Powered by Deep Web Technologies
Note: This page contains sample records for the topic "8-89 efg 07-90" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

AOCS Official Method Ce 8-89  

Science Conference Proceedings (OSTI)

Determination of Tocopherols and Tocotrienols in Vegetable Oils and Fats by HPLC AOCS Official Method Ce 8-89 Methods Methods and Analyses Analytical Chemistry Methods Downloads Methods Downloads DEFINITION Thi

2

Echo 8-9 Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Echo 8-9 Wind Farm Echo 8-9 Wind Farm Jump to: navigation, search Name Echo 8-9 Wind Farm Facility Echo 8-9 Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner John Deere Wind Developer John Deere Wind Energy Purchaser PacifiCorp Location Morrow and Umatilla Counties OR Coordinates 45.521953°, -119.248549° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.521953,"lon":-119.248549,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

3

EFG IO?-90)  

Office of Legacy Management (LM)

.?GE = 1325 d .?GE = 1325 d +3-891 EFG IO?-90) ' United States Government *memorandum DATE: FEB 6 1991 . . I ;' 1 , q' *_* Departrnkt of Energy --. -* r- i .,. 1 .' ;I "--' I ,_ % I : [ -- ,: -.. ! j i 1: \ REPLY TO ATTN OF: EM-421 SUBJECT: Authority Determination-- Former Beryllium Production Facility in Luckey, ' Ohio TO: The File The attached review documents the basis for determining whether DOE has authority for taking remedial action at the former beryllium production facility in Luckey, Ohio, under the Formerly Utilized Sites Remedial Action Program (FUSRAP). The following factors are significant in reaching determination: o The land was owned by the government at the time that the facility produced beryllium. o The facility was controlled by the AK both directly and indirectly.

4

NERSC Users Group Meeting January 8-9, 1996 Minutes  

NLE Websites -- All DOE Office Websites (Extended Search)

Minutes Minutes Minutes ERSUG Meeting Minutes - January 8,9, 1996 Lawrence Berkeley Laboratory January 8-9, 1996 Kirby Fong (NERSC, LLNL), Dave Stevens (LBL), Ricky A. Kendall (PNNL,ExERSUG Vice-Chair) Opening Remarks From the Berkeley Laboratory This ERSUG meeting, originally planned for Princeton, New Jersey, was rescheduled at the Lawrence Berkeley Laboratory to facilitate a user visit of the recently announced new home of the National Energy Research Supercomputer Center. Due to blizzard conditions closing many airports in the eastern U.S., DOE staff and Berkeley Laboratory director Charles Shank (who was in the east) were unable to attend the ERSUG meeting. In Charles Shank's place, Pier Oddone, the Berkeley Laboratory Deputy Director welcomed attendees and summarized the three main points that Director Shank

5

Aug. 8-9, 2006 HAPL meeting, GA Open Discussion on Advanced Armor  

E-Print Network (OSTI)

Aug. 8-9, 2006 HAPL meeting, GA 1 Open Discussion on Advanced Armor Concepts Moderated by A. René in case the W armor does not work. #12;Aug. 8-9, 2006 HAPL meeting, GA 3 Roman Aquaduct at Pont du Gard, Provence #12;Aug. 8-9, 2006 HAPL meeting, GA 4 Possible Advanced Armor Options Include: · Engineered

Raffray, A. René

6

Data:068c2cb8-9f67-41a8-9a2d-9091b85ad20b | Open Energy Information  

Open Energy Info (EERE)

cb8-9f67-41a8-9a2d-9091b85ad20b cb8-9f67-41a8-9a2d-9091b85ad20b No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Springfield, Oregon (Utility Company) Effective date: 2013/05/01 End date if known: Rate name: Street Lighting 400 W MH Opt. 1 L-1 Sector: Lighting Description: Option 1 refers to a Customer owned and installed fixture. The fixed monthly charge covers energy, operation and fixture maintenance fees. Possible Additional Fees include: Transfer of a street light, mast arm, overhead conductor, and conductor support to a new pole, and make necessary electrical connection: $175 each.

7

Table HC8.9 Home Appliances Characteristics by Urban/Rural ...  

U.S. Energy Information Administration (EIA)

Table HC8.9 Home Appliances Characteristics by Urban/Rural Location, 2005 Home Appliances Characteristics Million U.S. Housing Units Housing Units (millions)

8

2012 National Electricity Forum: February 8-9, 2012 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

12 National Electricity Forum: February 8-9, 2012 12 National Electricity Forum: February 8-9, 2012 2012 National Electricity Forum: February 8-9, 2012 January 4, 2012 - 11:28am Addthis The 2012 National Electricity Forum will be held on February 8 and 9, 2012, and is sponsored by the DOE Office of Electricity Delivery and Energy Reliability and the National Association of Regulatory Utility Commissioners (NARUC). Online registratin is now closed; participants are welcome to register onsite. A Leading Role The DOE is taking a leading role in this week's National Electricity Forum, with key speakers providing input on a variety of topics. Secretary of Energy Steven Chu and Assistant Secretary for Electricity Delivery and Energy Reliability Patricia Hoffman will join NARUC President David Wright for the keynote discussion on Wednesday morning.

9

??? ??????? ? ! #"?%$ & (' ) &"1032? (4 5? "6? )?7 8?9 @ A B$?3 ...  

E-Print Network (OSTI)

&"1032? (4 5? "6?. )?7 8?9 @ A B$?3 C2ED F?7G? C2 H?? ?. ? 2I' ? 5P??I???9" ? Q?R?S C2ITE?? U. VW X`YbadceW fRgihSf&fRgeW p qsrdqtp uvp...

10

OpenEI maintenance March 8-9, 2013 | OpenEI Community  

Open Energy Info (EERE)

OpenEI maintenance March 8-9, 2013 OpenEI maintenance March 8-9, 2013 Home > Groups > Utility Rate Rmckeel's picture Submitted by Rmckeel(297) Contributor 8 March, 2013 - 14:23 developer Maintenance OpenEI We would like to inform the OpenEI community that OpenEI will be undergoing a significant software upgrade during a maintenance window this weekend. We will be upgrading the wiki and semantic mediawiki portions of OpenEI, which means /datasets, /apps, /lod, /sparql and /community will continue to function normally. Additionally, web services that rely on Ask queries (utility rate database API) may have some downtime as we transition. OpenEI will begin maintenance at 5pm MST Friday, March 8th, 2013. This means that the /wiki URLs will go into read-only mode and editing pages will not be possible. Maintenance is expected to end by 5pm MST Saturday,

11

Optimization of the Ballistic Guide Design for the SNS FNPB 8.9 A Neutron Line  

E-Print Network (OSTI)

The optimization of the ballistic guide design for the SNS Fundamental Neutron Physics Beamline 8.9 A line is described. With a careful tuning of the shape of the curve for the tapered section and the width of the straight section, this optimization resulted in more than 75% increase in the neutron flux exiting the 33 m long guide over a straight m=3.5 guide with the same length.

Takeyasu M. Ito; Christopher B. Crawford; Geoffrey L. Greene

2006-04-24T23:59:59.000Z

12

Susceptor for EFG crystal growth apparatus  

DOE Patents (OSTI)

An improved susceptor for a crucible/die assembly for growing tubular crystalline structures by the EFG process is provided. The crucible/die assembly comprises a die having a substantially polygonally-shaped top end surface for supporting a film of silicon feed material that is replenished from a melt in the crucible through capillary action. A hollow crystalline body is grown from the film of silicon material on the top end surface of the die. The heat susceptor is made of graphite or similar material, and has a peripheral configuration similar to that of the die. Further, the upper surface of the heat susceptor has a central land and a plurality of circumferentially-spaced upwardly extending projections. The central land thermally contacts a central portion of the lower surface of the crucible/die, and the projections thermally contact the lower surface of the crucible/die at its corners, whereby a temperature distribution is provided that permits growth of hollow bodies having more nearly constant thickness walls.

Menna, Andrew A. (Belmont, MA)

1996-09-03T23:59:59.000Z

13

Multi-Hundred Watt Radioisotope Thermoelectric Generator Program, LES 8/9 Program, MJS Program. Bi-monthly progress report, 1 September--31 October 1974  

DOE Green Energy (OSTI)

Significant events, activities and achievements on the MHW LES 8/9 and MJS Programs for the reporting period are reported. Topics discussed include programmatic, safety, systems, isotope heat source, converter, product assurance, acceptance testing, and converter fabrication. (TFD)

Not Available

1974-01-01T23:59:59.000Z

14

Multi-Hundred Watt Radioisotope Thermoelectric Generator Program, LES 8/9 Program, MJS Program, Bi-monthly progress report, 1 November--31 December 1975  

DOE Green Energy (OSTI)

Significant events, activities and achievements on the MHW LES 8/9 and MJS Programs for the reporting period are reported. Topics discussed include safety systems, isotope heat source, converter, product assurance, hardware fabrication, acceptance testing, and ground support equipment. (TFD)

Not Available

1975-01-01T23:59:59.000Z

15

Multi-Hundred Watt Radioisotope Thermoelectric Generator Program, LES 8/9 Program, MJS Program. Bi-monthly progress report, 1 May--30 June 1975  

DOE Green Energy (OSTI)

Significant events, activities and achievements on the MHW LES 8/9 and MJS Programs for the reporting period are reported. Topics discussed include programmatic, safety, systems, isotope heat source, converter, product assurance, hardware fabrication, acceptance testing, and ground support equipment. (TFD)

Not Available

1975-01-01T23:59:59.000Z

16

Multi-Hundred Watt Radioisotope Thermoelectric Generator Program, LES 8/9 Program, MJS Program. Bi-monthly progress report, 1 July--31 August 1975  

DOE Green Energy (OSTI)

Significant events, activities and achievements on the MHW LES 8/9 and MJS Programs for the reporting period are reported. Topics discussed include safety systems, isotope heat source, converter, product assurance, hardware fabrication, acceptance testing, and ground support equipment. (TFD)

Not Available

1975-01-01T23:59:59.000Z

17

Large area silicon sheet by EFG. Annual progress report, October 29, 1975--September 30, 1976  

DOE Green Energy (OSTI)

At the end of one year the program is on schedule. EFG ribbon growth system JPL No. 2 is being used to perform meaningful growth rate and ribbon thickness experiments. The new, wide ribbon growth system is in operation. A theoretical study of stresses in ribbons is reported. EFG ribbons have been observed to exhibit a characteristic defect structure which is orientation dependent in the early stages of growth.

Morrison, A.D.; Ravi, K.V.; Hari Rao, C.V.; Surek, T.; Bliss, D.F.; Garone, L.C.; Hogencamp, R.W.

1976-09-15T23:59:59.000Z

18

Data:40706b55-b1fd-4db8-9c79-aecf21be6429 | Open Energy Information  

Open Energy Info (EERE)

b55-b1fd-4db8-9c79-aecf21be6429 b55-b1fd-4db8-9c79-aecf21be6429 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Columbus Southern Power Co Effective date: 2012/03/09 End date if known: Rate name: Experimental Residential Real-Time Pricing Service Sector: Residential Description: Source or reference: https://www.aepohio.com/global/utilities/lib/docs/ratesandtariffs/Ohio/2012-04-05_CSP_OP_StandardTariff.pdf Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V):

19

Data:Aa31bf99-7310-47c8-9b2d-47d252613ad8 | Open Energy Information  

Open Energy Info (EERE)

1bf99-7310-47c8-9b2d-47d252613ad8 1bf99-7310-47c8-9b2d-47d252613ad8 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Bonners Ferry, Idaho (Utility Company) Effective date: 2009/10/01 End date if known: Rate name: Interdepartmental: S1PO Sector: Commercial Description: Note: $10.00 added to Fixed monthly charge if Remote Read Device is used. Source or reference: Rate Binder 1, Illinois State University Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V):

20

Data:7be3cbec-a8f6-48f8-9a40-2116ebba1d80 | Open Energy Information  

Open Energy Info (EERE)

cbec-a8f6-48f8-9a40-2116ebba1d80 cbec-a8f6-48f8-9a40-2116ebba1d80 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Public Serv Comm of Yazoo City Effective date: End date if known: Rate name: Electric Commercial - Seasonal Sector: Commercial Description: Source or reference: ISU Documentation Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >> << Previous 1 2 3 Next >>

Note: This page contains sample records for the topic "8-89 efg 07-90" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Data:9f8227f8-89b7-466c-9180-fc08a4229f7c | Open Energy Information  

Open Energy Info (EERE)

f8-89b7-466c-9180-fc08a4229f7c f8-89b7-466c-9180-fc08a4229f7c No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Little Ocmulgee El Member Corp Effective date: 2009/01/01 End date if known: Rate name: Schedule "GS-7" Sector: Residential Description: Applicable to Non- Residential consumers requiring single-phase service and transformer capacity of 50 kVA or less. Not available solely for irrigation service. Source or reference: ISU Documentation Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months):

22

Data:0d506e47-0127-4332-b2f8-9c0da3486c56 | Open Energy Information  

Open Energy Info (EERE)

-0127-4332-b2f8-9c0da3486c56 -0127-4332-b2f8-9c0da3486c56 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Emerald People's Utility Dist Effective date: 2012/04/01 End date if known: Rate name: AGRICULTURAL PUMPING Single Phase Sector: Commercial Description: APPLICABLE: To customers desiring service for irrigation and soil drainage pumping installations only. Service furnished under this schedule will be metered and billed separately at each point of delivery. Source or reference: http://www.epud.org/Documents/Cust%20Svc%20Docs/Rate%20Schedules%20effective%2020120401%20%28website%20version%29.pdf

23

Data:962cfcca-ebe5-4c90-86d8-9a2248fae8c4 | Open Energy Information  

Open Energy Info (EERE)

cfcca-ebe5-4c90-86d8-9a2248fae8c4 cfcca-ebe5-4c90-86d8-9a2248fae8c4 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Village of Benton, Wisconsin (Utility Company) Effective date: 2007/08/17 End date if known: Rate name: Rg-1 Residential Service Sector: Residential Description: Availability: Available to all single-phase residential customers for ordinary household purposes and aggregate motor loads not to exceed 5 horsepower. Fixed Monthly Charge includes Commitment to Community Rider: $1.33 per customer per month Source or reference: http://psc.wi.gov/apps40/tariffs/viewfile.aspx?type=electric&id=460

24

Data:Fa2931a5-291b-4907-85e8-9feddb3931f9 | Open Energy Information  

Open Energy Info (EERE)

931a5-291b-4907-85e8-9feddb3931f9 931a5-291b-4907-85e8-9feddb3931f9 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of St Marys, Ohio (Utility Company) Effective date: 2001/06/10 End date if known: Rate name: Industrial General Service Tax Exempt Rate 125-Primary Sector: Industrial Description: *Specifically available for use by U.S. Government facilities exempt from the KWH tax within and outside the corporate limits of the City of St. Marys for lighting, heating, cooking and power. Character of service:120/240, 120/208, 208, 240, 480 Volt Alternating Current, 60 Hertz, Single or Three Phase as agreed to.

25

Data:49c2fc57-db45-47e4-86a8-9c14cad414a0 | Open Energy Information  

Open Energy Info (EERE)

fc57-db45-47e4-86a8-9c14cad414a0 fc57-db45-47e4-86a8-9c14cad414a0 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Walton Electric Member Corp Effective date: 2013/06/01 End date if known: Rate name: Directional FLoodlight- MH 400 Watt Bronze Sector: Lighting Description: Source or reference: http://www.waltonemc.com/commercial/ Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>

26

Data:95fe7eb0-19b4-44f8-9d87-705a6e747282 | Open Energy Information  

Open Energy Info (EERE)

-19b4-44f8-9d87-705a6e747282 -19b4-44f8-9d87-705a6e747282 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Sacramento Municipal Utility District Effective date: 2012/01/01 End date if known: Rate name: AG (ASN) Sector: Description: Source or reference: https://www.smud.org/en/business/customer-service/rates-requirements-interconnection/documents/1-AG.pdf Source Parent: Comments FRA= Solar Surcharge Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category:

27

Data:3c42138a-7a21-41f8-9b48-b5ac19eb7a9b | Open Energy Information  

Open Energy Info (EERE)

a-7a21-41f8-9b48-b5ac19eb7a9b a-7a21-41f8-9b48-b5ac19eb7a9b No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Town of Concord, Massachusetts (Utility Company) Effective date: 2013/01/01 End date if known: Rate name: RATE R-1 RESIDENTIAL SERVICE - FARM (THREE PHASE) Sector: Residential Description: Additional Info Applicability: The Massachusetts Department of Food and Agriculture must certify the Customer as being eligible for the Farm Energy Discount Program. Once certified, this rate schedule is applicable to all electric service required by the Customer exclusively for domestic purposes for individual (single family) private residences.

28

Data:34f3ac1f-faca-4ed8-9cd9-7899509bc90c | Open Energy Information  

Open Energy Info (EERE)

f-faca-4ed8-9cd9-7899509bc90c f-faca-4ed8-9cd9-7899509bc90c No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Greendale, Indiana (Utility Company) Effective date: End date if known: Rate name: Municipal street light service - 175 Watt Mercury Vapor Sector: Lighting Description: Source or reference: http://cityofgreendale.net Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>

29

Data:E589f5e8-9e84-416a-88ab-2cec11630366 | Open Energy Information  

Open Energy Info (EERE)

e8-9e84-416a-88ab-2cec11630366 e8-9e84-416a-88ab-2cec11630366 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Tri-County Elec Member Corp Effective date: 2008/10/01 End date if known: Rate name: Outdoor Lighting Customer Owned Light/Sign Fixture 100 W Sector: Lighting Description: Source or reference: http://www.tri-countyemc.com/skins/userfiles/file/Outdoor_lighting.pdf Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category:

30

Data:462fc1eb-5ce2-41e8-9f76-9957df731d68 | Open Energy Information  

Open Energy Info (EERE)

eb-5ce2-41e8-9f76-9957df731d68 eb-5ce2-41e8-9f76-9957df731d68 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Provo City Corp (Utility Company) Effective date: 2012/06/01 End date if known: Rate name: Private Outdoor Security (Closed Rate) - 175 W MV - No Pole Sector: Lighting Description: Source or reference: http://www.provo.org/util.rates_summary.html Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring:

31

Data:1fdafaa7-fba5-4de8-9cb2-8005b75f7dc2 | Open Energy Information  

Open Energy Info (EERE)

fdafaa7-fba5-4de8-9cb2-8005b75f7dc2 fdafaa7-fba5-4de8-9cb2-8005b75f7dc2 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Santee Electric Coop, Inc Effective date: 2011/09/01 End date if known: Rate name: Public Street Lighting Service (Mongoose (400 Watt) (Metal Halide)) Sector: Commercial Description: This Schedule is available for the purpose of lighting dedicated public streets, highways, parks or public places for municipal, county, state and federal governments in all territory served by the Cooperative. Dedicated Poles 30' Wood = $ 2.00 35' Wood = $ 4.00 40' Wood = $ 5.00 45' Wood = $ 6.00

32

Data:F1149de8-9fbd-43a6-9409-6997f96f2851 | Open Energy Information  

Open Energy Info (EERE)

9de8-9fbd-43a6-9409-6997f96f2851 9de8-9fbd-43a6-9409-6997f96f2851 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Florence Utility Comm Effective date: 2009/11/30 End date if known: Rate name: Rg-1 Residential Service Single Phase Sector: Residential Description: Power Cost Adjustment Clause - All metered rates shall be subject to a positive or negative power cost adjustment charge equivalent to the amount by which the current cost of power (per kilowatt-hour of sales) is greater or lesser than the base cost of power purchased (per kilowatt-hour of sales). The base cost of power (U) is $0.0791 per kilowatt-hour.

33

Thin EFG octagons. Semiannual subcontract report, 1 April 1993--30 September 1993  

DOE Green Energy (OSTI)

This report describes work to advance the manufacturing line capabilities in crystal growth and laser cutting of Mobil Solar`s unique edge-defined film-fed growth (EFG) octagon technology and to reduce the manufacturing costs of 10-cm {times} 10-cm polycrystalline silicon EFG wafers. The report summarizes the significant technical improvements in EFG technology achieved in the first 6 months of the PVMaT Phase 2 and the success in meeting program milestones. Technical results are reported for each of the three main pregrain areas: Task 5 -0 -- Thin octagon growth (crystal growth) -- to reduce the thickness of the octagon to 200 microns; Task 6 -- Laser cutting-to improve the laser cutting process so as to produce wafers with decreased laser cutting damage at increased wafer throughput rates; and Task 7 -- Process control and product specification --to implement advanced strategies in crystal growth process control and productivity designed to increase wafer yields.

Kalejs, J.P. [Mobil Solar Energy Corp., Billerica, MA (United States)

1994-03-01T23:59:59.000Z

34

Data:7cbed229-3ab3-44c8-9fbe-6706959e335d | Open Energy Information  

Open Energy Info (EERE)

cbed229-3ab3-44c8-9fbe-6706959e335d cbed229-3ab3-44c8-9fbe-6706959e335d No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Minnesota Power Inc Effective date: 2013/01/01 End date if known: Rate name: COMMERCIAL/INDUSTRIAL DUAL FUEL INTERRUPTIBLE ELECTRIC SERVICE LOW V Sector: Commercial Description: To the interruptible electric service requirements of Commercial/Industrial Customers where an alternative source of energy is available to satisfy these requirements during periods of interruption. Service shall be delivered at one point from facilities of adequate type and capacity and shall be metered at (or compensated to) the voltage of delivery. Service is subject to Company's Electric Service Regulations and any applicable Riders. TYPE OF SERVICE Single phase, three phase, or single and three phase, 60 hertz, at low voltage (voltage level lower than that available from Company's 13,000 volt system) or high voltage (voltage level equal to or greater than that available from Company's 13,000 volt system).

35

Data:7451bd7f-77c2-48e8-9a62-3695179d280d | Open Energy Information  

Open Energy Info (EERE)

f-77c2-48e8-9a62-3695179d280d f-77c2-48e8-9a62-3695179d280d No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Lyntegar Electric Coop, Inc Effective date: 2010/05/01 End date if known: Rate name: Street Lighting Service "SL" 13000 HPS Sector: Lighting Description: Source or reference: https://cas.sharepoint.illinoisstate.edu/grants/Sunshot/Lists/DATA%20ENTRY%20Database%20Now%20Compatible%20with%20Rates/Attachments/48/1%20COOP,%20TX,%20Lyntegar%20Electric%20Cooperative%20Tariff%20For%20Electric%20Service.pdf Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW):

36

Data:300f3281-74f3-4ca8-9a19-20c52fc52e22 | Open Energy Information  

Open Energy Info (EERE)

f3281-74f3-4ca8-9a19-20c52fc52e22 f3281-74f3-4ca8-9a19-20c52fc52e22 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: NSTAR Electric Company Effective date: 2012/06/01 End date if known: Rate name: ACTON General Service SB-T2 (C8/C9) (F8/F9) Supplemental Service Sector: Industrial Description: Service under this rate is available for all use at a single location on contiguous private property subject to the specific availability and billing provisions of the rate schedule under which this electric load would be served absent the supply provided by the Generation Units ("Applicable Rate

37

Data:6b7297b8-9f65-4f29-9d74-cae283c28d1c | Open Energy Information  

Open Energy Info (EERE)

97b8-9f65-4f29-9d74-cae283c28d1c 97b8-9f65-4f29-9d74-cae283c28d1c No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Groton Dept of Utilities Effective date: 2008/10/01 End date if known: Rate name: Street and Area Lighting Service(92 W Incandescent) Sector: Commercial Description: pplicable to public or private customers for standard street and area lighting installations provided and maintained by the Department to render 4,000 annual hours of lighting. Overhead installation is a light fixture attached to an existing overhead distribution system pole. Underground installation is a light fixture attached to a new pole served from an existing underground distribution system.

38

Data:11a6cb44-2fed-43b8-9c5a-78147a0a8c1d | Open Energy Information  

Open Energy Info (EERE)

1a6cb44-2fed-43b8-9c5a-78147a0a8c1d 1a6cb44-2fed-43b8-9c5a-78147a0a8c1d No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: New York Power Authority Effective date: 2013/07/01 End date if known: Rate name: SC 69 TOD Sector: Industrial Description: New York City Customers Source or reference: http://www.nypa.gov/about/documents.htm Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>

39

Data:5cb34ba8-9c34-46c9-acc5-6d95ad6e65cb | Open Energy Information  

Open Energy Info (EERE)

4ba8-9c34-46c9-acc5-6d95ad6e65cb 4ba8-9c34-46c9-acc5-6d95ad6e65cb No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Red River Valley Rrl Elec Assn Effective date: 2006/03/01 End date if known: Rate name: Outdoor Lighting 1000w Metal Halide - Metered Sector: Lighting Description: Available to all customers on or adjacent to the Association's distribution lines, for outdoor lighting. Source or reference: http://www.rrvrea.com/electric_service/RRV%20%20Rate%20and%20Tariff%20Sheets%201-27-09%20_As%20Filed%20with%20OCC_.pdf Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW):

40

Data:69766b33-4d1e-4cc8-9c13-7ae88acbea01 | Open Energy Information  

Open Energy Info (EERE)

3-4d1e-4cc8-9c13-7ae88acbea01 3-4d1e-4cc8-9c13-7ae88acbea01 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Village of Leigh, Nebraska (Utility Company) Effective date: 2013/01/15 End date if known: Rate name: Area Lighting - 250 W High Pressure Sodium- Customer Leased Sector: Lighting Description: To any customer who contracts for lighting of outdoor areas not provided for by the District's Street Lighting Schedules. Service shall be provided from dusk until dawn or approximately 4,000 hours per annum. The customer may lease the area lighting equipment to be installed on existing structures at a flat monthly charge which shall cover the equipment, installation, and maintenance only. The current shall be metered and paid for by the customer, along with other electrical use. Monthly charge for lease of equipment, installation, and maintenance.

Note: This page contains sample records for the topic "8-89 efg 07-90" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

Data:8049672c-1cc3-44b8-9ab9-e345633fcc69 | Open Energy Information  

Open Energy Info (EERE)

c-1cc3-44b8-9ab9-e345633fcc69 c-1cc3-44b8-9ab9-e345633fcc69 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: East Central Oklahoma Elec Coop Inc Effective date: 1995/12/01 End date if known: Rate name: Street Lighting - Up to 200 Watts Sector: Lighting Description: Available upon application to all consumers for illumination at desired points in developed areas served by the Cooperative. The monthly rate shall be increased by $2.00 if a steel pole is used for the installation of the light Source or reference: Rate Binder B #4 Source Parent: Comments Rate per month ($5.00) applies to up to 200 Watts of lighting installed on a wooden pole

42

Data:09ddb1c8-9a7d-462d-be17-0bb03852a18b | Open Energy Information  

Open Energy Info (EERE)

ddb1c8-9a7d-462d-be17-0bb03852a18b ddb1c8-9a7d-462d-be17-0bb03852a18b No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Benton County Effective date: 2013/05/01 End date if known: Rate name: Outdoor Lighting Service Sector: Lighting Description: Source or reference: ISU Documentation Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >> << Previous 1 2 3 Next >> Seasonal/Monthly Demand Charge Structures

43

Data:A1ff8959-ea3b-47f8-9ec2-a61e5b65efaf | Open Energy Information  

Open Energy Info (EERE)

A1ff8959-ea3b-47f8-9ec2-a61e5b65efaf A1ff8959-ea3b-47f8-9ec2-a61e5b65efaf No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: San Diego Gas & Electric Co Effective date: 2012/09/01 End date if known: Rate name: AL-TOU Secondary >500KW Sector: Commercial Description: Applicable to all metered non-residential customers whose monthly maximum demand equals, exceeds, or is expected to equal or exceed 20 kW. >500kW for customer charge. Source or reference: http://www2.sdge.com/tariff/com-elec/ALTOUSecondary.pdf Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months):

44

Data:7efc5745-5301-43d8-9c9d-ebf33f167754 | Open Energy Information  

Open Energy Info (EERE)

efc5745-5301-43d8-9c9d-ebf33f167754 efc5745-5301-43d8-9c9d-ebf33f167754 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Central Electric Coop Inc Effective date: 2011/10/01 End date if known: Rate name: Industrial(V2) Sector: Industrial Description: Alternating current, three phase, 60 cycles at available secondary voltage. Includes temporary service to construction projects and other such temporary loads as specified in the Central Electric Cooperative, Inc. General Service Rate Schedule B. A Central Electric Cooperative, Inc. customer shall qualify for the Industrial Service Rate if the customer's average of the two greatest non-zero monthly demands established during the 12 month period exceeds 350 KW.

45

Data:De214bb1-126b-4af8-9a8b-4431fbc3ef87 | Open Energy Information  

Open Energy Info (EERE)

bb1-126b-4af8-9a8b-4431fbc3ef87 bb1-126b-4af8-9a8b-4431fbc3ef87 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Gallatin, Tennessee (Utility Company) Effective date: 2012/08/01 End date if known: Rate name: GSA 2- >50- 1,000 kW or less than 50 kW(energy usage over 15,000 kWh) Sector: Commercial Description: GSA 2- >50- 1,000 kW or less than 50 kW w/energy usage over 15,000 kWh Source or reference: http://www.gallatinelectric.com/gallatin-electric-rates.php Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh):

46

Data:D728c4e5-f135-426f-acd8-9b39e35dbdb7 | Open Energy Information  

Open Energy Info (EERE)

e5-f135-426f-acd8-9b39e35dbdb7 e5-f135-426f-acd8-9b39e35dbdb7 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Tri-County Rural Elec Coop Inc Effective date: 2011/02/01 End date if known: Rate name: 3 Phase Demand Tri-county Sector: Commercial Description: * 3 Phase Demand Tri-County Acct. Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous

47

Data:9a350bb9-c067-48a8-9c33-c2d209b1f650 | Open Energy Information  

Open Energy Info (EERE)

50bb9-c067-48a8-9c33-c2d209b1f650 50bb9-c067-48a8-9c33-c2d209b1f650 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Tell City, Indiana (Utility Company) Effective date: 2008/07/01 End date if known: Rate name: Tariff E1, 2000 or Greater KVA Three Phase Large Power Sector: Industrial Description: The charges derived in the Tariff E rate are subject to adjustment for: Purchased Power Adjustment Tracking Factor. Source or reference: Rates Binder 1, Illinois State University Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh):

48

Data:79918288-1e95-4cf8-9f18-2a4c5a53c0de | Open Energy Information  

Open Energy Info (EERE)

88-1e95-4cf8-9f18-2a4c5a53c0de 88-1e95-4cf8-9f18-2a4c5a53c0de No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Springfield, Oregon (Utility Company) Effective date: 2013/05/01 End date if known: Rate name: Private Lighting 100 W HPS L-3 Sector: Lighting Description: New Lighting systems shall be overhead construction consisting of wood poles, aerial circuits, and conventional street lighting luminaries with mast arms not longer than ten feet, or floodlighting luminaries with no mast arms. The installed luminaries shall use low-pressure sodium lamps. All equipment used to provide service under this schedule will be furnished, owned, operated and maintained by the Springfield Utility Board.

49

Data:9eee360f-8668-44a8-9c47-ad9a505a7b04 | Open Energy Information  

Open Energy Info (EERE)

eee360f-8668-44a8-9c47-ad9a505a7b04 eee360f-8668-44a8-9c47-ad9a505a7b04 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Northeast Nebraska P P D Effective date: 2013/01/01 End date if known: Rate name: Irrigation Pumping ToU Sector: Industrial Description: Charges charged annually. Source or reference: http://www.nnppd.com/billing/rates/ Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3

50

Data:F96ac3e8-89af-42ed-af3b-e45b3976a771 | Open Energy Information  

Open Energy Info (EERE)

ac3e8-89af-42ed-af3b-e45b3976a771 ac3e8-89af-42ed-af3b-e45b3976a771 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: GreyStone Power Corporation Effective date: 2011/08/01 End date if known: Rate name: Residential Farm Service Sector: Residential Description: Source or reference: http://www.greystonepower.com/UploadedFiles/pdf/residential%20farm%20service%20rate.pdf Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring:

51

Data:Ddd8b57e-9c44-4ff8-9d79-a19544f839b5 | Open Energy Information  

Open Energy Info (EERE)

Ddd8b57e-9c44-4ff8-9d79-a19544f839b5 Ddd8b57e-9c44-4ff8-9d79-a19544f839b5 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Public Service Co of NM Effective date: 2011/08/21 End date if known: Rate name: 20 Streetlights and Floodlights 9500 Lumen 100 Watt High Pressure Sodium Streetlight Customer Owned Sector: Lighting Description: Applicable to street lighting and floodlighting systems and under contract with any municipal corporation or other political subdivision within the State of New Mexico. Available within the incorporated limits of cities and towns and adjacent territory served by the Company in its Albuquerque, Valencia, Sandoval, Clayton, Deming, Las Vegas, East Mountain, and Santa Fe Divisions and territory contiguous thereto.

52

Data:F7513911-6922-46d8-9e77-dac4e175e7b3 | Open Energy Information  

Open Energy Info (EERE)

513911-6922-46d8-9e77-dac4e175e7b3 513911-6922-46d8-9e77-dac4e175e7b3 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Village of Prairie Du Sac, Wisconsin (Utility Company) Effective date: 2009/07/06 End date if known: Rate name: Gs-2 General Service Three Phase Optional Time-of-Day 7am-7pm Sector: Commercial Description: Power Cost Adjustment Clause - All metered rates shall be subject to a positive or negative power cost adjustment charge equivalent to the amount by which the current cost of power (per kilowatt-hour of sales) is greater or lesser than the base cost of power purchased (per kilowatt-hour of sales). The base cost of power (U) is $0.0583 per kilowatt-hour.

53

Data:54b6b832-b465-43d8-9c75-88cce1b30981 | Open Energy Information  

Open Energy Info (EERE)

b6b832-b465-43d8-9c75-88cce1b30981 b6b832-b465-43d8-9c75-88cce1b30981 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: M J M Electric Cooperative Inc Effective date: End date if known: Rate name: Single Phase E/H Disc (25 KVA & Under) Sector: Commercial Description: Single Phase E/H Disc 25 KVA & Under Source or reference: Rate Binder #7 (Illinois State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category:

54

Data:5b35f2a4-d9bb-43f8-9d2b-43d0db37726f | Open Energy Information  

Open Energy Info (EERE)

d9bb-43f8-9d2b-43d0db37726f d9bb-43f8-9d2b-43d0db37726f No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Austin Energy Effective date: 2012/10/01 End date if known: Rate name: Commercial - Secondary Voltage > 50kW Sector: Commercial Description: There are additional fees of the Community Benefit Charge and Regulatory Charge of $0.00346 per kWh respectively and $2.59 per kW respectively. Source or reference: http://www.austinenergy.com/About%20Us/Rates/index.htm Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh):

55

Data:2d8b4b0b-a473-4dd8-9bf4-c218fdd36554 | Open Energy Information  

Open Energy Info (EERE)

b4b0b-a473-4dd8-9bf4-c218fdd36554 b4b0b-a473-4dd8-9bf4-c218fdd36554 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Elkhorn, Wisconsin (Utility Company) Effective date: 2012/07/01 End date if known: Rate name: General Service-Optional Time-of-Day Three Phase with Parallel Generation(20 kW or less)-Net Energy Billing Sector: Commercial Description: All metered rates shall be subject to a positive or negative power cost adjustment charge equivalent to the amount by which the current cost of power (per kilowatt-hour of sales) is greater or lesser than the base cost of power purchased (per kilowatt-hour of sales). The current cost per kilowatt-hour of energy billed is equal to the cost of power purchased for the most recent month, divided by the kilowatt-hours of energy sold. The monthly adjustment (rounded to the nearest one one-hundredth of a cent) is equal to the current cost less the base cost. The base cost of power (U) is $0.0785 per kilowatt-hour.

56

Data:Cfe68cf9-5aed-46a8-9d27-f6e4371ca37f | Open Energy Information  

Open Energy Info (EERE)

Cfe68cf9-5aed-46a8-9d27-f6e4371ca37f Cfe68cf9-5aed-46a8-9d27-f6e4371ca37f No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Eugene, Oregon (Utility Company) Effective date: 2013/05/01 End date if known: Rate name: G-4 (Very Large General Service, Secondary) Sector: Commercial Description: To electric service for large commercial, industrial and public agency customers with monthly billing demands over 5,000 kilowatts, or customers classified as New Large Single Load ("NLSL") by the Bonneville Power Administration ("BPA"). Service is applicable to NLSL customers or customers with the average of the three highest monthly kW demands in a 12-month period exceeding 5,000 kilowatts.

57

Data:934913f7-b14c-4bd8-9fa3-57eaa219b4eb | Open Energy Information  

Open Energy Info (EERE)

f7-b14c-4bd8-9fa3-57eaa219b4eb f7-b14c-4bd8-9fa3-57eaa219b4eb No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Norris Public Power District Effective date: 2012/01/20 End date if known: Rate name: SCHEDULE 15 - LARGE POWER - BETWEEN 2,500 - 7,500 kW Sector: Industrial Description: Available for commercial and industrial service greater than 2,500 kVA but less than 7,500 kVA required transformer capacity, for all uses including lighting, heating, and power within the District's service area. Source or reference: http://www.norrisppd.com/downloads/Schedule%2015%20-%20Large%20Power%20-%20Between%202,500%20-%207,500%20kW.pdf

58

Data:9227d6b8-9cf3-4c39-821b-5b1752c23277 | Open Energy Information  

Open Energy Info (EERE)

d6b8-9cf3-4c39-821b-5b1752c23277 d6b8-9cf3-4c39-821b-5b1752c23277 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Northcentral Mississippi E P A Effective date: 2011/10/01 End date if known: Rate name: Outdoor Lighting HPS 100 W Sector: Lighting Description: *The energy charge in Part A and Part B of this rate schedule shall be increased or decreased in accordance with the current Adjustment Addendum published by TVA. In addition, the energy charge in Part A and Part B of this rate schedule shall be increased or decreased to correspond to increases or decreases determined by TVA under Adjustment 4 of the wholesale power rate schedule applicable under contractual arrangements between TVA and Distributor.

