Powered by Deep Web Technologies
Note: This page contains sample records for the topic "abstract switchgrass panicum" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Protoplast isolation and transient gene expression in switchgrass, Panicum virgatum L.  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Biotechnology Biotechnology Journal DOI 10.1002/biot.200700189 Biotechnol. J. 2008, 3, 354-359 354 © 2008 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim 1 Introduction Switchgrass (Panicum virgatum L.) is a warm-sea- son perennial grass that is a major component of the prairies of North America. It is grown in mono- culture for hay, grazing, and erosion control [1]. Also, switchgrass has a high biomass production potential as a feedstock for biofuel production [2, 3]. Genetic manipulation of the growth and devel- opment of switchgrass is needed for better cellu- losic ethanol production, especially to improve cel- lulose-to-lignin ratios. The latest genomic and biotechnology tools can be used for the production of designer plants for this purpose, which is immi- nently feasible. Several genes can make significant


Switchgrass (Panicum virgatum L.) cell suspension cultures: Establishment, characterization, and application  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

M. M. Mazarei, et al., Switchgrass (Panicum virgatum L.) cell suspension cultures: Establishment, charac- terization, and application, Plant Sci. (2011), doi:10.1016/j.plantsci.2010.12.010 ARTICLE IN PRESS G Model PSL-8356; No. of Pages 4 Plant Science xxx (2011) xxx-xxx Contents lists available at ScienceDirect Plant Science j o u r n a l h o m e p a g e : w w w . e l s e v i e r . c o m / l o c a t e / p l a n t s c i Switchgrass (Panicum virgatum L.) cell suspension cultures: Establishment, characterization, and application Mitra Mazarei a,b,∗ , Hani Al-Ahmad a,1 , Mary R. Rudis a,b , Blake L. Joyce a , C. Neal Stewart Jr. a,b a Department of Plant Sciences, The University of Tennessee, 252 Ellington Plant Sciences, 2431 Joe Johnson Dr., Knoxville, TN 37996, USA b The BioEnergy Science Center (BESC), Oak Ridge National Laboratory, Oak Ridge, TN 37831-6026, USA a r t i c l e i n f o Article history: Received


Gatewaycompatible vectors for highthroughput gene functional analysis in switchgrass (Panicum virgatum L.) and other monocot species  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Gateway-compatible Gateway-compatible vectors for high-throughput gene functional analysis in switchgrass (Panicum virgatum L.) and other monocot species David G.J. Mann 1,5,†* , Peter R. LaFayette 2,3,5 , Laura L. Abercrombie 1,5 , Zachary R. King 3,5 , Mitra Mazarei 1,5 , Mathew C. Halter 1 , Charleson R. Poovaiah 1,5 , Holly Baxter 1,5 , Hui Shen 4,5 , Richard A. Dixon 4,5 , Wayne A. Parrott 2,3,5 and C. Neal Stewart Jr 1,5 1 Department of Plant Sciences, The University of Tennessee, Knoxville, TN, USA 2 Department of Crop and Soil Sciences, The University of Georgia, Athens, GA, USA 3 Institute for Plant Breeding, Genetics & Genomics, The University of Georgia, Athens, GA, USA 4 Plant Biology Division, Samuel Roberts Noble Foundation, Ardmore, OK, USA 5 The BioEnergy Science Center, Oak Ridge National Laboratory, Oak Ridge, TN, USA Received 31 May 2011; revised 12 June 2011; accepted 10 August 2011.


Switchgrass (Panicum virgatum L.) Intraspecific Variation and Thermotolerance Classification Using in Vitro Seed Germination Assay  

SciTech Connect (OSTI)

Cardinal temperatures for plant processes have been used for thermotolerance screening of genotypes, geoclimatic adaptability determination and phenological prediction. Current simulation models for switchgrass (Panicum virgatum L.) utilize single cardinal temperatures across genotypes for both vegetative and reproductive processes although in-tra-specific variation exists among genotypes. An experiment was conducted to estimate the cardinal temperatures for seed germination of 14 diverse switchgrass genotypes and to classify genotypes for temperature tolerance. Stratified seeds of each genotype were germinated at eight constant temperatures from 10???°C to 45???°C under a constant light inten-sity of 35 ???¼mol???·m?¢????2???·s?¢????1 for 12 h???·d?¢????1. Germination was recorded at 6-h intervals in all treatments. Maximum seed germi-nation (MSG) and germination rate (GR), estimated by fitting Sigmoidal function to germination-time series data, var-ied among genotypes. Quadratic and bilinear models best described the MSG and GR responses to temperature, re-spectively. The mean cardinal temperatures, Tmin, Topt, and Tmax, were 8.1, 26.6, and 45.1???°C for MSG and 11.1, 33.1, and 46.0???°C for GR, respectively. Cardinal temperatures for MSG and GR; however, varied significantly among geno-types. Genotypes were classified as sensitive (?¢????Cave-in-rock?¢????, ?¢????Dacotah?¢????, ?¢????Expresso?¢????, ?¢????Forestburg?¢????, ?¢????Kanlow?¢????, ?¢????Sun-burst?¢????, ?¢????Trailblazer?¢???? and ?¢????Tusca?¢????), intermediate (?¢????Alamo?¢????, ?¢????Blackwell?¢????, ?¢????Carthage?¢????, ?¢????Shawnee?¢????, and ?¢????Shelter?¢????) and tol-erant (?¢????Summer?¢????) to high temperature based on cumulative temperature response index (CTRI) estimated by summing individual response indices estimated from the MSG and GR cardinal temperatures. Similarly, genotypes were also classified as sensitive (Alamo, Blackwell, Carthage, Dacotah, Shawnee, Shelter and Summer), moderately sensitive (Cave-in-rock, Forestburg, Kanlow, Sunburst, and Tusca), moderately tolerant (Trailblazer), and tolerant (Expresso) to low temperatures. The cardinal temperature estimates would be useful to improve switchgrass models for field applica-tions. Additionally, the identified cold- and heat-tolerant genotypes can be selected for niche environments and in switchgrass breeding programs to develop new genotypes for low and high temperature environments.

Seepaul, Ramdeo; Macoon, Bisoondat; Reddy, K. Raja; Baldwin, Brian



Advances in biotechnology and genomics of switchgrass  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Open Open Access Advances in biotechnology and genomics of switchgrass Madhugiri Nageswara-Rao 1,2* , Jaya R Soneji 2 , Charles Kwit 1 and C Neal Stewart Jr 1,3* Abstract Switchgrass (Panicum virgatum L.) is a C 4 perennial warm season grass indigenous to the North American tallgrass prairie. A number of its natural and agronomic traits, including adaptation to a wide geographical distribution, low nutrient requirements and production costs, high water use efficiency, high biomass potential, ease of harvesting, and potential for carbon storage, make it an attractive dedicated biomass crop for biofuel production. We believe that genetic improvements using biotechnology will be important to realize the potential of the biomass and biofuel-related uses of switchgrass. Tissue culture techniques aimed at rapid propagation of switchgrass and genetic transformation protocols have


Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

miR156 miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production Chunxiang Fu 1 , Ramanjulu Sunkar 2 , Chuanen Zhou 1 , Hui Shen 3,4 , Ji-Yi Zhang 3,4 , Jessica Matts 2 , Jennifer Wolf 1 , David G. J. Mann 4,5 , C. Neal Stewart Jr 4,5 , Yuhong Tang 3,4 and Zeng-Yu Wang 1,4, * 1 Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 2 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USA 3 Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 4 BioEnergy Science Center, Oak Ridge, TN, USA 5 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 10 October 2011; revised 8 December 2011; accepted 12 December 2011. *Correspondence (Tel 1-580-224 6830; fax 1-580-224 6802; email zywang@noble.org) Re-use


Physiological responses of switchgrass (Panicum virgatum L.) to organic and inorganic amended heavy-metal contaminated chat tailings  

SciTech Connect (OSTI)

Study plots established at the Galena subsite of the Cherokee County Superfund Site in Southeastern Kansas by the US Bureau of Mines in 1990 were examined during the summer of 1996 to determine whether physiological criteria could be used to determine suitability of switchgrass for remediation of heavy-metal contaminated substrates. Switchgrass was chosen because it was the most frequently encountered species on these plots. Treatment plots included a treatment control, an organic residue treatment of 89.6 Mg Ha{sup {minus}1} composted cattle manure, and two inorganic fertilizer treatments recommended for either native grass or grass/legume mixtures. Plant response variables were photosynthetic rate, leaf conductance to water vapor, internal concentration of carbon dioxide in leaves, foliar transpiration rate, leaf water-use-efficiency, predawn leaf xylem water potential, and midday leaf xylem water potential. Predawn and midday xylem water potentials were higher for grass/legume inorganic treatment than for the other inorganic treatments. Leaf conductances were lower for organically treated plots than those plots not organically amended and both photosynthesis and transpiration were lower for organically treated plots. Leaf conductances and transpiration were higher for grass/legume treated plots than for plots lacking inorganic treatment. Water-use-efficiency was higher for native grass inorganically treated plots than for other inorganic treatments.

Youngman, A.L. [Wichita State Univ., KS (United States). Dept. of Biological Sciences



A genome-wide survey of switchgrass genome structure and organization.  

E-Print Network [OSTI]

Switchgrass as a sutainable bioenergy crop. BioresourcePanicum virgatum) as a bioenergy feedstock in the UnitedStates. Biomass and Bioenergy 28: Parrish DJ, Fike JH (2005)



Switchgrass Biomass Production in the Midwest USA: Harvest and Nitrogen Management  

E-Print Network [OSTI]

Switchgrass Biomass Production in the Midwest USA: Harvest and Nitrogen Management Kenneth P. Vogel.,for switchgrass (Panicum virgatum L.) grown as a biomass or bioen- 1998; Brejda, 2000; Muir et al., 2001). The N and N rates for biomass produc- ment of switchgrass used for hay or grazing largely de- tion

Laughlin, Robert B.



SciTech Connect (OSTI)

Switchgrass (Panicum virgatum L.) is a native warm season perennial grass that has productive potential of up to 20 Mg ha-1 of biomass and it persists for decades when harvested once per year. Switchgrass provides excellent ground cover and soil stabilization once established and contributes to soil sequestration of new carbon. Slow establishment on newly reclaimed soil, however, provides for significant erosive opportunities thereby requiring initial soil stabilization with a cover crop. Several planting options were evaluated on two topsoil substitute soils. The planting options included: 1) an existing stand of bermudagrass (Cynodon dactylon L.) that was killed with glyphosate followed by disking in red oxidized topsoil substitute and prime farmland topsoil respread in 2007, 2) red oxidized topsoil substitute was seeded directly with switchgrass, 3) browntop millet (Panicum ramosum) was established with switchgrass, 4) or switchgrass was established in senescing browntop millet or wheat without tillage. Switchgrass was successfully established into a bermudagrass sod that had been killed with herbicides and disked as well as into a senescing stand of browntop millet or wheat. Significant soil erosion occurred on the disked area in 2008 leading to considerable repair work followed by planting wheat. Disked areas that did not erode had an excellent stand of switchgrass with 23.3 plants m-2 in November, 2008. Eroded areas replanted in April, 2009 into senescing wheat had 46 plants m-2 by July, 2009. The area planted directly into newly respread soil in May, 2009 was eroded severely by a 75 mm thunderstorm and was repaired, disked and replanted to switchgrass and browntop millet. Switchgrass seeded with browntop millet had a sparse switchgrass stand and was replanted to switchgrass in August, 2009. Rainfall volumes from August, 2009 to October, 2009 totaled 750 mm, but new erosion damage in areas successfully planted to switchgrass has been minimal.

Lang, David; Shankle, Brandon; Oswalt, Ernest; Duckworth, Jeremy; Sanborn, Judd; Buell, Rebecca; Roberson, Bill



Simulating Potential Switchgrass Production in the United States  

SciTech Connect (OSTI)

Using results from field trials of switchgrass (Panicum virgatum L.) in the United States, the EPIC (Environmental Policy Integrated Climate) process-level agroecosystem model was calibrated, validated, and applied to simulate potential productivity of switchgrass for use as a biofuel feedstock. The model was calibrated with a regional study of 10-yr switchgrass field trials and subsequently tested against a separate compiled dataset of field trials from across the eastern half of the country. An application of the model in a national database using 8-digit watersheds as the primary modeling unit produces 30-yr average switchgrass yield estimates that can be aggregated to 18 major watersheds. The model projects average annual switchgrass productivity of greater than 7 Mg ha-1 in the Upper Mississippi, Lower Mississippi, and Ohio watersheds. The major factors limiting simulated production vary by region; low precipitation is the primary limiting factor across the western half of the country, while moderately acidic soils limit yields on lands east of the Mississippi River. Average projected switchgrass production on all crop land in the continental US is 5.6 Mg ha-1. At this level of productivity, 28.6 million hectares of crop land would be required to produce the 16 billion gallons of cellulosic ethanol called for by 2022 in the 2007 Energy Independence and Security Act. The model described here can be applied as a tool to inform the land-use and environmental consequences of switchgrass production.

Thomson, Allison M.; Izaurralde, Roberto C.; West, T. O.; Parrish, David J.; Tyler, Donald D.; Williams, Jimmy R.



Evaluation of switchgrass as a sustainable bioenergy crop in Texas  

SciTech Connect (OSTI)

Switchgrass (Panicum virgatum L.) has been selected as a model herbaceous biomass feedstock by the U.S. Department of Energy. Texas A&M University/The Texas Agricultural Experiment Station was selected as one of three Regional Switchgrass Cultivar and Management Testing Centers in 1992 by Oak Ridge National Laboratory. Research in Texas encompasses (1) evaluating switchgrass germplasm at six locations, (2) determining defoliation, fertility, and row spacing response of switchgrass, (3) selecting for differential crown node evaluation and reduced seed dormancy in Alamo switchgrass, (4) basic studies on switchgrass morphology, and (5) response of switchgrass to land application of municipal and agricultural wastes. Research locations span a north-south range of 725 km. We report on results from Objective 1 in this paper. Alamo switchgrass has been one of the best performing cultivars at all locations with yields ranging from 8 to 20 Mg of dry biomass ha{sup -1}. Increased production of Alamo in response to N fertilizer was quadratic at Stephenville and linear at Beeville to the highest N rate used of 200 kg ha{sup -1}. There was a small response to 20 kg ha{sup -1} of P{sub 2}O{sub 5} in 1992 at Stephenville, but no response in later years or at Beeville. Row spacing has not had a consistent effect on switchgrass yield. Harvest frequency studies have shown that total seasonal yields are decreased as harvest frequency increases. We have made progress in selecting populations for enhanced and reduced crown node (subcoleoptile internode) elevation and in reduced post harvest seed dormancy.

Sanderson, M.A. [Texas A& M Univ. Agricultural Research and Extension Center, Stephenville, TX (United States); Hussey, M.A. [Texas A& M Univ. Agricultural Research and Extension Center, College Station, TX (United States); Ocumpaugh, W.R. [Texas A& M Univ. Agricultural Research and Extension Center, Beeville, TN (United States)



evaluation of the bioconversion of genetically modified switchgrass using simultaneous saccharification and fermentation ans a consolidated bioprocessing approach  

SciTech Connect (OSTI)

Abstract Background: The inherent recalcitrance of lignocellulosic biomass is one of the major economic hurdles for the production of fuels and chemicals from biomass. Additionally, lignin is recognized as having a negative impact on enzymatic hydrolysis of biomass, and as a result much interest has been placed on modifying the lignin pathway to improve bioconversion of lignocellulosic feedstocks. Results: Previous results showed down-regulation of the caffeic acid 3-O-methyl transferase (COMT) gene in the lignin pathway yielded switchgrass (Panicum virgatum) that was more susceptible to bioconversion after dilute acid pretreatment. Here we examined the response of these plant lines to milder pretreatment conditions with yeast-based SSF, CBP with Clostridium thermocellum, and fermentations with the cellulolytic extreme thermophiles, Caldicellulosiruptor bescii and Caldicellulosiruptor obsidiansis. Unlike the S. cerevisiae SSF conversions, fermentations of pretreated down-regulated COMT transgenic switchgrass with C. thermocellum showed an apparent inhibition of fermentation not observed in the wild-type switchgrass. This inhibition can be eliminated by hot water extraction of the pretreated biomass which resulted in superior conversion yield with transgenic versus wild-type switchgrass for C. thermocellum, also exceeding the yeast-based SSF yield. Further fermentation evaluation of the transgenic switchgrass indicated differential inhibition for the Caldicellulosiruptor strains, which could not be rectified by additional processing conditions. Gas chromatography-mass spectrometry metabolite profiling was used to examine the fermentation broth to elucidate the relative abundance of lignin derived aromatic compounds. The types and abundance of fermentation-derived lignin constituents varied between C. thermocellum and each of the Caldicellulosiruptor strains. Conclusions: The down-regulation of the COMT gene improves the bioconversion of switchgrass relative to the wild-type regardless of the pretreatment condition or fermentation microorganism. However, bacterial fermentations demonstrated strain-dependent sensitivity to the COMT transgenic biomass, likely due to additional soluble lignin pathway-derived constituents resulting from the COMT gene disruption. Removal of these inhibitory constituents permitted completion of fermentation by C. thermocellum, but not by the Caldicellulosiruptor strains. The reason for this difference needs to be explored further.

Yee, Kelsey L [ORNL; Rodriguez, Jr., Miguel [ORNL; Tschaplinski, Timothy J [ORNL; Engle, Nancy L [ORNL; Martin, Madhavi Z [ORNL; Fu, Chunxiang [Noble Foundation; Wang, Zeng-Yu [Noble Foundation; Hamilton-Brehm, Scott [ORNL; Mielenz, Jonathan R [ORNL



Why Sequence Switchgrass?  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Switchgrass? Switchgrass? A long-standing mission of the DOE has been to develop alternative sources of energy from biomass, and with good reason President George W. Bush specifically mentioned switchgrass as a promising energy crop in his 2006 State of the Union Address. This native grass has many traits that make it well suited for use as an energy feedstock. Yields of switchgrass are high, averaging 7 tons per acre in unirrigated field trials with some lines yielding up to 10 tons per acre. Production costs are low because of the plant's low nutrient use, minimal pesticide requirements, propagation by seed, and perennial growth habit. Switchgrass can be harvested with conventional haying equipment, and its wide adaptability allows it to be grown productively across a large geographic area, including marginal


Structural analysis of arabinoxylans isolated from ball-milled switchgrass biomass  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

analysis analysis of arabinoxylans isolated from ball-milled switchgrass biomass Koushik Mazumder, William S. York * Complex Carbohydrate Research Center, University of Georgia, 315 Riverbend Road, Athens, GA 30602, USA a r t i c l e i n f o Article history: Received 16 June 2010 Received in revised form 20 July 2010 Accepted 22 July 2010 Available online 30 July 2010 Keywords: Switchgrass Enzymatic digestion Arabinoxylan oligosaccharides Per-O-methylation Multiple-step mass spectrometry Structural analysis a b s t r a c t Ball-milled alcohol-insoluble residue (AIR) was prepared from switchgrass (Panicum virgatum var Alamo) and sequentially extracted with 50 mM ammonium oxalate buffer, 50 mM sodium carbonate, 1 M KOH containing 1% NaBH 4 , and 4 M KOH containing 1% NaBH 4 . Arabinoxylan was the most abundant component of the 1 M KOH-extracted fraction, which was treated with endoxylanase


Effects of torrefaction and densification on switchgrass pyrolysis products  

SciTech Connect (OSTI)

Abstract The pyrolysis behaviors of four types of pretreated switchgrass (torrefied at 230 and 270 C, densification, and torrefaction at 270 C followed by densification) were studied at three temperatures (500, 600, 700 C) using a pyroprobe attached to a gas chromatogram mass spectroscopy (Py-GC/MS). The torrefaction of switchgrass improved its oxygen to carbon ratio and energy content. Contents of anhydrous sugars and phenols in pyrolysis products of torrefied switchgrass were higher than those in pyrolysis products of raw switchgrass. As the torrefaction temperature increased from 230 to 270 C, the contents of anhydrous sugars and phenols in pyrolysis products increased whereas content of guaiacols decreased. High pyrolysis temperature (600 and 700 C as compared to 500 C) enhanced decomposition of lignin and anhydrous sugars, leading to increase in phenols, aromatics and furans. Densification enhanced depolymerization of cellulose and hemicellulose during pyrolysis.

Yang, Z; Sarkar, M; Kumar, A; Jaya Shankar Tumuluru; R.L. Huhnke



Chemical profiles of switchgrass  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

profiles profiles of switchgrass Zhoujian Hu a,b , Robert Sykes a,c , Mark F. Davis a,c , E. Charles Brummer a,d , Arthur J. Ragauskas a,b,e, * a BioEnergy Science Center, USA b School of Chemistry and Biochemistry, Institute of Paper Science and Technology, Georgia Institute of Technology, Atlanta, GA 30332, USA c National Renewable Energy Laboratory, 1617 Cole Blvd., Golden, CO 80401, USA d Institute for Plant Breeding, Genetics, and Genomics, Department of Crop and Soil Sciences, University of Georgia, Athens, GA 30602, USA e Forest Products and Chemical Engineering Department, Chemical and Biological Engineering, Chalmers University of Technology, SE-412 96 Göteborg, Sweden a r t i c l e i n f o Article history: Received 15 April 2009 Received in revised form 10 December 2009 Accepted 10 December 2009 Available online 13 January 2010 Keywords: Switchgrass Morphological components Chemical


Biomass Losses During Harvest and Storage of Switchgrass  

SciTech Connect (OSTI)

Estimates of dry matter losses during harvest and storage of herbaceous biomass are needed to determine harvest efficiency and net biomass yeild. Losses of switchgrass (Panicum virgatum L.) biomass stored in large round bales as affected by protected and unprotected conditions in three experiments during 1992 to 1995. We also measured the losses of dry matter (DM) during the harvesting operation each year and determined the quantity and quality of runoff water from stored bales during one year. In Experiment 1, "Alamo" switchgrass was harvested in August 1992 and stored in 275 kg bales unprotected outside and on a grass sod for six months. In Experiments 2 and 3, switchgrass was harvested in November of 1993 and 1994, respectively, and stored in 370 kg bales for one year inside on concrete, outside on a grass sod unprotected from the elements or outside on a gravel pad. In each experiment, the biomass was field dried to 11 to 19% moisture and baled. The bales were weighed at the beginning and end of the storage period to determine DM losses. In Experiemnt 1, DM losses during six months of storage were 13% of the original bale dry weight. In Experiemnts 2 and 3, there were no differences (P>0.05) in DM losses (average of 5%) among outside treatments during the 12 months of storage. There were no biomass losses for bales stored inside in Experiment 2; however, there was a 2% loss in Experiment 3. Loses of DM during baling ranged from 1 to 5% depending on moisture concentration in the biomass at baling. Larger losses were associated with drier biomass, presumably because of more shattering. Quality and quantity of runoff water from bales were not different (P>0.05) from runoff water of control plots.

Sanderson, M. A.; Egg, R. P.; Wiselogel, A. E.



Harvest management of switchgrass for biomass feedstock and forage production  

SciTech Connect (OSTI)

Switchgrass (Panicum virgatum L.), a warm-season perennial grass native to North America, has potential as a biomass energy crop. Their objective was to develop harvest management recommendations for biomass feedstock and forage production. Alamo switchgrass was established in 1992 at Stephenville and Dallas, TX. Four harvest frequencies (one to four cuts per year) and three final autumn harvests (Sept., Oct., or Nov.) were imposed from 1993 to 1996. Tiller densities were counted each spring. Neutral detergent fiber (NDF) and crude protein (CP) concentrations were measured in 1993 and 1994. Concentrations of NDF were lowest and of CP were highest in May-harvested biomass. Forage quality of regrowth decreased with age, reaching NDF concentrations of 790 g kg{sup {minus}1} and CP of < 20 g kg{sup {minus}1}. Total seasonal yields decreased as harvest frequency increased; however, a severe drought reversed this trend at Dallas in 1996. The highest yields occurred with a single harvest in mid-September. Delaying the final harvest until November reduced yields. Harvest date and frequency did not affect tiller density, although tiller density decreased from 900 to 650 and 630 to 310 m{sup {minus}2} at Dallas and Stephenville, respectively, during 1994 to 1997. Thus, a single mid-September harvest should maximize biomass yields in the south-central USA. A two-cut (spring-autumn) system may allow a farmer to use initial growth as forage and the regrowth for biomass, but total yields would be reduced. More frequent harvests would reduce yields further.

Sanderson, M.A.; Read, J.C.; Reed, R.L.




Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

MEDIA CONTACTS: Ron Walli DRAFT MEDIA CONTACTS: Ron Walli DRAFT Oak Ridge National Laboratory Communications & External Relations (865) 576-0226; wallira@ornl.gov J. Adam Calaway The Samuel Roberts Noble Foundation Office of Public Relations (580) 224-6209; jacalaway@noble.org New lignin 'lite' switchgrass boosts biofuel yield by more than one-third OAK RIDGE, Tenn., Feb. 14, 2011 - Bioethanol from new lines of native perennial prairie grass could become less costly because of plant engineering by The Samuel Roberts Noble Foundation and fermentation research at Oak Ridge National Laboratory. In a paper published in the Proceedings of the National Academy of Sciences, researchers describe their transgenic version of switchgrass as one that produces about one-third

Note: This page contains sample records for the topic "abstract switchgrass panicum" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Science Journals Connector (OSTI)

The abstracts are presented in order of increasing accession number. This number appears as the last line of each entry.




Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Reinforcement Project, DOEEIS - 0436 States Involved: Washington and Oregon Abstract: BPA is proposing to build a 500-kilovolt (kV) lattice-steel-tower transmission line that...


The Switchgrass Genome: Tools and Strategies  

E-Print Network [OSTI]

of the transgenes. Bioenerg. Res. 2:275283. doi:effi ciency in switchgrass. Bioenergy Res. 4:153164. doi:transformation. Biomass Bioenergy 35:10461054. doi:



Switchgrass: a Valuable Biomass Crop for Energy  

Science Journals Connector (OSTI)

The editor, Andrea Monti, assembled a group of distinguished authors who have not only provided comprehensive documentation of research conducted on switchgrass, but also unique and valuable analyses of this info...

David Bransby



The Switchgrass Genome: Tools and Strategies  

E-Print Network [OSTI]

L. ) using DNA markers. Th eor. Appl. Genet. 110:13721383.repeats in switchgrass. Th eor. Appl. Genet. 111:956964.gene pools, and cultivars. Th eor. Appl. Genet. 122:805817.



Logs Wood Chips Straw Corn Switchgrass  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Clean energy can come from the sun. The energy in wind can make electricity. Bioenergy comes from plants we can turn into fuel. Logs Wood Chips Straw Corn Switchgrass We can use...


Global Simulation of Bioenergy Crop Productivity: Analytical Framework and Case Study for Switchgrass  

SciTech Connect (OSTI)

A global energy crop productivity model that provides geospatially explicit quantitative details on biomass potential and factors affecting sustainability would be useful, but does not exist now. This study describes a modeling platform capable of meeting many challenges associated with global-scale agro-ecosystem modeling. We designed an analytical framework for bioenergy crops consisting of six major components: (i) standardized natural resources datasets, (ii) global field-trial data and crop management practices, (iii) simulation units and management scenarios, (iv) model calibration and validation, (v) high-performance computing (HPC) simulation, and (vi) simulation output processing and analysis. The HPC-Environmental Policy Integrated Climate (HPC-EPIC) model simulated a perennial bioenergy crop, switchgrass (Panicum virgatum L.), estimating feedstock production potentials and effects across the globe. This modeling platform can assess soil C sequestration, net greenhouse gas (GHG) emissions, nonpoint source pollution (e.g., nutrient and pesticide loss), and energy exchange with the atmosphere. It can be expanded to include additional bioenergy crops (e.g., miscanthus, energy cane, and agave) and food crops under different management scenarios. The platform and switchgrass field-trial dataset are available to support global analysis of biomass feedstock production potential and corresponding metrics of sustainability.

Kang, Shujiang [ORNL; Kline, Keith L [ORNL; Nair, S. Surendran [University of Tennessee, Knoxville (UTK); Nichols, Dr Jeff A [ORNL; Post, Wilfred M [ORNL; Brandt, Craig C [ORNL; Wullschleger, Stan D [ORNL; Wei, Yaxing [ORNL; Singh, Nagendra [ORNL




Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Adaptation of the SGT6-6000G to a Dynamic Adaptation of the SGT6-6000G to a Dynamic Power Generation Market Ed Bancalari - Manager, SGT6-6000G Frame Pedy Chan - Project Engineer, SGT6-6000G Frame POWER-GEN International 2005 - Las Vegas, Nevada December 6-8th Abstract This paper describes the U.S. market conditions in which the SGT6-6000G was designed and its evolution to accommodate the current and future market requirements. The U.S. market drivers during the SGT6-6000G design were deregulation and replacing the old base load generation, such as old coal plants, with high efficiency/output power and low emissions combined cycle plants. The SGT6-6000G was originally designed primarily for base load operation, but also with sufficient cyclic life margin on its critical components to make it inherently suitable for


The effect of Panicum coloratum on sheep and rabbits  

E-Print Network [OSTI]

, and others may have sensitized coronary bands. In such cases, the animals are lame for several days. A form of photosensitization observed in New Zealand is facial eczema. This ccnditicn was observed by sheep 8 ranchers in 1938, when a serious outbreak.... Several species of Panicum have been associated with the occurrence of photosensitization in animals. In 1946, Panicum miliaceum was associated with an outbreak of pho- tosensitization and death among lambs grazing on the plant in New Zealand. Panicum...

Muchiri, Daniel James



Molecular biology study of satellite panicum mosaic virus capsid protein  

E-Print Network [OSTI]

Satellite panicum mosaic virus (SPMV) depends on its helper Panicum mosaic virus (PMV) for replication and movement in host plants. The positive-sense single-stranded genomic RNA of SPMV encodes a 17-kDa capsid protein (CP) to form 16-nm virions...

Qi, Dong



Nitrogen use in switchgrass grown for bioenergy across the USA  

E-Print Network [OSTI]

Nitrogen use in switchgrass grown for bioenergy across the USA V.N. Owens a , D.R. Viands b , H Available online 17 August 2013 Keywords: Nitrogen removal Switchgrass Bioenergy Nitrogen use efficiency as a forage, conservation, and bioenergy crop [1e5]. It offers a number of distinct benefits including broad

Pawlowski, Wojtek


A Genomics Approach to Deciphering Lignin Biosynthesis in Switchgrass  

Science Journals Connector (OSTI)

...lignification in the dedicated energy crop switchgrass, as...than five times more energy than the energy expended during production...lignocellulosic biomass into renewable fuels is the release...for sugar release. The cost of processing to overcome...

Hui Shen; Mitra Mazarei; Hiroshi Hisano; Luis Escamilla-Trevino; Chunxiang Fu; Yunqiao Pu; Mary R. Rudis; Yuhong Tang; Xirong Xiao; Lisa Jackson; Guifen Li; Tim Hernandez; Fang Chen; Arthur J. Ragauskas; C. Neal Stewart; Jr.; Zeng-Yu Wang; Richard A. Dixon



A Genomics Approach to Deciphering Lignin Biosynthesis in Switchgrass  

Science Journals Connector (OSTI)

...lignification in the dedicated energy crop switchgrass, as well as...produce more than five times more energy than the energy expended during production, harvesting...of lignocellulosic biomass into renewable fuels is the release of fermentable...

Hui Shen; Mitra Mazarei; Hiroshi Hisano; Luis Escamilla-Trevino; Chunxiang Fu; Yunqiao Pu; Mary R. Rudis; Yuhong Tang; Xirong Xiao; Lisa Jackson; Guifen Li; Tim Hernandez; Fang Chen; Arthur J. Ragauskas; C. Neal Stewart; Jr.; Zeng-Yu Wang; Richard A. Dixon



Gasification performance of switchgrass pretreated with torrefaction and densification  

SciTech Connect (OSTI)

The purpose of this study was to investigate gasification performance of four switchgrass pretreatments (torrefaction at 230 and 270 C, densification, and combined torrefaction and densification) and three gasification temperatures (700, 800 and 900 C). Gasification was performed in a fixed-bed externally heated reactor with air as an oxidizing agent. Switchgrass pretreatment and gasification temperature had significant effects on gasification performance such as gas yields, syngas lower heating value (LHV), and carbon conversion and cold gas efficiencies. With an increase in the gasification temperature, yields of H2 and CO, syngas LHV, and gasifier efficiencies increased whereas CH4, CO2 and N2 yields decreased. Among all switchgrass pretreatments, gasification performance of switchgrass with combined torrefaction and densification was the best followed by that of densified, raw and torrefied switchgrass. Gasification of combined torrefied and densified switchgrass resulted in the highest yields of H2 (0.03 kg/kg biomass) and CO (0.72 kg/kg biomass), highest syngas LHV (5.08 MJ m-3), CCE (92.53%), and CGE (68.40%) at the gasification temperature of 900 C.

Jaya Shankar Tumuluru; Various



Do yield and quality of big bluestem and switchgrass feedstock decline over winter?  

SciTech Connect (OSTI)

Switchgrass (Panicum virgatum L.) and big bluestem (Andropogon gerdardii Vitman) are potential perennial bioenergy feedstocks. Feedstock storage limitations, labor constraints for harvest, and environmental benefits provided by perennials are rationales for developing localized perennial feedstock as an alternative or in conjunction with annual feedstocks (i.e., crop residues). Little information is available on yield, mineral, and thermochemical properties of native species as related to harvest time. The studys objectives were to compare the feedstock quantity and quality between grasses harvested in the fall or the following spring. It was hypothesized that biomass yield may decline, but translocation and/or leaching of minerals from the feedstock would improve feedstock quality. Feedstock yield did not differ by crop, harvest time, or their interactions. Both grasses averaged 6.0 Mg ha-1 (fall) and 5.4 Mg ha-1 (spring) with similar high heating value (17.7 MJ kg-1). The K/(Ca + Mg) ratio, used as a quality indicator declined to below a 0.5 threshold, but energy yield (Megajoule per kilogram) decreased 13% by delaying harvest until spring. Only once during the four study-years were conditions ideal for early spring harvest, in contrast during another spring, very muddy conditions resulted in excessive soil contamination. Early spring harvest may be hampered by late snow, lodging, and muddy conditions that may delay or prevent harvest, and result in soil contamination of the feedstock. However, reducing slagging/fouling potential and the mass of mineral nutrients removed from the field without a dramatic loss in biomass or caloric content are reasons to delay harvest until spring.

