review progress to date in automating many parts of the hex meshing process, which has halved the time to produce all-hex meshes for large assemblies. Particular issues which have been exposed due to this progress will also be discussed, along with their applicability to the general unstructured meshing problem.

TAUTGES,TIMOTHY J.

2000-02-14T23:59:59.000Z

199

Corbino-geometry Josephson weak links in thin superconducting films  

SciTech Connect (OSTI)

I consider a Corbino-geometry superconducting-normal-superconducting Josephson weak link in a thin superconducting film, in which current enters at the origin, flows outward, passes through an annular Josephson weak link, and leaves radially. In contrast to sandwich-type annular Josephson junctions, in which the gauge-invariant phase difference obeys the sine-Gordon equation, here the gauge-invariant phase difference obeys an integral equation. I present exact solutions for the gauge-invariant phase difference across the weak link when it contains an integral number N of Josephson vortices and the current is zero. I then study the dynamics when a current is applied, and I derive the effective resistance and the viscous drag coefficient; I compare these results with those in sandwich-type junctions. I also calculate the critical current when there is no Josephson vortex in the weak link but there is a Pearl vortex nearby.

Clem, John R.

2010-11-29T23:59:59.000Z

200

Spin geometry and conservation laws in the Kerr spacetime  

E-Print Network [OSTI]

In this paper we will review some facts, both classical and recent, concerning the geometry and analysis of the Kerr and related black hole spacetimes. This includes the analysis of test fields on these spacetimes. Central to our analysis is the existence of a valence $(2,0)$ Killing spinor, which we use to construct symmetry operators and conserved currents as well as a new energy momentum tensor for the Maxwell test fields on a class of spacetimes containing the Kerr spacetime. We then outline how this new energy momentum tensor can be used to obtain decay estimated for Maxwell test fields. An important motivation for this work is the black hole stability problem, where fields with non-zero spin present interesting new challenges. The main tool in the analysis is the 2-spinor calculus, and for completeness we introduce its main features.

Andersson, Lars; Blue, Pieter

2015-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Acid Placement in Acid Jetting Treatments in Long Horizontal Wells  

E-Print Network [OSTI]

In the Middle East, extended reach horizontal wells (on the order of 25,000 feet of horizontal displacement) are commonly acid stimulated by jetting acid out of drill pipe. The acid is jetted onto the face of the openhole wellbore as the drill pipe...

Sasongko, Hari

2012-07-16T23:59:59.000Z

202

Acid placement and coverage in the acid jetting process  

E-Print Network [OSTI]

Many open-hole acid treatments are being conducted by pumping acid through jetting ports placed at the end of coiled tubing or drill pipe. The filter-cake on the bore-hole is broken by the jet; the acid-soluble material is dissolved, creating...

Mikhailov, Miroslav I.

2009-05-15T23:59:59.000Z

203

Black hole initial data with a horizon of prescribed intrinsic and extrinsic geometry  

E-Print Network [OSTI]

The purpose of this work is to construct asymptotically flat, time symmetric initial data with an apparent horizon of prescribed intrinsic and extrinsic geometry. To do this, we use the parabolic partial differential equation for prescribing scalar curvature. In this equation the horizon geometry is contained within the freely specifiable part of the metric. This contrasts with the conformal method in which the geometry of the horizon can only be specified up to a conformal factor.

Brian Smith

2010-06-14T23:59:59.000Z

204

E-Print Network 3.0 - axisymmetric geometry ii Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

pulmonary surfactant, respiratory flow and wall motion, the airways' geometry... , is the surface tension and is the mean curvature of the air-liquid interface. For the uni-...

205

E-Print Network 3.0 - affine differential geometry Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

geometry is the study... - preserving ... Source: Loftin, John - Department of Mathematics and Computer Science, Rutgers University at Newark Collection: Mathematics 2...

206

E-Print Network 3.0 - analysis differential geometry Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of Planar and Vertical Nanocoaxial Solar Cells Timothy Kirkpatrick, Michael... of a PIN solar cell, in both planar and cylindrical geometries, expressions for rectifying current...

207

E-Print Network 3.0 - arbitrary three-dimensional geometries...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

4 ARTICLE IN PRESS Computer-Aided Design ( ) Summary: a limited number of computed tomography (CT) images. The three-dimensional template geometry of a healthy... a limited...

208

Investigating acid rain  

SciTech Connect (OSTI)

A report is given of an address by Kathleen Bennett, Assistant Administrator of Air, Noise and Radiation, Environmental Protection Agency which was presented to the US Senate Committee on the Environment and Public Works. Bennet explained that in view of the many unknowns about acid rain, and the possible substantial cost burden of additional controls, EPA is proceeding with its program to investigate this environmental malady over a 10-year period. The three major areas of the research program are (1) transport, transformation, and deposition processes, (2) effects of acid deposition, and (3) assessments and policy studies. Other issues discussed were global transboundary air pollution and Senate amendments addressing long-range transport. (JMT)

Not Available

1981-01-01T23:59:59.000Z

209

Pantothenic acid biosynthesis in zymomonas  

DOE Patents [OSTI]

Zymomonas is unable to synthesize pantothenic acid and requires this essential vitamin in growth medium. Zymomonas strains transformed with an operon for expression of 2-dehydropantoate reductase and aspartate 1-decarboxylase were able to grow in medium lacking pantothenic acid. These strains may be used for ethanol production without pantothenic acid supplementation in seed culture and fermentation media.

Tao, Luan; Tomb, Jean-Francois; Viitanen, Paul V.

2014-07-01T23:59:59.000Z

210

The effect of charcoal tube geometry on breakthrough volume  

E-Print Network [OSTI]

TABLE OF CONTENTS. LIST OF TABLES. LIST OF FIGURES. . . . vi viii ix INTRODUCTION. LITERATURE REVIEW. Activated Carbon. Adsorption Theory. Fluid Flow in a Packed Bed Adsorption Rate. Charcoal Tubes and Breakthrough Volume. . The Problem... to approximately 170 C. Above this temperature the wood begins to partially degrade and carbon monoxide, carbon dioxide and acetic acid evolve. After the wood has completely dried it is heated to a temperature range of approximately 270-280 C...

Strange, Jay B.

1989-01-01T23:59:59.000Z

211

IEEE TRANSACTIONS ON VISUALIZATION AND COMPUTER GRAPHICS, VOL. , NO. , 2005 1 Geometry-Dependent Lighting  

E-Print Network [OSTI]

-Dependent Lighting Chang Ha Lee, Xuejun Hao, and Amitabh Varshney, Member, IEEE Abstract-- In this paper we introduce geometry- dependent lighting that allows lighting parameters to be defined independently and possibly discrepantly over an object or scene based on the local geometry. We present and discuss Light Collages

Varshney, Amitabh

212

Oil and Gas CDT The scale and geometry of differential compaction on  

E-Print Network [OSTI]

slope basins. Importantly, it can control the geometry of large-scale oil and gas prospects in deepOil and Gas CDT The scale and geometry of differential compaction on continental margins Cardiff will analyse a series of fault families imaged on high-quality 3D seismic data from the North Sea, Brazil

Henderson, Gideon

213

Fast Constructive-Solid Geometry Display in the Pixel-Powers Graphics System  

E-Print Network [OSTI]

Fast Constructive-Solid Geometry Display in the Pixel-Powers Graphics System Technical Report 86 for PublieatioD #12;Fast Constructive-Solid Geometry Display In the Pixel-Powers Graphics System Jack Goldfeather Hill ABSTRACT We present two algorithms for the display of CSG-defined objects on Pixel-Powers

North Carolina at Chapel Hill, University of

214

On downstream hydraulic geometry and optimal energy expenditure: case study of the Ashley and Taieri Rivers  

E-Print Network [OSTI]

On downstream hydraulic geometry and optimal energy expenditure: case study of the Ashley Abstract The downstream distribution of channel geometry and of the rate of energy expenditure per unit the network. We look at energy expenditure from two perspectives. (1) In the context of downstream hydraulic

Ramrez, Jorge A.

215

SIMULATION OF GEOMETRY AND SHADOW EFFECTS IN 3D ORGANIC POLYMER SOLAR CELLS  

E-Print Network [OSTI]

levels of Solar panels and new production capacity is driving solar PV prices lower and thereby, bringingSIMULATION OF GEOMETRY AND SHADOW EFFECTS IN 3D ORGANIC POLYMER SOLAR CELLS OF THE THESIS Simulation of Geometry and Shadow Effects in 3D Organic Polymer Solar Cells by Mihir Prakashbhai

Kassegne, Samuel Kinde

216

N/Z dependence of balance energy throughout the colliding geometries  

E-Print Network [OSTI]

We study the N/Z dependence of balance energy throughout the mass range for colliding geometry varying from central to peripheral ones. Our results indicate that balance energy decreases linearly with increase in N/Z ratio for all the masses throughout the colliding geometry range. Also, the N/Z dependence of balance energy is sensitive to symmetry energy.

Sakshi Gautam; Rajeev K. Puri

2011-07-28T23:59:59.000Z

217

2D and 3D Visibility in Discrete Geometry: an application to discrete geodesic paths  

E-Print Network [OSTI]

1 2D and 3D Visibility in Discrete Geometry: an application to discrete geodesic paths D discrete geodesic paths in discrete domain with obstacles. This allows us to introduce a new geodesic metric in discrete geometry. Keywords: discrete visibility, geodesic path, distance transform, discrete

Boyer, Edmond

218

A fast solver for the Stokes equations with distributed forces in complex geometries 1  

E-Print Network [OSTI]

A fast solver for the Stokes equations with distributed forces in complex geometries 1 George Biros geometries in a black-box fashion; (2) it is second order accurate; and (3) it has optimal algorithmic complexity. Our approach, to which we refer as the Embedded Boundary Integral method, is based on Anita Mayo

Mohri, Mehryar

219

Workshop on Linear Logic Geometry of Interaction, Traced Monoidal Categories and Implicit Complexity  

E-Print Network [OSTI]

on Linear Logic Geometry of Interaction, Traced Monoidal Categories and Implicit Complexity of Interaction for Polarized Linear Logic We present a Geometry of Interaction (GoI) model for the multiplicative & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & & Date: 7th November 2011 11th November 2011 Venue: Room 110, Faculty of Science Building No.3, Kyoto

Banbara, Mutsunori

220

Neutron Noise Calculations in Hexagonal Geometry and Comparison with Analytical Solutions  

E-Print Network [OSTI]

for addressing the noise calculations of light water reactors ~LWRs! in Cartesian geometries.3 This tool instability, etc. Extension of the noise calculation method to other reactor types such as Russian VVERsNeutron Noise Calculations in Hexagonal Geometry and Comparison with Analytical Solutions Hoai Nam

Demazière, Christophe

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

Geometry Optimization with QM/MM, ONIOM, and Other Combined Methods. I. Microiterations  

E-Print Network [OSTI]

Geometry Optimization with QM/MM, ONIOM, and Other Combined Methods. I. Microiterations calculation, have been very successful in describing large systems. Geometry optimization methods can take). A series of microit- erations can be employed to fully optimize the MM region for each optimization step

Schlegel, H. Bernhard

222

Geometry optimization methods for modeling large molecules O don Farkasa,*, H. Bernhard Schlegelb  

E-Print Network [OSTI]

Geometry optimization methods for modeling large molecules O¨ do¨n Farkasa,*, H. Bernhard Schlegelb, Wayne State University, Detroit, USA Abstract Geometry optimization is an essential part of quantum that there are different requirements for a chosen optimization method. The proposed method aims to meet two requirements

Schlegel, H. Bernhard

223

Oscillator or Segal-Shale-Weil representation Geometry: Associating the oscillator to symplectic manifolds  

E-Print Network [OSTI]

C -algebras Oscillator or Segal-Shale-Weil representation Geometry: Associating the oscillator or Segal-Shale-Weil representation Geometry: Associating the oscillator to symplectic manifolds Global and (x) = 0 implies x = 0 2 S. Krýsl #12;C -algebras Oscillator or Segal-Shale-Weil representation

Krysl, Svatopluk

224

Transforming BIM to BEM: Generation of Building Geometry for the NASA Ames  

E-Print Network [OSTI]

LBNL-6033E Transforming BIM to BEM: Generation of Building Geometry for the NASA Ames by Tobias Maile and expanded by Cody Rose. #12;Transforming BIM to BEM: Generation of Building Geometry Ames project and was the enabling software that facilitated semi-automated data transformations. GST

225

COMSOL Modeling of Groundwater Flow and Contaminant Transport in Two-Dimensional Geometries With Heterogeneities  

E-Print Network [OSTI]

COMSOL Modeling of Groundwater Flow and Contaminant Transport in Two-Dimensional Geometries, Environmental Sys- tems. 1 Introduction Groundwater contributes an large portion of stream flow and subsequently% of a streams nitrogen load has been discharged from groundwater. The surficial aquifer geometry in this area

Gobbert, Matthias K.

226

Disordered Topological Insulators: A Non-Commutative Geometry Perspective  

E-Print Network [OSTI]

This review deals with strongly disordered topological insulators and covers some recent applications of a well established analytic theory based on the methods of Non-Commutative Geometry (NCG) and developed for the Integer Quantum Hall-Effect. Our main goal is to exemplify how this theory can be used to define topological invariants in the presence of strong disorder, other than the Chern number, and to discuss the physical properties protected by these invariants. Working with two explicit 2-dimensional models, one for a Chern insulator and one for a Quantum spin-Hall insulator, we first give an in-depth account of the key bulk properties of these topological insulators in the clean and disordered regimes. Extensive numerical simulations are employed here. A brisk but self-contained presentation of the non-commutative theory of the Chern number is given and a novel numerical technique to evaluate the non-commutative Chern number is presented. The non-commutative spin-Chern number is defined and the analytic theory together with the explicit calculation of the topological invariants in the presence of strong disorder are used to explain the key bulk properties seen in the numerical experiments presented in the first part of the review.

Emil Prodan

2010-12-22T23:59:59.000Z

227

Gravitational perturbations of the Kerr geometry: High-accuracy study  

E-Print Network [OSTI]

We present results from a new code for computing gravitational perturbations of the Kerr geometry. This new code carefully maintains high precision to allow us to obtain high-accuracy solutions for the gravitational quasinormal modes of the Kerr space-time. Part of this new code is an implementation of a spectral method for solving the angular Teukolsky equation that, to our knowledge, has not been used before for determining quasinormal modes. We focus our attention on two main areas. First, we explore the behavior of these quasinormal modes in the extreme limit of Kerr, where the frequency of certain modes approaches accumulation points on the real axis. We compare our results with recent analytic predictions of the behavior of these modes near the accumulation points and find good agreement. Second, we explore the behavior of solutions of modes that approach the special frequency $M\\omega=-2i$ in the Schwarzschild limit. Our high-accuracy methods allow us to more closely approach the Schwarzschild limit than was possible with previous numerical studies. Unlike previous work, we find excellent agreement with analytic predictions of the behavior near this special frequency. We include a detailed description of our methods, and make use of the theory of confluent Heun differential equations throughout. In particular, we make use of confluent Heun polynomials to help shed some light on the controversy of the existence, or not, of quasinormal and total-transmission modes at certain special frequencies in the Schwarzschild limit.

Gregory B. Cook; Maxim Zalutskiy

2014-11-19T23:59:59.000Z

228

The 3D Geometry of Dark Matter Halos  

E-Print Network [OSTI]

The thickness of the neutral hydrogen layer, coupled with the rotation curve, traces the outer dark matter potential. We estimate the amplitude of the flaring in spiral galaxies from a 3D model of the HI gas. Warps in particular are explicitly parametrized in the form of an harmonical density wave. Applying our method to the galaxy NGC 891, the only model that could fit the observations, and in particular the HI at large height above the plane, includes a strong warp with a line of node almost coinciding with the line of sight. This high-Z HI is not observed at the most extreme velocity channels, those corresponding to high rotational velocities. This is accounted for by the model, since orbits in the tilted planes are not circular, but elongated, with their minor axis in the galaxy plane. Their velocity on the major axis (i.e. at their maximal height above the plane) is then 30% less than in the plane. We finally connect the modelled vertical outer gaseous distribution to the dark matter through hydrodynamical and gravitational equations. Under the assumption of isotropy of the gaseous velocity dispersion, we conclude on a very flattened halo geometry for the galaxy NGC 891 ($q \\approx 0.2$), while a vertical velocity dispersion smaller that the radial one would lead to a less flattened Dark Matter Halo ($q \\approx 0.4-0.5$). Both results however suggests that dark matter is dissipative or has been strongly influenced by the gas dynamics.

J. -F. Becquaert; F. Combes

1997-04-10T23:59:59.000Z

229

Geometry of the Motion of Ideal Fluids and Rigid Bodies  

E-Print Network [OSTI]

Arnold pointed out that the Euler equation of incompressible ideal hydrodynamics describes geodesics on the group of volume-preserving diffeomorphisms. A simple analogue is the Euler equation for a rigid body, which is the geodesic equation on the rotation group with respect to a metric determined by the moment of inertia. The metric on the group is left-invariant but not right-invariant. We will reduce the geometry of such groups (using techniques popularized by Milnor) to algebra on their tangent space. In particular, the curvature can be expressed as a biquadratic form on the Lie algebra. Arnold's result that motion of incompressible fluids has instabilities (due to the sectional curvature being negative) can be recovered more simply. Surprisingly, such an instability arises in rigid body mechanics as well: the metric on SO(3) corresponding to the moment of inertia of a thin cylinder (coin) has negative sectional curvature in one tangent plane. Both ideal fluids and rigid bodies can be thought of as hamiltonian systems with a quadratic hamiltonian, but whose Poisson brackets are those of a non-nilpotent Lie algebra. We will also describe a different point of view towards three dimensional incompressible flow in terms of the Clebsch parametrization. In this picture, the Poisson brackets are represented canonically. The hamiltonian is represented by a quartic function. This is meant mainly as an expository article, aimed at a mathematical audience familiar with physics. Based on Lectures at the Chennai Mathematical Institute and the University of Connecticut.

S. G. Rajeev

2009-05-31T23:59:59.000Z

230

Collision Geometry and Flow in Uranium+Uranium Collisions  

E-Print Network [OSTI]

Using event-by-event viscous fluid dynamics to evolve fluctuating initial density profiles from the Monte-Carlo Glauber model for U+U collisions, we report a "knee"-like structure in the elliptic flow as a function of collision centrality, located near 0.5% centrality as measured by the final charged multiplicity. This knee is due to the preferential selection of tip-on-tip collision geometries by a high-multiplicity trigger. Such a knee structure is not seen in the STAR data. This rules out the two-component MC-Glauber model for initial energy and entropy production. An enrichment of tip-tip configurations by triggering solely on high-multiplicity in the U+U collisions thus does not work. On the other hand, using the Zero Degree Calorimeters (ZDCs) coupled with event-shape engineering, we identify the selection purity of body-body and tip-tip events in the full-overlap U+U collisions. With additional constraints on the asymmetry of the ZDC signals one can further increases the probability of selecting tip-tip events in U+U collisions.

Andy Goldschmidt; Zhi Qiu; Chun Shen; Ulrich Heinz

2015-02-02T23:59:59.000Z

231

Collision Geometry and Flow in Uranium+Uranium Collisions  

E-Print Network [OSTI]

Using event-by-event viscous fluid dynamics to evolve fluctuating initial density profiles from the Monte-Carlo Glauber model for U+U collisions, we report a "knee"-like structure in the elliptic flow as a function of collision centrality, located near 0.5% centrality as measured by the final charged multiplicity. This knee is due to the preferential selection of tip-on-tip collision geometries by a high-multiplicity trigger. Such a knee structure is not seen in the STAR data. This rules out the two-component MC-Glauber model for initial energy and entropy production. An enrichment of tip-tip configurations by triggering solely on high-multiplicity in the U+U collisions thus does not work. On the other hand, using the Zero Degree Calorimeters (ZDCs) coupled with event-shape engineering, we identify the selection purity of body-body and tip-tip events in the full-overlap U+U collisions. With additional constraints on the asymmetry of the ZDC signals one can further increases the probability of selecting tip-ti...

Goldschmidt, Andy; Shen, Chun; Heinz, Ulrich

2015-01-01T23:59:59.000Z

232

$?$-Ray Pulsars: Emission Zones and Viewing Geometries, A Computer Animation  

E-Print Network [OSTI]

The computer animation illustrates the geometries described in a paper by the same authors. The preprint is available as number 9401045. The opening scene shows dipole field lines emanating from the polar caps of a rotating neutron star. The dipole axis is inclined along the green rods. The field lines shown are defined from the condition that they be tangent to the light cylinder (the cylindrical radius at which the tangential velocity of rotation reaches the speed of light). The static dipole field lines are smoothly morphed into the correct retarted-potential vacuum solutions. A red surface spanning these field lines is painted. In the next scene the blue surfaces represent the outer gaps above the surface of last closed field lines. High energy emission (blue) is produced in these outer gaps, and is beamed tangentially along the field lines. The radio emission (green) originates close to the surface of the star and is beamed along the dipole axes. The inclination angle $\\alpha$ of the dipole and the viewing angle $\\zeta$ are chosen to match the Crab parameters; $\\alpha$ = 70, $\\zeta$ = 65. The corresponding light curve is computed and shown for these angles, and the red dot traces rotation phase. The next scene shows the situation for angles appropriate to PSR1706-44; $\\alpha$ = 45, $\\zeta$ = 65. The final scene is a possibility for Geminga; $\\alpha$ = 20, $\\zeta$ = 75. These angles are poorly constrained as there is no radio emission.

I. -A. Yadigaroglu; Roger W. Romani

1994-06-08T23:59:59.000Z

233

acid acetic acid: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of asphaltene deposition that occurs during acid treatments of oil reservoirs. Asphaltenes are present to some degree in most hydrocarbons. Due to the molecular weight of the...

234

Acidic gas capture by diamines  

DOE Patents [OSTI]

Compositions and methods related to the removal of acidic gas. In particular, the present disclosure relates to a composition and method for the removal of acidic gas from a gas mixture using a solvent comprising a diamine (e.g., piperazine) and carbon dioxide. One example of a method may involve a method for removing acidic gas comprising contacting a gas mixture having an acidic gas with a solvent, wherein the solvent comprises piperazine in an amount of from about 4 to about 20 moles/kg of water, and carbon dioxide in an amount of from about 0.3 to about 0.9 moles per mole of piperazine.