59

Data:B05eebda-4b6a-44d8-9b3b-ebc664db4398 | Open Energy Information  

Open Energy Info (EERE)

eebda-4b6a-44d8-9b3b-ebc664db4398 eebda-4b6a-44d8-9b3b-ebc664db4398 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Tell City, Indiana (Utility Company) Effective date: 2009/09/01 End date if known: Rate name: Schedule ED-E: Economic Development Rider Sector: Industrial Description: Available for service to large power consumers who qualify under provisions of Tariff E and Tariff E1 and meet the following criteria: New Consumers: Must have monthly minimum billing demand of 400 KVA and greater. Existing Consumers: Must increase the monthly unadjusted billing demand by at least 200 KVA over the base average billing demand during the previous 2 to 12 months.

60

Data:A88711e8-9c20-4ad8-84b4-e3182e6036a7 | Open Energy Information  

Open Energy Info (EERE)

711e8-9c20-4ad8-84b4-e3182e6036a7 711e8-9c20-4ad8-84b4-e3182e6036a7 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Town of Wheatland, Wyoming (Utility Company) Effective date: 2013/01/01 End date if known: Rate name: 175W Mercury Vapor Sector: Lighting Description: To consumers within the service territory of the Association, subject to the rules and regulations of the Association and of Regulatory Authorities. Source or reference: http://psc.state.wy.us/htdocs/tariffs/wy_whe1/0001a.pdf Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh)

Note: This page contains sample records for the topic "8-89 efg 07-90" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

Data:7fb28492-4cc1-45b8-9fa5-36d38248bbda | Open Energy Information  

Open Energy Info (EERE)

8492-4cc1-45b8-9fa5-36d38248bbda 8492-4cc1-45b8-9fa5-36d38248bbda No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Wright-Hennepin Coop Elec Assn Effective date: 2010/08/01 End date if known: Rate name: Predetermined Demand Level Rate Sector: Commercial Description: Demand in excess of PDL during Peak Control Period = $15/kW if the member does not interrupt to the established PDL during the control period for the month. Source or reference: www.whe.org Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months):

62

Data:F579665e-6913-4ab8-9cdd-6618a00b7b13 | Open Energy Information  

Open Energy Info (EERE)

6913-4ab8-9cdd-6618a00b7b13 6913-4ab8-9cdd-6618a00b7b13 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Springfield, Oregon (Utility Company) Effective date: 2013/05/01 End date if known: Rate name: General Service (Large) Three Phase GS-3 Sector: Commercial Description: Source or reference: http://www.subutil.com/files/static_page_files/A6CFDCA3-94A4-7DCF-40A67DECC1D04974/201204SUBElec.pdf Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service

63

Data:A45e571e-607a-48f3-a0a8-9b273309e21e | Open Energy Information  

Open Energy Info (EERE)

1e-607a-48f3-a0a8-9b273309e21e 1e-607a-48f3-a0a8-9b273309e21e No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Tri-County Elec Member Corp Effective date: 2012/01/01 End date if known: Rate name: General Service Demand - Three Phase Sector: Industrial Description: Monthly Rate: First 20 kWh or less $42.50 per mo. Next 1,980 kWh 15.0¢ per kWh Next 198,000 kWh 10.3¢ per kWh Over 200,000 7.4¢ per kWh All consumption in excess of 200 kWh 6.9¢ per kWh per kW of billing demand All consumption in excess of 400 kWh 6.6¢ per kWh per kW of billing demand All consumption in excess of 600 kWh 5.8¢ per kWh

64

Data:Ef8f4827-f0cd-4aa8-9e8c-26ddc37179eb | Open Energy Information  

Open Energy Info (EERE)

7-f0cd-4aa8-9e8c-26ddc37179eb 7-f0cd-4aa8-9e8c-26ddc37179eb No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Lake Mills Light & Water Effective date: 2009/06/01 End date if known: Rate name: Cp-3 Industrial Power Time-of-Day Service above 1,000kW Demand 7am-9pm Primary Metering Discount with Parallel Generation(20kW or less) Sector: Industrial Description: Power Cost Adjustment Clause - All metered rates shall be subject to a positive or negative power cost adjustment charge equivalent to the amount by which the current cost of power (per kilowatt-hour of sales) is greater or lesser than the base cost of power purchased (per kilowatt-hour of sales). The base cost of power (U) is $0.0767 per kilowatt-hour.

65

Large area silicon sheet by EFG. First quarterly report, January 1, 1977--March 31, 1977  

DOE Green Energy (OSTI)

Work on an existing multiple growth furnace has begun with the aim of achieving growth of 5, 2'' wide ribbons simultaneously at a rate of 3 in./min. The equipment and the initial experiments carried out are described. Also starting is a task aiming to bring the 5 ribbons under automatic control, equally using pre-existing equipment and designs. Furthermore, the effort to characterize the EFG (edge-defined film-fed growth) materials produced is increased and particular emphasis is placed on measuring and analyzing their solar cell performance. Data are presented on defect densities in various EFG grown ribbons. It is demonstrated that the diffusion length is larger under AM1 than under ''dark'' conditions, and results are shown on electrical inhomogeneities in the ribbon cells. Many of these results are interpreted in terms of defect-impurity interactions which are believed to be the main impediment to better solar cell performance at the present time. However, data are reported on an EFG solar cell of 12% AM1 efficiency, and on several 1'' x 4'' EFG cells of efficiencies between 9 and 11%. In the single ribbon resistance heated crystal growth station, a major effort is made to identify the sources of impurities introduced during growth by testing a variety of machine components and designs. Also work is being started to evaluate how 3'' wide ribbons with low grown-in stress may be produced at rates of up to 3 in./min. These efforts are described in some detail.

Mackintosh, B.H.; Morrison, A.D.; Rao, C.V.H.N.; Ravi, K.V.; Serreze, H.B.; Surek, T.; Wald, F.V.; Yates, D.A.

1977-03-15T23:59:59.000Z

66

Data:1973c88f-8515-4bc8-9be3-fdd9cfb4e145 | Open Energy Information  

Open Energy Info (EERE)

Data Data Edit with form History Facebook icon Twitter icon » Data:1973c88f-8515-4bc8-9be3-fdd9cfb4e145 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Western Area Power Administration (Arizona) Effective date: 2012/07/01 End date if known: Rate name: Nonfirm Transmission Service Sector: Commercial Description: Source or reference: www.wapa.gov/dsw/pwrmkt/CRS/Current/Fy2012/RateSched.doc Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V):

67

Data:978d8818-4d6f-48d8-9bf0-923051e7ada7 | Open Energy Information  

Open Energy Info (EERE)

818-4d6f-48d8-9bf0-923051e7ada7 818-4d6f-48d8-9bf0-923051e7ada7 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: United Illuminating Co Effective date: 2008/10/22 End date if known: Rate name: FCDE Sector: Description: Availability: This Rider is available to any customer who installs a fuel cell to meet all or part of their load requirements and takes service in accordance with General Service Time-of-Use Rate GST or Large power Time-of-Use Rate LPT. In order to comply with Section 118 of Public Act 07-242, any demand charges incurred for the operation of a fuel cell in which loss of power is due to an interruption of distribution service or fuel cell unit shutdown occurring in the off-peak hours will be reviewed on a case by case basis, and billing adjustments will be made as appropriate. The Company will rely on information and communications from the customer describing and supporting a claim for waiver of a demand charge, and on meter and other technical data associated with both the fuel cell and the Company's distribution service location in order to qualify and quantify a charge amount to be waived. The charge waived will not exceed the amount result ing from the problem or shutdown.

68

Data:49e4ebe8-9c63-467c-b845-f596f98e4fd7 | Open Energy Information  

Open Energy Info (EERE)

ebe8-9c63-467c-b845-f596f98e4fd7 ebe8-9c63-467c-b845-f596f98e4fd7 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Poudre Valley R E A, Inc Effective date: 2013/01/01 End date if known: Rate name: 5000D - Commercial, Large - 5000kW & Above Dual Service Sector: Commercial Description: Available to all large power consumers for all types of usage for loads in excess of 5,000 kW with dual service, subject to the established rules and regulations, tariffs, bylaws and Articles of Incorporation of the Association. Service: Three-phase, 60 hertz, at voltages specified in the Contract, where a reserve transformer is required, each transformer being capable of providing the total service requirements and with special switching on both primary and secondary to provide automatic switchover in the event of failure of one transformer. The minimum monthly charge shall be the highest of the following: 1. The minimum monthly charge specified in the Contract; 2. A charge of $1.50 per KVA of required transformer capacity; 3. The demand charge; or 4. Current effective Facilities Charge: $110.00. Riders shall be applied in accordance with rate Schedule R.

69

Data:A8cfb15d-d06c-42b8-9b12-6012e22c2666 | Open Energy Information  

Open Energy Info (EERE)

cfb15d-d06c-42b8-9b12-6012e22c2666 cfb15d-d06c-42b8-9b12-6012e22c2666 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Northern States Power Co - Minnesota Effective date: 2012/05/01 End date if known: Rate name: Energy Controlled Service (non-demand metered Residential (A05) Sector: Residential Description: Available to residential and commercial customers with permanently connected interruptible loads of up to 50 kW that would be under Company control. The types of loads served would include dual fuel space heating, water heating, and other loads subject to Company approval. DETERMINATION OF CUSTOMER BILLS Customer bills shall reflect energy charges (if applicable) based on customer's kWh usage, plus a customer charge (if applicable), plus demand charges (if applicable) based on customer's kW billing demand as defined. OPTIONAL ENERGY CHARGE This option is available to customers with heat pump installations for non-interruptible service during June through September billing months. PLEASE SEE REFERENCE FOR MORE INFORMATION ON THE OPTIONAL ENERGY CHARGES. INTERIM RATE ADJUSTMENT A 4.49% Interim Rate Surcharge will be applied to rate components specified in the "Interim Rate Surcharge Rider." In addition, customer bills under this rate are subject to the following adjustments and/or charges. FUEL CLAUSE Bills are subject to the adjustments provided for in the Fuel Clause Rider. RESOURCE ADJUSTMENT Bills are subject to the adjustments provided for in the Conservation Improvement Program Adjustment Rider, the State Energy Policy Rate Rider, the Renewable Development Fund Rider, the Transmission Cost Recovery Rider, the Renewable Energy Standard Rider and the Mercury Cost Recovery Rider. ENVIRONMENTAL IMPROVEMENT RIDER Bills are subject to the adjustments provided for in the Environmental Improvement Rider.

70

Data:29392d38-2bd9-40b8-9fb1-ea9a5d2e5709 | Open Energy Information  

Open Energy Info (EERE)

d38-2bd9-40b8-9fb1-ea9a5d2e5709 d38-2bd9-40b8-9fb1-ea9a5d2e5709 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Bangor, Wisconsin (Utility Company) Effective date: 2010/05/19 End date if known: Rate name: Cp-2 Large Power Service Primary Metering Discount & Transformer Ownership Discount with Parallel Generation(20kW or less) Sector: Industrial Description: Application: This rate will be applied to customers for all types of service if their monthly Maximum Measured Demand is in excess of 200 kilowatts (kW) per month for three or more months in a consecutive 12-month period. Customers billed on this rate shall continue to be billed on this rate until their monthly Maximum Measured Demand is less than 200 kW per month for 12 consecutive months. The utility shall offer customers billed on this rate a one time option to continue to be billed on this rate for another 12 months if their monthly Maximum Measured Demand is less than 200 kW per month. However, this option shall be offered with the provision that the customer waives all rights to billing adjustments arising from a claim that the bill for service would be less on another rate schedule than under this rate schedule. Primary Metering Discount: Customers metered on the primary side of the transformer shall be given a 2.00 percent discount on the monthly energy charge, distribution demand charge, and demand charge. The PCAC and the monthly customer charge will not be eligible for the primary metering discount. Transformer Ownership Discount: Customers who own and maintain their own transformers or substations shall be given a credit of $0.15 per kW of distribution demand. Customer-owned substation equipment shall be operated and maintained by the customer. Support and substation equipment is subject to utility inspection and approval.

71

Market-driven EFG modules. Annual subcontract report, 14 December 1995--13 December 1996  

DOE Green Energy (OSTI)

This report summarizes the progress made at ASE Americas Inc. during the first year (Phase I) of the planned 3 year program in Phase 4A2 on the development of technology to address its photovoltaic module manufacturing flexibility and cost reduction for its products. This program focusses on advancing manufacturing technology to reduce the thickness of EFG wafers from 300 to 250 microns, to raise EFG solar cell efficiency to be able to produce cells with average efficiency of 15.5% on 10 cm x 10 cm area wafers, and to simplify processes and reduce costs in interconnect and module manufacturing. This work includes the development of a novel and new environmentally safe and reduced cost diffusion glass removal process for the solar cell manufacturing line. The overall goal of the program is to reduce EFG module manufacturing costs by 25%. Module cost reductions of approximately 7% can be identified as a result of successes on the program in the first year. The work in Phase I has been subdivided into efforts in three areas: Task 1: Wafers, Task 2: Cells, and Task 3: Modules.

Kardauskas, M.; Kalejs, J. [ASE Americas, Inc., Billerica, MA (United States)

1997-08-01T23:59:59.000Z

72

Large area silicon sheet by EFG. Second quarterly report, April 1, 1978--June 30, 1978  

DOE Green Energy (OSTI)

The main emphasis in Station No. 1 during this quarter was on the production and evaluation of a series of baseline ''clean runs''. These were designed to demonstrate that this furnace, when operating without any stainless steel parts in the interior, could produce material of a chemical quality sufficient to prepare solar cells of approximately 10% efficiency. However, interpretation of the solar cell results was complicated by the observation, that all EFG ribbon when grown using carbon crucibles has a reduced solar cell performance. It was then hypothesized that oxygen could act as an internal gettering mechanism for transition metal impurities, thus reducing their deleterious effects on the minority carrier lifetime in EFG silicon. Hence, experiments were undertaken to add oxygen to the melts contained in carbon crucibles. These experiments revealed that even small traces of oxygen, when introduced in the gas phase above the melt and near the meniscus, can significantly destabilize growth and may also generate excess silicon-carbide at the meniscus and thus cause an excessive number of ''freezes''. If this observation can be definitely confirmed, it is obviously very important since so far it is believed that all SiC occurring on the ribobns is an inevitable consequence of growing the silicon from carbon dies. These developments have, therefore, somewhat retarded work on the hypothesis concerning the effect of oxygen on the lifetime in EFG silicon contaminated with transition metals. It is planned to continue investigations on all these complex effects during the next quarter. Machine No. 3A also participated in these experiments and in an important way served to solidify some of the preliminary conclusions. The construction of the new Machine 17 which is now basically functioning as designed is discussed in detail.

Wald, F.V.

1978-07-15T23:59:59.000Z

73

Data:6b9c7c2c-66d1-44f8-9f5e-1cbcaa6a193d | Open Energy Information  

Open Energy Info (EERE)

c-66d1-44f8-9f5e-1cbcaa6a193d c-66d1-44f8-9f5e-1cbcaa6a193d No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Raton Public Service Company Effective date: End date if known: Rate name: Security Light 3 Sector: Lighting Description: Security lights are available to all (except as noted) residential, commercial and industrial customers served by the Raton Public Service Company for outside lighting purposes at the voltage and phase of the company's distribution system. RPS owns fixture and pole, power is furnished by customer. RPS furnishes parts & service. Source or reference: Rates Binder 5B (Illinois State University)

74

Data:5e8c1abd-cc61-477c-86f8-9f1c78a58de7 | Open Energy Information  

Open Energy Info (EERE)

abd-cc61-477c-86f8-9f1c78a58de7 abd-cc61-477c-86f8-9f1c78a58de7 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Murray, Kentucky (Utility Company) Effective date: 2013/06/01 End date if known: Rate name: Outdoor Lighting- 100W High Pressure Sodium Sector: Lighting Description: Available for service to street and park lighting systems, traffic signal systems, athletic field lighting installations, and outdoor lighting for individual customers. Source or reference: http://www2.murray-ky.net/outdoor_lighting_with_murray_electric_system.html Source Parent: Comments Applicability Demand (kW)

75

Stress studies in EFG. Quarterly progress report, April 1-June 30, 1984  

DOE Green Energy (OSTI)

Electrical characterization of defects induced in FZ and CZ silicon stress in four-point bending above 1200/sup 0/C has been started. Techniques to study electrical activity that will permit correlation of defect activity with diffusion length and with room and low temperature EBIC are being developed. Preliminary characterization of defects in ribbon grown at very low speeds of less than 1 cm/min shows that the dislocation density is very low over significant regions of cross section, while regions of high dislocation density (approx. 5 x 10/sup 6//cm/sup 2/) occur in bands in a number of places. Additional measurements of stress distributions in EFG material have been obtained at the University of Illinois using shadow-Moire interferometry.

Not Available

1984-08-15T23:59:59.000Z

76

Thin EFG octagons. Annual subcontract report, 1 April 1992--31 March 1993  

DOE Green Energy (OSTI)

Mobil Solar Energy Corporation currently practices a unique crystal growth technology for producing crystalline silicon sheet, which is then cut with lasers into wafers. The wafers are processed into solar cells and incorporated into modules for photovoltaic applications. The silicon sheet is produced using a method known as Edge-defined Film-fed growth (EFG), in the form of hollow eight-sided polygons (octagons) with 10 cm faces. These are grown to lengths of 5 meters and thickness of 300 microns, with continuous melt replenishment, in compact furnaces designed to operate at a high sheet area production area of 135 cm{sup 2}/min. The present Photovoltaic Manufacturing Technology (PVMaT) three-year program seeks to advance the manufacturing line capabilities of the Mobil Solar crystal growth and cutting technologies. If successful, these advancements will provide significant reductions in already low silicon raw material usage, improve process productivity, laser cutting throughput and yield, and so lower both individual wafer cost and the cost of module production. This report summarizes the significant technical improvements in EFG technology achieved in Phase 1 of this program. Technical results are reported for each of the three main program areas: (1) thin octagon growth (crystal growth) -- to reduce the thickness of the octagon to an interim goal of 250 microns during Phase 1, with an ultimate goal of achieving 200 micron thicknesses; (2) laser cutting -- to improve the laser cutting process, so as to produce wafers with decreased laser cutting damage at increased wafer throughput rates; and (3) process control and product specification -- to implement advanced strategies in crystal growth process control and productivity designed to increase wafer yields.

Kalejs, J.P. [Mobil Solar Energy Corp., Billerica, MA (United States)

1994-01-01T23:59:59.000Z

77

PVMaT Cost Reductions in the EFG High-Volume PV Manufacturing Line: Annual Report, August 1998-December 2000  

DOE Green Energy (OSTI)

The PVMaT 5A2 program at ASE Americas is a three-year program that addresses topics in the development of manufacturing systems, low-cost processing approaches, and flexible manufacturing methods. The three-year objectives are as follows: (1) implementation of computer-aided manufacturing systems, including Statistical Process Control, to aid in electrical and mechanical yield improvements of 10%, (2) development and implementation of ISO 9000 and ISO 14000, (3) deployment of wafer production from large-diameter (up to 1 m) EFG cylinders and wafer thicknesses down to 95 microns, (4) development of low-damage, high-yield laser-cutting methods for thin wafers, (5) cell designs for >15% cell efficiencies on 100-micron-thick EFG wafers, (6) development of Rapid Thermal Anneal processing for thin high-efficiency EFG cells, and (7) deployment of flexible manufacturing methods for diversification in wafer size and module design. In the second year of this program, the significant accomplishments in each of three tasks that cover these areas are as follows: Task 4-Manufacturing systems, Task 5-Low-cost processes, and Task 6-Flexible manufacturing.

Bathey, B.; Brown, B.; Cao, J.; Ebers, S.; Gonsiorawski, R.; Heath, B.; Kalejs, J., Mackintosh, B.; Ouellette, M.; Piwczyk, B., Rosenblum, M.; Southimath, B. (ASE Americas, Inc.)

2001-02-22T23:59:59.000Z

78

Stress studies in EFG. Quarterly progress report, October 1-December 31, 1983  

DOE Green Energy (OSTI)

Stress analysis at Harvard University has examined the implication of non-zero interface stresses on model predictions. Stress distributions at distances greater than about 1 mm from the interface are shown to be independent of the interface stress at high creep intensities, and the predictions based on zero initial stress can be used with confidence. Numerical models for growth dynamics developed at MIT are compared with experimental data on t-V relationships and on interface shape obtained from impurity redistribution in aluminum-doped 10 cm wide ribbon. Comparison of primary creep responses in FZ (floating zone) and CZ (Czochralski) silicon above 1200/sup 0/C using four-point bending indicates that oxygen has a significant influence on the creep rate. Both the strain rate and resulting dislocation densities generated in FZ silicon are an order of magnitude higher than for the CZ material at comparable applied stress levels. A fiber optics probe suitable for temperature measurement during sheet growth has been constructed and tested. Study of the feasibility of using laser interferometric techniques for residual stress measurements has continued at the University of Illinois. The method has been successfully applied to CZ silicon, and is being evaluated for use with EFG ribbon.

Kalejs, J.P.

1984-02-15T23:59:59.000Z

79

Data:72b264fb-5df3-4ec8-9c08-4f3535b3f4e5 | Open Energy Information  

Open Energy Info (EERE)

fb-5df3-4ec8-9c08-4f3535b3f4e5 fb-5df3-4ec8-9c08-4f3535b3f4e5 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Lake Mills Light & Water Effective date: 2009/06/01 End date if known: Rate name: Gs-2 General Service Optional Time-of-Day Three Phase 8am-8pm Sector: Commercial Description: Power Cost Adjustment Clause - All metered rates shall be subject to a positive or negative power cost adjustment charge equivalent to the amount by which the current cost of power (per kilowatt-hour of sales) is greater or lesser than the base cost of power purchased (per kilowatt-hour of sales). The base cost of power (U) is $0.0767 per kilowatt-hour.

80

Data:7f4c4d4e-c9be-4cc8-9e95-a9badf7e801b | Open Energy Information  

Open Energy Info (EERE)

d4e-c9be-4cc8-9e95-a9badf7e801b d4e-c9be-4cc8-9e95-a9badf7e801b No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Taylor County Rural E C C Effective date: 2013/01/01 End date if known: Rate name: Cogeneration and small power production power purchase rate schedule over 100 kW - non-time differentiated rates Sector: Commercial Description: Available only to qualified cogeneration or small power production facilities with a design capacity of over 100 kW which have executed a contract with Taylor County E C C and East Kentucky Power Cooperative for the purchase of electric power by East Kentucky Power Cooperative.

Note: This page contains sample records for the topic "8-89 efg 07-90" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Data:Cf3ff3ef-6d91-47b8-9bd1-309de1f0f2a1 | Open Energy Information  

Open Energy Info (EERE)

ef-6d91-47b8-9bd1-309de1f0f2a1 ef-6d91-47b8-9bd1-309de1f0f2a1 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Duke Energy Ohio Inc Effective date: 2013/05/06 End date if known: Rate name: Rate NSP - Private Outdoor Lighting for Non-Standard Units - 2,500 Lumen Mercury Vapor/Open Refractor - 100 SV Watt Sector: Lighting Description: Applicable to service for outdoor lighting on private property with Company owned overhead lighting fixtures in the Company's entire territory where secondary distribution lines are adjacent to the premise to be served. Not applicable to service for lighting of dedicated or undedicated public thoroughfares.

82

Data:Bbe9f0f8-9b3c-403d-8689-1d4b9b061b81 | Open Energy Information  

Open Energy Info (EERE)

Bbe9f0f8-9b3c-403d-8689-1d4b9b061b81 Bbe9f0f8-9b3c-403d-8689-1d4b9b061b81 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Richland Center, Wisconsin (Utility Company) Effective date: 2007/07/09 End date if known: Rate name: Cp-4 Large Industrial Power Time-of-Day Service with Parallel Generation(20kW or less) Sector: Industrial Description: Power Cost Adjustment Clause - All metered rates shall be subject to a positive or negative power cost adjustment charge equivalent to the amount by which the current cost of power (per kilowatt-hour of sales) is greater or lesser than the base cost of power purchased (per kilowatt-hour of sales). The base cost of power (U) is $0.0582 per kilowatt-hour.

83

Data:381ed842-4ea0-4b8f-9db8-9b0f0c9e8941 | Open Energy Information  

Open Energy Info (EERE)

42-4ea0-4b8f-9db8-9b0f0c9e8941 42-4ea0-4b8f-9db8-9b0f0c9e8941 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Jackson Electric Member Corp Effective date: 2006/06/01 End date if known: Rate name: GSTOU-06 General Service Time Of Use Sector: Commercial Description: To all electric service of one standard voltage, required on the customer's premises, delivered at one point and metered at or compensated to that voltage. No service rendered hereunder may be resold, nor transmitted to other premises, either directly or indirectly, without the express consent of the Cooperative. Source or reference: http://www.jacksonemc.com/business-manage-my-account-commercial-rates-options/schedules/general-service-time-use

84

Data:Ac6a66e7-9a41-4b96-bcd8-9b7caf435c56 | Open Energy Information  

Open Energy Info (EERE)

a66e7-9a41-4b96-bcd8-9b7caf435c56 a66e7-9a41-4b96-bcd8-9b7caf435c56 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Scenic Rivers Energy Coop Effective date: 2012/01/26 End date if known: Rate name: Commercial Power Sector: Commercial Description: Available to farm and commercial members with required transformer capacity in excess of 75 kVa up to and including 200 kVa. Water heater lead control credit- a maximum of $.17 will be applied per day for water heater load control. An additional $.02 per day per kVa will be applied for transformers over 75 kVa. Source or reference: ISU Documentation

85

Data:E72388a1-a2fd-42e8-9fa7-2d0e3e809a19 | Open Energy Information  

Open Energy Info (EERE)

8a1-a2fd-42e8-9fa7-2d0e3e809a19 8a1-a2fd-42e8-9fa7-2d0e3e809a19 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Wilson, North Carolina (Utility Company) Effective date: End date if known: Rate name: Small General Services Rate (SGS-90), Single Phase, with Renew Rider-02 Sector: Commercial Description: "This schedule is available for electric service used by a non-residential customer at a single point of delivery, at one of the City's standard voltages, with a contract demand of less than 80 kW, until the customer's registered demand equals or exceeds 85 kW in two or more of the preceding 12 months, or until the customer's registered demand equals or exceeds 120 kW."

86

Data:Cc6ca81f-16a5-4da4-b4c8-89ae1682b0f2 | Open Energy Information  

Open Energy Info (EERE)

f-16a5-4da4-b4c8-89ae1682b0f2 f-16a5-4da4-b4c8-89ae1682b0f2 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Butler Public Power District Effective date: 2013/01/01 End date if known: Rate name: Irrigation Services Rate 45 daily control Sector: Industrial Description: Source or reference: http://www.butlerppd.com/common/New%20Customer%20Packet%20_1.2013.pdf Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring:

87

Data:225b952f-75c8-44c8-9e4b-2e63f6a9a928 | Open Energy Information  

Open Energy Info (EERE)

75c8-44c8-9e4b-2e63f6a9a928 75c8-44c8-9e4b-2e63f6a9a928 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Public Service Co of Oklahoma Effective date: 2011/01/31 End date if known: Rate name: LUGS (Small General Service) Sector: Commercial Description: This rate schedule is available on an annual basis to retail customers who: 1) take service from distribution secondary lines or transformers; or 2) take service below 2.4 kV with a second transformation provided by the Company. This schedule is not available for resale, or supplemental service. It is the customer's option whether service will be supplied under this schedule or any other schedule for which the customer is eligible. Once this schedule is selected, service will continue to be supplied under this schedule for twelve consecutive months unless a material and permanent change in the customer's load occurs or the customer is no longer eligible as described in the Special Conditions of Service.

88

Data:D1cd6d37-c8ed-46f8-9ebc-e9c8821b43c4 | Open Energy Information  

Open Energy Info (EERE)

d37-c8ed-46f8-9ebc-e9c8821b43c4 d37-c8ed-46f8-9ebc-e9c8821b43c4 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Johnson County Rural E M C Effective date: 2010/04/01 End date if known: Rate name: Outdoor Lighting: STN, Directional Flood, Mercury Vapor / Metal Halide, 400W Sector: Lighting Description: Availability Available to any member of the Corporation entering into a contract for said service where 120 volt service exists for the use of street and security lighting. All lights must exist in a truck accessible location. Maintenance of Lighting System The Corporation will repair and/or replace and maintain all equipment owned by the Corporation, including lamps and glassware, which may be necessary to provide continuous operation of the street and security lighting.

89

Data:C118ee36-835f-44a8-9c51-b2c599f7d5f8 | Open Energy Information  

Open Energy Info (EERE)

ee36-835f-44a8-9c51-b2c599f7d5f8 ee36-835f-44a8-9c51-b2c599f7d5f8 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Alabama Power Co Effective date: 2009/01/01 End date if known: Rate name: 150W METAL HALIDE COBRA Sector: Lighting Description: Source or reference: http://www.alabamapower.com/pricing/pdf/FPL.pdf Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >> << Previous

90

Data:C1d7e720-d25c-44e8-9e0a-7058a738a2d5 | Open Energy Information  

Open Energy Info (EERE)

d7e720-d25c-44e8-9e0a-7058a738a2d5 d7e720-d25c-44e8-9e0a-7058a738a2d5 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: PUD No 1 of Cowlitz County Effective date: 2011/11/01 End date if known: Rate name: PUBLIC STREET LIGHTING SERVICE SCHEDULE 40- HPS 70 WATT Sector: Lighting Description: From dusk to dawn daily, controlled by a photoelectric control or time switch to be mutually agreeable to the Customer and District. Source or reference: http://www.cowlitzpud.org/pdf/Rate%20Schedule%2040%20Public%20Street%20Lighting%2010-25-11.pdf Source Parent: Comments Applicability Demand (kW) Minimum (kW):

91

Large area silicon sheet by EFG. Second quarterly report, April 1-June 30, 1979  

DOE Green Energy (OSTI)

In Furnace No. 1 during this quarter, experiments were conducted in which the total argon purge rate in this furnace was decreased. A number of extremely significant changes in the crystallographic structure and electronic quality of the ribbons were observed in these experiments. Ribbon segments were grown in which the equilibrium defect structure was no longer present and the electrical properties improved to the extent that cells of 50 cm/sup 2/ area having AM1 efficiencies over 11% could be prepared. In Furnace No. 3A, the final five-ribbon demonstration run was performed. The furnace performed nearly flawlessly over the 15 hour run during which approx. 30 meters of 5 cm wide ribbon were grown at a rate of approx. 3.3 cm/min from each of the five cartridges. Initial evaluation of a small lot of 45 cm/sup 2/ solar cells of approx. 9% (AM1) efficiency. Subsequent to this final multiple demonstration run, the furnace was converted to be operated with three 10 cm width cartridges, plus a melt replenishment unit. This conversion is now complete, and the first growth runs using one cartridge and the melt replenisher have produced approx. 4 meters of 10 cm wide ribbon at a growth rate of 3.5 cm/min. In Furnace 17, work on stress has continued, and a basic investigation of stress and buckle generation in the ribbon has shown this to be a fairly complex problem at high growth rates. However, at rates up to perhaps 5 cm/min, the problem may be manageable through improvements in puller design and ribbon guidance. Also on this machine, the work with automatic control designs is making progress, and in an appendix to this report, a very comprehensive discussion of the control dynamics during EFG growth is provided.

Not Available

1979-07-15T23:59:59.000Z

92

Data:F3b0e7fe-5d9e-40e8-89ba-1c48c1beefd1 | Open Energy Information  

Open Energy Info (EERE)

b0e7fe-5d9e-40e8-89ba-1c48c1beefd1 b0e7fe-5d9e-40e8-89ba-1c48c1beefd1 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Western Massachusetts Elec Co Effective date: 2013/06/01 End date if known: Rate name: Rate S-1 Street and Security Lighting-HP Sodium 1,103 watts - basic service Sector: Lighting Description: This rate is applicable to street, highway, and off-street lighting for "Dusk to Dawn" or the "Midnight" lighting service http://nuwnotes1.nu.com/apps/wmeco/webcontent.nsf/AR/SummaryOfElectricRates/$File/Summary%20of%20Electric%20Rates.pdf 2) LUMINAIRE CHARGE: a) Standard Street Lighting Luminaire No additional charge b) Luminaire furnished, installed and maintained by and at the expense of the customer No additional charge c) Decorative Luminaire installed after December 24, 1972: 4,000, 6,300, 8,000, 9,500, and 16,000 lumen sizes $ 3.09 27,500 and 50,000 lumen sizes $ 4.82 d) Flood Light or Spot Light Luminaire installed after December 24, 1972: 22,000, 22,500, 27,500, 36,000, 50,000, 60,000, 110,000, and 140,000 lumen sizes $ 2.63 e) Premium Decorative Luminaire Standard $ 8.06 Deluxe $11.50

93

Data:487dff70-c6a1-4ab0-93f8-9f1f1161e5e6 | Open Energy Information  

Open Energy Info (EERE)

dff70-c6a1-4ab0-93f8-9f1f1161e5e6 dff70-c6a1-4ab0-93f8-9f1f1161e5e6 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Jacksonville Electric Authority Effective date: 2012/01/01 End date if known: Rate name: IS Option A Interruptible Service Rider Transmission Service 230000+ volts Discount Sector: Description: Option A - Single Price with Peaking Price Rolled-In Transmission Service will be allowed for service taken at 230000 volts or higher. To all customers eligible for Rate Schedules SS or GSLD, whose accounts have an average load factor equal to or exceeding 35%, and who have executed an Interruptible Service Agreement with JEA. JEA reserves the right to limit the total load served under this rider. All service hereunder will be rendered through a single metering installation and may be completely interrupted by JEA. Resale of energy purchased under this rider is not permitted. Interruptible service under this rider is subject to interruption during any time period that electric power and energy delivered hereunder from JEA's available generating resources is required to a) maintain service to JEA's firm power customers and firm power sales commitments, or b) supply emergency Interchange service to another utility for its firm load obligations only, or c) when the price of power available to JEA from other sources exceeds 30 cents per kWh.

94

Data:Da3223a8-9c4e-439c-b7ad-d33a3e55a916 | Open Energy Information  

Open Energy Info (EERE)

Da3223a8-9c4e-439c-b7ad-d33a3e55a916 Da3223a8-9c4e-439c-b7ad-d33a3e55a916 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Northern States Power Co - Wisconsin Effective date: 2011/01/15 End date if known: Rate name: Experimental Advanced Renewable Energy Purchase Service-Biomass/Biogas Energy Systems (Tier 1: 800 kW less than 200amps) Sector: Description: Effective In All territories served by the Company. Definition: Distributed generation facilities are electricity generators owned by the customer, located R close to the point of energy consumption, and small in scale, usually no more than the existing load of the customer. Availability The advanced renewable energy tariff is available to retail customers who own small distributed generation facilities that are powered by a renewable resource and placed in initial service after January 1, 2012, or who executed an advanced renewable energy contract prior to January 1, 2012. maximum size project per customer is: * Biomass/Biogas: * Tier 1: 800 kW * Tier 2: 2 MW * Tier 3 5 MW (Community-based Projects Only) Generators rated 100 kW or less and delivering electric energy at less than 200 amps.$ 6.40/mo.

95

EFG Technology and Diagnostic R&D for Large-Scale PV Manufacturing; Final Subcontract Report, 1 March 2002 - 31 March 2005  

DOE Green Energy (OSTI)

The objective of this subcontract was to carry out R&D to advance the technology, processes, and performance of RWE Schott-Solar's wafer, cell, and module manufacturing lines, and help configure these lines for scaling up of edge-defined, film-fed growth (EFG) ribbon technology to the 50-100 MW PV factory level. EFG ribbon manufacturing continued to expand during this subcontract period and now has reached a capacity of 40 MW. EFG wafer products were diversified over this time period. In addition to 10 cm x 10 cm and 10 cm x 15 cm wafer areas, which were the standard products at the beginning of this program, R&D has focused on new EFG technology to extend production to 12.5 cm x 12.5 cm EFG wafers. Cell and module production also has continued to expand in Billerica. A new 12-MW cell line was installed and brought on line in 2003. R&D on this subcontract improved cell yield and throughput, and optimized the cell performance, with special emphasis on work to speed up wafer transfer, hence enhancing throughput. Improvements of wafer transfer processes during this program have raised cell line capacity from 12 MW to over 18 MW. Optimization of module manufacturing processes was carried out on new equipment installed during a manufacturing upgrade in Billerica to a 12-MW capacity to improve yield and reliability of products.

Kalejs, J.; Aurora, P.; Bathey, B.; Cao, J.; Doedderlein, J.; Gonsiorawski, R.; Heath, B.; Kubasti, J.; Mackintosh, B.; Ouellette, M.; Rosenblum, M.; Southimath, S.; Xavier, G.