Jane M.F. Johnson; Garold L. Gresham



Making Biofuel From Corncobs and Switchgrass in Rural America | Department  

Broader source: Energy.gov (indexed) [DOE]

Biofuel From Corncobs and Switchgrass in Rural America Biofuel From Corncobs and Switchgrass in Rural America Making Biofuel From Corncobs and Switchgrass in Rural America June 11, 2010 - 4:48pm Addthis DuPont Danisco Cellulosic Ethanol (DDCE) opened a new biorefinery in Vonore, Tenn., last year. | Photo courtesy of DDCE DuPont Danisco Cellulosic Ethanol (DDCE) opened a new biorefinery in Vonore, Tenn., last year. | Photo courtesy of DDCE Lindsay Gsell Energy crops and agricultural residue, like corncobs and stover, are becoming part of rural America's energy future. Unlike the more common biofuel derived from corn, these are non-food/feed based cellulosic feedstocks, and the energy content of the biomass makes it ideal for converting to sustainable fuel. Last January in Vonore, Tenn., DuPont Danisco Cellulosic Ethanol (DDCE)


Biofuel, land and water: maize, switchgrass or Miscanthus?  

Science Journals Connector (OSTI)

The productive cellulosic crops switchgrass and Miscanthus are considered as viable biofuel sources. To meet the 2022 national biofuel target mandate, actions must be taken, e.g., maize cultivation must be intensified and expanded, and other biofuel crops (switchgrass and Miscanthus) must be cultivated. This raises questions on the use efficiencies of land and water; to date, the demand on these resources to meet the national biofuel target has rarely been analyzed. Here, we present a data-model assimilation analysis, assuming that maize, switchgrass and Miscanthus will be grown on currently available croplands in the US. Model simulations suggest that maize can produce 3.05.4kiloliters (kl) of ethanol for every hectare of land, depending on the feedstock to ethanol conversion efficiency; Miscanthus has more than twice the biofuel production capacity relative to maize, and switchgrass is the least productive of the three potential sources of ethanol. To meet the biofuel target, about 26.5 million hectares of land and over 90km3 of water (of evapotranspiration) are needed if maize grain alone is used. If Miscanthus was substituted for maize, the process would save half of the land and one third of the water. With more advanced biofuel conversion technology for Miscanthus, only nine million hectares of land and 45km3 of water would probably meet the national target. Miscanthus could be a good alternative biofuel crop to maize due to its significantly lower demand for land and water on a per unit of ethanol basis.

Qianlai Zhuang; Zhangcai Qin; Min Chen



Switchgrass is a promising, high-yielding crop for California biofuel  

E-Print Network [OSTI]

San Joaquin and Imperial valleys. Average biomass yieldsthe cool north to warm Imperial Valley in the south. In theSan Joaquin and Imperial valleys. Switchgrass had moderate



Switchgrass is a promising, high-yielding crop for California biofuel  

E-Print Network [OSTI]

al. 2008. Net energy of cellulosic ethanol from switchgrass.cellulosic ethanol has higher productivity and net energyenergy crops (biofuels). gasoline contains about 6% ethanol



Combined inactivation of the Clostridium cellulolyticum lactate and malate dehydrogenase genes substantially increases ethanol yield from cellulose and switchgrass fermentations  

E-Print Network [OSTI]

Keywords: Cellulose, ethanol, biofuel, Clostridiumincreases ethanol yield from cellulose and switchgrassincreases ethanol yield from cellulose and switchgrass


Note: This page contains sample records for the topic "abstract switchgrass panicum" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Translational Genomics for the Improvement of Switchgrass  

SciTech Connect (OSTI)

Our objectives were to apply bioinformatics and high throughput sequencing technologies to identify and classify the genes involved in cell wall formation in maize and switchgrass. Targets for genetic modification were to be identified and cell wall materials isolated and assayed for enhanced performance in bioprocessing. We annotated and assembled over 750 maize genes into gene families predicted to function in cell wall biogenesis. Comparative genomics of maize, rice, and Arabidopsis sequences revealed differences in gene family structure. In addition, differences in expression between gene family members of Arabidopsis, maize and rice underscored the need for a grass-specific genetic model for functional analyses. A forward screen of mature leaves of field-grown maize lines by near-infrared spectroscopy yielded several dozen lines with heritable spectroscopic phenotypes, several of which near-infrared (nir) mutants had altered carbohydrate-lignin compositions. Our contributions to the maize genome sequencing effort built on knowledge of copy number variation showing that uneven gene losses between duplicated regions were involved in returning an ancient allotetraploid to a genetically diploid state. For example, although about 25% of all duplicated genes remain genome-wide, all of the cellulose synthase (CesA) homologs were retained. We showed that guaiacyl and syringyl lignin in lignocellulosic cell-wall materials from stems demonstrate a two-fold natural variation in content across a population of maize Intermated B73 x Mo7 (IBM) recombinant inbred lines, a maize Association Panel of 282 inbreds and landraces, and three populations of the maize Nested Association Mapping (NAM) recombinant inbred lines grown in three years. We then defined quantitative trait loci (QTL) for stem lignin content measured using pyrolysis molecular-beam mass spectrometry, and glucose and xylose yield measured using an enzymatic hydrolysis assay. Among five multi-year QTL for lignin abundance, two for 4-vinylphenol abundance, and four for glucose and/or xylose yield, not a single QTL for aromatic abundance and sugar yield was shared. A genome-wide association study (GWAS) for lignin abundance and sugar yield of the 282-member maize Association Panel provided candidate genes in the eleven QTL and showed that many other alleles impacting these traits exist in the broader pool of maize genetic diversity. The maize B73 and Mo17 genotypes exhibited surprisingly large differences in gene expression in developing stem tissues, suggesting certain regulatory elements can significantly enhance activity of biomass synthesis pathways. Candidate genes, identified by GWAS or by differential expression, include genes of cell-wall metabolism, transcription factors associated with vascularization and fiber formation, and components of cellular signaling pathways. Our work provides new insights and strategies beyond modification of lignin to enhance yields of biofuels from genetically tailored biomass.

Carpita, Nicholas; McCann, Maureen



Switchgrass for Bioenergy held at the University of NebraskaLincoln  

E-Print Network [OSTI]

Switchgrass for Bioenergy held at the University of Nebraska­Lincoln Agricultural Research. Cenusa bioenergy, a USDA-funded research initiative, is investigating the creation of a sustainable Diagnostic Clinics Switchgrass for Bioenergy training session was conducted during the UNL Extension Late

Farritor, Shane


Purification of an Alpha Amylase Inhibitor from Seeds of Little Millet (Panicum sumatrens Roth)  

Science Journals Connector (OSTI)

An insect specific alpha-amylase inhibitor (?-Al) from seeds of...Panicum sumatrens...Roth) was isolated and purified to homogeneity following ammonium sulfate precipitation, successive chromatographic separation...

P. Rajendran; B. Thayumanavan



Virus vector gene inserts are stabilized in the presence of satellite panicum mosaic virus coat protein  

E-Print Network [OSTI]

The coat protein of satellite panicum mosaic virus (SPMV) was used to stabilize viral vector gene inserts in planta. A Potato virus X (PVX) vector carrying the SPMV capsid protein (CP) gene was successfully stabilized through three serial passages...

Everett, Anthany Laurence



Light utilization and competition between Echinacea purpurea, Panicum virgatum and Ratibida pinnata under greenhouse and field conditions  

Science Journals Connector (OSTI)

Competitive interactions were compared under field and greenhouse conditions for three representative tallgrass prairie species,...Echinacea purpurea, Panicum virgatum and Ratibida pinnata.... These were planted ...

Michael Knee; Laura C. Thomas



Biomass losses during harvest and storage of switchgrass  

SciTech Connect (OSTI)

We determined the effects of environmental factors on switchgrass biomass stored in large round bales as affected by protected and unprotected conditions in four experiments during 1991 to 1995. Additionally, we measured the losses of dry matter during the biomass harvesting process (cutting, drying, and baling) and determined the quantity and quality of runoff waste from stored bales. In Experiments 1 and 2, `Alamo` switchgrass was harvested in October 1991 and August 1992, respectively, and stored in 275-kg bales unprotected outside for six months. In Experiments 3 and 4, switchgrass was harvested in November of 1993 and 1994, respectively, and stored in 380-kg bales for one year. In each experiment, the biomass was field dried to less than 11 to 19% moisture and baled. Losses during baling in 1993 and 1994 were measured by collecting biomass at the baler and gleaned from the stubble. In 1993 and 1994, bales were stored inside on concrete, outside on a grass sod unprotected from the elements, or outside on a gravel pad. In each experiment, bales from each treatment were destructively sampled periodically to determine the depth of weathered biomass and composition of weathered and unweathered biomass. Most of the visible weathering in the bales occurred in the surface 7 to 15 cm in each experiment. In Experiment 2, losses during storage were 13% of the biomass initially present. In Experiment 3, there were no differences (P > 0.05) among outside storage treatments in losses of biomass during the 12 months (average of 4.7%). There were no biomass losses for bales stored inside. Losses of biomass during baling ranged from 1 to 5% depending on moisture concentration in the biomass at baling. Larger losses were associated with drier biomass, presumably because of more shattering. Quality and quantity of runoff water from bales were not different (P > 0.05) from runoff water of control plots.

Sanderson, M.A.; Egg, R.P.; Coble, C.G. [Texas A& M Univ., College Station, TX (United States)



Using electrical resistance probes for moisture determination in switchgrass windrows  

SciTech Connect (OSTI)

Determining moisture levels in windrowed biomass is important for both forage producers and researchers. Energy crops such as switchgrass have been troublesome when using the standard methods set for electrical resistance meters. The objectives of this study were to i) develop the methodologies needed to measure MC in switchgrass using electrical resistance meters, ii) to determine the effects of pressure and probe orientation on MC measurement and iii) to generate MC calibration equations for electrical resistance meters using switchgrass in the senescence growth stage. Two meters (Meter 1, Farmex HT-PRO; Meter 2, Delmhorst F-2000) were selected based on commercial availability. A forage compression apparatus was designed and constructed with on-farm materials and methods to provide a simple system of applying pressure achievable by any forage producer or researcher in the field. Two trials were performed to test four levels of moisture contents (10, 20, 30, and 40%), five pressures (0, 1.68, 3.11, 4.55, 6.22 kN/m 2; 0, 35, 65, 95, 130 lb/ft 2), and two probe orientations (axial and transverse) in a 4x5x2 factorial design. Results indicated that meter accuracy increased as pressure increased. Regression models accounted for 91% and 81% of the variation for Meter 1 and Meter 2 at a pressure of 4.55 kN/m 2 (95 lb/ft 2) and a transverse probe orientation. Calibration equations were developed for both meters to improve moisture measurement accuracy for farmers and researchers in the field.

Chesser Jr., G. D.; Davis, J. D.; Purswell, J. L.; Lemus, R.



Consolidated bioprocessing of transgenic switchgrass by an engineered and evolved Clostridium thermocellum strain  

SciTech Connect (OSTI)

Background: Switchgrass is an abundant and dedicated bioenergy feedstock however its inherent recalcitrance is one of the economic hurdles for producing biofuels. The down-regulation of the caffeic acid O-methyl transferase (COMT) gene in the lignin pathway of switchgrass reduced lignin content and S/G ratio, and the transgenic lines showed improved fermentation yield with S. cerevisiae and C. thermocellum (ATCC 27405) in comparison to the wild-type switchgrass. Results: Here we examine the fermentation potential of the COMT transgenic switchgrass and its wild-type line, with an engineered and evolved Clostridium thermocellum (M1570) strain. The fermentation of the transgenic switchgrass had superior conversion relative to the control line with an increase of 20% and ethanol was the primary metabolite accounting for 90% of the total metabolites measured by HPLC. Conclusions: The down-regulation of the COMT gene in switchgrass reduced recalcitrance and improved microbial bioconversion yield. Moreover, these results showed ethanol as the main fermentation metabolite produced by an engineered and evolved C. thermocellum strain grown on a transgenic switchgrass.

Yee, Kelsey L [ORNL; Rodriguez Jr, Miguel [ORNL; Thompson, Olivia A [ORNL; Fu, Chunxiang [Noble Foundation; Wang, Zeng-Yu [Noble Foundation; Davison, Brian H [ORNL; Mielenz, Jonathan R [ORNL



O R I G I N A L P A P E R Biolistic  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Biolistic Biolistic transformation of elite genotypes of switchgrass (Panicum virgatum L.) Zachary R. King * Adam L. Bray * Peter R. LaFayette * Wayne A. Parrott Received: 14 July 2013 / Revised: 25 September 2013 / Accepted: 18 October 2013 Ó Springer-Verlag Berlin Heidelberg 2013 Abstract Key message With a novel elite genotype, SA37, and an improved transformation protocol, it is now possible to routinely and efficiently engineer switchgrass using biolistic transformation. Abstract Transformation of elite switchgrass (Panicum virgatum L.) genotypes would facilitate the characterization of genes related to cell wall recalcitrance to saccharification. However, transformation of explants from switchgrass plants has remained difficult. Therefore, the objective of this study was to develop a biolistic transformation protocol for elite genotypes. Three switchgrass genotypes


Exploring Potential U.S. Switchgrass Production for Lignocellulosic Ethanol  

SciTech Connect (OSTI)

In response to concerns about oil dependency and the contributions of fossil fuel use to climatic change, the U.S. Department of Energy has begun a research initiative to make 20% of motor fuels biofuel based in 10 years, and make 30% of fuels bio-based by 2030. Fundamental to this objective is developing an understanding of feedstock dynamics of crops suitable for cellulosic ethanol production. This report focuses on switchgrass, reviewing the existing literature from field trials across the United States, and compiling it for the first time into a single database. Data available from the literature included cultivar and crop management information, and location of the field trial. For each location we determined latitude and longitude, and used this information to add temperature and precipitation records from the nearest weather station. Within this broad database we were able to identify the major sources of variation in biomass yield, and to characterize yield as a function of some of the more influential factors, e.g., stand age, ecotype, precipitation and temperature in the year of harvest, site latitude, and fertilization regime. We then used a modeling approach, based chiefly on climatic factors and ecotype, to predict potential yields for a given temperature and weather pattern (based on 95th percentile response curves), assuming the choice of optimal cultivars and harvest schedules. For upland ecotype varieties, potential yields were as high as 18 to 20 Mg/ha, given ideal growing conditions, whereas yields in lowland ecotype varieties could reach 23 to 27 Mg/ha. The predictive equations were used to produce maps of potential yield across the continental United States, based on precipitation and temperature in the long term climate record, using the Parameter-elevation Regressions on Independent Slopes Model (PRISM) in a Geographic Information System (GIS). Potential yields calculated via this characterization were subsequently compared to the Oak Ridge Energy Crop County Level data base (ORECCL), which was created at Oak Ridge National Laboratory (Graham et al. 1996) to predict biofuel crop yields at the county level within a limited geographic area. Mapped output using the model was relatively consistent with known switchgrass distribution. It correctly showed higher yields for lowland switchgrass when compared with upland varieties at most locations. Projections for the most northern parts of the range suggest comparable yields for the two ecotypes, but inadequate data for lowland ecotypes grown at high latitudes make it difficult to fully assess this projection. The final model is a predictor of optimal yields for a given climate scenario, but does not attempt to identify or account for other limiting or interacting factors. The statistical model is nevertheless an improvement over historical efforts, in that it is based on quantifiable climatic differences, and it can be used to extrapolate beyond the historic range of switchgrass. Additional refinement of the current statistical model, or the use of different empirical or process-based models, might improve the prediction of switchgrass yields with respect to climate and interactions with cultivar and management practices, assisting growers in choosing high-yielding cultivars within the context of local environmental growing conditions.

Gunderson, Carla A [ORNL; Davis, Ethan [ORNL; Jager, Yetta [ORNL; West, Tristram O. [ORNL; Perlack, Robert D [ORNL; Brandt, Craig C [ORNL; Wullschleger, Stan D [ORNL; Baskaran, Latha Malar [ORNL; Webb, Erin [ORNL; Downing, Mark [ORNL



R E S E A R C H A R T I C L E Genetic  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Genetic diversity and structure of natural and agronomic switchgrass (Panicum virgatum L.) populations Madhugiri Nageswara-Rao * C. Neal Stewart Jr. * Charles Kwit Received: 17 March 2012 / Accepted: 16 August 2012 Ó Springer Science+Business Media Dordrecht 2012 Abstract Panicum virgatum L. (switchgrass) is an obligate outcrossing C 4 perennial prairie grass cur- rently being pursued for the production of lignocellu- losic ethanol. Commercial production of switchgrass for bioenergy has increased substantially in the United States. Understanding the degree of native genetic diversity within and among switchgrass populations will facilitate effective germplasm improvement, conservation, and management programs. In this study, the genetic diversity and differentiation among natural and agronomic switchgrass populations were analyzed at the molecular level by


Physical insight into switchgrass dissolution in the ionic liquid 1-ethyl-3-methylimidazolium acetate  

SciTech Connect (OSTI)

Small-angle neutron scattering was used to characterize solutions of switchgrass and the constituent biopolymers cellulose, hemicellulose, and lignin, as well as a physical mixture of them mimicking the composition of switchgrass, dissolved in the ionic liquid (IL) 1-ethyl-3-methylimidazolium acetate. The results demonstrate that the IL dissolves the cellulose fibrils of switchgrass, although a supramolecular biopolymer network remains that is not present in solutions of the individual biopolymers and that does not self-assemble in a solution containing the physical mixture of the individual biopolymers. The persistence of a network-like structure indicates that dissolving switchgrass in the IL does not disrupt all of the physical entanglements and covalent linkages between the biopolymers created during plant growth. Reconstitution of the IL-dissolved switchgrass yields carbohydrate-rich material containing cellulose with a low degree of crystallinity, as determined by powder X-ray diffraction, which impacts potential down-stream uses of the biopolymers produced by the process. The data suggests that the use of chemical additives which would break bonds that exist between the lignin and hemicellulose might improve the purity of the resulting product, but may not be able to disrupt the highly physically-entangled biopolymer network sufficiently to facilitate their separation.

Wang, Hui [University of Alabama, Tuscaloosa] [University of Alabama, Tuscaloosa; Gurau, Gabriela [University of Alabama, Tuscaloosa] [University of Alabama, Tuscaloosa; Pingali, Sai Venkatesh [ORNL] [ORNL; O'Neil, Hugh [ORNL] [ORNL; Evans, Barbara R [ORNL] [ORNL; Urban, Volker S [ORNL] [ORNL; Heller, William T [ORNL] [ORNL; Rogers, Robin D [University of Alabama, Tuscaloosa] [University of Alabama, Tuscaloosa



Amber Waves of...Switchgrass? How about Sorghum? | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Amber Waves of...Switchgrass? How about Sorghum? Amber Waves of...Switchgrass? How about Sorghum? Amber Waves of...Switchgrass? How about Sorghum? October 28, 2011 - 5:09pm Addthis Matthew Loveless Matthew Loveless Data Integration Specialist, Office of Public Affairs What does this mean for me? For many counties, the expanding market for energy products made from biomass is a potential source of economic growth. Is your county one of them? As the fall harvest comes to an end in Marshall County, Kansas, farmers are already planning what crops they'll be planting next year. As they do, food might not be the only thing on their mind. According to the US Billion-Ton Update, a study sponsored by the Energy Department, by increasing production of energy crops and using more agricultural residues, including the non-food portion of plant material, this county is well


Structural changes in switchgrass lignin and hemicelluloses during pretreatments by NMR analysis  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

changes changes in switchgrass lignin and hemicelluloses during pretreatments by NMR analysis Reichel Samuel a, c , Marcus Foston a, c , Nan Jiang a, c , Lenong Allison a, c , Arthur J. Ragauskas a, b, c, * a School of Chemistry and Biochemistry, Georgia Institute of Technology, Atlanta, GA, USA b Institute of Paper Science and Technology, Georgia Institute of Technology, Atlanta, GA, USA c BioEnergy Science Center, USA a r t i c l e i n f o Article history: Received 14 May 2011 Received in revised form 13 August 2011 Accepted 25 August 2011 Available online xxx Keywords: Switchgrass Pretreatment HSQC NMR analysis Lignin a b s t r a c t Switchgrass is currently being developed as a sustainable bio-energy crop due to its broad adaptability, high mass yield and low agricultural input. Its current conversion to biofuels is detrimentally impacted by its native recalcitrance which is typically addressed using


Shoot dynamics of 'Alamo' switchgrass as influenced by defoliation and fertilization  

E-Print Network [OSTI]

of MASTER OF SCIENCE August 1981 Major Subject: Range Science SHOOT DYNAMICS OF 'ALAMO' SWITCHGRASS AS INFLUENCED BY DE1'OLIATION AND FERTILIZATION A Thesis by TOMMY DALE COPELAND Approved as to style and content by: CF1airman of Committees) g mber... of MASTER OF SCIENCE August 1981 Major Subject: Range Science SHOOT DYNAMICS OF 'ALAMO' SWITCHGRASS AS INFLUENCED BY DE1'OLIATION AND FERTILIZATION A Thesis by TOMMY DALE COPELAND Approved as to style and content by: CF1airman of Committees) g mber...

Copeland, Tommy Dale



The Mycorrhizal Fungus, Sebacina  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Mycorrhizal Mycorrhizal Fungus, Sebacina vermifera, Enhances Seed Germination and Biomass Production in Switchgrass (Panicum virgatum L) Sita R. Ghimire & Nikki D. Charlton & Kelly D. Craven Published online: 16 April 2009 # Springer Science + Business Media, LLC. 2009 Abstract Seed dormancy and slow seedling establishment are two major concerns in switchgrass (Panicum virgatum L.) production, often resulting in a poor stand with reduced productivity. Studies were conducted to investigate the stability of artificial associations between switchgrass and the ectomycorrhizal fungus, Sebacina vermifera, and to evaluate the potential benefits of this novel association in seed germination and biomass production. All six strains of S. vermifera tested had a high frequency of colonization on switchgrass roots of a synthetic cultivar NF/GA-993. The positive effects of the associations


An Improved Tissue Culture System  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Improved Improved Tissue Culture System for Embryogenic Callus Production and Plant Regeneration in Switchgrass (Panicum virgatum L.) Jason N. Burris & David G. J. Mann & Blake L. Joyce & C. Neal Stewart Jr. Published online: 10 October 2009 # Springer Science + Business Media, LLC. 2009 Abstract The increased emphasis on research of dedicated biomass and biofuel crops begs for biotechnology method improvements. For switchgrass (Panicum virgatum L.), one limitation is inefficient tissue culture and transformation systems. The objectives of this study were to investigate the utility of a new medium described here, LP9, for the production and maintenance of switchgrass callus and its regeneration, which also enables genetic transformation. LP9 medium is not based on Murashige and Skoog (MS) medium, the basal medium that all published switchgrass transformation has been


ORNL/TM-2007/183 Exploring Potential U.S. Switchgrass Production  

E-Print Network [OSTI]

ORNL/TM-2007/183 Exploring Potential U.S. Switchgrass Production for Lignocellulosic Ethanol August of any information, apparatus, product, or process disclosed, or represents that its use would not infringe privately owned rights. Reference herein to any specific commercial product, process, or service

Pennycook, Steve



E-Print Network [OSTI]

FARM NET INCOME IMPACT OF SWITCHGRASS PRODUCTION AND CORN STOVER COLLECTION FOR HEAT AND POWER and Corn Stover Collection for Heat and Power Generation Mitchell A. Myhre Advisor: Associate Professor heat and electric power. To perform this analysis, yield and production potentials were explored

Wisconsin at Madison, University of


The usability of switchgrass, rice straw, and logging residue as feedstocks for power generation in East Texas  

E-Print Network [OSTI]

This thesis examines the economic implications of using agriculturally based feedstock for bio-energy production in East Texas. Specifically I examined the use of switchgrass, rice straw, and logging residue as a feedstock for electrical power...

Hong, Sung Wook


Note: This page contains sample records for the topic "abstract switchgrass panicum" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Co-gasification of Biomass and Non-biomass Feedstocks: Synergistic and Inhibition Effects of Switchgrass Mixed with Sub-bituminous Coal and Fluid Coke During CO2 Gasification  

Science Journals Connector (OSTI)

Co-gasification of biomass, namely, switchgrass, with coal and fluid coke was performed to investigate the availability of the gasification catalysts to the mixed feedstock, especially alkali and alkaline earth elements, naturally present on switchgrass. ...

Rozita Habibi; Jan Kopyscinski; Mohammad S. Masnadi; Jill Lam; John R. Grace; Charles A. Mims; Josephine M. Hill



Changes in lignocellulosic supramolecular and ultrastructure during dilute acid pretreatment of Populus and switchgrass  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

lignocellulosic lignocellulosic supramolecular and ultrastructure during dilute acid pretreatment of Populus and switchgrass Marcus Foston, Art J. Ragauskas* BioEnergy Science Center, School of Chemistry and Biochemistry, Institute of Paper Science and Technology, Georgia Institute of Technology, 500 10th St., Atlanta, GA 30332, USA a r t i c l e i n f o Article history: Received 23 March 2009 Received in revised form 17 July 2010 Accepted 23 July 2010 Available online xxx Keywords: Dilute acid pretreatment Cellulose Supramolecular structure Populus Switchgrass a b s t r a c t Dilute acid pretreatment (DAP) is commonly employed prior to enzymatic deconstruction of cellulose to increase overall sugar and subsequent ethanol yields from downstream bioconversion processes. Typically optimization of pretreatment is evaluated by deter- mining hemicellulose removal, subsequent reactivity towards


Development of Kinetics and Mathematical Models for High Pressure Gasification of Lignite-Switchgrass Blends  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Kinetics and Mathematical Kinetics and Mathematical Models for High Pressure Gasification of Lignite-Switchgrass Blends Background Significant progress has been made in recent years in controlling emissions resulting from coal-fired electricity generation in the United States through the research, development, and deployment of innovative technologies such as gasification. Gasification is a process that converts solid feedstocks such as coal, biomass, or blends



Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Agrobacterium-Mediated Transformation of Switchgrass and Inheritance of the Transgenes Agrobacterium-Mediated Transformation of Switchgrass and Inheritance of the Transgenes Yajun Xi 1, 2 , Chunxiang Fu 1 , Yaxin Ge 1 , Rangaraj Nandakumar 1, 3 , Hiroshi Hisano 1, 3 , Joseph Bouton 1 and Zeng-Yu Wang 1, 3 Published online: 13 October 2009 Abstract Switchgrass (Panicum virgatum L.) has been developed into an important biofuel crop. Embryogenic calli induced from caryopses or inflorescences of the lowland switchgrass cultivar Alamo were used for Agrobacterium-mediated transformation. A chimeric hygromycin phosphotransferase gene (hph) was used as the selectable marker and hygromycin as the selection agent. Embryogenic calli were infected with Agrobacterium tumefaciens strain EHA105. Calli resistant to hygromycin were obtained after 5 to 8 weeks of selection. Soil-grown transgenic switchgrass plants were obtained 4 to 5 months after Agrobacterium infection. The transgenic nature



Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Home Registration Abstract Submission Proceedings Manuscript Review Conference Schedule Poster Session Satellite Workshops Conference Committee Accommodations Vendors Travel tips...



Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

& DEVELOPMENT: & DEVELOPMENT: PROGRAM ABSTRACTS Energy Efficiency and Renewable Energy Office of Transportation Technologies Office of Advanced Automotive Technologies Catalyst Layer Bipolar Plate Electrode Backing Layers INTEGRATED SYSTEMS Polymer Electrolyte Membrane Fuel Cells Fuel Cell Stack


Pilot-Scale Gasification of Corn Stover, Switchgrass, Wheat Straw, and Wood: 1. Parametric Study and Comparison with Literature  

Science Journals Connector (OSTI)

Pilot-Scale Gasification of Corn Stover, Switchgrass, Wheat Straw, and Wood: 1. Parametric Study and Comparison with Literature ... Chemical Reviews (Washington, DC, United States) (2006), 106 (9), 4044-4098 CODEN: CHREAY; ISSN:0009-2665. ... A review of the primary measures for tar elimination in biomass gasification processes Biomass Bioenergy 2003, 24, 125 140 ...

Daniel L. Carpenter; Richard L. Bain; Ryan E. Davis; Abhijit Dutta; Calvin J. Feik; Katherine R. Gaston; Whitney Jablonski; Steven D. Phillips; Mark R. Nimlos



Overexpression of the maize Corngrass1 microRNA prevents flowering, improves digestibility, and increases starch content of switchgrass  

Science Journals Connector (OSTI)

...accumulates in stems.Cg1 switchgrass aerial stems store starch and initiate both roots...maize . Plant Cell 6 : 1343 1355 . 28 Fukushima RS Hatfield RD ( 2004 ) Comparison of the acetyl bromide...CAAGTGCTACGGCAAGGAGG CGTGAGGGTCATTGTCTTCTGC 1. Fukushima RS, Hatfield RD (2004) Comparison...

George S. Chuck; Christian Tobias; Lan Sun; Florian Kraemer; Chenlin Li; Dean Dibble; Rohit Arora; Jennifer N. Bragg; John P. Vogel; Seema Singh; Blake A. Simmons; Markus Pauly; Sarah Hake



A National Assessment of Promising Areas for Switchgrass, Hybrid Poplar, or Willow Energy Crop Production  

SciTech Connect (OSTI)

The objective of this paper is to systematically assess the cropland acreage that could support energy crops and the expected farm gate and delivered prices of energy crops. The assessment is based on output from two modeling approaches: (1) the Oak Ridge County-Level Energy Crop (ORECCL) database (1996 version) and (2) the Oak Ridge Integrated Bioenergy Analysis System (ORIBAS). The former provides county-level estimates of suitable acres, yields, and farmgate prices of energy crops (switchgrass, hybrid poplar, willow) for all fifty states. The latter estimates delivered feedstock prices and quantities within a state at a fine resolution (1 km2) and considers the interplay between transportation costs, farmgate prices, cropland density, and facility demand. It can be used to look at any type of feedstock given the appropriate input parameters. For the purposes of this assessment, ORIBAS has been used to estimate farmgate and delivered switchgrass prices in 11 states (AL, FL, GA, IA, M N, MO, ND, NE, SC, SD, and TN). Because the potential for energy crop production can be considered from several perspectives, and is evolving as policies, economics and our basic understanding of energy crop yields and production costs change, this assessment should be viewed as a snapshot in time.

Graham, R.L.; Walsh, M.E.



Abstracting Preparation  

E-Print Network [OSTI]

Guidelines & Review Manuscript Preparation Submit Your Manuscript Book Reviews Movies & Videos Contact of Biological and Chemical Sciences. Queen Mary, University of London, Mile End Road, London, UK. Abstract Two motive force for energy conversion, providing for metabolism, for active transport, and for synthesis

Allen, John F.


Abstracting Preparation  

E-Print Network [OSTI]

, Massachusetts Institute of Technology, Cambridge, MA 2Engineering Systems Division, Massachusetts Institute, Massachusetts Institute of Technology, Cambridge, MA Abstract NASA's new direction for human spaceflight reaffirms that Mars is the ultimate goal of human exploration of the inner solar system. Eventually we

de Weck, Olivier L.


Enzyme Pretreatment of Grass Lignocellulose for Potential High-Value Co-products and an Improved Fermentable Substrate  

Science Journals Connector (OSTI)

Crops such as switchgrass (Panicum virgatum L.), bermudagrass (Cynodon dactylon L.), or napiergrass (Pennisetum purpureum Schumach.) have the capacity to produce large quantities of lignocellulose for biofuel (1)...

1|*|William F. Anderson; Joy Peterson



Network Abstractions:  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Abstractions: Abstractions: The first step towards a programmable WAN Inder Monga TIP 2013 January 15 th , 2013 Lawrence Berkeley National Laboratory U.S. Department of Energy | Office of Science Ongoing Science Revolution Data-intensive Science * Era of 'Big-Data' Exascale, HPC and Future Data Centers * Optics to the end 12/18/12 2 Inder Monga, OTS Demo Lawrence Berkeley National Laboratory U.S. Department of Energy | Office of Science Data Integration Bringing together 'big-data' from various sources Dataset Experiment Data Simulation Data Observation Data Source: Kathy Yelick Lawrence Berkeley National Laboratory U.S. Department of Energy | Office of Science Distributed Data, consolidated computation Elephant Flows: 'big-data' movement for Science, end-to-end


Development of a Low Input and sustainable Switchgrass Feedstock Production System Utilizing Beneficial Bacterial Endophytes  

SciTech Connect (OSTI)

Switchgrass represents a promising feedstock crop for US energy sustainability. However, its broad utilization for bioenergy requires improvements of biomass yields and stress tolerance. In this DOE funded project, we have been working on harnessing beneficial bacterial endophytes to enhance switchgrass performance and to develop a low input feedstock production system for marginal lands that do not compete with the production of food crops. We have demonstrated that one of most promising plant growth-promoting bacterial endophytes, Burkholderia phytofirmans strain PsJN, is able to colonize roots and significantly promote growth of switchgrass cv. Alamo under in vitro, growth chamber, greenhouse, as well as field conditions. Furthermore, PsJN bacterization improved growth and development of switchgrass seedlings, significantly stimulated plant root and shoot growth, and tiller number in the field, and enhanced biomass accumulation on both poor (p<0.001) and rich (p<0.05) soils, with more effective stimulation of plant growth in low fertility soil. Plant physiology measurements showed that PsJN inoculated Alamo had consistently lower transpiration, lower stomatal conductance, and higher water use efficiency in greenhouse conditions. These physiological changes may significantly contribute to the recorded growth enhancement. PsJN inoculation rapidly results in an increase in photosynthetic rates which contributes to the advanced growth and development. Some evidence suggests that this initial growth advantage decreases with time when resources are not limited such as in greenhouse studies. Additionally, better drought resistance and drought hardening were observed in PsJN inoculated switchgrass. Using the DOE-funded switchgrass EST microarray, in a collaboration with the Genomics Core Facility at the Noble Foundation, we have determined gene expression profile changes in both responsive switchgrass cv. Alamo and non-responsive cv. Cave-in-Rock (CR) following PsJN bacterization. With the MapMan software to analyze microarray data, the number of up- and down-regulated probes was calculated. The number of up-regulated probes in Alamo was 26, 14, 14, and 12% at 0.5, 2, 4 and 8 days after inoculation (DAI) with PsJN, respectively while the corresponding number in CR was 24, 22, 21, and 19%, respectively. In both cultivars, the largest number of up-regulated probes occurred at 0.5 DAI. Noticeable differences throughout the timeframe between Alamo and CR were that the number was dramatically decreased to half (12%) in Alamo but remained high in CR (approximately 20%). The number of down regulated genes demonstrated different trends in Alamo and CR. Alamo had an increasing trend from 9% at 0.5 DAI to 11, 17, and 28% at 2, 4, and 8 DAI, respectively. However, CR had 13% at 0.5 and 2 DAI, and declined to 10% at 4 and 8 DAI. With the aid of MapMan and PageMan, we mapped the response of the ID probes to the observed major gene regulatory network and major biosynthetic pathway changes associated with the beneficial bacterial endophyte infection, colonization, and early growth promotion process. We found significant differences in gene expression patterns between responsive and non-responsive cultivars in many pathways, including redox state regulation, signaling, proteolysis, transcription factors, as well as hormone (SA and JA in particular)-associated pathways. Form microarray data, a total of 50 key genes have been verified using qPCR. Ten of these genes were chosen for further functional study via either overexpression and/or RNAi knockout technologies. These genes were calmodulin-related calcium sensor protein (CAM), glutathione S-transferase (GST), histidine-containing phosphotransfer protein (H-221), 3 different zinc finger proteins (ZF-371, ZF131 and ZF242), EF hand transcription factor (EF-622), peroxidase, cellulose synthase catalytic submit A2 (CESA2), and Aux/IAA family. A total of 8 overexpression and 5 RNAi transgenic plants have been regenerated, and their gene expression levels determined using qPCR. Consequently

Mei, Chuansheng [IALR; Nowak, Jerzy [VPISU; Seiler, John [VPISU



Structural Characterization  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Characterization Characterization and Comparison of Switchgrass Ball-milled Lignin Before and After Dilute Acid Pretreatment Reichel Samuel & Yunqiao Pu & Babu Raman & Arthur J. Ragauskas Received: 25 April 2009 / Accepted: 10 August 2009 # Humana Press 2009 Abstract To reduce the recalcitrance and enhance enzymatic activity, dilute H 2 SO 4 pretreatment was carried out on Alamo switchgrass (Panicum virgatum). Ball-milled lignin was isolated from switchgrass before and after pretreatment. Its structure was characterized by 13 C, HSQC, and 31 P NMR spectroscopy. It was confirmed that ball-milled switchgrass lignin is of HGS type with a considerable amount of p-coumarate and felurate esters of lignin. The major ball-milled lignin interunit was the β-O-4 linkage, and a minor amount of phenylcoumarin, resinol, and spirodienone units were also present. As a result of the acid pretreatment,


Cellulose solventbased biomass pretreatment breaks highly ordered hydrogen bonds in cellulose fibers of switchgrass  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Solvent-Based Solvent-Based Biomass Pretreatment Breaks Highly Ordered Hydrogen Bonds in Cellulose Fibers of Switchgrass Noppadon Sathitsuksanoh, 1,2 Zhiguang Zhu, 1 Sungsool Wi, 3 Y.-H. Percival Zhang 1,2,4 1 Biological Systems Engineering Department, Virginia Polytechnic Institute and State University (Virginia Tech), 210-A Seitz Hall, Blacksburg, Virginia 24061; telephone: 540-231-7414, fax: 540-231-3199; e-mail: ypzhang@vt.edu 2 Institute for Critical Technology and Applied Science (ICTAS), Virginia Polytechnic Institute and State University, Blacksburg, Virginia 3 Chemistry Department, Virginia Polytechnic Institute and State University, Blacksburg, Virginia 4 DOE BioEnergy Science Center (BESC), Oak Ridge, Tennessee Received 25 June 2010; revision received 23 August 2010; accepted 4 October 2010 Published online 21 October 2010 in Wiley Online Library (wileyonlinelibrary.com).