Rochelle, Gary (Austin, TX); Hilliard, Marcus (Missouri City, TX)

2011-05-10T23:59:59.000Z

235

Carbonic Acid Pretreatment of Biomass  

SciTech Connect (OSTI)

This project sought to address six objectives, outlined below. The objectives were met through the completion of ten tasks. 1) Solidify the theoretical understanding of the binary CO2/H2O system at reaction temperatures and pressures. The thermodynamics of pH prediction have been improved to include a more rigorous treatment of non-ideal gas phases. However it was found that experimental attempts to confirm theoretical pH predictions were still off by a factor of about 1.8 pH units. Arrhenius experiments were carried out and the activation energy for carbonic acid appears to be substantially similar to sulfuric acid. Titration experiments have not yet confirmed or quantified the buffering or acid suppression effects of carbonic acid on biomass. 2) Modify the carbonic acid pretreatment severity function to include the effect of endogenous acid formation and carbonate buffering, if necessary. It was found that the existing severity functions serve adequately to account for endogenous acid production and carbonate effects. 3) Quantify the production of soluble carbohydrates at different reaction conditions and severity. Results show that carbonic acid has little effect on increasing soluble carbohydrate concentrations for pretreated aspen wood, compared to pretreatment with water alone. This appears to be connected to the release of endogenous acids by the substrate. A less acidic substrate such as corn stover would derive benefit from the use of carbonic acid. 4) Quantify the production of microbial inhibitors at selected reaction conditions and severity. It was found that the release of inhibitors was correlated to reaction severity and that carbonic acid did not appear to increase or decrease inhibition compared to pretreatment with water alone. 5) Assess the reactivity to enzymatic hydrolysis of material pretreated at selected reaction conditions and severity. Enzymatic hydrolysis rates increased with severity, but no advantage was detected for the use of carbonic acid compared to water alone. 6) Determine optimal conditions for carbonic acid pretreatment of aspen wood. Optimal severities appeared to be in the mid range tested. ASPEN-Plus modeling and economic analysis of the process indicate that the process could be cost competitive with sulfuric acid if the concentration of solids in the pretreatment is maintained very high (~50%). Lower solids concentrations result in larger reactors that become expensive to construct for high pressure applications.

G. Peter van Walsum; Kemantha Jayawardhana; Damon Yourchisin; Robert McWilliams; Vanessa Castleberry

2003-05-31T23:59:59.000Z

236

Comparison of Three Cre-LoxP Based Paired-End Library Construction Methods  

SciTech Connect (OSTI)

Paired-end library sequencing has been proven useful in scaffold construction during de novo whole genome shotgun assembly. The ability of generating mate pairs with > 8 Kb insert sizes is especially important for genomes containing long repeats. To make mate paired libraries for next generation sequencing, DNA fragments need to be circularized to bring the ends together. There are several methods that can be used for DNA circulation, namely ligation, hybridization and Cre-LoxP recombination. With higher circularization efficiency with large insert DNA fragments, Cre-LoxP recombination method generally has been used for constructing >8 kb insert size paired-end libraries. Second fragmentation step is also crucial for maintaining high library complexity and uniform genome coverage. Here we will describe the following three fragmentation methods: restriction enzyme digestion, random shearing and nick translation. We will present the comparison results for these three methods. Our data showed that all three methods are able to generate paired-end libraries with greater than 20 kb insert. Advantages and disadvantages of these three methods will be discussed as well.

Peng, Ze; Nath, Nandita; Tritt, Andrew; Liang, Shoudan; Han, James; Pennacchio, Len; Chen, Feng

2013-03-26T23:59:59.000Z

237

Microuidic device reads up to four consecutive base pairs in DNA sequencing-by-synthesis  

E-Print Network [OSTI]

connected through tygon tubing (Cole-Parmer, Vernon Hills, IL) to Lee-valve arrays (Fluidigm Corp., South

Quake, Stephen R.

238

TABASCO: A single molecule, base-pair resolved gene expression simulator  

E-Print Network [OSTI]

Background Experimental studies of gene expression have identified some of the individual molecular components and elementary reactions that comprise and control cellular behavior. Given our current understanding of gene ...

Kosuri, Sriram

239

Fracturing pressures and near-well fracture geometry of arbitrarily oriented and horizontal wells  

SciTech Connect (OSTI)

The hydraulic fracturing of arbitrarily oriented and horizontal wells is made challenging by the far more complicated near-well fracture geometry compared to that of conventional vertical wells. This geometry is important both for hydraulic fracture propagation and the subsequent post-treatment well performance. Fracture tortuosity of arbitrarily oriented and horizontal wells is likely to cause large initiation pressures and reduction in the fracture widths. This paper presents a comprehensive study of the effects of important variables, including the principal stresses, wellbore orientation, and perforation configuration on fracture geometry. Initiation pressures, the contact between arbitrarily oriented wells and the fracture plane, and the near-well fracture geometry are determined and discussed. This study also shows that because of the near-well stress concentration the fracture width at the wellbore is always smaller than the maximum fracture width. This can have important consequences during hydraulic fracturing.

Chen, Z.; Economides, M.J.

1995-12-31T23:59:59.000Z

240

Scattering of Dirac Fermions in Barrier Geometries on the Surface of Topological Insulators  

E-Print Network [OSTI]

Scattering of Dirac Fermions in Barrier Geometries on the Surface of Topological Insulators Lindsay Fleischer 1 Introduction Predicted theoretically and discovered experimentally, the topological insulators topological in- sulators and the trivial insulating vacuum have wavefunctions which are not smoothly

Torquato, Salvatore

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

TR 2006/002 ISSN 0874-338X GeoThms -Geometry Framework  

E-Print Network [OSTI]

& Montenegro Centre for Informatics and Systems of the University of Coimbra #12;GeoThms - Geometry Framework 11000 Belgrade, SERBIA & MONTENEGRO e-mail: janicic@matf.bg.ac.yu April 24, 2006 1 This work

Almeida, Pedro Quaresma de

242

Variable impedance energy dissipation on the micro-scale : field responsive fluids in novel geometries  

E-Print Network [OSTI]

The aim of this thesis was to further characterize the effectiveness of field responsive fluids (FRFs) in geometries pertinent to the soldier and to examine the effects of specific geometric and kinematic parameters, ...

Griffin, Ryan A

2006-01-01T23:59:59.000Z

243

Power Electronics Design Implications of Novel Photovoltaic Collector Geometries and Their Application for Increased Energy Harvest  

E-Print Network [OSTI]

of energy scavenging scenarios in which either total energy harvested needs to be maximized or unusual geometries for the PV active surfaces are required, including building-integrated PV. This thesis develops the analysis of the potential energy harvest...

Karavadi, Amulya

2011-10-21T23:59:59.000Z

244

The applicability and accuracy of computer modeling in regards to acoustical scattering by a complex geometry  

E-Print Network [OSTI]

The intent of the investigation is to try to characterize the nature of scattered acoustical energy off of the face of a concrete masonry unit with an atypical geometry. The nature of the tests conducted would be in ...

Elliot, William J., S.B. Massachusetts Institute of Technology

2005-01-01T23:59:59.000Z

245

E-Print Network 3.0 - arbitrary microvascular geometries Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

on the cell free layer and Summary: -759. Udaykumar, H.S., Kan, H.C., Shyy, W., Tran-Son-Tay, R., 1997. Multiphase dynamics in arbitrary geometries... and cow- orkers (Pozrikidis,...

246

Geometry and temperature dependent thermal conductivity of diamond nanowires: A non-equilibrium molecular dynamics study  

E-Print Network [OSTI]

plasma etching of polycrystalline diamond films [7], microwave plasma assisted chemical vapor deposition. For theoretical calculations of proper- ties of nanosized diamond materials, polycrystalline diamond thin filmsGeometry and temperature dependent thermal conductivity of diamond nanowires: A non

Melnik, Roderick

247

SEGMENTING CROSSING FIBER GEOMETRIES USING FLUID MECHANICS TENSOR DISTRIBUTION FUNCTION TRACTOGRAPHY  

E-Print Network [OSTI]

SEGMENTING CROSSING FIBER GEOMETRIES USING FLUID MECHANICS TENSOR DISTRIBUTION FUNCTION introduce a fluid mechanics based tractography method that estimates the most likely connection path between using fluid mechanics based tractography has demonstrated superior performance vs. other competing

Thompson, Paul

248

Higher order global differentiability local approximations for 2-D and 3-D distorted element geometries  

E-Print Network [OSTI]

The primary focus of this thesis is to present a framework to develop higher order global differentiability local approximations for 2-D and 3-D distorted element geometries. The necessity and superiority of higher order global differentiability...

Maduri, Rajesh Kumar

2008-02-01T23:59:59.000Z

249

Simulation and visualization of fields and energy flows in electric circuits with idealized geometries  

E-Print Network [OSTI]

This thesis develops a method to simulate and visualize the fields and energy flows in electric circuits, using a simplified physical model based on an idealized geometry. The physical models combine and extend previously ...

Ohannessian, Mesrob I., 1981-

2005-01-01T23:59:59.000Z

250

On the fundamental length of quantum geometry and the black hole entropy  

E-Print Network [OSTI]

The geometric operators of area, volume, and length, depend on a fundamental length l of quantum geometry which is a priori arbitrary rather than equal to the Planck length l_P. The fundamental length l and the Immirzi parameter $\\gamma$ determine each other. With any l the entropy formula is rendered most naturally in units of the length gap sqrt{{sqrt 3}/2} (sqrt{gamma} l). Independently of the choice of l, the black hole entropy derived from quantum geometry in the limit of classical geometry is completely consistent with the Bekenstein-Hawking form. The extremal limit of 1-puncture states of the quantum surface geometry corresponds rather to an extremal string than to a classical horizon.

M. Rainer

1999-05-17T23:59:59.000Z

251

Math 125 Calculus and Analytic Geometry II Winter 2008 Instructor Amites Sarkar  

E-Print Network [OSTI]

Math 125 Calculus and Analytic Geometry II Winter 2008 Instructor Amites Sarkar Text Calculus and Fridays, in 216 Bond Hall. My phone number is 650 7569 and my e-mail is amites.sarkar@wwu.edu #12;

Sarkar, Amites

252

Math 224 Multivariable Calculus and Analytic Geometry I Winter 2013 Instructor Amites Sarkar  

E-Print Network [OSTI]

Math 224 Multivariable Calculus and Analytic Geometry I Winter 2013 Instructor Amites Sarkar Text phone number is 650 7569 and my e-mail is amites.sarkar@wwu.edu #12;Course Objectives The successful

Sarkar, Amites

253

Math 125 Calculus and Analytic Geometry II Fall 2010 Instructor Dr. Amites Sarkar  

E-Print Network [OSTI]

Math 125 Calculus and Analytic Geometry II Fall 2010 Instructor Dr. Amites Sarkar Text Calculus, in 216 Bond Hall. My phone number is 650 7569 and my e-mail is amites.sarkar@wwu.edu #12;Course

Sarkar, Amites

254

Math 224 Multivariable Calculus and Analytic Geometry I Winter 2014 Instructor Amites Sarkar  

E-Print Network [OSTI]

Math 224 Multivariable Calculus and Analytic Geometry I Winter 2014 Instructor Amites Sarkar Text is 650 7569 and my e-mail is amites.sarkar@wwu.edu #12;Course Objectives The successful student

Sarkar, Amites

255

Math 224 Multivariable Calculus and Analytic Geometry I Spring 2014 Instructor Amites Sarkar  

E-Print Network [OSTI]

Math 224 Multivariable Calculus and Analytic Geometry I Spring 2014 Instructor Amites Sarkar Text-mail is amites.sarkar@wwu.edu #12;Course Objectives The successful student will demonstrate: 1. Understanding of

Sarkar, Amites

256

Math 124 Calculus and Analytic Geometry I Fall 2007 Instructor Amites Sarkar  

E-Print Network [OSTI]

Math 124 Calculus and Analytic Geometry I Fall 2007 Instructor Amites Sarkar Text Calculus: Single phone number is 650 7569 and my e-mail is amites.sarkar@wwu.edu #12;

Sarkar, Amites

257

Math 125 Calculus and Analytic Geometry II Spring 2010 Instructor Amites Sarkar  

E-Print Network [OSTI]

Math 125 Calculus and Analytic Geometry II Spring 2010 Instructor Amites Sarkar Text Calculus phone number is 650 7569 and my e-mail is amites.sarkar@wwu.edu #12;Course objectives The successful

Sarkar, Amites

258

Math 125 Calculus and Analytic Geometry II Fall 2009 Instructor Amites Sarkar  

E-Print Network [OSTI]

Math 125 Calculus and Analytic Geometry II Fall 2009 Instructor Amites Sarkar Text Calculus: Single-mail is amites.sarkar@wwu.edu #12;Course objectives The successful student will demonstrate: 1. Understanding

Sarkar, Amites

259

Math 225 Multivariable Calculus and Analytic Geometry II Spring 2012 Instructor Amites Sarkar  

E-Print Network [OSTI]

Math 225 Multivariable Calculus and Analytic Geometry II Spring 2012 Instructor Amites Sarkar Text, in 216 Bond Hall. My phone number is 650 7569 and my e-mail is amites.sarkar@wwu.edu #12;Course

Sarkar, Amites

260

Supersymmetry and noncommutative geometry Part III: The noncommutative supersymmetric Standard Model  

E-Print Network [OSTI]

In a previous paper we developed a formalism to construct (potentially) supersymmetric theories in the context of noncommutative geometry. We apply this formalism to explore the existence of a noncommutative version of the minimal supersymmetric Standard Model (MSSM). We obtain the exact particle content of the MSSM and identify (in form) its interactions but conclude that their coefficients are such that the standard action functional used in noncommutative geometry is in fact not supersymmetric.

Wim Beenakker; Walter D. van Suijlekom; Thijs van den Broek

2014-09-21T23:59:59.000Z

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

Geometry dependence of crack growth resistance curves in thin sheet aluminum alloys  

E-Print Network [OSTI]

GEOMETRY DEPENDENCE OF CRACK GROWTH RESISTANCE CURVES IN THIN SHEET ALUMINUM ALLOYS A Thesis by LANCE LEE STRICKLIN Submitted to the Office of Graduate Studies of Texas ASM University in partial fulfillment of the requirement for the degree... of MASTER OF SCIENCE December 1988 Major Subject: Mechanical Engineering GEOMETRY DEPENDENCE OF CRACK GROWTH RESISTANCE CURVES IN THIN SHEET ALUMINUM ALLOYS A Thesis by LANCE LEE STRICKLIN Approved as to style and content by: Ted L. Anderson...

Stricklin, Lance Lee

1988-01-01T23:59:59.000Z

262

Resonance and fractal geometry Johann Bernoulli Institute for Mathematics and Computer Science  

E-Print Network [OSTI]

;Devil's staircase -0.6 -0.4 -0.2 0 0.2 0.4 0.6 -0.4 -0.2 0 0.2 0.4 rotation number mean rotationResonance and fractal geometry Henk Broer Johann Bernoulli Institute for Mathematics and Computer space non-resonance fractal geometry Cantor set, topologically small (nowhere dense) positive Lebesgue

Broer, H.W.

263

Transverse electrokinetic and microfluidic effects in micro-patterned channels: lubrication analysis for slab geometries  

E-Print Network [OSTI]

Off-diagonal (transverse) effects in micro-patterned geometries are predicted and analyzed within the general frame of linear response theory, relating applied presure gradient and electric field to flow and electric current. These effects could contribute to the design of pumps, mixers or flow detectors. Shape and charge density modulations are proposed as a means to obtain sizeable transverse effects, as demonstrated by focusing on simple geometries and using the lubrication approximation.

Armand Ajdari

2001-01-29T23:59:59.000Z

264

Geometry of hydrogen bonds formed by lipid bilayer nitroxide probes : A high frequency pulsed ENDOR/EPR study.  

SciTech Connect (OSTI)

Solvent effects on magnetic parameters of nitroxide spin labels in combination with side-directed spin-labeling EPR methods provide very useful means for elucidating polarity profiles in lipid bilayers and mapping local electrostatic effects in complex biomolecular systems. One major contributor to these solvent effects is the hydrogen bonds that could be formed between the nitroxide moiety and water and/or the available hydroxyl groups. Here, formation of hydrogen bonds between a lipid bilayer spin probe 5-doxyl stearic acid, 5DSA and hydrogen-bond donors has been studied using high-frequency (HF) pulsed ENDOR and EPR. A hydrogen-bonded deuteron was directly detected in HF ENDOR (130 GHz) spectra of 5DSA dissolved in several deuterated alcohols, while the characteristic signal was absent in nonpolar toluene-d{sub 8}. The length of the hydrogen bond, 1.74 {+-} 0.06 {angstrom}, and its geometry were found to be essentially the same for all four alcohols studied, indicating that nearly identical hydrogen bonds have been formed regardless of the solvent dielectric constant. This strengthens a hypothesis that HF EPR spectra are exclusively sensitive to formation of hydrogen bonds and could be used for probing the hydrogen-bond network in complex biomolecular assemblies and lipid bilayers with site-directed spin-labeling methods.

Smirnova, T. I.; Smirnov, A. I.; Pachtchenko, S.; Poluektov, O. G.; Chemistry; North Carolina State Univ.

2007-01-01T23:59:59.000Z

265

Metabolism of Thioctic Acid in Algae  

E-Print Network [OSTI]

METABOLISM OF THlOCTlC ACID IN ALGAE TWO-WEEK LOAN COPY ThisMETABOLISM OF THIOCTIC ACID IN ALGAE Hans Grisebach, R. , C.METABOLISM OF THIOCTIC ACID IN ALGAE Hans Grisebach, R. C.

Grisebach, Hans; Fuller, R.C.; Calvin, M.

1956-01-01T23:59:59.000Z

266

Solvent extraction of inorganic acids  

E-Print Network [OSTI]

the solution by a sim?. le process that is economically =ttrsctlve is of con- sider. ble interest~ Dilute "olution; of hydrochloric, nitric and sul- furic acid d; occur in many processes either alone or toga- th: r . 'he use of li. , uid-li~uid extraction...~~ram for hexyl c~rbitol- water-nitric acid 17 ~ Distribution die, r m for hoxl'' ca:-bitol- watcr-sulfur'c acid Table 1. . 'xperimental d ta of amyl alcohol-water-!!Cl Pa, e 33 2. Experimental data of isoamyl alcohol-water- HC1 34 3 ~ Cxperimental data...

Ysrael, Miguel Curie

1965-01-01T23:59:59.000Z

267

Naphthenic acid corrosion literature survey  

SciTech Connect (OSTI)

Naphthenic acid corrosion is a growing concern for refineries processing crudes containing high levels of naphthenic acid. Due to this concern initiatives in place to better understand the mechanism of corrosion for mitigating the corrosion. During the 1996 Fall Corrosion Group, organized existing literature relevant to the literature search. Committee Week, NACE International many refineries have and evaluate methods T-8 Refining Industry a task group, T-8-22, to perform a review and compilation of naphthenic acid corrosion. This paper provides a summary of the literature research.

Babaian-Kibala, E. [Nalco/Exxon Energy Chemicals, Sugar Land, TX (United States); Nugent, M.J. [Tosco Refining Co., Linden, NJ (United States)

1999-11-01T23:59:59.000Z

268

acetic acid solutions: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

In the present study, bonding among formic, acetic and benzoic acids, sulfuric acid, ammonia, acetic, and benzoic acids with free and hydrated sulfuric acid has been...

269

arachidonic acid activation: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

In the present study, bonding among formic, acetic and benzoic acids, sulfuric acid, ammonia, acetic, and benzoic acids with free and hydrated sulfuric acid has been...

270

acid inertness studies: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

In the present study, bonding among formic, acetic and benzoic acids, sulfuric acid, ammonia, acetic, and benzoic acids with free and hydrated sulfuric acid has been...

271

acid activated montmorillonite: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

In the present study, bonding among formic, acetic and benzoic acids, sulfuric acid, ammonia, acetic, and benzoic acids with free and hydrated sulfuric acid has been...

272

acid amide hydrolase: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

In the present study, bonding among formic, acetic and benzoic acids, sulfuric acid, ammonia, acetic, and benzoic acids with free and hydrated sulfuric acid has been studied....

273

acid chelation phototherapeutic: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

In the present study, bonding among formic, acetic and benzoic acids, sulfuric acid, ammonia, acetic, and benzoic acids with free and hydrated sulfuric acid has been...

274

acid phosphatase activity: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

In the present study, bonding among formic, acetic and benzoic acids, sulfuric acid, ammonia, acetic, and benzoic acids with free and hydrated sulfuric acid has been...

275

acetic acid solution: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

In the present study, bonding among formic, acetic and benzoic acids, sulfuric acid, ammonia, acetic, and benzoic acids with free and hydrated sulfuric acid has been...

276

acetic acid operational: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

In the present study, bonding among formic, acetic and benzoic acids, sulfuric acid, ammonia, acetic, and benzoic acids with free and hydrated sulfuric acid has been...

277

acid phosphatase activities: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

In the present study, bonding among formic, acetic and benzoic acids, sulfuric acid, ammonia, acetic, and benzoic acids with free and hydrated sulfuric acid has been...

278

acid sphingomyelinase activity: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

In the present study, bonding among formic, acetic and benzoic acids, sulfuric acid, ammonia, acetic, and benzoic acids with free and hydrated sulfuric acid has been...

279

acids decreases fibrinolysis: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

In the present study, bonding among formic, acetic and benzoic acids, sulfuric acid, ammonia, acetic, and benzoic acids with free and hydrated sulfuric acid has been...

280

arachidonic acid activates: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

In the present study, bonding among formic, acetic and benzoic acids, sulfuric acid, ammonia, acetic, and benzoic acids with free and hydrated sulfuric acid has been...

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

acid decarboxylase activity: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

In the present study, bonding among formic, acetic and benzoic acids, sulfuric acid, ammonia, acetic, and benzoic acids with free and hydrated sulfuric acid has been...

282

acid activates nrf2: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

In the present study, bonding among formic, acetic and benzoic acids, sulfuric acid, ammonia, acetic, and benzoic acids with free and hydrated sulfuric acid has been...

283

acid processing activity: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

In the present study, bonding among formic, acetic and benzoic acids, sulfuric acid, ammonia, acetic, and benzoic acids with free and hydrated sulfuric acid has been...

284

ascorbic acid enhances: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

In the present study, bonding among formic, acetic and benzoic acids, sulfuric acid, ammonia, acetic, and benzoic acids with free and hydrated sulfuric acid has been...

285

acid cupric chloride: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

In the present study, bonding among formic, acetic and benzoic acids, sulfuric acid, ammonia, acetic, and benzoic acids with free and hydrated sulfuric acid has been...

286

In vivo incorporation of unnatural amino acids  

DOE Patents [OSTI]

The invention provides methods and compositions for in vivo incorporation of unnatural amino acids. Also provided are compositions including proteins with unnatural amino acids.

Schultz, Peter G. (La Jolla, CA); Wang, Lei (San Diego, CA); Anderson, John Christopher (San Diego, CA); Chin, Jason W. (Cambridge, GB); Liu, David R. (Lexington, MA); Magliery, Thomas J. (North Haven, CT); Meggers, Eric L. (Philadelphia, PA); Mehl, Ryan Aaron (Lancaster, PA); Pastrnak, Miro (San Diego, CA); Santoro, Stephen William (Cambridge, MA); Zhang, Zhiwen (San Diego, CA)

2012-05-08T23:59:59.000Z

287

Carbonic Acid Shows Promise in Geology, Biology  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

The Surprising Secrets of Carbonic Acid Probing the Surprising Secrets of Carbonic Acid Berkeley Lab Study Holds Implications for Geological and Biological Processes October 23,...

288

Mineralogical transformations controlling acid mine drainage...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Mineralogical transformations controlling acid mine drainage chemistry. Mineralogical transformations controlling acid mine drainage chemistry. Abstract: The role of Fe(III)...