2005-10-01T23:59:59.000Z

96

Report on Inspection of the Performance Based Incentive Program at the Richland Operations Office, IG-0401  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

(8-89) EFG (07-90) United States Government Department of Energy MEMORANDUM DATE: March 10, 1997 REPLY TO ATTN OF: IG-1 SUBJECT: INFORMATION: Report on "Inspection of the Performance Based Incentive Program at the Richland Operations Office" TO: The Acting Secretary BACKGROUND: The subject final report is provided for your information. While conducting other inspection work at the Richland Operations Office (Richland), the Office of Inspector General identified the Fiscal Year 1995 Richland Performance Based Incentive (PBI) Program as an area of concern. Specifically, we were unable to identify any

97

EFG Technology and Diagnostic R&D for Large-Scale PV Manufacturing: Annual Subcontract Report, 1 July 2003--30 June 2004  

DOE Green Energy (OSTI)

The objective of this subcontract over its duration was to carry out R&D to advance RWE Schott Solar Inc. (formerly ASE Americas)--''RSSI''--manufacturing technology, processes and capabilities of wafer, cell, and module manufacturing lines, which will help configure them for scaling up of EFG ribbon technology to the 50-100 MW PV factory level. The basic EFG technology principles have already been established and are being demonstrated on the scale of 10-20 MW manufacturing lines. By the successful completion of this effort, RSSI is planning to reduce overhead costs of production and of direct, variable manufacturing costs with the scale up of EFG processes and equipment currently in use. To achieve these objectives, RSSI needs to maintain or enhance yield, quality, process control, and throughput relative to present levels throughout the three areas of wafer, cell, and module manufacture.

Kalejs, J.; Aurora, P.; Bathey, B.; Cao, J.; Gonsiorawski, R; Heath, B.; Kubasti, J.; Mackintosh, B.; Ouellette, M.; Rosenblum. M.; Southimath, S.; Xavier, G.

2005-01-01T23:59:59.000Z

98

Need to Consider International Destructive Acts in NEPA Documents  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

8-89) 8-89) EFG (07-90) United States Government Department of Energy memorandum DATE: December 1,2006 REPLY TO A T ~ N OF: Office of NEPA Policy and Compliance (ECohen: 202-586-7684) SUBJECT: Need to Consider Intentional Destructive Acts in NEPA Documents TO: DOE NEPA Community (list attached) In light of two recent decisions by the United States Court of Appeals for the Ninth Circuit, DOE National Environmental Policy Act (NEPA) documents, including environmental impact statements (EISs) and environmental assessments (EAs), should explicitly address potential environmental consequences of intentional destructive acts (i.e., acts of sabotage or terrorism). This interim guidance has been developed by the Office of NEPA Policy and Compliance, in consultation with the Assistant General

99

United States Government Department of Energy Memorandum  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

8-89) 8-89) EFG (07-90) United States Government Department of Energy Memorandum DATE: March 26, 2004 REPLY TO IG-30 (A03RL15) Audit Report No.: OAS-L-04-12 ATTN OF: SUBJECT: Audit of Consolidation of Hanford's Surplus Plutonium-Bearing Material TO: Assistant Secretary for Environmental Management INTRODUCTION AND OBJECTIVE The Department of Energy's (Department) Office of Environmental Management (EM) and National Nuclear Security Administration (NNSA) are responsible for stabilization, repackaging and safeguarding of about 13 metric tons of surplus weapons-usable plutonium or plutonium-bearing material (surplus plutonium). The Defense Nuclear Safety Board (DNFSB) agreed to the stabilization and repackaging as long as there would be a continued surveillance of the material.

100

PVMaT Cost Reductions in the EFG High Volume PV Manufacturing Line: Final Subcontract Report, 5 August 1998 -- 4 February 2001  

DOE Green Energy (OSTI)

This report describes the three major task areas: manufacturing systems development, low-cost processing technology, and flexible manufacturing methods. In Manufacturing Systems, we have worked on implementing and utilizing SPC on a larger scale by developing support systems for computer-aided data bases and equipment and process-tracking methodology; developing and implementing new diagnostic techniques; reducing acid use and waste products by introducing a new dry-etch process; and formalizing documentation and training procedures for manufacturing processes (ISO 9000) and for waste product and safety management (ISO 14000) to assist in handling the larger manufacturing organization. Low-Cost Processes, we report on progress in demonstrating low-damage, high-throughput laser technology; studies on Rapid Thermal Processing approaches to improving cell efficiency; evaluating new thin-wafer technology using EFG cylinders; and developing a large EFG octagon and laser-cutting technology for producing 12.5 cm x 12.5 cm wafers. For Flexible Manufacturing, we completed introduction of manufacturing data bases for wafer and cell manufacturing; process modifications to accommodate manufacture of 10 cm x 15 cm wafers; and module field-performance studies and defect tracking to be used to improve manufacturing processes, new encapsulant qualification and introduction into manufacturing, and progress in developing designs for low-cost modules.

Kalejs, J.; Bathey, B.; Brown, B.; Cao, J.; Doedderlein, J.; Ebers, S.; Gonsiorawski, R.; Heath, B.; Kardauskas, M.; Mackintosh, B.; Ouellette, M.; Piwczyk, B.; Rosenblum, M.; Southimath, B.

2002-03-01T23:59:59.000Z

Note: This page contains sample records for the topic "8-89 efg 07-90" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

NERSC Users Group Meeting April 8-9, 1998 Presentations  

NLE Websites -- All DOE Office Websites (Extended Search)

A Case Study in T3E Optimization A Case Study in T3E Optimization April 8, 1998 | Author(s): Jonathan Carter | Download File: jcarter.pdf | pdf | 339 KB In this presentation we show the various stages of converting a program from PVP to MPP. After producing a basic message passing program, we optimize both the communications and computational kernel. After some work we can achieve a factor of two over a dedicated C90.[NERSC, User Services Group] Application of the PVODE Solver to Parallelize the Fluid Transport Code UEDGE April 7, 1998 | Author(s): Xueqiao Xu | (Lawrence Livermore National Laboratory)[Download not available] Aztec: A Library for the Parallel Solution of Sparse Linear Systems April 7, 1998 | Author(s): John Wu | Download File: aztec.pdf | pdf | 82 KB AZTEC is a package for solving large sparse linear systems generated from

102

NERSC Users Group Meeting April 8-9, 1998 Presentations  

NLE Websites -- All DOE Office Websites (Extended Search)

Aztec: A Library for the Parallel Solution of Sparse Linear Systems Aztec: A Library for the Parallel Solution of Sparse Linear Systems April 7, 1998 | Author(s): John Wu | Download File: aztec.pdf | pdf | 82 KB AZTEC is a package for solving large sparse linear systems generated from scientific and engineering applications. It contains a very developed matrix-vector multiplication routine for general sparse matrices. It is suitable to solve large linear systems on massively parallel environments. [NERSC, Scientific Computing Group] Remote Visualization at NERSC April 7, 1998 | Author(s): Stephen Lau | As part of the Visualization Group's efforts to help remote NERSC users, NERSC recently purchased a remote visualization server. The area of remote visualization is an ongoing research topic in the field of visualization.

103

NERSC Users Group Meeting April 8-9, 1998 Presentations  

NLE Websites -- All DOE Office Websites (Extended Search)

Shmem and Synchronization Primitives on the Cray T3E Shmem and Synchronization Primitives on the Cray T3E April 8, 1998 | Author(s): Adrian Wong | The task asynchronous programming model and one-sided communication protocols will be briefly surveyed. The SHMEM library and symmetric memory on the Cray-T3E will be discussed in detail. Other specialized synchronization primitives will also be touched on. [NERSC, Scientific Computing Group] [Download not available] Multigrid Solvers for Finite Element Matrices on Unstructured Grids with PETSc April 8, 1998 | Author(s): Mark Adams | Download File: madam.pdf | pdf | 1.4 MB We are work with developing and analyzing highly scalable equation solvers for finite element method (FEM) matrices on unstructured meshes. We maintain a minimal interface with the FEM implementation by constructing

104

NERSC Users Group Meeting April 8-9, 1998 Presentations  

NLE Websites -- All DOE Office Websites (Extended Search)

Download not available Parallelization of a 3D Plasma Fluid Turbulence Model on the NERSC Cray T3E at NERSC April 7, 1998 | Author(s): Jean-Noel LeBoeuf | Download File:...

105

NERSC Users Group Meeting April 8-9, 1998 Agenda  

NLE Websites -- All DOE Office Websites (Extended Search)

Breakfast 08:30 Welcome Ricky Kendall 08:35 View From Washington Tom Kitchens 08:55 New NERSC Staff Introductions Horst Simon 09:00 NERSC Research Efforts (Leverage to the NERSC...

106

NERSC Users Group Meeting April 8-9, 1998 Minutes  

NLE Websites -- All DOE Office Websites (Extended Search)

and made routine announcements. The View from Washington The first speaker was NERSC Program Manager Tom Kitchens from DOE's Mathematical, Information and Computational...

107

NERSC Users Group Meeting January 8-9, 1996  

NLE Websites -- All DOE Office Websites (Extended Search)

Berkeley Lab8:45 Coffee9:15 Report from the MICS Program Office -- Kitchens9:45 NERSC ESnet -- McCurdy, Leighton, McCoy, Jette, Welcome, - What stays the same - Shape and Scope...

108

NERSC Users Group Meeting January 8-9, 1996 Agenda  

NLE Websites -- All DOE Office Websites (Extended Search)

Lab 8:45 Coffee 9:15 Report from the MICS Program Office -- Kitchens 9:45 NERSC ESnet -- McCurdy, Leighton, McCoy, Jette, Welcome, - What stays the same - Shape and Scope...

109

Meeting of the TGDC - July 8-9, 2010  

Science Conference Proceedings (OSTI)

Meeting of the Technical Guidelines Development Committee. Purpose: ... Angela Ellis Conference Facilities, NIST 301/975-3881. Technical Contact: ...

2012-07-18T23:59:59.000Z

110

Graduate School Form 9 (Revised 8/89)  

E-Print Network (OSTI)

The effects of reservoir geometry on the seismic response of gravity dams M. A. Mill´an,,, Y. L. Young§ and J 08544, U.S.A. SUMMARY Conventional seismic analysis of gravity dams assumes that the behaviour of a gravity dam that violates the 2-D assumptions. Canyon Ferry dam on Missouri river. Montana (U

Gu, Tingyue

111

,. United States Government  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

i. 001 i. 001 DOE F 1325.8 (8-89) EFG (07-90) ,. United States Government Department of Energy memorandum DATE: September 11, 2003 REPLYTO: IG-34 (A03NE045) Audit Report No.: OAS-L-03-20 SUBJECT: Audit of Procurement Administration at the Oak Ridge National Laboratory TO: Director, Office of Management, Budget and Evaluation/Chief Financial Officer, ME-1 The purpose of this report is to inform you of the results of our survey of procurement administration at the Oak Ridge National Laboratory (Laboratory). This review was initiated in May 2003 and fieldwork was conducted through August 2003. Our review methodology is described in an attachment to this report. INTRODUCTION AND OBJECTIVE In Fiscal Year (FY) 2002, the Department of Energy's (Department) management contractors procured approximately $6.4 billion worth of goods and services from

112

United States Government Department of Ena  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DOL F 1325.8 DOL F 1325.8 (8-89) EFG (07-90) United States Government Department of Ena memorandum DATE: January 22, 2003 Audit Report No.: OAS-L-03-09 REPLY TO ATTN OF: IG-34 (A02PT033) SUBJECT: Review of the Department's Administration of Financial Instruments TO: Director/Chief Financial Officer, Office of Management, Budget, and Evaluation, ME-1 The purpose of this report is to inform you of the results of our review of the Department of Energy's (Department) administration of financial instruments. The review was initiated in September 2002 and fieldwork was conducted through December 2002 at Department Headquarters, the National Energy Technology Laboratory (NETL) and the Oak Ridge National Laboratory (ORNL). Our methodology is described in the attachment to this report.

113

EM-1 Related Memorandum  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

(8-89) EFG (07-90) United States Government Department of Energy DATE: February 12, 2001 REPLY TO ATTN OF: EM-6 (D. Pepson, 301-903-7432) SUBJECT: Environmental Management-Project Definition Rating Index TO: Distribution In March 2000, the Environmental Management-Project Definition Rating Index (EM-PDRI) was directed for use in EM to enhance our up-front project planning process. Revision 1 of the EM-PDRI, which incorporates the requirements of DOE Order, 413.3, Program and Project Management for the Acquisition of Capital Assets is now being issued. As in the past, EM- PDRI scores must be provided for Critical Decisions (CDs) for all Capital Asset Projects prior to construction/remediation (i.e., all CDs other than CD-4). Attachment 1 shows the CDs for each type of EM project and the expected EM-PDRI score for

114

L  

Office of Legacy Management (LM)

aOr; < 1325.8 aOr; < 1325.8 L ' (8.89) EFG (07-90) e I United St&es Government memorandum MAY 29 1%1 DATE: REPLY TO AlTN OF: EM-421 SUBJECT: Elimination of the C. G . Sargents and Sons Company Site TO: The File I have reviewed the attached site summary and elimination recommendation for the C. G . Sargents and Sons Company Site Site in Graniteville, Massachusetts. I have determined that there is little likelihood of radioactive contamination at this site. Based on the above, the C. G . Sargents and Sons Company Site is hereby eliminated from further consideration under the Formerly Utilized Sites Remedial Action Program. $LL &lz&&G$ &4&A W. Alexander Williams, PhD Designation and Certification Manager O ff-Site Branch Division of Eastern Area Programs

115

United States Government Degartment of Ener  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

'J3/30/05 11:07 FAX 301 903 4656 CAPITAL REGION - 'J3/30/05 11:07 FAX 301 903 4656 CAPITAL REGION - FORS FIVEA 1I001 DOE F 1325.8 ( 89 ' EFG (07-90) United States Government Degartment of Ener M m o r am . Office of Inspector General Memorandum DATE: MAR 3 0 2005 Audit Report No.: OAS-L-05-05 REPLY TO ATTN OF: IG-34 (A05SC023) SUBJECT: Audit of the Spallation Neutron Source Project TO: Director, Office of Science, SC-1 The purpose of this report is to inform you of the results of our audit of the Spallation Neutron Source (SNS) Project. The audit was initiated in November 2004. Fieldwork was conducted through February 2005 at Department of Energy (Department) Headquarters, Oak Ridge National Laboratory (Oak Ridge), and Brookhaven National Laboratory (Brookhaven). The audit methodology is described in an attachment to this

116

A.12a (Pre-SAS 115) Letter to communicate significant deficiencies and/or material weaknesses in internal control over financial reporting noted in an audit of financial statements of a nonpublic entity, excluding FDICIA engagements (Rev. 1/08)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

I325 8 I325 8 (8-89) EFG (07-90) United States Government Department of Energy Memorandum DATE: December 22,2009 REPLY TO A I T N OF: IG-322 (A09FN006) SUBJECT: Management Letter on the Audit of the Department of Energy's Consolidated Financial Statements for Fiscal Year 2009 TO: Chief Financial Officer, CF- 1 Attached is the subject letter prepared by KPMG LLP, our contract auditors. The letter contains 21 new findings (see letter, Exhibit A) and 5 repeat findings (see letter, Exhibit B) that were issued during the course of the Fiscal Year 2009 audit of the Department of Energy's (Department) Consolidated Financial Statements. Management generally concurred with and provided planned corrective actions for most of the recommendations listed in the Management Letter and management's comments are

117

Environmental Quality Improvement Act of 1970; Department of Energy NEPA Regulations & Guidance  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

F F 1325.B (8-89) EFG (07-90) United States Government Department of Energy memorandum DATE: May O8, 1995 REPLY TO ATTN OF: Office of NEPA Policy and Assistance:Borgstrom:6-4600 SUBJECT: Guidance for Si te-wide Environmental Impact Statements TO: Henry Garson, NEPA Compliance Officer Office of Defense Programs You have raised a concern that several programmatic and site-wide environmental impact statements (EISs) related to the nuclear weapons complex involve potential overlaps in scope. If not addressed appropriately, such overlaps could result in unnecessary cost, delay, and stakeholder concern regarding the Department's decision making process. In addition, given the interrelationships among proposed actions and alternatives in the programmatic and site-wide EISs, it is not clear how to cover

118

United States Government -DeOartment  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

0/03 10:1.0 FAX 301 903 4656 CAPITAL REGION 0/03 10:1.0 FAX 301 903 4656 CAPITAL REGION - FORS FIVEA |002/004 DOE F 1325.8 (8.89) EFG (07-90) United States Government -DeOartment of Enaera Memorandum DATE: February 19, 2003 Audit Report No.: C:AS-L-03-10 REPLY TO ATTN OF: IG-34 (A02PT034) SUBJECT: Audit of the Research and Development Investment Criteria for Fossil Energy TO: Assistant Secretary for Fossil Energy (FE-1) The purpose of this report is to inform you of the results of our review of Research and Development (R&D) Investment Criteria for Fossil Energy. This review was initiated in August 2002 and fieldwork was conducted through December 2002 at Department Headquarters and the National Energy Technology Laboratory (NETL). The review methodology is described in the attachment to this report.

119

United States Government Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

F 1325.8 F 1325.8 (8-89) EFG (07-90) United States Government Department of Energy memorandum DATE: December 18, 2006 Report Number: OAS-L-07-04 REPLY TO ATTN OF: IG-32 (A07LL039) SUBJECT: Report on "Inquiry to the Hotline Complaint on Possible Design Mistakes and Cost Overruns of the Linac Coherent Light Source Project at Stanford Linear Accelerator Center" TO: Manager, Stanford Site Office INTRODUCTION AND OBJECTIVE The purpose of the Stanford Linear Accelerator Center (SLAC) Linac Coherent Light Source (LCLS) project is to provide laser-like radiation in the x-ray region of the spectrum that is 10 billion times greater in peak brightness than any existing coherent x-ray light source. The LCLS will be an important tool in the study of, among other things, materials

120

United States Government Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DOE,: 1325.8 DOE,: 1325.8 ./ (8-89) iEFG (07-90) United States Government Department of Energy memorandum DATE: October 18, 2006 Audit Report Number: OAS-L-07-02 REPLY TO ATTN OF: IG-32 (A06LL041) SUBJECT: Audit Report on "Emergency Response Training at Lawrence Livermore National Laboratory" TO: Manager, Livermore Site Office, National Nuclear Security Administration INTRODUCTION AND OBJECTIVE The Secretary of Energy (Secretary) identified the safety of employees and the communities surrounding the Department of Energy's (Department) facilities as one of his highest priorities. Consistent with this priority, the National Nuclear Security Administration (NNSA) tasked Lawrence Livermore National Laboratory (Laboratory) to ensure that its firefighters were properly trained to

Note: This page contains sample records for the topic "8-89 efg 07-90" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

United States Government Department of Energy Memorandum DATE: November 20, 2003 Audit Report Number: OAS-L-04-05  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DOb F 1325.8 DOb F 1325.8 (8-89) EFG (07-90) United States Government Department of Energy Memorandum DATE: November 20, 2003 Audit Report Number: OAS-L-04-05 REPLY TO: IG-30 (A03AL036) SUBJECT: Audit of Controls Over Expenditures Within the Office of Secure Transportation TO: Michael Kane, Associate Administrator for Management and Administration INTRODUCTION AND OBJECTIVE The National Nuclear Security Administration's (NNSA) Office of Secure Transportation (OST) supports the Department of Energy's (Department) national security core programs by safely and securely transporting nuclear weapons, special nuclear materials, and components between Department facilities and Department of Defense destinations. OST's primary field facility locations are the Transportation Safeguards Training Center

122

PVMaT cost reductions in the EFG high volume PV manufacturing line: Annual report, 5 August 1998--4 August 1999[PhotoVoltaic Manufacturing Technology, Edge-defined Film-fed Growth  

DOE Green Energy (OSTI)

This report describes work performed by ASE Americas researchers during the first year of this Photovoltaic Manufacturing Technology 5A2 program. Significant accomplishments in each of three task are as follows. Task 1--Manufacturing Systems: Researchers completed key node analysis, started statistical process control (SPC) charting, carried out design-of-experiment (DoE) matrices on the cell line to optimize efficiencies, performed a capacity and bottleneck study, prepared a baseline chemical waste analysis report, and completed writing of more than 50% of documentation and statistical sections of ISO 9000 procedures. A highlight of this task is that cell efficiencies in manufacturing were increased by 0.4%--0.5% absolute, to an average in excess of 14.2%, with the help of DoE and SPC methods. Task 2--Low-Cost Processes: Researchers designed, constructed, and tested a 50-cm-diameter, edge-defined, film-fed growth (EFG) cylinder crystal growth system to successfully produce thin cylinders up to 1.2 meters in length; completed a model for heat transfer; successfully deployed new nozzle designs and used them with a laser wafer-cutting system with the potential to decrease cutting labor costs by 75% and capital costs by 2X; achieved laser-cutting speeds of up to 8X and evaluation of this system is proceeding in production; identified laser-cutting conditions that reduce damage for both Q-switched Nd:YAG and copper-vapor lasers with the help of a breakthrough in fundamental understanding of cutting with these short-pulse-length lasers; and found that bulk EFG material lifetimes are optimized when co-firing of silicon nitride and aluminum is carried out with rapid thermal processing (RTP). Task 3--Flexible Manufacturing: Researchers improved large-volume manufacturing of 10-cm {times} 15-cm EFG wafers by developing laser-cutting fixtures, adapting carriers and fabricating adjustable racks for etching and rinsing facilities, and installing a high-speed data collection net work; initiated fracture studies to develop methods to reduce wafer breakage; and started a module field studies program to collect data on field failures to help identify potential manufacturing problems. New encapsulants, which cure at room temperature, are being tested to improve flexibility and provide higher yields for thin wafers in lamination.

Bathey, B.; Brown, B.; Cao, J.; Ebers, S.; Gonsiorawski, R.; Heath, B.; Kalejs, J.; Kardauskas, M.; Mackintosh, B.; Ouellette, M.; Piwczyk, B.; Rosenblum, M.; Southimath, B.

1999-11-16T23:59:59.000Z

123

Proceedings of the Joint Russian-American Hydrogeology Seminar, Berkeley, CA, July 8-9, 1997  

E-Print Network (OSTI)

of U Rad data Indicate depleted uranium contamination NC7-34depleted waters Mgas-yMaasy = 0.0072+/-0.0001 for U t na Total uranium (

Tsang, Chin-Fu

2010-01-01T23:59:59.000Z

124

Table 8.9 Electricity End Use, 1949-2011 (Thousand ...  

U.S. Energy Information Administration (EIA)

1954. 116,228,286 : 93,594,893 [e] 208,464,736 : 5,875,877 [e] 424,163,792 : na : 424,163,792 : 72,141,108: 27,329,662: 1955. 128,400,614 : ...

125

Table 8.9 Electricity End Use, 1949-2011 (Billion Kilowatthours)  

U.S. Energy Information Administration (EIA)

street and highway lighting, interdepartmental sales, and other sales to public authorities. 2 Commercial sector, including public street and highway lighting, ...

126

Instructions for use 8.9 JPY/kWh+ 2010  

E-Print Network (OSTI)

) GSTanomaly(K) Sapporo GST Tokyo Abashiri Fig. 3 Annual average temperature in cities in Japan (JMA data), The Role of Atmospheric Nuclear Explosions on the Stagnation of Global Warming in the Mid 20th Century Annualyieldofatmospheric Atmospheric nuclear explosions nuclearexplosions(MT/y) Sunspotnumber 0 300 Sunspot number Fig. 4

Tachizawa, Kazuya

127

Proceedings of the Joint Russian-American Hydrogeology Seminar, Berkeley, CA, July 8-9, 1997  

E-Print Network (OSTI)

underground water deep injection wells and basins of liquidCH2M H i l l , Class I Injection Well Survey-Phase I Report;underground water deep injection wells and basins of liquid

Tsang, Chin-Fu

2010-01-01T23:59:59.000Z

128

1 SUMMARY: DECEMBER 8-9, 2005, MEETING of the NIBS ...  

Science Conference Proceedings (OSTI)

... The decision was made to develop a plan ... issues (eg, a 1990 Oak Ridge National Laboratory report and ... that accurate information is critical so what ...

2012-02-29T23:59:59.000Z

129

Programme expenditure 362.3 Notional charge against capital 8.9  

E-Print Network (OSTI)

Research outputs 8 Research policy and operations 5 Funding applications 3 Business policy and operations 5 to air Arising from : Energy Electricity consumption 147,700 153.000 Gas consumption 41,800 44,100 Oil disposed to landfill 9

Brierley, Andrew

130

Proceedings of the Joint Russian-American Hydrogeology Seminar, Berkeley, CA, July 8-9, 1997  

E-Print Network (OSTI)

with the concrete object (e.g. water intake or spring) underClosure of the Novogorny water intake also reduces usage ofoutput points (e.g. , water-intakes, springs and so on)

Tsang, Chin-Fu

2010-01-01T23:59:59.000Z

131

Proceedings of the Joint Russian-American Hydrogeology Seminar, Berkeley, CA, July 8-9, 1997  

E-Print Network (OSTI)

Zubkov A. A Study of radionuclides transport in deep-wellPreliminary assessment of radionuclides migration from the HContaminant hydrogeology of radionuclides at L L N L site

Tsang, Chin-Fu

2010-01-01T23:59:59.000Z

132

Table 8.9 Electricity End Use, 1949-2011 (Billion Kilowatthours)  

U.S. Energy Information Administration (EIA)

Short-Term Energy Outlook Annual Energy Outlook ... Company Monthly Statement." - 1984-1996-EIA, Form EIA-861, "Annual Electric Utility Report." - 1997

133

I  

Office of Legacy Management (LM)

DiJi F lZ25.8 DiJi F lZ25.8 (8-89) - I EFG (07-90) United. States Government Department of Energy m e m o randum DATE: @ fi 2 0 1094 REPLYTO EM-421 (W. A. W illiams, 903-8149) AI-I-N OF: SUBJECT: Authorization for Remedial Action at the Former Herring-Hall-Marvin Safe Company Site in Hamilton, O h io To' L. Price, OR The former Herring-Hall-Marvin Safe Company, site at 1550 Grand Boulevard in Hamilton, O h io, is designated for remedial action under the Formerly Utilized Sites Remedial Action Program (FUSRAP). Until very recently, the site has been owned by the Diebold Safe Company and vacant. W e understand that the property may recently have been sold. This designation is based on the results of radiological surveys and conclusions from an authority review. Copies of the radiological survey reports and the authority

134

I EFG Kww United States Government  

Office of Legacy Management (LM)

Cincinnati, OH (*) Fenwal, Ashland, MA Food Machining Corp., Nitro, WV General Electric Plant, Shelbyville, IN (*) Gleason Works, Rochester, NY C.I. Haynes, Cranston, RI...

135

Differences in physical activity and sedentary time in relation to weight in 8-9 year old children.  

E-Print Network (OSTI)

, Burns TL, Torner JC, Willing MC, Warren JJ: Fat- ness, Physical Activity, and Television Viewing in Children during the Adiposity Rebound Period: The Iowa Bone Devel- opment Study. Prev Med 2002, 35:563-571. 12. Rowlands AV, Pilgrim EL, Eston RG...

Purslow, Lisa R; Hill, Claire; Saxton, Jenny; Corder, Kirsten; Wardle, Jane

2008-12-12T23:59:59.000Z

136

7SVF@S69W6I8@9YS6`TPGVUDPIT M86-E02010 -0102 1  

E-Print Network (OSTI)

against crystal decay). 3 Graphical User Interface COSMO is controlled by a Tcl/Tk based graphical user

Meagher, Mary

137

Uniter+ States Government  

Office of Legacy Management (LM)

EFG (07-90) EFG (07-90) Uniter+ States Government ~L.aQ-i; Department of Energy inemorandum DATE: SEP 2 5 1992 REPLY TO Al-fN OF: EM-421 (W. A. W illiams, 903-8149) SUBJECT: Authorization for Remedial Action at the Former Dow Chemical Company Facility in M a d ison, Illinois TO: L. Price, OR The site of the Former Dow Chemical Company in M a d ison, Illinois, which is currently owned and operated by the Spectrulite Consortium, is designated for inclusion in the Formerly Utilized Sites Remedial Action Program (FUSRAP). This designation is based upon the results of a preliminary radiological survey and other information described in the attached Designation Summary. The authority determination and preliminary survey report also are attached for information. The site has been assigned a low priority under the FUSRAP protocol, as

138

EfG KMOJ- United States Government I@,&  

Office of Legacy Management (LM)

Fenwal, Ashland, MA Cincinnati, OH (*) Food Machining Corp., Nitro, W V General Electric Plant, Shelbyville, IN (*) Gleason W o rks, Rochester, NY C.I. Haynes, Cranston, RI...

139

Klasse 5-7 Klasse 8-9 Klasse 10-13 Lehrer Anreise bis 8:30 Ankunft, Registrierung Hrsaalgebude Chemie, INF 252  

E-Print Network (OSTI)

Chemie, INF 252 9:00-9:15 Begrü?ung GHS Chemie, INF 252 9:30-10:00 Vom Prisma zur schnellsten Rutsche Dr. Martin Rheinländer GHS Chemie, INF 252 9:30-10:15 Wozu brauchen Roboter Mathematik? Prof. Katja Mombaur , Botanisches Institut, INF 360 Teilnahme an einem der Vorträge 10:15-11:30 Team-Speedwettbewerb GHS Chemie, INF

Heermann, Dieter W.

140

JOURNAL DE PHYSIQUE Colloque CS, Supplment au no 8-9, Tome 33, Aoat-Septembre 1972, page C5-17 EFFETS DE COUCHE DANS LA FISSION  

E-Print Network (OSTI)

an essential advance in fission theory. As a conclusion to this talk, 1 may suggest that the analysis of single

Paris-Sud XI, Université de

Note: This page contains sample records for the topic "8-89 efg 07-90" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

NAC Ad-Hoc Task Force on Planetary Defense July 8-9, 2010 CORRECTED 9/15/10 1 NASA ADVISORY COUNCIL (NAC)  

E-Print Network (OSTI)

-finding at NASA HQ. DISCUSSION Timeline for Ad-Hoc Task Force on Planetary Defense A brief discussion reiterated Force purview. · Ken Ford, NAC Chair, has requested from the Task Force a coherent, organized report, such as the National Research Council (NRC) report. · Key would be an individual at NASA HQ who would have a budget

142

JOURNAL DE PHYSIQUE Colloque C 4, supplment au no 8-9, Tome 28, Aot-Septembre 1967, page'c 3-34 LE CENTRE INTERSTITIEL LITHIUM  

E-Print Network (OSTI)

-34 LE CENTRE INTERSTITIEL LITHIUM DANS LE FLUORURE DE LITHIUM IRRADI? par Y. FARGE(l) Laboratoire de A apparaît dans des cristaux de fluorurede lithium fortement irradiés aux électrons ou aux neutrons'irradiation;ce centre, effet primaire de l'irradiation, serait l'interstitiel lithium qui formerait un ion moléculaire

Paris-Sud XI, Université de

143

Data:93377f1c-bbd6-41c8-9a33-f9349e67ee86 | Open Energy Information  

Open Energy Info (EERE)

shops, filling stations, laundries, retail stores, dairies, hatcheries, greenhouses, welding shops, frozen storage plants, etc., except under the terms and conditions contained...

144

Data:5eae05f3-0992-4df8-9a69-3a7a990ad635 | Open Energy Information  

Open Energy Info (EERE)

Sector: Lighting Description: Applicable for dusk to dawn lighting service by means of ballast operated lamp fixtures on a suitable wood pole. The service includes all electrical...

145

The Analysis and Prediction of the 89 May 2007 Oklahoma Tornadic Mesoscale Convective System by Assimilating WSR-88D and CASA Radar Data Using 3DVAR  

Science Conference Proceedings (OSTI)

The Advanced Regional Prediction System (ARPS) model is employed to perform high-resolution numerical simulations of a mesoscale convective system and associated cyclonic line-end vortex (LEV) that spawned several tornadoes in central Oklahoma on ...

Alexander D. Schenkman; Ming Xue; Alan Shapiro; Keith Brewster; Jidong Gao

2011-01-01T23:59:59.000Z

146

Multi-hundred watt radioisotope thermoelectric generator program, LES 8/9 program, MJS program. Period from 1 September--31 October 1975  

DOE Green Energy (OSTI)

Significant activities performed or monitored by the General Electric Company on the MHW-RTG Program during Sept. and Oct. 1975 are reported. The work included safety, design, development, integration with ERDA and associate contractors, product assurance, hardware fabrication, and acceptance testing. (TFD)

Not Available

1975-01-01T23:59:59.000Z

147

C:\Forms\DOE F 3315.1.cdr  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

subject subject employee has/ has not performed satisfactorily during his/her period of probation. I recommend that subject employee should/ should not be retained in the position following com- pletion of this period. DOE F 3315.1 (07-90) EFG (07-90) U.S. DEPARTMENT OF ENERGY PROBATIONARY PERIOD EVALUATION FOR SUPERVISORS AND MANAGERS (See Reverse for Instructions) Note: ALL EVALUATIONS COMPLETED DURING A SINGLE PROBATIONARY PERIOD MUST BE ATTACHED PRIOR TO FILING IN THE OFFICIAL PERSONNEL FOLDER. 1. Name: 4. Organization: Name: Name: Name: (Type or Print) (Type or Print) (Type or Print) Signature: Signature: Signature: Signature: Date: Date: Date: Date: 7. I hereby certify that I have discussed the attached performance requirements and standards with this employee and that I agree to periodically discuss his/her performance, skills, and abilities which may

148

Letter Report on "Department of Energy Funding of Tribal Colleges and Universities"  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

(08-93) EFG (07-90) United States Government Department of Energy memorandum DATE: April 7, 2009 REPLY TO ATTN OF: IG-40 SUBJECT: Letter Report on "Department of Energy Funding of Tribal Colleges and Universities" INS-L-09-04, S09IS011) ( TO: Acting Assistant Secretary for Environmental Management Acting Director, Office of Economic Impact and Diversity This is to inform you of the results of an Office of Inspector General inspection regarding an allegation that the Department of Energy overstated its financial support to Tribal Colleges and Universities for fiscal year (FY) 2007. BACKGROUND The Department of Energy is required to submit annual reports describing the financial

149

C:\Forms\DOE F 3305.14e.cdr  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

e e (06-91) EFG (07-90) (All Other Editions Are Obsolete) U.S. Department of Energy Part II - Managerial Competencies E. Utilization of Human Resources CONTENT DESCRIPTION: Involves activities and procedures for assuring that people are appropriately employed; effectively and efficiently utilized; trained or developed; and dealt with in a fair and equitable manner. Major competencies within this activity include: Acquiring staff through appropriate staffing processes - work force planning, recruitment and selection, including affirmative action and EEO. Delegating work among subordinate groups and individuals. Resolving conflicts and attending to morale and organizational climate issues. Assessing individual capabilities and needs and providing coaching, counseling and career

150

Large area silicon sheet by EFG. Third quarterly progress report, April 1, 1976--June 30, 1976  

DOE Green Energy (OSTI)

The ''wide'' ribbon machine, JPL No. 1, is satisfactorily nearing completion. Heat sinks to accelerate growth rates were tested. Although horizontal gradients can be tailored with the heat sinks, no growth rate improvement was realized. The electrical effects of linear boundaries have been studied. Thin ribbon growth as an immediate task is reconsidered.

Morrison, A.D.; Ravi, K.V.; Rao, C.V.H.; Surek, T.; Bliss, D.F.; Garone, L.C.

1976-06-15T23:59:59.000Z

151

ABC D EFG H IJKL M NO P QR S T U VWXYZ  

Science Conference Proceedings (OSTI)

... file; Principal Component Analysis; Problems (and answers); Profile plots (intensity); Pseudo color: using sliders. RAE file format; RAM (memory, assign ...

152

Large area silicon sheet by EFG. Second quarterly report, April 1, 1977--June 30, 1977  

DOE Green Energy (OSTI)

During the quarter on which this document reports significant amounts of 2'' wide ribbon have been grown from both growth systems at speeds up to 2''/min. Solar cells prepared from the material have shown conversion efficiencies up to 8% (AM1). Thus, it is believed that the basic effort to produce reasonably clean conditions in these resistance heated furnaces has succeeded. However, the ribbons produced show a cross-sectional structure which is significantly different from that of induction furnace grown ribbon (1'' wide at a rate of 1''/min). Also, the ribbon produced in this program has unusually large inhomogeneities across its width. Some hypotheses to explain both of these features are advanced and the possible implications for solar cell performance are touched upon. The multiple ribbon growth system (JPL No. 3A) has shown a number of flaws with respect to the reliability of the basic furnace design. These definitely need to be rectified before any significant demonstration of multiple ribbon growth can proceed. The cartridges, however, have performed quite well. The work on 3'' cartridge design and automatic controls has proceeded nearly on schedule and the report contains a detailed description of the approach and the equipment to be used for automatic control of ribbon width.

Wald, F.V.

1977-06-15T23:59:59.000Z

153

Large area silicon sheet by EFG. Fourth quarterly report, October 1--December 31, 1976  

DOE Green Energy (OSTI)

During this reporting period, 5 cm wide ribbons, some with no measurable residual stress, have been grown at speeds up to 5 cm/min. The relationship between residual stress and system vertical temperature gradient was further defined. The problems associated with the purity of the ribbons are being investigated. The influence of light on the recombination characteristics of defects in the ribbons has been investigated. Procedures and results are reported.

Morrison, A.D.; Ravi, K.V.; Hari Rao, C.V.; Surek, T.; Bliss, D.F.; Garone, L.C.; Hogencamp, R.W.

1976-12-15T23:59:59.000Z

154

The Catastrophic Flash-Flood Event of 89 September 2002 in the Gard Region, France: A First Case Study for the CvennesVivarais Mediterranean Hydrometeorological Observatory  

Science Conference Proceedings (OSTI)

The CvennesVivarais Mediterranean Hydrometeorological Observatory (OHM-CV) is a research initiative aimed at improving the understanding and modeling of the Mediterranean intense rain events that frequently result in devastating flash floods in ...