Soil and variety effects on energy use and carbon emissions associated with switchgrass-based ethanol production in Mississippi  

SciTech Connect (OSTI)

High biomass production potential, wide adaptability, low input requirement, and low environmental risk make switchgrass an economically and ecologically viable energy crop.The inherent variablity in switchgrass productivity due to variations in soil and variety could affect the sustainability and eco-friendliness of switchgrass-based ethanol production. This study examined the soil and variety effects on these variables. Three locations in Mississippi were selected based on latitude and potential acreage. Using ALMANAC, switchgrass biomass yields were simulated for several scenarios of soils and varities. The simulated yields were fed to IBSAL to compute energy use and CO2 emissions in various operations in the biomass supply From the energy and emissions values, the sustainability and eco-friendliness of ethanol production were determined using net energy value (NEV) and carbon credit balance (CCB) as indicators, respectively. Soil and variety effects on NEV and CCB were analyzed using the Kruskal-Wallis test. Results showed significant differences in NEV and CCB across soils and varieties. Both NEV and CCB increased in the direction of heavier to lighter soils and on the order of north-upland , south-upland, north-lowland, and south-lowland varieties. Only north-upland and south-lowland varieties were significantly significantly different because they were different in both cytotype and ecotype. Gaps between lowland and upland varieties were smaller in a dry year than in a wet year. The NEV and CCB increased in the direction of dry to wet year. From south to north, they decreased for lowland cytotypes but increased for upland cytotypes. Thus, the differences among varieties decreased northwards.

Woli, Prem; Paz, Joel O.; Baldwin, Brian S.; Lang, David J.; Kiniry, James R.




SciTech Connect (OSTI)

Biomass preprocessing and pretreatment technologies such as size reduction and chemical preconditioning are aimed at reducing the cost of ethanol production from lignocellulosic biomass. Size reduction is an energy-intensive biomass preprocessing unit operation. In this study, switchgrass, wheat straw, and corn stover were chopped in an instrumented knife mill to evaluate size reduction energy and corresponding particle size distribution as determined with a standard forage sieve analyzer. Direct mechanical power inputs were determined using a dedicated data acquisition system for knife mill screen openings from 12.7 to 50.8 mm, rotor speeds between 250 and 500 rpm, and mass feed rates from 1 to 11 kg/min. A speed of 250 rpm gave optimum performance of the mill. Optimum feed rates for 25.4 mm screen and 250 rpm were 7.6, 5.8, and 4.5 kg/min for switchgrass, wheat straw, and corn stover, respectively. Total specific energy (MJ/Mg) was defined as the size reduction energy required to operate the knife mill plus that imparted to the biomass. Effective specific energy was defined as the energy imparted to the biomass. For these conditions, total specific energies were 27.3, 37.9, and 31.9 MJ/Mg and effective specific energies were 10.1, 15.5, and 3.2 MJ/Mg for switchgrass, wheat straw, and corn stover, respectively. These results demonstrated that biomass selection affects the size reduction energy, even for biomass with similar features. Second-order polynomial equations for the total specific energy requirement fitted well (R2 > 0.95) as a function of knife mill screen size, mass feed rate, and speed for biomass materials tested. The Rosin-Rammler equation fitted the cumulative undersize mass of switchgrass, wheat straw, and corn stover chop passed through ASABE sieves with high R2 (>0.983). Knife mill chopping of switchgrass, wheat straw, and corn stover resulted in particle size distributions classified as 'well-graded strongly fine-skewed mesokurtic', 'well-graded fine-skewed mesokurtic', and 'well-graded fine-skewed mesokurtic', respectively, for small knife mill screen sizes (12.7 to 25.4 mm) and distributions classified as 'well-graded fine-skewed mesokurtic', 'well-graded strongly fine-skewed mesokurtic', and 'well-graded fine-skewed mesokurtic', respectively, for the large screen size (50.8 mm). Total and effective specific energy values per unit size reduction of wheat straw were greater compared to those for switchgrass. Corn stover resulted in reduced total and effective specific energy per unit size reduction compared to wheat straw for the same operating conditions, but higher total specific energy per unit size reduction and lesser effective specific energy per unit size reduction compared to switchgrass. Data on minimized total specific energy with corresponding particle spectra will be useful for preparing feed material with a knife mill for subsequent grinding with finer size reduction devices.

Bitra, V.S.P. [University of Tennessee, Knoxville (UTK); Womac, A.R. [University of Tennessee, Knoxville (UTK); Sokhansanj, Shahabaddine [ORNL; Igathinathane, C. [North Dakota State University



Introduction Abstract reflection groups and abstract buildings  

E-Print Network [OSTI]

Introduction Abstract reflection groups and abstract buildings Their geometric realizations Compactly supported cohomology L2 -cohomology Cohomology of Coxeter groups and buildings Mike Davis (work groups and buildings #12;Introduction Abstract reflection groups and abstract buildings Their geometric

Vogtmann, Karen


Rapid Assessment  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Assessment Assessment of Lignin Content and Structure in Switchgrass (Panicum virgatum L.) Grown Under Different Environmental Conditions David G. J. Mann & Nicole Labbé & Robert W. Sykes & Kristen Gracom & Lindsey Kline & Isabella M. Swamidoss & Jason N. Burris & Mark Davis & C. Neal Stewart Jr. Published online: 13 October 2009 # Springer Science + Business Media, LLC. 2009 Abstract Switchgrass (Panicum virgatum L.) is a candi- date feedstock in bioenergy, and plant breeding and molecular genetic strategies are being used to improve germplasm. In order to assess these subsequent modifica- tions, baseline biomass compositional data are needed in a relevant variety of environments. In this study, switch- grass cv. Alamo was grown in the field, greenhouse, and growth chamber and harvested into individual leaf and stem tissue components. These components

Note: This page contains sample records for the topic "abstract switchgrass panicum" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

glacial glacial evolution of Panicum virgatum: centers of diversity and gene pools revealed by SSR markers and cpDNA sequences Yunwei Zhang * Juan E. Zalapa * Andrew R. Jakubowski * David L. Price * Ananta Acharya * Yanling Wei * E. Charles Brummer * Shawn M. Kaeppler * Michael D. Casler Received: 17 March 2011 / Accepted: 4 July 2011 / Published online: 23 July 2011 Ó Springer Science+Business Media B.V. (outside the USA) 2011 Abstract Switchgrass (Panicum virgatum), a central and Eastern USA native, is highly valued as a component in tallgrass prairie and savanna restoration and conservation projects and a potential bioenergy feedstock. The purpose of this study was to identify regional diversity, gene pools, and centers-of-diversity of switchgrass to gain an under- standing of its post-glacial evolution and to identify both the geographic range and potential overlap between func- tional


Transforming Abstract Interpretations by Abstract Interpretation  

E-Print Network [OSTI]

an instance of the same abstract interpretation frame- work lifted to higher types, i.e. where the objectsTransforming Abstract Interpretations by Abstract Interpretation New Challenges in Language - Verona, Italy (roberto.giacobazzi|isabella.mastroeni)@univr.it Abstract. In this paper we exploit

Giacobazzi, Roberto



Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

PL PL ANT GENOME NOVEMBER 2011 VOL. 4, NO. 3 273 SPECIAL SUBMISSIONS The Switchgrass Genome: Tools and Strategies Michael D. Casler, Christian M. Tobias, Shawn M. Kaeppler, C. Robin Buell, Zeng-Yu Wang, Peijian Cao, Jeremy Schmutz, and Pamela Ronald* Abstract Switchgrass (Panicum virgatum L.) is a perennial grass species receiving signifi cant focus as a potential bioenergy crop. In the last 5 yr the switchgrass research community has produced a genetic linkage map, an expressed sequence tag (EST) database, a set of single nucleotide polymorphism (SNP) markers that are distributed across the 18 linkage groups, 4x sampling of the P. virgatum AP13 genome in 400-bp reads, and bacterial artifi cial chromosome (BAC) libraries containing over 200,000 clones. These studies



Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Characterization Characterization of the Rust Fungus, Puccinia emaculata, and Evaluation of Genetic Variability for Rust Resistance in Switchgrass Populations Srinivasa Rao Uppalapati & Desalegn D. Serba & Yasuhiro Ishiga & Les J. Szabo & Shipra Mittal & Hem S. Bhandari & Joseph H. Bouton & Kirankumar S. Mysore & Malay C. Saha # The Author(s) 2012. This article is published with open access at Springerlink.com Abstract Several fungal pathogens have been identified on ornamental and native stands of switchgrass (Panicum virga- tum L.). Diseases of switchgrass, particularly rust, have been largely neglected and are likely to become the major limiting factor to biomass yield and quality, especially when monocul- tured over a large acreage. Based on teliospore morphology and internal transcribed spacer-based diagnostic primers, the rust pathogen collected


Fu et al 2011 In Press.pdf  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Downregulation Downregulation of Cinnamyl Alcohol Dehydrogenase (CAD) Leads to Improved Saccharification Efficiency in Switchgrass Chunxiang Fu & Xirong Xiao & Yajun Xi & Yaxin Ge & Fang Chen & Joseph Bouton & Richard A. Dixon & Zeng-Yu Wang # Springer Science+Business Media, LLC. 2010 Abstract The bioconversion of carbohydrates in the herba- ceous bioenergy crop, switchgrass (Panicum virgatum L.), is limited by the associated lignins in the biomass. The cinnamyl alcohol dehydrogenase (CAD) gene encodes a key enzyme which catalyzes the last step of lignin monomer biosynthesis. Transgenic switchgrass plants were produced with a CAD RNAi gene construct under the control of the maize ubiquitin promoter. The transgenic lines showed reduced CAD expression levels, reduced enzyme activities, reduced lignin content, and altered lignin composition. The modification


National-Level Infrastructure and Economic Effects of Switchgrass Cofiring with Coal in Existing Power Plants for Carbon Mitigation  

Science Journals Connector (OSTI)

Limiting individual power plant cofiring rates to 20% (on an energy basis) to avoid boiler replacement results in 74% of available switchgrass consumed and 256 million tons CO2 per year mitigated (12% of year 2000 coal power plant CO2 emissions). ... Assuming that U.S. federal policy continues to remain neutral on carbon emissions and individual states decide their own carbon mitigation strategies, state legislators should consider their neighboring states environmental legislative directions prior to estimating benefits from their own biomass energy legislative goals as this could have a significant impact on COM. ... Since biomass will have competitive uses, renewable portfolio policies should consider where biomass will provide the greatest carbon mitigating benefits at the lowest price instead of simply requiring a certain percent of electricity or transportation energy to come from renewable sources. ...

William R. Morrow; W. Michael Griffin; H. Scott Matthews



AbstractAbstract Improving efficiency of thermoelectric  

E-Print Network [OSTI]

-classical transport models used to predict ZT can effectively predict thermoelectric performance of bulk materials Material PerformanceThermoelectric Material Performance 0 0.5 1 1.5 2 2.5 3 1950 1960 1970 1980 1990 2000AbstractAbstract · Improving efficiency of thermoelectric energy conversion devices is a major

Walker, D. Greg



Broader source: Energy.gov (indexed) [DOE]

CALL FOR ABSTRACTS CALL FOR ABSTRACTS For the 2014 National Environmental Justice Conference and Training Program (Due to the recent Federal Government Shutdown, the dates for the submission and acceptance of Abstracts have been extended as set forth below) The 2014 National Environmental Justice Conference and Training Program planners are inviting individuals to submit abstracts, not to exceed two pages, related to environmental justice. Each abstract should include the submitter's name, affiliation and full contact information. The overall conference theme is Enhancing Communities Through Capacity Building and Technical Assistance. The subtheme for the 2014 conference is: Environmental Justice: The Next Twenty Years. The conference planners are interested in panel presentations,


SSRL30 Abstracts  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Users' Meeting. Please use the abstract submission form via the web. Poster Session Posters will be displayed throughout the meeting and will be highlighted during a poster...


Abstract 1. Introduction  

E-Print Network [OSTI]

Apr 11, 2008 ... Abstract. This paper presents a general technique to develop approximation .... the hub location problem in the work by Ge et al. [14].




Broader source: Energy.gov (indexed) [DOE]

CALL FOR ABSTRACTS CALL FOR ABSTRACTS For the 2013 National Environmental Justice Conference and Training Program The 2013 National Environmental Justice Conference and Training Program planners are inviting individuals to submit abstracts of no less than 1 page and no more than 2 pages related to environmental justice. The conference will focus on Enhancing Communities Through Capacity Building and Technical Assistance. However, all environmental justice related abstracts will be considered. Individuals selected to present or moderate will serve on a voluntary basis. All moderators and presenters MUST register for the conference. Since the registration is free for most participants, conference travel expenses and hotel accommodations will be at the participant's expense. Each abstract should include the submitter's


Biomass Fractionation for the Biorefinery: Heteronuclear Multiple Quantum CoherenceNuclear Magnetic Resonance Investigation of Lignin Isolated from Solvent Fractionation of Switchgrass  

Science Journals Connector (OSTI)

Biomass Fractionation for the Biorefinery: Heteronuclear Multiple Quantum CoherenceNuclear Magnetic Resonance Investigation of Lignin Isolated from Solvent Fractionation of Switchgrass ... Center for Renewable Carbon, Center for Direct Catalytic Conversion of Biomass to Biofuels (C3Bio), University of Tennessee, 2506 Jacob Drive, Knoxville, Tennessee 37996, United States ... The results show that solvent fractionation conditions between about 120 C and 0.1 M H2SO4 and 160 C and 0.025 M H2SO4 are optimal for separating biomass in the biorefinery to give process streams most suitable for biobased fuel and chemical production. ...

Joseph J. Bozell; C. J. O'Lenick; Stacy Warwick



SSRL28 Abstract Submission  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Visitor Info Visitor Info General Info Need more information? Contact: Cathy Knotts Manager, URA SSRL, MS 99 2575 Sand Hill Road Menlo Park, CA 94025 28th Annual Stanford Synchrotron Radiation Laboratory Users' Meeting Menlo Park, California USA October 17-19, 2001 Oral Abstract Submissions - Due August 24 Poster Abstract Submissions - Due September 28 Users are invited to submit abstracts highlighting research activities conducted over the past year at SSRL for poster presentations at the Users' Meeting. Please use the abstract submission form via the web. POSTER SESSION Posters will be displayed throughout the meeting and will be highlighted during a poster session and reception on Thursday, October 19. The poster session will be located just steps away from the main auditorium and the vendor display area. Users presenting posters must also register for the Users' Meeting.


Computer Abstractions and Technology  

E-Print Network [OSTI]

& wheel Supersedes roller-ball mechanical mouse #12;Chapter 1 -- Computer Abstractions and Technology to building sized Embedded computers Hidden as components of systems Stringent power of machine instructions executed per operation Processor and memory system Determine how fast instructions

Huang, Chun-Hsi


C Goldschmidt Abstracts 2012  

Science Journals Connector (OSTI)

...sedimentary formation and aquifers turn oxic upon groundwater over-abstraction or fracking fluid intrusion. Many...shallow ground-water aquifers may threaten the long-term...leakage into freshwater aquifers is a major concern accompanying...


Abstracts of contributed papers  

SciTech Connect (OSTI)

This volume contains 571 abstracts of contributed papers to be presented during the Twelfth US National Congress of Applied Mechanics. Abstracts are arranged in the order in which they fall in the program -- the main sessions are listed chronologically in the Table of Contents. The Author Index is in alphabetical order and lists each paper number (matching the schedule in the Final Program) with its corresponding page number in the book.

Not Available




Broader source: Energy.gov (indexed) [DOE]

Nuclear Energy Research Initiative Nuclear Energy Research Initiative U.S. DEPARTMENT OF ENERGY INTERNATIONAL NUCLEAR ENERGY RESEARCH INITIATIVE United States/Japan ABSTRACT Principal Investigator (U.S.): S. Michael Modro, Idaho National Engineering and Environmental Laboratory Principal Investigator (Japan): Professor Hideki Matsui, Institute for Materials Research, Tohoku University Collaborators: University of Michigan, University of



E-Print Network [OSTI]

.com/nautilus and see Peer-to-Peer for news for peer-reviewers and about peer review http://blogs.nature in semi- natural field conditions over 3 years was a lot of work. I was worried something might go wrongFROM THE BLOGOSPHERE Abstractions Visit Nautilus for regular news relevant to Nature authors http://blogs.nature

Wu, Zhigang


Programme, Abstracts, Presentations & Proceedings  

E-Print Network [OSTI]

Programme, Abstracts, Presentations & Proceedings 24th IAEA Fusion Energy Conference October 8. #12;QR Codes for Smartphone Conference App Scan relevant QR to download the conference app QR code for Android QR code for iPhone The Conference4me application provides a digital, mobile copy of the confer



Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Collection Collection and Analysis of Expressed Sequence Tags Derived from Laser Capture Microdissected Switchgrass (Panicum virgatum L. Alamo) Vascular Tissues Avinash C. Srivastava & Karuppaiah Palanichelvam & Junying Ma & Jarrod Steele & Elison B. Blancaflor & Yuhong Tang # Springer Science+Business Media, LLC. 2010 Abstract Switchgrass is a perennial C4 grass that thrives in a wide range of North American habitats and is an emerging crop for the production of lignocellulosic biofuels. Lignin is an integral component of secondary plant cell walls that provides structural rigidity to the cell wall but it interferes with the conversion of cellulose to fermentable sugars by prevent- ing chemical access to cellulose. Thus, one strategy for improving production of cellulosic ethanol is the down- regulation of lignin in plants. To achieve this goal, it is important

Note: This page contains sample records for the topic "abstract switchgrass panicum" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Ghimire et al 2010.pdf  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of of fungal endophyte communities inhabiting switchgrass (Panicum virgatum L.) growing in the native tallgrass prairie of northern Oklahoma Sita R. Ghimire & Nikki D. Charlton & Jeremey D. Bell & Yelugere L. Krishnamurthy & Kelly D. Craven Received: 24 November 2010 / Accepted: 12 December 2010 # Kevin D. Hyde 2010 Abstract This study was conducted to explore fungal endophyte communities inhabiting native switchgrass plants from the tallgrass prairie of northern Oklahoma. The primary focus was to isolate these endophytes in pure culture from surface-sterilized plant tissues and provide taxonomic identifications based on comparative analysis of ITS rDNA gene sequences. From these data, we evaluated the biodiversity of these potentially beneficial endosym- bionts from this rapidly disappearing habitat of the Great Plains. While important from a strictly



Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

The Ectomycorrhizal Fungus Sebacina vermifera, Enhances Biomass Production of 1 The Ectomycorrhizal Fungus Sebacina vermifera, Enhances Biomass Production of 1 Switchgrass (Panicum virgatum L.) Under Drought Conditions 2 3 Sita R. Ghimire and Kelly D. Craven * 4 Plant Biology Division, The Samuel Roberts Noble Foundation, 2510 Sam Noble 5 Parkway, Ardmore, OK 73401, USA 6 7 Abstract 8 Experiments were conducted to examine the effects of cocultivating the important 9 bioenergy crop switchgrass with the ectomycorrhizal fungus, Sebacina vermifera under 10 severe drought conditions. Plants cocultivated with the fungus produced significantly 11 higher biomass and had a higher macronutrient content than uninoculated control plants 12 under both well watered and drought conditions. 13 14 Running title: 15 Symbiosis offsets drought related biomass losses 16


Biological & Environmental Research Abstracts Database  

Office of Scientific and Technical Information (OSTI)

Submit Ober Abstracts All project abstracts should be submitted via email to: Please include the project title and principal investigator's name along with the abstract submission....


Abstract IA37: Clinical genomics  

Science Journals Connector (OSTI)

...Research. 15 October 2014 meeting-abstract Clinical Genomics Clinical Genomics: Oral Presentations - Invited Abstracts Abstracts...2013; San Diego, CA Abstract IA37: Clinical genomics Katherine A. Janeway Dana-Farber Cancer Institute...

Katherine A. Janeway



SSRL29 Abstract Form  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Users are invited to submit abstracts highlighting research activities conducted over the past year at SSRL for oral or poster presentation at the meeting. Posters will be displayed throughout the meeting and will be highlighted during a poster session and reception on Monday, October 7. Graduate students submitting posters must also register for the Users' Meeting and are eligible for one of the poster prizes. All posters require submission of this form no later than September 23 to guarantee space and inclusion in the program materials. Users are invited to submit abstracts highlighting research activities conducted over the past year at SSRL for oral or poster presentation at the meeting. Posters will be displayed throughout the meeting and will be highlighted during a poster session and reception on Monday, October 7. Graduate students submitting posters must also register for the Users' Meeting and are eligible for one of the poster prizes. All posters require submission of this form no later than September 23 to guarantee space and inclusion in the program materials. Please Note: Fields marked with require entry. General Presentation Information Please select a presentation type: Oral Presentation Poster Presentation Invited Presentation: Users' Meeting Invited Presentation: Workshop Speaker


Abstract List.PDF  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Synthesis Workshop: University of Virginia, October 7-11, 2000 Synthesis Workshop: University of Virginia, October 7-11, 2000 LIST OF PRESENTATIONS and ACCOMPANYING ABSTRACTS Monday October 7, 2001 Relevance of SAFARI 2000: Science to National and International Program Goals 09:00 - 09:10 Official Welcome to the University of Virginia/Opening of the Synthesis Workshop Prof. Gene Block, Provost, University of Virginia 09:10 - 09:30 SAFARI 2000 - Past, Present, Future Asst. Prof. Robert J. Swap, University of Virginia 09:30 - 09:50 Relevance of SAFARI 2000 to the NASA ESE Dr. Diane Wickland, NASA HQ and Prof. Chris O. Justice, University of Maryland 09:50 - 10:10 Relevance of SAFARI 2000 to South Africa's National Research Foundation, the Department of Arts, Culture, Science and Technology


Abstraction of Drift Seepage  

SciTech Connect (OSTI)

This model report documents the abstraction of drift seepage, conducted to provide seepage-relevant parameters and their probability distributions for use in Total System Performance Assessment for License Application (TSPA-LA). Drift seepage refers to the flow of liquid water into waste emplacement drifts. Water that seeps into drifts may contact waste packages and potentially mobilize radionuclides, and may result in advective transport of radionuclides through breached waste packages [''Risk Information to Support Prioritization of Performance Assessment Models'' (BSC 2003 [DIRS 168796], Section 3.3.2)]. The unsaturated rock layers overlying and hosting the repository form a natural barrier that reduces the amount of water entering emplacement drifts by natural subsurface processes. For example, drift seepage is limited by the capillary barrier forming at the drift crown, which decreases or even eliminates water flow from the unsaturated fractured rock into the drift. During the first few hundred years after waste emplacement, when above-boiling rock temperatures will develop as a result of heat generated by the decay of the radioactive waste, vaporization of percolation water is an additional factor limiting seepage. Estimating the effectiveness of these natural barrier capabilities and predicting the amount of seepage into drifts is an important aspect of assessing the performance of the repository. The TSPA-LA therefore includes a seepage component that calculates the amount of seepage into drifts [''Total System Performance Assessment (TSPA) Model/Analysis for the License Application'' (BSC 2004 [DIRS 168504], Section]. The TSPA-LA calculation is performed with a probabilistic approach that accounts for the spatial and temporal variability and inherent uncertainty of seepage-relevant properties and processes. Results are used for subsequent TSPA-LA components that may handle, for example, waste package corrosion or radionuclide transport.

J.T. Birkholzer




Office of Scientific and Technical Information (OSTI)

SAND2007-2331 SAND2007-2331 Unlimited Release Printed April 2007 Autothermal Reforming of Natural Gas to Synthesis Gas Reference: KBR Paper #2031 Steven F. Rice and David P. Mann Prepared by Sandia National Laboratories Albuquerque, New Mexico 87185 and Livermore, California 94550 Sandia is a multiprogram laboratory operated by Sandia Corporation, a Lockheed Martin Company, for the United States Department of Energy's National Nuclear Security Administration under Contract DE-AC04-94AL85000. Approved for public release; further dissemination unlimited. Issued by Sandia National Laboratories, operated for the United States Department of Energy by Sandia Corporation. NOTICE: This report was prepared as an account of work sponsored by an agency of the United



Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

penetrating radar survey and tracer observations at the West Pearl penetrating radar survey and tracer observations at the West Pearl Queen carbon sequestration pilot site, New Mexico Thomas H. Wilson*, Arthur W. Wells, J. Rodney Diehl, Grant S. Bromhal, Duane H. Smith, and William Carpenter*, National Energy Technology Laboratory (NETL), Pittsburgh, PA & Morgantown, WV & *West Virginia University Department of Geology and Geography The potential for leakage of injected CO 2 at carbon sequestration sites is a significant concern in the design and deployment of long-term carbon sequestration efforts. Effective and reliable monitoring of near-surface environments in the vicinity of these sites is essential to ensure the viability of sequestration activities as well as long term public and environmental safety. Identification of geological features such as faults, fracture zones,



Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Proper maintenance can help vehicles perform as designed, positively affecting fuel economy, emissions, and overall driveability. This paper addresses the issue of whether air filter replacement improves fuel economy. Described are measured results for increasing air filter pressure drop in turbocharged diesel-engine-powered vehicles, with primary focus on changes in vehicle fuel economy but also including



Science Journals Connector (OSTI)

......California, and Enola, Arkansas, and before and after hydraulic fracturing in Camborne, Cornwall. These changes can be directly...Overhauser proton memory- magnetometer sensor mounted on a trailer or boom and a satellite- controlled vehicle dead reckoning......

Abstracts for the Thirteenth UK Geophysical Assembly




Science Journals Connector (OSTI)

......other calamities of natural origin. The Disaster...HellenicMining Coof Cyprus has yielded a large...evaluation difficult. The natural wavefield used in...telephone cables, gas and sewer pipes is...technology used for gas hazard surveys at...TROODOS OPHIOLITE, CYPRUS G Maliotis, Hellenic......

Abstracts for the Fifteenth UK Geophysical Assembly




Science Journals Connector (OSTI)

......Steel Co, Ltd.. The model HF-2000 Cold-field emission...unknon. le have used confocal laser microscopy and fluorescent tracers...observed under the confocal laser microscope. Ihen CD was applied...through their exocytotic membrane fusion. After the removal of CD......

The Forty-seventh Annual Meeting of the Japanese Society of Electron Microscopy




Science Journals Connector (OSTI)

......hydrofluoric acid method (HF method) using human chromosomes...from the slide glasses. HF method : After specimens...6% formvar and 0 3 % HF. We discuss here the results using confocal laser scanning microscope and...and consequent membrane fusion during thawing of cells......

The Fifty-first Annual Meeting of the Japanese Society of Electron Microscopy




Science Journals Connector (OSTI)

......Radiation Effect Research in Nuclear Fuel Cycle Jun TAKADA1...Hiroshima Univ. Development of Nuclear fuel cycle has been promoting as an important energy policy in our country in the 21st...Siberia with underground nuclear explosions, restricted......

Nuclear Fuel Cycle for 21 Century; Public Radioprotection




Science Journals Connector (OSTI)

......was developed on Ihe around of H similar principle to that of aerial survey and was applied to measurements of the rat and mouse...acid phos- phatase) activity in chicken bone tissues. Osamu Fukushima, Hlroshi Yamashlta and Carol V. Gay Dept.Anat.Jikei Univ......

The Forty-seventh Annual Meeting of the Japanese Society of Electron Microscopy




Science Journals Connector (OSTI)

......Tanaka* Koriyama Inst.Med.Immunol., Fukushima-ken,963 Japan; *Inst.Med.Sci...Resolution Analytical Electron Microscope K. Fukushima, T. Kaneyama, F. Hosokawa, H. Tsuno...163-91, Japan PD-9 Reconstruction fro* aerial stereo pair images H. Ohira, *E......

The Forty-ninth Annual Meeting of the Japanese Society of Electron Microscopy




Science Journals Connector (OSTI)

... 've been working on a process to convert sugars into a chemical intermediate known as 5-hydroxymethylfurfural, or HMF. This is very flexible and can be converted into plastics or fuel ...




Science Journals Connector (OSTI)

......transition to I x 1 phase on heating process above 830 C were...and a=l 13.8 , the space group being R?. The...fitted with a mag- netic sector system and a scanning...conventional magnetic sector type EELS analyzing system...elapsed since the first construction of universal-type 0......

The Thirty-second Symposium of the Japanese Society of Electron Microscopy




Office of Scientific and Technical Information (OSTI)

One such site is SASOL in South Africa, which uses ATRs licensed by Lurgi out of Germany. As stated above, KBR-designed ATRs have been installed in ammonia plants in Kitimat,...

Note: This page contains sample records for the topic "abstract switchgrass panicum" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Science Journals Connector (OSTI)

......System has been developed for UK opencast coal exploration. W e have used explosive...physical properties to the study of rock chemistry. OG15 DETERMINATION OF MODEL MINERALOGY...and organic carbon content (using a combustion/C02 gas analyser method) i n d i c......

Abstracts for the Thirteenth UK Geophysical Assembly




Science Journals Connector (OSTI)

......voltage power source and that the standard resistance is housed in a separate...structure. Not only the general plan of structure of the prolamellar...Interesting Nuclear Structure. (Review on Nuclear Inclusion Body in...tracks of fission fragments from uranium and their interaction with......





Science Journals Connector (OSTI)

......resulting in an ultra- depleted lithosphereunable to...REACTION' (CONCRETE CANCER) USING DIELECTRIC ANALYSIS...elements potassium (K), uranium (U) and thorium (Th...lakes and aeolian sands. Uranium anomalies occur throughout...velocititiesof 8km/s when also depleted of 10-20%of gabbroic......

Abstracts for the Fifteenth UK Geophysical Assembly




Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

New low-dimensional materials such as graphene and hexagonal boron nitride (hBN) have opened up new opportunities in experimental condensed matter physics, chemistry, materials...



Science Journals Connector (OSTI)

......changed at the upper reservoir of the pumped-storage power station at Ffestiniog, N...count rates falling within the seawater background, while high gamma ray...West, Plymouth P U 8AA. Large storage pots were sampled at the Urartu......

Abstracts for the Fifteenth UK Geophysical Assembly




Science Journals Connector (OSTI)

......University, Tsu, 514, Japan Arc discharging carbon rods...nanoscale physics. Since the arc discharge method is applicable with...Tsukuba 305, 2 Showa Electric Wire & Cable,Ltd. 2-2-1...were synthesized by an electric arc method, were examined......

The Forty-ninth Annual Meeting of the Japanese Society of Electron Microscopy




Science Journals Connector (OSTI)

......carrier of constituent units of cell walls such as cuticles and waxes. 28-11-1015 Action of pradimicin on reverting protoplasts...studied the SCM and the electron beam analysis on the vector pipeline computer CRAY X-MP. On the computer, the SCM can be run......

The Forty-ninth Annual Meeting of the Japanese Society of Electron Microscopy




Science Journals Connector (OSTI)

......Hachlouli. Tokyo 192-03, Japan. Wax-rich cells of Euglena gracilis...previously. The proplastids In these wax-rich cells were shown to contain...Wben the apeiiaen teaperature wax 3007 or higher, this ptttnoaanon...electron beam. Using the vector pipeline supercomputer CRAY X-MP......

The Fiftieth Annual Meeting of the Japanese Society of Electron Microscopy




Science Journals Connector (OSTI)

......central body of the virus vanished or became defective very frequently. 4) In the cytoplasm...The fine structure of martensite in plain car- bon steels has been studied by transmission...around the dislocations and tiny metastable car- bides precipitate in situ. With the......





Science Journals Connector (OSTI)

......Voltage Electron Microscope Observation or Gate destructed Transistor Fumiko Arakawa...KJmura, T. Itoh and J. Sugiyama* Wood Research Institute, Kyoto University...sweat gland and hair follicles. In the red free margin, the epithelial prolongations......