289

Seasonalepisodic control of acid deposition  

E-Print Network [OSTI]

This report contains the climatological, technical and economic factors for episodic and seasonal control of emissions in existing power plants. Analyzing a large data set of acid deposition for the years 1982-85, we find ...

Fay, James A.

1988-01-01T23:59:59.000Z

290

Asphaltene damage in matrix acidizing  

E-Print Network [OSTI]

This work addresses the problem of asphaltene deposition that occurs during acid treatments of oil reservoirs. Asphaltenes are present to some degree in most hydrocarbons. Due to the molecular weight of the components these asphaltenes are more...

Hinojosa, Roberto Antonio

2012-06-07T23:59:59.000Z

291

Controlling acid rain : policy issues  

E-Print Network [OSTI]

The policy and regulatory ramifications of U.S. acid rain control programs are examined; particularly, the alternative of a receptor-oriented strategy as constrasted to emission-oriented proposals (e.g., the Mitchell bill) ...

Fay, James A.

1983-01-01T23:59:59.000Z

292

Nitrate and Prussic Acid Poisoning  

E-Print Network [OSTI]

Nitrate and prussic acid poisoning in cattle are noninfectious conditions that can kill livestock. This publication explains the causes and symptoms of these conditions as well as preventive measures and sampling and testing steps....

Stichler, Charles; Reagor, John C.

2001-09-05T23:59:59.000Z

293

Factors controlling naphthenic acid corrosion  

SciTech Connect (OSTI)

A laboratory study was conducted to elucidate the influence of chemical and physical parameters on corrosion of type 1018 carbon steel (CS, UNS G10180) and 5% Cr-0.5% Mo steel in oils containing naphthenic acids (NAs) for application to crude oil refinery systems. Effects of test duration, temperature, and acid concentration were assessed for a range of single acids of varying carbon numbers and for NA mixtures in mineral oil (MO) and in heavy vacuum gas oil (HGVO). In addition, a limited study of the effect of hydrogen sulfide (H{sub 2}S) addition to the acid-oil mixture was conducted. Use of the total acid number (TAN) as a measure of corrosiveness of a crude oil was discredited further. For the same TAN value, molecular size and structure of the acid were shown to have an important influence. Tests conducted in HGVO showed lower corrosion rates than in MO, suggesting inhibition caused by S species in the oil or the steric hindrance of naphtheno-aromatic acids. In oil containing the mixture of NAs, the corrosion rate of type 1018 CS was lower than that for 5% Cr-0.5% Mo steel. The 0.1% H{sub 2}S that passed through the acid-oil mixtures had an inhibiting effect on corrosion. Predicting corrosiveness of a crude oil from the measurement of TAN, distribution of NA composition, and S content and form was particularly challenging. The simple tests used were informative, but further work will be required to establish a standard test method that can provide an adequate ranking of crudes.

Turnbull, A. [National Physical Lab., Teddington (United Kingdom); Slavcheva, E. [Bulgarian Academy of Sciences, Sofia (Bulgaria); Shone, B. [Ty Isa, Nr Mold (United Kingdom)

1998-11-01T23:59:59.000Z

294

Dynamics of laser-blow-off induced Li plume in confined geometry  

SciTech Connect (OSTI)

Dynamics of Li plasma plume created by laser-blow-off technique in air ambient is reported. Plasma plume dynamics and its optical emission are investigated in planar and confined geometries using time resolved shadowgraph imaging and optical emission spectroscopy. Significant differences in the plasma characteristics in confined geometry are quantitatively investigated by comparing the plasma parameters (temperature and density) in free expansion and confined geometry configurations. Dynamics and physical parameters of the primary as well as the reflected shock waves (in confined geometry) and their interactions with expanding plasma are briefly addressed. A large enhancement in the emission intensities of Li I 610.3 nm (2p {sup 2}P{sub 1/2,3/2}? 3d {sup 2}P{sub 3/2,5/2}) and 670.8 nm (2s {sup 2}S{sub 1/2}? 2p {sup 2}P{sub 1/2,3/2}) is correlated with the shock wave dynamics in the two geometries. Strong self reversal in the neutral emission infers an increase in the population density of neutrals within the confined plasma plume.

Kumar, Bhupesh; Singh, R K; Kumar, Ajai [Institute for Plasma Research, Bhat, Gandhinagar-382 428 (India)] [Institute for Plasma Research, Bhat, Gandhinagar-382 428 (India)

2013-08-15T23:59:59.000Z

295

Acid sorption regeneration process using carbon dioxide  

DOE Patents [OSTI]

Carboxylic acids are sorbed from aqueous feedstocks onto a solid adsorbent in the presence of carbon dioxide under pressure. The acids are freed from the sorbent phase by a suitable regeneration method, one of which is treating them with an organic alkylamine solution thus forming an alkylamine-carboxylic acid complex which thermally decomposes to the desired carboxylic acid and the alkylamine.

King, C. Judson (Kensington, CA); Husson, Scott M. (Anderson, SC)

2001-01-01T23:59:59.000Z

296

Succinic acid production by Anaerobiospirillum succiniciproducens  

E-Print Network [OSTI]

, succinic acid has been produced commercially by chemical processes. Recently, however, fermentative of bacteria produce succinic acid as a fermentation end product,4 7 few species can produce it as the major 10 Previous studies showed that A. succiniciproducens produces succinic acid and acetic acid

297

Role of colliding geometry on the balance energy of mass-asymmetric systems  

E-Print Network [OSTI]

We study the role of colliding geometry on the balance energy (Ebal) of mass-asymmetric systems by varying the mass asymmetry ({\\eta} = AT - Ap/AT + AP, where AT and AP are the masses of the target and projectile, respectively) from 0.1 to 0.7, over the mass range 40-240 and on the mass dependence of the balance energy. Our findings reveal that colliding geometry has a significant effect on the Ebal of asymmetric systems. We find that, as we go from central collisions to peripheral ones, the effect of mass asymmetry on Ebal increases throughout the mass range. Interestingly, we find that for every fixed system mass (Atot) the effect of the impact parameter variation is almost uniform throughout the mass-asymmetry range. For each {\\eta}, Ebal follows a power-law behavior (\\propto A{\\tau}) at all colliding geometries

Supriya Goyal

2011-04-16T23:59:59.000Z

298

Final Report for the grant "Applied Geometry" (DOE DE-FG02-04ER25657)  

SciTech Connect (OSTI)

The primary purpose of this 3-year DOE-funded research effort, now completed, was to develop consistent, theoretical foundations of computations on discrete geometry, to realize the promise of predictive and scalable management of large geometric datasets as handled routinely in applied sciences. Geometry (be it simple 3D shapes or higher dimensional manifolds) is indeed a central and challenging issue from the modeling and computational perspective in several sciences such as mechanics, biology, molecular dynamics, geophysics, as well as engineering. From digital maps of our world, virtual car crash simulation, predictive animation of carbon nano-tubes, to trajectory design of space missions, knowing how to process and animate digital geometry is key in many cross-disciplinary research areas.

Prof. Mathieu Desbrun

2009-05-20T23:59:59.000Z

299

The impact of magnetic geometry on wave modes in cylindrical plasmas  

E-Print Network [OSTI]

Both space and laboratory plasmas can be associated with static magnetic field, and the field geometry varies from uniform to non-uniform. This thesis investigates the impact of magnetic geometry on wave modes in cylindrical plasmas. The cylindrical configuration is chosen so as to explore this impact in a tractable but experimentally realisable configuration. Three magnetic geometries are considered: uniform, focused and rippled. These studies suggest suppressing drift waves in a uniformly magnetised plasma by increasing the field strength, enhancing the efficiency of helicon wave production of plasma by using a focused magnetic field, and forming a gap eigenmode on a linear plasma device by introducing a local defect to the system's periodicity, which is useful for understanding the gap-mode formation and interaction with energetic particles in fusion plasmas.

Chang, Lei

2015-01-01T23:59:59.000Z

300

Analysis of the Effect of Geometry Generated Turbulence on HCCI Combustion by Multi-Zone Modeling  

SciTech Connect (OSTI)

This paper illustrates the applicability of a sequential fluid mechanics, multi-zone chemical kinetics model to analyze HCCI experimental data for two combustion chamber geometries with different levels of turbulence: a low turbulence disc geometry (flat top piston), and a high turbulence square geometry (piston with a square bowl). The model uses a fluid mechanics code to determine temperature histories in the engine as a function of crank angle. These temperature histories are then fed into a chemical kinetic solver, which determines combustion characteristics for a relatively small number of zones (40). The model makes the assumption that there is no direct linking between turbulence and combustion. The results show that the multi-zone model yields good results for both the disc and the square geometries. The model makes good predictions of pressure traces and heat release rates. The experimental results indicate that the high turbulence square geometry has longer burn duration than the low turbulence disc geometry. This difference can be explained by the sequential multi-zone model, which indicates that the cylinder with the square bowl has a thicker boundary layer that results in a broader temperature distribution. This broader temperature distribution tends to lengthen the combustion, as cold mass within the cylinder takes longer to reach ignition temperature when compressed by the expansion of the first burned gases. The multi-zone model, which makes the basic assumption that HCCI combustion is controlled by chemical kinetics, is therefore capable of explaining the experimental results obtained for different levels of turbulence, without considering a direct interaction between turbulence and combustion. A direct connection between turbulence and HCCI combustion may still exists, but it seems to play a relatively minor role in determining burn duration at the conditions analyzed in this paper.

Aceves, S M; Flowers, D L; Martinez-Frias, J; Espinosa-Loza, F; Christensen, M; Johansson, B; Hessel, R P

2004-12-13T23:59:59.000Z

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

Geometry Effects on Multipole Components and Beam Optics in High-Velocity Multi-Spoke Cavities  

SciTech Connect (OSTI)

Velocity-of-light, multi-spoke cavities are being proposed to accelerate electrons in a compact light-source. There are strict requirements on the beam quality which require that the linac have only small non-uniformities in the accelerating field. Beam dynamics simulations have uncovered varying levels of focusing and defocusing in the proposed cavities, which is dependent on the geometry of the spoke in the vicinity of the beam path. Here we present results for the influence different spoke geometries have on the multipole components of the accelerating field and how these components, in turn, impact the simulated beam properties.

Hopper, Christopher S. [ODU, JLAB; Deitrick, Kirsten E. [ODU, JLAB; Delayen, Jean R. [ODU, JLAB

2013-12-01T23:59:59.000Z

302

Role of colliding geometry on the N/Z dependence of balance energy  

E-Print Network [OSTI]

We study the role of colliding geometry on the N/Z dependence of balance energy using isospin-dependent quantum molecular dynamics model. Our study reveals that the N/Z dependence of balance energy becomes much steeper for peripheral collisions as compared to the central collisions. We also study the effect of system mass on the impact parameter dependence of N/Z dependence of balance energy. The study shows that lighter systems shows greater sensitivity to colliding geometry towards the N/Z dependence.

Sakshi Gautam; Aman D. Sood; Rajeev K. Puri

2011-08-01T23:59:59.000Z

303

Method for production of petroselinic acid and OMEGA12 hexadecanoic acid in transgenic plants  

DOE Patents [OSTI]

The present invention relates to a process for producing lipids containing the fatty acid petroselinic acid in plants. The production of petroselinic acid is accomplished by genetically transforming plants which do not normally accumulate petroselinic acid with a gene for a .omega.12 desaturase from another species which does normally accumulate petroselinic acid.

Ohlrogge, John B. (Okemos, MI); Cahoon, Edgar B. (Lansing, MI); Shanklin, John (Upton, NY); Somerville, Christopher R. (Okemos, MI)

1995-01-01T23:59:59.000Z

304

Method for production of petroselinic acid and OMEGA12 hexadecanoic acid in transgenic plants  

DOE Patents [OSTI]

The present invention relates to a process for producing lipids containing the fatty acid, petroselinic acid, in plants. The production of petroselinic acid is accomplished by genetically transforming plants which do not normally accumulate petroselinic acid with a gene for a {omega}12 desaturase from another species which does normally accumulate petroselinic acid. 19 figs.

Ohlrogge, J.B.; Cahoon, E.B.; Shanklin, J.; Somerville, C.R.

1995-07-04T23:59:59.000Z

305

New syntheses of aminoalkylphosphonic acids  

E-Print Network [OSTI]

NEW SYNTHESES OF AMINOALKYLPHOSPHON1C ACIDS A Thesis by John Frederick DeBardeleben, Jr. Su'bmitted to the Graduate School of the Agricultural and Mechanical College of Texas in partial fulfillment of the requirements for the degree of MASTER... OF SCIENCE August 196$ Major Subject: Chemistry NEW SYNTHESES OF AMINOALKYLPHOSPHONIC ACIDS A Thesis BY John Frederick DeBardeleben, Jr. Approved as to style and content hy: (Chairman of Committee) iJ C wc+'. A-c-~-' & (Head of Department...

DeBardeleben, John Frederick

2012-06-07T23:59:59.000Z

306

Bone density and geometry in juvenile racehorses fed differing amounts of minerals  

E-Print Network [OSTI]

designed as low, moderate, moderately high and high. Radiographs of the third metacarpal (MCIII) were taken on day 0, 28, 60, 92 and 124 to evaluate change in bone density and bone geometry. Bone density was expressed as radiographic bone aluminum...

Nolan, Meghan Muire

2002-01-01T23:59:59.000Z

307

Non-Commutative Geometry in Higher Dimensional Quantum Hall Effect as A-Class Topological Insulator  

E-Print Network [OSTI]

We clarify relations between the higher dimensional quantum Hall effect and A-class topological insulator. In particular, we elucidate physical implications of the higher dimensional non-commutative geometry in the context of A-class topological insulator. This presentation is based on arXiv:1403.5066.

Kazuki Hasebe

2014-08-04T23:59:59.000Z

308

USE OF VARIOUS DEVICE GEOMETRIES TO IMPROVE THE PERFORMANCE OF CdTe DETECTORS (*)  

E-Print Network [OSTI]

343 USE OF VARIOUS DEVICE GEOMETRIES TO IMPROVE THE PERFORMANCE OF CdTe DETECTORS (*) K. ZANIO. - The most direct method of increasing the resolution of CdTe gamma ray and x-ray detectors is to increase of Environmental and Biomedical Research. doped CdTe. Devices do not polarize as those having blocking contacts

Paris-Sud XI, Université de

309

AN OBATA-TYPE THEOREM IN CR GEOMETRY SONG-YING LI AND XIAODONG WANG  

E-Print Network [OSTI]

AN OBATA-TYPE THEOREM IN CR GEOMETRY SONG-YING LI AND XIAODONG WANG Abstract. We discuss a sharp. 1 #12;2 SONG-YING LI AND XIAODONG WANG the proof of the Bochner formula in [G]. Due to this error

Wang, Xiaodong

310

A kinematic wave model for rivers with flood plains and other irregular geometries  

E-Print Network [OSTI]

A kinematic wave model for rivers with flood plains and other irregular geometries Pablo M. Jacovkis Esteban G. Tabak March 2006 Abstract A general kinematic wave model for flood propagation) This kinematic wave equation, which has been studied by [3], can be derived from the complete system (1, 2) under

Tabak, Esteban G.

311

Synthetic fabrication strategy optimizes the illumination geometry and transport properties of dye-sensitized solar cells.  

E-Print Network [OSTI]

solar cells. Using oriented titanium oxide (TiO2 ) nanotube (NT) arrays has shown promise for dye- sensitized solar cells (DSSCs). High solar conversion efficiency requires that the incident light entersSynthetic fabrication strategy optimizes the illumination geometry and transport properties of dye-sensitized

312

Turbulent Flow Analysis and Coherent Structure Identification in Experimental Models with Complex Geometries  

E-Print Network [OSTI]

through the core of an annular pebble bed VHTR. The complex geometry of the core and the highly turbulent nature of the coolant flow passing through the gaps of fuel pebbles make this case quite challenging. In this experiment, a high frequency Hot Wire...

Amini, Noushin

2012-02-14T23:59:59.000Z

313

Vector Geometry Mapping 1 Job: Vogel 2 689-8 (MiMB) Operator: Sean Murdock  

E-Print Network [OSTI]

24 Vector Geometry Mapping: A Method to Characterize the Conformation of Helix-Loop-Helix Calcium Members of the EF-hand protein superfamily (1) share a common calcium- binding helix-loop-helix motif 44 45 46 47 48 49 50 51 52 53 54 1 From: Methods in Molecular Biology, vol. 173: Calcium

Ikura, Mitsuhiko

314

Computational Geometry On The OTIS-Mesh Optoelectronic Computer Chih-fang Wang Sartaj Sahni  

E-Print Network [OSTI]

Computational Geometry On The OTIS-Mesh Optoelectronic Computer Chih-fang Wang Sartaj Sahni: optoelectronic computer, OTIS- Mesh, convex hull, smallest enclosing box, ECDF, two-set dominance, maximal points within the group. The OTIS-Mesh optoelectronic computer is a class of OTIS computers in which

Sahni, Sartaj K.

315

PPPL-3134 -Preprint: August 1995 Optimal geometry for neutral-beam-based  

E-Print Network [OSTI]

issue for neutral-beam-based optical diagnostics in tokamak plasmas, such as charge of these diagnostics near the magnetic axis of the plasma, where peak values of ion temperature and toroidal rotation1 PPPL-3134 - Preprint: August 1995 Optimal geometry for neutral-beam-based optical diagnostics

316

Compact fluorescent lamp using horizontal and vertical insulating septums and convective venting geometry  

DOE Patents [OSTI]

A novel design is described for a compact fluorescent lamp, including a lamp geometry which will increase light output and efficacy of the lamp in a base down operating position by providing horizontal and vertical insulating septums positioned in the ballast compartment of the lamp to provide a cooler coldspot. Selective convective venting provides additional cooling of the ballast compartment. 9 figs.

Siminovitch, M.

1998-02-10T23:59:59.000Z

317

Jet-like circulations occur in the `simple' geometries of gas planets and Earth's  

E-Print Network [OSTI]

#12;Jet-like circulations occur in the `simple' geometries of gas planets and Earth's liquid stratification and boundary topography are both essential elements in structuring energy-containing eddies-slope waveguide) in a model basin, here driven by a compact cooling region at high latitude (Hallberg & Rhines JPO

318

The Geometry of Intersecting Tubes Applied to Controlling a Robotic Welding Torch  

E-Print Network [OSTI]

The Geometry of Intersecting Tubes Applied to Controlling a Robotic Welding Torch John M. Stockie Abstract: The question of how to control a robotic welding torch to trace the joint between two cylindrical that increase its applicability to more advanced mathematics courses. Keywords: pipe welding, cylinders

Stockie, John

319

Measuring the Influence of Grain-Boundary Misorientation on Thermal Groove Geometry in Ceramic Polycrystals  

E-Print Network [OSTI]

Measuring the Influence of Grain-Boundary Misorientation on Thermal Groove Geometry in Ceramic. The width and depth of the thermal grooves formed by these same grain bound- aries were also measured of the grain-boundary misorientation and thermal groove ge- ometry leads to the observation that grain

Rohrer, Gregory S.

320

AN APPROACH FOR INTERSUBJECT ANALYSIS OF 3D BRAIN IMAGES BASED ON CONFORMAL GEOMETRY  

E-Print Network [OSTI]

AN APPROACH FOR INTERSUBJECT ANALYSIS OF 3D BRAIN IMAGES BASED ON CONFORMAL GEOMETRY Guangyu Zou Emission Tomography (PET) and Diffusion Tensor Imaging (DTI) have accelerated brain research in many aspects. In order to better understand the synergy of the many processes involved in normal brain function

Hua, Jing

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

A PRIMER ON RIEMANNIAN GEOMETRY AND STOCHASTIC ANALYSIS ON PATH SPACES  

E-Print Network [OSTI]

A PRIMER ON RIEMANNIAN GEOMETRY AND STOCHASTIC ANALYSIS ON PATH SPACES BRUCE K. DRIVER Abstract for the first lecture which was held at University of Zürich. Contents 1. Summary of ETH talk contents 2 2 of California, San Diego . La Jolla, CA 92093-0112 . 1 #12;2 BRUCE K. DRIVER 5.1. Tangent spaces and Riemannian

Driver, Bruce

322

Materials Science and Engineering B 108 (2004) 241252 Cathode and interdigitated air distributor geometry optimization  

E-Print Network [OSTI]

geometry optimization in polymer electrolyte membrane (PEM) fuel cells M. Grujicic, C.L. Zhao, K of the optimal PEM fuel cell design. The results of the optimization analysis show that higher current densities electrolyte membrane (PEM) fuel cells; Design; Optimization; Robustness 1. Introduction Due to their potential

Grujicic, Mica

323

Pschl-Teller Hamiltonian: Gazeau-Klauder type coherent states, related statistics and geometry  

E-Print Network [OSTI]

This work mainly addresses a construction of Gazeau-Klauder type coherent states for a P\\"oschl-Teller model. Relevant characteristics are investigated. Induced geometry and statistics are studied. Then the Berezin - Klauder - Toeplitz quantization of the classical phase space observables is presented.