Guy Delrieu; John Nicol; Eddy Yates; Pierre-Emmanuel Kirstetter; Jean-Dominique Creutin; Sandrine Anquetin; Charles Obled; Georges-Marie Saulnier; Vronique Ducrocq; Eric Gaume; Olivier Payrastre; Herv Andrieu; Pierre-Alain Ayral; Christophe Bouvier; Luc Neppel; Marc Livet; Michel Lang; Jacques Parent du-Chtelet; Andrea Walpersdorf; Wolfram Wobrock

2005-02-01T23:59:59.000Z

155

Large Value Qtr YTD 1 Yr 3 Yrs 5 Yrs 10 Yrs Expense MFS Value R3 0.69 16.13 16.13 8.89 0.89 7.53 0.96  

E-Print Network (OSTI)

.89 7.53 0.96 TIAA-CREF Large-Cap Value Premier 2.52 19.35 19.35 9.83 0.73 7.78 0.72 Russell 1000 Value.84 Fidelity International Small Cap 4.20 18.89 18.89 7.99 (0.41) 14.36 1.36 TIAA-CREF International Eq Premier, Fidelity and TIAA-CREF and deemed reliable. Performance as of December 31, 2012* #12;Balanced

156

JOURNAL DE PHYSIQUE Colloque C 4, suppliment au no 8-9, Tome 28, AoGt-Septembre 1967, page C 4-39 NONCUBIC CENTERS IN CUBIC CRYSTALS AND THEIR  

E-Print Network (OSTI)

l'ktude des CN est discutk,qui consisteB faire usage d'une action anisotrope sur le cristal electric field (a linear Stark effect for centers which do not possess inversion ; (3) External magnetic charge ; an inherent point symmetry corresponding to lower, 4. An imbedded molecule or radical which

Paris-Sud XI, Université de

157

United. States Government Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

.9) .9) EFG (07-90) United. States Government Department of Energy memorandum DATE: January 5, 2006 Audit Report Number: OAS-L-06-05 REPLY TO ATTN OF: IG-32 (A04LL017) SUBJECT: Audit Report on "Management Controls over Technologies at the Special Nuclear Material Component Requalification Facility" TO: Deputy Administrator for Defense Programs, NA-10 INTRODUCTION AND OBJECTIVE In support of the enduring stockpile, pits must now be recertified or requalified each year. This process ensures that these components, which will be reused to rebuild war reserve weapons in the enduring stockpile, continue to perform as designed for their required service life. Accordingly, in 2001 the National Nuclear Security Administration (NNSA) assigned the Pantex Plant (Pantex) the responsibility to construct the Special Nuclear

158

United States Government Department of Energy Memorandum DATE:  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

*- - *- - ~Lull-- " --- .lUI -4 ru a rlyA IgjUU Z JEf 1325.8 (6-89) EFG (07.90) United States Government Department of Energy Memorandum DATE: SEP 2 2 2003 REPLY TO: IG-34 (A03TG049) Audit Report No.: OAS-L-03-21 sueJEcT: Evaluation of "The Federal Energy Regulatory Commission's Cyber Security Program-2003" TO: Chairman, Federal Energy Regulatory Commission The purpose of this report is to inform you of the results of our evaluation of the Federal Energy Regulatory Commission's (Commission) cyber security program. The evaluation was initiated in July 2003, and our fieldwork was conducted through September 2003. Our methodology is described in the attachment to this report. INTRODUCTION AND OBJECTIVE As with other Federal organizations, the Commission is increasing its focus on the

159

. UrZed States Government DePartment of Enerq DATE: REPLY TO  

Office of Legacy Management (LM)

YVE r 1Lcla YVE r 1Lcla (8.8gJ EFG (07.90) (3f1 , q q - z . UrZed States Government DePartment of Enerq DATE: REPLY TO A?TN OF: SUBJECT: TO: =.--. AUG12 1991 EM-421 (J. Wagoner, 3-8147) Elimination of the Processes Research, Inc. Site The File I have reviewed the attached site summary and elimination recommendation for the Processes Research, Inc. Site in Cincinnati, Ohio. I have determined that there is little likelihood of radioactive contamination at this site. Based on the above, the Processes Research, Inc. Site is hereby eliminated from further consideration under the Formerly Utilized Sites Remedial Action Program. 4,1/f&+iQJiQ?A W . Alexander W illiams, PhD Designation and Certification Manager Off-Site Branch Division of Eastern Area Programs

160

United States Government  

Office of Legacy Management (LM)

DOE F t325.8 DOE F t325.8 (s8s) Dl? l 36-z EFG (07-90) United States Government m e m o randum Department of Energy DATE: LUG 2 ' 3 1394 ",cl,'," EM-421 (W. A. W illiams, 427-1719) SUBJECT: Elimination of the Sites from the Formerly Utilized Sites Remedial Action Program To' The File In 1990, with the assistance of M r. Doug Tonkay and Ms. M ichelle Landis, I reviewed a number of sites that had formerly provided goods and/or services to the Fernald facility as subcontractors. For 24 of these sites, recoamnendations were aade to eliminate them from further consideration under Formerly Utilized Sites Remedial Action Program (FUSRAP). In each case, I made or reviewed the evaluation, and, in each case, a handwritten evaluation was prepared. This is to provide a more

Note: This page contains sample records for the topic "8-89 efg 07-90" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

- United States Government  

Office of Legacy Management (LM)

8 8 my EFG (07.90) . - United States Government . * Department of. Energy * inemorandum DATE: DEC :! ;j 1993 REPLY TO ATTN OF: EM-421 (W.'A. W illiams, 903-8149) : NY 41 I .' 41 G I? SUBJECT: Elimination of the T itanium Alloy Manufacturing Co., Niagara Falls, New York TO: The F ile I have reviewed the attached site. summary and elimination recommendation for the T itanium Alloy Manufacturing Company. I have determined that the potential for radiological contamination is low because of the lim ited duration of the activities at the site. Further, at least some of the contractual activities at the site were licensed under the Atomic Energy Act, and the licensed activities are thereby disqualified from further consideration under the Department of Energy's Formerly Utilized Sites

162

United States Government  

Office of Legacy Management (LM)

I8 891 I8 891 EFG (07.90) United States Government m e m o randum bepartrne% of Energy -P ' ; N. A *I Pi id : DATE: AUG 3, 9 1994 REPLY TO Al-iN OF: EM-421 (W. A. W illiams, 427-1719) r, )' \, ! c ' d, ' t ' 3 ' 2 -L SUBJECT: Elimination of the Sites from the Formerly Utilized Sites Remedial Action Program To' The File In 1990, with the assistance of M r. Doug Tonlsay and Ms. M ichelle Landis, I reviewed a nmber of sites that had formerly provided goods and/or services to the Fernald facility as subcontractors. For 24 of.these sites, recommdations were made to eliminate them from further consideration under Formerly Utilized Sites Remedial Action Program (FUSRAP). In each case, I made or reviewed the evaluation, and, in each case, a handwritten evaluation was prepared. This is to provide a more

163

DATE: REPLY TO Al-l' N OF: SUBJECT: TO:  

Office of Legacy Management (LM)

oy&$= IL4 2%?5- oy&$= IL4 2%?5- EFG (07.90) ' Uni,ted bates Government memorandum Department of Energy /Em 7:3/ (5 2L-e DATE: REPLY TO Al-l' N OF: SUBJECT: TO: - MAR 1 1 1991 EM-421 Authority Determination-- Granite City Steel Site, Granite City, Illinois The File The attached review documents the basis for determining whether DOE has authority for taking remedial action at the Granite City Steel Site in Granite City, Illinois, under the Formerly Utilized Sites Remedial Action Program (FUSRAP). The Betatron Building at the Granite City facility was used by the Mallinckrodt Chemical Works as a subcontractor for uranium metal quality control work from 1958 to 1966. The services furnished at the Granite City Steel site under a series of purchase orders consisted of

164

Ethnicity, Employment and Migration  

E-Print Network (OSTI)

ABCDEG][CF]5 >EFG][ABCDEGJ[ACF][BCF][CDF][ CEF][CFG] >EFG][ABCDEG][ACFJ[CDF][CEF][CFG] >EFG][ABCDEGJ[ACF][BCF][CEF][CFG] 1EFGJ[ABCDEGJ[ACF][BCFJ[CDF][CFG] 1EFG][ABCDEGJ[ACF][

Wilson, Franklin D.; Tienda, Marta

1988-01-01T23:59:59.000Z

165

Inspection Letter Report: INS-L-09-05  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

F 1 F 1 3 2 5 8 (8-89) EFCi (07-90) United States Government Department of Energy memorandum DATE. May 6, 2009 =PLY TO ATIT OF. IG-40 SUBJECT Letter Report on "Selected Aspects of the Department of Energy's Activities Involving the Foreign Intelligence Surveillance Act," INS-L-09-05 (S09IS0 14) TO. Director, Office of Intelligence and Counterintelligence This report provides the results of our review of selected aspects of the Foreign Intelligence Surveillance Act activities of the Department of Energy's Office of Intelligence and Counterintelligence. BACKGROUND In conjunction with the Department of Energy's (DOE'S) role as part of the U.S. intelligence community, the Office of Intelligence and Counterintelligence (IN) provides technical intelligence analyses on all aspects of foreign nuclear weapons, nuclear

166

CAPITAL REGION  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

t 09/20/07 15:28 FAX 301 903 4656 t 09/20/07 15:28 FAX 301 903 4656 CAPITAL REGION 0 j002 SDOE F 1325.8 (8-89) EFG (0790) Energy United States Government Department of Energy Memorandum DATE. September 18, 2007 Audit Report No.: OAS-L-07-23 REPLY TO: IG-34 (A07TG036) SUBJECT: Evaluation of "The Federal Energy Regulatory Commission's Cyber Security Program-2007" TO: Chairman, Federal Energy Regulatory Commission The purpose of this report is to inform you of the results o Four evaluation of the Federal Energy Regulatory Commission's (Commission) cyber security program. The evaluation was initiated in May 2007, and our fieldwork was conducted through September 2007. Our methodology is described in the attachment to this report. . INTRODUCTION AND OBJECTIVE The Commission reports that it is constantly improving thl stability, reliability, and

167

JOURNAL RE PHYSIQUE CoLIoque C5, s u p p l e m e n t au no 8-9, Tome 33, Aoiit-Septembre 1972, p a g e C5-73 NUCLIDES FAR OFF THE STABILITY LINE AND SUPER-HEAVY NUCLEI  

E-Print Network (OSTI)

-Effekt . . . . . . . . . . . . . . . . . . . . . . . . . . . 145 2.5.3 Stern-Gerlach-Experiment (1921) . . . . . . . . . . . . . . . . . . . . . 146 2.5.4 Einstein

Paris-Sud XI, Université de

168

United States Government Department of Energy Memorandum  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

3/03 THU 13:41 FAX 865 576 3213 OAK RIDGE AUDIT A4- AIGA 0002 3/03 THU 13:41 FAX 865 576 3213 OAK RIDGE AUDIT A4- AIGA 0002 (8.89) EFG (07-0) United States Government Department of Energy Memorandum DATE: November 4, 2003 REPLY TO IG-36 (A03RL018) Audit Report No.: OAS-L-04-03 ATTN OF: SUBJECT: Audit of Accelerated Remediation of Tank Waste at Hanford TO: Roy J. Schepens, Manager, Office of River Protection INTRODUCTION AND OBJECTIVE Millions of gallons of radioactive waste, the result of decades of plutonium production, are stored in underground tanks at the Hanford Site. The tanks hold about 11 million gallons of High-Level Waste and 42 million gallons of Low-Activity Waste that must be treated prior to disposal. The Department's Tri-Party Agreement with the U.S. Environmental Protection Agency and the State of Washington requires that it immobilize all tank waste

169

Alternative Fuels Data Center: Heavy-Duty Vehicle and Engine...  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

60BRT Application: Bus - Transit Fuel Types: CNG, LNG, Hybrid - Diesel Electric Maximum Seating: 43 Power Source(s): Cummins Westport - ISL G 8.9L Cummins - ISL 8.9L Hybrid...

170

Upper-Tropospheric Winds Derived from Geostationary Satellite Water Vapor Observations  

Science Conference Proceedings (OSTI)

The coverage and quality of remotely sensed upper-tropospheric moisture parameters have improved considerably with the deployment of a new generation of operational geostationary meteorological satellites: GOES-8/9 and GMS-5. The GOES-8/9 water ...

Christopher S. Velden; Christopher M. Hayden; Steven J. Nieman; W. Paul Menzel; Steven Wanzong; James S. Goerss

1997-02-01T23:59:59.000Z

171

Alternative Fuels Data Center: Heavy-Duty Vehicle and Engine...  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

31LFW 35LFW 40LFW Application: Bus - Transit Fuel Types: CNG, Hybrid - Diesel Electric Maximum Seating: 40 Power Source(s): Cummins Westport - ISL G 8.9L Cummins - ISL 8.9L...

172

Alternative Fuels Data Center: Heavy-Duty Vehicle and Engine...  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

Volvo - VNM Daycab Application: Tractor Fuel Type: CNG Power Source(s): Cummins Westport - ISL G 8.9L...

173

Microsoft PowerPoint - DOE Meeting Morgantown Presentation 031412...  

NLE Websites -- All DOE Office Websites (Extended Search)

Loss transmission of EFG vs. LHPG growth methods for single crystal sapphire from J. J. Fitzgibbon, H. E. Bates, A. P. Pryshlak, and J. R. Dugan, "Sapphire optical fibers for...

174

Microsoft Word - Fe-S_Clusters  

NLE Websites -- All DOE Office Websites (Extended Search)

structure of an intermediate form of FeFe- hydrogenase (HydA EFG ) from the green algae Chlamydomonas reinhardtii expressed in Escherichia coli in a genetic background devoid...

175

United States Government  

Office of Legacy Management (LM)

"- .-A*" (MQ) EfG (07-W) United States Government rrla.g-a Department of Energy memorandum DATE: tlEC 1 F: l??? REPLYTo EM-421 (W. A. W illiams , 903-8149) AJTN OF: SUBJECT:...

176

Name of Project Pi(s)/Institution(s)  

NLE Websites -- All DOE Office Websites (Extended Search)

Rational Catalyst Design for Energy Production Andreas Heyden Department of Chemical Engineering University of South Carolina, Columbia NERSC BES Requirements for 2017 October 8-9,...

177

GHG Measurement Efforts Planned in So. America ...  

Science Conference Proceedings (OSTI)

... Workshop SIM-GA Quertaro, Mxico October 8-9, 2013 TNT Coal Methanol Ethanol Butanol Natural ... Coal is 25 x cheaper than gasoline, for the ...

2013-10-31T23:59:59.000Z

178

2012 National Electricity Forum | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

National Electricity Forum 2012 National Electricity Forum At the 2012 National Electricity Forum, held February 8-9, 2012 and jointly organized by DOE's Office of Electricity...

179

Alternative Fuels Data Center: Heavy-Duty Vehicle and Engine...  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

Freightliner - Business Class M2 112 Applications: Tractor, Vocational truck Fuel Types: CNG, LNG Power Source(s): Cummins Westport - ISL G 8.9L...

180

Alternative Fuels Data Center: Heavy-Duty Vehicle and Engine...  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

114SD Application: Vocational truck Fuel Types: CNG, LNG Power Source(s): Cummins Westport - ISL G 8.9L Cummins Westport - ISX12 G...

Note: This page contains sample records for the topic "8-89 efg 07-90" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Alternative Fuels Data Center: Heavy-Duty Vehicle and Engine...  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

20 G Application: Refuse hauler Fuel Types: CNG, LNG Power Source(s): Cummins Westport - ISL G 8.9L...

182

Alternative Fuels Data Center: Heavy-Duty Vehicle and Engine...  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

Cargotec - Ottawa 4x2 Application: Tractor Fuel Types: CNG, LNG Power Source(s): Cummins Westport - ISL G 8.9L...

183

Alternative Fuels Data Center: Heavy-Duty Vehicle and Engine...  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

Peterbilt Motors - 384 Application: Tractor Fuel Types: CNG, LNG Maximum Seating: 2 Power Source(s): Cummins Westport - ISL G 8.9L...

184

Alternative Fuels Data Center: Heavy-Duty Vehicle and Engine...  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

ElDorado National - XHF Application: Bus - Transit Fuel Types: CNG, LNG Maximum Seating: 39 Power Source(s): Cummins Westport - ISL G 8.9L...

185

Joint Meeting on Hydrogen Delivery Modeling and Analysis Meeting...  

NLE Websites -- All DOE Office Websites (Extended Search)

on Hydrogen Delivery Modeling and Analysis FreedomCAR and Fuels Partnership Hydrogen Delivery, Storage and Fuel Pathway Integration Tech Teams May 8-9, 2007 Energetics...

186

Alternative Fuels Data Center: Heavy-Duty Vehicle and Engine...  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

Heil Environmental - RapidRail Application: Refuse hauler Fuel Type: CNG Maximum Seating: 3 Power Source(s): Cummins Westport - ISL G 8.9L...

187

Buildings and Energy in the 1980's  

U.S. Energy Information Administration (EIA) Indexed Site

. . . . . . . . . . 79 1,464 732 460 8.9 a See Appendices B and F for descriptions of the Standard Industrial Classification system. NFNo applicable RSE rowcolumn factor. *...

188

npp_pacr_summaries0508.dvi  

NLE Websites -- All DOE Office Websites (Extended Search)

Actions Following Brookhaven National Laboratory Nuclear and Particle Physics Program Advisory Committee Meetings September 1996-May 2008 8-9 May 2008 P971 (Y. Semertzidis, et...

189

The Sorted City: San Francisco, Hope SF, and the Redevelopment of Public Housing  

E-Print Network (OSTI)

houses, but also tanneries, tallow works, and butchers asblow a nasty stench from the tallow works (OBrien, pp.8-9).

Rongerude, Jane Marie

2009-01-01T23:59:59.000Z

190

LCLS Workshop October 2002  

NLE Websites -- All DOE Office Websites (Extended Search)

Experimental Opportunities with LCLS Stanford Synchrotron Radiation Laboratory October 8-9, 2002 Organizers: John Galayda & Jerry Hastings A very successful one and one half day...

191

Conjugated Polymer Design and Engineering for Organic Electronics  

E-Print Network (OSTI)

not efficiently blanket the solar spectrum. To achieve eveneffective overlap with the solar spectrum, which peaks at ~gaps and blanket the solar spectrum more effectively, 8,9

Woo, Claire Hoi Kar

2011-01-01T23:59:59.000Z

192

Table HC6-1a. Usage Indicators by Climate Zone, | | | 1 | | |  

U.S. Energy Information Administration (EIA)

Adequacy of Insulation | Well Insulated..... 42.6 3.8 12.3 10.3 7.2 9.1 | 8.9 Adequately Insulated ...

193

Alternative Fuels Data Center: Heavy-Duty Vehicle and Engine...  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

Champion Bus Inc. - CTS - Front Engine Application: Bus - Shuttle Fuel Type: CNG Maximum Seating: 32 Power Source(s): Cummins Westport - ISL G 8.9L...

194

Alternative Fuels Data Center: Heavy-Duty Vehicle and Engine...  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

Peterbilt Motors - 320 HLA Application: Refuse hauler Fuel Type: Hybrid - Diesel Hydraulic Power Source(s): Cummins - ISL 8.9L Hybrid System(s):...

195

Alternative Fuels Data Center: Heavy-Duty Vehicle and Engine...  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

Blue Bird Corp. - All American Rear Engine Application: Bus - School Fuel Type: CNG Maximum Seating: 84 Power Source(s): Cummins Westport - ISL G 8.9L...

196

Microsoft Word - Sensing Workshop_Summary Notes.docx  

NLE Websites -- All DOE Office Websites (Extended Search)

May 8-9, 2010 Funding identified as needbarrier: Funding shortfall and advocate support during technology transition from proof of principle or scale-up demonstrations into...

197

Agenda3807 | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

March 8-9, 2007 March 8-9, 2007 Nuclear Science Advisory Committee (NSAC) NSAC Home Meetings Members Charges/Reports Charter .pdf file (629KB) NP Committees of Visitors NP Home Meetings March 8-9, 2007 Print Text Size: A A A RSS Feeds FeedbackShare Page DOE/NSF Nuclear Science Advisory Committee Meeting March 8-9, 2007 Where: Sheraton Crystal City Hotel, 1800 Jefferson Davis Highway, Arlington, VA (Metro Blue or Yellow Line to Crystal City Metro Stop) Telephone Number: 703-486-1111 Fax Number: 703-769-3955 Purpose/Topics: Perspectives from Department of Energy and National Science Foundation Status Report - NuSAG Report from NuPECC Presentation and discussion on the Committee of Visitors Report from the Sub-Committee Status Report from NSAC RIB Task Force Town Meeting Updates Public Comment

198

Agenda 20130308 | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

DOE/NSF Nuclear Science Advisory Committee Meeting March 8-9, 2013 DOE/NSF Nuclear Science Advisory Committee Meeting March 8-9, 2013 Nuclear Science Advisory Committee (NSAC) NSAC Home Meetings Members Charges/Reports Charter .pdf file (629KB) NP Committees of Visitors NP Home Meetings DOE/NSF Nuclear Science Advisory Committee Meeting March 8-9, 2013 Print Text Size: A A A RSS Feeds FeedbackShare Page DOE/NSF Nuclear Science Advisory Committee Meeting Gaithersburg Marriott Washingtonian Center Salons F-G 9751 Washington Boulevard, Gaithersburg, Maryland March 8-9, 2013 Agenda .pdf file (11KB) Friday, March 8 9:00 Welcome and Introduction to New Members Appreciation to the Departing Members Timothy J. Hallman 9:15 NSF MPS Update F. Fleming Crim 9:45 DOE Office of Science Update W. F. Brinkman 10:15 NSF Nuclear Physics Overview Bradley Keister .pdf file (499KB)

199

International Energy Statistics  

U.S. Energy Information Administration (EIA)

Jordan: 8 : 89 : 0 : 97 : Kuwait: 414 : 31 : 0 : 446 : Lebanon: 0 : 5 : 0 : 5 : Oman: 957 : 67 : 404 : 621 : Qatar: 3,402 : 0 : 3,779 : 770 : Saudi ...

200

ENERGY & ENVIRONMENT DIVISION. ANNUAL REPORT FY 1980  

E-Print Network (OSTI)

5? of our national energy consumption, 3.5 quads annually,bulb).8,9 The national energy consumption for incandescentwas calculated. National energy consumption is a function of

Authors, Various

2010-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "8-89 efg 07-90" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Energy Crop Chemical Fate and Nutrient Cycling Study  

SciTech Connect

This project has demonstrated that water yield and nutrient export from 8-9 year old hybrid poplar were similar to that of 22-to 34-year-old natural mixed aspen stands in northwestern Minnesota.

J.G. Isehrands

2004-11-19T23:59:59.000Z

202

Word Pro - Untitled1  

Annual Energy Outlook 2012 (EIA)

or industrial process located within the same facility or group of facilities that house the generating equip- ment. Direct use is exclusive of station use. Source: Table 8.9....

203

Nano fabrication approaches for patterned magnetic recording media  

E-Print Network (OSTI)

domains into V-shaped grooves. Nano Letters, 2006. 6(10): p.of a diblock copolymer. Nano Letters, 2008. 8(9): p. Chuang,an ABC Triblock Terpolymer. Nano Letters, 2009. 9(12): p.

Choi, Chulmin

2010-01-01T23:59:59.000Z

204

Alternative Fuels Data Center: Heavy-Duty Vehicle and Engine...  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

82 Application: Tractor Fuel Types: CNG, LNG Power Source(s): Cummins Westport - ISL G 8.9L Additional Description: A heavy-duty truck designed for regional-haul applications....

205

Alternative Fuels Data Center: Heavy-Duty Vehicle and Engine...  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

Axess Application: Bus - Transit Fuel Types: CNG, LNG, Hydrogen, Hybrid - Diesel Electric Maximum Seating: 41 Power Source(s): Cummins Westport - ISL G 8.9L Ballard Power Systems -...

206

Alternative Fuels Data Center: Heavy-Duty Vehicle and Engine...  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

North American Bus Industries - 42BRT Application: Bus - Transit Fuel Types: CNG, LNG, Hybrid - Diesel Electric Maximum Seating: 43 Power Source(s): Cummins Westport - ISL G 8.9L...

207

Alternative Fuels Data Center: Heavy-Duty Vehicle and Engine...  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

CrosswindEaglePelican Applications: Street sweeper, Vocational truck Fuel Types: CNG, LNG, Propane Power Source(s): Cummins Westport - ISL G 8.9L Ford Motor Co. - 2.5L Propane...

208

Alternative Fuels Data Center: Heavy-Duty Vehicle and Engine...  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

E-Z Rider II BRT Application: Bus - Transit Fuel Types: CNG, LNG, Hybrid - Diesel Electric Maximum Seating: 33 Power Source(s): Cummins Westport - ISL G 8.9L Cummins - ISB 6.7L...

209

Alternative Fuels Data Center: Heavy-Duty Vehicle and Engine...  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

T440 Tractor Application: Tractor Fuel Types: CNG, LNG Power Source(s): Cummins Westport - ISL G 8.9L Additional Description: Can be a Class 7 or a Class 8 truck...

210

Alternative Fuels Data Center: Heavy-Duty Vehicle and Engine...  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

Kenworth - T470 Tractor Application: Tractor Fuel Types: CNG, LNG Power Source(s): Cummins Westport - ISL G 8.9L Additional Description: Can be a Class 7 or a Class 8 truck...

211

Empathy in Inquiry : supporting middle school science students in developing empathy through group reflections during guided inquiry  

E-Print Network (OSTI)

the opportunity to conduct an investigation of their groups8.9.a. Plan and conduct a scientific investigation to test aDesign and conduct a scientific investigation. c. When the

Greenstein, Samantha Brooke

2010-01-01T23:59:59.000Z

212

Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Millions  

U.S. Energy Information Administration (EIA) Indexed Site

'11 to Nov '12: 8.9% YTD '11 to YTD '12: -1.9% * Calculated on a per day basis. 2 U.S. Energy Information AdministrationPrime Supplier Report, November 2012 Measurement of...

213

Reports on Workshop  

NLE Websites -- All DOE Office Websites (Extended Search)

the Working Groups ATLAS Users Meeting August 8-9, 2009-09-16 Report of working group on Nuclear Structure - Focus on Physics Convenors: D. Hartley, P. Fallon and M.P. Carpenter...

214

--No Title--  

Annual Energy Outlook 2012 (EIA)

24 34 HVAC Maintenance ... 2,581 294 129 201 8 89 101 233 Energy Management and Control System (EMCS) ... 252 100 Q Q 2 9 5 14 Window and Interior...

215

Supporting Water, Ecological, and Transportation Systems in the Great Lakes Basin Ecosystem  

E-Print Network (OSTI)

8-9, 2004. Ann Arbor, Michigan. Great Lakes InformationKeystone, Colorado. Lake Michigan (MI) Lakewide ManagementOffice (GLNPO) Lake Michigan Lakewide Management Plan (LaMP)

Beck, Judy; Kamke, Sherry; Majerus, Kimberly

2007-01-01T23:59:59.000Z

216

RECS Lighting: Use and Potential Savings - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

According to the 1993 Residential Energy Consumption Survey, U.S. Households have on average, 5.4 indoor lights that are on one or more hours per day, and 8.9 lights ...

217

Microsoft PowerPoint - BNL Solar PV Environmental Research.pptx  

NLE Websites -- All DOE Office Websites (Extended Search)

Solar Energy Research Center (NSERC) Planning Workshop March 8-9, 2011 1 web: www.bnl.govpv A Solar Grand Plan A Solar Grand Plan A Solar Grand Plan A Solar Grand Plan By 2050...

218

A Brief Overview of Hydrogen Storage Issues and Needs  

NLE Websites -- All DOE Office Websites (Extended Search)

Brief Overview of Hydrogen Storage Issues and Needs George Thomas and Sunita Satyapal Joint Tech Team Meeting Delivery, Storage and Fuels Pathway Tech Teams May 8-9, 2007 Storage...

219

The Natural Geochemistry of Tetrafluoromethane and Sulfur Hexafluoride : Studies of Ancient Mojave Desert Groundwaters, North Pacific Seawaters and the Summit Emissions of Kilauea Volcano  

E-Print Network (OSTI)

pdfs_desc/8-9.pdf Flint L. E. ,Hevesi J. A. , Flint A. L. , Christensen A. H. , Sneed M. ,of our child. Lorrie Flint (USGS) kindly sent me the

Deeds, Daniel A

2008-01-01T23:59:59.000Z

220

Maintenance | OpenEI Community  

Open Energy Info (EERE)

Maintenance Home Rmckeel's picture Submitted by Rmckeel(297) Contributor 8 March, 2013 - 14:23 OpenEI maintenance March 8-9, 2013 developer Maintenance OpenEI We would like to...

Note: This page contains sample records for the topic "8-89 efg 07-90" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

Alternative Fuels Data Center: Heavy-Duty Vehicle and Engine...  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

North American Bus Industries - CompoBus Application: Bus - Transit Fuel Types: CNG, Hybrid - Diesel Electric Maximum Seating: 47 Power Source(s): Cummins Westport - ISL G 8.9L...

222

Alternative Fuels Data Center: Heavy-Duty Vehicle and Engine...  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

LFX Application: Bus - Transit Fuel Type: Hybrid - Diesel Electric Maximum Seating: Varies Power Source(s): Cummins - ISL 8.9L Cummins - ISB 6.7L Hybrid System(s): Allison...

223

Alternative Fuels Data Center: Heavy-Duty Vehicle and Engine...  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

Autocar - E3 Hybrid Application: Refuse hauler Fuel Type: Hybrid - Diesel Electric Power Source(s): Cummins - ISL 8.9L Hybrid System(s): Parker Hannifin Corp. - RunWise...

224

Alternative Fuels Data Center: Heavy-Duty Vehicle and Engine...  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

Thomas Built Buses - Saf-T-Liner HDX CNG Application: Bus - School Fuel Type: CNG Maximum Seating: 90 Power Source(s): Cummins Westport - ISL G 8.9L...

225

Nuclear & Particle Physics Directorate  

NLE Websites -- All DOE Office Websites (Extended Search)

8-9 May 2008 Thursday, 8 May Room 2-160, Bldg. 510 (Physics) 0830 Executive Session Large Seminar Room, Bldg. 510 (Physics) (talk+questions) 0900 PHENIX FY09 Beam Use Proposal and...

226

Multiscale Structure and Evolution of an Oklahoma Winter Precipitation Event  

Science Conference Proceedings (OSTI)

A significant winter precipitation event occurred on 89 March 1994 in Oklahoma. Snow accumulations greater than 30 cm (12 in.) were measured within a narrow corridor in northern Oklahoma. On the synoptic scale and mesoscale, a correspondence ...

R. Jeffrey Trapp; David M. Schultz; Alexander V. Ryzhkov; Ronald L. Holle

2001-03-01T23:59:59.000Z

227

Commercial Nickel and Nickel Alloys  

Science Conference Proceedings (OSTI)

Table 6   Room-temperature physical properties of selected nickel-base alloys...Nickel 200 8.89 1435??1445 2615??2635 456 0.109 13.3 7.4 70 485 95 360 680 Nickel 201 8.89 1435??1445 2615??2635 456 0.109 13.1 7.3 79.3 550 85 360 680 Nickel 205 8.89 1435??1445 2615??2635 456 0.109 13.3 7.4 75.0 520 95 360 680 Nickel 211 8.72 1427 2600 532 0.127 13.3 7.4 44.7 310 169 310 590...

228

Residential Retrofit Program Design Guide  

NLE Websites -- All DOE Office Websites (Extended Search)

Technical Assistance Program Technical Assistance Program Residential Retrofit Program Design Guide May 2011 This work has been performed by the Vermont Energy Investment Corporation (VEIC) and Energy Futures Group (EFG), under the Contract No. 4200000341 with Oak Ridge National Laboratory which is managed by UT-Battelle, LLC under Contract with the US Department of Energy No. DE-AC05-00OR22725. This document was prepared in collaboration with a partnership of companies under this contract. The partnership is led by the Vermont Energy Investment Corporation (VEIC), and includes the following companies: American Council for an Energy Efficient Economy (ACEEE), Energy Futures Group (EFG), Midwest Energy Efficiency Alliance (MEEA), Northwest Energy Efficiency Alliance (NEEA), Northeast Energy Efficiency Partnership (NEEP), Natural

229

Commercially available CO{sub 2} capture technology  

SciTech Connect

While many CO{sub 2} removal technologies are being researched through laboratory and pilot-scale testing, an existing technology has a significant operating history at commercial-scale facilities, where it is collecting CO{sub 2} from multiple sources, including low-CO{sub 2} concentration flue gas with high oxygen concentrations. This is an advanced amine-based post-combustion CO{sub 2} capture technology developed by Fluor called Ecoamine FG Plus (EFG+). This has been successfully applied at a natural gas-fired power plant at the Bellingham Energy Centre in Massachusetts. EFG+ technology is a cost effective process for removing CO{sub 2} from low pressure, oxygen-containing flue gas. FLuor and E.ON Energie AG are developing a pilot plant which will begin operation in 2010 at E.ON's coal-fired power plant in Wilhelmshaven, Germany. 4 figs.

Johnson, D.W.; Reddy, S.; Brown, J.H. [Fluor Corp. (United States)

2009-08-15T23:59:59.000Z

230

Contoured inner after-heater shield for reducing stress in growing crystalline bodies  

DOE Patents (OSTI)

An apparatus for growing hollow crystalline bodies by the EFG process, comprising an EFG die having a top surface shaped for growing a hollow crystalline body having a cross-sectional configuration in the shape of a polygon having n faces, and a radiation shield adjacent to and surrounded by the top end surface of the die, characterized in that the shield has an inner edge defining a similar polygon with n sides, and the inner edge of the shield is notched so that the spacing between the n faces and the n sides is greatest between the central portions of the n faces and the n sides, whereby the greater spacing at the central portions helps to reduce lateral temperature gradients in the crystalline body that is grown by use of the die.

Kalejs, Juris P. (Wellesley, MA)

1996-09-24T23:59:59.000Z

231

NdBaFe{sub 2}O{sub 5+w} and steric effect of Nd on valence mixing and ordering of Fe  

Science Conference Proceedings (OSTI)

NdBaFe{sub 2}O{sub 5} above and below Verwey transition is studied by synchrotron X-ray powder diffraction and Moessbauer spectroscopy and compared with GdBaFe{sub 2}O{sub 5} that adopts a higher-symmetry charge-ordered structure typical of the Sm-Ho variants of the title phase. Differences are investigated by Moessbauer spectroscopy accounting for iron valence states at their local magnetic and ionic environments. In the charge-ordered state, the orientation of the electric-field gradient (EFG) versus the internal magnetic field (B) agrees with experiment only when contribution from charges of the ordered d{sub xz} orbitals of Fe{sup 2+} is included, proving thus the orbital ordering. The EFG magnitude indicates that only some 60% of the orbital order occurring in the Sm-Ho variants is achieved in NdBaFe{sub 2}O{sub 5}. The consequent diminishing of the orbit contribution (of opposite sign) to the field B at the Fe{sup 2+} nucleus explains why B is larger than for the Sm-Ho variants. The decreased orbital ordering in NdBaFe{sub 2}O{sub 5} causes a corresponding decrease in charge ordering, which is achieved by decreasing both the amount of the charge-ordered iron states in the sample and their fractional valence separation as seen by the Moessbauer isomer shift. The charge ordering in NdBaFe{sub 2}O{sub 5+w} is more easily suppressed by the oxygen nonstoichiometry (w) than in the Sm-Ho variants. Also the valence mixing into Fe{sup 2.5+} is destabilized by the large size of Nd. The orientation of the EFG around this valence-mixed iron can only be accounted for when the valence-mixing electron is included in the electrostatic ligand field. This proves that the valence mixing occurs between the two iron atoms facing each other across the structural plane of the rare-earth atoms. -- Graphical Abstract: Moessbauer spectrum detects ordering of d{sub xz} orbitals of Fe{sup II}O{sub 5} via the electric-field gradient (EFG) of the orbital, which makes the main component of the total EFG parallel with the magnetic moment B. Display Omitted

Linden, J. [Department of Physics, AAbo Akademi, FI-20500 Turku (Finland); Karen, P., E-mail: pavel.karen@kjemi.uio.n [Department of Chemistry, University of Oslo, P.O.Box 1033, Blindern, N-0315 Oslo (Norway)

2010-11-15T23:59:59.000Z

232

Table 7. U.S. Refiner Motor Gasoline Volumes by Grade and Sales Type  

Gasoline and Diesel Fuel Update (EIA)

1993 January ....................... 33.5 35.0 - - - 170.6 8.2 8.4 - - - 25.2 February ..................... 35.3 37.0 - - - 179.9 8.6 8.8 - - - 27.0 March .......................... 35.6 37.4 - - - 182.3 8.5 8.8 - - - 26.8 April ............................ 36.5 38.3 - - - 184.4 8.6 8.9 - - - 27.6 May ............................. 36.1 37.7 - - - 182.2 8.6 8.9 - - - 27.1 June ............................ 38.0 39.7 - - - 191.9 8.9 9.2 - - - 28.2 July ............................. 36.5 38.0 - - - 189.3 9.0 9.3 - - - 28.9 August ........................ 36.1 37.7 - - - 187.0 9.0 9.2 - - - 28.4 September .................. 35.5 37.1 - - - 181.9 8.6 8.9 - - - 27.9 October ....................... 34.5 36.2 47.9 116.5 18.2 182.6 8.7 9.0 13.1 14.9 0.2 28.1 November ................... 34.7 36.2

233

Table 6. U.S. Refiner Motor Gasoline Prices by Grade and Sales...  