The Fifty-first Annual Meeting of the Japanese Society of Electron Microscopy




Science Journals Connector (OSTI)

......there were no smooth muscle cells in the red pulp, so nerve fibers terminated around...longitudinal faces, were. prepared from small wood blocks. They were useful to understand...microscopic histochemistry of glycoconju- gates in the duodenal glands of the cow Kazushige......

Abstracts of Papers Presented at the Thirtieth Hokkaido Regional; Memorial Meeting of the Japanese Society of Electron Microscopy




Science Journals Connector (OSTI)

......epltheium, the devetopmont of Wood vessels around the aVaotar sac...scanning electron microscopy on the red pulp of various mammalian spleens...hydrostatic pressures. The splenic red pulp of these animals consisted...olycoconjugatcs and sulfoglycoconju gates in the rat digestive tract This......

The Fiftieth Annual Meeting of the Japanese Society of Electron Microscopy




Science Journals Connector (OSTI)

......from the surface field of the cathode without space charge. The...of the distance between the cathode and the anode by considering...diameter, and showed presynaptic active zones which were composed of a fine meshwork of fibnllar materials and accumulated granular materials......

Abstracts of Papers Presented at the 1985 Kansai Regional Meeting of the Japanese Society of Electron Microscopy




Science Journals Connector (OSTI)

......properties for the cathode materials, we have assessed...structure of the bio-active ceramics and the...Research In Inorganic Materials, Namikl, Tsukuba...between surface active ceramls (A-W...Fujita Department of Materials Science and Engineering......

The Forty-seventh Annual Meeting of the Japanese Society of Electron Microscopy




Science Journals Connector (OSTI)

......monoamine few positive materials were found in the...voltage power supply, cathode and anode plates...cells ijunmore- active to S-100 protein...preservation of biological materials. It has been indicated...radiation sensitive material such as a purple...assisted field emission cathode. The higher efficiency......

The Forty-ninth Annual Meeting of the Japanese Society of Electron Microscopy




Broader source: Energy.gov (indexed) [DOE]

Conference on Building Commissioning Whitepaper on: Commissioning of Combined Heat and Power Systems Information was compiled with support from the U. S. Department of Energy and...



Science Journals Connector (OSTI)

......spacing of between 2 and 6 km. PLANS FOR CRUSTAL SEISMIC REFLECTION...Leeds, LS2 9JT. By world standards Cameroon is considered aseismic...Institute of Geological and Mining Research (IRGM), Cameroon...Bedston Observatory. This paper reviews recent and future work on gravity......

Abstracts for the Fifteenth UK Geophysical Assembly




E-Print Network [OSTI]

... elements, heterogeneous soils. CONICET, Facultad de Ciencias Astron omicas y Geof isicas, Universidad Nacional de La Plata,. La Plata (1900), Argentina.




Science Journals Connector (OSTI)

......Since B. hominis was well-stained with Sudan Black stain, the localization of lipids...me diffraction pattern makes arcs. By thermal polymerization, the DCHD was also polymerized...isotopic features, they suffered unique thermal metamorphism. In the metamorphism phyllosilicates......

The Fiftieth Annual Meeting of the Japanese Society of Electron Microscopy




Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Biography Michael C. Browne Current Address: Home Address: The University of Washington 3833 23rd Ave W. Nuclear Physics Laboratory Seattle, WA 98199 Seattle, WA 98195 (206)...

Note: This page contains sample records for the topic "abstract switchgrass panicum" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Science Journals Connector (OSTI)

......to environmental toxicants William W. AU1 , 1 Dept. Preventive Med. and Community Health, The Univ. of Texas Med. Branch, Galveston, TX 77555-1110, USA Chemicals that can induce genotoxic effects in somatic cells can also induce transmissible......

Satellite Symposium: Transgenerational Effects with Various Agents




Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Laboratory (INL) project, which is being conducted with assistance from the Institute for Energy Technology at the Norway Halden Reactor Project, is investigating in-pile fuel...



Science Journals Connector (OSTI)

......microscopy, combined with die tannic acid and chitosan infiltration, clearly demonstrated the...inhibited by the presence of aculeacin A, an inhibitor of /}-(!, --* 3) glucan. 23-HV-1045...repressed by PAO. A tyroslne kinase inhibitor, erbstatin, altered the dynamics of......

The Fifty-second Annual Meeting of the Japanese Society of Electron Microscopy: Held at Nipponseinenkan; Shinjuku; Tokyo; on May 22?24. 1996




Science Journals Connector (OSTI)

......RESISTIVITY SOUNDING FOR GEOTHERMAL EXPLORATION IN THE NORTHERN...potential sites for geothermal energy. Apparent resistivity...f r i c t i o n a l heating of the probe on insertion...which perturb the local geothermal gradient. To isolate...Cornwall, the Lake District and Scotland. Noisy......

Abstracts for the Thirteenth UK Geophysical Assembly




Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

manufactures a portable, electric-powered wire-wheel machine that removes coating for pipeline inspection and repair operations. The equipment is designed to provide an...



Science Journals Connector (OSTI)

......at the upper reservoir of the pumped-storage power station at Ffestiniog, N Wales...carbonates show count rates falling within the seawater background, while high gamma ray fluxes...South West, Plymouth P U 8AA. Large storage pots were sampled at the Urartu Capital......

Abstracts for the Fifteenth UK Geophysical Assembly




Science Journals Connector (OSTI)

......Low-level Radioactive Waste Storage Center are in operation inRokkasho-mura...Aomori Prefecture. Spent Fuel Storage Facility have already completed...stored in the Vitri- fied Waste Storage Facility. Commercial Uranium...agricultural prod- ucts, seawater, seafoods etc.) around the......

Nuclear Fuel Cycle for 21 Century; Public Radioprotection




Science Journals Connector (OSTI)

......tumors with those in neptunium (Np)- or radon (Rn)-induced lung tumors. Genomic...Semipalatinsk nuclear testing site (STNS), Kazakhstan, including 87 atmospheric. Several hundred thousand people living in the East Kazakhstan region were exposed to radioactive fallout......

Effects of Radiation (II)




Science Journals Connector (OSTI)

......flux ($) and irradiation temperature (7") as follows: CLOC...adjoining visual cones in the snake retina Shingo HARA and-Masayuki...junctions of visual cells in the snake retina (Elaphe quadrivirgata...Between days six and seven, development of the epididymal preadipose......

Abstracts of Papers Presented at the 1981 Kyushu Regional Scientific Meeting of the Japanese Society of Electron Microscopy




Science Journals Connector (OSTI)

......Then the tissues were brought into room temperature and hydrated with cacodylate buffer...one of the purified mold lipases and snake venom phos- pholipases, respectively...from known amino acid sequence. 11. Development of quantitative immunoelectron mi- croscopy......

The Thirty-first Symposium of the Japanese Society of Electron Microscopy Held at Faculty of Engineering; University of Tokyo; Tokyo; Japan October 17-18; 1985 Main Theme: Localization of Constituents




Office of Scientific and Technical Information (OSTI)

symptoms and performance of office work under combined exposure to temperature, noise and air pollution. PhD Thesis. International Centre for Indoor Environment and Energy,...



E-Print Network [OSTI]

this environment. To find and ... offers researchers an environment where the entire problem ... ware architecture for the FFT, Proceedings of ICASSP. 1998, vol...




Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

We present a unique approach to the design and synthesis of "giant molecules" based on "nano-atoms" for engineering structures across multiple length scales and controlling their...



Science Journals Connector (OSTI)

...analyses of spillways, non-straight gravity dams and dams with...commercial activity, its two gasoline stations, the fire station...initial FFT-based detector is run on the continuous data from...solution process in a natural and straight- forward way.The weight...



E-Print Network [OSTI]

Our method runs in sublinear time on networks where the maximum degree grows doubly logarithmic with respect to the number of nodes. For collaboration...



E-Print Network [OSTI]

Nov 16, 2013 ... This is ongoing work in collaboration with Stuart Kent. Vladimir Sverak, University of Minnesota. Sun, Nov 17, 11:3012:20, MATH 175.




Science Journals Connector (OSTI)

... ' following an air puff. This work could prove useful in the future development of audio and telecommunication aids for the hearing impaired. First author



Memory abstractions for parallel programming  

E-Print Network [OSTI]

A memory abstraction is an abstraction layer between the program execution and the memory that provides a different "view" of a memory location depending on the execution context in which the memory access is made. Properly ...

Lee, I-Ting Angelina



Microsoft Word - roepke_abstract  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

in nuclear systems Professor Gerd Roepke Institute of Physics, Rostock University, Germany Abstract To describe cluster formation in nuclear matter at subsaturation densities,...


Microsoft Word - mosel_abstract  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Physics is needed" Professor Ulrich Mosel Univ Giessen, Inst Theoret Phys, Giessen, Germany Abstract: Long baseline experiments with neutrinos require a precise knowledge of the...

Note: This page contains sample records for the topic "abstract switchgrass panicum" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Microsoft Word - satz_abstract  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Professor Helmut Satz Fakultaet fuer Physik, Universitaet Bielefeld, Bielefeld, Germany 10 May 2012 Abstract Hadron abundances in all high energy collisions follow the...


Microsoft Word - linnyk_abstract  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

energies" Dr. Olena Linnyk Frankfurt Institute for Advanced Study (FIAS), Frankfurt, Germany Abstract: Analysis of SPS and RHIC data have established that collisions of heavy...


Microsoft Word - bentley_abstract  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of York, York, UK Abstract: The new international FAIR facility in Darmstadt, Germany, has been launched and will provide a major radioactive beam facility in Europe for a...


Microsoft Word - pang_abstract  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

and Physics Univ. of Illinois, Urbana, IL NSCL, Michigan State University, E. Lansing, MI ABSTRACT: The slowing down and thermalizing of nuclear reaction products from projectile...


Biological & Environmental Research Abstracts Database  

Office of Scientific and Technical Information (OSTI)

Welcome to the Biological and Environmental Research Abstracts Database The U.S. Department of Energy's Office of Biological and Environmental Research (BER) conducts research in...


Efficient CSP Z Data Abstraction  

Science Journals Connector (OSTI)

This paper proposes an algorithm for abstracting infinite state CSP Z formal combination of CSP (behavioural part) and Z (data part ... model checking. Differently from previous...

Adalberto Farias; Alexandre Mota; Augusto Sampaio



The Fusion Machine (extended abstract)  

E-Print Network [OSTI]

The Fusion Machine (extended abstract) Philippa Gardner Cosimo Laneve Lucian Wischik March 27, 2002. In particular, we describe a dis- tributed abstract machine called the fusion machine. In it, only channels exist at runtime. It uses a form of concurrent constraints called fusions--equations on channel names

Gardner, Philippa


Clara Aldana (Nantes) Abstract: TBA  

E-Print Network [OSTI]

Program Clara Aldana (Nantes) TBA Abstract: TBA Ubertino Battisti (Torino) "Fourier integral operators on manifolds with boundary and index of symplectomorphisms on manifolds with boundary" Abstract using Egorov Theorem, that U is always Fredholm and set i() = i(U ). In a joint work with S. Coriasco

Baer, Christian


Aristotelian Logic, Axioms, and Abstraction  

Science Journals Connector (OSTI)

......01ms. HALE, B., and C. WRIGHT [2001]: The Reason's...Oxford University Press. SHAPIRO, S., and A. Weir [1999...8, 160-189. WRIGHT, C. [1983]: Frege's Conception...Press. ABSTRACT. Stewart Shapiro and Alan Weir have argued......




Aspects of abstraction in software development  

Science Journals Connector (OSTI)

Abstraction is a fundamental tool of human thought in every context. This essay briefly reviews some manifestations of abstraction in everyday life, in engineering and mathematics, and in software and system development. Vertical and horizontal abstraction ... Keywords: Abstraction, Analogic model, Bottom-up design, Free abstraction, Grounded abstraction, Horizontal abstraction, Monsters, Refinement, Theory, Top-down design, Vertical abstraction

Michael Jackson



Resources Abstracts Input Transaction Form  

E-Print Network [OSTI]

#12;Resources Abstracts Input Transaction Form 4. Title 5. Report Date 6.Urban Aquaculture Covered The University of the District of Columbia 12. Sponsoring Organization Water Resources Research of the rainbow trout (Salmo gairdneri) in a closed recycling water system in an urban environment is described

District of Columbia, University of the


sample abstract for 2005 WOCA  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Release of Ammonia from SCR / SNCR Fly Ashes Release of Ammonia from SCR / SNCR Fly Ashes Carol Cardone, Ann Kim and Karl Schroeder U.S. Dept. of Energy, NETL, PO Box 10940, Pittsburgh, PA 15236 KEYWORDS: fly ash, ammoniated fly ash, leaching Abstract One of the goals of the Department of Energy is to increase the utilization of coal utilization byproducts (CUB) to 50% by 2010. This will require both developing new markets and maintaining traditional ones such as the use of fly ash in concrete. However, the addition of pollution control devices can introduce side-effects that affect the marketability of the CUB. Such can be the case when NO x control is achieved using selective catalytic or non-catalytic reduction (SCR or SNCR). Depending on site-specific details, the ammonia slip (un-reacted NH


A Guide to the Petroleum Abstracts  

E-Print Network [OSTI]

Petroleum Abstracts A Guide to the Petroleum Abstracts Information Service Serving the Exploration Conferences Covered #12;Petroleum Abstracts . . . your global information partner. Statement of Purpose Petroleum Abstracts is an abstracting and indexing service conducted as a not-for-profit operation

Reynolds, Albert C.


The Abstract Domain of Segmented Ranking Functions  

E-Print Network [OSTI]

function by abstract in- terpretation. We build our work on their proposed general framework, and we designThe Abstract Domain of Segmented Ranking Functions Caterina Urban ´Ecole Normale Sup´erieure - CNRS - INRIA, Paris, France urban@di.ens.fr Abstract. We present a parameterized abstract domain for proving

Paris-Sud XI, Université de


Environmental pollutant studies: FY 1980. [Lead abstract  

SciTech Connect (OSTI)

Separate abstracts were prepared for the 16 papers presented in this annual report of the Energy and Environment Division. (KRM)

Not Available



Hybrid Abstractions that Preserve Timed Languages  

E-Print Network [OSTI]

Hybrid Abstractions that Preserve Timed Languages Paulo Tabuada1 and George J. Pappas2 1 Instituto@ee.upenn.edu Abstract. In this paper we consider the problem of extracting an ab- straction from a hybrid control system that determine when trajectories of the original hybrid system can be generated by the abstracted hybrid system

Pappas, George J.


Stone Age Distributed Computing (Extended Abstract)  

E-Print Network [OSTI]

on the first page. Copyrights for components of this work owned by others than ACM must be honored. AbstractingStone Age Distributed Computing (Extended Abstract) Yuval Emek Distributed Computing Group ETH wattenhofer@ethz.ch ABSTRACT A new model that depicts a network of randomized finite state machines operating


CEES Conference Proceedings, Abstracts, Presentations, and Poster...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

and K. Amine, "Performance of Thiophene-based Electrolyte Additive in Lithium Ion Batteries," Extended Abstract KK4.9, Materials Research Society Meeting, Boston, MA, Nov....


Conference Abstracts & Book Chapters | Photosynthetic Antenna...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Abstracts & Book Chapters Collins AM, Wen J and Blankenship RE (2011) Photosynthetic Light Harvesting Complexes. In Molecular Solar Fuels, T. Wydrzynski and W. Hillier, Eds.,...


Virtual Sensors: Abstracting Data from Physical Sensors  

E-Print Network [OSTI]

Virtual Sensors: Abstracting Data from Physical Sensors TR-UTEDGE-2006-001 Sanem Kabadayi Adam Pridgen Christine Julien © Copyright 2006 The University of Texas at Austin #12;Virtual Sensors: Abstracting Data from Physical Sensors Sanem Kabadayi, Adam Pridgen, and Christine Julien The Center

Julien, Christine

Note: This page contains sample records for the topic "abstract switchgrass panicum" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Semi-Autonomous Intersection Management (Extended Abstract)  

E-Print Network [OSTI]

Semi-Autonomous Intersection Management (Extended Abstract) Tsz-Chiu Au School of Electrical@cs.utexas.edu ABSTRACT Autonomous Intersection Management (AIM) is a reservation-based intersection control protocol. AIM was designed for the time when all, or most, of the vehicles on the road are fully autonomous

Au, Tsz-Chiu


Call for Abstracts-- 2014 National Environmental Justice Conference and Training Program, Deadline for Submission of Abstracts  

Broader source: Energy.gov [DOE]

Course Title:Call for Abstracts--2014 National Environmental Justice Conference and Training Program


Kansas Statistical Abstract 2007 (42nd Edition)  

E-Print Network [OSTI]

The Kansas Statistical Abstract contains state, county, and city-level data for Kansas on agriculture, banking and finance, business and exports, climate, communications and information, crime, education, employment and ...

Policy Research Institute



Kansas Statistical Abstract 2006 (41st Edition)  

E-Print Network [OSTI]

The Kansas Statistical Abstract contains state, county, and city-level data for Kansas on population, vital statistics and health, housing, elections, education, business and manufacturing, exports, employment, income, ...

Policy Research Institute



Kansas Statistical Abstract 2005 (40th Edition)  

E-Print Network [OSTI]

The Kansas Statistical Abstract contains state, county, and city-level data for Kansas on population, vital statistics and health, housing, elections, education, business and manufacturing, exports, employment, income, ...

Policy Research Institute



Kansas Statistical Abstract 2009 (44th Edition)  

E-Print Network [OSTI]

The Kansas Statistical Abstract contains state, county, and city-level data for Kansas on agriculture, banking and finance, business and exports, climate, communications and information, crime, education, employment and ...

Policy Research Institute



Pulmonary toxicology of respirable particles. [Lead abstract  

SciTech Connect (OSTI)

Separate abstracts were prepared for the 44 papers presented in these proceedings. The last paper (Stannard) in the proceedings is an historical review of the field of inhalation toxicology and is not included in the analytics. (DS)

Sanders, C.L.; Cross, F.T.; Dagle, G.E.; Mahaffey, J.A. (eds.)



Specifying API Trace Birthmark by Abstract Interpretation  

Science Journals Connector (OSTI)

API trace birthmark is a major class of software birthmarks, where API sequences are defined as software birthmarks to ... , an abstract interpretation-based method for specifying API trace birthmark is proposed ...

Ying Zeng; Fenlin Liu; Jian Chen; Bin Yan



Kansas Statistical Abstract 2008 (43rd Edition)  

E-Print Network [OSTI]

The Kansas Statistical Abstract contains state, county, and city-level data for Kansas on agriculture, banking and finance, business and exports, climate, communications and information, crime, education, employment and ...

Policy Research Institute



Kansas Statistical Abstract 2010 (45th Edition)  

E-Print Network [OSTI]

The Kansas Statistical Abstract 2010, contains the latest available state, county, and city-level data for Kansas on population, vital statistics and health, housing, education, business and manufacturing, exports, employment, ...

Institute for Policy & Social Research



Kansas Statistical Abstract 2012 (47th Edition)  

E-Print Network [OSTI]

The Kansas Statistical Abstract 2012, contains the latest available state, county, and city-level data for Kansas on population, vital statistics and health, housing, education, business and manufacturing, exports, employment, ...

Institute for Policy & Social Research



Photoinduced Hydrogen Abstraction from Phenols by Aromatic Ketones. A New Mechanism for Hydrogen Abstraction by  

E-Print Network [OSTI]

Photoinduced Hydrogen Abstraction from Phenols by Aromatic Ketones. A New Mechanism for Hydrogen carried out of the kinetics of inter- and intramolecular phenolic hydrogen abstraction phenolic hydrogen, which yields the corresponding phenoxyl-hemipinacol biradical. The biradicals have also

Leigh, William J.


Data Abstraction Form for population PK, PD publications MODEL BUILDING Data Abstraction Form  

E-Print Network [OSTI]

Data Abstraction Form for population PK, PD publications MODEL BUILDING 1 Data Abstraction Form for population PK/PD publications MODEL BUILDING Brendel K.1* , Dartois C.2* , Comets E.1 , Lemenuel-Diot A.3;Data Abstraction Form for population PK, PD publications MODEL BUILDING 2 Table of contents Purpose

Boyer, Edmond


Domain-specific abstractions and compiler transformations  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Domain-specific abstractions and compiler Domain-specific abstractions and compiler transformations Domain-specific abstractions and compiler transformations March 4, 2013 sadayappan Saday Sadayappan Department of Computer Science and Engineering, Ohio State University Recent trends in architecture are making multicore parallelism as well as heterogeneity ubiquitous. This creates significant chalenges to application developers as well as compiler implementations. Currently it is virtually impossible to achieve performance portability of high-performance applications, i.e., develop a single version of source code for an application that achieves high performance on different parallel computer platforms. Different implementations of compute intensive core functions are generally needed for different target platforms, e.g., for multicore


Bounds Analysis by Abstract Interpretation Xiaolei Qian Allen Goldberg  

E-Print Network [OSTI]

representations fo* *r these abstract types. In this work an abstract context, i.e. model, consists * Bounds Analysis by Abstract@csl.sri.com goldberg@kestrel.edu Abstract Abstract interpretation

Goldberg, Allen


Colorado Natural Heritage Program 2003 Project Abstracts  

E-Print Network [OSTI]

Colorado Natural Heritage Program 2003 Project Abstracts #12;Cover photo: A CNHP researcher collects freshwater specimens (Pisidium spp.) at Long Slough Reservoir on the Grand Mesa of Colorado's West of Colorado's biodiversity, what efforts are underway to maintain it, and why more biological information


Equilibrium Pricing with Positive Externalities (Extended Abstract)  

E-Print Network [OSTI]

a product in the presence of historical externalities? A low introductory price may attract early adoptersEquilibrium Pricing with Positive Externalities (Extended Abstract) Nima Anari1 , Shayan Ehsani1 an item to strategic buyers in the pres- ence of positive historical externalities, where the value

Immorlica, Nicole


Book of Abstracts The Center for Nanoscience &  

E-Print Network [OSTI]

Book of Abstracts 5th Workshop The Center for Nanoscience & Nanotechnology Tel Aviv University: 5TH Workshop The Center for Nanoscience & Nanotechnology Tel Aviv University February 22-24, 2009 Ha: ... " S.E.C. SCIENTIFIC EQUIPMENT CO. LTD. 5TH Workshop The Center for Nanoscience & Nanotechnology Tel

Lifshitz, Ron


Natural radiation environment III. [Lead Abstract  

SciTech Connect (OSTI)

Separate abstracts were prepared for the 52 research papers presented at this symposium in April 1978. The major topics in this volume deal with penetrating radiation measurements, radiation surveys and population exposure, radioactivity in the indoor environment, and technologically enhanced natural radioactivity. (KRM)

Gesell, T.F.; Lowder, W.M. (eds.)



Abstract AndParallel Machines Nachum Dershowitz  

E-Print Network [OSTI]

Abstract And­Parallel Machines Nachum Dershowitz University of Illinois Urbana, IL 61801 U are introduced. The first of them, the And­ Parallel Turing Machine, can be viewed as a generalization of the deterministic Turing machine in which the infinite tape is replaced by an infinite tree­like tape on which

Dershowitz, Nachum

Note: This page contains sample records for the topic "abstract switchgrass panicum" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


On Generalized Rough Sets (extended abstract)  

E-Print Network [OSTI]

On Generalized Rough Sets (extended abstract) Anita Wasilewska Department of Computer Science State Rough Sets The idea of rough set was proposed by Pawlak in 1982 [10]. The starting point of the rough a rough set. The lower and upper approximations treated as one argument operations R and R in the ap

Vigneron, Laurent


AbstractThe satellite-borne  

E-Print Network [OSTI]

Abstract­The satellite-borne Scanning for a Satellite Radar Wind Sounder (RAWS) RK Moore, B. Beh Analysis and forecasting using numerical weather models would improve greatly if world wide wind information were available, Lasers on satellites were proposed for this purpose, and the Laser Wind Sounder

Kansas, University of


Transforming and Refining Abstract Constraint Specifications  

E-Print Network [OSTI]

Transforming and Refining Abstract Constraint Specifications Alan M. Frisch1 , Brahim Hnich2 , Ian choose model transformations to reduce greatly the amount of effort that is required to solve a problem by systematic search. It is a consid- erable challenge to automate such transformations. A problem may be viewed

Walsh, Toby


Interchange Format for Hybrid Systems: Abstract Semantics  

E-Print Network [OSTI]

of implicit equations [4, 5]. The language is object-oriented and objects can be instantiated inside otherInterchange Format for Hybrid Systems: Abstract Semantics Alessandro Pinto1 , Luca P. Carloni3 general enough to accommodate the translation across the various modeling approaches used in the ex

Carloni, Luca



E-Print Network [OSTI]

CFE 10 & ERCIM 10 PROGRAMME AND ABSTRACTS 4th CSDA International Conference on Computational and Financial Econometrics (CFE 10) http://www.cfe-csda.org/cfe10 and 3rd International Conference of the ERCIM (ERCIM 10) http://www.cfe-csda.org/ercim10 Senate House, University of London, UK 10-12 December 2010

Fernandez, Thomas


Abstract LB-69: Minnesota Ovarian Cancer Alliance  

Science Journals Connector (OSTI)

...Abstract LB-196: Sequencing symptom control: Results from the Alliance N08C1 and N08CA genetics of chemotherapy neuropathy trials...Loprinzi. Sequencing symptom control: Results from the Alliance N08C1 and N08CA genetics of chemotherapy neuropathy trials...

Kathleen A. Gavin



Low Dose Radiation Program: Workshop VI Abstracts  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Workshop VI Principal Investigator and Abstracts Workshop VI Principal Investigator and Abstracts Anderson, Carl Whole Genome Analysis of Functional Protein Binding Sites and DNA Methylation: Application to p53 and Low Dose Ionizing Radiation. Averbeck, Dietrich Cellular Responses at Low Doses of Ionizing Radiation. Azzam, Edouard Adaptive Responses to Low Dose/Low Dose-Rate ?-Rays in Normal Human Fibroblasts: The Role of Oxidative Metabolism. Bailey, Susan The Role of Telomere Dysfunction in Driving Genomic Instability. Balajee, Adayabalam Low Dose Radiation Induced DNA Damage Signaling and Repair Responses in Human 3-Dimensional Skin Model System. Barcellos-Hoff, Mary Helen Imaging Bioinformatics for Mapping Multidimensional Responses. Barcellos-Hoff, Mary Helen Biological Response to Radiation Mediated through the Microenvironment and


Automatic identification of abstract online groups  

DOE Patents [OSTI]

Online abstract groups, in which members aren't explicitly connected, can be automatically identified by computer-implemented methods. The methods involve harvesting records from social media and extracting content-based and structure-based features from each record. Each record includes a social-media posting and is associated with one or more entities. Each feature is stored on a data storage device and includes a computer-readable representation of an attribute of one or more records. The methods further involve grouping records into record groups according to the features of each record. Further still the methods involve calculating an n-dimensional surface representing each record group and defining an outlier as a record having feature-based distances measured from every n-dimensional surface that exceed a threshold value. Each of the n-dimensional surfaces is described by a footprint that characterizes the respective record group as an online abstract group.

Engel, David W; Gregory, Michelle L; Bell, Eric B; Cowell, Andrew J; Piatt, Andrew W



Subwog 12-D tritium technology meeting. Abstracts  

SciTech Connect (OSTI)

The first Subwog 12-D Tritium Technology Meeting was held at the Westinghouse Savannah River Site during the week of May 21, 1990. Subwog 12-D was created as a subwog of JOWOG 12 to address the need to understand tritium applications throughout the entire weapons complex. This includes weapons related concerns, but is primarily intended to cover tritium production and handling, environmental, safety and health issues, compatibility with materials in general; and facility design, commissioning and decommissioning activities. Tritium technology issues discussed included the physical and chemical properties, kinetics, storage, reservoir loading techniques, isotope exchange, radiolysis/aging, process and handling technology, compatibility, purification and filtering, analysis, monitoring methods, function testing, packaging and shipping, environmental and operational safety, facility design and safety, glovebox atmosphere clean-up systems, glovebox/facility decommissioning, tritium production target materials, and tritium recovery. This document provides a collection of most of the unclassified extended abstracts and abstracts presented at Subwog 12-D.

Parker, M.J.; Addis, R.P.



FFCAct Clearinghouse, Directory of abstracts. Revision 1  

SciTech Connect (OSTI)

The Federal Facility Compliance Act (FFCAct) Clearinghouse is a card catalog of information about the FFCAct and its requirements for developing Site Treatment Plans (STP). The information available in the clearinghouse includes abstracts describing computer applications, technical reports, and a list of technical experts. Information can be accessed for use in responding to FFCAct requirements, and the clearinghouse provides search capabilities on particular topics and issues related to STP development. Appendix A includes: contacts from each site, for which contact has been made, who are developing STPs; the FFCAct Clearinghouse Fact Sheet and; additional hard copy forms to be used to populate the database. This report contains 50 abstracts related to the Radioactive Waste Technical Support Program.

Harwood, T.



Property:Abstract | Open Energy Information  

Open Energy Info (EERE)

Abstract Abstract Jump to: navigation, search This is a property of type Text. Pages using the property "Abstract" Showing 25 pages using this property. (previous 25) (next 25) 2 2-D Magnetotellurics At The Geothermal Site At Soultz-Sous-Forets- Resistivity Distribution To About 3000 M Depth + With the aim of investigating the possibilities of magnetotelluric methods for the exploration of potential Enhanced Geothermal System (EGS) sites in the Upper Rhine valley, a 2-D magnetotelluric (MT) survey has been carried out on a 13 km long profile across the thermal anomaly in the area of the geothermal power plant of Soultz-sous-Forets in the winter 2007/08. Despite strong artificial noise, processing using remote referencing and Sutarno phase consistent smoothing revealed significant results from 10 out of 16 sites. Indication for 1-D structures was found in the shortest periods, 2-D effects in the periods up to 40 s, and 3-D effects in the long period range. Since 3-D effects were found in the longer periods, 2-D inversion was carried out for periods smaller than 40 s. The results of the inversion are consistent with the geology of the geothermal site and distinguish well the sediments from the granitic basement including the structures given by the faults. A conductive anomaly with a resistivity of about 3 Ωm has been found at a depth down to 2000 m in the area of the Soultz and Kutzenhausen faults, which is attributed to geothermal processes.



SciTech Connect (OSTI)

The purpose of the saturated zone (SZ) flow and transport model abstraction task is to provide radionuclide-transport simulation results for use in the total system performance assessment (TSPA) for license application (LA) calculations. This task includes assessment of uncertainty in parameters that pertain to both groundwater flow and radionuclide transport in the models used for this purpose. This model report documents the following: (1) The SZ transport abstraction model, which consists of a set of radionuclide breakthrough curves at the accessible environment for use in the TSPA-LA simulations of radionuclide releases into the biosphere. These radionuclide breakthrough curves contain information on radionuclide-transport times through the SZ. (2) The SZ one-dimensional (I-D) transport model, which is incorporated in the TSPA-LA model to simulate the transport, decay, and ingrowth of radionuclide decay chains in the SZ. (3) The analysis of uncertainty in groundwater-flow and radionuclide-transport input parameters for the SZ transport abstraction model and the SZ 1-D transport model. (4) The analysis of the background concentration of alpha-emitting species in the groundwater of the SZ.




Polyhedral graph abstractions and an approach to the Linear Hirsch ...  

E-Print Network [OSTI]

March 17, 2011. Abstract. We introduce a new combinatorial abstraction for the graphs of polyhe- dra. The new abstraction is a flexible framework defined by...



AbstractAbstract Vendors of high performance computers are converging towards an  

E-Print Network [OSTI]

AbstractAbstract Vendors of high performance computers are converging towards an architecture based full advantage of the available computing power, in order to achieve the best scalability.This new of computer time #12;Poloidal Grid: unstructured meshPoloidal Grid: unstructured mesh · Gives uniform


Abstract IA14: Functional genomics and cancer vulnerabilities  

Science Journals Connector (OSTI)

...Cancer Research. November 2014 meeting-abstract Genomics Genomics: Oral Presentations - Invited Abstracts Abstracts...2013; San Diego, CA Abstract IA14: Functional genomics and cancer vulnerabilities William C. Hahn Dana-Farber...

William C. Hahn



VEST: Abstract Vector Calculus Simplification in Mathematica  

SciTech Connect (OSTI)

We present a new package, VEST (Vector Einstein Summation Tools), that performs abstract vector calculus computations in Mathematica. Through the use of index notation, VEST is able to reduce scalar and vector expressions of a very general type using a systematic canonicalization procedure. In addition, utilizing properties of the Levi-Civita symbol, the program can derive types of multi-term vector identities that are not recognized by canonicalization, subsequently applying these to simplify large expressions. In a companion paper [1], we employ VEST in the automation of the calculation of Lagrangians for the single particle guiding center system in plasma physics, a computation which illustrates its ability to handle very large expressions. VEST has been designed to be simple and intuitive to use, both for basic checking of work and more involved computations. __________________________________________________

J. Squire, J. Burby and H. Qin



Interfacing microbiology and biotechnology. Conference abstracts  

SciTech Connect (OSTI)

The Interfacing Microbiology and Biotechnology Conference was attended by over 100 faculty, post-docs, students, and research scientists from the US, Europe, and Latin America. The conference successfully stimulated communication and the dissemination of knowledge among scientists involved in basic and applied research. The focus of the conference was on microbial physiology and genetics and included sessions on C1 metabolism, archaeal metabolism, proteases and chaperones, gene arrays, and metabolic engineering. The meeting provided the setting for in-depth discussions between scientists who are internationally recognized for their research in these fields. The following objectives were met: (1) The promotion of interaction and future collaborative projects among scientists involved in basic and applied research which incorporates microbial physiology, genetics, and biochemistry; (2) the facilitation of communication of new research findings through seminars, posters, and abstracts; (3 ) the stimulation of enthusiasm and education among participants including graduate and undergraduate students.

Maupin, Julia A.



2013 LIST OF PUBLICATIONS REVIEWED BY PETROLEUM ABSTRACTS Petroleum Abstracts reviews the following publications on a regular basis and selects material for indexing and abstracting according to  

E-Print Network [OSTI]

2013 LIST OF PUBLICATIONS REVIEWED BY PETROLEUM ABSTRACTS Petroleum Abstracts reviews the following was used by Petroleum Abstracts through 2004. Beginning with 2005 issues, the Complete Title is used. TABLE OF CONTENTS SERVICE As a current-awareness service, Petroleum Abstracts Document Delivery Service (PADDS

Reynolds, Albert C.