Mahouton Norbert Hounkonnou; Sama Arjika; Ezinvi Balotcha

2014-03-27T23:59:59.000Z

324

Scroll waves in spherical shell geometries Francisco Chavez and Raymond Kapral  

E-Print Network [OSTI]

Scroll waves in spherical shell geometries Francisco Cha´vez and Raymond Kapral Chemical Physics Received 25 April 2001; accepted 21 July 2001; published 4 October 2001 The evolution of scroll waves. The motion of scroll wave filaments that are the locii of phaseless points in the medium and organize

Glass, Leon

325

Curved carbon nanotubes: From unique geometries to novel properties and peculiar applications  

E-Print Network [OSTI]

Curved carbon nanotubes: From unique geometries to novel properties and peculiar applications Incorporating pentagons and heptagons into the hexagonal networks of pristine carbon nanotubes (CNTs) can form are discussed. 1 Introduction The discovery of carbon nanotubes (CNTs) can be considered a prominent landmark

Simons, Jack

326

Constraints on backstop geometry of the southwest Ryukyu subduction based on reection seismic data  

E-Print Network [OSTI]

Constraints on backstop geometry of the southwest Ryukyu subduction based on re¯ection seismic data 1999; revised 10 May 2000 Abstract Based on the analysis of 45 seismic re¯ection pro®les, the top from the frontal part (southernmost extremity) of the Ryukyu margin. From seismic re¯ection pro®les, we

Demouchy, Sylvie

327

Learning 3D Object Templates by Hierarchical Quantization of Geometry and Appearance Spaces  

E-Print Network [OSTI]

Learning 3D Object Templates by Hierarchical Quantization of Geometry and Appearance Spaces Wenze for learning 3D object tem- plates from view labeled object images. The 3D template is defined in a joint-sampled discrete space. Using information gain as a criterion, the best 3D template can be searched through the AND

Zhu, Song Chun

328

Coupled Effects of Mechanics, Geometry, and Chemistry on Bio-membrane Behavior  

E-Print Network [OSTI]

build and analyze complete models to understand the behavior of multi-component membranes. We proposeCoupled Effects of Mechanics, Geometry, and Chemistry on Bio-membrane Behavior Thesis by Ha Giang, and encouragement. #12;iv Abstract Lipid bilayer membranes are models for cell membranesthe structure that helps

Winfree, Erik

329

Building Part-based Object Detectors via 3D Geometry Abhinav Shrivastava Abhinav Gupta  

E-Print Network [OSTI]

Building Part-based Object Detectors via 3D Geometry Abhinav Shrivastava Abhinav Gupta The Robotics on heuristics such as high gradient energy. This part- based model is trained discriminatively; however, learning this model is a complex task as it involves optimization of a non-convex function over a set

Treuille, Adrien

330

High Resolution Sharp Computational Methods for Elliptic and Parabolic Problems in Complex Geometries  

E-Print Network [OSTI]

High Resolution Sharp Computational Methods for Elliptic and Parabolic Problems in Complex Geometries Frdric Gibou Chohong Min Ron Fedkiw November 2, 2012 In honor of Stan Osher's 70th birthday of chemical species (see [48] and the references therein); they are also core building blocks in fields

Fedkiw, Ron

331

Scale and geometry effects on heat-recirculating combustors Chien-Hua Chen*  

E-Print Network [OSTI]

Scale and geometry effects on heat-recirculating combustors Chien-Hua Chen* and Paul D. Ronney effects on heat-recirculating combustors A simple analysis of linear and spiral counterflow heat-recirculating combustors was conducted to identify the dimensionless parameters expected to quantify the performance

332

Helena Berekov, ass. prof. RNDr., PhD. Department of Algebra, Geometry and Didactics of Mathematics  

E-Print Network [OSTI]

Helena Bereková, ass. prof. RNDr., PhD. Department of Algebra, Geometry and Didactics of the Theory of Embodiment, elements of the Theory of Didactical Situations and history. The chapter 1 of some context. The methodology, which the author used, was derived mainly from the Theory of Didactical

Spagnolo, Filippo

333

Generating and Rendering Four-Dimensional Polytopes John M. Sullivan, Geometry Supercomputer Project  

E-Print Network [OSTI]

Generating and Rendering Four-Dimensional Polytopes John M. Sullivan, Geometry Supercomputer, and can be rendered in three dimensions in stereographic projection. In this article we construct one with Mathematica graphics, or with a more sophisticated renderer such as RenderMan. Regular Polytopes and Soap

Sullivan, John M.

334

ON THE INFLUENCE OF THE GEOMETRY ON SKIN EFFECT IN ELECTROMAGNETISM  

E-Print Network [OSTI]

ON THE INFLUENCE OF THE GEOMETRY ON SKIN EFFECT IN ELECTROMAGNETISM GABRIEL CALOZ, MONIQUE DAUGE, ERWAN FAOU, VICTOR P´ERON ABSTRACT. We consider the equations of electromagnetism set on a domain made in electromagnetism. This effect describes the rapid decay of electromagnetic fields with depth inside a metallic

Dauge, Monique

335

arXiv:condmat/0002194 Geometry, Statistics and Asymptotics of Quantum Pumps  

E-Print Network [OSTI]

arXiv:cond­mat/0002194 v2 31 May 2000 Geometry, Statistics and Asymptotics of Quantum Pumps J. E¨uttiker et. al. (BPT) relating the adiabatically pumped current to the S matrix and its (time) derivatives. We relate the charge in BPT to Berry's phase and the corresponding Brouwer pumping formula

336

Geometry and Nanolength Scales versus Interface Interactions: Water Dynamics in AOT Lamellar Structures and  

E-Print Network [OSTI]

occur in the water structure and dynamics. At the same time, MD simulations have shown that the mostGeometry and Nanolength Scales versus Interface Interactions: Water Dynamics in AOT Lamellar Structures and Reverse Micelles David E. Moilanen, Emily E. Fenn, Daryl Wong, and M. D. Fayer* Department

Fayer, Michael D.

337

Combined effects of prepulsing and target geometry on efficient extreme ultraviolet  

E-Print Network [OSTI]

and the deposition of EUV and out of band radiation can fur- ther cause surface erosion and damage at the required targets geometries with special grooves as developed previously by the authors. C 2011 Society of Photo-Optical. Damage of multilayer Mo/Si mirrors by the de- bris products of laser beam interaction with target

Harilal, S. S.

338

Acoustically driven cavitation cluster collapse in planar geometry Ivan van der Kroon,1  

E-Print Network [OSTI]

the dynamics of arrays of transient cavitation bubbles exposed to a sound field in a planar geometry. Single with a digital hologram and focusing it into a thin gap of liquid. The liquid is driven with an oscillating with high-speed photography with a two-dimensional Rayleigh model. For multibubble configura- tions we

Ohl, Claus-Dieter

339

Breakdown characteristics in n&planar geometries and hollow cathode pseudospark switches  

E-Print Network [OSTI]

's law, whose scaling parameter is pd (gas pressure x electrode separation). In nonplanar geometries, Paschen's law is not directly applicable due to the ambiguity in the distance between the electrodes in helium (0.1 to a few Torr, voltages of tens of kV, effective electrode separation of a few mm

Kushner, Mark

340

Geometry Aware Direction Field Processing Nicolas Ray, Bruno Vallet, Laurent Alonso and Bruno Levy  

E-Print Network [OSTI]

. Extrapolating and smoothing such fields is usually performed by minimizing an energy composed of a smoothness.7 [Computer Graphics]: Three-Dimensional Graphics and Realism-- Color, shading, shadowing, and texture; I.3.5 [Computer Graphics]: Computational Geometry and Object Mod- eling; G.1.6 [Numerical Analysis]: Optimization

Frey, Pascal

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Effect of Nozzle Geometry on Jet Noise Reduction Using Fan Flow Deflectors  

E-Print Network [OSTI]

or sideforce p = pressure q = dynamic pressure S = wedge wetted area u = mean velocity in jet plume U = nozzleEffect of Nozzle Geometry on Jet Noise Reduction Using Fan Flow Deflectors Dimitri Papamoschou of baseline nozzle shape on the ability of fan flow deflectors to reduce downward-emitted turbulent mixing

Papamoschou, Dimitri

342

Long time evolution of train dynamics with respect to track geometry  

E-Print Network [OSTI]

Long time evolution of train dynamics with respect to track geometry N. Lestoillea,b , C. Soizea to maintain a high level of safety and comfort in the high speed trains. We propose a computational stochastic experimental data basis. The nonlinear stochastic dynamics of the train excited by track irregularities

Paris-Sud XI, Université de

343

amine-nitro hydrogen-bond geometry: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

amine-nitro hydrogen-bond geometry First Page Previous Page 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Next Page Last Page Topic Index 1 A new...

344

On bicycle tire tracks geometry, hatchet planimeter, Menzin's conjecture and oscillation  

E-Print Network [OSTI]

On bicycle tire tracks geometry, hatchet planimeter, Menzin's conjecture and oscillation of unicycle tracks Mark Levi and Serge Tabachnikov April 13, 2008 Abstract The model of a bicycle is a unit wheel is fixed on the bicycle frame); the same model describes the hatchet planimeter. The trajectory

Tabachnikov, Sergei

345

Acid Catalysis in Modern Organic  

E-Print Network [OSTI]

catalyst for organic synthesis". That is the starting sentence of this book by Yamamoto and Ishihara, which follows their earlier book "Lewis Acids in Organic Synthesis (2000)", and covers the new developments book that should be available in every well-equipped chemistry library. It will certainly be helpful

Snyder, Scott A.

346

HYDROFLUORIC ACID FIRST AID INSTRUCTIONS  

E-Print Network [OSTI]

with large amounts of cool running water. Immediately washing off the acid is of primary importance. 2.Remove Immediately flush eyes for at least 15 minutes with copious cool flowing water. 2 If only one eye is affected by a glass of milk or milk of magnesia. 3 Call 911 for immediate medical assistance. REMEMBER, ALL PERSONNEL

Jalali. Bahram

347

E-Print Network 3.0 - acid acetylsalicylic acid Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Acids are kept in storage cabinets under the fume hood... in the plastic box. 3. Place filters in hood, add 50% (approximate concentration) HCl acid (Fisher, certified ACS......

348

E-Print Network 3.0 - acid methoxyacetic acid Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Acids are kept in storage cabinets under the fume hood... in the plastic box. 3. Place filters in hood, add 50% (approximate concentration) HCl acid (Fisher, certified ACS......

349

E-Print Network 3.0 - acidic alpha-amino acids Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Acids are kept in storage cabinets under the fume hood... in the plastic box. 3. Place filters in hood, add 50% (approximate concentration) HCl acid (Fisher, certified ACS......

350

E-Print Network 3.0 - acid sorbic acid Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Acids are kept in storage cabinets under the fume hood... in the plastic box. 3. Place filters in hood, add 50% (approximate concentration) HCl acid (Fisher, certified ACS......

351

E-Print Network 3.0 - acid dichloroacetic acid Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Acids are kept in storage cabinets under the fume hood... in the plastic box. 3. Place filters in hood, add 50% (approximate concentration) HCl acid (Fisher, certified ACS......

352

E-Print Network 3.0 - acid n-glycolylneuraminic acid Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Acids are kept in storage cabinets under the fume hood... in the plastic box. 3. Place filters in hood, add 50% (approximate concentration) HCl acid (Fisher, certified ACS......

353

E-Print Network 3.0 - acids organic acids Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

in the decomposition of organic material, is the primary source of acidity in unpolluted rainwater. NOTE: Parts per... A ACID RAIN Audrey Gibson ATOC 3500 Thursday, April ......

354

E-Print Network 3.0 - acid propionic acid Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by Explorit Topic List Advanced Search Sample search results for: acid propionic acid Page: << < 1 2 3 4 5 > >> 1 Biodegradation 9: 463473, 1998. 1998 Kluwer Academic...

355

E-Print Network 3.0 - acid linoleic acid Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

FAs (linolenic, linoleic) - - monounsaturated FAs (oleic acid) - olive, canola - hydrogenation... Biol 458 Lecture 6 & 7 Fatty Acids 1 A. Introduction to acyl lipids...

356

Particle image velocimetry measurements in complex geometries L. M. Hopkins, J. T. Kelly, A. S. Wexler, A. K. Prasad  

E-Print Network [OSTI]

Particle image velocimetry measurements in complex geometries L. M. Hopkins, J. T. Kelly, A. S as $100 per model. Currently, rapid prototyping cannot be directly employed to build PIV-compatible models a technique by which replicate models of arbitrary geometry, suitable for ow diagnostics with PIV, can

Prasad, Ajay K.

357

Modeling of Acid Fracturing in Carbonate Reservoirs  

E-Print Network [OSTI]

The acid fracturing process is a thermal, hydraulic, mechanical, and geochemical (THMG)-coupled phenomena in which the behavior of these variables are interrelated. To model the flow behavior of an acid into a fracture, mass and momentum balance...

Al Jawad, Murtada s

2014-06-05T23:59:59.000Z

358

acidization: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 7 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

359

Fuel cell electrolyte membrane with acidic polymer  

DOE Patents [OSTI]

An electrolyte membrane is formed by an acidic polymer and a low-volatility acid that is fluorinated, substantially free of basic groups, and is either oligomeric or non-polymeric.

Hamrock, Steven J. (Stillwater, MN); Larson, James M. (Saint Paul, MN); Pham, Phat T. (Little Canada, MN); Frey, Matthew H. (Cottage Grove, MN); Haugen, Gregory M. (Edina, MN); Lamanna, William M. (Stillwater, MN)

2009-04-14T23:59:59.000Z

360

Recovery of mercury from acid waste residues  

DOE Patents [OSTI]

Mercury can be recovered from nitric acid-containing fluids by reacting the fluid with aluminum metal to produce mercury metal, and thence quenching the reactivity of the nitric acid prior to nitration of the mercury metal. 1 fig.

Greenhalgh, W.O.

1987-02-27T23:59:59.000Z

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Recovery of mercury from acid waste residues  

DOE Patents [OSTI]

Mercury can be recovered from nitric acid-containing fluids by reacting the fluid with aluminum metal to produce mercury metal, and then quenching the reactivity of the nitric acid prior to nitration of the mercury metal.

Greenhalgh, Wilbur O. (Richland, WA)

1989-01-01T23:59:59.000Z

362

amino acid intake: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

protein intake (PDI) and net portal appearance rate of amino acids by continuous infusion of para-aminohippuric acid via the mesenteric catheter. The amino-acid appearance...

363

Reactions Between Water Soluble Organic Acids and Nitrates in...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Reactions Between Water Soluble Organic Acids and Nitrates in Atmospheric Aerosols: Recycling of Nitric Acid and Formation of Reactions Between Water Soluble Organic Acids and...

364

acid synthase impacts: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

acid utilization and glucose oxidation. Glucose... Adhikari, Sean 2006-10-30 246 ANTIBODY PURIFICATION USING CAPRYLIC ACID In mildly acidic conditions, the addition of short-chain...

365

Unnatural reactive amino acid genetic code additions  

DOE Patents [OSTI]

This invention provides compositions and methods for producing translational components that expand the number of genetically encoded amino acids in eukaryotic cells. The components include orthogonal tRNAs, orthogonal aminoacyl-tRNA synthetases, orthogonal pairs of tRNAs/synthetases and unnatural amino acids. Proteins and methods of producing proteins with unnatural amino acids in eukaryotic cells are also provided.

Deiters, Alexander; Cropp, T. Ashton; Chin, Jason W.; Anderson, J. Christopher; Schultz, Peter G.

2014-08-26T23:59:59.000Z

366

Organic Acid Production by Filamentous Fungi  

E-Print Network [OSTI]

-being. Indeed, organic acid fermentations are often not even identified as fungal bioprocesses, having been Aspergillus niger in aerated stirred-tank-reactors can convert glucose to citric acid with greater than 80 lipolytica, and related yeast species, may be in use commercially to produce citric acid (Lopez-Garcia, 2002

367

Unnatural reactive amino acid genetic code additions  

DOE Patents [OSTI]

This invention provides compositions and methods for producing translational components that expand the number of genetically encoded amino acids in eukaryotic cells. The components include orthogonal tRNAs, orthogonal aminoacyl-tRNAsyn-thetases, pairs of tRNAs/synthetases and unnatural amino acids. Proteins and methods of producing proteins with unnatural amino acids in eukaryotic cells are also provided.

Deiters, Alexander (La Jolla, CA); Cropp, T. Ashton (Bethesda, MD); Chin, Jason W. (Cambridge, GB); Anderson, J. Christopher (San Francisco, CA); Schultz, Peter G. (La Jolla, CA)

2011-08-09T23:59:59.000Z

368

Unnatural reactive amino acid genetic code additions  

DOE Patents [OSTI]

This invention provides compositions and methods for producing translational components that expand the number of genetically encoded amino acids in eukaryotic cells. The components include orthogonal tRNAs, orthogonal aminoacyl-tRNA synthetases, pairs of tRNAs/synthetases and unnatural amino acids. Proteins and methods of producing proteins with unnatural amino acids in eukaryotic cells are also provided.

Deiters, Alexander; Cropp, Ashton T; Chin, Jason W; Anderson, Christopher J; Schultz, Peter G

2013-05-21T23:59:59.000Z

369

Synthesis of an acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters  

DOE Patents [OSTI]

A process is disclosed for preparing an acid addition salt of delta-aminolevulinic acid comprising. The process involves dissolving a lower alkyl 5-bromolevulinate and an alkali metal diformylamide in an organic solvent selected from the group consisting of acetonitrile, methanol, tetrahydrofuran, 2-methyltetrahydrofuran and methylformate or mixtures to form a suspension of an alkyl 5-(N,N-diformylamino) levulinate ester; and hydrolyzing the alkyl 5-(N,N-diformylamino) levulinate with an inorganic acid to form an acid addition salt of delta-amino levulinic acid.

Moens, L.

1999-05-25T23:59:59.000Z

370

Synthesis of an acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters  

DOE Patents [OSTI]

A process of preparing an acid addition salt of delta-aminolevulinic acid comprising: dissolving a lower alkyl 5-bromolevulinate and an alkali metal diformylamide in an organic solvent selected from the group consisting of acetonitrile, methanol, tetrahydrofuran, 2-methyltetrahydrofuran and methylformate or mixtures thereof to form a suspension of an alkyl 5-(N,N-diformylamino) levulinate ester; and hydrolyzing said alkyl 5-(N,N-diformylamino) levulinate with an inorganic acid to form an acid addition salt of delta-amino levulinic acid.

Moens, Luc (Lakewood, CO)

1999-01-01T23:59:59.000Z

371

ARM - Lesson Plans: Acid Rain  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsruc Documentation RUC : XDCResearch Related InformationAcid Rain Outreach Home Room News

372

Thermal Stability Of Formohydroxamic Acid  

SciTech Connect (OSTI)

The thermal stability of formohydroxamic acid (FHA) was evaluated to address the potential for exothermic decomposition during storage and its use in the uranium extraction process. Accelerating rate calorimetry showed rapid decomposition at a temperature above 65 {degree}?C; although, the rate of pressure rise was greater than two orders of magnitude less than the lower bound for materials which have no explosive properties with respect to transportation. FHA solutions in water and nitric acid did not reach runaway conditions until 150 {degree}?C. Analysis by differential scanning calorimetry showed that FHA melted at 67 {degree}?C and thermally decomposed at 90 {degree}?C with an enthalpy of -1924 J/g. The energics of the FHA thermal decomposition are comparable to those measured for aqueous solutions of hydroxylamine nitrate. Solid FHA should be stored in a location where the temperature does not exceed 20-25 {degree}?C. As a best practice, the solid material should be stored in a climate-controlled environment such as a refrigerator or freezer. FHA solutions in water are not susceptible to degradation by acid hydrolysis and are the preferred way to handle FHA prior to use.

Fondeur, F. F.; Rudisill, T. S.

2011-10-21T23:59:59.000Z

373

CHAPTER 13. ACID RAIN Acid rain was discovered in the 19th century by Robert Angus  

E-Print Network [OSTI]

247 CHAPTER 13. ACID RAIN Acid rain was discovered in the 19th century by Robert Angus Smith, a pharmacist from Manchester (England), who measured high levels of acidity in rain falling over industrial decline of fish populations in the lakes of southern Norway and traced the problem to acid rain. Similar

Jacob, Daniel J.

374

Fate of Acids in Clouds 1. Combination with bases dissolved in clouds: acids neutralized  

E-Print Network [OSTI]

problems. E#11;ects of Acid Rain 1. Vegetation: SO 2 is toxic to plants #15; Leaves damaged below pH 3 rain { Athens and Rome cathedrals and statues: pollution leads to acid rain #15; SteelFate of Acids in Clouds 1. Combination with bases dissolved in clouds: acids neutralized NH 3 (g

Schofield, Jeremy

375

Condensed Geometry  

E-Print Network [OSTI]

A spin (dependent) system treatment of gravity is adopted akin to the Sen-Ashtekar treatment. Time is reinserted into the space ``fluid'' at the quantum Level. This time - the Lorentzian one- is shown to be a vorticity of a ``fluid particle'' of the space and the effect is integrated over all the fluid particles to incorporate time in quantum gravity. This spacetime is viewed as a fluid of future light cones called the SU(2) dipoles of causality here in the paper.The future light cone structure is soldered internally to the new variables derived in this paper to accomodate a background free physics of quantum strings. The emergence of spacetime is shown to be a first order phase transition and that of separation of gravity from the unified field to be a second order phase transition. For the former case the cosmic time is chosen as the order parameter and for the latter case the angular momentum is chosen as the order parameter. A quantum blackhole thus nucleates at transition temperature which is the Planck temperature, $\\tau_{pl}$. Then the SU(2) dipoles enable interpretation of this black hole as a gravity gauge SL(2,$\\mathbb{C}$) dual of the U(1) gauge ferromagnetic phase. The usual QFT interpretation of this effect is the existence of locally Lorentzian spacetimes.

Koustubh Kabe

2010-02-10T23:59:59.000Z

376

Electromagnetic Geometry  

E-Print Network [OSTI]

We show that Maxwell's electromagnetism can be mapped into the Born-Infeld theory in a curved space-time, which depends only on the electromagnetic field in a specific way. This map is valid for any value of the two lorentz invariants $F$ and $G$ confirming that we have included all possible solutions of Maxwell's equations. Our result seems to show that specifying the dynamics and the space-time structure of a given theory can be viewed merely as a choice of representation to describe the physical system.

M. Novello; F. T. Falciano; E. Goulart

2011-11-08T23:59:59.000Z

377

Radioiodinated fatty acid analogs for myocardial imaging  

SciTech Connect (OSTI)

Fatty acids are the preferred substrate for the normoxic heart. About sixty percent of the energy required by the myocardium is provided by fatty acid [beta]-oxidation. Many scientists have focused on the alterations in fatty acid metabolism in the ischemic heart for the development of radiolabelled fatty acids for functional imaging of the heart. Three main categories of compounds were synthesized: tetrazoles (1 and 2), glycidic and [alpha]-methylene acids (3-5), and analogs of oleic acid (6,7 and 7A). The tetrazole group has a similar pKa and size to that of a carboxyl group; however, such fatty acid analogs cannot undergo normal fatty acid metabolism. Glycidic and [alpha]-methylene analogs are potential irreversible inhibitors of fatty acid metabolism. Oleic acid analogs were investigated to assess the affect of stereochemical consequences on biodistribution. The key intermediates in the synthesis of the target compounds were [omega]-nitrophenyl alkylcarboxylic acids and alcohols, which were made using a variety of cross-coupling reactions. The Wittig reaction, which was used in the synthesis of tetrazole 1 and glycidic acid 3, gave low yields of the cross-coupled products. The remaining target compounds were synthesized by condensation of appropriate RCu (CN) ZnI and substituted benzyl bromides or by Pd[sup II] catalyzed cross-coupling of substituted arylhalides with suitable alkynes. The latter two reactions produced much higher yields of the desired products. All of the target compounds were radiolabeled with [sup 125]I by various Cu(I) catalyzed radioiodine exchange procedures and were then subjected to tissue biodistribution (TD) studies in rats. Except for the 15-(4-iodophenyl)-2-methylene-pentadecanoic acid (5), all of the fatty acid analogs failed to surpass clinically-used 15-(4-iodophenyl)pentadecanoic acid (IPPA) in their ability to be taken up and retained by the rat myocardium.

Ruyan, M.K.

1993-01-01T23:59:59.000Z

378

The Non-Commutative Geometry of the Complex Classes of Topological Insulators  

E-Print Network [OSTI]

Alain Connes' Non-Commutative Geometry program [Connes 1994] has been recently carried out [Prodan, Leung, Bellissard 2013, Prodan, Schulz-Baldes 2014] for the entire A- and AIII-symmetry classes of topological insulators, in the regime of strong disorder where the insulating gap is completely filled with dense localized spectrum. This is a short overview of these results, whose goal is to highlight the methods of Non-Commutative Geometry involved in these studies. The exposition proceeds gradually through the cyclic cohomology, quantized calculus with Fredholm-modules, local formulas for the odd and even Chern characters and index theorems for the odd and even Chern numbers. The characterization of the A- and AIII-symmetry classes in the presence of strong disorder and magnetic fields emerges as a natural application of these tools.