Annual Energy Outlook 2012 (EIA)

61.5 67.3 89.8 89.5 82.2 69.4 71.1 74.9 See footnotes at end of table. 6. U.S. Refiner Motor Gasoline Prices by Grade and Sales Type 12 Energy Information Administration ...

234

Structure and Evolution of Winter Cyclones in the Central United States and Their Effects on the Distribution of Precipitation. Part VI: A Mesoscale Modeling Study of the Initiation of Convective Rainbands  

Science Conference Proceedings (OSTI)

A cyclonic storm that moved over the central United States on 89 March 1992 developed two convective rainbands, namely, a predry trough rainband and a cold front aloft (CFA) rainband. This study extends the results of previous investigations of ...

Mark T. Stoelinga; John D. Locatelli; Peter V. Hobbs

2000-10-01T23:59:59.000Z

235

University Budget Office Report on Governor's Proposed Amendments and House and Senate Committee  

E-Print Network (OSTI)

contribution and eliminating the 3% salary increase. (Item 469, page 410) Optional Retirement Plan (ORP) Contributions ­ Governor reduces the annual employer contribution to ORPs from 10.4% to 8.5% (or up to 8.9% for higher education) for faculty and staff enrolled in an ORP and hired prior to July 1, 2010. House

Acton, Scott

236

Journal of Molecular Catalysis A: Chemical 163 (2000) 918 Methane activation on Ni and Ru model catalysts  

E-Print Network (OSTI)

these intermediates play in important methane reactions such as steam reforming, partial oxidation and homologation, methane activation represents a great challenge to researchers all over the world. Currently steam reforming of methane represents the primary route for methane conversion [8,9]. This highly endothermic

Goodman, Wayne

237

visualcement.nist.gov/BOB/pate035/pate03_1_29hvol1.bob  

Science Conference Proceedings (OSTI)

... K2ZKQWT~m[T3Efnt^W[XB>HI^Uvxi᪢g5*$I:.Gcni{RH>.:1**"- 0EnmgXZtec8).9/-?ED1*?:UdOfy^1URS{֫B?dq\\B3LpjV ...

2002-04-17T23:59:59.000Z

238

A Comparison of Extended and Quasigeostrophic Dynamics for a Case of SmallRossby Number Extratropical Cyclone Development  

Science Conference Proceedings (OSTI)

This note compares the extended (EXT) and quasigeostrophic (QG) dynamics of a smallRossby number extratropical cyclone using the ZwackOkossi (ZO) equation. Applied to a cyclone that occurred on 89 November 1985 over the North Atlantic Ocean, ...

James M. Vasilj; Phillip J. Smith

1997-12-01T23:59:59.000Z

239

Bay Area ATIS Testbed Plan  

E-Print Network (OSTI)

P.M. -VAR. 3. TOS W-80, P.MdW8.9 (STIP TSM PROJ) 4. SCL -VAR. is0224 w 88STIP MINOR A STIP 90/91TSM 90/9lTSM 9Ot9lTSM

Khattak, Asad; Al-deek, Haitham; Yim, Youngbin; Hall, Randolph

1992-01-01T23:59:59.000Z

240

ON-ROAD REMOTE SENSING OF CO EMISSIONS IN THE LOS ANGELES  

E-Print Network (OSTI)

#12;ON-ROAD REMOTE SENSING OF CO EMISSIONS IN THE LOS ANGELES BASIN Donald H. Stedman, Gary A. Comparison of tailpipe %CO measured by an on-board analyzer and by remote sensing. Data collected 12/8/89, 12

Denver, University of

Note: This page contains sample records for the topic "8-89 efg 07-90" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Design of a High-energy, Two-stage Pulsed Plasma Thruster T.E. Markusic  

E-Print Network (OSTI)

Canting in Pulsed Electromagnetic Accelerators. PhD thesis, Prince- ton University, 2002. [14] Y.C.F. Thio electromagnetic accelerators are devices which use intense bursts of electrical current (8@9BADCFEHGIADCFPDQ A, July 7-10, 2002. Copyright by authors. Published by the AIAA with permission. 1 Introduction Pulsed

Choueiri, Edgar

242

Large-scale pattern growth of graphene films for stretchable transparent electrodes  

E-Print Network (OSTI)

of these highly conducting and transparent electrodes in flexible, stretchable, foldable electronics8,9 . Graphene growth provides high-quality multilayer graphene samples interacting strongly with their substrates method to grow and transfer high-quality stretchable graphene films on a large scale using CVD on nickel

Kim, Philip

243

April 28-May 4.2011 CENTER eXpress  

E-Print Network (OSTI)

mini-Magnet confer- ence turned into a full day of sharing," said Jennifer Thibault, RN, quality out Series: "Journal Club," Charlene Adkins, MD, 8-9 a.m.; "Experiential Music Therapy," Jennifer Fiore, 9-516-9566. STURDY DESK with hutch, pho- tos, $50. 913-568-9139. VINTAGE 1950s Berkshire House Formica table, 4

Albertini, David

244

COMMUNITY AND ECOSYSTEM ECOLOGY Influences on the Structure of Suburban Ant (Hymenoptera  

E-Print Network (OSTI)

mini-Magnet confer- ence turned into a full day of sharing," said Jennifer Thibault, RN, quality out Series: "Journal Club," Charlene Adkins, MD, 8-9 a.m.; "Experiential Music Therapy," Jennifer Fiore, 9-516-9566. STURDY DESK with hutch, pho- tos, $50. 913-568-9139. VINTAGE 1950s Berkshire House Formica table, 4

Sanders, Nathan J.

245

IFT1025 automne 2009 Avant l'intra  

E-Print Network (OSTI)

'acc`es : public, private, protected, niveau module (package) classe abstraite red´efinition de m´ethodes de la chapitres 1­6, sections 8.3­8.8. Packages `A lire : Big Java section 8.9. notion de package (module) import UML documentation structur´ee, javadoc #12;

Csürös, Miklós

246

Regional NO2 emission inversion through four-dimensional variational approach using  

E-Print Network (OSTI)

of Columbia area,343 revealing the NOx emission reduction. With emission at surface and upper344 levels reduction results from four test cases range346 from 8.9% to 11.4%, indicating the power plant NOx emission reduction from347 2001 to 2004. Stavrakou et al. (2008) reported their inferred posterior NOx348 emissions

Sandu, Adrian

247

Million U.S. Housing Units Total...............................  

U.S. Energy Information Administration (EIA) Indexed Site

... 25.8 1.4 5.0 4.8 5.7 8.9 Use of Most-Used Ceiling Fan Used All Summer... 18.7 2.3 4.6 4.9 4.3 2.6...

248

Variation in wood density determines spatial patterns in Amazonian forest biomass  

E-Print Network (OSTI)

confeitaria,s/ cacau 10,12 Papel e Celulose 8,86 Produtos cerâmicos 7,04 Vidros e suas obras 5,6 Calçados e e peles (+18,0%), Alumínio em bruto (+8,9%) Celulose (+4,7%). Máquinas e aparelhos para

Malhi, Yadvinder

249

INDICADORES DE PRODUO Bruno Mazzucco  

E-Print Network (OSTI)

confeitaria,s/ cacau 10,12 Papel e Celulose 8,86 Produtos cerâmicos 7,04 Vidros e suas obras 5,6 Calçados e e peles (+18,0%), Alumínio em bruto (+8,9%) Celulose (+4,7%). Máquinas e aparelhos para

Floeter, Sergio Ricardo

250

Main Title 32pt  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Tf 2 Zn(EA) 4 101 8.9 Tf 3 Fe(dEA) 6 207 13.1 Tf 2 Zn(EA) 6 341 14.6 E a of aqueous (and molten) metal salt 3-5 kcal mol -1 conductivity is low: suggests significant ion pairing...

251

Available online at www.sciencedirect.com Colloids and Surfaces B: Biointerfaces 62 (2008) 232237  

E-Print Network (OSTI)

, it is also essential that these coatings have a highly uniform surface chemistry. © 2007 Elsevier B.V. All facilities [5,6], cooling towers [7], marine surfaces [8,9], medical device surfaces [10], to name a few, is essential for taking appropri- ate measures to reduce biofouling. Once a bacterium reaches the vicinity

252

Proceedings of the Cooling Tower Technology Conference  

Science Conference Proceedings (OSTI)

The performance of cooling towers and associated systems strongly affects availability and heat rate in fossil and nuclear power plants. Twenty-four papers presented at the 2012 Cooling Tower Technology Conference, held August 89, 2012, in Pensacola, Florida, discuss research results, industry experience, and case histories of cooling tower problems and solutions. ...

2012-09-13T23:59:59.000Z

253

Total U.S. Housing Units.................................  

Gasoline and Diesel Fuel Update (EIA)

5.4 5.9 9.6 10.1 8.9 4.5 Housing Unit Characteristics Affecting Usage Adequacy of Insulation Well Insulated... 42.8 3.9 2.2 4.0 4.4 6.5...

254

Interannual Variability of the Onset of the Indian Summer Monsoon and Its Association with Atmospheric Features, El Nio, and Sea Surface Temperature Anomalies  

Science Conference Proceedings (OSTI)

The long-term mean date of the monsoon onset over Kerala (MOK) varies between 30 May and 2 June according to different estimates, with a standard deviation of 89 days. The earliest date of MOK, and the most delayed one, during the last 100 years ...

Porathur V. Joseph; Jon K. Eischeid; Robert J. Pyle

1994-01-01T23:59:59.000Z

255

Arkansas Natural Gas Prices  

U.S. Energy Information Administration (EIA) Indexed Site

11.53 11.46 11.77 1967-2012 Percentage of Total Residential Deliveries included in Prices 100.0 100.0 100.0 100.0 99.8 100.0 1989-2012 Commercial Price 10.07 11.32 10.72 8.89...

256

Alaska Natural Gas Prices  

U.S. Energy Information Administration (EIA) Indexed Site

10.23 8.89 8.77 8.47 1967-2012 Percentage of Total Residential Deliveries included in Prices 100.0 100.0 100.0 100.0 100.0 100.0 1989-2012 Commercial Price 7.57 8.66 9.51 8.78...

257

LLNL-PRES-407935 Mirror Status Workshop  

E-Print Network (OSTI)

LLNL-PRES-407935 Mirror Status Workshop September 8-9, 2008 Lawrence Berkeley National Laboratory; #12; #12; #12;LLNL-PRES-406923 Comments-9 September 2008 R. F. Post, LLNL MW08-01 #12;The Kinetic Stabilizer concept allows the use of axisymmetric

258

Colorado Natural Gas Prices  

Annual Energy Outlook 2012 (EIA)

4.43 4.71 5.65 1989-2013 Residential Price 7.00 6.79 7.05 7.22 7.61 8.89 1989-2013 Percentage of Total Residential Deliveries included in Prices 100.0 100.0 100.0 100.0 100.0...

259

Genizah MS T-S AS 153.157  

E-Print Network (OSTI)

*k T-S AS 153.157 *t Legal document *s 8.9 x 10.5; 5 lines (recto; verso is blank) *m Paper; 1 leaf; torn, holes, rubbed, stained *l Judaeo-Arabic *c Legal document. *e In the hand of ?alfon b. Manasseh....

Unknown

2011-02-24T23:59:59.000Z

260

Development of a Cummins ISL Natural Gas Engine at 1.4g/bhp-hr NOx + NMHC Using PLUS Technology: Final Report  

DOE Green Energy (OSTI)

NREL subcontractor report describes Cummins Westport, Inc.'s development of an 8.9 L natural gas engine (320 hp, 1,000 ft-lb peak torque) with CARB emissions certification of 1.4 g/bhp-hr NOx + NMHC.

Kamel, M. M.

2005-07-01T23:59:59.000Z

Note: This page contains sample records for the topic "8-89 efg 07-90" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

Polymorphisms and haplotypes in folate-metabolizing genes and risk of non-Hodgkin lymphoma  

E-Print Network (OSTI)

) in the promoter region of the thymidylate synthase gene (TYMS 3R 3 2R) and variant alleles in the cytosolic serine in the development of lymphoma.8,9 For example, in agreement with our previous findings in adultALL, the TYMS 3R

California at Berkeley, University of

262

Genomic reconstruction of Shewanella oneidensis MR-1 metabolism reveals previously uncharacterized machinery for lactate utilization  

Science Conference Proceedings (OSTI)

The ability to utilize lactate as a sole source of carbon and energy is one of the key metabolic signatures of Shewanellae, a diverse group of dissimilatory metal reducing bacteria commonly found in aquatic and sedimentary environments. Nonetheless, homology searches failed to recognize orthologs of previously described bacterial D- or L-lactate oxidizing enzymes (Escherichia coli genes dld and lldD) in any of the 13 analyzed genomes of Shewanella spp. Using comparative genomic techniques, we identified a conserved chromosomal gene cluster in Shewanella oneidensis MR-1 (locus tag: SO1522-SO1518) containing lactate permease and candidate genes for both D- and L-lactate dehydrogenase enzymes. The predicted D-LDH gene (dldD, SO1521) is a distant homolog of FAD-dependent lactate dehydrogenase from yeast, whereas the predicted L-LDH is encoded by three genes with previously unknown functions (lldEGF, SO1520-19-18). Through a combination of genetic and biochemical techniques, we experimentally confirmed the predicted physiological role of these novel genes in S. oneidensis MR-1 and carried out successful functional validation studies in Escherichia coli and Bacillus subtilis. We conclusively showed that dldD and lldEFG encode fully functional D-and L-LDH enzymes, which catalyze the oxidation of the respective lactate stereoisomers to pyruvate. Notably, the S. oneidensis MR-1 LldEFG enzyme is the first described example of a multi-subunit lactate oxidase. Comparative analysis of >400 bacterial species revealed the presence of LldEFG and Dld in a broad range of diverse species accentuating the potential importance of these previously unknown proteins in microbial metabolism.

Pinchuk, Grigoriy E.; Rodionov, Dmitry A.; Yang, Chen; Li, Xiaoqing; Osterman, Andrei L.; Dervyn, Etienne; Geydebrekht, Oleg V.; Reed, Samantha B.; Romine, Margaret F.; Collart, Frank R.; Scott, J.; Fredrickson, Jim K.; Beliaev, Alex S.

2009-02-24T23:59:59.000Z

263

Study of Isospin Correlation in High Energy Heavy Ion Interactions with the RHIC PHENIX. Final Report  

Science Conference Proceedings (OSTI)

This report describes the research work performed under the support of the DOE research grant E-FG02-97ER4108. The work is composed of three parts: (1) Visual analysis and quality control of the Micro Vertex Detector (MVD) of the PHENIX experiments carried out of Brookhaven National Laboratory. (2) Continuation of the data analysis of the EMU05/09/16 experiments for the study of the inclusive particle production spectra and multi-particle correlation. (3) Exploration of a new statistical means to study very high-multiplicity of nuclear-particle ensembles and its perspectives to apply to the higher energy experiments.

Takahashi, Y.

2003-06-08T23:59:59.000Z

264

Decade of PV Industry R and D Advances in Silicon Module Manufacturing  

DOE Green Energy (OSTI)

The US Photovoltaic (PV) industry has made significant technical advances in crystalline silicon (Si) module manufacturing through the PV Manufacturing R and D Project during the past decade. Funded Si technologies in this project have been Czochralski, cast polycrystalline, edge-defined film-fed growth (EFG) ribbon, string ribbon, and Si-film. Specific R and D Si module-manufacturing categories that have shown technical growth and will be discussed are in crystal growth and processing, wafering, cell fabrication, and module manufacturing. These R and D advancements since 1992 have contributed to a 30% decrease in PV manufacturing costs and stimulated a sevenfold increase in PV production capacity.

Symko-Davis, M.; Mitchell, R.L.; Witt, C.E.; Thomas, H.P. [National Renewable Energy Laboratory; King, R. [U.S. Department of Energy; Ruby, D.S. [Sandia National Laboratories

2001-01-18T23:59:59.000Z

265

Data:D3260d78-9f0c-4b10-ae98-953c20a50efa | Open Energy Information  

Open Energy Info (EERE)

8-9f0c-4b10-ae98-953c20a50efa 8-9f0c-4b10-ae98-953c20a50efa No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Orangeburg, South Carolina (Utility Company) Effective date: 2009/01/01 End date if known: Rate name: Small Demand Service Sector: Commercial Description: Applicable: To any customer for general power and energy purposes having demands of 50 kW and not exceeding 200 kW, or for those customers who do not otherwise meet the service criteria for any other existing rate schedule. This schedule is not applicable to breakdown, standby, supplementary, resale or shared electric service.

266

Buildings Energy Data Book: 7.4 Efficiency Standards for Commercial HVAC  

Buildings Energy Data Book (EERE)

3 3 Efficiency Standards for Commercial Air Conditioners and Heat Pumps (1) Type Cooling Capacity (Btu/hr) Category (2) Efficiency Level Small commercial package air conditioning <65,000 AC SEER = 13.0 and heating equipment (air-cooled, HP SEER = 13.0 three-phase) Single package vertical air conditioners and <65,000 AC EER = 9.0 single package vertical heat pumps, HP EER = 9.0, COP = 3.0 single-phase and three phase Single package vertical air conditioners and ≥65,000 and <135,000 AC EER = 8.9 single package vertical heat pumps HP EER = 8.9, COP = 3.0 Single package vertical air conditioners and ≥135,000 and <240,000 AC EER = 8.6 single package vertical heat pumps HP EER = 8.6, COP = 2.9 Small commercial package air-conditioning

267

" Million U.S. Housing Units"  

U.S. Energy Information Administration (EIA) Indexed Site

HC8.9 Home Appliances Characteristics by Urban/Rural Location, 2005" HC8.9 Home Appliances Characteristics by Urban/Rural Location, 2005" " Million U.S. Housing Units" ,,"Urban/Rural Location (as Self-Reported)" ,"Housing Units (millions)" "Home Appliances Characteristics",,"City","Town","Suburbs","Rural" "Total U.S.",111.1,47.1,19,22.7,22.3 "Cooking Appliances" "Conventional Ovens" "Use an Oven",109.6,46.2,18.8,22.5,22.1 "1.",103.3,44.1,17.8,21.2,20.2 "2 or More",6.2,2.1,1,1.3,1.9 "Do Not Use an Oven",1.5,1,"Q",0.2,"Q" "Most-Used Oven Fuel" "Electric",67.9,26.8,11.5,14.4,15.1 "Natural Gas",36.4,19.2,6.9,7.6,2.7

268

X-ray Imaging Workshop  

NLE Websites -- All DOE Office Websites (Extended Search)

Imaging and Spectro-microscopy: Imaging and Spectro-microscopy: the Present and the Future Stanford Synchrotron Radiation Laboratory October 8-9, 2002 Organizers: John Miao & Keith Hodgson A workshop on "X-ray Imaging and Spectro-microscopy: the Present and the Future" was held on October 8-9, 2002. This workshop, organized by John Miao (SSRL) and Keith Hodgson (SSRL) provided a forum to discuss the scientific applications of a variety of imaging and spectro-microscopic techniques, including photoemission electron microscopy (PEEM), angle resolved photoemission spectroscopy (ARPES), coherent diffraction imaging, x-ray microscopy, micro-tomography, holographic imaging, and x-ray micro-probe. Twelve invited speakers discussed the important scientific applications of these techniques, and also predicted the future scientific directions with the advance of instrumentation and x-ray sources. The workshop was well attended with over fifty registered attendees.

269

Short-Term Energy Outlook July 2013  

Gasoline and Diesel Fuel Update (EIA)

Refiner Average Crude Oil Cost 2.42 2.32 2.37 2.39 2.41 2.40 -1.2 3.7 1.3 Wholesale Gasoline Price c 2.99 3.02 3.00 2.84 2.75 2.79 -4.9 -8.9 -6.9 Wholesale Diesel Fuel Price c...

270

Percent of Industrial Natural Gas Deliveries in Utah Represented...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 8.9 8.6 9.5 2000's 10.0 10.4 13.6 13.6 19.8 19.5 20.1 14.1 12.7 12.2 2010's 12.1 12.7 11.0...

271

Report of the DOE Workshop on Hydrogen Separations and Purification  

NLE Websites -- All DOE Office Websites (Extended Search)

Energy Energy Bringing you a prosperous future where energy is clean, abundant, reliable and affordable Report of the DOE Workshop on Hydrogen Separations and Purification September 8-9, 2004 Arlington, VA U.S. Department of Energy Office of Hydrogen, Fuel Cells & Infrastructure Technologies CONTENTS INTRODUCTION ...............................................................................................1 Background ................................................................................................................. 1 Current Hydrogen Separation Technology .................................................................. 2 Hydrogen Membrane Separation Technologies .......................................................... 3 HYDROGEN MEMBRANE SEPARATION PERFORMANCE TARGETS.........................6

272

Table 12. U.S. Refiner Reformulated Motor Gasoline Prices by Grade and Sales Type  

Gasoline and Diesel Fuel Update (EIA)

January ....................... - - - - - - - - - - - - February ..................... - - - - - - - - - - - - March .......................... - - - - - - - - - - - - April ............................ - - - - - - - - - - - - May ............................. - - - - - - - - - - - - June ............................ - - - - - - - - - - - - July ............................. - - - - - - - - - - - - August ........................ - - - - - - - - - - - - September .................. - - - - - - - - - - - - October ....................... - - - - - - - - - - - - November ................... 77.9 77.7 72.6 60.3 58.7 65.2 89.8 89.5 77.9 69.0 - 75.4 December ................... 76.4 75.7 72.0 56.7 53.3 63.7 87.8 87.2 77.0 62.5 W 72.6 1994 ...............................

273

Herzig, P.M., Humphris, S.E., Miller, D.J., and Zierenberg, R.A. (Eds.), 1998 Proceedings of the Ocean Drilling Program, Scientific Results, Vol. 158  

E-Print Network (OSTI)

.1 10.1 0.1 m2 Alaskan tundra Fox (1985) Pocket gopher mound 10.2 8.9 0.5 m2 old field (Minnesota, USA mound 2.1 1.5 1 m2 Florida (USA) sandhill forest Kaczor and Hartnett (1990) Ant mound 7.8 5.0 n.a. Paspalum vaginautm grassland, spring Lewis et al. (1991) Ant mound 7.3 4.5 n.a. Paspalum vaginatum

274

Abstract Performance of the CMS Pixel Detector at an upgraded LHC  

E-Print Network (OSTI)

The CMS experiment will include a pixel detector for pattern recognition and vertexing. It will consist of three barrel layers and two endcaps on each side, providing three space-points up to a pseudorapidity of 2.1. Taking into account the expected limitations of its performance in the LHC environment an 8-9 layer pixel detector for an upgraded LHC is discussed.

R. Horisberger; D. Kotli?ski; T. Rohe

2005-01-01T23:59:59.000Z

275

Financial Automated Management Environment Kimberly D. Barnes and Michael R. Leuze  

E-Print Network (OSTI)

.89 Morgantown $1.36 $1.28 $8.47 Pittsburgh, PA $1.49 $1.32 $8.89 Washington, DC $1.69 $1.53 $9.46 New York,559,174 Washington, DC 138.5 115.1 218.9 101.9 107.1 103.2 102.5 5,358,130 Third Quarter 2009 * ACCRA pricing

276

Average Residential Price  

U.S. Energy Information Administration (EIA) Indexed Site

3.08 13.89 12.14 11.39 11.03 10.71 1967-2012 Alabama 18.14 18.30 18.12 15.79 15.08 16.20 1967-2012 Alaska 8.68 8.72 10.23 8.89 8.77 8.47 1967-2012 Arizona 17.21 17.60 17.65 15.87...

277

Process for producing peracids from aliphatic hydroxy carboxylic acids  

DOE Patents (OSTI)

A process for producing peracids from lactic acid-containing solutions derived from biomass processing systems comprising: adjusting the pH of the solution to about 8-9 and removing alkaline residue fractions therefrom to form a solution comprised substantially of lower aliphatic hydroxy acids; oxidizing the solution to produce volatile lower aliphatic aldehydes; removing said aldehydes as they are generated; and converting said aldehydes to peracids.

Chum, Helena L. (Arvada, CO); Ratcliff, Matthew A. (Lakewood, CO); Palasz, Peter D. (Lakewood, CO)

1986-01-01T23:59:59.000Z

278

Comparison of geoelectric and seismic reection models of the Zambezi Valley basins, northern Zimbabwe  

E-Print Network (OSTI)

time 0-1 1-2 2-3 3-4 4-5 5-6 6-7 7-8 8-9 9-10 Ttl Spp Ttl Hours 2) BEIGE: West Coast, Karoo and Western ___ Karoo Eremomela0626 1 ___ Karoo Chat0566 5 ___ Karoo Korhaan0220 2 ___ Karoo Lark0461 4 ___ Karoo Long-billed Lark4127 7 ___ Karoo Prinia4139 9 ___ Karoo Scrub-Robin0583 8 ___ Karoo Thrush1104 2 ___ Kelp Gull0287

279

doi:10.1144/SP324.19 2009; v. 324; p. 287-306Geological Society, London, Special Publications  

E-Print Network (OSTI)

time 0-1 1-2 2-3 3-4 4-5 5-6 6-7 7-8 8-9 9-10 Ttl Spp Ttl Hours 2) BEIGE: West Coast, Karoo and Western ___ Denham's Bustard0219 6 ___ Karoo Korhaan0220 2 ___ Blue Korhaan0223 5 ___ African Jacana0228 8-coloured Lark0459 8 ___ Sabota Lark0460 7 ___ Karoo Lark0461 4 ___ Large-billed Lark0463 0 ___ Spike-heeled Lark

Schmid, Stefan M.

280

Please cite this article in press as: Coney, L. et al., Geochemical and mineralogical investigation of the PermianTriassic boundary in the continental realm of the southern Karoo Basin, South Africa, Palaeoworld (2007), doi:10.1016/j.palwor.2007.05.003  

E-Print Network (OSTI)

time 0-1 1-2 2-3 3-4 4-5 5-6 6-7 7-8 8-9 9-10 Ttl Spp Ttl Hours 2) BEIGE: West Coast, Karoo and Western ___ Karoo Korhaan0220 2 ___ Blue Korhaan0223 5 ___ Blue Crane0216 5 ___ Red-chested Flufftail0205 4-billed Crombec0621 7 ___ #12;Yellow-bellied Eremomela0600 8 ___ Karoo Eremomela0626 1 ___ Little Rush-Warbler0609

Vajda, Vivi

Note: This page contains sample records for the topic "8-89 efg 07-90" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Table 12. U.S. Refiner Reformulated Motor Gasoline Prices by...  

Annual Energy Outlook 2012 (EIA)

- - - - November ... 77.9 77.7 72.6 60.3 58.7 65.2 89.8 89.5 77.9 69.0 - 75.4 December ... 76.4 75.7 72.0 56.7 53.3 63.7 87.8 87.2 77.0 62.5 W 72.6...

282

Carbon, oxygen and their interaction with intrinsic point defects in solar silicon ribbon material. Annual report, September 1982-September 1983  

DOE Green Energy (OSTI)

This report first provides some background information on intrinsic point defects, and on carbon and oxygen in silicon in so far as it may be relevant for the efficiency of solar cells fabricated from EFG ribbon material. We discuss the co-precipitation of carbon and oxygen and especially of carbon and silicon self interstitials. A simple model for the electrical activity of carbon-self-interstitial agglomerates is presented. We assume that the self-interstitial content of these agglomerates determines their electrical activity and that both compressive stresses (high self-interstitial content) and tensile stresses (low self-interstitial content) give rise to electrical activity of the agglomerates. The self-interstitial content of these carbon-related agglomerates may be reduced by an appropriate high-temperature treatment and enhanced by a supersaturation of self-interstitials generated during formation of the p-n junction of solar cells. It is suggested that oxygen present in supersaturation in carbon-rich silicon may be induced to form SiO/sub 2/ precipitates by self-interstitials generated during phosphorus diffusion. It is proposed that the SiO/sub 2/-Si interface of the precipates gives rise to a continuum of donor states and that these interface states are responsible for at least part of the light-enhancement effects observed in oxygen containing EFG silicon after phosphorus diffusion.

Goesele, U.; Ast, D.G.

1983-10-01T23:59:59.000Z

283

Electromigration process for the purification of molten silicon during crystal growth  

DOE Patents (OSTI)

A process for the purification of molten materials during crystal growth by electromigration of impurities to localized dirty zones. The process has particular applications for silicon crystal growth according to Czochralski techniques and edge-defined film-fed growth (EFG) conditions. In the Czochralski crystal growing process, the impurities are electromigrated away from the crystallization interface by applying a direct electrical current to the molten silicon for electromigrating the charged impurities away from the crystal growth interface. In the EFG crystal growth process, a direct electrical current is applied between the two faces which are used in forming the molten silicon into a ribbon. The impurities are thereby migrated to one side only of the crystal ribbon. The impurities may be removed or left in place. If left in place, they will not adversely affect the ribbon when used in solar collectors. The migration of the impurity to one side only of the silicon ribbon is especially suitable for use with asymmetric dies which preferentially crystallize uncharged impurities along one side or face of the ribbon.

Lovelace, Alan M. Administrator of the National Aeronautics and Space (San Pedro, CA); Shlichta, Paul J. (San Pedro, CA)

1982-01-01T23:59:59.000Z

284

C:\Forms\DOE F 3330.1.cdr  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

30.1 30.1 (07-90) Name, Address and Telephone Number of Registering Office Name of Registrant Repromotion consideration (grade and pay retention eligible). Repromotion consideration (ineligible for grade and pay retention). Reemployment consideration based on: separation through reduction in force; or full or partial recovery from a compensable injury or illness after more than one year. Mandatory reemployment based on: service with a public international organization; a Letter of Authority; the Foreign Assistance Act; statutory reemployment; full recovery from a compensable illness or injury within one year; military service; or reserve service Recovery disability annuitant. Special consideration program. Mandatory corrective or remedial action. Failure to satisfactorily complete supervisory or managerial probationary period.

285

C:\Forms\HQ F 3305.7.cdr  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

305.7 305.7 (07-90) U.S. DEPARTMENT OF ENERGY Applicant Name: Thank you for applying for consideration for our Senior Executive Service vacancy of: Your application was received in our office postmarked on Although you were found to meet the basic qualifications required for this position, we regret to inform you that another candidate has been selected for this position. The competitive process for filing this position has been cancelled due to: Your application could not be forwarded for competitive consideration because: Your interest in employment with the Department of Energy is appreciated and we regret that our response to you could not be favorable for this particular vacancy. The noncompetitive reassignment or transfer of a current Senior Executive Service (SES) employee

286

United States Government Department  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

B.89) B.89) EFO (07-90) United States Government Department of Energ Memorandum SEP 24 20t DATE: REPLY TO: IG-34 (A04TG032) Audit Report No.: OAS-L-04-21 SUBJECT: Evaluation of "The Federal Energy Regulatory Commission's Cyber Security Program - 2004" TO: Chairman, Federal Energy Regulatory Commission The purpose of this report is to inform you of the results of our annual evaluation of the Federal Energy Regulatory Commission's unclassified cyber security program. This evaluation was initiated in June 2004 and our field work was conducted through September 2004. The evaluation methodology is described in the attachment to this report. Introduction and Objective The Commission's increasing reliance on information technology (IT) is consistent with satisfying the President's Management Agenda initiative of expanding electronic

287

C:\Forms\DOE F 1512.3.cdr  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

12.3 12.3 (05-90) (Formerly DOE F 5638.2) EFG (05-90) All Other Editions Are Obsolete U.S. DEPARTMENT OF ENERGY 1. NAME OF TRAVELER: (Last, first, middle) (Include maiden name if married) 2. ACCESS AUTHORIZATION: 3. RELATIVES RESIDING IN SENSITIVE COUNTRIES: (Including in-laws) (Name-relationship-address-citizenship) 4. ANALYSIS: 5. TRAVELER HAS BEEN INFORMED OF: PRIVACY ACT INFORMATION STATEMENT Collection of the information requested is authorized by the Atomic Energy Act of 1954, as amended, Chapter 12, Control of Information. The information on the form will be used to review the proposed travel plan to determine if it may endanger either the security of the atomic energy program, or the personal safety of the traveler. Disclosure of the information on the form is voluntary.

288

I-J  

Office of Legacy Management (LM)

.8 .8 I-J EFG (07-W) United States Government m e m o randum (J 1' 7& - 1 Department of Energy REPLY TO AITN OF: EM-421 (W. A. W illiams, 903-8149) SUBJECT: Authorization for Remedial Action at B&T Metals in Columbus, Ohio TO: L. Price, OR The B&T Metals facility, located at 425 West Town Street in Columbus, Ohio, is hereby designated for inclusion in the Formerly Utilized Sites Remedial Action Program (FUSRAP). This designation is based on the results of a radiological survey and conclusions from an authority review as noted in the attached Designation Summary. Copies of the preliminary radiological survey report and authority determination are provided for information. The site has been assigned a low priority under the FUSRAP protocol. The

289

United States Government Department of Energy  

Office of Legacy Management (LM)

-. -. (8-29) EFG (07-W) United States Government Department of Energy m e m o randum DATE: b; zl3 REPLY TO Al-I-N OF: EM-421 (W. A. W illiams, 903-8149) ion of the Southern Research Institute, Birmingham, A SUBJECT: Eliminat labama TO: The F ile I have reviewed the attached site summary and elimination recommendation for the Southern Research Institute. I have determined that the activities at the site were licensed under the Atomic Energy Act and that the site is thereby disqualified from further consideration under the Department of Energy's Formerly Utilized Sites Remedial Action Program (FUSRAP). Based on the above, the Southern Research Institute is hereby eliminated from further consideration under FUSRAP. W . Alexander W illiams, PhD Designation and Certification Manager

290

REPLY TO AlTN OF: W-421 (W. A. W  

Office of Legacy Management (LM)

QOEF 13254 QOEF 13254 i.3891 EFG iO7W United- states Government bemoranduin DATE: f-!uG 3, 9 19g4 REPLY TO AlTN OF: W-421 (W. A. W illiams, 427-1719) SUBJECT: Elimination of the Sites from Program the Formerly Utilized Sites Remedial Action To' The File In 1990, with the assistance of Mr. reviewed a number of sites that had services to the Fernald facility as . _ Doug Tonkay and Us. Michelle Landis, I formerly provided goods and/or subcontractors. For 24 of .these B. . sites, recoaaaendations were made to ellrlnate them from further consideration under Fomerly Utilized Sites Remedial Action Program (FUSRAP). In each case, I made or reviewed the evaluation, and, in each case, a handwritten evaluation was prepared. This is to provide a more formal record of the decision on these sites and to ratify and confirm the

291

STATEMENT OF CONSIDERATIONS PETITION FOR ADVANCE WAIVER OF PATENT RIGHTS BY ASE  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

ASE ASE AMERICAS, INC., UNDER NREL SUBCONTRACT NO. NREL-ZAX-8- 17647-10 UNDER PRIME CONTRACT NO. DE-AC02-83CH10093; W(A)-98-013; CH-0978 The Petitioner, ASE Americas, has requested a waiver of domestic and foreign patent rights for all subject inventions arising from its participation under the above referenced subcontract. The subcontract is entitled "PVMaT Cost Reductions in the EFG High Volume Manufacturing Line." The Photovoltaic Manufacturing Technology (PVMaT) project was initiated in FY 1991 to assist U.S. industry in the improvement of module manufacturing processes and the substantial reduction of module manufacturing cost. During this particular subcontract, Petitioner will address the PVMaT goals of PV module cost reduction and improved PV module manufacturing process

292

Change Notice for DOE-STD-3013-2000  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

18-891 18-891 EFG 107-9OJ United States Government Department of Energy memorandum aEPLY To ATTN OF: EM-21 (T. Kiess, (301) 903-1446; G. Roberson, (505) 845-5805) SUBJECT: Change Notice for Authorization of a Procedural Allowance to Rocky Flats Environmental Technology Site To: Richard Serbu, Office of Nuclear Safety Policy and Standards, EH-3 1 This memorandum provides a "Change Notice," required by the Department of Energy (DOE) Technical Standards Program Procedures document, "Maintenance of DOE Technical Standards" (DOE-TSPP-9, Rev. 5). The addendum to this memorandum describes a procedural allowance to the Rocky Flats Environmental Technology Site. This allowance is a lmm modification to the 126mm diameter specification in Section 6.2.2, item 3, of DOE-STD-3013. This Inn-n modification

293

December 17, 1998 Memo, Incentives for the Department's Facility Representative Program  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

mE mE F 1325.8 (a89) EFG (U7-W) United States Government Department of Energy memorandum DATE: December 17, 1998 REPLY TO ATTN OF: FM- 10(J. Hassenfeldt, 202 586-1643) SUBJECT Incentives for the Department's Facility Representative Program TO:Distribution The Department's Revised Implementation Plan for Defense Nuclear Facilities Safety Board Recommendation 93-3 has once again underscored the Department's commitment to maintaining the technical capability necessary to safely manage and operate our defense nuclear facilities. Attracting and retaining highly qualified employees and placing them in our critical technical positions is vital to fi.dfilling this commitment. You have identified 95'% of your Facility Representative positions as critical technical positions. The Office of Field Management has noted a 12'?40 annual attrition rate of Facility Representatives

294

D"E(:pa  

Office of Legacy Management (LM)

e e D"E(:pa . EFG (0744 United States Government .;,~&ljy gb' /fq Department of Eneigy memorandum JUN 4 1992 DATE: REPLY TO ATTN OF: EM-421 (W. A. Williams, 903-8149) SUBJECT: Authority Determination -- Springdale, Pennsylvania Former C. H. Schnoor & Company facility, TO: The File The attached review documents the basis for determining whether DOE has authority for taking remedial action at the former C. H. Schnoor & Company facility in Springdale, Pennsylvania, under the Formerly Utilized Sites Remedial Action Program (FUSRAP). The facility was used for the shaping of uranium by the Manhattan Engineer District (MED) during the Second World War. The following factors are significant in reaching a decision and are discussed in more detail in the attached authority review:

295

WQl  

Office of Legacy Management (LM)

WQl WQl . EFG@po) United States Government m e m o randum 1 WL-i)p-I j&J p-j/: lhpartIn6;t 0 A--E new - 7; (._./ DATE: OCT 0 8 19% REPLY TO ATTN OF: EM-421 (W. A. W illiams, 903-8149) SUBJECT: Authorization for Remedial Action at the Former Diamond Magnesium Facility, Painesville, O h io TO: Manager, DOE Oak Ridge F ield O ffice This is to notify you that the Former Diamond Magnesium Facility in Painesville, O h io, is designated for remedial action under the Formerly Utilized Sites Remedial Action Program (FUSRAP). This notification does not constitute a FUSRAP baseline change control approval. Approval of the baseline change will be accomplished through the normal baseline change control procedures. The site apparently became contaminated with uranium ore and uranium

296

. United States Government  

Office of Legacy Management (LM)

,:n5.5.8 ,:n5.5.8 ,849, EfG pw, . United States Government DATE: AUG 2 i994 y#J;; EM-421 (W. A. Williams, 427-1719) sUBJECT: -Elimination of the Robbins & Myers Site, Springfield, Ohio 11179 I The File TO: I have reviewed the attached elimination recommendation and the original historical records for the Myers & Robbins facility in Springfield, Ohio. I have determined that there is little likelihood of radioactive contamination at these sites. The only record of activity at this site by Department of Energy predecessors is an equipment test of a pump in March 1975. This test involved limited amounts of radioactive materials and there was a serious effort to decontaminate the equipment at the conclusion of the tests. Based on the above, the Myers & Robbins site in Springfield, Ohio, is

297

QA. J I-3 - Ukited States Government  

Office of Legacy Management (LM)

lmEFl&25.a . lmEFl&25.a . EFG (QWO) * QA. J I-3 - Ukited States Government memorandum Department of Energy p&j ' ;A DATE: OCT 0 8 1992 REPLY TO AlT' N OF: EM-421 (W. A. Williams, 903-8149) r/7.1\ SUBJECT: Authorization for Remedial Action at the Former C. H. Schnoor & Company Site, Springdale, Pennsylvania TO: Manager, DOE Oak Ridge Field Office This is to notify you that the former C. H. Schnoor & Company facility in Springdale, Pennsylvania, is designated for remedial action under the Formerly Utilized Sites Remedial Action Program (FUSRAP). This notification does not constitute a FUSRAP baseline change control approval. Approval of the baseline change will be accomplished through the normal baseline change control procedures. The site was used by the former Manhattan Engineer District for the

298

W89,  

Office of Legacy Management (LM)

W89, W89, EFG ,cl,.oo) IL. 3a- vI., Uhiied States Government memorandum ~ DATE: AUG 1 2 1991. r+@- REPLY TO ** Al-m OF: EM-421 (J. Wagoner, 3-8147d*/ SUEJECT: Elimination of the Ordnance Plant Site - TO: The File I have reviewed the attached site summary and elimination recommendat for the Kankakee Ordnance Plant Site in Kankakee, Illinois. I have determined that there is little likelihood of radioactive contaminati this site. Based on the above, the Kankakee Ordnance Plant Site is hereby elimin from further consideration under the Formerly Utilized Sites Remedial Action Program. W. fiexander Williams, PhO Designation and Certification Manager, Off-Site Branch Division of Eastern Area Programs Office of Environmental Restoration Attachment - - I ,a1 . I

299

Silicon solar cell process development, fabrication and analysis. Phase II. Annual report, 1 July 1979-30 June 1980  

DOE Green Energy (OSTI)

Solar cells were fabricated from EFG (RH) ribbons from multiple dies, silicon on ceramic (SOC), dendritic web, cast silicon by HEM, and semi-continuous CZ from both VARIAN and HAMCO. Baseline and improved solar cells were made from the sheets. Baseline solar cells processed in both Phase I and Phase II, involving cells from EFG, SOC, dendritic web, and HEM, indicated that no significant improvement in silicon sheet quality has been achieved in Phase II. Solar cells from semi-continuous CZ showed cell performance close to the conventional CZ control cells, although the cells from the semi-continuous CZ have shown wider performance range because of variation in crystalline perfection. Generally, process upgrading provided improvement in cell performance, the improvement depending on the process used and the quality of the sheet silicon. Study of the effect of grain size on solar cell performance suggested that the minimum grain size to make solar cells of 10% AMO efficiency is about 500 ..mu..m, which is expected to provide minimum module efficiency of 10% AMI. If other harmful impurities are added in the process of sheet growth, the minimum grain size must be increased. The BSF study showed that the higher the resistivity of the starting substrates, the greater the relative improvement in cell performance, probably because of greater shift in Fermi levels at the back L/H junction (pp+) and also because of the higher initial values of minority carrier diffusion length. This study also suggested that proper control of the back-surface field (BSF) process could minimize the junction shunting problems often introduced by the BSF processing.