DOE-NABIR PI Workshop: Abstracts 2003  

SciTech Connect (OSTI)

The mission of the NABIR program is to provide the fundamental science that will serve as the basis for the development of cost-effective bioremediation and long-term stewardship of radionuclides and metals in the subsurface at DOE sites. The focus of the program is on strategies leading to long-term immobilization of contaminants in situ to reduce the risk to humans and the environment. Contaminants of special interest are uranium, technetium, plutonium, chromium, and mercury. The focus of the NABIR program is on the bioremediation of these contaminants in the subsurface below the root zone, including both vadose and saturated zones. The program consists of four interrelated Science Elements (Biotransformation, Community Dynamics/Microbial Ecology, Biomolecular Science and Engineering, and Biogeochemistry). The program also has a cross-cutting Assessment Element that supports development of innovative approaches and technologies to support the science elements. An element called Bioremediation and its Societal Implications and Concerns (BASIC) addresses potential societal issues of implementing NABIR scientific findings. The material presented at this year's workshop focuses on approximately 60 research projects funded in FY 2000-2003 by the Environmental Remediation Sciences Division in DOE's Office of Biological and Environmental Research (BER) in the Office of Science. Abstracts of NABIR research projects are provided in this book.




Verification of Parallel Garbage Collection by Abstract Model Checking  

E-Print Network [OSTI]

have a finite state space provided that the abstraction mapping is powerful. M¨uller and Nipkow's work working on abstract model checking. In Section 4, the abstractions we defined on garbage #12; collectionVerification of Parallel Garbage Collection by Abstract Model Checking (Extended Abstract) Masami

Hagiya, Masami

Note: This page contains sample records for the topic "abstract switchgrass panicum" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



SciTech Connect (OSTI)

Several hundred distinct types of DOE-owned spent nuclear fuel (DSNF) may potentially be disposed in the Yucca Mountain repository. These fuel types represent many more types than can be viably individually examined for their effect on the Total System Performance Assessment for the License Application (TSPA-LA). Additionally, for most of these fuel types, there is no known direct experimental test data for the degradation and dissolution of the waste form in repository groundwaters. The approach used in the TSPA-LA model is, therefore, to assess available information on each of 11 groups of DSNF, and to identify a model that can be used in the TSPA-LA model without differentiating between individual codisposal waste packages containing different DSNF types. The purpose of this report is to examine the available data and information concerning the dissolution kinetics of DSNF matrices for the purpose of abstracting a degradation model suitable for use in describing degradation of the DSNF inventory in the Total System Performance Assessment for the License Application. The data and information and associated degradation models were examined for the following types of DSNF: Group 1--Naval spent nuclear fuel; Group 2--Plutonium/uranium alloy (Fermi 1 SNF); Group 3--Plutonium/uranium carbide (Fast Flux Test Facility-Test Fuel Assembly SNF); Group 4--Mixed oxide and plutonium oxide (Fast Flux Test Facility-Demonstration Fuel Assembly/Fast Flux Test Facility-Test Demonstration Fuel Assembly SNF); Group 5--Thorium/uranium carbide (Fort St. Vrain SNF); Group 6--Thorium/uranium oxide (Shippingport light water breeder reactor SNF); Group 7--Uranium metal (N Reactor SNF); Group 8--Uranium oxide (Three Mile Island-2 core debris); Group 9--Aluminum-based SNF (Foreign Research Reactor SNF); Group 10--Miscellaneous Fuel; and Group 11--Uranium-zirconium hydride (Training Research Isotopes-General Atomics SNF). The analyses contained in this document provide an ''upper-limit'' (i.e., instantaneous degradation) model for use in the TSPA-LA model. ''Best-estimate'' models for the degradation of the fuels in each of the DSNF groups are discussed to provide a basis for selecting the upper limit model for use in the TSPA-LA model. The instantaneous degradation model is chosen for use in the TSPA-LA model because the available information shows that the degradation rate of the N Reactor fuel (which constitutes most of the DSNF inventory) is very high and because the available qualified information is insufficient to justify use of a less conservative approach. The commercial spent nuclear fuel model will be used for naval spent nuclear fuel because it has been shown to be conservative for representing naval spent nuclear fuel.




ABSTRACT: Bioenergy Harvesting Technologies to Supply Crop Residues...  

Broader source: Energy.gov (indexed) [DOE]

ABSTRACT: Bioenergy Harvesting Technologies to Supply Crop Residues In a Densified Large Square Bale Format ABSTRACT: Bioenergy Harvesting Technologies to Supply Crop Residues In a...


Asymptotic almost-equivalence of abstract evolution systems ?  

E-Print Network [OSTI]

May 13, 2008 ... Abstract. We study the asymptotic behavior of almost-orbits of abstract .... In that sense our work is different but complementary to [12,11].



Biological & Environmental Research Abstracts Database  

Office of Scientific and Technical Information (OSTI)

Search Term(s) Search Term(s) (supports AND and OR operators and phrase in "double quotes") Register Number Title Abstract Principal Investigator PI Lookup Institution Institution Lookup City Adelaide SA 5001 Aiken Albany Albuquerque Alcoa Center Alexandria Ames Amherst Anchorage Ann Arbor Ardmore Argonne Arlington Asheville Athens Atlanta Auburn Auburn University Augusta Aurora Austin Bailrigg, Lancaster UK, LA1 4Y Baltimore Bar Harbor Batavia Baton Rouge Beaufort Beaverton Belleville Bellevue Bellingham Beltsville Berkeley Bern Bethesda Billerica Bilthoven Binghamton Birmingham Blacksburg Bloomington Boise Boston Bothell Boulder Bozeman Bronx Bronxville Brooklyn Buffalo Burlington Calverton Cambridge Cambridge CB1 4RN Canal Point Carbondale Champaign Chapel Hill Charleston Charlottesville Chestnut Hill Chicago Chico Cincinnati Claremont Clayton Clemson Cleveland Clifton Park Colchester Cold Spring Harbor College Park College Station Colorado Springs Columbia Columbus Concord Cookeville Copenhagen Coral Gables Corvallis Dallas Danville Davis Dayton DeBilt DeKalb Delft Denton Denver Des Plaines Detroit Docklands, Victoria Downsview Duarte Durham East Lansing El Paso Esch-sur-Alzette Essen Eugene Evanston Fairbanks Fairfax Falmouth Flagstaff Fort Collins Gainesville Gaithersburg Galveston Germantown Gloucester Point Golden Grand Forks Grand Junction Great Falls Greenbelt Greenville Guelph Halifax Hamburg Hamilton, Ontario Hampton Hanover Hattiesburg Helsinki Hershey Honolulu Houghton Houston Hunt Valley Huntsville Hyde Park Idaho Falls Indianapolis Iowa City Irvine Ithaca Jerusalem Kalamazoo Kansas City Kennewick Kent Keystone Kingston Kingsville Klamath Falls Knoxville LS2 9JT La Jolla La Jolla, Lafayette Lake Placid Lakewood Lanham Laramie Las Cruces Las Vegas Lausanne Lawrence Lawrenceville Leawood Lethbridge Lewes Lexington Lincoln Little Rock Livermore Loma Linda London London NW1 2BE Los Alamos Los Angeles Louisville Lubbock Lutherville Lyngby Madison Manchester Manhattan Mayaguez McLean Medford Melbourne Memphis Menands Menlo Park Merced Mercer Island Miami Middlesex Middletown Millbrook Milwaukee Minneapolis Mississippi State Missoula Moab Mobile Modena Moffett Field Monash, Australia Monterey Montreal Montreal (Quebec) Morgantown Moscow Moss Landing Mountain View Nashua Nashville New Brunswick New Haven New Orleans New York Newark Newport News Newtown Square Norfolk Norman North Dartmouth Norwich Notre Dame Oak Brook Oak Ridge Oakdale Oakland Oklahoma City Old Westbury Omaha Ontario Ontario K1N 6N5 Orlando Orono Ottawa Oxford Oxon Palisades Palo Alto Pasadena Pasco Peoria Philadelphia Phoenix Piscataway Pittsburgh Placitas Plymouth Portland Potsdam Princeton Providence Pullman Radnor Raleigh Rapid City Reading Redmond Reno Rensselaer Research Triangle Pk Reston Richland Richmond Riverside Roanoke Rochester Rockville Rohnert Park Rome Royal Oak Salt Lake City San Antonio San Diego San Francisco San Fransisco San Jose San Marcos Santa Barbara Santa Cruz Santa Fe Santa Monica Santiago Savannah Scranton Seattle Sequims Sharon Hill Shreveport Silver Spring Silverthorne Sioux Falls Socorro Sonoma St. Louis St. Paul St. Petersburg Stanford State College Stennis Space Center Stennis Space Ctr. Stillwater Stockholm Stockton Stony Brook Storrs Storrs Mansfield Stowe Syracuse Tallahassee Tampa Tempe Thousand Oaks Toledo Toronto Toronto, ON Troy Tucson Tulsa Tuscaloosa Tuskegee Ulm University University Park Upton Urbana Victoria Walpole Waltham Washington Watkinsville West Kingston West Lafayette Westhampton Beach Wheeling Winston-Salem Woodland Park Woods Hole Worcester Yorktown Heights


Poster Instructions for Ag-ESD Symposium 2012 Poster Abstract  

E-Print Network [OSTI]

Poster Instructions for Ag-ESD Symposium 2012 Poster Abstract Please follow these instructions for preparation of a one page abstract of your poster presentation. 1. Language English Only 2. Abstract format send "Poster Abstract" in Word file format by E-mail to agesd@nourin.tsukuba.ac.jp (Do not send "pdf

Ejiri, Shinji


Formal Proof of Abstract Model Checking of Concurrent Garbage Collection  

E-Print Network [OSTI]

, the correctness of abstraction is not always easy to verify. In our pre- vious work, we applied abstract model with that of proving the concrete system from scratch (not by abstract model checking). In our previous work [6], whichFormal Proof of Abstract Model Checking of Concurrent Garbage Collection Koichi Takahashi Masami

Hagiya, Masami


Abstract machines for game semantics, revisited Olle Fredriksson  

E-Print Network [OSTI]

: In this paper we are developing the line of work on PAM/IAM/JAM in order to define new abstract machines whichAbstract machines for game semantics, revisited Olle Fredriksson University of Birmingham, UK Dan R. Ghica University of Birmingham, UK Abstract--We define new abstract machines for game seman- tics which

Ghica, Dan


Net energy of cellulosic ethanol from switchgrass  

Science Journals Connector (OSTI)

...bioenergy based on theoretical market prices (1). The majority...2), herbicides (33%), diesel fuel (29%), and seed (23...Nitrogen fertilizer (67%), diesel fuel (18%), and herbicides...In some previous analyses, diesel fuel requirements were based...

M. R. Schmer; K. P. Vogel; R. B. Mitchell; R. K. Perrin



Net energy of cellulosic ethanol from switchgrass  

Science Journals Connector (OSTI)

...converted cropland (28). Life-cycle analysis...hybrids, whereas the remaining improvement...a dry-weight basis. Life Cycle Bioenergy Analysis...cycle power system and a gas turbine combined cycle system...

M. R. Schmer; K. P. Vogel; R. B. Mitchell; R. K. Perrin



Net energy of cellulosic ethanol from switchgrass  

Science Journals Connector (OSTI)

...factors needed to optimize capture of solar energy are lacking...Rankine cycle power system and a gas turbine combined cycle system (9, 44). Energy output was based on the...1991 ) Emissions of Greenhouse Gases from the Use of Transportation Fuels and Electricity...

M. R. Schmer; K. P. Vogel; R. B. Mitchell; R. K. Perrin



Regional Feedstock Partnership 2010 Switchgrass Report  

E-Print Network [OSTI]

;Overall Objective ! Establish and perform replicated field trials of diverse herbaceous biomass feedstocks

Pawlowski, Wojtek


Net energy of cellulosic ethanol from switchgrass  

Science Journals Connector (OSTI)

...conversion technology, which...represents the technology available...stage of development or after...system and a gas turbine combined cycle...2001 ) Development and Use of...and Vehicle Technologies ( Argonne National Laboratory...

M. R. Schmer; K. P. Vogel; R. B. Mitchell; R. K. Perrin



The Switchgrass Genome: Tools and Strategies  

E-Print Network [OSTI]

GE, genetically engineered; GLBRC, Great Lakes BioenergyBioenergy Research Center (GLBRC) (Madison, WI), and SRNFas a collaboration among GLBRC, BESC, SRNF, and NimbleGen (



Directions to Petroleum Abstracts Petroleum Abstracts' main office is located in the basement of John Rogers Hall (JRH)  

E-Print Network [OSTI]

Directions to Petroleum Abstracts Petroleum Abstracts' main office is located in the basement approximately 2 blocks West of South Harvard Avenue. Petroleum Abstracts' office (Room 1520) is on the basement wish to visit Petroleum Abstracts and they will contact us to direct you to our office in the basement

Reynolds, Albert C.



Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

CROP SCIENCE, VOL. 51, NOVEMBER- CROP SCIENCE, VOL. 51, NOVEMBER- DECEMBER 2011 RESEARCH S witchgrass (Panicum virgatum L.) is a warm-season peren- nial bunchgrass native to North America. Being one of the predominant species found in tallgrass prairies, switchgrass has traditionally been used for soil conservation and forage produc- tion (Bouton, 2007; Vogel and Jung, 2001). Because of its high biomass productivity, low nutrient requirement, and potential environmental benefits, switchgrass has been developed into a major herbaceous bioenergy crop for the production of cellulosic biofuels in recent years (Hisano et al., 2009; McLaughlin et al., 2006; Schmer et al., 2008). An important aspect of switchgrass taxonomy and reproduc- tive behavior is its grouping into two distinct ecotype categories:


Abstract B29: Training cancer researchers that are community advocates  

Science Journals Connector (OSTI)

...meeting-abstract Behavioral and Social Science Health Education: Poster Presentations - Proffered Abstracts...International Conference on the Science of Cancer Health Disparities...change with tailored health education for breast and colorectal cancer...

Danyell S. Wilson; Joel Aliancy; Kenneth Shain; Nicholas Eustace,; Eric Haura; Beulah Joseph; Keiran Smalley; Karla Schramm; Robert Gillies; Bin Fang; William Dalton; John Koomen; and Cathy Meade



Abstract 5089: Survivin safeguards chromosome numbers and protects from aneuploidy  

Science Journals Connector (OSTI)

...April 5-9, 2014; San Diego, CA Abstract 5089: Survivin safeguards chromosome numbers and protects from aneuploidy Ralf Wiedemuth...Evelin Schroeck, Gabriele Schackert, Achim Temme. Survivin safeguards chromosome numbers and protects from aneuploidy. [abstract...

Ralf Wiedemuth; Barbara Klink; Evelin Schroeck; Gabriele Schackert; Achim Temme



Abstract SY36-01: Functional genomics and cancer dependencies  

Science Journals Connector (OSTI)

...CA Abstract SY36-01: Functional genomics and cancer dependencies William C. Hahn...Institute, Boston, MA. Recent advances in genomics continue to elucidate the genetic lesions...Format: William C. Hahn. Functional genomics and cancer dependencies. [abstract...

William C. Hahn



Division of Environmental Control Technology Program, 1979. [Lead abstract  

SciTech Connect (OSTI)

Separate abstracts were prepared for the 10 sections in this progress report dealing with environmental engineering. (KRM)




Poster Instructions for Ag-ESD Symposium 2011 Poster Abstract  

E-Print Network [OSTI]

Poster Instructions for Ag-ESD Symposium 2011 Poster Abstract Please follow these instructions for preparation of a one page abstract of your poster presentation. 1. Language English Only 2. Abstract format. #12;Poster Format, Display and Example 1. Language English only 2. Size We recommend you prepare an A0

Tanaka, Jiro

Note: This page contains sample records for the topic "abstract switchgrass panicum" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


The Impact of Distributed Programming Abstractions on Application Energy Consumption  

E-Print Network [OSTI]

The Impact of Distributed Programming Abstractions on Application Energy Consumption Young-Woo Kwon of their energy consumption patterns. By varying the abstractions with the rest of the functionality fixed, we measure and analyze the impact of distributed programming abstractions on application energy consumption

Tilevich, Eli


A Typed Calculus Supporting Shallow Embeddings of Abstract Machines  

E-Print Network [OSTI]

A Typed Calculus Supporting Shallow Embeddings of Abstract Machines Aaron Bohannon Zena M. Ariola taken by abstract machines and reductions in a system of proof terms for a version the sequent calculus. We believe that by doing so we shed light on some essential characteristics of abstract machines

Ariola, Zena M.


Reasoning with Generic Cases in the Arithmetic of Abstract Matrices  

E-Print Network [OSTI]

Department of Computer Science, University of Western Ontario www.csd.uwo.ca/watt Abstract. In previous work specifying n. We call this working with "symbolic" or "abstract" values. In previous work we have givenReasoning with Generic Cases in the Arithmetic of Abstract Matrices Alan P. Sexton1 , Volker Sorge1

Sorge, Volker


Reasoning with Generic Cases in the Arithmetic of Abstract Matrices  

E-Print Network [OSTI]

Department of Computer Science, University of Western Ontario www.csd.uwo.ca/~watt Abstract. In previous work specifying n. We call this working with "symbolic" or "abstract" values. In previous work we have givenReasoning with Generic Cases in the Arithmetic of Abstract Matrices Alan P. Sexton1 , Volker Sorge1

Watt, Stephen M.


A certifying frontend for (sub)polyhedral abstract domains  

E-Print Network [OSTI]

of the overall abstract domain. The main contribution of the work described here is the design of the linkA certifying frontend for (sub)polyhedral abstract domains Alexis Fouilhe and Sylvain Boulmé Univ. Grenoble-Alpes, VERIMAG, F-38000 Grenoble, France {alexis.fouilhe,sylvain.boulme}@imag.fr Abstract. Convex

Paris-Sud XI, Université de


No. ___________ Reviewer: ______________________________ 2014 WSU Academic Showcase Abstract Evaluation Rubric  

E-Print Network [OSTI]

, or student A student-submitted abstract has either a faculty co-author or a faculty Sponsor All work mustNo. ___________ Reviewer: ______________________________ 2014 WSU Academic Showcase Abstract Evaluation Rubric Eligibility Criteria1 Does not meet criteria Abstract is submitted by a WSU faculty, staff

Collins, Gary S.


Abstract Local Reasoning for Concurrent Libraries: Mind the Gap  

E-Print Network [OSTI]

considerable work on combining lo- cal reasoning with abstraction. There are two main approaches. One approach, truly abstract reasoning of a tree module (such as DOM) works with predicates based on connecting treeMFPS 2014 Abstract Local Reasoning for Concurrent Libraries: Mind the Gap Philippa Gardner, Azalea

Gardner, Philippa


Search Results Cite abstracts as Author(s) (2010), Title, Abstract xxxxx-xxxx presented at 2010 Fall  

E-Print Network [OSTI]

2010 Fall Meeting Search Results Cite abstracts as Author(s) (2010), Title, Abstract xxxxx will present results on the scaling of reconnection rate with S, as well as turbulence levels. This work

Ng, Chung-Sang


Abstracts | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

Abstracts Abstracts Chemical Sciences, Geosciences, & Biosciences (CSGB) Division CSGB Home About Research Areas Scientific Highlights Reports & Activities Principal Investigators' Meetings BES Home Third DOE BES Separations Research Workshop Abstracts Print Text Size: A A A RSS Feeds FeedbackShare Page Third DOE/BES Separations Research Workshop Presentation Abstracts Last Modified May 18, 1999 High Pressure and High Temperature Spectroscopic Studies of Supercritical Fluid Solutions Clement R. Yonker Understanding on a molecular level the intermolecular interactions underlying separations and extractions in supercritical fluids is important to extend these useful solvents to new separation technologies and chemical synthesis in addition to providing a basis for improving existing


Selected Translated Abstracts of Chinese-Language Climate Change Publications  

SciTech Connect (OSTI)

This report contains English-translated abstracts of important Chinese-language literature concerning global climate change for the years 1995-1998. This body of literature includes the topics of adaptation, ancient climate change, climate variation, the East Asia monsoon, historical climate change, impacts, modeling, and radiation and trace-gas emissions. In addition to the biological citations and abstracts translated into English, this report presents the original citations and abstracts in Chinese. Author and title indexes are included to assist the reader in locating abstracts of particular interest.

Cushman, R.M.; Burtis, M.D.



Geothermal: Sponsored by OSTI -- Geothermal Energy: Current abstracts  

Office of Scientific and Technical Information (OSTI)

Energy: Current abstracts Geothermal Technologies Legacy Collection HelpFAQ | Site Map | Contact Us | Admin Log On HomeBasic Search About Publications Advanced Search New Hot...


Abstracts | U.S. DOE Office of Science (SC)  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Reports Abstracts Basic Energy Sciences (BES) BES Home About Research Facilities Science Highlights Benefits of BES Funding Opportunities Basic Energy Sciences Advisory...


Poster Abstract of Eighteenth ARM STM: Sort by Title  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

with Multiscale Modeling Framework (MMF) Simulated Radar Profiles ABSTRACT, POSTER Marchand, R., Ackerman, T., and Beagley, N. A Comparison of Heating Rates and Related Cloud...


7th international symposium on photosynthetic prokaryotes. Abstracts  

SciTech Connect (OSTI)

This book contains the abstracts of all the presentations made either in oral or poster form, at the VII International Symposium on Photosynthetic Prokaryotes.

Fuller, R.C.



Handling Nonnegative Constraints in Spectral Estimation Abstract 1 ...  

E-Print Network [OSTI]

Abstract. We consider convex optimization problems with the. constraint that the variables form a ... component of this work in other works, must be obtained from.


Abstract Presented at Synchrotron Environmental Science II (SES-II)  

E-Print Network [OSTI]

Abstract Presented at Synchrotron Environmental Science II (SES-II) Argonne National Laboratory - 6 such as dioxins and furans, polychlorinated biphenyls (PCBs), and polynuclear aromatic hydrocarbons (PAHs). *Work

Brookhaven National Laboratory


Submitted Abstract on November 02, 11:49 PM  

E-Print Network [OSTI]

Simulation of Thermal Boundary Resistance between a Carbon Nanotube and Surrounding Materials. AUTHORS (ALL Nanotubes, Molecular Dynamics Simulation, Thermal Boundary Resistance. Abstract TITLE: Molecular Dynamics. ABSTRACT BODY: Several kind of thermal boundary resistance related to single-walled carbon nanotubes (SWNTs

Maruyama, Shigeo


Abstract Interpretation with Alien Expressions and Heap Structures  

E-Print Network [OSTI]

Abstract Interpretation with Alien Expressions and Heap Structures Bor-Yuh Evan Chang0, and K constraint mentions other, alien, function or relation symbols, it is ignored (that is, it is very coarsely over-approximated) by the abstract domain. Rather than building in special treatment of such alien

Leino, K. Rustan M.


Ecological Research Division Theoretical Ecology Program. [Contains abstracts  

SciTech Connect (OSTI)

This report presents the goals of the Theoretical Ecology Program and abstracts of research in progress. Abstracts cover both theoretical research that began as part of the terrestrial ecology core program and new projects funded by the theoretical program begun in 1988. Projects have been clustered into four major categories: Ecosystem dynamics; landscape/scaling dynamics; population dynamics; and experiment/sample design.

Not Available



Abstract 3380: Cancer usurps skeletal muscle as an energy repository  

Science Journals Connector (OSTI)

...Association for Cancer Research. 1 October 2014 meeting-abstract Molecular and...infection shifts the energy catabolism ratio...Boston College Research Expense fund...infection shifts the energy catabolism ratio...malignancy. [abstract]. In: Proceedings...Association for Cancer Research; 2014 Apr 5-9...

Yi Luo; Junya Yoneda; Hitoshi Ohmori; Takamitsu Sasaki; and Hiroki Kuniyasu


Note: This page contains sample records for the topic "abstract switchgrass panicum" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Transformation of Meta-Information by Abstract Co-Interpretation  

E-Print Network [OSTI]

Transformation of Meta-Information by Abstract Co-Interpretation Raimund Kirner and Peter Puschner based on abstract interpretation to transform meta-information in parallel with the transformation. The construction of a correct transformation function for the meta-information can be quite complicated in case


Abstract B17: Health disparities in brain cancer incidence  

Science Journals Connector (OSTI)

...GA Abstract B17: Health disparities in brain cancer incidence Emanuela Taioli 1 Wenqi...reported that US black patients have lower brain cancer rates than whites, and this has...Gregory J. Riggins. Health disparities in brain cancer incidence. [abstract]. In...

Emanuela Taioli; Wenqi Gan; Gregory J. Riggins



Hanford Personnel Dosimeter supporting studies FY-1980. [Lead abstract  

SciTech Connect (OSTI)

Separate abstracts were prepared for the 10 sections of this report which describe fundamental characteristics of the Hanford multipurpose personnel dosimeter (HMPD). Abstracts were not prepared for Appendix A and Appendix B which deal with calculated standard deviations for 100 mrem mixed field exposures and detailed calculations of standard deviations, respectively. (KRM)

Endres, G.W.R.; Cummings, F.M.; Aldrich, J.M.; Thorson, M.R.; Kathren, R.L.



Poster Abstract of Seventeenth ARM STM: Sort by Title  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

7 Science Team Meeting 7 Science Team Meeting 2007 Proceedings Proceedings Sorted by Title Proceedings Sorted by Author Proceedings Sorted by Category Cover image Poster Abstract of the Seventeenth Atmospheric Radiation Measurement (ARM) Science Team Meeting ARM-CONF-2007, March 2007 Monterey, California View poster abstract by Author or Category or Title. 10 Years of External Data ABSTRACT, POSTER Ma, L., Wagener, R., Gregory, L., Liang, M., Tilp, A., and Cialella, A. A Comparison of Broad-band Fluxes at the Main and Auxiliary AMF Sites During the RADAGAST Campaign. ABSTRACT, POSTER Settle, J. A Comparison of Cloud Radar Profiles of Cloud Occurrence with MMF Simulated Radar Profiles as a Function of the Large-Scale Atmospheric State ABSTRACT, POSTER Marchand, R., Beagley, N., and Ackerman, T.


International congress on DNA damage and repair: Book of abstracts  

SciTech Connect (OSTI)

This document contains the abstracts of 105 papers presented at the Congress. Topics covered include the Escherichia coli nucleotide excision repair system, DNA repair in malignant transformations, defective DNA repair, and gene regulation. (TEM)

Not Available




E-Print Network [OSTI]

ABSTRACT STEINER POINTS FOR CONVEX POLYTOPES CHRISTIAN BERG Let &d denote the set of all convex, JOUR. 13 12 #12;CHRISTIAN BERG178 which implies that From this and (10) we obtain Moreover, for reasons

Berg, Christian


Abstract Data Types and UML Models* Heinrich Hussmann1  

E-Print Network [OSTI]

, Francoise Tort3 1 Department of Computer Science, Dresden University of Technology, Germany 2 DISI in order to find out to which extent it follows clean data abstraction principles. In this sense

Reggio, Gianna


Studying Professional Software Designers and their Use of Abstraction  

E-Print Network [OSTI]

abstractions according domain (e.g., problem domain vs. user- interface domain vs. computer-science domain and support beams, and the configurations of rooms; electrical plans map out the electrical circuits

Godfrey, Michael W.


Abstract The rapidly emerging field of synthetic biology  

E-Print Network [OSTI]

Abstract The rapidly emerging field of synthetic biology originated, as synthetic biology has expanded into mammalian systems, it is increasingly more. Biomaterials will play an important role in advancing synthetic biology

Reisslein, Martin


Poster abstract SyNAPSE Proposer's Day Workshop  

E-Print Network [OSTI]

Poster abstract SyNAPSE Proposer's Day Workshop DARPA 03-04-2008, Reston, VA Periodic engineered effects. This poster presents a brief overview of laser interference direct structuring and its

Pennycook, Steve


Pediatric Academic Societies 2014 Abstracts Morgan Stanley Children's Hospital  

E-Print Network [OSTI]

Pediatric Academic Societies 2014 Abstracts Morgan Stanley Children's Hospital #12;#12;DearYork-Presbyterian/Morgan Stanley Children's Hospital 2014 PEDIATRIC ACADEMIC SOCIETIES ANNUAL MEETING #12; 3. Presenter

Adams, Mark


Membrane Ion Channels and Ionic Hydration Energies [Abstract Only  

Science Journals Connector (OSTI)

25 November 1980 research-article Membrane Ion Channels and Ionic Hydration Energies [Abstract Only] D. T. Edmonds The Royal Society is collaborating with JSTOR to digitize, preserve, and extend access to Proceedings...



SERS internship Fall 1992--Spring 1993: Abstract and research papers  

SciTech Connect (OSTI)

This report contains the abstracts and research papers by students on a variety of topics in engineering, genetics, solid state physics, thermonuclear energy, astrophysics, and other science related topics.

Not Available



Abstract 991: Brain metastasis depends on tumor cell initiated coagulation  

Science Journals Connector (OSTI)

...5-9, 2014; San Diego, CA Abstract 991: Brain metastasis depends on tumor cell initiated coagulation...La Jolla, CA. Background: The incidence of brain metastasis exceeds that of primary brain tumors tenfold and is most frequently associated...

Laurie J. Gay; John Day; Sarah LeBoeuf; Melissa Ritland; Zaverio Ruggeri; Wolfram Ruf; Brunhilde H. Felding



FREE FILM SCREENING AND DISCUSSION Abstract from Jezebel Productions  

E-Print Network [OSTI]

FREE FILM SCREENING AND DISCUSSION Abstract from Jezebel Productions: "No Dinosaurs in Heaven charge: free and open to the public. THURSDAY OCTOBER 27, 2011 7:00 PM Mackey Auditorium Ruby Gerontology

de Lijser, Peter


Symposium on atomic spectroscopy (SAS-83): abstracts and program  

SciTech Connect (OSTI)

Abstracts of papers given at the symposium are presented. Session topics include: Rydbergs, optical radiators, and planetary atoms; highly ionized atoms; ultraviolet radiation; theory, ion traps, and laser cooling; beam foil; and astronomy. (GHT)

Not Available



Earth Sciences Division annual report 1981. [Lead abstract  

SciTech Connect (OSTI)

Separate abstracts were prepared for the 59 papers of the 1981 annual report of the Earth Sciences Division at Lawrence Berkeley Laboratory. The general topics covered included nuclear waste isolation, geophysics and reservoir engineering, and geosciences. (KRM)

Not Available



Abstract Interpretation for Worst and Average Case Analysis  

E-Print Network [OSTI]

energy usage whilst bounding the average number of requests waiting to be served. PRISM is used phase extracts a control flow graph ­ for some classes of language this may already involve an abstract

Di Pierro, Alessandra


Technology Lecture: Developments in Scientific Information Systems [Abstract Only  

Science Journals Connector (OSTI)

22 July 1983 research-article Technology Lecture: Developments in Scientific Information Systems [Abstract Only] Robert Clayton The Royal Society is collaborating with JSTOR to digitize, preserve, and extend access...



Abstract Submitted for the DPP07 Meeting of  

E-Print Network [OSTI]

Abstract Submitted for the DPP07 Meeting of The American Physical Society Sorting Category: 5-interface periodic-cylinder configuration. In this work, we per- form a stability scan over pressure and for a two

Hudson, Stuart

Note: This page contains sample records for the topic "abstract switchgrass panicum" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


,~ Abstract Submitted to 1997 Denver X-Ray Conference  

E-Print Network [OSTI]

,~ Abstract Submitted to 1997 Denver X-Ray Conference Denver, Colorado -August 4-8, 1997 BNL-.64346 being distributed through the entire volume of the particle needs further investigation. *Work supported

Brookhaven National Laboratory


Abstract Submitted for the DPP97 Meeting of  

E-Print Network [OSTI]

Abstract Submitted for the DPP97 Meeting of The American Physical Society Sorting Category: 5 solve these problems. 1 This work supported by DoE Contract DE­AC02­76CH03073. Prefer Oral Session X

Hammett, Greg


Abstract 5087: UCSC Cancer Genomics Browser 2.0  

Science Journals Connector (OSTI)

...Abstract nr 3720. doi:1538-7445.AM2012-3720 The Global Cancer Genomics Consortium: interfacing genomics and cancer medicine. | The Global Cancer Genomics Consortium (GCGC) is an international collaborative platform that amalgamates...

Jingchun Zhu; Brian Craft; Teresa Swatloski; Kyle Ellrott; Mary Goldman; Christopher Wilks; Singer Ma; Christopher Szeto; Eric Collisson; David Haussler



Soil physical and hydrological properties under three biofuel crops in Ohio  

SciTech Connect (OSTI)

While biofuel crops are widely studied and compared for their energy and carbon footprints, less is known about their effects on other soil properties, particularly hydrologic characteristics. Soils under three biofuel crops, corn (Zea mays), switchgrass (Panicum virgatum), and willow (Salix spp.), were analyzed seven years after establishment to assess the effects on soil bulk density ({rho}{sub b}), penetration resistance (PR), water-holding capacity, and infiltration characteristics. The PR was the highest under corn, along with the lowest associated water content, while PR was 50-60% lower under switchgrass. In accordance with PR data, surface (0-10 cm) bulk density also tended to be lower under switchgrass. Both water infiltration rates and cumulative infiltration amounts varied widely among and within the three crops. Because the Philip model did not fit the data, results were analyzed using the Kostiakov model instead. Switchgrass plots had an average cumulative infiltration of 69 cm over 3 hours with a constant infiltration rate of 0.28 cm min{sup -1}, compared with 37 cm and 0.11 cm min{sup -1} for corn, and 26 cm and 0.06 cm min{sup -1} for willow, respectively. Results suggest that significant changes in soil physical and hydrologic properties may require more time to develop. Soils under switchgrass may have lower surface bulk density, higher field water capacity, and a more rapid water infiltration rate than those under corn or willow.

Bonin, Catherine [Ohio State University; Lal, Dr. Rattan [Ohio State University; Schmitz, Matthias [Rheinsche Friedrich/Wilhelms Universitaet Boon; Wullschleger, Stan D [ORNL



1605714896914210 1..15  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Enhanced Enhanced characteristics of genetically modified switchgrass (Panicum virgatum L.) for high biofuel production Hui Shen 1,6† , Charleson R Poovaiah 2,6† , Angela Ziebell 3,6 , Timothy J Tschaplinski 6 , Sivakumar Pattathil 4,6 , Erica Gjersing 3,6 , Nancy L Engle 6 , Rui Katahira 3,7 , Yunqiao Pu 3,6 , Robert Sykes 3,6 , Fang Chen 1,6 , Arthur J Ragauskas 5,6 , Jonathan R Mielenz 6 , Michael G Hahn 4,6 , Mark Davis 3,6 , C Neal Stewart Jr 2,6 and Richard A Dixon 1,6,7* Abstract Background: Lignocellulosic biomass is one of the most promising renewable and clean energy resources to reduce greenhouse gas emissions and dependence on fossil fuels. However, the resistance to accessibility of sugars embedded in plant cell walls (so-called recalcitrance) is a major barrier to economically viable cellulosic ethanol production. A recent report from the US National Academy of Sciences indicated


Vulnerability analysis for complex networks using aggressive abstraction.  