Emil Prodan

2014-06-13T23:59:59.000Z

379

Results of the GAP-4 experiment on molten-fuel drainage through intersubassembly gap geometry. [LMFBR  

SciTech Connect (OSTI)

One of the key issues in assessment of the meltout phase of a hypothetical core disruptive accident in the LMFBR system involves the timing and paths for dispersal of molten fuel from the disrupted core. A program of experiments is underway at Argonne National Laboratory to investigate molten fuel penetration through these postulated escape paths. The purpose of the GAP-4 test was to examine the penetration distances of molten fuel flowing through the flat, narrow channels representing the intersubassembly gap geometry. In the experiment design, the gap geometry was selected to be two-dimensional on the basis that the gap volume in a reactor design would be interconnected and continuous. The molten fuel used in these tests was a mixture of UO/sub 2/ (81%) and molybdenum (19%) which was generated by an exothermic thermite reaction at a temperature of approx. 3470 K.

Spencer, B.W.; Vetter, D.; Wesel, R.; Sienicki, J.J.

1983-01-01T23:59:59.000Z

380

'AdS_5' Geometry Beyond Space-time and 4D Noncommutative Space-time  

E-Print Network [OSTI]

We discuss a 4D noncommutative space-time as suggested by the version of quantum (deformed) relativity which provides a classical geometry picture as an `AdS_5'. The 4D noncommutative space-time is more like a part of a phase space description, in accordance with the quantum notion -- quantum mechanics talks about only states but not configurations. The `AdS_5' picture also illustrates the classical 4D space-time is to be described as part of a bigger geometry beyond space-time at the quantum level. The radically new picture of quantum 'space-time' is expected to provide the basis for a (still to be formulated) new approach to quantum gravity with fundamental constants (quantum) hbar and Newton's constant G put at a similar level as c, the speed of light.

Otto C. W. Kong

2009-06-19T23:59:59.000Z

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

Simulating higher-dimensional geometries in GADRAS using approximate one-dimensional solutions.  

SciTech Connect (OSTI)

The Gamma Detector Response and Analysis Software (GADRAS) software package is capable of simulating the radiation transport physics for one-dimensional models. Spherical shells are naturally one-dimensional, and have been the focus of development and benchmarking. However, some objects are not spherical in shape, such as cylinders and boxes. These are not one-dimensional. Simulating the radiation transport in two or three dimensions is unattractive because of the extra computation time required. To maintain computational efficiency, higher-dimensional geometries require approximations to simulate them in one-dimension. This report summarizes the theory behind these approximations, tests the theory against other simulations, and compares the results to experimental data. Based on the results, it is recommended that GADRAS users always attempt to approximate reality using spherical shells. However, if fissile material is present, it is imperative that the shape of the one-dimensional model matches the fissile material, including the use of slab and cylinder geometry.

Thoreson, Gregory G.; Mitchell, Dean James; Harding, Lee T.

2013-02-01T23:59:59.000Z

382

Capacitative coupling of singlet-triplet qubits in different inter-qubit geometries  

E-Print Network [OSTI]

In the singlet-triplet qubit architecture, the two-qubit interactions required in universal quantum computing can be implemented by capacitative coupling, by exploiting the charge distribution differences of the singlet and triplet states. The efficiency of this scheme is limited by decoherence, that can be mitigated by stronger coupling between the qubits. In this paper, we study the capacitative coupling of singlet-triplet qubits in different geometries of the two-qubit system. The effects of the qubit-qubit distance and the relative orientation of the qubits on the capacitative coupling strength are discussed using an accurate microscopic model and exact diagonalization of it. We find that the trapezoidal quantum dot formations allow strong coupling with low charge distribution differences between the singlet and triplet states. The analysis of geometry on the capacitative coupling is also extended to the many-qubit case and the creation of cluster states.

Tuukka Hiltunen; Ari Harju

2014-04-22T23:59:59.000Z

383

Variable-geometry turbocharger with asymmetric divided volute for engine exhaust gas pulse optimization  

DOE Patents [OSTI]

A turbine assembly for a variable-geometry turbocharger includes a turbine housing defining a divided volute having first and second scrolls, wherein the first scroll has a substantially smaller volume than the second scroll. The first scroll feeds exhaust gas to a first portion of a turbine wheel upstream of the throat of the wheel, while the second scroll feeds gas to a second portion of the wheel at least part of which is downstream of the throat. Flow from the second scroll is regulated by a sliding piston. The first scroll can be optimized for low-flow conditions such that the turbocharger can operate effectively like a small fixed-geometry turbocharger when the piston is closed. The turbine housing defines an inlet that is divided by a dividing wall into two portions respectively feeding gas to the two scrolls, a leading edge of the dividing wall being downstream of the inlet mouth.

Serres, Nicolas (Epinal, FR)

2010-11-09T23:59:59.000Z

384

Zeeman tomography of magnetic white dwarfs, I. Reconstruction of the field geometry from synthetic spectra  

E-Print Network [OSTI]

We have computed optical Zeeman spectra of magnetic white dwarfs for field strengths between 10 and 200MG and effective temperatures between 8000 and 40000K. They form a database containing 20628 sets of flux and circular polarization spectra. A least-squares optimization code based on an evolutionary strategy can recover relatively complex magnetic field topologies from phase-resolved synthetic Zeeman spectra of rotating magnetic white dwarfs. We consider dipole and quadrupole components which are non-aligned and shifted off-centre. The model geometries include stars with a single high-field spot and with two spots separated by approx. 90 degrees. The accuracy of the recovered field structure increases with the signal-to-noise ratio of the input spectra and is significantly improved if circular polarization spectra are included in addition to flux spectra. We discuss the strategies proposed so far to unravel the field geometries of magnetic white dwarfs.

F. Euchner; S. Jordan; K. Beuermann; B. T. Gaensicke; F. V. Hessmann

2002-05-21T23:59:59.000Z

385

Two and Three-Qubits Geometry, Quaternionic and Octonionic Conformal maps, and Intertwining Hopf Fibration  

E-Print Network [OSTI]

In this paper the geometry of two and three-qubit states under local unitary groups is discussed. We first review the one qubit geometry and its relation with Riemanian sphere under the action of group $SU(2)$. We show that the second Hopf fiberation intertwines between local unitary group $SU(2)\\otimes SU(2)$ and quaternionic M\\"obius transformation. The invariant term appearing in this operation is related to concurrence measure. Yet, there exists the same intertwining Hopf map for much more global group $Sp(2)$, generalizing the familiar Bloch sphere in 2-level systems. Subsequently, we introduce third Hopf fiberation and octonionic conformal map (or octonionic M\\"obius maps) for three-qubit states and find evidence that they may have invariant terms under local unitary operations which shows that both maps have entanglement sensitive.

G. Najarbashi; B. Seifi; S. Mirzaei

2015-01-24T23:59:59.000Z

386

Optical reference geometry and inertial forces in Kerr-de Sitter spacetimes  

E-Print Network [OSTI]

Optical reference geometry and related concept of inertial forces are investigated in Kerr-de Sitter spacetimes. Properties of the inertial forces are summarized and their typical behaviour is illustrated. The intuitive 'Newtonian' application of the forces in the relativistic dynamics is demonstrated in the case of the test particle circular motion, static equilibrium positions and perfect fluid toroidal configurations. Features of the optical geometry are illustrated by the embedding diagrams of its equatorial plane. The embedding diagrams do not cover whole the stationary regions of the spacetimes, therefore the limits of embeddability are established. A shape of the embedding diagrams is related to the behaviour of the centrifugal force and it is characterized by the number of turning points of the diagrams. Discussion of the number of embeddable photon circular orbits is also included and the typical embedding diagrams are constructed. The Kerr-de Sitter spacetimes are classified according to the properties of the inertial forces and embedding diagrams.

Jiri Kovar; Zdenek Stuchlik

2007-01-03T23:59:59.000Z

387

Ray-tracing study of electron-cyclotron heating in toroidal geometry  

SciTech Connect (OSTI)

TORAY, a ray-tracing code has been developed to study electron-cyclotron heating and current drive in toroidal geometry. Ray patterns are initiated similar to those of an actual antenna and a full graphics package has been developed for displaying the behavior of the rays. We study the interplay of the plasma and wave parameters in order to establish which parameters are most important in determining the energy deposition.

Kritz, A.H.; Hsuan, H.; Goldfinger, R.C.; Batchelor, D.B.

1983-03-01T23:59:59.000Z

388

Teaching, Learning, and Modeling with Geometry in the Middle and High School  

E-Print Network [OSTI]

, such as Geometer's Sketchpad, Cabri, and GeoGebra SketchUp POV-Ray (ray tracer) Blender (has features akin to both SketchUp and POV-Ray) -- used in some High School design classes Carl Lee (UK) MS and HS Geometry Fields InstituteAugust 2014 10 / 26 #12;Second Project: SketchUp in Middle School Partner and Project Initiator: Dr

Lee, Carl

389

Homogenization of a catalyst layer model for periodically distributed pore geometries in PEM fuel cells  

E-Print Network [OSTI]

We formally derive an effective catalyst layer model comprising the reduction of oxygen for periodically distributed pore geometries. By assumption, the pores are completely filled with water and the surrounding walls consist of catalyst particles which are attached to an electron conducting microstructure. The macroscopic transport equations are established by a multi-scale approach, based on microscopic phenomena at the pore level, and serve as a first step toward future optimization of catalyst layer designs.

Schmuck, Markus

2012-01-01T23:59:59.000Z

390

Homogenization of a catalyst layer model for periodically distributed pore geometries in PEM fuel cells  

E-Print Network [OSTI]

We formally derive an effective catalyst layer model comprising the reduction of oxygen for periodically distributed pore geometries. By assumption, the pores are completely filled with water and the surrounding walls consist of catalyst particles which are attached to an electron conducting microstructure. The macroscopic transport equations are established by a multi-scale approach, based on microscopic phenomena at the pore level, and serve as a first step toward future optimization of catalyst layer designs.

Markus Schmuck; Peter Berg

2012-04-30T23:59:59.000Z

391

Final Technical Report: Global Field Aligned Mesh and Gyrokinetic Field Solver in a Tokamak Edge Geometry  

SciTech Connect (OSTI)

This project was a collaboration between researchers at the California Institute of Technology and the University of California, Irvine to investigate the utility of a global field-aligned mesh and gyrokinetic field solver for simulations of the tokamak plasma edge region. Mesh generation software from UC Irvine was tested with specific tokamak edge magnetic geometry scenarios and the quality of the meshes and the solutions to the gyrokinetic Poisson equation were evaluated.

Cummings, Julian C. [California Institute of Technology

2013-05-15T23:59:59.000Z

392

Entropic Dynamics: from Entropy and Information Geometry to Hamiltonians and Quantum Mechanics  

E-Print Network [OSTI]

Entropic Dynamics is a framework in which quantum theory is derived as an application of entropic methods of inference. There is no underlying action principle. Instead, the dynamics is driven by entropy subject to the appropriate constraints. In this paper we show how a Hamiltonian dynamics arises as a type of non-dissipative entropic dynamics. We also show that the particular form of the "quantum potential" that leads to the Schroedinger equation follows naturally from information geometry.

Ariel Caticha; Daniel Bartolomeo; Marcel Reginatto

2014-12-17T23:59:59.000Z

393

Effect of pore geometry in porous media on the miscibility of crude oil and carbon dioxide  

E-Print Network [OSTI]

or low pressure gas, capillary forces and interfacial tensions will result in the leaving behind of a fixed residual oil saturation. Therefore complete or total recovery of oil from an oil bearing for- mation is impossible, even though many pore...EFFECT OF PORE GEOMETRY IN POROUS MEDIA ON THE MISCIBILITY OF CRUDE OIL AND CARBON DIOXIDE A Thesis by HAMED SARKHOSH Submitted to the Graduate College of Texas AIM University in partial fulfillment of the requirement for the degree...

Sarkhosh, Hamed

1977-01-01T23:59:59.000Z

394

THE EFFECT OF DUST GEOMETRY ON THE Lyalpha OUTPUT OF GALAXIES  

SciTech Connect (OSTI)

We present the optical spectroscopic follow-up of 31 z = 0.3 Lyalpha emitters, previously identified by Deharveng et al. We find that 17% of the Lyalpha emitters have line ratios that require the hard ionizing continuum produced by an active galactic nucleus. The uniform dust screen geometry traditionally used in studies similar to ours is not able to simultaneously reproduce the observed high Lyalpha/Halpha and Halpha/Hbeta line ratios. We consider different possibilities for the geometry of the dust around the emitting sources. We find that also a uniform mixture of sources and dust does not reproduce the observed line ratios. Instead, these are well reproduced by a clumpy dust screen. This more realistic treatment of the geometry results in extinction corrected (Lyalpha/Halpha) {sub C} values consistent with case B recombination theory, whereas a uniform dust screen model would imply values (Lyalpha/Halpha) {sub C} higher than 8.7. Our analysis shows that there is no need to invoke ad hoc multiphase media in which the Lyalpha photons only scatter between the dusty clouds and eventually escape.

Scarlata, C.; Colbert, J.; Teplitz, H. I.; Caon, A.; Bridge, C. [Spitzer Science Center, California Institute of Technology, 314-6, Pasadena, CA-91125 (United States); Panagia, N. [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Hayes, M. [Observatoire de Geneve, 51, Ch. des Maillettes, CH-1290, Sauverny (Switzerland); Siana, B.; Rau, A. [California Institute of Technology, MS 105-24, Pasadena, CA 91125 (United States); Francis, P. [Research School of Astronomy and Astrophysics, the Australian National University, Canberra 0200 (Australia); Pizzella, A. [Department of Astronomy, University of Padova, Vicolo dell'Osservatorio 3, I-35122, Padova (Italy)

2009-10-20T23:59:59.000Z

395

Approaches to the Use of Geometry in Architecture: A study of the works of Andrea Palladio, Frank Lloyd Wright, and Frank Gehry  

E-Print Network [OSTI]

Geometry deals with form, shape, and measurement and is a part of mathematics where visual thought is dominant. Both design and construction in architecture deal with visualization, and architects constantly employ geometry. Today, with the advent...

Srinivasan, Urmila

2010-01-16T23:59:59.000Z

396

Accurate Analysis of Large Datasets of Protein-Ligand Binding Geometries Using a Linear Clustering Method Based on MapReduce  

E-Print Network [OSTI]

are traditionally scored based on energy values. A protein-ligand complex selected because Accurate Analysis of Large Datasets of Protein-Ligand Binding Geometries for classifying protein-ligand binding geometries in molecular docking. We analyze results

Maccabe, Barney

397

Micro-electro-mechanical systems phosphoric acid fuel cell  

DOE Patents [OSTI]

A phosphoric acid fuel cell system comprising a porous electrolyte support, a phosphoric acid electrolyte in the porous electrolyte support, a cathode electrode contacting the phosphoric acid electrolyte, and an anode electrode contacting the phosphoric acid electrolyte.

Sopchak, David A. (Livermore, CA); Morse, Jeffrey D. (Martinez, CA); Upadhye, Ravindra S. (Pleasanton, CA); Kotovsky, Jack (Oakland, CA); Graff, Robert T. (Modesto, CA)

2010-12-21T23:59:59.000Z

398

Micro-electro-mechanical systems phosphoric acid fuel cell  

DOE Patents [OSTI]

A phosphoric acid fuel cell system comprising a porous electrolyte support, a phosphoric acid electrolyte in the porous electrolyte support, a cathode electrode contacting the phosphoric acid electrolyte, and an anode electrode contacting the phosphoric acid electrolyte.

Sopchak, David A. (Livermore, CA); Morse, Jeffrey D. (Martinez, CA); Upadhye, Ravindra S. (Pleasanton, CA); Kotovsky, Jack (Oakland, CA); Graff, Robert T. (Modesto, CA)

2010-08-17T23:59:59.000Z

399

acid bacteria isolates: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

acids are solids not liquids. They sublime under vacuum to compare the strengths of solid acids with liquid acids therefore led us to obtain a measure of acidity in dilute...

400

acid bacteria isolated: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

acids are solids not liquids. They sublime under vacuum to compare the strengths of solid acids with liquid acids therefore led us to obtain a measure of acidity in dilute...

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Double stranded nucleic acid biochips  

DOE Patents [OSTI]

This invention describes a new method of constructing double-stranded DNA (dsDNA) microarrays based on the use of pre-synthesized or natural DNA duplexes without a stem-loop structure. The complementary oligonucleotide chains are bonded together by a novel connector that includes a linker for immobilization on a matrix. A non-enzymatic method for synthesizing double-stranded nucleic acids with this novel connector enables the construction of inexpensive and robust dsDNA/dsRNA microarrays. DNA-DNA and DNA-protein interactions are investigated using the microarrays.

Chernov, Boris; Golova, Julia

2006-05-23T23:59:59.000Z

402

Design and Simulation for Architectural Geometry Figure 1: Daytime and nighttime scenes of designed roof by using the developed computational tools  

E-Print Network [OSTI]

roof by using the developed computational tools 031.PDF Keywords: Architectural Geometry, Procedural an innovative computational design tool used to edit architectural geometry interactively and demonstratesDesign and Simulation for Architectural Geometry Figure 1: Daytime and nighttime scenes of designed

403

Self-assembling multimeric nucleic acid constructs  

DOE Patents [OSTI]

The invention is directed to constructs and compositions containing multimeric forms of nucleic acid. Multimeric nucleic acids comprise single-stranded nucleic acids attached via biotin to streptavidin and bound with a functional group. These constructs can be utilized in vivo to treat or identify diseased tissue or cells. Repeated administrations of multimeric nucleic acid compositions produce a rapid and specific amplification of nucleic acid constructs and their attached functional groups. For treatment purposes, functional groups may be toxins, radioisotopes, genes or enzymes. Diagnostically, labeled multimeric constructs may be used to identify specific targets in vivo or in vitro. Multimeric nucleic acids may also be used in nanotechnology and to create self-assembling polymeric aggregates such as membranes of defined porosity, microcircuits and many other products. 5 figs.

Cantor, C.R.; Niemeyer, C.M.; Smith, C.L.; Sano, Takeshi; Hnatowich, D.J.; Rusckowski, M.

1996-10-01T23:59:59.000Z

404

Self-assembling multimeric nucleic acid constructs  

DOE Patents [OSTI]

The invention is directed to constructs and compositions containing multimeric forms of nucleic acid. Multimeric nucleic acids comprise single-stranded nucleic acids attached via biotin to streptavidin and bound with a functional group. These constructs can be utilized in vivo to treat or identify diseased tissue or cells. Repeated administrations of multimeric nucleic acid compositions produce a rapid and specific amplification of nucleic acid constructs and their attached functional groups. For treatment purposes, functional groups may be toxins, radioisotopes, genes or enzymes. Diagnostically, labeled multimeric constructs may be used to identify specific targets in vivo or in vitro. Multimeric nucleic acids may also be used in nanotechnology and to create self-assembling polymeric aggregates such as membranes of defined porosity, microcircuits and many other products.

Cantor, Charles R. (Boston, MA); Niemeyer, Christof M. (Bremen, DE); Smith, Cassandra L. (Boston, MA); Sano, Takeshi (Boston, MA); Hnatowich, Donald J. (Brookline, MA); Rusckowski, Mary (Southborough, MA)

1999-10-12T23:59:59.000Z

405

Self-assembling multimeric nucleic acid constructs  

DOE Patents [OSTI]

The invention is directed to constructs and compositions containing multimeric forms of nucleic acid. Multimeric nucleic acids comprise single-stranded nucleic acids attached via biotin to streptavidin and bound with a functional group. These constructs can be utilized in vivo to treat or identify diseased tissue or cells. Repeated administrations of multimeric nucleic acid compositions produce a rapid and specific amplification of nucleic acid constructs and their attached functional groups. For treatment purposes, functional groups may be toxins, radioisotopes, genes or enzymes. Diagnostically, labeled multimeric constructs may be used to identify specific targets in vivo or in vitro. Multimeric nucleic acids may also be used in nanotechnology and to create self-assembling polymeric aggregates such as membranes of defined porosity, microcircuits and many other products.

Cantor, Charles R. (Boston, MA); Niemeyer, Christof M. (Bremen, DE); Smith, Cassandra L. (Boston, MA); Sano, Takeshi (Boston, MA); Hnatowich, Donald J. (Brookline, MA); Rusckowski, Mary (Southborough, MA)

1996-01-01T23:59:59.000Z

406

Testing of organic acids in engine coolants  

SciTech Connect (OSTI)

The effectiveness of 30 organic acids as inhibitors in engine coolants is reported. Tests include glassware corrosion of coupled and uncoupled metals. FORD galvanostatic and cyclic polarization electrochemistry for aluminum pitting, and reserve alkalinity (RA) measurements. Details of each test are discussed as well as some general conclusions. For example, benzoic acid inhibits coupled metals well but is ineffective on cast iron when uncoupled. In benzoic acid inhibits coupled metals well but is ineffective on cast iron when uncoupled. In general, the organic acids provide little RA when titrated to a pH of 5.5, titration to a pH of 4.5 can result in precipitation of the acid. Trends with respect to acid chain length are reported also.

Weir, T.W. [ARCO Chemical Co., Newtown Square, PA (United States)

1999-08-01T23:59:59.000Z

407

LOCFES-NL: a tool for testing nonlinear spatial approximations to neutron transport in plane-parallel geometry  

E-Print Network [OSTI]

of the requirements for the degree of MASTER OF SCIENCE December 1997 Major Subject:Nuclear Engineering LOCFES-NL: A TOOL FOR TESTING NONLINEAR SPATIAL APPROXIMATIONS TO NEUTRON TRANSPORT IN PLANE-PARALLEL GEOMETRY A Thesis by STEVEN DOUGLAS NOLEN Submitted...) John . Poston, Sr. (Head of Department) December 1997 Major Subject: Nuclear Engineering ABSTRACT LOCFES-NL: A Tool for Testing Nonlinear Spatial Approximations to Neutron Transport in Plane-Parallel Geometry. (December 1997) Steven Douglas Nolen...

Nolen, Steven Douglas

1997-01-01T23:59:59.000Z

408

Geometry and continuity of fine-grained reservoir sandstones deformed within an accretionary prism - Basal Unit, West Woodbourne  

E-Print Network [OSTI]

be difficult to distinguish reservoir from non-reservoir intervals in successions of thinly interbedded sandstones and shales using conventional well logs; (3) There is limited outcrop analogue data that could be used to estimate the geometry and lateral... the depositional geometry and continuity of deep-water reservoir sandstones within the Basal Unit of the Scotland Formation in Woodbourne Trough, beneath Barbados. Observations in the study area were combined with observations of local outcrops of the Scotland...

Blackman, Ingrid Maria

2004-09-30T23:59:59.000Z

409

Carboxylic acid accelerated formation of diesters  

DOE Patents [OSTI]

This invention pertains to accelerating the rate of formation of 1,1-dicarboxylic esters from the reaction of an aldehyde with a carboxylic acid anhydride or a ketene in the presence of a non-iodide containing a strong Bronsted acid catalyst by the addition of a carboxylic acid at about one bar pressure and between about 0 and 80 C in the substantial absence of a hydrogenation or carbonylation catalyst.

Tustin, G.C.; Dickson, T.J.

1998-04-28T23:59:59.000Z

410

Organic Phosphoric Acid of the Soil.  