Yoo, H.I.; Iles, P.A.; Ho, F.F.; Leung, D.C.

1980-01-01T23:59:59.000Z

300

Defect behavior of polycrystalline solar cell silicon  

DOE Green Energy (OSTI)

The major objective of this study, conducted from October 1988 to September 1991, was to gain an understanding of the behavior of impurities in polycrystalline silicon and the influence of these impurities on solar cell efficiency. The authors studied edge-defined film-fed growth (EFG) and cast poly-Si materials and solar cells. With EFG Si they concentrated on chromium-doped materials and cells to determine the role of Cr on solar cell performance. Cast poly-Si samples were not deliberately contaminated. Samples were characterized by cell efficiency, current-voltage, deep-level transient spectroscopy (DLTS), surface photovoltage (SPV), open-circuit voltage decay, secondary ion mass spectrometry, and Fourier transform infrared spectroscopy measurements. They find that Cr forms Cr-B pairs with boron at room temperature and these pairs dissociate into Cr{sub i}{sup +} and B{sup {minus}} during anneals at 210{degrees}C for 10 min. Following the anneal, Cr-B pairs reform at room temperature with a time constant of 230 h. Chromium forms CrSi{sub 2} precipitates in heavily contaminated regions and they find evidence of CrSi{sub 2} gettering, but a lack of chromium segregation or precipitation to grain boundaries and dislocations. Cr-B pairs have well defined DLTS peaks. However, DLTS spectra of other defects are not well defined, giving broad peaks indicative of defects with a range of energy levels in the band gap. In some high-stress, low-efficiency cast poly-Si they detect SiC precipitates, but not in low-stress, high-efficiency samples. SPV measurements result in nonlinear SPV curves in some materials that are likely due to varying optical absorption coefficients due to locally varying stress in the material.

Schroder, D.K.; Park, S.H.; Hwang, I.G.; Mohr, J.B.; Hanly, M.P. [Arizona State Univ., Tempe, AZ (US). Center for Solid State Electronics Research

1993-05-01T23:59:59.000Z

Note: This page contains sample records for the topic "8-89 efg 07-90" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

Buildings Energy Data Book: 3.9 Educational Facilities  

Buildings Energy Data Book (EERE)

4 4 Energy Benchmarks for Existing Large Hotels, by Selected City and End-Use (thousand Btu per square foot) IECC Post Pre Post Pre Post Pre Post Pre Miami 1A 1.4 0.1 155.0 142.0 30.1 29.4 8.9 11.2 Houston 2A 7.1 1.9 119.9 117.9 38.1 37.1 8.8 10.8 Phoenix 2B 4.5 1.1 113.2 111.5 33.5 32.7 9.1 11.4 Atlanta 3A 13.1 3.8 91.3 88.5 45.7 44.6 8.8 10.5 Los Angeles 3B 3.1 0.7 77.5 74.9 44.3 43.1 8.9 10.4 Las Vegas 3B 7.4 2.2 78.9 83.0 39.0 38.0 9.0 11.2 San Francisco 3C 8.0 2.6 48.8 49.6 50.8 49.5 8.7 10.0 Baltimore 4A 20.8 6.9 82.8 74.4 51.8 50.5 8.8 10.1 Albuquerque 4B 13.7 5.4 51.3 54.8 50.6 49.4 9.1 10.9 Seattle 4C 18.2 6.4 46.7 40.4 54.9 53.5 8.9 9.9 Chicago 5A 29.1 9.7 71.1 63.4 57.1 55.6 8.8 9.6 Boulder 5B 20.5 8.0 47.6 44.8 56.8 55.4 9.0 10.1 Minneapolis 6A 37.2 12.6 67.5 59.8 61.6 60.1 8.8 9.6 Helena 6B 30.3 11.5 43.4 37.9 62.5 60.9 9.0 9.8 Duluth 7 45.5 15.9 51.3 40.6 69.2 67.4 8.9 9.3 Fairbanks 8 74.5 24.3

302

Released: August 2009  

U.S. Energy Information Administration (EIA) Indexed Site

5 Relative Standard Errors for Table 3.5;" 5 Relative Standard Errors for Table 3.5;" " Unit: Percents." ,,,,,,,,"Waste",," " ,,,"Blast",,,"Pulping Liquor",,"Oils/Tars" "NAICS",,,"Furnace/Coke",,"Petroleum","or","Wood Chips,","and Waste" "Code(a)","Subsector and Industry","Total","Oven Gases","Waste Gas","Coke","Black Liquor","Bark","Materials" ,,"Total United States" , 311,"Food",9.1,"X",25,"X","X",6,55.6 3112," Grain and Oilseed Milling",8.9,"X",47.4,"X","X",0,0 311221," Wet Corn Milling",0,"X",0,"X","X",0,"X"

303

Table 22. Energy Intensity, Projected vs. Actual Projected  

U.S. Energy Information Administration (EIA) Indexed Site

Energy Intensity, Projected vs. Actual Energy Intensity, Projected vs. Actual Projected (quadrillion Btu / real GDP in billion 2005 chained dollars) 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 AEO 1994 11.2 11.1 11.0 10.8 10.7 10.5 10.4 10.3 10.1 10.0 9.9 9.8 9.7 9.6 9.5 9.4 9.3 9.2 AEO 1995 10.9 10.8 10.6 10.4 10.3 10.1 10.0 9.9 9.8 9.6 9.5 9.4 9.3 9.2 9.1 9.1 9.0 AEO 1996 10.7 10.6 10.4 10.3 10.1 10.0 9.8 9.7 9.6 9.5 9.4 9.3 9.2 9.2 9.1 9.0 8.9 AEO 1997 10.3 10.3 10.2 10.1 9.9 9.8 9.7 9.6 9.5 9.4 9.3 9.2 9.2 9.1 9.0 8.9 AEO 1998 10.1 10.1 10.1 10.0 9.9 9.8 9.7 9.6 9.5 9.5 9.4 9.3 9.2 9.1 9.0 AEO 1999 9.6 9.7 9.7 9.7 9.6 9.4 9.3 9.1 9.0 8.9 8.8 8.7 8.6 8.5 AEO 2000 9.4 9.4 9.3 9.2 9.1 9.0 8.9 8.8 8.7 8.7 8.6 8.5 8.4 AEO 2001 8.7 8.6 8.5 8.4 8.3 8.1 8.0 7.9 7.8 7.6 7.5 7.4

304

Percent of Industrial Natural Gas Deliveries in Indiana Represented by the  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2001 15.1 14.0 7.1 7.1 4.2 3.7 5.2 1.0 5.5 8.3 6.6 10.2 2002 8.4 8.1 10.1 6.4 5.3 6.2 5.3 5.9 6.6 12.5 12.6 12.4 2003 14.2 12.9 8.9 7.2 7.0 5.9 6.2 5.7 9.3 6.2 11.3 9.3 2004 9.2 8.9 8.9 6.9 6.4 6.2 6.9 6.5 7.3 7.9 10.4 11.6 2005 9.8 7.7 9.6 5.8 6.3 5.5 5.5 6.7 8.2 8.2 10.6 8.9 2006 8.2 9.3 7.4 4.3 7.0 5.0 6.4 5.9 6.3 8.2 8.3 8.4 2007 9.3 9.4 5.8 7.6 6.1 5.5 6.0 5.0 6.9 6.8 9.5 9.1 2008 8.4 7.5 7.0 6.7 5.5 4.5 4.7 4.7 5.3 9.1 8.4 7.6 2009 8.6 8.5 5.3 6.3 7.1 6.2 6.8 5.0 6.2 7.8 6.8 8.1 2010 7.5 6.4 5.7 5.4 4.1 4.4 4.6 4.3 5.0 4.7 5.5 6.3 2011 4.5 4.8 4.8 3.5 3.4 3.2 3.5 2.2 2.5 2.4 3.1 4.0

305

Microsoft Word - Sensing Workshop_Summary Notes.docx  

NLE Websites -- All DOE Office Websites (Extended Search)

Stakeholder Workshop for Advanced Sensing in Fossil Energy Applications Stakeholder Workshop for Advanced Sensing in Fossil Energy Applications Summary of Poster Notes from Roundtable Discussions May 8-9, 2010 Funding identified as need/barrier:  Funding shortfall and advocate support during technology transition from proof of principle or scale-up demonstrations into commercialization or full-scale plant demonstrations  Some funding and some testing; enough long-term & real environments to get industry support  Leverage funding with industry to support transition  More funding to provide value to industry - 53% of power make them better with better measurement  Funding from small business perceptive

306

2011 Alkaline Membrane Fuel Cell Workshop Final Report  

SciTech Connect

A workshop addressing the current state-of-the-art in alkaline membrane fuel cells (AMFCs) was held May 8-9, 2011, at the Crystal Gateway Marriott in Arlington, Virginia. This workshop was the second of its kind, with the first being held December 11-13, 2006, in Phoenix, Arizona. The 2011 workshop and associated workshop report were created to assess the current state of AMFC technology (taking into account recent advances), investigate the performance potential of AMFC systems across all possible power ranges and applications, and identify the key research needs for commercial competitiveness in a variety of areas.

Pivovar, B.

2012-02-01T23:59:59.000Z

307

Identification of unique reciprocal and non reciprocal cross packaging relationships between HIV-1, HIV-2 and SIV reveals an efficient SIV/HIV-2 lentiviral vector system with highly favourable features for in vivo testing and clinical usage  

E-Print Network (OSTI)

, transduction of neural stem cells with lentiviral and adeno associated viral vectors express- ing therapeutic genes that will affect differentiation and Gag-Pol packaging constructsFigure 1 Gag-Pol packaging constructs. gag Poly ApolLTR vpx vprvif rev tat ?Env... (1153bp) ?? ? ? gag Poly A polCMV rev tat ?Env ?? HIV-1 Gag-Pol ?8.9 (2nd Generation) gag LTRpolLTR vpx vprvif rev tat nef ?Env (550bp) ?? ? ? RRE RRE RRE SIV Gag-Pol (SgpDelta2) Gag-Pol packaging constructs HIV-2 Gag-PolPage 2 of 14 (page number...

Strappe, Padraig M; Hampton, David W; Brown, Douglas; Gonzales, Begona-cachon; Caldwell, Maeve; Fawcett, James W; Lever, Andrew M L

2005-09-16T23:59:59.000Z

308

Rediness Review Team Member Training  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MEMBER MEMBER TRAINING Idaho National Engineering Laboratory Michael Hillman DOE HQ - HSS Idaho National Engineering Laboratory Dan M. Stover, PE Technical And Professional Services, Inc. 47 James Habersham Blvd Beaufort, SC 29906 Official DOE Team Member Readiness Review Training November 8-9, 2010 Module 1 Module 1 READINESS REVIEW TEAM MEMBER TRAINING Introduction & Course Conduct Readiness Review Readiness Review Official DOE Team Member Readiness Review Training November 2010 TRAINING READINESS REVIEW TEAM MEMBER TRAINING Purpose of this Course Provide Prospective Readiness Review Team members h with: * An understanding of the background behind the Readiness Review Process; e e ocess; * Training in the mechanics of performance and reporting of

309

New Vision front  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

4 4 United States Department of Energy Office of Electric Transmission and Distribution . . NATIONAL ELECTRIC DELIVERY TECHNOLOGIES ROADMAP Transforming the Grid to Revolutionize Electric Power in North America Transforming the Grid to Revolutionize Electric Power in North America Transforming the Grid to Revolutionize Electric Power in North America Transforming the Grid to Revolutionize Electric Power in North America United States Department of Energy Office of Electric Transmission and Distribution . . Based on the Results of the National Electric Delivery Technologies Roadmap Workshop Washington, DC July 8-9, 2003 January 2004 NATIONAL ELECTRIC DELIVERY TECHNOLOGIES ROADMAP - DESIGNING "GRID 2030" ARCHITECTURE - - DEVELOPING CRITICAL TECHNOLOGIES -

310

RomanowiczFrenchRev.pptx  

NLE Websites -- All DOE Office Websites (Extended Search)

and Calibration of Mantle Structure at and Calibration of Mantle Structure at Global and Regional Scales Using
 Full-Waveform Seismic Tomography" Scott French! sfrench@seismo.berkeley.edu! Romanowicz Group! Berkeley Seismological Laboratory! UC Berkeley! NERSC BES Requirements for 2017! October 8-9, 2013! Gaithersburg, MD! Present and Future Computing Requirements Seismological Laboratory Berkeley University of California Project Description! PI: Prof. Barbara Romanowicz Berkeley Seismological Laboratory, UC Berkeley; Institute de Physique du Globe de Paris, Paris, France; Collège de France, Paris, France 1 / 8 1000 km Deep mantle Ocean Hawaii Marquesas Tahiti Samoa Pitcairn Macdonald Hotspot volcanic islands North Seismic shear-wave velocity

311

BigHorn Home Improvement Center Energy Performance: Preprint  

SciTech Connect

This is one of the nation's first commercial building projects to integrate extensive high-performance design into a retail space. The extensive use of natural light, combined with energy-efficient electrical lighting design, provides good illumination and excellent energy savings. The reduced lighting loads, management of solar gains, and cool climate allow natural ventilation to meet the cooling loads. A hydronic radiant floor system, gas-fired radiant heaters, and a transpired solar collector deliver heat. An 8.9-kW roof-integrated photovoltaic (PV) system offsets a portion of the electricity.

Deru, M.; Pless, S.; Torcellini, P.

2006-04-01T23:59:59.000Z

312

Snap: Robust Tool for Internet-wide Operating System Fingerprinting  

E-Print Network (OSTI)

Different approaches have been developed for TCP/IP fingerprinting, but none of these approaches is suited for Internet-wide fingerprinting. In this work, we develop approaches that rigorously tackle the issue of noise and packet loss while carrying out Internet-wide fingerprinting. We then carry out an Internet-wide scan to determine the distribution of different operating systems on the Internet. The results of our scan indicate that there are approximately 8.9 million publicly accessible web-servers on the Internet running Linux, while there are nearly 9.6 million web-servers with different embedded operating systems.

Nandwani, Ankur Bharatbhushan

2010-12-01T23:59:59.000Z

313

BigHorn Home Improvement Center Energy Performance: Preprint  

DOE Green Energy (OSTI)

This is one of the nation's first commercial building projects to integrate extensive high-performance design into a retail space. The extensive use of natural light, combined with energy-efficient electrical lighting design, provides good illumination and excellent energy savings. The reduced lighting loads, management of solar gains, and cool climate allow natural ventilation to meet the cooling loads. A hydronic radiant floor system, gas-fired radiant heaters, and a transpired solar collector deliver heat. An 8.9-kW roof-integrated photovoltaic (PV) system offsets a portion of the electricity.

Deru, M.; Pless, S.; Torcellini, P.

2006-04-01T23:59:59.000Z

314

The Industry/Utility Interface - An Overview  

E-Print Network (OSTI)

For many years, starting in the Jate forties, a number of different factors combined to make self-generation of electrical energy cost-prohibitive except for a few very large users of electrical service. The nation's utilities were virtually a true monopoly. An annual growth rate of electrical energy consumption of 8-9% per year, the continuing availability of increasingly larger and larger, more efficient generating units, coupled with fuel prices of less than 25c per million BTU'S, perpetuated this monopoly up into the mid-seventies.

Hamilton, D. E.

1990-06-01T23:59:59.000Z

315

The molecular basis for recognition of bacterial ligands at equine TLR2, TLR1 and TLR6  

E-Print Network (OSTI)

of syndromes from reduced performance in young racing thoroughbreds to life-threatening sepsis in neo- nates [8,9]. Equine peripheral blood mononuclear cells (PBMC) stimulated with the TLR2/1 ligand Pam3CSK4 produce tumour necrosis factor-? (TNF-?), and LTA... (Thermo Scientific), according to the following recipe: 18.25 ?L nuclease-free water, 2.5 ?L 5 Phusion HF buf- fer, 0.5 ?L 10 mM dNTP, 1.25 ?L 10 ?M forward primer, 1.25 ?L 10 ?M reverse primer, 2 ?L first-strand cDNA template and 0.25 ?L Phusion HF DNA...

Irvine, Katherine L; Hopkins, Lee J; Gangloff, Monique; Bryant, Clare E

2013-07-04T23:59:59.000Z

316

Plans for a Neutron EDM Experiment at SNS  

E-Print Network (OSTI)

The electric dipole moment of the neutron, leptons, and atoms provide a unique window to Physics Beyond the Standard Model. We are currently developing a new neutron EDM experiment (the nEDM Experiment). This experiment, which will be run at the 8.9 A Neutron Line at the Fundamental Neutron Physics Beamline (FNPB) at the Spallation Neutron Source (SNS) at the Oak Ridge National Laboratory, will search for the neutron EDM with a sensitivity two orders of magnitude better than the present limit. In this paper, the motivation for the experiment, the experimental method, and the present status of the experiment are discussed.

Takeyasu M. Ito

2007-02-10T23:59:59.000Z

317

Flying lemurs - the "flying tree shrews"? Molecular cytogenetic evidence for a Scandentia-Dermoptera sister clade  

E-Print Network (OSTI)

evidence such as shared signatures pro- vided by chromosomal rearrangements. Cross-species chromosome painting [25,26] is a powerful method for investigating the evolution of genome organ- izations. This method enables (1) the rapid and reliable... . variegatus chromosomes (GVA8+9 and 16+17), the other two regions each contained three G. var- iegatus chromosomes (GVA18+19+20 and 24+25+26). A complete set of G. variegatus chromosome-specific paints except for the Y was generated. Reciprocal painting...

Nie, Wenhui; Fu, Beiyuan; O'Brien, Patricia C M; Wang, Jinhuan; Su, Weiting; Tanomtong, Alongklod; Volobouev, Vitaly; Ferguson-Smith, Malcolm A; Yang, Fengtang

2008-05-01T23:59:59.000Z

318

Modelling Anisothermal Recrystallization in Austenitic Stainless Steels  

E-Print Network (OSTI)

?RT=T?S^_RN?:=T9WY?V#17;;>=I?T?CJ3E?RTD#19;JK\\:?K9_E?E>EFRN9_9U?KElPX?A^G8:\\:9UJeHS9_=/D#19;\\:H?;>?KJKOdDM?d??YM?K]A`A? H:9U\\A?:O?;>Y5?K f_gM?#19;?Mi ????|?*?X?h?*??X?*?*??LB?B?2??L???Ǎ*`??F????I=?#15;g?fl?Əg???L?#14;???2?F?:?h?L...

Hopkin, Gareth John

2002-05-28T23:59:59.000Z

319

Percent of Industrial Natural Gas Deliveries in Illinois Represented...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2001 14.3 14.6 11.7 8.9 7.1 6.7 5.8 6.1 7.5 8.7 10.3 12.1 2002 11.2 11.2 11.1 10.3 7.6 7.2 3.9 5.4 6.6 9.4 10.7 12.6 2003 13.4...

320

Illinois Share of Total U.S. Natural Gas Delivered to Consumers  

Gasoline and Diesel Fuel Update (EIA)

9.12 9.2 9.5 9.2 8.7 8.9 1993-2011 Commercial 6.93 6.7 7.1 7.1 6.4 6.8 1993-2011 Industrial 3.77 3.8 4.0 3.8 4.1 4.0 1993-2011 Vehicle Fuel 1.14 1.0 0.9 0.9 1.0 1.0 1993-2011...

Note: This page contains sample records for the topic "8-89 efg 07-90" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

FOCUSING HORN SYSTEM FOR THE BNL VERY LONG BASELINE NEUTRINO OSCILLATION EXPERIMENT.  

SciTech Connect

This paper describes the focusing horn system for the proposed very long baseline neutrino oscillation experiment using a neutrino beam from BNL to an underground facility such as the Homestake Mine in South Dakota. The proposed experiment uses a 1 MW upgraded AGS. In order to achieve this performance the AGS will operate with a cycle time of 2.5 Hz and 8.9 x 10{sup 13} protons on target at 28 GeV. This paper discusses the design criteria of a horn system necessary to handle this intense beam and the optical geometry to achieve the desired flux distribution at the detector.

KAHN,S.A.CARROLL,A.DIWAN,M.V.GALLARDO,J.C.KIRK,H.SCARLETT,C.SIMOS,N.VIREN,B.ZHANG,W.

2003-05-12T23:59:59.000Z

322

Buildings Energy Data Book: 1.4 Environmental Data  

Buildings Energy Data Book (EERE)

Carbon Dioxide Emissions for U.S. Buildings, by Year (Million Metric Tons) (1) Buildings U.S. Site Growth Rate Buildings % Buildings % Fossil Electricity Total 2010-Year Total of Total U.S. of Total Global 1980 630 933 1562 - 4723 - 33% 8.5% 1981 586 945 1531 - 4601 - 33% 8.4% 1982 585 938 1523 - 4357 - 35% 8.4% 1983 566 959 1524 - 4332 - 35% 8.4% 1984 584 990 1575 - 4561 - 35% 8.2% 1985 569 1026 1595 - 4559 - 35% 8.2% 1986 558 1033 1592 - 4564 - 35% 8.0% 1987 566 1077 1642 - 4714 - 35% 8.0% 1988 597 1134 1731 - 4939 - 35% 8.2% 1989 601 1149 1749 - 4983 - 35% 8.1% 1990 566 1190 1756 - 5039 - 35% 8.1% 1991 575 1199 1774 - 4996 - 36% 8.3% 1992 586 1191 1777 - 5093 - 35% 8.3% 1993 598 1261 1859 - 5185 - 36% 8.6% 1994 593 1273 1866 - 5258 - 35% 8.6% 1995 592 1298 1890 - 5314 - 36% 8.5% 1996 629 1352 1982 - 5501 - 36% 8.7% 1997 611 1405 2016 - 5575 - 36% 8.7% 1998 562 1483 2044 - 5622 - 36% 8.9% 1999 585 1497 2082 - 5682 - 37% 8.9% 2000

323

O:\Data_Publication\Prime Supplier Report\historical\2006\10\ventura\c007.vp  

U.S. Energy Information Administration (EIA) Indexed Site

Jul '07 to Aug '07: +8.9% Jul '07 to Aug '07: +8.9% Aug '06 to Aug '07: +1.6% YTD '06 to YTD '07: +2.2% U.S. Residual Fuel Sales 500 600 700 800 900 1,000 1,100 1,200 Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Millions of Gallons 2005 2006 2007 Adjusted Growth Rates* Jul '07 to Aug '07: +3.9% Aug '06 to Aug '07 -3.7% YTD '06 to YTD '07: +8.7% U.S. Kerosene-Type Jet Fuel Sales 1,500 1,600 1,700 1,800 1,900 2,000 2,100 2,200 Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Millions of Gallons 2005 2006 2007 Adjusted Growth Rates* Jul '07 to Aug '07: +3.8% Aug '06 to Aug '07: +2.9% YTD '06 to YTD '07: +2.0% U.S. Motor Gasoline Sales 8,000 9,000 10,000 11,000 12,000 13,000 Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Millions of Gallons 2005 2006 2007 Adjusted Growth Rates* Jul '07 to Aug '07: +2.5% Aug '06 to Aug '07: -0.1% YTD '06 to YTD '07: +0.4%

324

EIA - State Nuclear Profiles  

Gasoline and Diesel Fuel Update (EIA)

Washington profile Washington profile Washington total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 1,097 3.6 9,241 8.9 Coal 1,340 4.4 8,527 8.2 Hydro and Pumped Storage 21,495 70.5 68,342 66.0 Natural Gas 3,828 12.6 10,359 10.0 Other 1 - - 354 0.3 Other Renewable1 2,703 8.9 6,617 6.4 Petroleum 15 * 32 * Total 30,478 100.0 103,473 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable. * = Absolute percentage less than 0.05.

325

Toyota_RAV4.PDF  

NLE Websites -- All DOE Office Websites (Extended Search)

1999 Inductive version tested. 1999 Inductive version tested. Test Date: June 1999 / Revised: 10/07/99 1999 TOYOTA RAV4-EV* (NIMH BATTERIES) PERFORMANCE CHARACTERIZATION SUMMARY ELECTRIC TRANSPORTATION DIVISION Urban Range (On Urban Pomona Loop - see other side for map) Payload (lb) 92.8 89.5 84.8 Range Without Aux. loads With Aux. loads Maximum 760 Minimum 160 UR1 UR2 UR3 UR4 68.9 Test UR1 UR2 UR3 UR4 Payload (lb.) 160 160 766 766 AC kWh Recharge 31.80 33.96 32.72 32.22 AC kWh/mi. 0.329 0.394 0.360 0.434 Range (mi.) 92.8 84.8 89.5 68.9 Avg. Ambient Temp. 68.5°F 75.3°F 80.0°F 87.0°F Note: A/C fluctuating and may have impacted A/C tests. UR1 Urban Range Test, Min Payload, No Auxiliary Loads UR2 Urban Range Test, Min Payload, A/C on High, Headlights on Low, Radio On UR3 Urban Range Test, Max Payload, No Auxiliary Loads UR4

326

EIA - State Nuclear Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Washington profile Washington profile Washington total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 1,097 3.6 9,241 8.9 Coal 1,340 4.4 8,527 8.2 Hydro and Pumped Storage 21,495 70.5 68,342 66.0 Natural Gas 3,828 12.6 10,359 10.0 Other 1 - - 354 0.3 Other Renewable1 2,703 8.9 6,617 6.4 Petroleum 15 * 32 * Total 30,478 100.0 103,473 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable. * = Absolute percentage less than 0.05.

327

Data:Bb8a0468-9c87-4e1f-860e-ddb5532a3d32 | Open Energy Information  

Open Energy Info (EERE)

8-9c87-4e1f-860e-ddb5532a3d32 8-9c87-4e1f-860e-ddb5532a3d32 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Polk County Rural Pub Pwr Dist Effective date: 2012/01/01 End date if known: Rate name: Large Power - CYC 2/REV 6 - Demand >1000 kVA Sector: Industrial Description: Source or reference: Illinois State University #10 Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>

328

Application of a Hough search for continuous gravitational waves on data from the 5th LIGO science run  

E-Print Network (OSTI)

We report on an all-sky search for periodic gravitational waves in the frequency range $\\mathrm{50-1000 Hz}$ with the first derivative of frequency in the range $-8.9 \\times 10^{-10}$ Hz/s to zero in two years of data collected during LIGO's fifth science run. Our results employ a Hough transform technique, introducing a $\\chi^2$ test and analysis of coincidences between the signal levels in years 1 and 2 of observations that offers a significant improvement in the product of strain sensitivity with compute cycles per data sample compared to previously published searches. Since our search yields no surviving candidates, we present results taking the form of frequency dependent, 95$%$ confidence upper limits on the strain amplitude $h_0$. The most stringent upper limit from year 1 is $1.0\\times 10^{-24}$ in the $\\mathrm{158.00-158.25 Hz}$ band. In year 2, the most stringent upper limit is $\\mathrm{8.9\\times10^{-25}}$ in the $\\mathrm{146.50-146.75 Hz}$ band. This improved detection pipeline, which is computationally efficient by at least two orders of magnitude better than our flagship Einstein$@$Home search, will be important for "quick-look" searches in the Advanced LIGO and Virgo detector era.

The LIGO Scientific Collaboration; The Virgo Collaboration; J. Aasi; J. Abadie; B. P. Abbott; R. Abbott; T. Abbott; M. R. Abernathy; T. Accadia; F. Acernese; C. Adams; T. Adams; R. X. Adhikari; C. Affeldt; M. Agathos; N. Aggarwal; O. D. Aguiar; P. Ajith; B. Allen; A. Allocca; E. Amador Ceron; D. Amariutei; R. A. Anderson; S. B. Anderson; W. G. Anderson; K. Arai; M. C. Araya; C. Arceneaux; J. Areeda; S. Ast; S. M. Aston; P. Astone; P. Aufmuth; C. Aulbert; L. Austin; B. E. Aylott; S. Babak; P. T. Baker; G. Ballardin; S. W. Ballmer; J. C. Barayoga; D. Barker; S. H. Barnum; F. Barone; B. Barr; L. Barsotti; M. Barsuglia; M. A. Barton; I. Bartos; R. Bassiri; A. Basti; J. Batch; J. Bauchrowitz; Th. S. Bauer; M. Bebronne; B. Behnke; M. Bejger; M. G. Beker; A. S. Bell; C. Bell; I. Belopolski; G. Bergmann; J. M. Berliner; D. Bersanetti; A. Bertolini; D. Bessis; J. Betzwieser; P. T. Beyersdorf; T. Bhadbhade; I. A. Bilenko; G. Billingsley; J. Birch; M. Bitossi; M. A. Bizouard; E. Black; J. K. Blackburn; L. Blackburn; D. Blair; M. Blom; O. Bock; T. P. Bodiya; M. Boer; C. Bogan; C. Bond; F. Bondu; L. Bonelli; R. Bonnand; R. Bork; M. Born; V. Boschi; S. Bose; L. Bosi; J. Bowers; C. Bradaschia; P. R. Brady; V. B. Braginsky; M. Branchesi; C. A. Brannen; J. E. Brau; J. Breyer; T. Briant; D. O. Bridges; A. Brillet; M. Brinkmann; V. Brisson; M. Britzger; A. F. Brooks; D. A. Brown; D. D. Brown; F. Brckner; T. Bulik; H. J. Bulten; A. Buonanno; D. Buskulic; C. Buy; R. L. Byer; L. Cadonati; G. Cagnoli; J. Caldern Bustillo; E. Calloni; J. B. Camp; P. Campsie; K. C. Cannon; B. Canuel; J. Cao; C. D. Capano; F. Carbognani; L. Carbone; S. Caride; A. Castiglia; S. Caudill; M. Cavaglia; F. Cavalier; R. Cavalieri; G. Cella; C. Cepeda; E. Cesarini; R. Chakraborty; T. Chalermsongsak; S. Chao; P. Charlton; E. Chassande-Mottin; X. Chen; Y. Chen; A. Chincarini; A. Chiummo; H. S. Cho; J. Chow; N. Christensen; Q. Chu; S. S. Y. Chua; S. Chung; G. Ciani; F. Clara; D. E. Clark; J. A. Clark; F. Cleva; E. Coccia; P. -F. Cohadon; A. Colla; M. Colombini; M. Constancio Jr.; A. Conte; R. Conte; D. Cook; T. R. Corbitt; M. Cordier; N. Cornish; A. Corsi; C. A. Costa; M. W. Coughlin; J. -P. Coulon; S. Countryman; P. Couvares; D. M. Coward; M. Cowart; D. C. Coyne; K. Craig; J. D. E. Creighton; T. D. Creighton; S. G. Crowder; A. Cumming; L. Cunningham; E. Cuoco; K. Dahl; T. Dal Canton; M. Damjanic; S. L. Danilishin; S. D'Antonio; K. Danzmann; V. Dattilo; B. Daudert; H. Daveloza; M. Davier; G. S. Davies; E. J. Daw; R. Day; T. Dayanga; G. Debreczeni; J. Degallaix; E. Deleeuw; S. Delglise; W. Del Pozzo; T. Denker; T. Dent; H. Dereli; V. Dergachev; R. T. DeRosa; R. De Rosa; R. DeSalvo; S. Dhurandhar; M. Daz; A. Dietz; L. Di Fiore; A. Di Lieto; I. Di Palma; A. Di Virgilio; K. Dmitry; F. Donovan; K. L. Dooley; S. Doravari; M. Drago; R. W. P. Drever; J. C. Driggers; Z. Du; J. C. Dumas; S. Dwyer; T. Eberle; M. Edwards; A. Effler; P. Ehrens; J. Eichholz; S. S. Eikenberry; G. Endroczi; R. Essick; T. Etzel; K. Evans; M. Evans; T. Evans; M. Factourovich; V. Fafone; S. Fairhurst; Q. Fang; S. Farinon; B. Farr; W. Farr; M. Favata; D. Fazi; H. Fehrmann; D. Feldbaum; I. Ferrante; F. Ferrini; F. Fidecaro; L. S. Finn; I. Fiori; R. Fisher; R. Flaminio; E. Foley; S. Foley; E. Forsi; N. Fotopoulos; J. D. Fournier; S. Franco; S. Frasca; F. Frasconi; M. Frede; M. Frei; Z. Frei; A. Freise; R. Frey; T. T. Fricke; P. Fritschel; V. V. Frolov; M. -K. Fujimoto; P. Fulda; M. Fyffe; J. Gair; L. Gammaitoni; J. Garcia; F. Garufi; N. Gehrels; G. Gemme; E. Genin; A. Gennai; L. Gergely; S. Ghosh; J. A. Giaime; S. Giampanis; K. D. Giardina; A. Giazotto; S. Gil-Casanova; C. Gill; J. Gleason; E. Goetz; R. Goetz; L. Gondan; G. Gonzlez; N. Gordon; M. L. Gorodetsky; S. Gossan; S. Gossler; R. Gouaty; C. Graef; P. B. Graff; M. Granata; A. Grant; S. Gras; C. Gray; R. J. S. Greenhalgh; A. M. Gretarsson; C. Griffo; P. Groot; H. Grote; K. Grover; S. Grunewald; G. M. Guidi; C. Guido; K. E. Gushwa; E. K. Gustafson; R. Gustafson; B. Hall; E. Hall; D. Hammer; G. Hammond; M. Hanke; J. Hanks; C. Hanna; J. Hanson; J. Harms; G. M. Harry; I. W. Harry; E. D. Harstad; M. T. Hartman; K. Haughian; K. Hayama; J. Heefner; A. Heidmann; M. Heintze; H. Heitmann; P. Hello; G. Hemming; M. Hendry; I. S. Heng; A. W. Heptonstall; M. Heurs; S. Hild; D. Hoak; K. A. Hodge; K. Holt; T. Hong; S. Hooper; T. Horrom; D. J. Hosken; J. Hough; E. J. Howell; Y. Hu; Z. Hua; V. Huang; E. A. Huerta; B. Hughey; S. Husa; S. H. Huttner; M. Huynh; T. Huynh-Dinh; J. Iafrate; D. R. Ingram; R. Inta; T. Isogai; A. Ivanov; B. R. Iyer; K. Izumi; M. Jacobson; E. James; H. Jang; Y. J. Jang; P. Jaranowski; F. Jimnez-Forteza; W. W. Johnson; D. Jones; D. I. Jones; R. Jones; R. J. G. Jonker; L. Ju; Haris K; P. Kalmus; V. Kalogera; S. Kandhasamy; G. Kang; J. B. Kanner; M. Kasprzack; R. Kasturi; E. Katsavounidis; W. Katzman; H. Kaufer