SciTech Connect (OSTI)

Large, complex networks are ubiquitous in nature and society, and there is great interest in developing rigorous, scalable methods for identifying and characterizing their vulnerabilities. This paper presents an approach for analyzing the dynamics of complex networks in which the network of interest is first abstracted to a much simpler, but mathematically equivalent, representation, the required analysis is performed on the abstraction, and analytic conclusions are then mapped back to the original network and interpreted there. We begin by identifying a broad and important class of complex networks which admit vulnerability-preserving, finite state abstractions, and develop efficient algorithms for computing these abstractions. We then propose a vulnerability analysis methodology which combines these finite state abstractions with formal analytics from theoretical computer science to yield a comprehensive vulnerability analysis process for networks of realworld scale and complexity. The potential of the proposed approach is illustrated with a case study involving a realistic electric power grid model and also with brief discussions of biological and social network examples.

Colbaugh, Richard; Glass, Kristin L.



ARM - Publications: Science Team Meeting Documents: Abstracts sorted by  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Meeting Meeting 2005 Proceedings Proceedings Sorted by Title Proceedings Sorted by Author Science Team Meeting Proceedings Cover image Proceedings of the Fifteenth Atmospheric Radiation Measurement (ARM) Science Team Meeting ARM-CONF-2005, March 2005 Daytona Beach, Florida For proper viewing, extended abstracts should be viewed with Adobe Acrobat Reader. Download the latest version from the Adobe Reader website. * Poster abstract only; an extended abstract was not provided by the author(s). View session papers by Author or Title. A B C D E F G H I J K L M N O P Q R S T U V W X Y Z A Abdou, W. Determination of Aerosol and Surface Reflectance Characteristics at the ARM CART Site Using MISR Observations* Ackerman, A. Factors Controlling the Properties of Multi-Phase Arctic


Low Dose Radiation Program: Workshops, Proceedings, Abstracts and Programs  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Workshops, Proceedings, Abstracts and Programs Workshops, Proceedings, Abstracts and Programs UPDATE: Investigators' Workshop Postponed The annual Low Dose Radiation Research Program Investigators' Workshop typically held in April or May has been postponed until next year. Please keep checking the website for updates. 2010 The 2010 DOE Low Dose Radiation Research Investigators' Workshop was held April 12-14, 2010, at the Renaissance M Street Hotel in Washington, D.C. In addition to 34 plenary talks and more than 70 poster presentations made by the program investigators, participants heard guest speakers from the National Cancer Institute and from sister low-dose programs in Europe and Japan. See link for investigators' abstracts. 2009 The DOE Low Dose Radiation Research Investigators' Workshop VIII was held


Nanotube Boiler 1 Abstract--Controlled copper evaporation at attogram  

E-Print Network [OSTI]

Nanotube Boiler 1 Abstract-- Controlled copper evaporation at attogram level from individual carbon nanotube (CNT) vessels, which we call nanotube boilers, is investigated experimentally, and ionization in these CNT boilers, which can serve as sources for mass transport and deposition in nanofluidic

Paris-Sud XI, Université de


Nineteenth annual actinide separations conference: Conference program and abstracts  

SciTech Connect (OSTI)

This report contains the abstracts from the conference presentations. Sessions were divided into the following topics: Waste treatment; Spent fuel treatment; Issues and responses to Defense Nuclear Facility Safety Board 94-1; Pyrochemical technologies; Disposition technologies; and Aqueous separation technologies.

Bronson, M. [ed.



Abstract CN06-02: Breast cancer stem cells.  

Science Journals Connector (OSTI)

...Granados-Principal 1 Junhua Mai 1 Steven Gross 2 Haifa Shen 1 Vivek Mittal 2 Mauro Ferrari 1 1Methodist Cancer Center, The Methodist Hospital...Granados-Principal, Junhua Mai, Steven Gross, Haifa Shen, Vivek Mittal, Mauro Ferrari. Breast cancer stem cells. [abstract]. In: Proceedings...

Jenny C. Chang; Bhuvanesh Dave; Sergio Granados-Principal; Junhua Mai; Steven Gross; Haifa Shen; Vivek Mittal; Mauro Ferrari



Overall Efficiency Abstract-Computational fluid dynamics (C  

E-Print Network [OSTI]

to characterize the ef turbines. Efficiency is taken as the ratio of powe useful electricity) to total power lostOverall Efficiency Dept. of Abstract-Computational fluid dynamics (C have been completed from the u flow energy. Many tidal turbine developers ducted designs which accelerate the flow thro

Pedersen, Tom


Goldschmidt Conference Abstracts Mineralogical Magazine www.minersoc.org  

E-Print Network [OSTI]

patterns. In addition to removal of silicic acid, simultaneous removal of boron coprecipitatedGoldschmidt Conference Abstracts Mineralogical Magazine www.minersoc.org 2224 Silicic acid removal to short lifetime of reinjection well caused by siliceous deposit from geothermal water. Removal of silicic

Sparks, Donald L.


Abstract Crystals for Quantum Generalized Kac-Moody Algebras  

Science Journals Connector (OSTI)

......have ~eib = ~fib = 0. We sometimes write wti(b) = hi, wt b for i I and b B. Remark...article have the following properties: (1) wti(b) 0 for any i Iim and b B, (2) i...max k 0 ; ~f k i b = 0 f or i Ire , wti(b) for i Iim , Abstract Crystals for......

Kyeonghoon Jeong; Seok-Jin Kang; Masaki Kashiwara; Dong-Uy Shin



Improving large-sized PLC programs verification using abstractions  

E-Print Network [OSTI]

Improving large-sized PLC programs verification using abstractions V. Gourcuff O. de Smet J [2005]) models of PLC programs, which can be verified with well- known model-checkers, like UPPAAL the development of industrial PLC programs up to now (John- son [2007]). Several reasons can explain

Paris-Sud XI, Université de


Concrete vs. Abstract Problem Formats: A Disadvantage of Prior Knowledge  

E-Print Network [OSTI]

Concrete vs. Abstract Problem Formats: A Disadvantage of Prior Knowledge Andrew F. Heckler is identified for some questions. When a problem potentially elicits prior knowledge that is contrary to scientific knowledge, e.g. a scientific "misconception", it is found that the concrete representation invokes

Heckler, Andrew F.


Static Analysis and Verification of Aerospace Software by Abstract Interpretation  

E-Print Network [OSTI]

synchronous control/command software in open loop. Recent advances consider imperfectly synchronous, parallelStatic Analysis and Verification of Aerospace Software by Abstract Interpretation Julien Bertrane ´Ecole normale sup´erieure, Paris Patrick Cousot, Courant Institute of Mathematical Sciences, NYU, New

Miné, Antoine


Demo Abstract: MARVEL: Multiple Antenna based Relative Vehicle Localizer  

E-Print Network [OSTI]

to install especially on existing vehicles and exhibit a tradeoff between accuracy and cost. Similarly, usingDemo Abstract: MARVEL: Multiple Antenna based Relative Vehicle Localizer Dong Li , Tarun Bansal , Zhixue Lu and Prasun Sinha Department of Computer Science and Engineering The Ohio State University

Sinha, Prasun


Abstract geometrical computation 4: small Turing universal signal machines  

E-Print Network [OSTI]

Abstract geometrical computation 4: small Turing universal signal machines J´er^ome Durand provides several very small signal machines able to perform any compu- tation --in the classical understanding-- generated from Turing machines, cellular automata and cyclic tag systems. A halting universal

Paris-Sud XI, Université de


A Functional Correspondence between Evaluators and Abstract Machines  

E-Print Network [OSTI]

A Functional Correspondence between Evaluators and Abstract Machines Mads Sig Ager, Dariusz machine from an ordinary call-by-name evaluator and by deriving an ordinary call-by-value evaluator from Felleisen et al.'s CEK-machine. The first derivation is strikingly simpler than what can be found

Hutton, Graham

Note: This page contains sample records for the topic "abstract switchgrass panicum" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


30 Years of Abstract Interpretation Thomas Jaudon Ball  

E-Print Network [OSTI]

minute talk I gave at the 30 Years of Abstract Interpretation Workshop in San Francisco, California, USA comprised a statement of principles rather than a constitution with legal effect. Just think about it: over history); a peanut farmer from Georgia became the 39th President of the United States; Gary Gilmore

Ball, Thomas


Abstract 2061: Implication of NQO1 knockdown on prostate carcinogenesis  

Science Journals Connector (OSTI)

...31-Apr 4, 2012; Chicago, IL Abstract 2061: Implication of NQO1 knockdown on prostate carcinogenesis Dinesh Thapa 1 Addanki P. Kumar 2 Rita Ghosh 2 1Department of Urology, School of Medicine, UT Health Science Center, San Antonio, TX 2Departments...

Dinesh Thapa; Addanki P. Kumar; and Rita Ghosh



Publish by Abstract RNA Extraction From Different Apple Tissues  

E-Print Network [OSTI]

Publish by Abstract RNA Extraction From Different Apple Tissues Rich in Polyphenols. An efficient procedure for isolating RNA from bud, internodal shoot, flower, and fruit tissues of apple has in apple fruit and flower tissues. Isolated RNA is of high qual- ity and is undegraded as assessed

Korban, Schuyler S.


Security Policy Testing via Automated Program Code Generation (Extended Abstract)  

E-Print Network [OSTI]

-language-specific coverage crite- ria [5, 6] and test generation algorithms [4, 5]. One limitation of these previous testingSecurity Policy Testing via Automated Program Code Generation (Extended Abstract) Ting Yu North's sophisticated access control policies. Similar to quality assurance of software systems, testing techniques [4

Xie, Tao


Human Genome Program Report. Part 2, 1996 Research Abstracts  

DOE R&D Accomplishments [OSTI]

This report contains Part 2 of a two-part report to reflect research and progress in the US Department of Energy Human Genome Program from 1994 through 1996, with specified updates made just before publication. Part 2 consists of 1996 research abstracts. Attention is focused on the following: sequencing; mapping; informatics; ethical, legal, and social issues; infrastructure; and small business innovation research.



Math 4323: Intro to Abstract Algebra Second Exam  

E-Print Network [OSTI]

Math 4323: Intro to Abstract Algebra Second Exam Fall 2014, University of Oklahoma 10/29/2014 Ralf your work, in a reasonably neat and coherent way, in the space provided. All answers must be justified work will receive no credit; an incorrect answer supported by substantially correct calculations

Schmidt, Ralf


20 CURA REPORTER Abstract: Understanding the spatial link-  

E-Print Network [OSTI]

20 CURA REPORTER Abstract: Understanding the spatial link- ages between home and work is critical decisions. This research project explored where people live and work in Minnesota to determine whether workers in different earnings groups exhibit similar patterns in "work- force flows" across county lines

Levinson, David M.


Electronic Spin: Abstract Mathematical or Real Physical Phenomenon  

E-Print Network [OSTI]

In the description of electron spin obtained through the conventional Copenhagen interpretation of quantum mechanics, the concrete picture of rotation was replaced by an abstract mathematical representation; visualization or visualisability was entirely lost. The work described here takes a step towards restoring this.

S. K. Pandey



Abstract 5360: Ethanol enhances arsenic-induced mutagenesis in colon  

Science Journals Connector (OSTI)

...2014; San Diego, CA Abstract 5360: Ethanol enhances arsenic-induced mutagenesis...one of the common nutritional factors, ethanol is also a well-documented risk factor...effects of co-exposure to arsenic and ethanol in mutagenesis and carcinogenesis. In...

Lei Wang; Lisha Kuang; Young-Ok Son; John Andrew Hitron; Pratheeshkumar Poyil; Zhuo Zhang; Jia Luo; Zhigang Wang; Xianglin Shi



A new audio device driver abstraction Dickon Reed  

E-Print Network [OSTI]

A new audio device driver abstraction Dickon Reed Computer Laboratory, University of Cambridge� ence ``Networks and Operating Systems Support for distributed audio and video'', 1998 Traditional audio device drivers are unable to pro� vide low latency audio services and often do not pro� vide audio mixing

Hand, Steven


CSP-based counter abstraction for systems with node identifiers  

Science Journals Connector (OSTI)

Abstract The Parameterised Model Checking Problem asks whether an implementation I m p l ( t ) satisfies a specification S p e c ( t ) for all instantiations of parameter t . In general, t can determine numerous entities: the number of processes used in a network, the type of data, the capacities of buffers, etc. The main theme of this paper is automation of uniform verification of a subclass of PMCP with the parameter of the first kind, i.e.where it determines the number of processes used in a network. We use CSP as our formalism. Counter abstraction is a technique that replaces a concrete state space by an abstract one, where each abstract state is a tuple of integer counters ( c 1 , , c k ) such that for each i , c i counts how many node processes are currently in the i -th state. Each counter c i is given a finite threshold z i and we interpret c i = z i as there being z i or more processes in the i -th state. Standard counter abstraction techniques require all processes to be identical, which means that nodes cannot use node identifiers. In this paper we present how counter abstraction techniques can be extended to processes that make use of node identifiers in a symmetrical way. Our method creates a process A b s t r that is independent of t and is refined by ? ( I m p l ( T ) ) for all sufficiently large T , where ? maps all (sufficiently large) instantiations T of the parameter to some fixed type. By transitivity of refinement, testing if A b s t r refines S p e c ( ? ( t ) ) implies that S p e c ( ? ( t ) ) is refined by ? ( I m p l ( T ) ) . Then, using the type reduction theory from Mazur and Lowe (2012) [29], we can deduce that S p e c ( T ) is refined by I m p l ( T ) for all sufficiently large T , thus obtaining a positive answer to the original verification problem.

Tomasz Mazur; Gavin Lowe



Niigata (Japan), July 18-20, 2007 Pierre Laforcade 1 Graphical representation of abstractGraphical representation of abstract  

E-Print Network [OSTI]

Niigata (Japan), July 18-20, 2007 Pierre Laforcade 1 Graphical representation of abstract (Japan), July 18-20, 2007 Pierre Laforcade 2 Outline 1. Research context 2. Experimentation: the UML4LD proposition 3. Summary and ongoing work #12;Niigata (Japan), July 18-20, 2007 Pierre Laforcade 3 Research

Laforcade, Pierre


Microsoft Word - BPA DEIS TOC Abstract Summary.doc  

Broader source: Energy.gov (indexed) [DOE]

Draft Environmental Impact Statement Draft Environmental Impact Statement July 2010 DOE/EIS-0422 Central Ferry-Lower Monumental 500-kilovolt Transmission Line Project Draft Environmental Impact Statement Bonneville Power Administration July 2010 Abstract DEIS i Central Ferry - Lower Monumental 500-kilovolt Transmission Line Project Responsible Agency: U.S. Department of Energy (DOE), Bonneville Power Administration (BPA) Cooperating Agency: Washington Energy Facility Site Evaluation Council (EFSEC) Title of Proposed Project: Central Ferry-Lower Monumental 500-kilovolt Transmission Line Project, DOE/EIS - 0422 State Involved: Washington Abstract: BPA is proposing to construct, operate, and maintain a 38- to 40-mile-long 500-kilovolt (kV) transmission line in Garfield, Columbia, and Walla Walla counties, Washington. The proposed line would


Abstract„Production of two types of superconducting  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

68271-AB 68271-AB Abstract submitted to the 17 th International Conf. on Magnet Technology, Geneva, Sept. 24-28, 2001 Test Results for Prototypes of the Twin Aperture Dipoles for the LHC Insertion Region* J. Muratore, M. Anerella, J. Cozzolino, G. Ganetis, A. Ghosh, R. Gupta, M. Harrison, A. Jain, A. Marone, S. Plate, J. Schmalzle, R. Thomas, P. Wanderer, E. Willen and K.C. Wu Brookhaven National Laboratory, P.O. Box 5000, Upton, NY 11973-5000 Abstract-The Superconducting Magnet Division at Brookhaven National Laboratory (BNL) is building 26 insertion region dipoles of various types for the Large Hadron Collider (LHC) at CERN. These 9.45 m-long, 8 cm aperture magnets use the same coil design as the arc dipoles for the Relativistic Heavy Ion Collider (RHIC) at BNL. The


An investigation of accessory chromosomes in Panicum Coloratum L  

E-Print Network [OSTI]

present on the ctiCmco. Bnccdnction of pollen tzoctcd ct s7 C cnd AO C indicated that it c. cs cfzcctcd by the hect trcctm"nt, 'Xhc esthete ct tbc A8 C treatment t ended to main inside thc spil:clct. Some heat dmscCc to the inflo c cancer ucs also... present on the ctiCmco. Bnccdnction of pollen tzoctcd ct s7 C cnd AO C indicated that it c. cs cfzcctcd by the hect trcctm"nt, 'Xhc esthete ct tbc A8 C treatment t ended to main inside thc spil:clct. Some heat dmscCc to the inflo c cancer ucs also...

Burson, Byron Lynn



Particle Tracking Model and Abstraction of Transport Processes  

SciTech Connect (OSTI)

The purpose of this report is to document the abstraction model being used in total system performance assessment (TSPA) model calculations for radionuclide transport in the unsaturated zone (UZ). The UZ transport abstraction model uses the particle-tracking method that is incorporated into the finite element heat and mass model (FEHM) computer code (Zyvoloski et al. 1997 [DIRS 100615]) to simulate radionuclide transport in the UZ. This report outlines the assumptions, design, and testing of a model for calculating radionuclide transport in the UZ at Yucca Mountain. In addition, methods for determining and inputting transport parameters are outlined for use in the TSPA for license application (LA) analyses. Process-level transport model calculations are documented in another report for the UZ (BSC 2004 [DIRS 164500]). Three-dimensional, dual-permeability flow fields generated to characterize UZ flow (documented by BSC 2004 [DIRS 169861]; DTN: LB03023DSSCP9I.001 [DIRS 163044]) are converted to make them compatible with the FEHM code for use in this abstraction model. This report establishes the numerical method and demonstrates the use of the model that is intended to represent UZ transport in the TSPA-LA. Capability of the UZ barrier for retarding the transport is demonstrated in this report, and by the underlying process model (BSC 2004 [DIRS 164500]). The technical scope, content, and management of this report are described in the planning document ''Technical Work Plan for: Unsaturated Zone Transport Model Report Integration'' (BSC 2004 [DIRS 171282]). Deviations from the technical work plan (TWP) are noted within the text of this report, as appropriate. The latest version of this document is being prepared principally to correct parameter values found to be in error due to transcription errors, changes in source data that were not captured in the report, calculation errors, and errors in interpretation of source data.

B. Robinson



Second SIAM conference on sparse matrices: Abstracts. Final technical report  

SciTech Connect (OSTI)

This report contains abstracts on the following topics: invited and long presentations (IP1 & LP1); sparse matrix reordering & graph theory I; sparse matrix tools & environments I; eigenvalue computations I; iterative methods & acceleration techniques I; applications I; parallel algorithms I; sparse matrix reordering & graphy theory II; sparse matrix tool & environments II; least squares & optimization I; iterative methods & acceleration techniques II; applications II; eigenvalue computations II; least squares & optimization II; parallel algorithms II; sparse direct methods; iterative methods & acceleration techniques III; eigenvalue computations III; and sparse matrix reordering & graph theory III.




Abstract 3360: Loss of sulf-1 reprograms energy metabolism in ovarian cancer  

Science Journals Connector (OSTI)

...for Cancer Research January 2010 meeting-abstract Behavioral...Abstracts - Energy Balance: From...and Community Abstracts: AACR International...Prevention Research-- Dec 6-9...Houston, TX Abstract CN05-04: Energy balance within...

Susmita Mondal; Debarshi Roy; Juliana Camacho Pereira; Eduardo N. Chini; and Vijayalakshmi Shridhar




SciTech Connect (OSTI)

The hydrogen atom abstraction reaction is an important fundamental process that is extensively involved in atmospheric and combustion chemistry. The practical significance of this type of reaction with polyatomic hydrocarbons is manifest, which has led to many kinetics studies. The detailed understanding of these reactions requires corresponding dynamics studies. However, in comparison to the A + HX {radical} AH + X reactions, the study of the dynamics of A + HR {yields} AH + R reactions is much more difficult, both experimentally and theoretically (here and in the following, A stands for an atom, X stands for a halogen atom, and R stands for a polyatomic hydrocarbon radical). The complication stems from the structured R, in contrast to the structureless X. First of all, there are many internal degrees of freedom in R that can participate in the reaction. In addition, there are different carbon sites from which an H atom can be abstracted, and the dynamics are correspondingly different; there are also multiple identical carbon sites in HR and in the picture of a local reaction, there exist competitions between neighboring H atoms, and so on. Despite this complexity, there have been continuing efforts to obtain insight into the dynamics of these reactions. In this chapter, some examples are presented, including the reactions of ground state H, Cl, and O atoms, with particular focus on our recent work using imaging to obtain the differential cross sections for these reactions.




Microsoft PowerPoint - aps2007-abstract.ppt  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

on MSE: theory S. Scott (PPPL) J. Ko, I. Hutchinson (PSFC/MIT) H. Yuh (Nova Photonics) Poster NP8.00087 49 th Annual Meeting, DPP-APS Orlando, FL November 2007 Abstract A standard calibration technique for Motional Stark Effect (MSE) diagnostics is to compare the polarization direction of Doppler-shifted Hα emission from a diagnostic neutral beam (DNB) that is fired into a gas-filled torus to the pitch angle inferred from known toroidal and vertical fields. However, the polarization direction of Hα emission from "secondary" beam neutrals that ionize, gyrate about field lines, and then charge exchange a second time differs from the polarization direction of the primary beam neutrals and thus confuses the calibration results. We compute the ratio of secondary-to-primary H emission, I

Note: This page contains sample records for the topic "abstract switchgrass panicum" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Broader source: Energy.gov (indexed) [DOE]

WAIVER ACTION - WAIVER ACTION - ABSTRACT REQUESTER CONTRACT SCOPE OF WORK RATIONAL FOR DECISION DISPOSITION General Motors Conduct research, development and Cost Sharing 20 percent Recommended Corporation testing of 30 KW proton-exchange- membrane (PEM) fuel cell propulsion systems 0 STATEMENT OF CONSIDERATIONS REQUEST BY GENERAL MOTORS CORPORATION FOR AN ADVANCE WAIVER OF DOMESTIC AND FOREIGN RIGHTS UNDER CONTRACT NO. DE-AC02-90CH10435, W(A)-90- 056, CH-0663 The Allison Gas Turbine Division of the General Motors Corporation (hereafter GM), a large business, has petitioned for an advance waiver of patent rights under DOE Contract No. DE-AC02- 90CH10435. The contract, yet to be definitized, resulted from an RFP issued in January 1990. As set out in the attached waiver petition, GM has requested that domestic and foreign title to


Microsoft Word - BPA PFEIS Cover Abstract.doc  

Broader source: Energy.gov (indexed) [DOE]

Final Environmental Impact Statement Final Environmental Impact Statement February 2011 DOE/EIS-0422 Central Ferry-Lower Monumental 500-kilovolt Transmission Line Project Final Environmental Impact Statement Bonneville Power Administration February 2011 FEIS i Central Ferry - Lower Monumental 500-kilovolt Transmission Line Project Responsible Agency: U.S. Department of Energy (DOE), Bonneville Power Administration (BPA) Cooperating Agency: Washington Energy Facility Site Evaluation Council (EFSEC) Title of Proposed Project: Central Ferry-Lower Monumental 500-kilovolt Transmission Line Project, DOE/EIS - 0422 State Involved: Washington Abstract: BPA is proposing to construct, operate, and maintain a 38- to 40-mile-long 500-kilovolt (kV) transmission line in Garfield, Columbia, and Walla Walla counties, Washington. The proposed line would


Low Dose Radiation Research Program: Research Program Workshop I Abstracts  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Genetic Factors Affecting Susceptibility to Low-Dose Radiation Genetic Factors Affecting Susceptibility to Low-Dose Radiation William F. Morgan and John H.J. Petrini Radiation Oncology Research Laboratory, University of Maryland at Baltimore, Baltimore, MD Summary: The goal of our application is to improve the scientific basis for understanding potential risks to the population from low dose radiation exposure based on potential genetic differences that may modulate an individual's sensitivity to low doses of radiation. Abstract: The goal of this application is to improve the scientific basis for understanding potential risks to the population from low dose radiation exposure. We propose to address specific genetic factors that affect individual susceptibility to low dose radiation and ask the question do genetic differences exist that make some individuals more sensitive to


Microsoft Word - Poster Abstract_2010_WVU.doc  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Syngas Trace Contaminants on SOFC Anode Performance Syngas Trace Contaminants on SOFC Anode Performance Ismail Celik National Institute for Fuel Cell Technology West Virginia University Ismail.celik@mail.wvu.edu Abstract National Institute for Fuel Cell Technology (NIFT) at West Virginia University (WVU) is a center of excellence on research related to fuel cell technology specifically and, in general, to clean power generation from coal derived fuels as well as renewable energy. The research cluster is based on a multi-scale, multi- disciplinary approach, conducted by nine faculty members in four departments at WVU including collaboration with the National Energy Technology Laboratory. NIFT members are conducting research to establish the tolerance limits of contaminant levels in the coal syngas for SOFCs and to predict the lifetime of the


Abstracts of the symposium on unsaturated flow and transport modeling  

SciTech Connect (OSTI)

Abstract titles are: Recent developments in modeling variably saturated flow and transport; Unsaturated flow modeling as applied to field problems; Coupled heat and moisture transport in unsaturated soils; Influence of climatic parameters on movement of radionuclides in a multilayered saturated-unsaturated media; Modeling water and solute transport in soil containing roots; Simulation of consolidation in partially saturated soil materials; modeling of water and solute transport in unsaturated heterogeneous fields; Fluid dynamics and mass transfer in variably-saturated porous media; Solute transport through soils; One-dimensional analytical transport modeling; Convective transport of ideal tracers in unsaturated soils; Chemical transport in macropore-mesopore media under partially saturated conditions; Influence of the tension-saturated zone on contaminant migration in shallow water regimes; Influence of the spatial distribution of velocities in porous media on the form of solute transport; Stochastic vs deterministic models for solute movement in the field; and Stochastic analysis of flow and solute transport. (DMC)

Not Available



JGI - CSP Sequencing Plans for 2013  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

3 3 Proposer Affiliation Project Description Bartley, Laura University of Oklahoma Switchgrass resequencing to enhance biofuel production Bartley, Laura University of Oklahoma Panicum virgatum RNA sequencing to identify gene expression changes related to biofuel traits Blanchard, Jeffrey University of Massachusetts Microbial community dynamics in a long-term soil warming chronosequence Boeke, Jef Johns Hopkins University Synthesis of the largest yeast chromosome, chromosome IV, and the synthetic yeast genome Sc2.0 Brune, Andreas Max-Planck Institute, Marburg, Germany Metagenomics and metatranscriptomics of the gut microbiota of higher termites Constant, Philippe INRS, Canada Metagenomic and Metatranscriptomic Analysis of Soil Biogeochemical Processes Sustained by Interspecific Transfer of Molecular Hydrogen


Abstract A77: Colorectal cancer screening among overweight versus non-overweight Asian Americans  

Science Journals Connector (OSTI)

...Cancer Research. November 2014 meeting-abstract Behavioral and Social Science Other Topics in Behavioral and Social Science Other Topics in Behavioral and Social Science: Poster Presentations - Proffered Abstracts Abstracts: Sixth AACR Conference...

Edwin Chandraskar; Helen Lam; Karen Kim



Abstract A81: Examining racial differences in social support needs among women diagnosed with ovarian cancer  

Science Journals Connector (OSTI)

...Cancer Research. November 2014 meeting-abstract Behavioral and Social Science Other Topics in Behavioral and Social Science Other Topics in Behavioral and Social Science: Poster Presentations - Proffered Abstracts Abstracts: Sixth AACR Conference...

Will Tarver; Michelle Martin; Ronald Alvarez; Ellen Funkhouser; Kerri Bevis; Maria Pisu



Abstract 1258: Regulation of energy metabolism and protein synthesis by the Pim protein kinases  

Science Journals Connector (OSTI)

...American Association for Cancer Research April 15, 2010 meeting-abstract Prevention Research Poster Presentations - Proffered Abstracts Poster Presentations - Animal...Washington, DC Abstract 950: Energy deprivation by Inositol Hexaphosphate...

Marina Yu Zemskova; Zanna Beharry; Sandeep Mahajan; and Andrew S. Kraft



Abstract CN06-03: Pediatric obesity research: a transdisciplinary approach  

Science Journals Connector (OSTI)

...meeting-abstract Prevention Research Poster Presentations...Late-Breaking Abstracts Late-Breaking...Dietary energy balance modulation...Dietary energy balance modulation...factor-1. [abstract]. In: Proceedings...for Cancer Research; 2013 Apr...

Donna Spruijt-Metz



Abstract CN05-04: Energy balance within the community: What's new?  

Science Journals Connector (OSTI)

...meeting-abstract Prevention Research Poster Presentations...Proffered Abstracts Poster Presentations...Dietary energy balance modulates...of dietary energy balance on...Authors}. {Abstract title...for Cancer Research; 2010 Apr...

Tim E. Byers



Abstract 1858: Development of a multiplex panel of biomarkers to assess energy metabolism in cancer.  

Science Journals Connector (OSTI)

...May 2009 meeting-abstract Cellular and Molecular...Presentations - Proffered Abstracts AACR Annual Meeting...2009; Denver, CO Abstract #8: A translational research paradigm by using...couple with dietary energy restriction for breast...

Meenakshi P. Balakrishnan; Ralph E. Parchment; Melinda G. Hollingshead; Joseph E. Tomaszewski; Robert J. Kinders; James H. Doroshow; and Apurva K. Srivastava



SPLTRAK Abstract Submission file:///Users/lauren/Documents/Research/2007/HBM/abstractHBM20... 1 of 4 1/8/07 1:18 PM  

E-Print Network [OSTI]

SPLTRAK Abstract Submission file:///Users/lauren/Documents/Research/2007/HBM/abstractHBM20... 1 white matter of each subject. A low anisotropy threshold was employed to allow tracking into the tumor-11 (2006); [2] O'Donnell L et al. AJNR, 27(5) (2006). #12;SPLTRAK Abstract Submission file:///Users/lauren/Documents


Selected translated abstracts of Russian-language climate-change publications: II, Clouds. Issue 159  

SciTech Connect (OSTI)

This report presents abstracts (translated into English) of important Russian-language literature concerning clouds as they relate to climate change. In addition to the bibliographic citations and abstracts translated into English, this report presents the original citations and abstracts in Russian. Author and title indexes are included to assist the reader in locating abstracts of particular interest.

Burtis, M.D. [comp.



Selected translated abstracts of Russian-language climate-change publications: I, Surface energy budget  

SciTech Connect (OSTI)

This report presents abstracts (translated into English) of important Russian-language literature concerning the surface energy budget as it relates to climate change. In addition to the bibliographic citations and abstracts translated into English, this report presents the original citations and abstracts in Russian. Author and title indexes are included, to assist the reader in locating abstracts of particular interest.

Burtis, M.D. (comp.)



Selected translated abstracts of Russian-language climate-change publications, III aerosols: Issue 164  

SciTech Connect (OSTI)

This report presents abstracts in Russian and translated into English of important Russian-language literature concerning aerosols as they relate to climate change. In addition to the bibliographic citations and abstracts translated into English, this report presents the original citations and abstracts in Russian. Author and title indexes are included to assist the reader in locating abstracts of particular interest.

Razuvaev, V.N.; Ssivachok, S.G. [All-Russian Research Inst. of Hydrometeorological Information-World Data Center, Obninsk (Russian Federation)



Selected translated abstracts of Russian-language climate-change publications. 4: General circulation models  

SciTech Connect (OSTI)

This report presents English-translated abstracts of important Russian-language literature concerning general circulation models as they relate to climate change. Into addition to the bibliographic citations and abstracts translated into English, this report presents the original citations and abstracts in Russian. Author and title indexes are included to assist the reader in locating abstracts of particular interest.

Burtis, M.D. [comp.] [Oak Ridge National Lab., TN (United States). Carbon Dioxide Information Analysis Center; Razuvaev, V.N.; Sivachok, S.G. [All-Russian Research Inst. of Hydrometeorological Information--World Data Center, Obninsk (Russian Federation)



11th Topical conference high-temperature plasma diagnostics. Book of abstracts  

SciTech Connect (OSTI)

This report contains abstracts from the 11th topical conference on high-temperature plasma diagnostics.




hal-00136662,version1-14Mar2007 Relational Abstract Domains for the  

E-Print Network [OSTI]

generic. 2 Related Work Abstract Domains. A key component in Abstract-Interpretation-based anal- yseshal-00136662,version1-14Mar2007 Relational Abstract Domains for the Detection of Floating-Point Run-Time Errors Antoine Min´e DI-´Ecole Normale Sup´erieure de Paris, France, mine@di.ens.fr Abstract We present

Paris-Sud XI, Université de



E-Print Network [OSTI]

, MA 02139, U.S.A. e-mail address: brossman@mit.edu Abstract. In earlier work, the Abstract StateINTERACTIVE SMALL-STEP ALGORITHMS II: ABSTRACT STATE MACHINES AND THE CHARACTERIZATION THEOREM Machine Thesis -- that arbitrary algo- rithms are behaviorally equivalent to abstract state machines

Blass, Andreas R.

Note: This page contains sample records for the topic "abstract switchgrass panicum" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Method of pollination and heritability for seedling vigor in switchgrass  

E-Print Network [OSTI]

selection or modified ear to row selection for reductions in the arabinose:glucose or xylose:glucose ratios. Biomass Yield Production of transportation fuels, such as ethanol, and generation of electrical power are the two primary markets for bioenergy.... The biofuels industry in the US is 9 based almost entirely (98%) on the conversion of corn (Zea mays L.) to ethanol (Petrulis et al. 1993). There are three principal technological endpoints for bioenergy crops: 1) conversion to liquid fuels; 2) combustion...

Ramirez de Leon, Hector



Changes in soil carbon and nitrogen associated with switchgrass production  

E-Print Network [OSTI]

.), other forage grasses, cultivated crops, and forest were collected seasonally at six locations. Soil organic C (SOC), total N, soil microbial biomass C (SMBC) and N (SMBN), soil mineralizable C and N, and basal soil respiration (BSR) were in general...

Lobo Alonzo, Porfirio Jose



Understanding Mineral Transport in Switchgrass | U.S. DOE Office...  