E-Print Network [OSTI]

TEXAS AGRICULTURAL EXPERIMENT STATIONS BULLETIN NO. +6CT /36 CHEMICAL SECTION, FEBRUARY, 191 1 I TECHNICAL BULLETIN Organic Phosphoric Acid of the Soil BY G. S. FRAPS, Chemist POSTOFFICE College Station, Brazos County, 'Texas. ,\\ustin... . ................................................ introduction 5 .............................. hmmonia-Soluble Phosphoric Acid 5 ................ Solubility of Phosphates in Ammonia 6 I Fixation of Phosphoric Acid from Ammonia .......... 7 Effect of Ratio of Soil to Solvent in Extraction of Phos- I I...

Fraps, G. S. (George Stronach)

1911-01-01T23:59:59.000Z

411

Acid rain information book. Draft final report  

SciTech Connect (OSTI)

Acid rain is one of the most widely publicized environmental issues of the day. The potential consequences of increasingly widespread acid rain demand that this phenomenon be carefully evaluated. Reveiw of the literature shows a rapidly growing body of knowledge, but also reveals major gaps in understanding that need to be narrowed. This document discusses major aspects of the acid rain phenomenon, points out areas of uncertainty, and summarizes current and projected research by responsible government agencies and other concerned organizations.

None

1980-12-01T23:59:59.000Z

412

Carboxylic acid accelerated formation of diesters  

DOE Patents [OSTI]

This invention pertains to accelerating the rate of formation of 1,1-dicarboxylic esters from the reaction of an aldehyde with a carboxylic acid anhydride or a ketene in the presence of a non-iodide containing a strong Bronsted acid catalyst by the addition of a carboxylic acid at about one bar pressure and between about 0.degree. and 80.degree. C. in the substantial absence of a hydrogenation or carbonylation catalyst.

Tustin, Gerald Charles (Kingsport, TN); Dickson, Todd Jay (Kingsport, TN)

1998-01-01T23:59:59.000Z

413

Novel Regenerated Solvent Extraction Processes for the Recovery of Carboxylic Acids or Ammonia from Aqueous Solutions Part I. Regeneration of Amine-Carboxylic Acid Extracts  

E-Print Network [OSTI]

production of citric acid by fermentation, recovery of theof Citric Acid from Aqueous Fermentation Solutions byof citric acid was 1.1.1 Lactic Acid Currently, fermentation

Poole, L.J.

2008-01-01T23:59:59.000Z

414

Acid Doped Membranes for High Temperature PEMFC  

Broader source: Energy.gov [DOE]

Presentation on Acid Doped Membranes for High Temperature PEMFC to the High Temperature Membrane Working Group, May 25, 2004 in Philadelphia, PA.

415

A stochastic model for tumor geometry evolution during radiation therapy in cervical cancer  

SciTech Connect (OSTI)

Purpose: To develop mathematical models to predict the evolution of tumor geometry in cervical cancer undergoing radiation therapy. Methods: The authors develop two mathematical models to estimate tumor geometry change: a Markov model and an isomorphic shrinkage model. The Markov model describes tumor evolution by investigating the change in state (either tumor or nontumor) of voxels on the tumor surface. It assumes that the evolution follows a Markov process. Transition probabilities are obtained using maximum likelihood estimation and depend on the states of neighboring voxels. The isomorphic shrinkage model describes tumor shrinkage or growth in terms of layers of voxels on the tumor surface, instead of modeling individual voxels. The two proposed models were applied to data from 29 cervical cancer patients treated at Princess Margaret Cancer Centre and then compared to a constant volume approach. Model performance was measured using sensitivity and specificity. Results: The Markov model outperformed both the isomorphic shrinkage and constant volume models in terms of the trade-off between sensitivity (target coverage) and specificity (normal tissue sparing). Generally, the Markov model achieved a few percentage points in improvement in either sensitivity or specificity compared to the other models. The isomorphic shrinkage model was comparable to the Markov approach under certain parameter settings. Convex tumor shapes were easier to predict. Conclusions: By modeling tumor geometry change at the voxel level using a probabilistic model, improvements in target coverage and normal tissue sparing are possible. Our Markov model is flexible and has tunable parameters to adjust model performance to meet a range of criteria. Such a model may support the development of an adaptive paradigm for radiation therapy of cervical cancer.

Liu, Yifang; Lee, Chi-Guhn [Department of Mechanical and Industrial Engineering, University of Toronto, 5 King's College Road, Toronto, Ontario M5S 3G8 (Canada)] [Department of Mechanical and Industrial Engineering, University of Toronto, 5 King's College Road, Toronto, Ontario M5S 3G8 (Canada); Chan, Timothy C. Y., E-mail: tcychan@mie.utoronto.ca [Department of Mechanical and Industrial Engineering, University of Toronto, 5 King's College Road, Toronto, Ontario M5S 3G8, Canada and Techna Institute for the Advancement of Technology for Health, 124-100 College Street Toronto, Ontario M5G 1P5 (Canada)] [Department of Mechanical and Industrial Engineering, University of Toronto, 5 King's College Road, Toronto, Ontario M5S 3G8, Canada and Techna Institute for the Advancement of Technology for Health, 124-100 College Street Toronto, Ontario M5G 1P5 (Canada); Cho, Young-Bin [Department of Radiation Physics, Radiation Medicine Program, Princess Margaret Cancer Centre, University Health Network, 610 University of Avenue, Toronto, Ontario M5T 2M9, Canada and Department of Radiation Oncology, University of Toronto, 148-150 College Street, Toronto, Ontario M5S 3S2 (Canada)] [Department of Radiation Physics, Radiation Medicine Program, Princess Margaret Cancer Centre, University Health Network, 610 University of Avenue, Toronto, Ontario M5T 2M9, Canada and Department of Radiation Oncology, University of Toronto, 148-150 College Street, Toronto, Ontario M5S 3S2 (Canada); Islam, Mohammad K. [Department of Radiation Physics, Radiation Medicine Program, Princess Margaret Cancer Centre, University Health Network, 610 University of Avenue, Toronto, Ontario M5T 2M9 (Canada) [Department of Radiation Physics, Radiation Medicine Program, Princess Margaret Cancer Centre, University Health Network, 610 University of Avenue, Toronto, Ontario M5T 2M9 (Canada); Department of Radiation Oncology, University of Toronto, 148-150 College Street, Toronto, Ontario M5S 3S2 (Canada); Techna Institute for the Advancement of Technology for Health, 124-100 College Street, Toronto, Ontario M5G 1P5 (Canada)

2014-02-15T23:59:59.000Z

416

Analytic solutions for seismic travel time and ray path geometry through simple velocity models.  

SciTech Connect (OSTI)

The geometry of ray paths through realistic Earth models can be extremely complex due to the vertical and lateral heterogeneity of the velocity distribution within the models. Calculation of high fidelity ray paths and travel times through these models generally involves sophisticated algorithms that require significant assumptions and approximations. To test such algorithms it is desirable to have available analytic solutions for the geometry and travel time of rays through simpler velocity distributions against which the more complex algorithms can be compared. Also, in situations where computational performance requirements prohibit implementation of full 3D algorithms, it may be necessary to accept the accuracy limitations of analytic solutions in order to compute solutions that satisfy those requirements. Analytic solutions are described for the geometry and travel time of infinite frequency rays through radially symmetric 1D Earth models characterized by an inner sphere where the velocity distribution is given by the function V (r) = A-Br{sup 2}, optionally surrounded by some number of spherical shells of constant velocity. The mathematical basis of the calculations is described, sample calculations are presented, and results are compared to the Taup Toolkit of Crotwell et al. (1999). These solutions are useful for evaluating the fidelity of sophisticated 3D travel time calculators and in situations where performance requirements preclude the use of more computationally intensive calculators. It should be noted that most of the solutions presented are only quasi-analytic. Exact, closed form equations are derived but computation of solutions to specific problems generally require application of numerical integration or root finding techniques, which, while approximations, can be calculated to very high accuracy. Tolerances are set in the numerical algorithms such that computed travel time accuracies are better than 1 microsecond.

Ballard, Sanford

2007-12-01T23:59:59.000Z

417

Optimization approach for the computation of magnetohydrostatic coronal equilibria in spherical geometry  

E-Print Network [OSTI]

Context: This paper presents a method which can be used to calculate models of the global solar corona from observational data. Aims: We present an optimization method for computing nonlinear magnetohydrostatic equilibria in spherical geometry with the aim to obtain self-consistent solutions for the coronal magnetic field, the coronal plasma density and plasma pressure using observational data as input. Methods: Our code for the self-consistent computation of the coronal magnetic fields and the coronal plasma solves the non-force-free magnetohydrostatic equilibria using an optimization method. Previous versions of the code have been used to compute non-linear force-free coronal magnetic fields from photospheric measurements in Cartesian and spherical geometry, and magnetostatic-equilibria in Cartesian geometry. We test our code with the help of a known analytic 3D equilibrium solution of the magnetohydrostatic equations. The detailed comparison between the numerical calculations and the exact equilibrium solutions is made by using magnetic field line plots, plots of density and pressure and some of the usual quantitative numerical comparison measures. Results: We find that the method reconstructs the equilibrium accurately, with residual forces of the order of the discretisation error of the analytic solution. The correlation with the reference solution is better than 99.9% and the magnetic energy is computed accurately with an error of <0.1%. Conclusions: We applied the method so far to an analytic test case. We are planning to use this method with real observational data as input as soon as possible.

T. Wiegelmann; T. Neukirch; P. Ruan; B. Inhester

2008-01-18T23:59:59.000Z

418

Organic acid-tolerant microorganisms and uses thereof for producing organic acids  

DOE Patents [OSTI]

Organic acid-tolerant microorganisms and methods of using same. The organic acid-tolerant microorganisms comprise modifications that reduce or ablate AcsA activity or AcsA homolog activity. The modifications increase tolerance of the microorganisms to such organic acids as 3-hydroxypropionic acid (3HP), acrylic acid, and propionic acid. Further modifications to the microorganisms such as increasing expression of malonyl-CoA reductase and/or acetyl-CoA carboxylase provide or increase the ability of the microorganisms to produce 3HP. Methods of generating an organic acid with the modified microorganisms are provided. Methods of using acsA or homologs thereof as counter-selectable markers include replacing acsA or homologs thereof in cells with genes of interest and selecting for the cells comprising the genes of interest with amounts of organic acids effective to inhibit growth of cells harboring acsA or the homologs.

Pfleger, Brian Frederick; Begemann, Matthew Brett

2014-05-06T23:59:59.000Z

419

E-Print Network 3.0 - acid eicosapentaenoic acid Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sample search results for: acid eicosapentaenoic acid Page: << < 1 2 3 4 5 > >> 1 Fish or Fish Oil in the Diet and Heart Attacks MAURICE E. STANSBY Summary: . Further...

420

E-Print Network 3.0 - acids eicosapentaenoic acid Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sample search results for: acids eicosapentaenoic acid Page: << < 1 2 3 4 5 > >> 1 Fish or Fish Oil in the Diet and Heart Attacks MAURICE E. STANSBY Summary: . Further...

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

2006 DOE Hydrogen Program Poly (p-phenylene Sulfonic Acid)s with...  

Broader source: Energy.gov (indexed) [DOE]

2006 DOE Hydrogen Program Poly (p-phenylene Sulfonic Acid)s with Frozen-in Free Volume for use in High Temperature Fuel Cells 2006 DOE Hydrogen Program Poly (p-phenylene Sulfonic...

422

2006 DOE Hydrogen Program Poly (p-phenylene Sulfonic Acid)s with...  

Broader source: Energy.gov (indexed) [DOE]

Poly(p-phenylene Sulfonic Acid)s with Frozen-in Free Volume for use in High Temperature Fuel Cells Morton Litt and Peter Pintauro Case Western Reserve University Cleveland, Ohio...

423

acid-dependent ribonucleic acid: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

by USDA and U of I researchers Illinois at Urbana-Champaign, University of 40 Controlling acid rain MIT - DSpace Summary: High concentrations of sulfuric and nitric acid in raTn fn...

424

Decomposition Studies of Triphenylboron, Diphenylborinic Acid and Phenylboric Acid in Aqueous Alkaline Solutions Containing Copper  

SciTech Connect (OSTI)

This report documents the copper-catalyzed chemical kinetics of triphenylboron, diphenylborinic acid and phenylboric acid (3PB, 2PB and PBA) in aqueous alkaline solution contained in carbon-steel vessels between 40 and 70 degrees C.

Crawford, C.L. [Westinghouse Savannah River Company, AIKEN, SC (United States); Peterson, R. A.

1997-02-11T23:59:59.000Z

425

Verification of a neutronic code for transient analysis in reactors with Hex-z geometry  

SciTech Connect (OSTI)

Due to the geometry of the fuel bundles, to simulate reactors such as VVER reactors it is necessary to develop methods that can deal with hexagonal prisms as basic elements of the spatial discretization. The main features of a code based on a high order finite element method for the spatial discretization of the neutron diffusion equation and an implicit difference method for the time discretization of this equation are presented and the performance of the code is tested solving the first exercise of the AER transient benchmark. The obtained results are compared with the reference results of the benchmark and with the results provided by PARCS code. (authors)

Gonzalez-Pintor, S.; Verdu, G. [Departamento de Ingenieria Quimica Y Nuclear, Universitat Politecnica de Valencia, Cami de Vera, 14, 46022. Valencia (Spain); Ginestar, D. [Departamento de Matematica Aplicada, Universitat Politecnica de Valencia, Cami de Vera, 14, 46022. Valencia (Spain)

2012-07-01T23:59:59.000Z

426

New method for computing ideal MHD normal modes in axisymmetric toroidal geometry  

SciTech Connect (OSTI)

Analytic elimination of the two magnetic surface components of the displacement vector permits the normal mode ideal MHD equations to be reduced to a scalar form. A Galerkin procedure, similar to that used in the PEST codes, is implemented to determine the normal modes computationally. The method retains the efficient stability capabilities of the PEST 2 energy principle code, while allowing computation of the normal mode frequencies and eigenfunctions, if desired. The procedure is illustrated by comparison with earlier various of PEST and by application to tilting modes in spheromaks, and to stable discrete Alfven waves in tokamak geometry.

Wysocki, F.; Grimm, R.C.

1984-11-01T23:59:59.000Z

427

Operational experience with compressed geometry acceleration tubes in the Oak Ridge 25URC tandem accelerator  

SciTech Connect (OSTI)

Installation of compressed geometry acceleration tubes and other associated modifications have increased the effective voltage capability of the Oak Ridge 25URC tandem accelerator by about 3 MV. Since mid-September 1988, the accelerator has been operated routinely at terminal potentials up to 24 MV and occasionally near 25 MV. In 3500 hours of full-column operation, including 1100 hours at potentials about 22 MV, no significant spark-included damage was observed. Some considerations related to further improvements in voltage performance are discussed. 7 refs., 5 figs.

Jones, C.M.; Haynes, D.L.; Juras, R.C.; Meigs, M.J.; Ziegler, N.F.

1989-01-01T23:59:59.000Z

428

Comparative analysis of continuous-wave surface-plasma negative ion sources with various discharge geometry  

SciTech Connect (OSTI)

Negative ion extraction from continuous-wave (CW) magnetron and semiplanotron discharges was studied and it was compared with that for the source with Penning electrode geometry. The CW negative ion beam up current to 13 mA was extracted from the magnetron source with emission aperture of 3.5 mm in diameter, while the beam with current up to 8 mA was obtained from the semiplanotron source modification. Characteristics of CW magnetron and semiplanotron sources are presented and analyzed.

Belchenko, Yu, E-mail: belchenko@inp.nsk.su [Budker Institute of Nuclear Physics, Siberian Branch of Russian Academy of Sciences, Novosibirsk (Russian Federation)] [Budker Institute of Nuclear Physics, Siberian Branch of Russian Academy of Sciences, Novosibirsk (Russian Federation); Sanin, A.; Sotnikov, O. [Budker Institute of Nuclear Physics, Siberian Branch of Russian Academy of Sciences, Novosibirsk (Russian Federation) [Budker Institute of Nuclear Physics, Siberian Branch of Russian Academy of Sciences, Novosibirsk (Russian Federation); Novosibirsk State University, Novosibirsk, 630090 (Russian Federation)

2014-02-15T23:59:59.000Z

429

Effects of inlet geometries on flow recirculation in an axial-flow pump  

E-Print Network [OSTI]

and mixing occurred. The problem was remedied for good by mounting two single lip seals back to back. Because of its availability, an automotive air conditioning con- denser was used as the heat exchanger for the cooling/lubricating system. The pressure... APPARATUS. 3. 1 Introduction. . . . ~ 3 ' 2 Test Pump 3. 3 Power Supply. 3. 4 Hydraulic Loop 3. 5 Lubricating and Cooling System. 3. 6 Inlet Geometries. ~ ~ ~ ~ ~ ~ ~ 3. 7 Instrumentation 'I P 14 14 14 19 23 23 30 33 CHAPTER IV. EXPERIMENTAL...

Alpan, Kenan

1984-01-01T23:59:59.000Z

430

Layered reactive particles with controlled geometries, energies, and reactivities, and methods for making the same  

DOE Patents [OSTI]

An energetic composite having a plurality of reactive particles each having a reactive multilayer construction formed by successively depositing reactive layers on a rod-shaped substrate having a longitudinal axis, dividing the reactive-layer-deposited rod-shaped substrate into a plurality of substantially uniform longitudinal segments, and removing the rod-shaped substrate from the longitudinal segments, so that the reactive particles have a controlled, substantially uniform, cylindrically curved or otherwise rod-contoured geometry which facilitates handling and improves its packing fraction, while the reactant multilayer construction controls the stability, reactivity and energy density of the energetic composite.

Fritz, Gregory M; Knepper, Robert Allen; Weihs, Timothy P; Gash, Alexander E; Sze, John S

2013-04-30T23:59:59.000Z

431

Equilibrium Geometries, Reaction Pathways, and Electronic Structures of Ethanol Adsorbed on the Si (111) Surface  

E-Print Network [OSTI]

Equilibrium atomic configurations and electron energy structure of ethanol adsorbed on the Si (111) surface are studied by the first-principles density functional theory. Geometry optimization is performed by the total energy minimization method. Several equilibrium atomic configurations of ethanol, both undissociated and dissociated, on the Si (111) surface are found. Reaction pathways and predicted transition states are discussed in comparison with available experimental data in terms of the feasibility of the reactions occurring. Analysis of atom and orbital resolved projected density of states indicate substantial modifications of the Si surface valence and conduction bands due to the adsorption of ethanol affecting the electrical properties of the surface.

Gavrilenko, A V; Gavrilenko, V I

2008-01-01T23:59:59.000Z

432

A Dodecalogue of Basic Didactics from Applications of Abstract Differential Geometry to Quantum Gravity  

E-Print Network [OSTI]

We summarize the twelve most important in our view novel concepts that have arisen, based on results that have been obtained, from various applications of Abstract Differential Geometry (ADG) to Quantum Gravity (QG). The present document may be used as a concise, yet informal, discursive and peripatetic conceptual guide-cum-terminological glossary to the voluminous technical research literature on the subject. In a bonus section at the end, we dwell on the significance of introducing new conceptual terminology in future QG research by means of `poetic language'

Ioannis Raptis

2006-07-10T23:59:59.000Z

433

A Dodecalogue of Basic Didactics from Applications of Abstract Differential Geometry to Quantum Gravity  

E-Print Network [OSTI]

We summarize the twelve most important in our view novel concepts that have arisen, based on results that have been obtained, from various applications of Abstract Differential Geometry (ADG) to Quantum Gravity (QG). The present document may be used as a concise, yet informal, discursive and peripatetic conceptual guide-cum-terminological glossary to the voluminous technical research literature on the subject. In a bonus section at the end, we dwell on the significance of introducing new conceptual terminology in future QG research by means of `poetic language'

Raptis, I

2006-01-01T23:59:59.000Z

434

Excited state geometry optimization with the density matrix renormalization group as applied to polyenes  

E-Print Network [OSTI]

We describe and extend the formalism of state-specific analytic density matrix renormalization group (DMRG) energy gradients, first used by Liu et al (J. Chem. Theor.Comput. 9, 4462 (2013)). We introduce a DMRG wavefunction maximum overlap following technique to facilitate state-specific DMRG excited state optimization. Using DMRG configuration interaction (DMRG-CI) gradients we relax the low-lying singlet states of a series of trans-polyenes up to C20H22. Using the relaxed excited state geometries as well as correlation functions, we elucidate the exciton, soliton, and bimagnon ("single-fission") character of the excited states, and find evidence for a planar conical intersection.

Hu, Weifeng

2015-01-01T23:59:59.000Z

435

Influence of finite radial geometry on the growth rate of ion-channel free electron laser  

SciTech Connect (OSTI)

The influence of finite radial geometry on the instability of a tenuous relativistic electron beam propagating in an ion-channel in a waveguide is investigated. The instability analysis is based on the linearized Vlasov-Maxwell equations for the perturbation about a self-consistent beam equilibrium. With the help of characteristic method the dispersion relation for the TE-mode is derived and analyzed through the numerical solutions. It is found that the positioning of the beam radius R{sub b} relative to the waveguide radius R{sub c}, and the ion-channel frequency can have a large influence on the maximum growth rate and corresponding wave number.

Bahmani, Mohammad; Hamzehpour, Hossein [Department of Physics, K.N. Toosi University of Technology, Tehran 15875-4416 (Iran, Islamic Republic of)] [Department of Physics, K.N. Toosi University of Technology, Tehran 15875-4416 (Iran, Islamic Republic of); Hasanbeigi, Ali [Department of Physics and Institute for Plasma Research, Kharazmi University, 49 Dr. Mofateh Avenue, Tehran 15614 (Iran, Islamic Republic of)] [Department of Physics and Institute for Plasma Research, Kharazmi University, 49 Dr. Mofateh Avenue, Tehran 15614 (Iran, Islamic Republic of)

2013-11-15T23:59:59.000Z

436

Cumulus Geometry from Satellite and Surface Data at the ARM TWP Site  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: Vegetation Proposed Newcatalyst phases on &gamma;-Al2O3.WinterCrystalApplicationsCumulus Geometry

437

BNL Citric Acid Technology: Pilot Scale Demonstration  

SciTech Connect (OSTI)

The objective of this project is to remove toxic metals such as lead and cadmium from incinerator ash using the Citric Acid Process developed at Brookhaven National Laboratory. In this process toxic metals in bottom ash from the incineration of municipal solid waste were first extracted with citric acid followed by biodegradation of the citric acid-metal extract by the bacterium Pseudomonas fluorescens for metals recovery. The ash contained the following metals: Al, As, Ba, Ca, Cd, Cr, Cu, Fe, Mg, Mn, Ni, Pb, Se, Sr, Ti, and Zn. Optimization of the Citric Acid Process parameters which included citric acid molarity, contact time, the impact of mixing aggressiveness during extraction and pretreatment showed lead and cadmium removal from incinerator ash of >90%. Seeding the treated ash with P. fluorescens resulted in the removal of residual citric acid and biostabilization of any leachable lead, thus allowing it to pass EPA?s Toxicity Characteristic Leaching Procedure. Biodegradation of the citric acid extract removed >99% of the lead from the extract as well as other metals such as Al, Ca, Cu, Fe, Mg, Mn, Ti, and Zn. Speciation of the bioprecipitated lead by Extended X-ray Absorption Fine Structure at the National Synchrotron Light Source showed that the lead is predominantly associated with the phosphate and carboxyl functional groups in a stable form. Citric acid was completely recovered (>99%) from the extract by sulfide precipitation technique and the extraction efficiency of recovered citric acid is similar to that of the fresh citric acid. Recycling of the citric acid should result in considerable savings in the overall treatment cost. We have shown the potential application of this technology to remove and recover the metal contaminants from incinerator ash as well as from other heavy metal bearing wastes (i.e., electric arc furnace dust from steel industry) or soils. Information developed from this project is being applied to demonstrate the remediation of lead paint contaminated soils on Long Island.