2013-11-11T23:59:59.000Z

329

Percent of Industrial Natural Gas Deliveries in Iowa Represented by the  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2001 9.5 10.3 7.4 5.5 6.3 3.3 6.0 4.5 5.4 7.8 10.9 9.9 2002 8.5 5.3 8.3 6.1 4.9 5.4 5.4 5.2 5.6 10.4 12.8 10.2 2003 10.3 8.9 9.3 6.7 5.2 6.0 5.5 5.6 6.3 8.8 10.6 9.1 2004 10.4 8.9 8.8 5.7 4.9 5.3 4.0 4.8 5.1 8.4 16.2 12.9 2005 11.8 9.6 9.8 7.7 7.8 8.0 8.8 8.3 9.1 11.5 12.5 10.7 2006 10.3 9.5 9.6 6.1 7.4 6.4 5.7 6.7 7.1 9.4 11.9 10.2 2007 8.9 8.1 6.4 6.1 5.8 5.2 4.2 5.0 5.8 6.6 7.0 7.5 2008 7.9 6.5 5.8 5.0 6.0 5.0 4.6 5.0 5.1 7.2 9.1 10.2 2009 6.9 7.2 6.4 4.7 4.3 4.6 4.5 4.4 4.3 7.3 9.4 10.2 2010 9.3 7.6 5.7 4.9 4.2 4.3 4.4 5.5 5.6 5.0 5.5 6.5 2011 6.5 6.5 5.5 5.3 4.6 5.1 4.2 4.4 5.9 5.6 6.2 5.8

330

Table 18. Total Delivered Commercial Energy Consumption, Projected vs. Actual  

U.S. Energy Information Administration (EIA) Indexed Site

Total Delivered Commercial Energy Consumption, Projected vs. Actual Total Delivered Commercial Energy Consumption, Projected vs. Actual Projected (quadrillion Btu) 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 AEO 1994 6.8 6.9 6.9 7.0 7.1 7.1 7.2 7.2 7.3 7.3 7.4 7.4 7.4 7.5 7.5 7.5 7.5 7.6 AEO 1995 6.9 6.9 7.0 7.0 7.0 7.1 7.1 7.1 7.1 7.1 7.2 7.2 7.2 7.2 7.3 7.3 7.3 AEO 1996 7.1 7.2 7.2 7.3 7.3 7.4 7.4 7.5 7.6 7.6 7.7 7.7 7.8 7.9 8.0 8.0 8.1 AEO 1997 7.4 7.4 7.4 7.5 7.5 7.6 7.7 7.7 7.8 7.8 7.9 7.9 8.0 8.1 8.1 8.2 AEO 1998 7.5 7.6 7.7 7.8 7.9 8.0 8.0 8.1 8.2 8.3 8.4 8.4 8.5 8.6 8.7 AEO 1999 7.4 7.8 7.9 8.0 8.1 8.2 8.2 8.3 8.4 8.5 8.6 8.7 8.8 8.9 AEO 2000 7.7 7.8 7.9 8.0 8.1 8.2 8.3 8.4 8.5 8.5 8.7 8.7 8.8 AEO 2001 7.8 8.1 8.3 8.6 8.7 8.9 9.0 9.2 9.3 9.5 9.6 9.7 AEO 2002 8.2 8.4 8.7 8.9 9.0 9.2 9.4 9.6 9.7 9.9 10.1

331

Nebraska Natural Gas % of Total Residential - Sales (Percent)  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2002 71.4 90.5 87.4 84.8 95.4 86.8 82.7 90.4 81.3 75.5 79.7 78.6 2003 80.3 93.4 87.6 91.1 95.3 94.9 87.9 80.0 95.4 69.4 78.6 80.7 2004 81.5 91.9 86.8 94.5 88.7 84.8 89.1 89.1 88.2 83.7 83.7 88.7 2005 86.1 87.2 86.3 83.0 84.5 86.5 85.0 84.4 85.5 83.9 84.3 84.1 2006 87.1 85.9 86.7 85.8 85.0 86.2 87.0 86.2 85.9 83.3 84.2 85.1 2007 84.9 87.4 89.4 86.1 87.5 86.9 88.7 85.5 83.3 77.5 76.6 83.9 2008 86.6 89.0 90.3 89.6 90.1 89.0 87.7 87.3 85.6 75.2 77.2 85.0 2009 90.2 89.1 89.1 86.8 85.8 88.1 86.7 88.8 86.4 83.6 84.6 85.4 2010 87.0 88.8 89.5 86.2 82.5 87.3 86.5 87.8 87.6 87.1 84.0 86.8 2011 87.2 88.9 89.2 86.3 86.1 86.1 87.8 89.1 86.7 86.3 83.3 86.1

332

Simulations of The Dalles Dam Proposed Full Length Spillwall  

DOE Green Energy (OSTI)

This report presents results of a computational fluid dynamics (CFD) modeling study to evaluatethe impacts of a full-length spillwall at The Dalles Dam. The full-length spillwall is being designed and evaluated as a structural means to improve tailrace egress and thus survival of juvenile fish passing through the spillway. During the course of this study, a full-length spillwall at Bays 6/7 and 8/9 were considered. The U.S. Army Corps of Engineers (USACE) has proposed extending the spillwall constructed in the stilling basin between spillway Bays 6 and 7 about 590 ft farther downstream. It is believed that the extension of the spillwall will improve egress conditions for downstream juvenile salmonids by moving them more rapidly into the thalweg of the river hence reducing their exposure to predators. A numerical model was created, validated, and applied the The Dalles Dam tailrace. The models were designed to assess impacts to flow, tailrace egress, navigation, and adult salmon passage of a proposed spill wall extension. The more extensive model validation undertaken in this study greatly improved our confidence in the numerical model to represent the flow conditions in The Dalles tailrace. This study used these validated CFD models to simulate the potential impacts of a spillwall extension for The Dalles Dam tailrace for two locations. We determined the following: (1)The construction of an extended wall (between Bays 6/7) will not adversely impact entering or exiting the navigation lock. Impact should be less if a wall were constructed between Bays 8/9. (2)The construction of a wall between Bays 6/7 will increase the water surface elevation between the wall and the Washington shore. Although the increased water surface elevation would be beneficial to adult upstream migrants in that it decreases velocities on the approach to the adult ladder, the increased flow depth would enhance dissolved gas production, impacting potential operations of the project because of water quality. A wall between Bays 8/9 should have a lesser impact as the confined spill would be across more bays and the relative flow constriction less. (3) The 405 kcfs case was used for the rapid assessment of flow conditions and hydraulic mechanisms that might be responsible for the unexpected erosion at the end of the shelf downstream of Bay 7.

Rakowski, Cynthia L.; Perkins, William A.; Richmond, Marshall C.; Serkowski, John A.

2008-02-25T23:59:59.000Z

333

NREL: TroughNet - Parabolic Trough Workshops  

NLE Websites -- All DOE Office Websites (Extended Search)

Parabolic Trough Workshops Parabolic Trough Workshops Here you'll find information about workshops and forums concerning parabolic trough technology and concentrating solar power. Also, see upcoming events on concentrating solar power. Past Workshops and Forums 2007 Parabolic Trough Technology Workshop March 8-9, 2007 Golden, CO 2007 Solar Power Tower, Dish Stirling and Linear Fresnel Technologies Workshop March 7, 2007 Golden, CO 2006 Parabolic Trough Technology Workshop February 14-16, 2006 Incline Village, NV 2004 Solar Thermal Electric International Project Development Forum July 13, 2004 Portland, OR 2003 Parabolic Trough Thermal Energy Storage Workshop February 20-21, 2003 Golden, CO 2001 Solar Energy Forum: The Power to Choose April 21-25, 2001 Washington, D.C. 2000 Parabolic Trough Technology Workshop

334

NREL: TroughNet - 2007 Parabolic Trough Technology Workshop  

NLE Websites -- All DOE Office Websites (Extended Search)

2007 Parabolic Trough Technology Workshop 2007 Parabolic Trough Technology Workshop NREL hosted a parabolic trough technology workshop on March 8-9, 2007, in Golden, Colorado. It had three goals: Exchanging technical information Collaborating on SolarPaces projects: receiver testing and dry cooling Gathering industry input on laboratory R&D directions. The workshop featured presentations on the following parabolic trough power plant topics: Current and future market vision Project developments Solar resource assessment Technology trends Molten-salt heat transfer fluids Direct steam generation Advanced tools and testing capabilities Researchers also presented a poster session on laboratory capabilities. Note: if a presentation or poster isn't listed below, NREL hasn't yet received permission or approval to post it.

335

Membranes and MEAs for Dry, Hot Operating Conditions  

NLE Websites -- All DOE Office Websites (Extended Search)

and MEA's and MEA's for Dry, Hot Operating Conditions - Kick off 1 3 Membranes and MEA's for Dry, Hot Operating Conditions DE-FG36-07GO17006 Steve Hamrock 3M Company February 13, 2007 2007 DOE HFCIT Kick-Off Meeting This presentation does not contain any proprietary or confidential information Membranes and MEA's for Dry, Hot Operating Conditions - Kick off 2 3 Overview 3 Timeline * Project start 1/1/07 * Project end 12/31/10 * 0% complete Barriers A. Durability B. Performance DOE Technical Targets (2010) * Durability w/cycling: > 5000 hrs, * Conductivity 0.1 S/cm @120ºC * Cost: $20/m 2 , Budget * Total Project funding $11.4 million - $8.9 million - DOE - $2.5 million - contractor cost share (22%) * Received in FY07: $ 0 * Case Western Reserve Univ. * Colorado School of Mines * University of Detroit Mercy

336

H2A Delivery: GH2 and LH2 Forecourt Land Areas  

NLE Websites -- All DOE Office Websites (Extended Search)

GH2 and LH2 Forecourt GH2 and LH2 Forecourt GH2 and LH2 Forecourt Land Areas Land Areas Hydrogen Delivery Analysis Meeting May 8-9, 2007 Columbia, Maryland TIAX LLC Matthew Hooks 1601 S. D Anza Blvd. hooks.matthew@TIAXLLC.com Cupertino CA, 95014 Tel. 408-517-1550 Reference: D0348 © 2007 TIAX LLC General Assumptions ƒ Forecourt stations with fewer than 6 hydrogen dispensers will have both hydrogen and gasoline dispensers on-site (6 total) ƒ Forecourt area (not including convenience store) will be allocated based on relative number of hydrogen/gasoline dispensers ƒ All stations with more than 6 hydrogen dispensers will only dispense hydrogen ƒ 100% of forecourt area (not including convenience store) will be allocated to hydrogen delivery ƒ Area allocated to hydrogen storage will be in excess of the

337

India's Energy Challenges: Illustrative Approaches to Solutions  

NLE Websites -- All DOE Office Websites (Extended Search)

India's Energy Challenges: Illustrative Approaches to Solutions India's Energy Challenges: Illustrative Approaches to Solutions Speaker(s): S. Padmanabhan Date: May 26, 2011 - 12:00pm Location: 90-3122 Seminar Host/Point of Contact: Girish Ghatikar Energy security and climate change have emerged as key global challenges in the 21st century. A low carbon development strategy is in India's interest and is not incompatible with its energy security concerns. Energy demand in India is expected to grow at an annual rate of nearly 4-5 percent over the next 10 years with projected economic growth rates of 8-9 percent. Finding adequate supplies of energy to satisfy this increased demand is a significant challenge. The Indian energy sector continues to struggle to overcome chronic energy shortages caused by a combination of low levels of

338

Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

51 - 2360 of 26,777 results. 51 - 2360 of 26,777 results. Download Solar Background Document 6 Graph illustrating solar cell production in the United States and China from 2002 to 2010. http://energy.gov/downloads/solar-background-document-6 Page Occupational Safety & Health Criteria & Review Approach Documents http://energy.gov/hss/occupational-safety-health-criteria-review-approach-documents Download Docket No. EO-05-01: Letter Documenting Department of Energy Receipt of the Mirant Potomac River Compliance Plan http://energy.gov/oe/downloads/docket-no-eo-05-01-letter-documenting-department-energy-receipt-mirant-potomac-river Download Readiness Review Training- Development of Criteria And Review Approach Documents Slides used for November 8-9, 2010 Readiness Review Training - Development

339

Energy Efficient Appliance Sales Soar in North Carolina | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Energy Efficient Appliance Sales Soar in North Carolina Energy Efficient Appliance Sales Soar in North Carolina Energy Efficient Appliance Sales Soar in North Carolina July 23, 2010 - 11:00am Addthis Joshua DeLung What does this mean for me? The program discounted 62,970 appliances. $8.8 million in Recovery Act funding spurred $64 million in retail sales. A total of $300 million in Recovery Act funding was allotted nationwide for appliance rebates. It took just eight days total for North Carolina retailers to rack up $64 million in sales of appliances under the $8.9 million American Recovery and Reinvestment Act investment through the state's Appliance Rebate Program. "In very real ways, this has stimulated our economy and moved money in North Carolina," said Seth Effron, communications director for the North

340

Total.............................................................................  

U.S. Energy Information Administration (EIA) Indexed Site

Cooking Appliances Cooking Appliances Frequency of Hot Meals Cooked 3 or More Times A Day......................................... 8.2 1.4 1.0 0.4 2 Times A Day...................................................... 24.6 5.8 3.5 2.3 Once a Day........................................................... 42.3 10.7 7.8 2.9 A Few Times Each Week...................................... 27.2 5.6 4.0 1.6 About Once a Week.............................................. 3.9 0.9 0.6 0.3 Less Than Once a Week....................................... 4.1 1.1 0.7 0.4 No Hot Meals Cooked........................................... 0.9 Q Q N Conventional Oven Use an Oven......................................................... 109.6 25.3 17.6 7.7 More Than Once a Day..................................... 8.9 1.3 0.8 0.5 Once a Day.......................................................

Note: This page contains sample records for the topic "8-89 efg 07-90" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

PSH-12-0029 - In the Matter of Personnel Security Hearing | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

29 - In the Matter of Personnel Security Hearing 29 - In the Matter of Personnel Security Hearing PSH-12-0029 - In the Matter of Personnel Security Hearing The Individual is employed by a DOE contractor in a position requiring him to hold a DOE access authorization. DOE Ex. 3. In December 2010, while on disability leave due to a medical condition, the Individual voluntarily entered an inpatient substance abuse facility to receive treatment for alcohol dependence. DOE Ex. 8. The Individual reported his treatment to his management, who in turn informed the Local Security Office (LSO). DOE Ex. 10 at 8-9. This potentially derogatory information prompted a March 2011 Personnel Security Interview (PSI). DOE Ex. 10. After the PSI, the LSO referred the Individual to a DOE consultant-psychiatrist ("the DOE

342

U  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

PERFORMANCE MANAGEMENT SYSTEM Revised September 28, 2011 TABLE OF CONTENTS CHAPTER 1 - GENERAL PAGE(S) 1-1 Authority and Purpose 1 1-2 Coverage 2 1-3 Exclusions 2 CHAPTER 2 - BASIC RESPONSIBILITIES 2-1 Secretarial Officers 2 2-2 Rating Officials 2-3 2-3 Higher Level Reviewing Officials 3 2-4 Members of the Senior Executive Service 3 CHAPTER 3 - ESTABLISHING THE PERFORMANCE PLAN 3-1 Performance Plan Requirements 4 3-2 Critical Elements 4-6 3-3 Performance Requirements 6 3-4 Organizational Assessment and Guidelines 6-7 CHAPTER 4 - APPRAISAL PROCESS 4-1 Appraisal Period 7 4-2 120-day Moratorium 7 4-3 Policy 8-9 4-4 Progress Review 9

343

GTT Activities | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DOE Grid Tech Team » Activities/Outreach » GTT DOE Grid Tech Team » Activities/Outreach » GTT Activities GTT Activities GTT Activities Activities To receive input and feedback on the development of the future grid vision and other GTT documents, the GTT hosts targeted workshops and meetings to inform its deliberations. 2013 HVDC Workshop, April 22 2013 ARPA-E Summit, February 25-27 2012 Transmission Workshop, November 1-2 Distribution Workshop, September 24-25 2012 ARPA-E Summit, February 27-29 2012 National Electricity Forum, February 8-9 2012 NARUC Winter Meeting, February 5-8 NARUC Webinar on Vision of the Future Grid, January 26 2011 Vision of the Future Grid Workshop, November 15-16 If you have an event that you'd like the GTT to know about or participate in, please contact us. Grid Tech Team Overview About the GTT

344

May 6, 2010, Savannah River Site Safety Training Workshop Report  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MAY o G aorn MAY o G aorn MEMORANDUM FOR JACK CRAIG MANAGER SAVANNAH RIVER sr~~ FROM: ARNOLDE.GUEVA~ DIRECTOR NATIONAL TRAINING CENTER OFFICE OF HEAL TH, SAFETY AND SECURITY SUBJECT: Savannah River Site Safety Training Workshop Report Attached please find the final report from the December 8-9, 2009 collaborative safety training workshop conducted in Savannah River Site (SRS), which was attended by key SRS federal, contractor and union representatives. We apologize for the belated delivery of this report. The report provides results and recommendations developed by workshop attendees on possible enhancements to the safety training programs across the SRS complex. It should be noted that SRS has already implemented numerous initiatives to gain

345

Summary of On-Board Storage Models and Analyses  

NLE Websites -- All DOE Office Websites (Extended Search)

On-Board Storage On-Board Storage Models and Analyses R.K. Ahluwalia, T. Q. Hua and J-K Peng Hydrogen Delivery Analysis Meeting FreedomCAR and Fuels Partnership Delivery, Storage and Hydrogen Pathways Tech Teams May 8-9, 2007 Columbia, MD 2 Objective: To determine the performance of the on-board system relative to the storage targets (capacity, efficiency, etc) 1. On-Board System Configuration 2. Dehydrogenation Reactor Dehydrogenation kinetics Trickle bed hydrodynamics Dehydrogenation reactor model Reactor performance with pelletized and supported catalysts 3. System Performance Storage efficiency Storage capacity On-Board Hydrogen Storage System with a Liquid Carrier 3 Fuel Cell System with H 2 Stored in a Liquid Carrier Enthalpy Wheel Spent H 2 Fuel cell Stack Stack Coolant

346

OpenEI Community Central | OpenEI Community  

Open Energy Info (EERE)

OpenEI Community Central OpenEI Community Central Home > OpenEI Community Central > Posts by term > OpenEI Community Central Content Group Activity By term Q & A Feeds Term: developer Type Term Title Author Replies Last Post sort icon Blog entry developer New Robust References! Jweers 1 8 Aug 2013 - 08:12 Blog entry developer Multicolor Maps from Compound Queries Jweers 16 May 2013 - 14:22 Blog entry developer New Result Formats on OpenEI Jweers 25 Mar 2013 - 12:22 Blog entry developer OpenEI maintenance March 8-9, 2013 Rmckeel 8 Mar 2013 - 14:23 Blog entry developer Current and historical incentive data available as XML! Rmckeel 11 Sep 2012 - 13:41 Groups Menu You must login in order to post into this group. Recent content Are you willing to reply to a text message once a day with information

347

Integrated Market Modeling of Hydrogen Transition Scenarios with HyTrans  

NLE Websites -- All DOE Office Websites (Extended Search)

Integrated Market Modeling of Integrated Market Modeling of Hydrogen Transition Scenarios with HyTrans Paul N. Leiby, David L. Greene and David Bowman Oak Ridge National Laboratory A presentation to the Hydrogen Delivery Analysis Meeting FreedomCAR and Fuels Partnership Delivery, Storage and Hydrogen Pathways Tech Teams May 8-9, 2007 Columbia, MD 2 OAK RIDGE NATIONAL LABORATORY U. S. DEPARTMENT OF ENERGY Drawing from several other DOE models, HyTrans integrates supply and demand in a dynamic non-linear market model to 2050. * H2A - Hydrogen Production - Hydrogen Delivery * PSAT & ASCM - Fuel economy - 2010/2015 cost & performance goals * ORNL Vehicle Choice Model - Fuel availability - Make & model diversity - Price, fuel economy, etc. * Vehicle Manufacturing Cost Estimates (assisted by OEMs)

348

NETL: Clean Coal Technology Demonstration Program (CCTDP) - Round 1  

NLE Websites -- All DOE Office Websites (Extended Search)

1 1 Industrial Applications Advanced Cyclone Combustor with Internal Sulfur, Nitrogen, and Ash Control - Project Brief [PDF-302KB] Coal Tech Corp., Williamsport, PA PROGRAM PUBLICATIONS Final Reports Demonstration of an Advanced Cyclone Coal Combustor with Internal Sulfur Nitrogen, and Ash Control for the Conversion of a 23-MMBtu/Hour Oil Fired Boiler to Pulverized Coal (Aug 1991) Volume 1: Final Technical Report [PDF-5.9MB] Appendixes I through VI [PDF-8.9MB] CCT Reports: Project Performance Summaries, Post-Project Assessments, & Topical Reports The Coal Tech Advanced Cyclone Combustor Demonstration Project -- A DOE Assessment [PDF-234KB] (May 1993) Environmental Reports Annual Environmental Report for The Demonstration of an Advanced Cyclone Coal Combustor, with Internal Sulfur, Nitrogen, and Ash Control for the Conversion of a 23 MMBtu/Hour Boiler to Coal [PDF-812KB] (Sept 1987)

349

Hydrogen Delivery Infrastructure Analysis, Options and Trade-offs, Transition and Long-term  

NLE Websites -- All DOE Office Websites (Extended Search)

Option Analysis Project Kick Off Meeting SOW, Budget, Schedule Tan-Ping Chen DOE Hydrogen Delivery Analysis and High Pressure Tanks R&D Project Review Meeting February 8-9, 2005 Argonne National Laboratory 2 Project Team Real world infrastructure project experience * Air Liquide * GTI * Nexant Technology forward looking expertise * Tiax * NREL Ultimate users to advise on H2 infrastructure path * ChevronTexaco Technology Venture (CTTV) * Pinnacle West (PW) 3 Current Gas Station Operation in US 220 million cars for 280 million people = roughly 1 car/person Gasoline dispensed per station = 2,000 gallons/d Gasoline filled in the station = 8-10 gallons/car Cars pulled in per station = 200-250/d Fueling peaks at the morning and afternoon rush hours People do refueling close to home and work place

350

Microsoft PowerPoint - ATLAS_upgrade_physics_program  

NLE Websites -- All DOE Office Websites (Extended Search)

Guy Savard Guy Savard Argonne National Laboratory and University of Chicago Science with the ATLAS Efficiency and Intensity Upgrade ATLAS Users Meeting August 8-9 2009 2 G. Savard 2009 ATLAS S&T Review May 18-19, 2009 Outline Evolving landscape for low-energy nuclear physics Self-assessment of ATLAS present and near future program Process followed to evaluate near and longer term physics program needs and role in community Option proposed - Physics - Machine - Instrumentation 3 G. Savard 2009 ATLAS S&T Review May 18-19, 2009 The new landscape: what is coming to a town near us ---- FRIB ---- At full power - Fast beams - Reaccelerated beams at a few % of that Starts operating ~ 2017-18

351

C:EFHFRONT.PDF  

Office of Legacy Management (LM)

600/P-95/002Fa 600/P-95/002Fa August 1997 VOLUME I - GENERAL FACTORS EXPOSURE FACTORS HANDBOOK Update to Exposure Factors Handbook EPA/600/8-89/043 - May 1989 Office of Research and Development National Center for Environmental Assessment U.S. Environmental Protection Agency Washington, DC 20460 Page Exposure Factors Handbook ii August 1997 DISCLAIMER This document has been reviewed in accordance with U.S. Environmental Protection Agency policy and approved for publication. Mention of trade names or commercial products does not constitute endorsement or recommendation for use. Exposure Factors Handbook Page August 1997 iii CONTENTS Page No. VOLUME I 1. INTRODUCTION . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1-1 1.1. PURPOSE . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

352

ARM - Events Article  

NLE Websites -- All DOE Office Websites (Extended Search)

19, 2011 [Events] 19, 2011 [Events] 2011 Far-Infrared Remote Sensing Workshop Bookmark and Share The 2011 Workshop on Far-Infrared Remote Sensing (FIRS) will be held in Madison, Wisconsin, on November 8-9, 2011. The two-day meeting will include invited speakers, a full poster session, time for discussions, and a workshop dinner. Topics to be discussed include: instrumentation, radiative transfer model development and validation, thermodynamic profiling, cloud property remote sensing, and climate studies. Attendees are invited to participate in the workshop by submitting a poster presentation. There are a limited number of oral presentation positions available; these will be selected from the submitted poster presentations. Registration deadline is October 6, 2011. For program and registration information, visit the workshop

353

Total.............................................................................  

U.S. Energy Information Administration (EIA) Indexed Site

Cooking Appliances Cooking Appliances Frequency of Hot Meals Cooked 3 or More Times A Day......................................... 8.2 1.2 1.0 0.2 2 Times A Day...................................................... 24.6 4.0 2.7 1.2 Once a Day........................................................... 42.3 7.9 5.4 2.5 A Few Times Each Week...................................... 27.2 6.0 4.8 1.2 About Once a Week.............................................. 3.9 0.6 0.5 Q Less Than Once a Week....................................... 4.1 0.6 0.4 Q No Hot Meals Cooked........................................... 0.9 0.3 Q Q Conventional Oven Use an Oven......................................................... 109.6 20.3 14.9 5.4 More Than Once a Day..................................... 8.9 1.4 1.2 0.3 Once a Day.......................................................

354

TableHC9.1.xls  

U.S. Energy Information Administration (EIA) Indexed Site

Census Region and Division Census Region and Division Northeast............................................................... 20.6 1.9 9.8 8.9 N N New England...................................................... 5.5 1.3 4.1 Q N N Middle Atlantic.................................................... 15.1 Q 5.7 8.8 N N Midwest................................................................. 25.6 6.9 12.3 6.4 N N East North Central.............................................. 17.7 4.9 9.9 3.0 N N West North Central............................................ 7.9 Q Q 3.4 N N South..................................................................... 40.7 N Q 8.5 11.5 19.9 South Atlantic..................................................... 21.7 N Q 5.8 7.0 8.0 East South Central............................................. 6.9 N N 1.8

355

Table 38. Coal Stocks at Coke Plants by Census Division  

U.S. Energy Information Administration (EIA) Indexed Site

Coal Stocks at Coke Plants by Census Division Coal Stocks at Coke Plants by Census Division (thousand short tons) U.S. Energy Information Administration | Quarterly Coal Report, April - June 2013 Table 38. Coal Stocks at Coke Plants by Census Division (thousand short tons) U.S. Energy Information Administration | Quarterly Coal Report, April - June 2013 Census Division June 30, 2013 March 31, 2013 June 30, 2012 Percent Change (June 30) 2013 versus 2012 Middle Atlantic w w w w East North Central 1,313 1,177 1,326 -1.0 South Atlantic w w w w East South Central w w w w U.S. Total 2,500 2,207 2,295 8.9 w = Data withheld to avoid disclosure. Note: Total may not equal sum of components because of independent rounding. Source: U.S. Energy Information Administration (EIA), Form EIA-5, 'Quarterly Coal Consumption and Quality Report - Coke Plants.'

356

Natural Gas Weekly Update, Printer-Friendly Version  

Gasoline and Diesel Fuel Update (EIA)

1, 2008 1, 2008 Next Release: August 7, 2008 Overview Prices Storage Other Market Trends Natural Gas Transportation Update Overview (Wednesday, July 23, to Wednesday, July 30) During the report week (Wednesday-Wednesday, July 23-30), natural gas prices declined substantially at virtually all market locations in the Lower 48 States, with most decreases ranging between 40 and 99 cents per million Btu (MMBtu). Prices in some areas in the Lower 48 States declined by well more than $1 per MMBtu. The Henry Hub spot price ended the report week at $9.01 per MMBtu, which was 88 cents or 8.9 percent lower than last Wednesday’s (July 23) price. At the New York Mercantile Exchange (NYMEX), prices for the September delivery contract declined 60 cents per MMBtu to $9.248. The

357

Energy Systems Integration | OpenEI Community  

Open Energy Info (EERE)

Groups > Groups > Energy Systems Integration Groups > Groups > Energy Systems Integration Content Group Activity By term Q & A Feeds There are no feeds from external sites for this group. Groups Menu You must login in order to post into this group. Groups Menu You must login in order to post into this group. Group members (8) Managers: Aaronbeach Recent members: Jim mcveigh Derekhogue Ads15 Marklane Qinsun Wisconsin Weatherall Windows Payne Recent content OpenEI maintenance March 8-9, 2013 Research topics related to ESI Prospects for Nuclear Power(Davis 2012) A Framework for the Optimization of Integrated Energy Systems(Jain and Alleyne 2012) Energy System Integration(Smith 2001) more Group members (8) Managers: Aaronbeach Recent members: Jim mcveigh Derekhogue Ads15 Marklane Qinsun Wisconsin Weatherall Windows Payne

358

Energy Systems Integration | OpenEI Community  

Open Energy Info (EERE)

Energy Systems Integration Energy Systems Integration Home > Features > Groups Content Group Activity By term Q & A Feeds Content type Blog entry Discussion Document Event Poll Question Keywords Author Apply Rmckeel OpenEI maintenance March 8-9, 2013 Posted by: Rmckeel 8 Mar 2013 - 14:23 We would like to inform the OpenEI community that OpenEI will be undergoing a significant software upgrade during a maintenance window this weekend. We will be upgrading the wiki and... Tags: developer, Maintenance, OpenEI Qinsun Research topics related to ESI Posted by: Qinsun 15 Nov 2012 - 13:55 · Modeling and optimization of multiple energy carriers [2-6] · ... Tags: ESI, MarketsIncentives Qinsun Prospects for Nuclear Power(Davis 2012) Posted by: Qinsun 15 Nov 2012 - 13:36 This paper analyzed the potential of nuclear power compare to other type of

359

Catalysis Workshop  

NLE Websites -- All DOE Office Websites (Extended Search)

Opportunities in Catalysis Research Using Synchrotron Radiation Opportunities in Catalysis Research Using Synchrotron Radiation Stanford Synchrotron Radiation Laboratory October 8-9, 2002 Organizer: Anders Nilsson Chemical catalysis is one of the research areas of enormous importance for the industrial society. There are important challenges to be met in the near future where development of new processes and catalysts are a necessity. We need to find a way to make methanol from methane, split water into hydrogen using sunlight, find replacement of platinum metals, etc. The fundamental understanding of many catalytic processes is still emerging and there seems to be a new opportunity with the recent development in experimental and theoretical methods. The intention of workshop was to bring researchers from many different disciplines together to discuss how synchrotron radiation can be applied to address some fundamental questions in catalysis.

360

Commercial Building Energy Asset Rating Workshop  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

BUILDING BUILDING ENERGY ASSET RATING WORKSHOP December 8-9, 2011 Washington, D.C. Nora Wang (Pacific Northwest National Laboratory) Will Gorrissen (Pacific Northwest National Laboratory) Molly McCabe (Hayden Tanner, LLC) Cody Taylor (Department of Energy) 1 I Asset Rating D.C. Workshop eere.energy.gov PRE-DECISIONAL Information included in this document is for discussion purposes and does not constitute the final program design. FOR INFORMATION ONLY 2 I Asset Rating D.C. Workshop eere.energy.gov Program Goals * Facilitate cost-effective investment in energy efficiency and reduce energy use in the commercial building sector * Establish a national standard for voluntary commercial building asset rating * Create a tool to help building owners identify and implement

Note: This page contains sample records for the topic "8-89 efg 07-90" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Total U.S.....................................................................  

U.S. Energy Information Administration (EIA) Indexed Site

4.2 4.2 7.6 16.6 Cooking Appliances Conventional Ovens Use an Oven........................................................ 109.6 23.7 7.5 16.2 1....................................................................... 103.3 22.4 6.8 15.6 2 or More.......................................................... 6.2 1.3 0.6 0.6 Do Not Use an Oven............................................ 1.5 0.5 Q 0.4 Most-Used Oven Fuel Electric.............................................................. 67.9 13.4 4.5 8.9 Natural Gas....................................................... 36.4 9.2 2.2 7.1 Propane/LPG.................................................... 5.2 1.0 0.7 0.3 Self-Cleaning Oven Use a Self-Cleaning Oven................................. 62.9 13.1 4.6 8.5 Continuous....................................................