Office of Science (SC) Website

of sustainably grown feedstocks (i.e., bioenergy crops that yield high amounts of biomass with minimal inputs of water, fertilizer, and other chemicals). The efficient...


Glycoside Hydrolase Activities of Thermophilic Bacterial Consortia Adapted to Switchgrass  

Science Journals Connector (OSTI)

...configurations designed to transform lignocellulosic biomass into biofuels (11, 23). The large variety of potential biomass feedstocks and pretreatments available require tailored glycoside hydrolase cocktails that function optimally under diverse...

John M. Gladden; Martin Allgaier; Christopher S. Miller; Terry C. Hazen; Jean S. VanderGheynst; Philip Hugenholtz; Blake A. Simmons; Steven W. Singer



A Genomics Approach to Deciphering Lignin Biosynthesis in Switchgrass  

Science Journals Connector (OSTI)

...energy expended during production, harvesting, and processing...sugar release. The cost of processing to overcome...thioacidolysis followed by gas chromatography-mass...and increases ethanol production by up to 38% using...element differentiation or production of extracellular (i...

Hui Shen; Mitra Mazarei; Hiroshi Hisano; Luis Escamilla-Trevino; Chunxiang Fu; Yunqiao Pu; Mary R. Rudis; Yuhong Tang; Xirong Xiao; Lisa Jackson; Guifen Li; Tim Hernandez; Fang Chen; Arthur J. Ragauskas; C. Neal Stewart; Jr.; Zeng-Yu Wang; Richard A. Dixon



Switchgrass as a High-Potential Energy Crop  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

are generally available free via the U.S. Department of Energy (DOE) Information Bridge. Web site http:www.osti.govbridge Reports produced before January 1, 1996, may be...


Introduction Chaos Kac's program What we prove Abstract setting The abstract theorem Deriving the H-theorem Inverse solution to the Kac's program in mean-field  

E-Print Network [OSTI]

Introduction Chaos Kac's program What we prove Abstract setting The abstract theorem Deriving the H PDE Days, 26-27th of april 2011 Joint work with S. Mischler: arXiv:1001.2994 Joint work with S. Mischler and B. Wennberg: hal-00559132 Joint work with M. Hauray and S. Mischler in progress #12

Jensen, Max



Science Journals Connector (OSTI)

......Determination of Aldehydes and Ketones in Diesel Exhaust G. Creech, R.T. Johnson...faster than any other resin column on the market, up to 1.2 ml/min at 90 C, and 0...05 to 10 ppm range for carbonyls in diesel exhaust were made with good precision......

Brief Abstracts




Science Journals Connector (OSTI)

......The unrivaled reliability. More importantly...computer regression analysis were used to define...On-Line Single Run Analysis of Effluents from a Flscher- Tropsch Reactor 40 H.H. Nijs...Fischer- Tropsch reactor is presented. Fast...Chromatographic Analysis with Short Columns......

Brief Abstracts



Abstract Measurement  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

however, are not well understood in this energy range. This dissertation presents a measurement of the ratio of CC + to CCQE cross-sections for muon neutrinos on mineral oil (CH...


Meeting abstracts  

Science Journals Connector (OSTI)

Mikkel Rosendahl, MD, Ph.D1, Morten Tolstrup Andersen, MSc2, Mette Klarskov Andersen, MD, DMSc2, Lars Kjeldsen, MD, DMSc3, Elisabeth Ralfkir, MD, DMSc4, and Claus Yding Andersen, MSc, DMSc1



Abstract A33: Exploring pediatric cancer genomics with the UCSC Cancer Genomics Browser  

Science Journals Connector (OSTI)

...October 2014 meeting-abstract Pediatric Cancer Genomics and Epigenomics Pediatric Cancer Genomics and Epigenomics: Poster Presentations - Proffered...Abstract A33: Exploring pediatric cancer genomics with the UCSC Cancer Genomics Browser Melissa...

Melissa Cline; Olena Morozova; Teresa Swatloski; Brian Craft; Mary Goldman; David Haussler; Jingchun Zhu



Abstract LB-63: From the Golf Course to Education: Outreach & Support for Prostate Cancer  

Science Journals Connector (OSTI)

...meeting-abstract Immunology Poster Presentations - Proffered Abstracts Poster Presentations - Inflammation...suppressive cells require education from tumor-evoked Bregs...suppressive cells require education from tumor-evoked Bregs...

Egbert Brown



Abstract LB-43: Community health advisors: a model in community outreach and health education  

Science Journals Connector (OSTI)

...meeting-abstract Advocate Presentations Poster Presentations - Proffered Abstracts Poster Presentations - Advocates Poster Session Proceedings: AACR 103rd Annual...model in community outreach and health education Brenda M. Kyles 1 1Shelby County Health...

Brenda M. Kyles



Abstract ADV05: From the golf course to education, outreach, and support for prostate cancer.  

Science Journals Connector (OSTI)

...meeting-abstract Epidemiology Poster Presentations - Proffered Abstracts Poster Presentations - Epidemiologic...community-based breast cancer education intervention in New York State...conducted a community-based education intervention among targeted...

Egbert Brown



Abstract B6: Project toolbox: A practice-based model to address cancer health disparities  

Science Journals Connector (OSTI)

...meeting-abstract Behavioral and Social Science Health Education: Poster Presentations - Proffered Abstracts...International Conference on the Science of Cancer Health Disparities...health-related community education and outreach projects. Methods...

LaShonda Coulbertson; Desiree Rivers; Venessa Rivera-Colon; and Marlene Rivera



Abstract A29: Developing biospecimen and clinical research education materials for ethnic minorities and younger survivors.  

Science Journals Connector (OSTI)

...meeting-abstract Behavioral and Social Science Poster Presentations - Proffered Abstracts...B31: Collaborative breast health education addressing an alarming public health...Early Awareness is a breast health education program of Howard University Cancer...

Sophia Yeung; Mayra Serrano; and Kimlin Ashing-Giwa



Abstract B33: Project LINK: breaking new ground in fueling minority research experiences  

Science Journals Connector (OSTI)

...meeting-abstract Behavioral and Social Science Health Education: Poster Presentations - Proffered Abstracts...International Conference on the Science of Cancer Health Disparities...had less than a high school education. Clinical presentation, stage...

John L. Robinson; Maria Rincon; Emanuel Ortiz; Nia Jackson; Megan Newton; Scott Antonia; William S. Dalton; and Cathy D. Meade



Abstract B30: Increasing awareness of health research in the African American community  

Science Journals Connector (OSTI)

...meeting-abstract Behavioral and Social Science Health Education: Poster Presentations - Proffered Abstracts...International Conference on the Science of Cancer Health Disparities...CRC screenings lack adequate education of the various CRC procedures...

Carmelle D. Rogers; Mintesinot Jiru; Jamal Uddin; Tatiana Roth; and Jacob Adeyeye



Abstract A25: Evaluation of the food environment in rural towns in eastern Washington  

Science Journals Connector (OSTI)

...meeting-abstract Behavioral and Social Science Community-Based Interventions Community-Based...Abstracts: Sixth AACR Conference: The Science of Cancer Health Disparities; December...Center, Seattle, WA, 2Oregon Health and Science University, Portland, OR. Introduction...

Linda K. Ko; Cynthia Perry; Norma Mariscal; Edgar Rodriguez; Catherine Duggan; Mario Kratz; Beti Thompson


Note: This page contains sample records for the topic "abstract switchgrass panicum" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Abstract ED03-02: Communication in the context of community-based participatory research  

Science Journals Connector (OSTI)

...meeting-abstract Behavioral and Social Science Tailored Health Communications to Address...Abstracts: Sixth AACR Conference: The Science of Cancer Health Disparities; December...Estrada Louisiana State University Health Sciences Center, New Orleans, LA. Scientists...

John J. Estrada



Abstract A15: An innovative intervention to promote breast cancer screening in Chinese American women  

Science Journals Connector (OSTI)

...meeting-abstract Behavioral and Social Science Cancer Communications Cancer Communications...Abstracts: Sixth AACR Conference: The Science of Cancer Health Disparities; December...shines a new light to patient education science that a two-way communication exchange...

Helen Lam; Lisa Hinton; Karen Kim



Abstract A10: The development of a culturally appropriate informed consent communication tool  

Science Journals Connector (OSTI)

...meeting-abstract Behavioral and Social Science Cancer Communications Cancer Communications...Abstracts: Sixth AACR Conference: The Science of Cancer Health Disparities; December...CDRN's clinical trials and biospecimen science arm was originally funded by Biospecimen...

Samantha Torres; Erika de la Riva; Chirisse Taylor; Marla Clayman; Melissa Simon



Abstract PL02-02: Energy balance and cancer prevention: Lessons learned from clinical research  

Science Journals Connector (OSTI)

...for Cancer Research October 2011 meeting-abstract Epidemiology...Lifestyle Factors Energy Balance and...Prevention Research-- Oct 22-25...Boston, MA Abstract PL02-02: Energy balance and...from clinical research Pamela J...

Pamela J. Goodwin



Abstract 3373: Contribution of microRNA-122 to the homeostasis of liver energy metabolism  

Science Journals Connector (OSTI)

...for Cancer Research. 1 October 2014 meeting-abstract Molecular and...muscle as an energy repository...cells as an energy source. Citation...muscle as an energy repository. [abstract]. In: Proceedings...for Cancer Research; 2014 Apr...

Ann-Ping Tsou; Shuo-Ting Wang; and Tse-Wen Tao



Abstract 950: Energy deprivation by Inositol Hexaphosphate inhibits prostate tumor growth and progression in TRAMP mice  

Science Journals Connector (OSTI)

...Association for Cancer Research 15 April 2013 meeting-abstract Molecular and Cellular...fluorescence resonance energy transfer (FRET...FRET) technology. [abstract]. In: Proceedings...Association for Cancer Research; 2013 Apr 6-10...

Komal Raina; Kameswaran Ravichandran; Subapriya Rajamanickam; Kendra M. Hasebroock; Natalie J. Serkova; and Rajesh Agarwal



Abstract 1905: Influence of serum and oxygen on lipid biosynthesis and energy metabolism in murine glioblastoma.  

Science Journals Connector (OSTI)

...for Cancer Research. 1 October 2014 meeting-abstract Cancer Chemistry...resonance energy transfer...resonance energy transfer...resonance energy transfer (TR-FRET). [abstract]. In...for Cancer Research; 2014 Apr...

Nathan Ta and Thomas Seyfried



Abstract 4324: BNip3 connects energy sensing to hepatic lipid metabolism and mitophagy  

Science Journals Connector (OSTI)

...Association for Cancer Research April 15, 2013 meeting-abstract Molecular and Cellular...fluorescence resonance energy transfer (FRET...technology. [abstract]. In: Proceedings...Association for Cancer Research; 2013 Apr 6-10...

Michelle L. Boland; He Huang; Ramilla Shah; Almas Ali; Yingming Zhao; Christopher J. Rhodes; and Kay F. Macleod



Abstract B30: Indicators of energy balance and breast cancer risk among white and black women  

Science Journals Connector (OSTI)

...Lifestyle, and Genetics Physical Activity and Energy Balance Physical Activity and Energy Balance: Poster Presentations - Proffered Abstracts...2013; Atlanta, GA Abstract B30: Indicators of energy balance and breast cancer risk among white and...

Maureen Sanderson; Sandra L. Deming-Halverson; Alecia M. Fair; Martha J. Shrubsole; Alicia Beeghly-Fadiel; Sarah Nechuta; Yong Cui; David Shen-Miller; Heather O'Hara; Nia Foderingham; Xiao-Ou Shu; Wei Zheng



Abstract CN05-01: Genomics and cancer management: Mind the gap!  

Science Journals Connector (OSTI)

...2013 meeting-abstract Carcinogenesis Genomics and Epigenetics of Risk Prediction in Early Disease Genomics and Epigenetics of Risk Prediction in...National Harbor, MD Abstract CN05-01: Genomics and cancer management: Mind the gap...

Janusz A. Jankowski



Abstract 3834: The National Biomarkers Development Alliance (NBDA): A comprehensive solution  

Science Journals Connector (OSTI)

...Diego, CA Abstract 3834: The National Biomarkers Development Alliance (NBDA): A comprehensive solution Carolyn C. Compton The...Compton, The NBDA Team. The National Biomarkers Development Alliance (NBDA): A comprehensive solution. [abstract]. In: Proceedings...

Carolyn C. Compton and The NBDA Team



Abstract PL08-03: Melanoma Research Alliance: Investing in innovation.  

Science Journals Connector (OSTI)

...Abstract PL08-03: Melanoma Research Alliance: Investing in innovation. Louise M. Perkins Melanoma Research Alliance, Washington, DC Melanoma is the deadliest...Louise M. Perkins. Melanoma Research Alliance: Investing in innovation. [abstract...

Louise M. Perkins



E-Print Network 3.0 - alloy particles abstract Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

point of view Summary: , TEM, SEM, aluminum alloys, intermetallics particles, micro-electrochemistry Abstract Corrosion... population of intermetallic particles within...


Counterexample-guided Abstraction Re nement E. Clarke, O. Grumberg, S. Jha, Y. Lu, H. Veith  

E-Print Network [OSTI]

the model. The atomic formulas are similar to the predicates used for abstraction by Graf and Saidi 14


Counterexampleguided Abstraction Refinement E. Clarke, O. Grumberg, S. Jha, Y. Lu, H. Veith  

E-Print Network [OSTI]

. The atomic formulas are similar to the predicates used for abstraction by Graf and Saidi [14] and later


Checking Consistency of C and Verilog using Predicate Abstraction and Induction  

E-Print Network [OSTI]

consistency between an ANSI- C program and a circuit given in Verilog using Predicate Abstraction to existing tools that perform predicate abstraction, our approach is SAT-based and allows all ANSI Abstraction, Verilog, SAT, Equivalence Checking #12;1 Introduction ANSI-C is a language designed for best


Predicate Abstraction of ANSI--C Programs using SAT Edmund Clarke Daniel Kroening Natasha Sharygina  

E-Print Network [OSTI]

Predicate Abstraction of ANSI--C Programs using SAT Edmund Clarke Daniel Kroening Natasha Sharygina technique that uses an efficient SAT solver for generating the abstract transition relation of ANSI Abstraction, ANSI­C, SAT #12; 1 Introduction It is widely believed that effective model checking [10


Optimization Strategy apply to an Attribute Algorithm for the Abstract Interpretation  

E-Print Network [OSTI]

Cedex FRANCE e-mail: musumbu@labri.fr Abstract Presented in this work is a novel approach to implement of the transformation and that fixed point is the abstract semantics of the given logic program. Presented in this workOptimization Strategy apply to an Attribute Algorithm for the Abstract Interpretation Kaninda

Paris-Sud XI, Université de


Towards a Methodology for the Design of Abstract Machines for Logic Programming Languages  

E-Print Network [OSTI]

of Warren's Abstract Machine. The paper complements previous work of P. Kursawe who reconstructed several for the design of abstract machines and intermediate languages. Much of that work is due to M. Wand who designedTowards a Methodology for the Design of Abstract Machines for Logic Programming Languages Ulf

Zhao, Yuxiao


Titles and Abstracts Stephen Curran: A characterization of freeness by invari-  

E-Print Network [OSTI]

model on ran- dom graphs (based on joint work with Jones, Shlyakhtenko, Zinn Justin) Abstract of embeddable von Neumann algebras and sofic groups (based on joint work with N. Brown and K. Jung). Abstract work with M. Junge and T. Mei) Abstract: Given a discrete group G, consider a Fourier mul- tiplier Tm

Sunder, V S

Note: This page contains sample records for the topic "abstract switchgrass panicum" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Abstract 2830: Energy balance and breast cancer risk among sisters pairs in the Breast Cancer Family Registry Study  

Science Journals Connector (OSTI)

...for Cancer Research 7 January 2010 meeting-abstract Behavioral...Abstracts - Energy Balance: From...and Community Abstracts: AACR International...Prevention Research-- Dec 6-9...Houston, TX Abstract CN05-04: Energy balance within...

Fang Fang Zhang; Esther M. John; Dee W. West; Julia Knight; Irene Andrulis; Saundra Buys; Mary Daly; Beth Stearman; Manleen Kaur; Jamboor Vishwanatha; Alfredo Morabia; and Mary Beth Terry



A Symbolic Approach to Predicate Abstraction ? Shuvendu K. Lahiri 1 , Randal E. Bryant 1 , and Byron Cook 2  

E-Print Network [OSTI]

abstraction, #12;rst proposed by Graf and Saidi [15] as a special case of the general framework of abstract the abstract transition relation or the abstract state space. Most of the current methods, including Saidi

Sulzmann, Martin


Abstract Submitted to the NANOTUBE'05 Conference: Temperature dependence of Raman scattering from  

E-Print Network [OSTI]

://www.fy.chalmers.se/conferences/nt05/abstracts/P359.html; has been visited 27 times since April 7th. Last update: April 7th; 1

Maruyama, Shigeo


Nuclear medicine and imaging research. Progress report, January 1, 1980-December 31, 1980. [Lead Abstract  

SciTech Connect (OSTI)

Separate abstracts were prepared for the 5 subprojects designated as projects 1 to 4 and 6 in this progress report. (KRM)

Beck, R. N.; Cooper, M. C.



2015 National Environmental Justice Conference and Training Program Call for Abstracts  

Broader source: Energy.gov [DOE]

The 2015 National Environmental Justice Conference and Training Program planners are inviting individuals to submit abstracts, not to exceed two pages, related to environmental justice. Each...


Science and engineering research semester internship, Fall 1996, abstracts and research papers  

SciTech Connect (OSTI)

This document consists of abstracts and research papers from the science and engineering research semester internship fall 1996 at Lawrence Livermore National Laboratory.

Williams, B.; Brown, E.; Davis, M.; Downs, J.; Fox, K.; Hayden, C.; Jacobsen, E.; Kraut, E.; Lawrence, S.; Legler, T.; Oram, S.; Ragland, S.



E-Print Network 3.0 - abstracts volume 87-1 Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Utrecht Collection: Mathematics 2 Technical Report Documentation Page 1. Report No. Summary: Database 16. Abstract Comprehensive and reliable databases are essential for the...


Materials science and engineering at the Oak Ridge National Laboratory. Abstracts  

SciTech Connect (OSTI)

Abstracts of 31 papers are arranged under the following headings: surfaces and interfaces, advanced materials, and structural and electronic ceramics. (DLC)

Not Available



E-Print Network 3.0 - abstract proceedings signal Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Engineering 15 VHDL & SIGNAL: A COOPERATIVE APPROACH Mohammed BELHADJ Summary: , FRANCE ABSTRACT This work presents the study done to integrate VHDL with the Signal...


E-Print Network 3.0 - assessment lead abstract Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Network Management Information for Light-Path Assessment Summary: Institute of Technology Abstract - In this work, we consider assessing wavelength availability using partial......


CALL FOR ABSTRACTS for the 2014 National Environmental Justice Conference and Training Program  

Broader source: Energy.gov [DOE]

The 2014 National Environmental Justice Conference and Training Program planners are inviting individuals to submit abstracts, not to exceed two pages, related to environmental justice.


E-Print Network 3.0 - abstract executive summary Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

like C. There are numerous... ) and there are verifiers for cryptographic protocols that work on fairly abstract descriptions, but so far very few Source: Jurjens, Jan - Fakultt...


E-Print Network 3.0 - abstract state machines Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Machine Refinement in UML-B Summary: to facilitate abstraction is also introduced. Our work makes explicit the structures of class and state machine... -B. The essential concept...


The development and current status of perennial rhizomatous grasses as energy crops in the US and Europe  

Science Journals Connector (OSTI)

Perennial grasses display many beneficial attributes as energy crops, and there has been increasing interest in their use in the US and Europe since the mid-1980s. In the US, the Herbaceous Energy Crops Research Program (HECP), funded by the US Department of Energy (DOE), was established in 1984. After evaluating 35 potential herbaceous crops of which 18 were perennial grasses it was concluded that switchgrass (Panicum virgatum) was the native perennial grass which showed the greatest potential. In 1991, the DOE's Bioenergy Feedstock Development Program (BFDP), which evolved from the HECP, decided to focus research on a model crop system and to concentrate research resources on switchgrass, in order to rapidly attain its maximal output as a biomass crop. In Europe, about 20 perennial grasses have been tested and four perennial rhizomatous grasses (PRG), namely miscanthus (Miscanthus spp.), reed canarygrass (Phalaris arundinacea), giant reed (Arundo donax) and switchgrass (Panicum virgatum) were chosen for more extensive research programs. Reed canarygrass and giant reed are grasses with the C3 photosynthetic pathway, and are native to Europe. Miscanthus, which originated in Southeast Asia, and switchgrass, native to North America, are both C4 grasses. These four grasses differ in their ecological/climatic demands, their yield potentials, biomass characteristics and crop management requirements. Efficient production of bioenergy from such perennial grasses requires the choice of the most appropriate grass species for the given ecological/climatic conditions. In temperate and warm regions, C4 grasses outyield C3 grasses due to their more efficient photosynthetic pathway. However, the further north perennial grasses are planted, the more likely cool season grasses are to yield more than warm season grasses. Low winter temperatures and short vegetation periods are major limits to the growth of C4 grasses in northern Europe. With increasing temperatures towards central and southern Europe, the productivity of C4 grasses and therefore their biomass yields and competitiveness increase. Since breeding of and research on perennial rhizomatous grasses (PRG) is comparatively recent, there is still a significant need for further development. Some of the given limitations, like insufficient biomass quality or the need for adaption to certain ecological/climatic zones, may be overcome by breeding varieties especially for biomass production. Furthermore, sure and cost-effective establishment methods for some of the grasses, and effective crop production and harvest methods, have yet to be developed. This review summarizes the experience with selecting perennial grasses for bioenergy production in both the US and Europe, and gives an overview of the characteristics and requirements of the four most investigated perennial rhizomatous grasses; switchgrass, miscanthus, reed canarygrass and giant reed.

Iris Lewandowski; Jonathan M.O. Scurlock; Eva Lindvall; Myrsini Christou



Edinburgh Research Explorer Quantifying the implicit process flow abstraction in SBGN-PD  

E-Print Network [OSTI]

Edinburgh Research Explorer Quantifying the implicit process flow abstraction in SBGN-PD diagrams the implicit process flow abstraction in SBGN-PD diagrams with Bio-PEPA'. in Proceedings of COMPMOD 2009. ETPCS to publication record in Edinburgh Research Explorer Published In: Proceedings of COMPMOD 2009 General rights

Millar, Andrew J.


Re ning Abstract Machine Speci cations of the Steam Boiler Control to Well Documented  

E-Print Network [OSTI]

Re ning Abstract Machine Speci cations of the Steam Boiler Control to Well Documented Executable the steam boiler control speci cation problem to il- lustrate how the evolving algebra approach to the speci, in June 1995, to control the Karlsruhe steam boiler simulator satisfactorily. The abstract machines

Börger, Egon


BPM-in-the-Large Towards a higher level of abstraction in Business Process Management  

E-Print Network [OSTI]

BPM-in-the-Large ­ Towards a higher level of abstraction in Business Process Management Constantin@idi.ntnu.no Abstract. Business Process Management (BPM) has gained tremendous importance in recent years and BPM that existing approaches have problems dealing with the enormous challenges real-life BPM projects are facing

Paris-Sud XI, Université de


Tool-Assisted Unit-Test Generation and Selection Based on Operational Abstractions  

E-Print Network [OSTI]

Tool-Assisted Unit-Test Generation and Selection Based on Operational Abstractions Tao Xie1 of Washington, Seattle, WA 98105 Abstract. Unit testing, a common step in software development, presents a chal- lenge. When produced manually, unit test suites are often insufficient to identify defects. The main

Xie, Tao


The iTron Family of Geocast Games (Extended Abstract) Robert J. Hall  

E-Print Network [OSTI]

hand, while physical activity and motor skill development are inherent in athletic and sports gamesThe iTron Family of Geocast Games (Extended Abstract) Robert J. Hall AT&T Labs Research Florham Park, NJ, USA hall@research.att.com Abstract--Geocast games are a new class of digital multi- player

Fisher, Kathleen


A Study of Loop Style and Abstraction in Pedagogic Practice David J. Barnes  

E-Print Network [OSTI]

A Study of Loop Style and Abstraction in Pedagogic Practice David J. Barnes School of Computing: Abstraction, exit-in-the-middle problems, iteration, object orientation, pedagogy, structured programming. 1 the research tradition that our role is to question and not to worship we sought to investigate the deployment

Kent, University of

Note: This page contains sample records for the topic "abstract switchgrass panicum" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Formal verification of a static analyzer: abstract interpretation in type theory  

E-Print Network [OSTI]

Formal verification of a static analyzer: abstract interpretation in type theory Xavier Leroy Inria Paris-Rocquencourt xavier.leroy@inria.fr (Joint work with David Pichardie, Sandrine Blazy, Jacques-Henri Jourdan, and Vincent Laporte.) Abstract Static analysis is the automatic inference and checking of simple

Paris-Sud XI, Université de


NOAA, 2012 Climate Prediction Applications Science Workshop, Climate Services for National Security Challenges: Abstract Submission  

E-Print Network [OSTI]

Challenges: Abstract Submission Presentation Title: Real-time Energy and Climate Simulations: Tools Lynmar Ave., Asheville NC 28804, apjones@climateinteractive.org Presentation Abstract: Under the United.org. #12;Two journal articles are currently under review on this work, one (on the model) at "Climatic

Miami, University of


ECMI2008 Abstract Agent-Based Simulation as a Novel Decision Support Tool for Retail Managers  

E-Print Network [OSTI]

ECMI2008 Abstract Agent-Based Simulation as a Novel Decision Support Tool for Retail Managers Dr Strategy, Learning & Change (LUBS), Leeds, LS2 9JT, UK Abstract: Intelligent agents offer a new and exciting way of understanding the world of work. We apply agent-based simulation to investigate a set

Aickelin, Uwe


From mind to matter: neural correlates of abstract and concrete mindsets  

E-Print Network [OSTI]

From mind to matter: neural correlates of abstract and concrete mindsets Michael Gilead,1 Nira Scopus, Jerusalem 91905, Israel Much work in the field of social cognition shows that adopting an abstract (vs concrete) mindset alters the way people construe the world, thereby exerting substantial

Anat, Maril,


Abstract 4188: Evolutionary dynamics in breast cancer via MRI textural kinetic analysis  

Science Journals Connector (OSTI)

...2013; Washington, DC Abstract 1930: The unknown piece of the pie: Molecular markers in triple-negative lung cancer. Brock...Stephan W. Morris, David R. Hout. The unknown piece of the pie: Molecular markers in triple-negative lung cancer. [abstract...

Jennifer S. Drukteinis; Baishali Chaudhury; Lawrence O. Hall; Dmitry B. Goldgof; Robert Gillies; Robert A. Gatenby



IEEE TRANSACTIONS ON SOFTWARE ENGINEERING, VOL. 23, NO. 3, MARCH 1997 157 On the Practical Need for Abstraction Relations  

E-Print Network [OSTI]

) and abstraction relation (right). 1.1 Prior Work on Abstraction Relations Previous work involving modular for Abstraction Relations to Verify Abstract Data Type Representations Murali Sitaraman, Member, IEEE Computer Society, Bruce W. Weide, Member, IEEE, and William F. Ogden, Member, IEEE Computer Society Abstract


Abstract Error Groups Via Jones Unitary Braid Group Representations at q=i  

E-Print Network [OSTI]

In this paper, we classify a type of abstract groups by the central products of dihedral groups and quaternion groups. We recognize them as abstract error groups which are often not isomorphic to the Pauli groups in the literature. We show the corresponding nice error bases equivalent to the Pauli error bases modulo phase factors. The extension of these abstract groups by the symmetric group are finite images of the Jones unitary representations (or modulo a phase factor) of the braid group at q=i or r=4. We hope this work can finally lead to new families of quantum error correction codes via the representation theory of the braid group.

Yong Zhang



Abstract B26: CDU/UCLA U54 Cancer Center Partnership's Education and Training Program: Methods, measures, and outcomes.  

Science Journals Connector (OSTI)

...meeting-abstract Survivor and Patient Advocacy Poster Presentations - Proffered Abstracts Poster Presentations - Advocates Poster Session Proceedings: AACR 102nd Annual...Abstract LB-63: From the Golf Course to Education: Outreach Support for Prostate Cancer...

Marianna Sarkissyan; May Ong; Yanyuan Wu; Judith Gasson; Robin Farias-Eisner; and Jaydutt V. Vadgama



Abstract A45: Impact of a bilingual education intervention on the quality of life of Latina breast cancer survivors.  

Science Journals Connector (OSTI)

...meeting-abstract Tumor Biology Poster Presentations - Proffered Abstracts Poster Presentations - Macrophages...Washington, DC Abstract 1545: Education of macrophages through modulation...harnessed to overcome the education of macrophages by tumor cells...

Gloria Juarez; Gwen Uman; Betty Ferrell; and Arti Hurria



Abstract A20: HPV and HPV vaccine education intervention: Effects on parents, healthcare staff, and school staff  

Science Journals Connector (OSTI)

...meeting-abstract Advocate Presentations Poster Presentations - Proffered Abstracts Poster Presentations - Advocates Poster Session Proceedings: AACR 104th Annual...Abstract ADV05: From the golf course to education, outreach, and support for prostate...

Paul L. Reiter; Brenda Stubbs; Catherine A. Panozzo; Dianne Whitesell; and Noel T. Brewer



Abstract A20: HPV and HPV vaccine education intervention: Effects on parents, healthcare staff, and school staff  

Science Journals Connector (OSTI)

...October 2010 meeting-abstract Behavioral and Social Science Health Education: Poster Presentations - Proffered Abstracts Abstracts: AACR International Conference on the Science of Cancer Health Disparities-- Sep 30-Oct 3...

Paul L. Reiter; Brenda Stubbs; Catherine A. Panozzo; Dianne Whitesell; and Noel T. Brewer



Abstract A80: Acral melanoma in the Hawaiian Islands: Exploring immunologic PDL-1 signature in the minority population  

Science Journals Connector (OSTI)

...Cancer Research. November 2014 meeting-abstract Behavioral and Social Science Other Topics in Behavioral and Social Science Other Topics in Behavioral and Social Science: Poster Presentations - Proffered Abstracts Abstracts: Sixth AACR Conference...

Shane Y. Morita



Abstract 4834: Energy-dependent AMPK association with the ULK1-mTORC1 complex regulates autophagy  

Science Journals Connector (OSTI)

...for Cancer Research 15 April 2010 meeting-abstract Cellular...Abstract 4834: Energy-dependent...response to energy stress...autophagy under energy stress conditions...Authors}. {Abstract title...for Cancer Research; 2010 Apr...

Jong Woo Lee; Sungman Park; Takahashi Yoshinori; and Hong Gang Wang



Abstract 4360: Distinct energy metabolism in human pluripotent stem cells and differentiated cells regulated by UCP2  

Science Journals Connector (OSTI)

...American Association for Cancer Research 15 April 2010 meeting-abstract Prevention Research Poster Presentations - Proffered Abstracts Poster Presentations - Animal...Washington, DC Abstract 950: Energy deprivation by Inositol Hexaphosphate...

JIin Zhang; Ivan Khvorostov; Jason Hong; Yavuz Oktay; Laurent Vergnes; Esther Nuebel; Anna Do; Hea-Jin Jung; Michael McCaffery; Karen Reue; Carla Koehler; and Michael Teitell



Abstract 4328: Marrow stromal cells promote mitochondrial energy metabolism in primary CLL cells without impacting cellular proliferation  

Science Journals Connector (OSTI)

...meeting-abstract Prevention Research Poster Presentations...Late-Breaking Abstracts Late-Breaking...Dietary energy balance modulation...Dietary energy balance modulation...factor-1. [abstract]. In: Proceedings...for Cancer Research; 2013 Apr...

Hima Venkata Vangapandu; Kumudha Balakrishnan; William G. Wierda; Michael J. Keating; Christine M. Stellrecht; and Varsha Gandhi



E-Print Network 3.0 - abstracts cost action Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

cost action Search Powered by Explorit Topic List Advanced Search Sample search results for: abstracts cost action Page: << < 1 2 3 4 5 > >> 1 Cost-sensitive Iterative Abductive...


E-Print Network 3.0 - abstracts anais da Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Textura de superf citas com sistemas de part Summary: , 22451041 Rio de Janeiro, RJ, Brasil lhf@icad.puc-rio.br Abstract. We present a new method for applying... coordenadas da...


Abstract A42: Adherence to cancer screening tests among Appalachian women  

Science Journals Connector (OSTI)

...Atlanta, GA Abstract A42: Adherence to cancer screening tests among Appalachian women Electra D. Paskett Gregory...disparities in the receipt of recent cancer screening tests for each test individually (ie, mammography (MA), Pap Test...

Electra D. Paskett; Gregory Young; Michael Pennell; Mira L. Katz; Paul L. Reiter



E-Print Network 3.0 - abstracts search period Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

the period you wish to search. 12;2 PsycINFO user guide September 2002 Enter your search term or terms... PsycINFO user guide citations summaries abstracts journal...


E-Print Network 3.0 - abstract index journal Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

www.ncbi.nlm.nih.goventrezquery.fcgi To search PubMed--fill in search box enter search terms, or enter author name, or journal titles... on Abstract or click on Display ......

Note: This page contains sample records for the topic "abstract switchgrass panicum" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


E-Print Network 3.0 - abstract 2006-2007 progress Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

WiMAX Forum "WiMAX ForumTM" and "WiMAX Forum CERTIFIEDTM" are Summary: , Scheduling PHY Model: Channel models, MIMO, ..., PHY abstraction 12;Copyright 2004, 2005, 2006, 2007...


Abstract LB-521: Expression profile of nuclear receptor superfamily in a lung cancer pathogenesis model  

Science Journals Connector (OSTI)

...Abstract 2296: Identification of novel nuclear receptor targets in estrogen receptor...subtype. Aims and Methods: To identify nuclear receptor (NR) targets, we did microarray...using previously published breast cancer datasets. Results and Conclusion: The 41 NRs...

Yangsik Jeong; Jihye Kim; Mitsuo Sato; Woochang Lee; Woochang Lee; Jonathan M. Kurie; John D. Minna; and David J. Mangelsdorf



Abstract: Design and Demonstration of an Advanced Agricultural Feedstock Supply System for Lignocellulosic Bioenergy Production  

Broader source: Energy.gov [DOE]

This abstract from FDC Enterprises discusses the impact and objectives for project that designs equipment improvements to streamline the harvest, staging, and hauling costs associated with supplying materials to biorefineries.


ABSTRACT: Bioenergy Harvesting Technologies to Supply Crop Residues In a Densified Large Square Bale Format  

Broader source: Energy.gov [DOE]

This abstract from AGCO presents the project objectives for the integration of advanced logistical systems and focused bioenergy harvesting technologies that supply crop residues and energy crops in a large bale format.