FRANCIS, A J; DODGE,; J, C; GILLOW, J B; FORRESTER, K E

1999-09-24T23:59:59.000Z

438

Further Investigation of Fluoboric Acid in Sandstone Acidizing Using ^(11)B and ^(19)F NMR  

E-Print Network [OSTI]

Although fluoboric acid (HBF_(4)) has long been known as one of the low-damaging acid treatments for clayey sandstone formations, little is known of its chemistry which could explain the mixed results of fluoboric acid in actual field application. A...

Pituckchon, Arpajit

2014-05-01T23:59:59.000Z

439

Producing dicarboxylic acids using polyketide synthases  

DOE Patents [OSTI]

The present invention provides for a polyketide synthase (PKS) capable of synthesizing a dicarboxylic acid (diacid). Such diacids include diketide-diacids and triketide-diacids. The invention includes recombinant nucleic acid encoding the PKS, and host cells comprising the PKS. The invention also includes methods for producing the diacids.

Katz, Leonard; Fortman, Jeffrey L; Keasling, Jay D

2013-10-29T23:59:59.000Z

440

Electrostatic precipitation of condensed acid mist  

SciTech Connect (OSTI)

This project addresses the acid mist that is formed by condensation of sulfuric acid vapor in flue gas from coal-fired utility boilers. An acid mist can be formed whenever the flue gas temperature approaches the prevailing acid dew point. This commonly occurs when the gas is subjected to rapid adiabatic cooling in a wet scrubber system for flue gas desulfurization. Acid mists can also sometimes result from unexpected temperature excursions caused by air inleakage, load cycling, and start-up operations. A wet electrostatic precipitator (WESP) is the best control option for acid mist. The mist would blind a fabric filter and attach glass fiber fabrics. A wet ESP is required because the acid would quickly corrode the plates in a conventional dry ESP. The wet ESP also offers the advantages of no rapping reentrainment and no sensitivity to fly ash resistivity. Therefore, this program has been structured around the use of a compact, wet ESP to control acid mist emissions. Progress to date is discussed. 7 refs., 1 fig.

Not Available

1990-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

Electrostatic precipitation of condensed acid mist  

SciTech Connect (OSTI)

This project addresses the acid mist that is formed by condensation of sulfuric acid vapor in flue gas from coal-fired utility boilers. An acid mist can be formed whenever the flue gas temperature approaches the prevailing acid dew point. This commonly occurs when the gas is subjected to rapid adiabatic cooling in a wet scrubber system for flue gas desulfurization. Acid mists can also sometimes result from unexpected temperature excursions caused by air inleakage, load cycling, and start-up operations. A wet electrostatic precipitator (WESP) is the best control option for acid mist. The mist would blind a fabric filter and attack glass fiber fabrics. A wet ESP is required because the acid would quickly corrode the plates in a conventional dry ESP. The wet ESP also offers the advantages of no rapping reentrainment and no sensitivity to fly ash resistivity. Therefore, this program has been structured around the use of a compact, wet ESP to control acid mist emissions. 7 refs.

Not Available

1990-01-01T23:59:59.000Z

442

Nanoparticles modified with multiple organic acids  

DOE Patents [OSTI]

Surface-modified nanoparticles of boehmite, and methods for preparing the same. Aluminum oxyhydroxide nanoparticles are surface modified by reaction with selected amounts of organic acids. In particular, the nanoparticle surface is modified by reactions with two or more different carboxylic acids, at least one of which is an organic carboxylic acid. The product is a surface modified boehmite nanoparticle that has an inorganic aluminum oxyhydroxide core, or part aluminum oxyhydroxide core and a surface-bonded organic shell. Organic carboxylic acids of this invention contain at least one carboxylic acid group and one carbon-hydrogen bond. One embodiment of this invention provides boehmite nanoparticles that have been surface modified with two or more acids one of which additional carries at least one reactive functional group. Another embodiment of this invention provides boehmite nanoparticles that have been surface modified with multiple acids one of which has molecular weight or average molecular weight greater than or equal to 500 Daltons. Yet, another embodiment of this invention provides boehmite nanoparticles that are surface modified with two or more acids one of which is hydrophobic in nature and has solubility in water of less than 15 by weight. The products of the methods of this invention have specific useful properties when used in mixture with liquids, as filler in solids, or as stand-alone entities.

Cook, Ronald Lee (Lakewood, CO); Luebben, Silvia DeVito (Golden, CO); Myers, Andrew William (Arvada, CO); Smith, Bryan Matthew (Boulder, CO); Elliott, Brian John (Superior, CO); Kreutzer, Cory (Brighton, CO); Wilson, Carolina (Arvada, CO); Meiser, Manfred (Aurora, CO)

2007-07-17T23:59:59.000Z

443

Nitrates and Prussic Acid in Forages  

E-Print Network [OSTI]

When nitrates and prussic acid accumulate in forage, the feed may not be safe for livestock consumption. Learn the symptoms of nitrate and prussic acid poisoning and which plants are most likely to pose a risk to livestock. Also learn sampling...

Provin, Tony; Pitt, John L.

2003-01-06T23:59:59.000Z

444

Amino acid analogs for tumor imaging  

DOE Patents [OSTI]

The invention provides novel amino acid compounds of use in detecting and evaluating brain and body tumors. These compounds combine the advantageous properties of 1-amino-cycloalkyl-1-carboxylic acids, namely, their rapid uptake and prolonged retention in tumors with the properties of halogen substituents, including certain useful halogen isotopes including fluorine-18, iodine-123, iodine-125, iodine-131, bromine-75, bromine-76, bromine-77 and bromine-82. In one aspect, the invention features amino acid compounds that have a high specificity for target sites when administered to a subject in vivo. Preferred amino acid compounds show a target to non-target ratio of at least 5:1, are stable in vivo and substantially localized to target within 1 hour after administration. An especially preferred amino acid compound is [{sup 18}F]-1-amino-3-fluorocyclobutane-1-carboxylic acid (FACBC). In another aspect, the invention features pharmaceutical compositions comprised of an {alpha}-amino acid moiety attached to either a four, five, or a six member carbon-chain ring. In addition, the invention features analogs of {alpha}-aminoisobutyric acid.

Goodman, M.M.; Shoup, T.

1998-10-06T23:59:59.000Z

445

Amino acid analogs for tumor imaging  

DOE Patents [OSTI]

The invention provides novel amino acid compounds of use in detecting and evaluating brain and body tumors. These compounds combine the advantageous properties of 1-amino-cycloalkyl-1-carboxylic acids, namely, their rapid uptake and prolonged retention in tumors with the properties of halogen substituents, including certain useful halogen isotopes including fluorine-18, iodine-123, iodine-125, iodine-131, bromine-75, bromine-76, bromine-77 and bromine-82. In one aspect, the invention features amino acid compounds that have a high specificity for target sites when administered to a subject in vivo. Preferred amino acid compounds show a target to non-target ratio of at least 5:1, are stable in vivo and substantially localized to target within 1 hour after administration. An especially preferred amino acid compound is [{sup 18}F]-1-amino-3-fluorocyclobutane-1-carboxylic acid (FACBC). In another aspect, the invention features pharmaceutical compositions comprised of an {alpha}-amino acid moiety attached to either a four, five, or a six member carbon-chain ring. In addition, the invention features analogs of {alpha}-aminoisobutyric acid.

Goodman, M.M.; Shoup, T.

1998-09-15T23:59:59.000Z

446

Amino acid analogs for tumor imaging  

DOE Patents [OSTI]

The invention provides novel amino acid compounds of use in detecting and evaluating brain and body tumors. These compounds combine the advantageous properties of 1-amino-cycloalkyl-1-carboxylic acids, namely, their rapid uptake and prolonged retention in tumors with the properties of halogen substituents, including certain useful halogen isotopes including fluorine-18, iodine-123, iodine-125, iodine-131, bromine-75, bromine-76, bromine-77 and bromine-82. In one aspect, the invention features amino acid compounds that have a high specificity for target sites when administered to a subject in vivo. Preferred amino acid compounds show a target to non-target ratio of at least 5:1, are stable in vivo and substantially localized to target within 1 hour after administration. An especially preferred amino acid compound is .sup.18 F!-1-amino-3-fluorocyclobutane-1-carboxylic acid (FACBC). In another aspect, the invention features pharmaceutical compositions comprised of an .alpha.-amino acid moiety attached to either a four, five, or a six member carbon-chain ring. In addition, the invention features analogs of .alpha.-aminoisobutyric acid.

Goodman, Mark M. (Atlanta, GA); Shoup, Timothy (Decatur, GA)

1998-09-15T23:59:59.000Z

447

Amino acid analogs for tumor imaging  

DOE Patents [OSTI]

The invention provides novel amino acid compounds of use in detecting and evaluating brain and body tumors. These compounds combine the advantageous properties of 1-amino-cycloalkyl-1-carboxylic acids, namely, their rapid uptake and prolonged retention in tumors with the properties of halogen substituents, including certain useful halogen isotopes including fluorine-18, iodine-123, iodine-125, iodine-131, bromine-75, bromine-76, bromine-77 and bromine-82. In one aspect, the invention features amino acid compounds that have a high specificity for target sites when administered to a subject in vivo. Preferred amino acid compounds show a target to non-target ratio of at least 5:1, are stable in vivo and substantially localized to target within 1 hour after administration. An especially preferred amino acid compound is .sup.18 F!-1-amino-3-fluorocyclobutane-1-carboxylic acid (FACBC). In another aspect, the invention features pharmaceutical compositions comprised of an .alpha.-amino acid moiety attached to either a four, five, or a six member carbon-chain ring. In addition, the invention features analogs of .alpha.-aminoisobutyric acid.

Goodman, Mark M. (Atlanta, GA); Shoup, Timothy (Decatur, GA)

1998-10-06T23:59:59.000Z

448

Naphthenic acid corrosion by Venezuelan crudes  

SciTech Connect (OSTI)

Venezuelan crudes can contain levels of naphthenic acids that cause corrosion in distillation units designed for sweet crudes. This naphthenic acid corrosion can be mitigated in several ways, the most common of which is selective alloying. This paper will provide information from field experience on how various refineries worldwide have upgraded materials to run Venezuelan crudes in a cost effective way.

Hopkinson, B.E.; Penuela, L.E. [Lagoven, S.A., Judibana (Venezuela). Amuay Refinery

1997-09-01T23:59:59.000Z

449

Naphthenic acid corrosion in crude distillation units  

SciTech Connect (OSTI)

This paper summarizes corrosion experience in crude distillation units processing highly naphthenic California crude oils. Correlations have been developed relating corrosion rates to temperature and total acid number. There is a threshold acid number in the range of 1.5 to 2 mg KOH/g below which corrosion is minimal. High concentrations of hydrogen sulfide may raise this threshold value.

Piehl, R.L.

1988-01-01T23:59:59.000Z

450

Critical Parameters of Complex Geometries of Intersecting Cylinders Containing Uranyl Nitrate Solution  

SciTech Connect (OSTI)

About three dozen previously unreported critical configurations are presented for very complex geometries filled with high concentration enriched uranyl nitrate solution. These geometries resemble a tall, thin Central Column (or trunk of a ''tree'') having long, thin arms (or ''branches'') extending up to four directions off the column. Arms are equally spaced from one another in vertical planes, and that spacing ranges from arms in contact to quite wide spacings. Both the Central Column and the many different arms are critically safe by themselves with each, alone, is filled with fissile solution; but, in combination, criticality occurs due to the interactions between arms and the column. Such neutronic interactions formed the principal focus of this study. While these results are fresh to the nuclear criticality safety industry and to those seeking novel experiments against which to validate computer codes, the experiments, themselves, are not recent. Over 100 experiments were performed at the Rocky Flats Critical Mass Laboratory between September, 1967, and February of the following year.

J. B. Briggs (INEEL POC); R. E. Rothe

1999-06-14T23:59:59.000Z

451

Optimizing RF gun cavity geometry within an automated injector design system  

SciTech Connect (OSTI)

RF guns play an integral role in the success of several light sources around the world, and properly designed and optimized cw superconducting RF (SRF) guns can provide a path to higher average brightness. As the need for these guns grows, it is important to have automated optimization software tools that vary the geometry of the gun cavity as part of the injector design process. This will allow designers to improve existing designs for present installations, extend the utility of these guns to other applications, and develop new designs. An evolutionary algorithm (EA) based system can provide this capability because EAs can search in parallel a large parameter space (often non-linear) and in a relatively short time identify promising regions of the space for more careful consideration. The injector designer can then evaluate more cavity design parameters during the injector optimization process against the beam performance requirements of the injector. This paper will describe an extension to the APISA software that allows the cavity geometry to be modified as part of the injector optimization and provide examples of its application to existing RF and SRF gun designs.

Alicia Hofler ,Pavel Evtushenko

2011-03-28T23:59:59.000Z

452

Searching for optimal mitigation geometries for laser-resistant multilayer high-reflector coatings  

SciTech Connect (OSTI)

Growing laser damage sites on multilayer high-reflector coatings can limit mirror performance. One of the strategies to improve laser damage resistance is to replace the growing damage sites with predesigned benign mitigation structures. By mitigating the weakest site on the optic, the large-aperture mirror will have a laser resistance comparable to the intrinsic value of the multilayer coating. To determine the optimal mitigation geometry, the finite-difference time-domain method was used to quantify the electric-field intensification within the multilayer, at the presence of different conical pits. We find that the field intensification induced by the mitigation pit is strongly dependent on the polarization and the angle of incidence (AOI) of the incoming wave. Therefore, the optimal mitigation conical pit geometry is application specific. Furthermore, our simulation also illustrates an alternative means to achieve an optimal mitigation structure by matching the cone angle of the structure with the AOI of the incoming wave, except for the p-polarized wave at a range of incident angles between 30 deg. and 45 deg.

Qiu, S. Roger; Wolfe, Justin E.; Monterrosa, Anthony M.; Feit, Michael D.; Pistor, Thomas V.; Stolz, Christopher J.

2011-03-20T23:59:59.000Z

453

Deep Mid-Infrared Silicate Absorption as a Diagnostic of Obscuring Geometry Toward Galactic Nuclei  

E-Print Network [OSTI]

The silicate cross section peak near 10um produces emission and absorption features in the spectra of dusty galactic nuclei observed with the Spitzer Space Telescope. Especially in ultraluminous infrared galaxies, the observed absorption feature can be extremely deep, as IRAS 08572+3915 illustrates. A foreground screen of obscuration cannot reproduce this observed feature, even at large optical depth. Instead, the deep absorption requires a nuclear source to be deeply embedded in a smooth distribution of material that is both geometrically and optically thick. In contrast, a clumpy medium can produce only shallow absorption or emission, which are characteristic of optically-identified active galactic nuclei. In general, the geometry of the dusty region and the total optical depth, rather than the grain composition or heating spectrum, determine the silicate feature's observable properties. The apparent optical depth calculated from the ratio of line to continuum emission generally fails to accurately measure the true optical depth. The obscuring geometry, not the nature of the embedded source, also determines the far-IR spectral shape.

N. A. Levenson; M. M. Sirocky; L. Hao; H. W. W. Spoon; J. A. Marshall; M. Elitzur; J. R. Houck

2006-11-14T23:59:59.000Z

454

Metabolic Flux Analysis for Succinic Acid Production by Recombinant Escherichia  

E-Print Network [OSTI]

; Samuelov et al., 1991). Escherichia coli produces several metabolic products by fermentation: acetic acid the final succinic acid concentration obtained was 9.5 g/L and the ratio of succinic acid to acetic acid being expended on the production of succinic acid by microbial fermentation using renewable feedstocks

455

System for conversion between the boundary representation model and a constructive solid geometry model of an object  

DOE Patents [OSTI]

A system converts from the boundary representation of an object to the constructive solid geometry representation thereof. The system converts the boundary representation of the object into elemental atomic geometrical units or I-bodies which are in the shape of stock primitives or regularized intersections of stock primitives. These elemental atomic geometrical units are then represented in symbolic form. The symbolic representations of the elemental atomic geometrical units are then assembled heuristically to form a constructive solid geometry representation of the object usable for manufacturing thereof. Artificial intelligence is used to determine the best constructive solid geometry representation from the boundary representation of the object. Heuristic criteria are adapted to the manufacturing environment for which the device is to be utilized. The surface finish, tolerance, and other information associated with each surface of the boundary representation of the object are mapped onto the constructive solid geometry representation of the object to produce an enhanced solid geometry representation, particularly useful for computer-aided manufacture of the object. 19 figs.

Christensen, N.C.; Emery, J.D.; Smith, M.L.

1985-04-29T23:59:59.000Z

456

Surfactant Screening to Alter the Wettability and Aid in Acidizing Carbonate Formations  

E-Print Network [OSTI]

, known as high temperature organic acids (HTO acids), have been found to be useful in acidizing subterranean formations at temperatures up to 400oF. Some of these acids are oxalic acid, malonic acid, pimelic acid, succinic acid, glutaric acid, adipic... acid and their mixtures. In addition to creating wormholes in carbonate formations, HTO acids can remove carbonate scale at high temperatures and cause very low corrosion to the tubing and casing. 6 1.2 Role of Surfactants in Acidizing 1...

Yadhalli Shivaprasad, Arun Kumar

2013-02-26T23:59:59.000Z

457

Difunctional carboxylic acid anions in oilfield waters  

SciTech Connect (OSTI)

Recent models of porosity enhancement during sandstone diagenesis have called upon the metal complexing ability of difunctional carboxylic acid anions in subsurface waters to explain aluminosilicate dissolution. Although carboxylic acid anions have been known to exist in oilfield waters since the turn of the century, until now the existence of significant concentrations of difunctional carboxylic acid anions has not been documented. Data from this study show that difunctional carboxylic acid anions can exist in concentrations up to 2640 ppm, and can account for nearly 100% of the organic acid anions in some oilfield waters. Formation water samples with exceptionally high concentrations of difunctional carboxylic acid anions are found in reservoirs which are at maximum levels of thermal exposure, and which are presently in the 80-100/sup 0/C thermal window. Plagioclase dissolution experiments performed with natural oilfield waters and artificial solutions indicate that waters with high difunctional acid anion concentrations are capable, by organo-metallic complexation, of being apparently oversaturated with respect to total aluminum concentrations compared to the inorganic solubility of kaolinite by several orders of magnitude. Dissolution experiments simulating a specific geologic environment (Stevens Sandstone, southern San Joaquin Basin, California; using natural oilfield waters and Stevens Sandstone core samples), produced plagioclase and calcite dissolution textures similar to those noted in well cores from the Stevens Sandstone, as well as raising total aluminum concentrations in these experimental solutions several orders of magnitude over the solubility of kaolinite.

MacGowan, D.B.; Surdam, R.C.

1988-01-01T23:59:59.000Z

458

A COMPARISON OF MEASURED AND CALCULATED GAMMA RAY ATTENUATION FOR A COMMON COUNTING GEOMETRY  

SciTech Connect (OSTI)

In order to perform quantitative gamma spectroscopy, it is necessary to know the sample-specific detection efficiency for photons as a function of energy. The detection efficiency, along with the branching ratio for the isotope and gamma ray of interest, is used to convert observed counts/second to actual disintegrations/second, and, hence, has a large effect on the accuracy of the measurement. In cases where the geometry of the source is simple and reproducible, such as a point source, small vial of solid, or jar of liquid, geometry-specific standards may be counted to determine the detection efficiency. In cases where the samples are large, irregular, or unique, this method generally cannot be used. For example, it is impossible to obtain a NIST-traceable standard glovebox or 55-gallon drum. In these cases, a combination of measured absolute detector efficiency and calculated sample-specific correction factors is commonly used. The correction factors may be calculated via Monte Carlo simulation of the item (the method used by Canberra's ISOCS system), or via semi-empirical calculation of matrix and container attenuations based on the thickness and composition of the container and radioactive matrix (ISOTOPIC by EG&G Ortec uses this method). The accuracy of these correction factors for specific geometries is often of vital interest when assessing the quality of gamma spectroscopy data. During the Building 251 Risk-Reduction Project, over 100 samples of high activity actinides will be characterized via gamma spectroscopy, typically without removing the material from the current storage containers. Most of the radioactive materials in B-251 are stored in cylindrical stainless steel canisters (called USV containers, after the Underground Storage Vaults they are commonly stored in), 13 cm in diameter, by 28 cm high, with walls that are 1.8 mm thick. While the actual samples have a variety of configurations inside the USV container, a very common configuration is the material (usually as an oxide powder pellet of approximately 2 cm diameter by {approx}2 mm thick) in a squat glass jar, with the jar placed in a thin steel food-pack can, which is then placed in the bottom of the USV canister. During data acquisition, the USV containers are typically rotated at approximately 4 rpm on a turntable to eliminate errors due to the material not being centered in the can, or attenuation not being isotropic. An aluminum plate is placed over the container, secured by three vertical rods, to securely hold the container. Pictures of both the containers, and this typical counting configuration are shown below.

Gaylord, R F

2004-02-26T23:59:59.000Z

459

Experimental Study of Acid Fracture Conductivity of Austin Chalk Formation  

E-Print Network [OSTI]

Acid fracture conductivity and the effect of key variables in the etching process during acid fracturing can be assessed at the laboratory scale. This is accomplished by using an experimental apparatus that simulates acid injection fluxes comparable...

Nino Penaloza, Andrea

2013-05-01T23:59:59.000Z

460

Experimental High Velocity Acid Jetting in Limestone Carbonates  

E-Print Network [OSTI]

Acid jetting is a well stimulation technique that is used in carbonate reservoirs. It typically involves injecting acid down hole at high flow rates through small orifices which cause high velocities of acid to strike the borehole wall...

Holland, Christopher

2014-04-30T23:59:59.000Z

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

acid-base imbalance: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

acid generates a material (PE-C02H Deutch, John 59 Acid-Based Synthesis of Monodisperse Rare-Earth-Doped Colloidal SiO2 Spheres Materials Science Websites Summary: Acid-Based...

462

aqueous tartaric acid: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

with limited success.2,3 During the last decade, attention to sulfuric acid anodizing and boric-sulfuric acid Paris-Sud XI, Universit de 255 Si isotope systematics of acidic...

463

Production of Succinic Acid for Lignocellulosic Hydrolysates  

SciTech Connect (OSTI)

The purpose of this Cooperative Research and Development Agreement (CRADA) is to add and test new metabolic activities to existing microbial catalysts for the production of succinic acid from renewables. In particular, they seek to add to the existing organism the ability to utilize xylose efficiently and simultaneously with glucose in mixtures of sugars or to add succinic acid production to another strain and to test the value of this new capability for production of succinic acid from industrial lignocellulosic hydrolyasates. The Contractors and Participant are hereinafter jointly referred to as the 'Parties'. Research to date in succinic acid fermentation, separation and genetic engineering has resulted in a potentially economical process based on the use of an Escherichia coli strain AFP111 with suitable characteristics for the production of succinic acid from glucose. Economic analysis has shown that higher value commodity chemicals can be economically produced from succinic acid based on repliminary laboratory findings and predicted catalytic parameters. The initial target markets include succinic acid itself, succinate salts, esters and other derivatives for use as deicers, solvents and acidulants. The other commodity products from the succinic acid platform include 1,4-butanediol, {gamma}-butyrolactone, 2-pyrrolidinone and N-methyl pyrrolidinone. Current economic analyses indicate that this platform is competitive with existing petrochemical routes, especially for the succinic acid and derivatives. The report presents the planned CRADA objectives followed by the results. The results section has a combined biocatalysis and fermentation section and a commercialization section. This is a nonproprietary report; additional proprietary information may be made available subject to acceptance of the appropriate proprietary information agreements.

Davison, B.H.; Nghiem, J.

2002-06-01T23:59:59.000Z

464

Naphthenic acid corrosion in refinery settings  

SciTech Connect (OSTI)

Naphthenic acid corrosion has been a problem in the refining industry for many years. Recently interest in this problem has grown because crudes that contain naphthenic acid are being recovered from areas which were not known to produce this type of crude, such as china, India, and Africa. New techniques for identifying naphthenic acid corrosion and chemical treatments for preventing this attack are presented. Refinery case studies include stream analysis, failure analysis, and inhibitor use. Laboratory tests to show the effect of hydrogen sulfide and phosphorus-based inhibitors are discussed.

Babaian-Kibala, E. (Nalco Chemical Co., Sugar Land, TX (United States)); Craig, H.L. Jr. (Mobil Research and Development Corp., Paulsboro, NJ (United States)); Rusk, G.L. (Mobil Oil Co., Torrance, CA (United States)); Blanchard, K.V.; Rose, T.J.; Uehlein, B.L. (Nalco Chemical Co., Paulsboro, NJ (United States)); Quinter, R.C. (Sun Co., Newtown Square, PA (United States)); Summers, M.A. (Sun Co., Marcus Hook, PA (United States))

1993-04-01T23:59:59.000Z

465

E-Print Network 3.0 - acid rain compliance Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

produces salt and water. 2. Acid rain... is rain that is slightly acidic due to pollution in the air. Acid rain greatly affects the ecosystems... is acid ... Source:...

466

E-Print Network 3.0 - acidic potassium permanganate Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

State University General Guidelines Summary: acid Aminoalkanoic acids with 6 or fewer carbon atoms and the ammonium, sodium and potassium salts... of these acids. Amino acids...

467

Coordinate families for the Schwarzschild geometry based on radial timelike geodesics  

E-Print Network [OSTI]

We explore the connections between various coordinate systems associated with observers moving inwardly along radial geodesics in the Schwarzschild geometry. Painlev\\'e-Gullstrand (PG) time is adapted to freely falling observers dropped from rest from infinity; Lake-Martel-Poisson (LMP) time coordinates are adapted to observers who start at infinity with non-zero initial inward velocity; Gautreau-Hoffmann (GH) time coordinates are adapted to observers dropped from rest from a finite distance from the black hole horizon. We construct from these an LMP family and a proper-time family of time coordinates, the intersection of which is PG time. We demonstrate that these coordinate families are distinct, but related, one-parameter generalizations of PG time, and show linkage to Lema\\^itre coordinates as well.

Tehani K. Finch

2014-12-23T23:59:59.000Z

468

Oscillation modes of direct current microdischarges with parallel-plate geometry  

SciTech Connect (OSTI)

Two different oscillation modes in microdischarge with parallel-plate geometry have been observed: relaxation oscillations with frequency range between 1.23 and 2.1 kHz and free-running oscillations with 7 kHz frequency. The oscillation modes are induced by increasing power supply voltage or discharge current. For a given power supply voltage, there is a spontaneous transition from one to other oscillation mode and vice versa. Before the transition from relaxation to free-running oscillations, the spontaneous increase of oscillation frequency of relaxation oscillations form 1.3 kHz to 2.1 kHz is measured. Fourier transform spectra of relaxation oscillations reveal chaotic behavior of microdischarges. Volt-ampere (V-A) characteristics associated with relaxation oscillations describes periodical transition between low current, diffuse discharge, and normal glow. However, free-running oscillations appear in subnormal glow only.

Stefanovic, Ilija; Kuschel, Thomas; Winter, Joerg [Institut fuer Experimentalphysik II, Ruhr-Universitaet Bochum, 44781 Bochum (Germany); Skoro, Nikola; Maric, Dragana; Petrovic, Zoran Lj [Institute of Physics, University of Belgrade, POB 68, 11080 Belgrade (Serbia)

2011-10-15T23:59:59.000Z

469

Low torque hydrodynamic lip geometry for bi-directional rotation seals  

DOE Patents [OSTI]

A hydrodynamically lubricating geometry for the generally circular dynamic sealing lip of rotary seals that are employed to partition a lubricant from an environment. The dynamic sealing lip is provided for establishing compressed sealing engagement with a relatively rotatable surface, and for wedging a film of lubricating fluid into the interface between the dynamic sealing lip and the relatively rotatable surface in response to relative rotation that may occur in the clockwise or the counter-clockwise direction. A wave form incorporating an elongated dimple provides the gradual convergence, efficient impingement angle, and gradual interfacial contact pressure rise that are conducive to efficient hydrodynamic wedging. Skewed elevated contact pressure zones produced by compression edge effects provide for controlled lubricant movement within the dynamic sealing interface between the seal and the relatively rotatable surface, producing enhanced lubrication and low running torque.

Dietle, Lannie L. (Houston, TX); Schroeder, John E. (Richmond, TX)

2011-11-15T23:59:59.000Z

470

Low torque hydrodynamic lip geometry for bi-directional rotation seals  

DOE Patents [OSTI]

A hydrodynamically lubricating geometry for the generally circular dynamic sealing lip of rotary seals that are employed to partition a lubricant from an environment. The dynamic sealing lip is provided for establishing compressed sealing engagement with a relatively rotatable surface, and for wedging a film of lubricating fluid into the interface between the dynamic sealing lip and the relatively rotatable surface in response to relative rotation that may occur in the clockwise or the counter-clockwise direction. A wave form incorporating an elongated dimple provides the gradual convergence, efficient impingement angle, and gradual interfacial contact pressure rise that are conducive to efficient hydrodynamic wedging. Skewed elevated contact pressure zones produced by compression edge effects provide for controlled lubricant movement within the dynamic sealing interface between the seal and the relatively rotatable surface, producing enhanced lubrication and low running torque.

Dietle, Lannie L. (Houston, TX); Schroeder, John E. (Richmond, TX)

2009-07-21T23:59:59.000Z

471

A comparison of four direct geometry time-of-flight spectrometers at the Spallation Neutron Source  

SciTech Connect (OSTI)

The Spallation Neutron Source at Oak Ridge National Laboratory now hosts four direct geometry time-of-flight chopper spectrometers. These instruments cover a range of wave-vector and energy transfer space with varying degrees of neutron flux and resolution. The regions of reciprocal and energy space available to measure at these instruments are not exclusive and overlap significantly. We present a direct comparison of the capabilities of this instrumentation, conducted by data mining the instrument usage histories, and specific scanning regimes. In addition, one of the common science missions for these instruments is the study of magnetic excitations in condensed matter systems. We have measured the powder averaged spin wave spectra in one particular sample using each of these instruments, and use these data in our comparisons.

Stone, M. B.; Abernathy, D. L.; Ehlers, G.; Garlea, O.; Podlesnyak, A.; Winn, B. [Quantum Condensed Matter Science Division, Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States)] [Quantum Condensed Matter Science Division, Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States); Niedziela, J. L.; DeBeer-Schmitt, L.; Graves-Brook, M. [Instrument and Source Division, Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States)] [Instrument and Source Division, Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States); Granroth, G. E. [Neutron Data Analysis and Visualization Division, Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States)] [Neutron Data Analysis and Visualization Division, Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States); Kolesnikov, A. I. [Chemical and Engineering Materials Division, Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States)] [Chemical and Engineering Materials Division, Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States)

2014-04-15T23:59:59.000Z

472

Casimir Forces in a Piston Geometry at Zero and Finite Temperatures  

E-Print Network [OSTI]

We study Casimir forces on the partition in a closed box (piston) with perfect metallic boundary conditions. Related closed geometries have generated interest as candidates for a repulsive force. By using an optical path expansion we solve exactly the case of a piston with a rectangular cross section, and find that the force always attracts the partition to the nearest base. For arbitrary cross sections, we can use an expansion for the density of states to compute the force in the limit of small height to width ratios. The corrections to the force between parallel plates are found to have interesting dependence on the shape of the cross section. Finally, for temperatures in the range of experimental interest we compute finite temperature corrections to the force (again assuming perfect boundaries).

M. P. Hertzberg; R. L. Jaffe; M. Kardar; A. Scardicchio

2007-11-18T23:59:59.000Z

473

Impact of geometry on light collection efficiency of scintillation detectors for cryogenic rare event searches  

E-Print Network [OSTI]

Simulations of photon propagation in scintillation detectors were performed with the aim to find the optimal scintillator geometry, surface treatment, and shape of external reflector in order to achieve maximum light collection efficiency for detector configurations that avoid direct optical coupling, a situation that is commonly found in cryogenic scintillating bolometers in experimental searches for double beta decay and dark matter. To evaluate the light collection efficiency of various geometrical configurations we used the ZEMAX ray-tracing software. It was found that scintillators in the shape of a triangular prism with an external mirror shaped as truncated cone gives the highest light collection efficiency. The results of the simulations were confirmed by carrying out measurements of the light collection efficiencies of CaWO4 crystal scintillators. A comparison of simulated and measured values of light output shows good agreement

F. A. Danevich; V. V. Kobychev; R. V. Kobychev; H. Kraus; V. B. Mikhailik; V. M. Mokina; I. M. Solsky

2014-04-30T23:59:59.000Z

474

The contact theorem for charged fluids: from planar to curved geometries  

E-Print Network [OSTI]

When a Coulombic fluid is confined between two parallel charged plates, an exact relation links the difference of ionic densities at contact with the plates, to the surface charges of these boundaries. It no longer applies when the boundaries are curved, and we work out how it generalizes when the fluid is confined between two concentric spheres (or cylinders), in two and in three space dimensions. The analysis is thus performed within the cell model picture. The generalized contact relation opens the possibility to derive new exact expressions, of particular interest in the regime of strong coulombic couplings. Some emphasis is put on cylindrical geometry, for which we discuss in depth the phenomenon of counter-ion evaporation/condensation, and obtain novel results. Good agreement is found with Monte Carlo simulation data.

Juan Pablo Mallarino; Gabriel Tellez; Emmanuel Trizac

2014-10-23T23:59:59.000Z

475

IBIS: An inverse geometry Brillouin inelastic neutron spectrometer for the SNS  

SciTech Connect (OSTI)

The high power target station at the Spallation Neutron Source (SNS) currently has about 20 completed neutron scattering instruments. With a broad coverage of the momentum transfer (Q)-energy (E) space, these instruments serve an extensive user community. In an effort to further expand the scientific capabilities of the SNS instrument suites, we propose a low background, inverse geometry Brillouin inelastic spectrometer for the SNS which will expand the Q-E coverage of the current instrument suite and facilitate the study of inelastic and quasi-elastic scatterings at low Q values. The possible location for the proposed instrument is either beamline 8 which views the decoupled water moderator, or beamline 14A, which views a cold, coupled super critical hydrogen moderator. The instrument parameters, optimizations, and performances at these two beamline locations are discussed.

Zhao, J. K.; Robertson, Lee; Herwig, Kenneth W. [Instrument and Source Development Division, Spallation Neutron Source, Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States); Wildgruber, Christoph U. [Chemical and Engineering Division, Spallation Neutron Source, Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States)

2013-02-15T23:59:59.000Z

476

Piston-Liner Crevice Geometry Effect on HCCI Combustion by Multi-Zone Analysis  

SciTech Connect (OSTI)

A multi-zone model has been developed that accurately predicts HCCI combustion and emissions. The multizone methodology is based on the observation that turbulence does not play a direct role on HCCI combustion. Instead, chemical kinetics dominates the process, with hotter zones reacting first, and then colder zones reacting in rapid succession. Here, the multi-zone model has been applied to analyze the effect of piston crevice geometry on HCCI combustion and emissions. Three different pistons of varying crevice size were analyzed. Crevice sizes were 0.26, 1.3 and 2.1 mm, while a constant compression ratio was maintained (17:1). The results show that the multi-zone model can predict pressure traces and heat release rates with good accuracy. Combustion efficiency is also predicted with good accuracy for all cases, with a maximum difference of 5% between experimental and numerical results. Carbon monoxide emissions are underpredicted, but the results are better than those obtained in previous publications. The improvement is attributed to the use of a 40-zone model, while previous publications used a 10-zone model. Hydrocarbon emissions are well predicted. For cylinders with wide crevices (1.3 and 2.1 mm), HC emissions do not decrease monotonically as the relative air/fuel ratio ({lambda}) increases. Instead, maximum HC emissions are obtained for an intermediate value of {lambda}. The model predicts this relative air/fuel ratio for maximum HC emissions with very good accuracy. The results show that the multi-zone model can successfully predict the effect of crevice geometry on HCCI combustion, and therefore it has applicability to the design of HCCI engines with optimum characteristics for high efficiency, low emissions and low peak cylinder pressure.

Aceves, S M; Flowers, D L; Espinosa-Loza, F; Martinez-Frias, J; Dibble, R W; Christensen, M; Johansson, B; Hessel, R P

2002-09-04T23:59:59.000Z

477

Streaked x-ray spectrometer having a discrete selection of Bragg geometries for Omega  

SciTech Connect (OSTI)

The streaked x-ray spectrometer (SXS) is used with streak cameras [D. H. Kalantar, P. M. Bell, R. L. Costa, B. A. Hammel, O. L. Landen, T. J. Orzechowski, J. D. Hares, and A. K. L. Dymoke-Bradshaw, in 22nd International Congress on High-Speed Photography and Photonics, edited by D. L. Paisley and A. M. Frank (SPIE, Bellingham, WA, 1997), Vol. 2869, p. 680] positioned with a ten-inch manipulator on OMEGA [T. R. Boehly et al., Opt. Commun. 133, 495 (1997)] and OMEGA EP [L. J. Waxer et al., Presented at CLEO/QELS 2008, San Jose, CA, 4-9 May 2008 (Paper JThB1)] for time-resolved, x-ray spectroscopy of laser-produced plasmas in the 1.4- to 20-keV photon-energy range. These experiments require measuring a portion of this photon-energy range to monitor a particular emission or absorption feature of interest. The SXS relies on a pinned mechanical reference system to create a discrete set of Bragg reflection geometries for a variety of crystals. A wide selection of spectral windows is achieved accurately and efficiently using this technique. It replaces the previous spectrometer designs that had a continuous Bragg angle adjustment and required a tedious alignment calibration procedure. The number of spectral windows needed for the SXS was determined by studying the spectral ranges selected by OMEGA users over the last decade. These selections are easily configured in the SXS using one of the 25 discrete Bragg reflection geometries and one of the six types of Bragg crystals, including two curved crystals.

Millecchia, M.; Regan, S. P.; Bahr, R. E.; Romanofsky, M.; Sorce, C. [Laboratory for Laser Energetics, University of Rochester, Rochester, New York 14623-1299 (United States)

2012-10-15T23:59:59.000Z

478

Development of a general method for obtaining the geometry of microfluidic networks  

SciTech Connect (OSTI)

In the present study, a general method for geometry of fluidic networks is developed with emphasis on pressure-driven flows in the microfluidic applications. The design method is based on general features of network's geometry such as cross-sectional area and length of channels. Also, the method is applicable to various cross-sectional shapes such as circular, rectangular, triangular, and trapezoidal cross sections. Using constructal theory, the flow resistance, energy loss and performance of the network are optimized. Also, by this method, practical design strategies for the fabrication of microfluidic networks can be improved. The design method enables rapid prediction of fluid flow in the complex network of channels and is very useful for improving proper miniaturization and integration of microfluidic networks. Minimization of flow resistance of the network of channels leads to universal constants for consecutive cross-sectional areas and lengths. For a Y-shaped network, the optimal ratios of consecutive cross-section areas (A{sub i+1}/A{sub i}) and lengths (L{sub i+1}/L{sub i}) are obtained as A{sub i+1}/A{sub i} = 2{sup ?2/3} and L{sub i+1}/L{sub i} = 2{sup ?1/3}, respectively. It is shown that energy loss in the network is proportional to the volume of network. It is also seen when the number of channels is increased both the hydraulic resistance and the volume occupied by the network are increased in a similar manner. Furthermore, the method offers that fabrication of multi-depth and multi-width microchannels should be considered as an integral part of designing procedures. Finally, numerical simulations for the fluid flow in the network have been performed and results show very good agreement with analytic results.

Razavi, Mohammad Sayed, E-mail: m.sayedrazavi@gmail.com; Salimpour, M. R. [Department of Mechanical Engineering, Isfahan University of Technology, Isfahan 84156-83111 (Iran, Islamic Republic of)] [Department of Mechanical Engineering, Isfahan University of Technology, Isfahan 84156-83111 (Iran, Islamic Republic of); Shirani, Ebrahim [Department of Engineering, Foolad Institute of Technology, FooladShahr 84916-63763, Isfahan (Iran, Islamic Republic of)] [Department of Engineering, Foolad Institute of Technology, FooladShahr 84916-63763, Isfahan (Iran, Islamic Republic of)

2014-01-15T23:59:59.000Z

479

Acid Initiation of Ammonia-Borane Dehydrogenation for Hydrogen...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Acid Initiation of Ammonia-Borane Dehydrogenation for Hydrogen Storage. Acid Initiation of Ammonia-Borane Dehydrogenation for Hydrogen Storage. Abstract: An abstract for this...

480

Characterizing Surface Acidic Sites in Mesoporous-Silica-Supported...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Surface Acidic Sites in Mesoporous-Silica-Supported Tungsten Oxide Catalysts Using Solid State NMR and Quantum Characterizing Surface Acidic Sites in Mesoporous-Silica-Supported...

Note: This page contains sample records for the topic "acid base-pair geometry" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

Lewis Acid-Base Interactions between Polysulfides and Metal Organic...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Lewis Acid-Base Interactions between Polysulfides and Metal Organic Framework in Lithium Sulfur Batteries. Lewis Acid-Base Interactions between Polysulfides and Metal Organic...

482

amino acid pattern: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Acid Sequence Analysis Pradipta Maji and Sankar K. Pal, Fellow, IEEE Abstract--In most pattern recognition algorithms, amino acids feature space. It is designed using an amino...

483

amino acid selective: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Acid Sequence Analysis Pradipta Maji and Sankar K. Pal, Fellow, IEEE Abstract--In most pattern recognition algorithms, amino acids feature space. It is designed using an amino...

484

amino acid selection: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Acid Sequence Analysis Pradipta Maji and Sankar K. Pal, Fellow, IEEE Abstract--In most pattern recognition algorithms, amino acids feature space. It is designed using an amino...

485

amino acid mutations: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Acid Sequence Analysis Pradipta Maji and Sankar K. Pal, Fellow, IEEE Abstract--In most pattern recognition algorithms, amino acids feature space. It is designed using an amino...

486

amino acid recognition: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Acid Sequence Analysis Pradipta Maji and Sankar K. Pal, Fellow, IEEE Abstract--In most pattern recognition algorithms, amino acids feature space. It is designed using an amino...

487

amino acid insertion: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

their distribution in known structures with experimental data such as amino acid transfer free energy scales (water to membrane center and water Senes, Alessandro 2 Amino Acid...

488

Selective Removal of Lanthanides from Natural Waters, Acidic...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Removal of Lanthanides from Natural Waters, Acidic Streams and Dialysate. Selective Removal of Lanthanides from Natural Waters, Acidic Streams and Dialysate. Abstract: The...

489

adenylic acid: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

preservation A Rauramaa A Tommila J Ltd, Espoo Reseach Centre, PO Box 44, 02271 Espoo, Finland Formic acid is known to improve silage hygienic quality. Formic acid based...

490

acid rain program: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

preservation A Rauramaa A Tommila J Ltd, Espoo Reseach Centre, PO Box 44, 02271 Espoo, Finland Formic acid is known to improve silage hygienic quality. Formic acid based...

491

Formation of iron complexs from trifluoroacetic acid based liquid...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of iron complexs from trifluoroacetic acid based liquid chromatography mobile phases as interference ions in liquid Formation of iron complexs from trifluoroacetic acid based...

492

Hydrogen-bond acidic functionalized carbon nanotubes (CNTs) with...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Hydrogen-bond acidic functionalized carbon nanotubes (CNTs) with covalently-bound hexafluoroisopropanol groups. Hydrogen-bond acidic functionalized carbon nanotubes (CNTs) with...

493

Membrane Stresses Induced by Overproduction of Free Fatty Acids...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Membrane Stresses Induced by Overproduction of Free Fatty Acids in Escherichia coli. Membrane Stresses Induced by Overproduction of Free Fatty Acids in Escherichia coli. Abstract:...

494

Electrodeposition From Acidic Solutions of Nickel Bis(benzenedithiolat...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

From Acidic Solutions of Nickel Bis(benzenedithiolate) Produces a Hydrogen-Evolving Ni-S Film on Glassy Carbon Electrodeposition From Acidic Solutions of Nickel...

495

acid bacteria inducing: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Summary: The Fate of Amino Acid in Soil Experiments: Bacteria, Roots and Fungi Melissa Campbell Clark of amino acid in soil using radioactive isotopes, however many experiments...

496

acid bacteria enhance: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

de 4 The Fate of Amino Acid in Soil Experiments: Bacteria, Roots and Fungi Melissa Campbell Environmental Sciences and Ecology Websites Summary: The Fate of Amino Acid in...

497

acid biosynthesis revealed: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Websites Summary: bioavailability of aluminum triggered by in- dustrialization and acid rain 20. The presence of organic acidsThe Metabolism of Aluminum Citrate and...

498

acid biosynthesis inhibitors: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Websites Summary: bioavailability of aluminum triggered by in- dustrialization and acid rain 20. The presence of organic acidsThe Metabolism of Aluminum Citrate and...

499

abscisic acid biosynthesis: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Websites Summary: bioavailability of aluminum triggered by in- dustrialization and acid rain 20. The presence of organic acidsThe Metabolism of Aluminum Citrate and...

500

aspartic acid racemization: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

rate of racemization for amino acids preserved in planktonic foraminifera climate change. Keywords: amino acid racemization, Quaternary geochronology, Arctic Ocean, planktonic...