Groundwater abstraction impacts on spring flow and base flow in the Hillsborough River Basin, Florida, USA  

Science Journals Connector (OSTI)

Groundwater abstraction has resulted in spring flow and groundwater base-flow declines in the Hillsborough River system of central Florida, USA. These declines have resulted in reduction of inflows to the Tamp...

Kenneth A. Weber; Robert G. Perry



Abstract 1812: Urban-rural distribution of cancer profiles in Gharbiah, Egypt  

Science Journals Connector (OSTI)

...Abstract 1820: Patterns of hematopoietic cancers in Egypt from a population-based registry Catherine...Ann Arbor, MI 2Tanta Cancer Center, Tanta, Egypt 3Gharbiah Cancer Society, Tanta, Egypt. Objectives: Rates of lymphoma are rising by...

Subhojit Dey; Amr S. Soliman; Zhenzhen Zhang; Ahmad Hablas; Ibrahim A. Seifeldin; Mohamed Ramadan; Hesham El-Hamzawy; Joe Harford; Sofia D. Merajver



Abstract A30: A cancer education program for community health workers in NYC  

Science Journals Connector (OSTI)

...Community-based Interventions: Poster Presentations - Proffered...FL Abstract A30: A cancer education program for community health...institutions. Outreach and education efforts focused on breast...research participation. Cancer education materials from NCI, the American...

Martha M. Sanchez; Victor R. Grann; Carol Magai; Maxine Ashby-Thomspon; Ana Chacon; Patricia Hepburn; Brenda Adjai; and Alfred Neugut



Abstract B25: Prostate cancer factual knowledge and misconceptions among African American, Jamaican, and Bahamian men  

Science Journals Connector (OSTI)

...Meeting-Abstract Behavioral and Social Science Health Education - Poster Presentations AACR International Conference: The Science of Cancer Health Disparities...promote cancer awareness and education through the development of...

Shanita D. Williams; Louie Ross; Lisa Hinton; V. Diane Woods; and Robin Roberts



Abstract B27: Developing promotora curriculum modules for cervical cancer prevention and control  

Science Journals Connector (OSTI)

...Meeting-Abstract Behavioral and Social Science Health Education - Poster Presentations AACR International Conference: The Science of Cancer Health Disparities...train their peers in health education strategies is a well established...

John S. Luque; Mondi Mason; Claudia Reyes Garcia; Andrea Hinojosa; and Cathy D. Meade



Abstract --Cybersecurity research demands extensive experimentation to be validated. This experimentation is  

E-Print Network [OSTI]

1 Abstract -- Cybersecurity research demands extensive experimentation to be validated to modern society, concerns about cybersecurity become increasingly important. The challenge of securing. In response to these factors, the cybersecurity research community demands increasingly realistic

Faber, Ted


E-Print Network 3.0 - ads abstract service Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

search results for: ads abstract service Page: << < 1 2 3 4 5 > >> 1 Software & Systems Engineering (TUM) Service White Paper 03.07.2006 1 Summary: system behavior view....


Abstract 3834: The National Biomarkers Development Alliance (NBDA): A comprehensive solution  

Science Journals Connector (OSTI)

...for prostate cancer management. Guiming Li Paul...Kumar UT Health Science Ctr. at San Antonio...will be a promising approach for prostate cancer management. Accordingly we...for prostate cancer management. [abstract...

Carolyn C. Compton and The NBDA Team



Abstract C23: Improved methods for collection of germline DNA in community settings  

Science Journals Connector (OSTI)

...Abstracts: Sixth AACR Conference: The Science of Cancer Health Disparities; December...2Ponce School of Medicine and Health Sciences, Ponce, PR. Introduction: The Ponce School of Medicine and Health Sciences (PSMHS), in Ponce, Puerto Rico...

Edward Seijo; Sonnian Oliver; Sylvia Gutierrez; Domenico Coppola; Teresita Munoz-Antonia; Idhaliz Flores



Abstract SS03-01: Promise and pitfalls of personalized medicine from a clinical science perspective  

Science Journals Connector (OSTI)

...Abstracts: Sixth AACR Conference: The Science of Cancer Health Disparities; December...personalized medicine from a clinical science perspective Nefertiti C. duPont . Personalized...medicine is not new, advances in biomedical science have evolved to target molecular pathways...

Nefertiti C. duPont



Abstract--With recent technological advances in smart sensor platforms, structural condition monitoring  

E-Print Network [OSTI]

Abstract--With recent technological advances in smart sensor platforms, structural condition and robust structural health monitoring (SHM) systems. With recent technological advances in wireless be relaxed with this approach, without sacrificing accuracy in the results. I. INTRODUCTION Recent

Lu, Chenyang


Late Palaeozoic Basins of the Southern U.S. Continental Interior [Abstract] [and Discussion  

Science Journals Connector (OSTI)

5 May 1982 research-article Late Palaeozoic Basins of the Southern U.S. Continental Interior [Abstract] [and Discussion] J. F. Dewey W...georef;1985006010 basins economic geology energy sources folds intracratonic basins Paleozoic...



Abstract --Securing a Grid environment presents a distinctive set of challenges. This paper groups the activities  

E-Print Network [OSTI]

1 Abstract -- Securing a Grid environment presents a distinctive set of challenges. This paper the security requirements of Grids more completely. Index Terms -- Grid security, authentication, authorization, trust management, secure communication, security policy I. INTRODUCTION The goal of Grid Computing


ONE-PAGE BRIEF: Competitive Grant Report EP2007-30 Abstract: The project  

E-Print Network [OSTI]

ONE-PAGE BRIEF: Competitive Grant Report EP2007-30 Abstract: The project explored the effects Heritage Foundation More details: www.leopold.iastate.edu/ research/grants/2011-1/ EP2007-30.pdf #12;

Debinski, Diane M.


Abstract C83: Health status and chronic conditions of biracial Asians in California 2001-2009  

Science Journals Connector (OSTI)

...AACR Conference: The Science of Cancer Health Disparities; December 6-9, 2013; Atlanta, GA Abstract C83: Health status and chronic conditions of biracial...cultural milieu and engender shifts in health, economic, social, and political landscapes...

Anh B. Nguyen; Nancy Breen; Trenette T. Clark; Richard Moser



E-Print Network 3.0 - abstract og upload Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

(LOM) nr. 4 -2010 ISSN: 1903-248X http:forskningsnettet.dklom 1 Summary: datalogi, ph.d.-studerende Aalborg Universitet Abstract I forret 2008 blev der etableret et...

Note: This page contains sample records for the topic "abstract switchgrass panicum" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Abstract 4070: Development of circulating tumor cell capture from whole blood using beads and microfluidics  

Science Journals Connector (OSTI)

...metastatic colorectal cancers by digital microfluidics: therapeutic implications. Deniz...analyzed by multiplex droplet-based microfluidics. This method, by segregating individual...metastatic colorectal cancers by digital microfluidics: therapeutic implications. [abstract...

Jason G. Kralj; Chanda Arya; Thomas P. Forbes; Matthew S. Munson; Samuel P. Forry



Abstract 4070: Development of circulating tumor cell capture from whole blood using beads and microfluidics  

Science Journals Connector (OSTI)

...metastatic colorectal cancers by digital microfluidics: therapeutic implications. Deniz...analyzed by multiplex droplet-based microfluidics. This method, by segregating individual...metastatic colorectal cancers by digital microfluidics: therapeutic implications. [abstract...

Jason G. Kralj; Chanda Arya; Thomas P. Forbes; Matthew S. Munson; Samuel P. Forry



Meteoritics & Planetary Science 38, Nr 6, 871885 (2003) Abstract available online at http://meteoritics.org  

E-Print Network [OSTI]

Meteoritics & Planetary Science 38, Nr 6, 871­885 (2003) Abstract available online at http://meteoritics.org 871 © Meteoritical Society, 2003. Printed in USA. Searching for the source regions of martian

Hamilton, Victoria E.


Abstract B41: Depleted uranium-induced oxidative stress in human bronchial epithelial cells  

Science Journals Connector (OSTI)

...Science of Cancer Health Disparities- Feb...AZ Abstract B41: Depleted uranium-induced oxidative...Science of Cancer Health Disparities- Feb...high deposits of uranium or tailings. There...occupational exposures to depleted uranium via military...

Monica Yellowhair; Leigh A. Henricksen; Aneesha Hossain; Kathleen Dixon; and R. Clark Lantz



Abstract B41: Depleted uranium-induced oxidative stress in human bronchial epithelial cells  

Science Journals Connector (OSTI)

...Association for Cancer Research 1 February...The Science of Cancer Health Disparities...Abstract B41: Depleted uranium-induced oxidative...Carefree, AZ Cancer and mortality...deposits of uranium or tailings...exposures to depleted uranium via...

Monica Yellowhair; Leigh A. Henricksen; Aneesha Hossain; Kathleen Dixon; and R. Clark Lantz



Abstract #1799: The anti-leukemic efficacy of bisphosphonate compounds: Prevention of radiation-induced leukemia  

Science Journals Connector (OSTI)

...TX Abstract B137: Cancer in population exposed...Mosavi-Jarrahi The Cancer Institute Research Center...and sizeable amount of depleted uranium was introduced into the...exposure in the incidence cancer. Methods: A cancer...

Alexandra Miller; Rafael Rivas; Michael Stewart; Robert Merlot; and Paul Lison



Abstract 3590: Depleted uranium-induced leukemia: Epigenetic and genetic changes.  

Science Journals Connector (OSTI)

...Association for Cancer Research April...Abstract 3590: Depleted uranium-induced leukemia...development. Depleted uranium is used in military...Max Costa. Depleted uranium-induced leukemia...Association for Cancer Research; 2013...

Alexandra C. Miller; Hailey Clancy; Thomas Kluz; Stuart Cohen; Rafael Rivas; Karvelisse Miller; and Max Costa



Abstract 3590: Depleted uranium-induced leukemia: Epigenetic and genetic changes.  

Science Journals Connector (OSTI)

...Washington, DC Abstract 3590: Depleted uranium-induced leukemia: Epigenetic...with leukemia development. Depleted uranium is used in military missions...Karvelisse Miller, Max Costa. Depleted uranium-induced leukemia: Epigenetic...

Alexandra C. Miller; Hailey Clancy; Thomas Kluz; Stuart Cohen; Rafael Rivas; Karvelisse Miller; and Max Costa



Abstract B41: Depleted uranium-induced oxidative stress in human bronchial epithelial cells  

Science Journals Connector (OSTI)

...Carefree, AZ Abstract B41: Depleted uranium-induced oxidative stress in...as occupational exposures to depleted uranium via military action. Cellular...to evaluate the toxicity of depleted uranium (DU) in its soluble and insoluble...

Monica Yellowhair; Leigh A. Henricksen; Aneesha Hossain; Kathleen Dixon; and R. Clark Lantz



Abstract 3563: Novel anticancer agents modulate multiple signal transduction pathways for cancer therapy  

Science Journals Connector (OSTI)

...Product-Based Agents Abstracts: AACR International Conference on Frontiers in Cancer Prevention...Malaysia, Kota Bharu, Malaysia; 2 International Islamic University, Kuantan, Malaysia...countries such as Malaysia, Thailand, Sri Lanka and India. It is used traditionally...

Ling Jong; Wan-ru Chao; Yihui Shi; Carol Green; Lidia Sambucetti; and Nathan Collins



Abstract, Institute of Lake Superior Geology, 2011 Mtg. Neoarchean magmatism in the NW Superior Craton  

E-Print Network [OSTI]

Abstract, Institute of Lake Superior Geology, 2011 Mtg. Neoarchean magmatism in the NW Superior in an attempt to understand the magmatic history and processes involved in batholith formation. Mapping


Regulatory and technical reports (abstract index journal): Annual compilation for 1996, Volume 21, No. 4  

SciTech Connect (OSTI)

This compilation is the annual cumulation of bibliographic data and abstracts for the formal regulatory and technical reports issued by the U.S. Nuclear Regulatory Commission (NRC) Staff and its contractors.

Sheehan, M.A.



ChemPages Laboratory: Abstract of Special Issue 24 on CD-ROM  

Science Journals Connector (OSTI)

ChemPages Laboratory: Abstract of Special Issue 24 on CD-ROM ... The ChemPages Laboratory CD-ROM uses text, images and video to clearly explain over 30 common laboratory techniques and items of equipment. ...

Joe L. March; John W. Moore; Jerrold J. Jacobsen



Free and bound generics: two techniques for abstract data types in modular C  

Science Journals Connector (OSTI)

A description of two fundamentally distinct techniques for the implementation of abstract data types within Modular C, a preprocessor extension of C. Issues of reusability, environmental design, and efficiency are discussed as criteria for the selection ...

Stowe Boyd



Heat-pipe technology: a bibliography with abstracts. Quarterly update, July-September, 1981  

SciTech Connect (OSTI)

This bibliography presents 41 pages of citations and abstracts of publications on heat pipe uses, operation, materials design, fabrication and testing. Author and permuted title indexes are provided. (LCL)

Not Available



E-Print Network 3.0 - agenda abstracts index Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Science and Engineering Pohang, Republic of Korea lcj80,hugman,gblee@postech.ac.kr Abstract... This work presents an agenda-based approach to improve the robustness of the...


Hanford to Host ISMS Safety Workshop in Kennewick: Abstracts Due in June  

Broader source: Energy.gov (indexed) [DOE]

Hanford to Host ISMS Safety Workshop in Kennewick: Abstracts Due in Hanford to Host ISMS Safety Workshop in Kennewick: Abstracts Due in June for September Event Hanford to Host ISMS Safety Workshop in Kennewick: Abstracts Due in June for September Event May 18, 2011 - 12:00pm Addthis Media Contact Cameron Hardy, DOE (509) 376-5365 Cameron.Hardy@rl.doe.gov RICHLAND, WASH. - The U.S. Department of Energy (DOE) at Hanford will hold its annual DOE Integrated Safety Management (ISM) Champions Workshop on September 12-15, 2011, at the Three Rivers Convention Center in Kennewick, Wash. DOE's Richland Operations Office and Office of River Protection are hosting this year's event. The purpose of the workshop is to promote a robust safety culture and educate attendees on safety developments and environmental compliance methods for effective implementation of the


Abstract Tracking System | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

Archives » Abstract Tracking System Archives » Abstract Tracking System Basic Energy Sciences (BES) BES Home About Research Facilities Science Highlights Benefits of BES Funding Opportunities Basic Energy Sciences Advisory Committee (BESAC) News & Resources Program Summaries Brochures Reports Accomplishments Presentations BES and Congress Science for Energy Flow Seeing Matter Scale of Things Chart Contact Information Basic Energy Sciences U.S. Department of Energy SC-22/Germantown Building 1000 Independence Ave., SW Washington, DC 20585 P: (301) 903-3081 F: (301) 903-6594 E: sc.bes@science.doe.gov More Information » Archives Abstract Tracking System Print Text Size: A A A RSS Feeds FeedbackShare Page The Division of Materials Sciences and Engineering (DMSE) within the Office of Basic Energy Sciences has entered the summaries of its FY 2005 - FY 2007


Microsoft Word - Poster Abstract_2010_CMU_High Surface Area Materials.docx  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

1th Annual SECA Workshop Poster Abstract 1th Annual SECA Workshop Poster Abstract Topic: High Surface Area, Mesoporous (La, Sr)MnO 3 For Solid Oxide Fuel Cell Cathodes Robin Chao, Graduate Student in Carnegie Mellon University 5700 Bunkerhill St. Apt 705, Pittsburgh, PA 15206 USA, hchao@andrew.cmu.edu, 412-260-5687 Dr. John Kitchin, Professor of Chemical Engineering in Carnegie Mellon University 5000 Forbes Ave, Pittsburgh PA, 15213, jkitchin@andrew.cmu.edu, 412-268-7803 Dr. Paul Salvador, Professor of Material Science and Engineering in Carnegie Mellon University 149 Roberts Eng Hall, Pittsburgh, PA 15213, paul7@andrew.cmu.edu, 412-268-2702 Abstract: The efficiency of the solid oxide fuel cell is limited by the cathode polarizations. One essential approach is to include high-surface-area cathode materials into the fabrication. However, conventional synthesis methods to


Regulatory and technical reports (abstract index journal): Annual compilation for 1994. Volume 19, Number 4  

SciTech Connect (OSTI)

This compilation consists of bibliographic data and abstracts for the formal regulatory and technical reports issued by the US Nuclear Regulatory Commission (NRC) Staff and its contractors. It is NRC`s intention to publish this compilation quarterly and to cumulate it annually. The main citations and abstracts in this compilation are listed in NUREG number order. These precede the following indexes: secondary report number index, personal author index, subject index, NRC originating organization index (staff reports), NRC originating organization index (international agreements), NRC contract sponsor index (contractor reports), contractor index, international organization index, and licensed facility index. A detailed explanation of the entries precedes each index.



Note: This page contains sample records for the topic "abstract switchgrass panicum" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Defining and Model Checking Abstractions of Complex Railway Models using CSP||B  

E-Print Network [OSTI]

Defining and Model Checking Abstractions of Complex Railway Models using CSP||B Faron Moller1. In [11, 10] we propose a new modelling approach for railway interlockings. We use CSP||B [13], which involves events such as train movements and, in the interlocking, state based reasoning. In this sense, CSP

Doran, Simon J.


Compiling Statemate Statecharts into CSP and verifying them using FDR --abstract  

E-Print Network [OSTI]

Compiling Statemate Statecharts into CSP and verifying them using FDR -- abstract Bill Roscoe developed for tackling the state exploration problem in the CSP/FDR framework would work in the setting from Statecharts into CSP. I developed the translation as a program written in CSP (making heavy use

Roscoe, Bill


Electronic copy available at: http://ssrn.com/abstract=995647 Battle of the Retail Channels  

E-Print Network [OSTI]

Electronic copy available at: http://ssrn.com/abstract=995647 0 Battle of the Retail Channels: How-and-mortar retailers. Although traditional retailers vastly outsell Internet retailers in most product categories, research on Internet retailing has largely neglected this fundamental dimension of competition. Is cross


ICNAAM-2004 Extended Abstracts 1 4 A numerical study of soliton solutions of the Boussinesq equa-  

E-Print Network [OSTI]

ICNAAM-2004 Extended Abstracts 1 ­ 4 A numerical study of soliton solutions of the Boussinesq equa and finite differences to another famous non-linear PDE describing water waves: the Boussinesq equation the famous Boussinesq equation (in one space dimension) written as [1] 2 u t2 - 2 u x2 + 3 2 u2 x2 + 4 u x4

Skokos, Charalampos "Haris"


Distributed, intelligent, interactive visualization and exploration of time-oriented clinical data and their abstractions  

Science Journals Connector (OSTI)

Objectives: We present KNAVE-II, an intelligent interface to a distributed architecture specific to the tasks of query, knowledge-based interpretation, summarization, visualization, interactive exploration of large numbers of distributed time-oriented ... Keywords: Clinical systems, Human-computer interaction, Intelligent visualization, Knowledge-based systems, Medical informatics, Temporal abstraction, Temporal reasoning

Yuval Shahar; Dina Goren-Bar; David Boaz; Gil Tahan



Abstract 3584: Ethanol and aging promote pathogenesis of hepatocellular carcinoma in mice.  

Science Journals Connector (OSTI)

...2013; Washington, DC Abstract 3584: Ethanol and aging promote pathogenesis of hepatocellular...additional hepatic injury. Methods: Ethanol was administered to ICR male mice through...Results: At 60th week, 40% of mice in the ethanol group had visible white nodules (5-10...

Joseph George; Mutsumi Tsuchishima; Nobuyuki Toshikuni; Takashi Saito; Mikihiro Tsutsumi



Demo Abstract: Toward Data-driven Demand-Response Optimization in a Campus Microgrid  

E-Print Network [OSTI]

Demo Abstract: Toward Data-driven Demand-Response Optimization in a Campus Microgrid Yogesh Simmhan-driven demand response optimization (DR) in the USC campus microgrid, as part of the Los An- geles Smart Grid of this project is to investigate techniques for demand-response optimization (DR) ­ cur- tailing the electricity

Prasanna, Viktor K.


Chatbots of the gods: imaginary abstracts for techno-spirituality research  

Science Journals Connector (OSTI)

This paper reflects on the intersection of human-computer interaction (HCI) with techno-spirituality and science fiction (SF). The paper considers science fiction treatments of spirituality, religion and "the numinous" --- a mysterious presence that ... Keywords: design fiction, imaginary abstracts, research through design, science fiction, techno-spirituality, user experience

Mark Blythe; Elizabeth Buie



Abstract PR1: Hepatocellular carcinoma research and prevention in South Texas: The imperative  

Science Journals Connector (OSTI)

...Texas (P30-CA54174), the Susan G. Komen Breast Cancer Foundation (POP 2000 704), and the National Cancer Institute, Redes En Accion (U01-CA86117). Citation Information: Cancer Res 2011;71(24 Suppl):Abstract nr P2-14-04.

Amelie G. Ramirez; Nancy S. Weiss; Alan E. Holden; Lucina Suarez; Sharon P. Cooper; Edgar Munoz; Susan L. Naylor



Abstract B67: Role of social support in Pap test decision making among Pacific Islander women  

Science Journals Connector (OSTI)

...Abstract B67: Role of social support in Pap test decision making among Pacific Islander...anticipated consequences of getting a Pap test. Items also assessed female participants...participants (49.9%) had received a Pap test within the past three years. A logistic...

Sora Park Tanjasiri; Jie Wu Weiss; Michele Mouttapa; Lola Sablan Santos; Jasmine Lacsamana DeGuzman; Vanessa Tuione May; Lourdes Quitugua; Dorothy Vaivao



ABSTRACT. The corrosion behavior of iron-aluminum alloys and their potential  

E-Print Network [OSTI]

ABSTRACT. The corrosion behavior of iron-aluminum alloys and their potential as protective corrosion claddings in sul- fidizing environments were investigated. As-solidified castings of Fe-Al alloys characterization of the corrosion scales consisted of sur- face and cross-sectional microscopy in combination

DuPont, John N.


Abstract--The variability and non-dispatchable nature of wind and solar energy production presents  

E-Print Network [OSTI]

1 Abstract--The variability and non-dispatchable nature of wind and solar energy production needed for a variety of energy storage applications can be found in [6]. Wind and solar power variations, energy storage can be a viable solution to balance energy production against its consumption. This paper


Tourism and mobile technology Abstract. While tourism presents considerable potential for the use of new mobile  

E-Print Network [OSTI]

Tourism and mobile technology Abstract. While tourism presents considerable potential for the use, examining the problems they encounter as they move between and visit new places. Tourism has been a popular, as mobile phones and #12;2 other portable devices becoming more advanced, tourism is one obvious application

Chalmers, Matthew


Abstract--Power Line Communications (PLC) is used for information exchange over the lines  

E-Print Network [OSTI]

Abstract-- Power Line Communications (PLC) is used for information exchange over the lines installed for delivering the electrical power. Inhome PLC is a technology which delivers telecom services to every corner of a household through already existing electrical wiring. In recent years, PLC has emerged

Boyer, Edmond


Original Paper Abstract: Phosphoinositide-specific phospholipase C (PI-PLC)  

E-Print Network [OSTI]

Original Paper Abstract: Phosphoinositide-specific phospholipase C (PI-PLC) hydrolyzes the membrane. DNA synthesis, a measure of cell growth, was significantly suppressed by the PI-PLC-specific inhibitor,5-pyrrolidinedione did not cause any suppression. Acti- vation of PI-PLC by MS salts increased DNA synthesis and abol

Bhattacharyya, Madan Kumar


AbstractThe red porgy, Pagrus pag rus, is an important reef fish in several  

E-Print Network [OSTI]

81 Abstract­The red porgy, Pagrus pag rus, is an important reef fish in several offshore fisheries a fishery-independent source. Red porgy attain a maximum age of at least 18 years and 733 mm total length revealed a difference in mean length at age of red porgy from the three sources. Red porgy in fishery


AbstractThe red snapper (Lutjanus campechanus) is currently under rig  

E-Print Network [OSTI]

653 Abstract­The red snapper (Lutjanus campechanus) is currently under rig orous federal and state of annuli in otolith thin sections have been used to age many species of fish, including red snapper. However, the utility of this method for aging red snapper has been questioned by those who dispute both


Abstract Cultivated tomato (Lycopersicon esculentum) encompass a wide range of fruit shape and size variants.  

E-Print Network [OSTI]

Abstract Cultivated tomato (Lycopersicon esculentum) encompass a wide range of fruit shape and size variants. This variation can be used to genetically dissect the mo- lecular basis of ovary and fruit morphology. The cultivar Long John displays an extremely elongated fruit pheno- type, while the wild relative

van der Knaap, Esther


Abstract Cultivated tomatoes (Lycopersicon esculen-tum) encompass a wide range of fruit size and shape  

E-Print Network [OSTI]

Abstract Cultivated tomatoes (Lycopersicon esculen- tum) encompass a wide range of fruit size of ovary and fruit development. One fruit shape variant is displayed by the cultivar Sun 1642 (TA491). TA491 has an elongated fruit phenotype, while the wild relative L. pimpinellifolium LA1589 produces

van der Knaap, Esther


Fee-For-Service Contracts in the Pharmaceutical Industry (Extended Abstract)  

E-Print Network [OSTI]

Fee-For-Service Contracts in the Pharmaceutical Industry (Extended Abstract) Kathleen Martino and Yao Zhao Starting from 2005, the pharmaceutical industry has experienced a drastic change in the pricing contracts between manufacturers and distributors as the industry moved from the dominating Buy

Lin, Xiaodong

Note: This page contains sample records for the topic "abstract switchgrass panicum" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Unifying Undergraduate Artificial Intelligence Robotics: Layers Of Abstraction Over Two Channels  

E-Print Network [OSTI]

Unifying Undergraduate Artificial Intelligence Robotics: Layers Of Abstraction Over Two Channels, Robotics often appears as a collection of disjoint, some- times antagonistic sub-fields. The lack robotics, and shows how these traditional sub-fields fit in to the whole. Finally, it presents a curriculum

Crabbe, Frederick


Unifying Undergraduate Artificial Intelligence Robotics: Layers Of Abstraction Over Two Channels  

E-Print Network [OSTI]

Unifying Undergraduate Artificial Intelligence Robotics: Layers Of Abstraction Over Two Channels, Robotics often appears as a collection of often disjoint, sometimes antagonistic sub-fields. The lack robotics, and shows how these traditional sub-fields fit in to the whole. Finally, it presents a curriculum

Crabbe, Frederick


ONE-PAGE BRIEF: Competitive Grant Report P2008-03 Abstract: The project  

E-Print Network [OSTI]

ONE-PAGE BRIEF: Competitive Grant Report P2008-03 Abstract: The project examined six public policy resources conservation: increased soil erosion; maintaining long- term soil productivity; water quality associated with soil and water conserva- tion practices. The aim was to identify and refine biofuels policy

Debinski, Diane M.


The Subject-Oriented Approach to Software and the Abstract State Machines Method  

E-Print Network [OSTI]

Process Modeling (S-BPM) has a precise semantical foundation in terms of Abstract State Machines (ASMs). The construction of an ASM model for the basic S- BPM concepts revealed a strong relation between S-BPM and the ASM the analysis to evaluate S-BPM as an approach to business process modeling and to suggest some challenging

Börger, Egon



E-Print Network [OSTI]

H to an abstract buckling problem operator. In the concrete case where S = -|C 0 () in L2(; dnx-type domains = Rn\\K, n 3, with K Rn compact and vanishing Bessel capacity B2,2(K) = 0, to prove equality of Friedrichs and Krein Laplacians in L2(; dnx), that is, -|C 0 () has a unique nonnegative self

Teschl, Gerald


Abstract 734: Water diffusion decreased in low collagen containing hypoxic regions of breast cancer xenograft.  

Science Journals Connector (OSTI)

...3-6, 2009; Carefree, AZ Abstract A57: Water consumption and urinary arsenic concentrations...and estimated arsenic consumption from water among United States (U.S.) Hispanic...Exposure Survey (BAsES). The impact of water consumption reporting on estimated arsenic...

Samata M. Kakkad; Jiangyang Zhang; Alireza Akhbardeh; Meiyappan Solaiyappan; Venu Raman; Dieter Leibfritz; Kristine Glunde; Zaver M. Bhujwalla



Regulatory and technical reports (abstract index journal): Annual compilation for 1997. Volume 22, Number 4  

SciTech Connect (OSTI)

This journal includes all formal reports in the NUREG series prepared by the NRC staff and contractors; proceedings of conferences and workshops; as well as international agreement reports. The entries in this compilation are indexed for access by title and abstract, secondary report number, personal author, subject, NRC organization for staff and international agreements, contractor, international organization, and licensed facility.




SOLAR BATTERY CHARGERS FOR NIMH BATTERIES1 Abstract -This paper proposes new solar battery  

E-Print Network [OSTI]

SOLAR BATTERY CHARGERS FOR NIMH BATTERIES1 Abstract - This paper proposes new solar battery chargers for NiMH batteries. Used with portable solar panels, existing charge control methods are shown of consumer portable solar arrays. These new arrays are lightweight, durable, and flexible and have been

Lehman, Brad


Abstract--Thoracocardiography approach pretends to non-invasively monitor stroke volume by inductive  

E-Print Network [OSTI]

Abstract--Thoracocardiography approach pretends to non- invasively monitor stroke volume. The purpose of this study was to investigate the potential of thoracocardiography to estimate stroke volumes while apnea with open glottis. We hypothesized that, when glottis is open, stroke volumes would

Paris-Sud XI, Université de


Abstract B27: Influence of fluorescence visualization on screening decisions in the general dental office  

Science Journals Connector (OSTI)

...meeting-abstract Behavioral and Social Science Screening and Early Detection...decisions in the general dental office Denise M. Laronde 1 P Michele...screening within the dental office could lead to earlier diagnosis...tools within the general dental office amongst clinicians who are...

Denise M. Laronde; P Michele Williams; Samson Ng; Catherine F. Poh; T Greg Hislop; Lewei Zhang; and Miriam P. Rosin



Abstract PL05-01: Cervical cancer as an example of gender-associated health inequality.  

Science Journals Connector (OSTI)

...meeting-abstract Behavioral and Social Science Gender Disparity Gender Disparity...Fifth AACR Conference on the Science of Cancer Health Disparities...Research Working Paper 4504.Office of the Regional Chief Economist...Fifth AACR Conference on the Science of Cancer Health Disparities...

Rolando Herrero



Demo Abstract: Wireless Sensor Network for Substation Monitoring: Design and Deployment  

E-Print Network [OSTI]

Demo Abstract: Wireless Sensor Network for Substation Monitoring: Design and Deployment Asis-Transmissions & Substations 9625 Research Drive Charlotte, NC 28262 {lvanderz,birodriguez} @epri.com Ralph McKosky, Joseph in a substation for monitoring the health of power subsystems such as circuit breakers, trans- formers

Nasipuri, Asis


Abstract No. jone0514 Elemental Distributions for NY/NJ Harbor Sediments  

E-Print Network [OSTI]

Abstract No. jone0514 Elemental Distributions for NY/NJ Harbor Sediments K. Jones (BNL), H. Feng (Montclair State U.) and A. Lanzirotti (U. of Chicago) Beamline(s): X26A Sediments in the New York/New Jersey Waterways Sediments, is a useful material for use in investigation of the spatial variability. This standard

Brookhaven National Laboratory


Abstract No. jone0499 FTIR Measurement of Organic Functional Groups in NY/NJ Harbor Sediments  

E-Print Network [OSTI]

Abstract No. jone0499 FTIR Measurement of Organic Functional Groups in NY/NJ Harbor Sediments H. Jones (BNL) Beamline(s): U2B Sediments in urban rivers and estuaries are usually contaminated contaminated sediments cause to the environment and human health is now widely recognized and has stimulated

Brookhaven National Laboratory


BOOK OF ABSTRACTS The 12 th International Symposium on Society and Resource Management  

E-Print Network [OSTI]

www.issrm2006.rem.sfu.ca Text was entered into the abstract database directly by the authors, who are therefore responsible for the content and accuracy. Opinions expressed may not necessarily reflect the position of the ISSRM 2006 Organizing Committee, Simon Fraser University or University of British Columbia. The 12 th International Symposium on Society and Resource Management

Book Of Abstracts; Wolfgang Haider (chair



Abstract B29: Case-control study of metabolic syndrome and breast cancer in Puerto Rico  

Science Journals Connector (OSTI)

...Abstracts: Sixth AACR Conference: The Science of Cancer Health Disparities; December...grant G12RR03051 from the UPR Medical Sciences Campus. Citation Format: Ana Patricia...Proceedings of the Sixth AACR Conference: The Science of Cancer Health Disparities; Dec 6-9...

Ana Patricia Ortiz; Cynthia Perez; Edna Mora; Damarys Santiago; Carola T. Snchez; Cristina Muoz; Marievelisse Soto; Mong-Hong Lee



A Do-It-All-Cipher for RFID: Design Requirements (Extended Abstract)  

E-Print Network [OSTI]

A Do-It-All-Cipher for RFID: Design Requirements (Extended Abstract) Markku-Juhani O. Saarinen that are present in real-life RFID systems. We give an overview of requirements emerging or already present in the widely deployed EPCGlobal Gen2 and ISO / IEC 18000-63 passive UHF RFID air interface standards


Abstract--Implementation of Distribution Automation (DA) and Demand Side Management (DSM) intended to serve both  

E-Print Network [OSTI]

Abstract--Implementation of Distribution Automation (DA) and Demand Side Management (DSM) intended, requires a wide-area two-way communication system. DA and DSM devices (customer meters, switches, etc for both DA/DSM applications can be met. And a scheduling policy is proposed to provide the applications

Paris-Sud XI, Université de


Abstract 1073: Cell surface F1-ATPase, a new potential target in colorectal cancer  

Science Journals Connector (OSTI)

...Chicago, IL Abstract 1073: Cell surface F1-ATPase, a new potential target in colorectal...from human colorectal cancer cells, the F1-ATPase as a binding protein for G-gly...proliferation and angiogenesis. Using purified F1-ATPase we confirmed by SPR a direct interaction...

Aline Kowalski-Chauvel; Souad Najib; Claudine Bertrand; Laurent Martinez; Elizabeth Cohen-Jonathan-Moyal; Audrey Ferrand; Catherine SEVA



VT-2014-00407.R1 1 Abstract--Simulation-based design optimization of an electric  

E-Print Network [OSTI]

of a motor design, thus confining its application to the early conceptual design stage. Practical electric analysis accuracy and efficiency, direct integration of a motor model into a system optimization model hasVT-2014-00407.R1 1 Abstract--Simulation-based design optimization of an electric vehicle (EV

Papalambros, Panos