362

Word Pro - Untitled1  

U.S. Energy Information Administration (EIA) Indexed Site

Carbon Dioxide Emissions From Energy Consumption by Sector, 1949-2011 Carbon Dioxide Emissions From Energy Consumption by Sector, 1949-2011 Residential and Commercial, by Major Source Industrial, by Major Source Transportation, by Major Source Electric Power, by Major Source 304 U.S. Energy Information Administration / Annual Energy Review 2011 1 Emissions from energy consumption in the electric power sector are allocated to the end- use sectors in proportion to each sector's share of total electricity retail sales (see Tables 8.9 and 11.2e). 2 Metric tons of carbon dioxide can be converted to metric tons of carbon equivalent by multi- plying by 12/44. 3 Includes coal coke net imports. Source: Tables 11.2a-11.2e. Retail Electricity¹ 1950 1960 1970 1980 1990 2000 2010 0 250 500 750 1,000 1,250 1,500 1,750 2,000 Million Metric Tons Carbon

363

DOE Hydrogen and Fuel Cells Program Record 9010: Benefits of Fuel Cell APU on Trucks  

NLE Websites -- All DOE Office Websites (Extended Search)

0 Date: November 3, 2009 0 Date: November 3, 2009 Title: Benefits of Fuel Cell APU on Trucks Originator: Tien D. Nguyen and Fred Joseck Approved by: Sunita Satyapal Date: November 25, 2009 Item: Approximately 700 million gallons of diesel can be saved annually through the use of fuel cell auxiliary power units (APUs) in the trucking industry, resulting in a reduction of 8.9 million metric tons of CO 2 per year. Data and Assumptions 1. Total number of trucks with sleeper berths is estimated to be 931,000 in 2030: The total number of heavy-duty freight trucks forecasted in EIA's Annual Energy Outlook 2009 is 5.21 millions in 2010, increasing to 6.93 millions in 2030. In a survey published in 2006, the American Transportation Research Institute (ATRI) received responses from

364

"Item","Full Service Providers",,,,,"Other Providers",,"Total"  

U.S. Energy Information Administration (EIA) Indexed Site

Alabama" Alabama" "Number of Entities",1,36,1,24,"NA","NA","NA",62 "Number of Retail Customers",1436229,523894,22,541977,"NA","NA","NA",2502122 "Retail Sales (thousand megawatthours)",55974,17463,5700,11725,"NA","NA","NA",90863 "Percentage of Retail Sales",61.6,19.22,6.27,12.9,"NA","NA","NA",100 "Revenue from Retail Sales (million dollars)",5076,1485,278,1236,"NA","NA","NA",8075 "Percentage of Revenue",62.86,18.39,3.44,15.31,"NA","NA","NA",100 "Average Retail Price (cents/kWh)",9.07,8.51,4.87,10.54,"NA","NA","NA",8.89

365

FY 2012 Control Table by Organization  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

2 Summary Control Table by Organization 2 Summary Control Table by Organization (dollars in thousands - OMB Scoring) FY 2010 FY 2011 FY 2011 FY 2012 Current Congressional Annualized Congressional Approp. Request CR Request $ % Discretionary Summary By Organization Department Of Energy By Organization National Nuclear Security Administration Weapons Activities * ............................................................................. 6,386,371 7,008,835 7,008,835 7,629,716 +620,881 +8.9% Defense Nuclear Nonproliferation * ...................................................... 2,131,382 2,687,167 2,136,709 2,549,492 -137,675 -5.1% Naval Reactors * ................................................................................... 945,133 1,070,486 945,133 1,153,662 +83,176 +7.8% Office of the Administrator * ................................................................. 410,754 448,267 410,754 450,060

366

Microsoft Word - Ringold Substation Upgrade CX.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1, 2011 1, 2011 REPLY TO ATTN OF: KEC-4 SUBJECT: Environmental Clearence Memorandum Myra Lovell - TELP-TPP-3 Proposed Action: Ringold Substation Structure Replacement Project Budget Information: Work Order # 00272078 Task 03 Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021: B4.6 "Additions or modifications to electric power transmission facilities..." Location: Franklin County, Washington - Township 12 North, Range 29 East, Section 26 of the Basin City Quadrangle Proposed by: Bonneville Power Administration (BPA) Description of the Proposed Action: BPA is proposing to replace the single pole structure 8/9 of the Benton-Scooteney No. 1 115-kV transmission line, the attached vertically mounted disconnect switch,

367

siteaplotm.cdr  

Office of Legacy Management (LM)

Site Site A/Plot M, Illinois, Decommissioned Reactor Site. This site is managed by the U.S. Department of Energy Office of Legacy Management. Site Description and History The Site A/Plot M decommissioned reactor site is located in the Palos Forest Preserve in Cook County, Illinois, 20 miles southwest of Chicago. The site is underlain by 100 feet of glacial till overlying dolomite bedrock. About 8.9 million people live within 50 miles of the site; the population within a 5-mile radius is about 150,000. The Site A/Plot M area is the former site of Argonne National Laboratory and its predecessor, the University of Chicago Metallurgical Laboratory, which was part of the World War II Manhattan Engineer District. In 1942, the U.S. Army Corps of Engineers leased 1,025 acres

368

United States Government Department of Energy DATE:  

Office of Legacy Management (LM)

kE FJ325.8 d& * 9 -1 kE FJ325.8 d& * 9 -1 . (8-89) ZFG fO7440 1 United States Government Department of Energy DATE: DEC 2 3 :gg3 REPLY TO ATTN OF: EM-421 (W. A. Williams, 903-8149) SUBJECT: Elimination of the Sites from the Formerly Utilized Sites Remedial Action Program TO: The File I have reviewed the attached site summaries and elimination recommendations for the following sites: e l Mitts & Merrel Co., Saginaw, Michigan l North Carolina State University, Raleigh, North Carolina l National Smelt & Refining, Cleveland, Ohio l Sutton, Steele & Steele, Dallas, Texas --------+. Norfolk Naval Station, Virginia In each case, the potential for radiological contamination above applicable guidelines is small. In each case the amounts of radioactive materials handled was small. Based on these considerations, these sites

369

OpenEI Community - Maintenance  

Open Energy Info (EERE)

maintenance maintenance March 8-9, 2013 http://en.openei.org/community/blog/openei-maintenance-march-8-9-2013  We would like to inform the OpenEI community that OpenEI will be undergoing a significant software upgrade during a maintenance window this weekend.  We will be upgrading the wiki and semantic mediawiki portions of OpenEI, which means /datasets, /apps, /lod, /sparql and /community will continue to function normally.  Additionally, web services that rely on Ask queries (utility rate database API) may have some downtime as we transition.read more

370

BERAC Meeting, February 16-17, 2012, Washington, DC| U.S. DOE Office of  

Office of Science (SC) Website

February 16-17, 2012, Washington, DC February 16-17, 2012, Washington, DC Biological and Environmental Research Advisory Committee (BERAC) BERAC Home Meetings BERAC Minutes BERAC Minutes Archive Members Charges/Reports Charter .pdf file (40KB) BER Committees of Visitors BER Home Meetings BERAC Meeting, February 16-17, 2012, Washington, DC Print Text Size: A A A RSS Feeds FeedbackShare Page BERAC Meeting February 16-17, 2012 Washington, DC Agenda .pdf file (25KB) Presentations William Brinkman, Comments from the Director, Office of Science .pdf file (24.4MB) Sharlene Weatherwax, State of BER Report .pdf file (4.3MB) Eddy Rubin, Joint Genome Institute Update .ppt file (18.0MB) Allison Campbell, Environmental Molecular Sciences Laboratory (EMSL) Update .pdf file (17.8MB) Adam Arkin, Knowledgebase Discussion .pdf file (8.9MB)

371

Meetings | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

Meetings Meetings Nuclear Science Advisory Committee (NSAC) NSAC Home Meetings Members Charges/Reports Charter .pdf file (629KB) NP Committees of Visitors NP Home Meetings Print Text Size: A A A RSS Feeds FeedbackShare Page Currently Scheduled NSAC Meetings There are currently no NSAC meetings scheduled. Please check back, future meetings will be posted here. Past Meetings | Minutes Meeting December 19, 2013 | Minutes | Webcast External link Meeting March 8-9, 2013 | Minutes .pdf file (222KB) | Webcast External link Meeting January 28-29, 2013 | Minutes .pdf file (201KB) | Webcast External link Meeting September 21, 2012 | Minutes .pdf file (387KB) | Webcast External link Meeting March 9, 2012 | Minutes .pdf file (1.3MB) | Webcast External link Meeting December 1, 2011 | Minutes .pdf file (239KB)

372

August 2006 | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

6 6 Advanced Scientific Computing Advisory Committee (ASCAC) ASCAC Home Meetings November 2013 March 2013 October 2012 August 2012 March 2012 November 2011 August 2011 March 2011 November 2010 August 2010 March 2010 November 2009 August 2009 March 2009 October 2008 August 2008 February 2008 November 2007 August 2007 February 2007 November 2006 August 2006 March 2006 April 2004 March 2003 October 2002 May 2002 October 2001 May 2001 November 2000 Members Charges/Reports Charter .pdf file (38KB) ASCR Committees of Visitors ASCR Home Meetings August 2006 Print Text Size: A A A RSS Feeds FeedbackShare Page The August 8-9, 2006, Advisory Committee Meeting was held at the American Geophysical Union (AGU), 2000 Florida Avenue in Washington, DC. * Agenda .pdf file (10KB) * Minutes .pdf file (45KB)

373

Supplement Analysis for the Transmission System Vegetation Management Program FEIS (DOE/EIS-0285/SA-70)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

(8-89) memorandum DATE: 7/19/02 REPLY TO ATTN OF: KEP-4 SUBJECT: Supplement Analysis for the Transmission System Vegetation Management Program FEIS (DOE/EIS-0285/SA-70) Bill Erickson - TFP/Walla Walla Natural Resource Specialist TO: Proposed Action: Vegetation Management on sections of the McNary-Ross, McNary-Horse Heaven, Horse Heaven-Harvarlum, Harvarlum-Big Eddy, and Hanford-John Day Transmission lines. The treatment areas are identified in Step 1 of the Planning Steps shown below. The work will involve the control of noxious weeds in the subject rights-of-ways (ROWs). Location: The ROWs are located in Umatilla and Sherman Counties, Oregon and Benton and Klickitat Counties, Washington, all being in the Walla Walla and Redmond Regions.

374

Release of DRAFT RFP Headquarters Reading Room Instructions/Guidelines  

NLE Websites -- All DOE Office Websites (Extended Search)

Release of DRAFT RFP Release of DRAFT RFP Headquarters Reading Room Instructions/Guidelines 1. Reading Room Points of Contact: 7/21 - 8/8, Mike Baehre, (202) 586-6575 8/9 - Close of Draft RFP, John Bernier, (202) 586-6416 Reading Room Availability: By Appointment - Reading Room will be available until DRAFT RFP Closes. Reading Room Hours: Morning, 9:00 a.m. - 11:30 a.m.; and Afternoon 1:00 p.m. - 3:30 p.m. Reading Room Will Accommodate: Up to 5-6 people 2. All personnel must: a. Sign-in b. Identify their Company or Firm they work for or are affiliated c. Indicate if they have a "Q" clearance 3. Personnel must stay in the Reading Room to view documents. The "A" corridor is inside a classified area and all visitors to the Reading Room must be escorted at all times.

375

"Item","Full Service Providers",,,,,"Other Providers",,"Total"  

U.S. Energy Information Administration (EIA) Indexed Site

Vermont" Vermont" "Number of Entities",3,15,"NA",2,"NA","NA","NA",20 "Number of Retail Customers",255597,54743,"NA",48338,"NA","NA","NA",358678 "Retail Sales (thousand megawatthours)",4310,787,"NA",498,"NA","NA","NA",5595 "Percentage of Retail Sales",77.04,14.06,"NA",8.9,"NA","NA","NA",100 "Revenue from Retail Sales (million dollars)",548,113,"NA",79,"NA","NA","NA",741 "Percentage of Revenue",74.02,15.3,"NA",10.68,"NA","NA","NA",100 "Average Retail Price (cents/kWh)",12.72,14.41,"NA",15.89,"NA","NA","NA",13.2

376

Total.............................................................................  

U.S. Energy Information Administration (EIA) Indexed Site

Cooking Appliances Cooking Appliances Frequency of Hot Meals Cooked 3 or More Times A Day......................................... 8.2 2.6 0.7 1.9 2 Times A Day...................................................... 24.6 6.6 2.0 4.6 Once a Day........................................................... 42.3 8.8 2.9 5.8 A Few Times Each Week...................................... 27.2 4.7 1.5 3.1 About Once a Week.............................................. 3.9 0.7 Q 0.6 Less Than Once a Week....................................... 4.1 0.7 0.3 0.4 No Hot Meals Cooked........................................... 0.9 0.2 Q Q Conventional Oven Use an Oven......................................................... 109.6 23.7 7.5 16.2 More Than Once a Day..................................... 8.9 1.7 0.4 1.3 Once a Day.......................................................

377

Pilot testing of in situ chemical reduction to treat carbon tetrachloride  

NLE Websites -- All DOE Office Websites (Extended Search)

Pilot testing of in situ chemical reduction to treat carbon tetrachloride Pilot testing of in situ chemical reduction to treat carbon tetrachloride at a former grain storage facility in Missouri March 26, 2013 At a former grain storage facility in Missouri, EVS has initiated a pilot test of an innovative treatment using amended zero-valent iron to achieve in situ chemical reduction of carbon tetrachloride contamination. Carbon tetrachloride concentrations above regulatory levels in soil and groundwater (at 8-89 ft below ground level [BGL]) are confined to a small area of the former facility, on property that is now a county fairground. At present, the contamination poses no known risks to fairgrounds workers or visitors. The deep bedrock aquifers in the area are at minimal risk of contamination. The areas targeted for treatment in the pilot test are localized

378

RHIC Superconducting Accelerator and Electron Cooling Group  

NLE Websites -- All DOE Office Websites (Extended Search)

Organization Chart (PDF) Organization Chart (PDF) Accelerator R&D Division eRHIC R&D Energy Recovery Linac Photocathode R&D Superconducting RF Electron Cooling LARP Center for Accelerator Science and Education C-AD Accelerator R&D Division Superconducting RF Group Group Headed By: Sergey Belomestnykh This web site presents information on the Superconducting Accelerator and RHIC Electron Cooling Group, which is in the Accelerator R&D Division of the Collider-Accelerator Department of Brookhaven National Laboratory. Work is supported mainly by the Division of Nuclear Physics of the US Department of Energy. Upcoming Events: TBD Most recent events: 56 MHz 2nd External Review, March 8-9, 2011 External Review of the Energy Recovery Linac, February 17-18, 2010. Report of the Review Committee

379

Supplement Analysis for the Business Plan EIS (DOE/EIS-0183/SA-04)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

e Electronic Form Approved by CILR - 09/26/2001 e Electronic Form Approved by CILR - 09/26/2001 (8-89) memorandum DATE: May 24, 2002 REPLY TO ATTN OF: KEC-4 SUBJECT: Supplement Analysis for the Business Plan EIS (DOE/EIS-0183/SA-04) Scott Wilson - PT-5 TO: Customer Account Executive Proposed Action: Klondike Wind Project - Power Purchase Agreement, Contract Number 02PB-11093. Proposed By: Bonneville Power Administration (BPA) and Northwestern Windpower, LLC. Location: Near Wasco, Sherman County, Oregon. Description of the Proposed Action: BPA proposes to purchase 24 megawatts (MW) of wind power from the Klondike Wind Project for a term of 20 years. Analysis: The existing 24-MW Klondike Wind Project, owned and operated by Northwestern Windpower,

380

OSTI, US Dept of Energy, Office of Scientific and Technical Information |  

Office of Scientific and Technical Information (OSTI)

Using Information Diffusion Using Information Diffusion Slide01 Slide01 Presented by RL Scott Walt Warnick, Ph.D. Director, Office of Scientific and Technical Information U.S. Department of Energy Workshop: Informatics Needs for Nanomaterials exit federal site Oak Ridge, TN February 8-9, 2007 Slide02 Slide02 Three Topics Relating to Nano Info Diffusion We see three complementary approaches to improve information sharing and awareness Modeling - It's possible. Metadata - numeric data, unlike textual data, requires metadata to ensure access Stewardship - numeric data could follow model of textual STI management Slide03 Slide03 OSTI's Mission OSTI's Mission. Link to larger image. To advance science and sustain technological creativity by making R&D findings available and useful to DOE researchers and the American people.

Note: This page contains sample records for the topic "8-89 efg 07-90" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

Low-Speed Electric Vehicles: Coming to a Neighborhood Near You? |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Low-Speed Electric Vehicles: Coming to a Neighborhood Near You? Low-Speed Electric Vehicles: Coming to a Neighborhood Near You? Low-Speed Electric Vehicles: Coming to a Neighborhood Near You? October 6, 2009 - 6:00am Addthis John Lippert In an earlier job, I was a contractor supporting the Navy and Marine Corps Energy Awareness Program. Half of the ground fleet-as well as half of the personal vehicles-on one of the Navy bases I visited were electric golf carts. [See Navy Develops Green Island Program to Improve Base Life beginning on page 13. (PDF 8.9 MB). Download Adobe Reader.] Soon after my visit, the base added low-speed electric cars and trucks, also known as neighborhood electric vehicles or NEVs. I interviewed the ground transportation fleet maintenance staff and was impressed with their electric vehicle program. Though low-tech, it made good economic and

382

Residential Buildings Historical Publications reports, data and housing  

Gasoline and Diesel Fuel Update (EIA)

90 90 Average Fuel Oil/Kerosene Residential Buildings Consumption Expenditures per Total per Square per per per Total Total Floorspace Building Foot per Household per Square per Household Households Number (billion (million (thousand Household Member Building Foot Household Member Characteristics (million) (million) sq. ft.) Btu) Btu) (million Btu) (million Btu) (dollars) (dollars) (dollars) (dollars) Total U.S. Households 16.3 13.5 33.2 77 31 63.9 23 609 0.25 506 181 Census Region and Division Northeast 8.9 6.4 19.3 121 40 87.7 32 950 0.32 690 253 New England 2.5 2.1 5.9 121 43 99.0 39 956 0.34 784 307 Middle Atlantic 6.3 4.4 13.4 121 39 83.2 30 947 0.31 652 234

383

Residential Buildings Historical Publications reports, data and housing  

Gasoline and Diesel Fuel Update (EIA)

1 1 Average Fuel Oil/Kerosene Residential Buildings Consumption Expenditures per Total per Square per per per Total Total Floorspace Building Foot per Household per Square per Household Households Number (billion (million (thousand Household Member Building Foot Household Member Characteristics (million) (million) sq. ft.) Btu) Btu) (million Btu) (million Btu) (dollars) (dollars) (dollars) (dollars) Total U.S. Households 14.6 11.0 28.9 116 44 87.9 32 1,032 0.39 781 283 Census Region and Division Northeast 8.9 5.9 18.0 158 51 103.5 36 1,405 0.46 923 323 New England 2.4 1.7 5.1 148 50 105.3 36 1,332 0.45 946 327 Middle Atlantic 6.5 4.1 12.8 161 52 102.9 36 1,435 0.46 915 322

384

Southwestern Power Administration  

NLE Websites -- All DOE Office Websites (Extended Search)

2 Conference 2 Conference 2011 Conference 2009 Conference 2008 Conference 2007 Conference 2006 Conference 2010 Hydropower Conference The 2010 Regional Hydropower Council and Conference was hosted by the Little Rock District of the U.S. Army Corps of Engineers in Branson, Missouri. Click the links below to view materials from the council and conference. June 8-9, 2010, Council Skip Navigation Links 2010 Hydropower Council Agenda FY 2011 Proposed Project Packet FY 2012 Preliminary Project Packet June 9-10, 2010, Conference Skip Navigation Links 2010 Hydropower Conference Agenda AECC Hydroelectric Generation Facilities Corps - New Budget Concept Denison Turbine Rehabilitation Planning Hydrokinetic Projects on the Mississippi River Kansas City District Projects Impacting Federal Power

385

Technical Targets of the President's FreedomCAR and Hydrogen Fuel Initiative  

NLE Websites -- All DOE Office Websites (Extended Search)

Targets of the President's Targets of the President's Freedom Car and Hydrogen Fuel Initiative Arlene Anderson Technology Development Manager US Department of Energy Hydrogen, Fuel Cells & Infrastructure Technologies DOE Workshop on Hydrogen Separations and Purification Technologies September 8-9, 2004 Arlington, Virginia 10/12/2004 2 Resources to Support the President's Hydrogen Fuel Initiative $77,500 $65,187 Fuel Cell Technologies : system components, stack components, fuel processors, technology validation $29,183 $0* Basic Science : production, storage and use $832 $555 Department of Transportation : safety, codes/standards $16,000 $4,889 Coal-based Hydrogen Production : gasification, gas separation $9,000 $6,377 Nuclear-based Hydrogen Production : high temperature reactions $227,840 $158,999**

386

APS User News-at-a-Glance, Issue 32  

NLE Websites -- All DOE Office Websites (Extended Search)

2: June 29, 2005 2: June 29, 2005 Contents 1. Message from Murray: XOR Tactical Plan Evolves; Three Upgrades Chosen 2. Science Highlight: Sequence to Structure in DNA 3. New Technique Captures Submicrosecond Images Using White Beam; Work Garners Argonne Award 4. Operating Mode Changes Decided for Summer Run 5. Proposal Deadlines Approaching: July 15 6. Crystallographic Exposure: APS at ACA 7. Four Elected to APS Users Organization Steering Committee 8. 2005 Users Meeting: A Rich Sampling of Science Past, Present, and Future --Briefly Noted subscribe to News Flash from lightsources.org meeting notice: neutron macromolecular crystallography at SNS, July 12-13 meeting notice: surface and interface characterization at APS, Sept. 8-9 meeting notice: Synchrotron Environmental Science III at Brookhaven,

387

Examination Report: OAS-RA-13-18 | Department of Energy  

NLE Websites -- All DOE Office Websites (Extended Search)

8 8 Examination Report: OAS-RA-13-18 April 18, 2013 Travis County Health & Human Services and Veterans Services Weatherization Assistance Program Funds Provided by the ARRA of 2009 As part of the American Recovery and Reinvestment Act of 2009 (Recovery Act), the Weatherization Assistance Program (Weatherization Program) received $5 billion to reduce energy consumption for low-income households through energy efficient upgrades. The State of Texas received $327 million in Weatherization Program Recovery Act grant funding, of which $8.9 million was allocated to Travis County Health & Human Services and Veterans Services (Travis County) to weatherize approximately 1,060 homes. The State of Texas' Department of Housing and Community Affairs (Texas) was

388

tymesvol2no18  

NLE Websites -- All DOE Office Websites (Extended Search)

Dollars Dollars Family medical plan rate history for BWXT Y-12 hourly Costs per year 1500 1200 900 600 $764 $775 $854 $647 $854 $683 $786 $1,024 $1,111 $1,331 $868 BWX TYmes Volume 2, Number 18 A newsletter for the employees and friends of the Y-12 National Security Complex December 2002 I N S I D E 2 7 8 Talented employee 4 Safeguards and Security Sentinel YSource 3 Disaster relief efforts Pension plan performance Medical costs continue to rise Premiums required to cover 2003 employee medical costs have increased slightly more than 20 percent from 2002 to 2003. BWXT Y-12 covers 88 percent of the cost of medical insurance, and employ- ees cover 12 percent. In 2002, total medical costs for BWXT Y-12 were $44.3 million. The 20 percent increase in cost for 2003 means an $8.9 million increase for BWXT Y-12.

389

C:EFHFRONT.PDF  

NLE Websites -- All DOE Office Websites (Extended Search)

P-95/002Fa P-95/002Fa August 1997 VOLUME I - GENERAL FACTORS EXPOSURE FACTORS HANDBOOK Update to Exposure Factors Handbook EPA/600/8-89/043 - May 1989 Office of Research and Development National Center for Environmental Assessment U.S. Environmental Protection Agency Washington, DC 20460 Page Exposure Factors Handbook ii August 1997 DISCLAIMER This document has been reviewed in accordance with U.S. Environmental Protection Agency policy and approved for publication. Mention of trade names or commercial products does not constitute endorsement or recommendation for use. Exposure Factors Handbook Page August 1997 iii CONTENTS Page No. VOLUME I 1. INTRODUCTION . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1-1 1.1. PURPOSE . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

390

NIST's Advanced Technology Program  

NLE Websites -- All DOE Office Websites (Extended Search)

NIST's Advanced NIST's Advanced Technology Program NIST's Advanced Technology Program DOE Workshop on Hydrogen Separation and Purification Technologies Arlington, VA, Sept. 8-9, 2004 Jason Huang 301-975-4197 National Institute of Standards and Technology 100 Bureau Drive Stop 4730 Gaithersburg, MD 20899-4730 http://www.atp.nist.gov National Institute of Standards and Technology * Technology Administration * U.S. Department of Commerce ATP is part of NIST Helping America Measure Up NIST Mission ATP is part of NIST NIST Mission: Strengthen the U.S. economy and improve the quality of life by working with industry to develop and apply technology, measurements, and standards. * * * * * * 3,000 employees $771 million annual budget 2,000 field agents 1,800 guest researchers $2.2 billion co-funding of

391

Los Alamos Lab: Science Program Office, Energy Security Newsletter  

NLE Websites -- All DOE Office Websites (Extended Search)

Fossil Energy & Environment (SPO-FE) Fossil Energy & Environment (SPO-FE) SPO FE Science AEI Nuclear Fossil Energy & Environment Home Office of Science Home Alternative Energy & Infrastructure Home Civilian Nuclear Programs All Issues Summer 2006 Winter 2006 Fall 2005 Spring 2005 Summer 2006 , Volume 2, Number 2 Download the Current Issue For Print (8.9 MB PDF--clear images but slower download) For Screen Viewing (1.2 MB PDF--quick download but low-quality images) Inside this Issue: Energy Solutions from Chemistry, Life, and Earth Sciences The Dawn of a New Era for Solar Energy Carrier multiplication and quantum dots can double the efficiency of photovoltaic panels. Cellulosic Biomass A Los Alamos scientist is helping to unlock the potential of this vast renewable resource. Microdrilling Changing the way industry approaches the fossil fuel cycle, from exploration to containment of CO2 emissions.

392

OSTI, US Dept of Energy, Office of Scientific and Technical Information |  

Office of Scientific and Technical Information (OSTI)

Speeding Nano Progress Using Information Diffusion Speeding Nano Progress Using Information Diffusion Slide01 Presented by RL Scott Walt Warnick, Ph.D. Director, Office of Scientific and Technical Information U.S. Department of Energy Workshop: Informatics Needs for Nanomaterials exit federal site Oak Ridge, TN February 8-9, 2007 Speeding Nano Progress Using Information Diffusion Slide02 Three Topics Relating to Nano Info Diffusion We see three complementary approaches to improve information sharing and awareness Modeling - It's possible. Metadata - numeric data, unlike textual data, requires metadata to ensure access Stewardship - numeric data could follow model of textual STI management Speeding Nano Progress Using Information Diffusion Slide03 OSTI's Mission OSTI's Mission. Link to larger image. To advance science and sustain technological creativity by making R&D

393

Southwestern Power Administration  

NLE Websites -- All DOE Office Websites (Extended Search)

09 Meeting 09 Meeting 2008 Meeting 2007 Meeting 2006 Meeting 2010 Hydropower Meeting The 2010 Regional Hydropower Council and Meeting were hosted by the Little Rock District of the U.S. Army Corps of Engineers in Branson, Missouri. Click the links below to view materials from the council and meeting. June 8-9, 2010, Council Skip Navigation Links 2010 Hydropower Council Agenda FY 2011 Proposed Project Packet FY 2012 Preliminary Project Packet June 9-10, 2010, Meeting Skip Navigation Links 2010 Hydropower Meeting Agenda AECC Hydroelectric Generation Facilities Corps - New Budget Concept Denison Turbine Rehabilitation Planning Hydrokinetic Projects on the Mississippi River Kansas City District Projects Impacting Federal Power Little Rock District Projects Impacting Federal Hydropower

394

Renewable Energy Consumption | OpenEI  

Open Energy Info (EERE)

Consumption Consumption Dataset Summary Description Total annual renewable electricity consumption by country, 2005 to 2009 (available in Billion Kilowatt-hours or as Quadrillion Btu). Compiled by Energy Information Administration (EIA). Source EIA Date Released Unknown Date Updated Unknown Keywords EIA renewable electricity Renewable Energy Consumption world Data text/csv icon total_renewable_electricity_net_consumption_2005_2009billion_kwh.csv (csv, 8.5 KiB) text/csv icon total_renewable_electricity_net_consumption_2005_2009quadrillion_btu.csv (csv, 8.9 KiB) Quality Metrics Level of Review Peer Reviewed Comment Temporal and Spatial Coverage Frequency Time Period 2005 - 2009 License License Other or unspecified, see optional comment below Comment Rate this dataset Usefulness of the metadata

395

Utility Rate | OpenEI Community  

Open Energy Info (EERE)

Utility Rate Utility Rate Home > Utility Rate > Posts by term > Utility Rate Content Group Activity By term Q & A Feeds Term: developer Type Term Title Author Replies Last Post sort icon Blog entry developer Utility Rates API Version 2 is Live! Sfomail 17 May 2013 - 11:14 Discussion developer Utility rate change propagation is now much faster Rmckeel 1 21 Mar 2013 - 09:11 Blog entry developer OpenEI maintenance March 8-9, 2013 Rmckeel 8 Mar 2013 - 14:23 Blog entry developer Semantic Mediawiki Semantic Forms update Rmckeel 22 Oct 2012 - 07:23 Discussion developer Increasing ask query limit Rmckeel 1 28 Jun 2012 - 14:35 Groups Menu You must login in order to post into this group. Recent content FYI, OpenEI now accommodates t... Very useful information. Thank...

396

Potential Carriers and Approaches for Hydrogen Delivery  

NLE Websites -- All DOE Office Websites (Extended Search)

Carriers and Potential Carriers and Carriers and Potential Carriers and Approaches for Hydrogen Approaches for Hydrogen Delivery Delivery TIAX LLC 1601 S. D Anza Blvd. Cupertino CA, 95014 Tel. 408-517-1550 Reference: D0348 © 2007 TIAX LLC Hydrogen Delivery Analysis Meeting May 8-9, 2007 Columbia, Maryland Matthew Hooks Stefan Unnasch Stephen Lasher 1 Novel Hydrogen Carriers Project Overview Cost Density (wt. and vol.) Energy requirements Forecourt storage requirements Codes and standards H H 2 2 Plant, Liquefier, LH Plant, Liquefier, LH 2 2 storage storage H H 2 2 Tube Trailer Tube Trailer LH 2 2 Tank/ Fueling Station LH Tank/ Fueling Station The efficient delivery of hydrogen is necessary for the adoption of hydrogen as a transportation fuel, but numerous challenges must be met. 2 "Conventional" delivery options are limited by volumetric density,

397

Energy Department Sets Tougher Standards for Clothes Washers to Qualify for  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Sets Tougher Standards for Clothes Washers to Sets Tougher Standards for Clothes Washers to Qualify for the ENERGY STAR® Label Energy Department Sets Tougher Standards for Clothes Washers to Qualify for the ENERGY STAR® Label December 19, 2005 - 4:49pm Addthis WASHINGTON, DC - The U.S. Department of Energy (DOE) today announced tougher standards for clothes washers to qualify for the ENERGY STAR® label, which lets American families identify which clothes washers save the most energy and use the least water. The new standards take effect January 1, 2007, and will increase the efficiency of new clothes washers up to 37 percent. The more energy-efficient clothes washers will have the potential to save up to $70 million in energy bills and 8.9 billion gallons of water each year. "With these tougher ENERGY STAR® standards, families will be able to

398

Recovery Act Workers Complete Environmental Cleanup of Coal Ash Basin  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Site (SRS) recently cleaned up a 17- Site (SRS) recently cleaned up a 17- acre basin containing coal ash residues from Cold War operations. The American Recovery and Reinvestment Act project was safely completed at a cost of $8.9 million, $2.9 million under budget. The manmade earthen basin received ash from the former R Area Pow- erhouse operations, which ended in 1964. The first of five reactors con- structed at SRS, the R Reactor produced nuclear materials for national defense. Recovery Act funding allowed SRS to accelerate cleanup of the basin and complete the project five years earlier than the target set in a regu- latory schedule. In late 2010, the U.S. Environmental Protection Agency and South Carolina Department of Health and Environmental Control determined the closure met all regulatory requirements after inspection

399

USDA and DOE Partnership Seeks to Develop Better Plants for Bioenergy |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Partnership Seeks to Develop Better Plants for Partnership Seeks to Develop Better Plants for Bioenergy USDA and DOE Partnership Seeks to Develop Better Plants for Bioenergy September 2, 2010 - 12:00am Addthis WASHINGTON, Sept. 2, 2010 -- Energy Secretary Steven Chu and Agriculture Secretary Tom Vilsack today announced research awards under a joint DOE-USDA program aimed at improving and accelerating genetic breeding programs to create plants better suited for bioenergy production. The $8.9 million investment is part of the Obama Administration's broader effort to diversify the nation's energy portfolio and to accelerate the development of new energy technologies designed to decrease the nation's dependence on foreign oil. "Cost-effective, sustainable biofuels are crucial to building a clean energy economy," said Secretary Chu. "By harnessing the power of science

400

End of Month Working  

Gasoline and Diesel Fuel Update (EIA)

The level of gas in storage at the end of the last heating season (March The level of gas in storage at the end of the last heating season (March 31, 2000) was 1,150 billion cubic feet (Bcf), just above the 1995-1999 average of 1,139 Bcf. Underground working gas storage levels are currently about 8-9 percent below year-ago levels. In large part, this is because injection rates since April 1 have been below average. Storage injections picked up recently due to warm weather in the last half of October. The month of November is generally the last month available in the year for injections into storage. A cold November would curtail net injections into storage. If net injections continue at average levels this winter, we project that storage levels will be low all winter, reaching a level of 818 Bcf at the end of March, the lowest level since 1996

Note: This page contains sample records for the topic "8-89 efg 07-90" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

COV Response | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

COV Response COV Response High Energy Physics Advisory Panel (HEPAP) HEPAP Home Meetings Members .pdf file (20KB) Charges/Reports Charter .pdf file (44KB) HEP Committees of Visitors HEP Home Charges/Reports COV Response Print Text Size: A A A RSS Feeds FeedbackShare Page Response to Issues Raised in the April 2004 Committee of Visitor's Report to the Office of High Energy Physics Introduction This document responds to the Report of the 2004 Committee of Visitors (COV) for the Office of High Energy Physics (OHEP) which met on March 8-9, 2004, and submitted its report to the High Energy Physics Advisory Committee on April 18, 2004. The report was subsequently transmitted by HEPAP to the Director, Office of Science, on April 22, 2004. We are pleased that, based on its review of the major activities of

402

Solar: monthly and annual average global horizontal (GHI) GIS data at 10km  

Open Energy Info (EERE)

West China from DLR West China from DLR Dataset Summary Description (Abstract): Data of high resolution (10kmx10km) Global Horizontal Irradiance (GHI) for China for the years 2000, 2002 and 2003. The data are available for monthly and annual sums stored in a ESRI-Shapefile. Please read the country report for additional information. (Purpose): The data are helpful for the assessment of the solar potential of the country and can give project developer a first impression of the solar resource of the country. Source DLR - Deutsches Zentrum für Luft- und Raumfahrt Date Released October 31st, 2004 (10 years ago) Date Updated November 01st, 2007 (7 years ago) Keywords China CRED CREIA DLR GHI GIS solar SWERA UNEP Data application/zip icon Download Shapefile (zip, 4.4 MiB) text/csv icon Download Data (csv, 8.9 MiB)

403

Energy Systems Integration | OpenEI Community  

Open Energy Info (EERE)

Energy Systems Integration Energy Systems Integration Home > Groups Content Group Activity By term Q & A Feeds Share your own status updates, and follow the updates & activities of others by creating your own account. Or, remember to log in If you already have an account. Groups Menu You must login in order to post into this group. Recent content OpenEI maintenance March 8-9, 2013 Research topics related to ESI Prospects for Nuclear Power(Davis 2012) A Framework for the Optimization of Integrated Energy Systems(Jain and Alleyne 2012) Energy System Integration(Smith 2001) more Group members (8) Managers: Aaronbeach Recent members: Jim mcveigh Derekhogue Ads15 Marklane Qinsun Wisconsin Weatherall Windows Payne 429 Throttled (bot load) Error 429 Throttled (bot load) Throttled (bot load) Guru Meditation:

404

renewable electricity | OpenEI  

Open Energy Info (EERE)

electricity electricity Dataset Summary Description Total annual renewable electricity consumption by country, 2005 to 2009 (available in Billion Kilowatt-hours or as Quadrillion Btu). Compiled by Energy Information Administration (EIA). Source EIA Date Released Unknown Date Updated Unknown Keywords EIA renewable electricity Renewable Energy Consumption world Data text/csv icon total_renewable_electricity_net_consumption_2005_2009billion_kwh.csv (csv, 8.5 KiB) text/csv icon total_renewable_electricity_net_consumption_2005_2009quadrillion_btu.csv (csv, 8.9 KiB) Quality Metrics Level of Review Peer Reviewed Comment Temporal and Spatial Coverage Frequency Time Period 2005 - 2009 License License Other or unspecified, see optional comment below Comment Rate this dataset Usefulness of the metadata

405

DOE F  

Office of Legacy Management (LM)

1325.8. (8-89) EFO IO?-90) United States Government Department of Energy memorandum _._ ._, \\--C' - ,, 0, DATE: AUG 3, 9 !gg4 \c. -7 REPLY TO AlTN OF: Eli-421 (U. A. Williillas, 427-1719) SUBJECT: Elimination of the Sites from the Formerly Utilized Sites Remedial Actieu Program To' The File In 1990, with the assistance of Mr. Doug Tonkay and Ms. Michelle Landis, I reviewed a number of sites that had formerly provided goods and/or services to the Fernald facility as subcontractors. For 24 of .these sites, recomaendations were made to eliminate them from further consideration under Formerly Utilized Sites Remedial Action Progrm (FUSRAP). In each case, I made or reviewed the evaluation, and, in each case, a handwritten evaluation was prepared. This is to provide a more

406

march2007.xls  

Gasoline and Diesel Fuel Update (EIA)

Orhan Yildiz at 202-287-1586, or at Orhan.Yildiz@eia.doe.gov. Orhan Yildiz at 202-287-1586, or at Orhan.Yildiz@eia.doe.gov. Monthly Flash Estimates of Data for: January 2007 Section 1. Commentary Electric Power Data According to the National Oceanic and Atmospheric Administration (NOAA) Climatic Data Center, after "the 11th record warmest December on record in 2006", more typical winter conditions returned, particularly in the Eastern United States, in the latter part of January 2007. For the month, heating degree days were 26.1 percent higher than January 2006, but still 8.9 percent lower than normal. In January 2007, increased demand for winter heating, coupled with economic strength, as observed by growth in industrial production, resulted in a 7.7 percent growth in electricity generation compared to January 2006. (Industrial production increased 1.92

407

Residential Buildings Historical Publications reports, data and housing  

Gasoline and Diesel Fuel Update (EIA)

0 0 Average Electricity Residential Buildings Consumption Expenditures per Total per Square per per per Total Total Floorspace Building Foot per Household per Square per Household Households Number (billion (million (thousand Household Member Building Foot Household Member Characteristics (million) (million) sq. ft.) Btu) Btu) (million Btu) (million Btu) (dollars) (dollars) (dollars) (dollars) Total 81.6 65.3 142.5 38 17 30.3 11 625 0.29 500 178 Census Region and Division Northeast 17.7 12.2 34.8 33 12 23.0 8 742 0.26 514 181 New England 4.3 2.9 8.9 34 11 23.1 8 747 0.25 508 177 Middle Atlantic 13.4 9.3 26.0 33 12 22.9 8 740 0.27 516 183

408

September 2012, Training Work Group Status Overview  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Training Work Group Status Overview Training Work Group Status Overview Accomplishments: 1. May 7-8. Attended NIEHS Trainer's Exchange in Oak Ridge. 2. May 8-9. Joined HAMMER in visiting Oak Ridge entities to build support for the Radworker pilot. Entities visited included ORISE, Y-12, DOE TRU Project, and local labor entities. 3. June 19-20. Participated with Char Wells, Sandia National Laboratory Training Manager, (NTC, NIEHS and HAMMER in attendance) at a DOE M&O contractor led Learning/Training Workshop. - Obtained EFCOG commitment to create a Human Capital Training Subgroup under the Business Management Working Group. - Serving this group as data repository and communications hub for efforts to standardize General Employee Radiation Training (GERT) within DOE. - Briefed the complex wide Radworker reciprocity concept finding interest and

409

Developer | OpenEI Community  

Open Energy Info (EERE)

Developer header Developer header Developer Home > Developer > Posts by term > Developer Content Group Activity By term Q & A Feeds Term: developer Type Term Title Author Replies Last Post sort icon Blog entry developer New Robust References! Jweers 1 8 Aug 2013 - 08:12 Blog entry developer Utility Rates API Version 2 is Live! Sfomail 17 May 2013 - 11:14 Blog entry developer Multicolor Maps from Compound Queries Jweers 16 May 2013 - 14:22 Blog entry developer New Result Formats on OpenEI Jweers 25 Mar 2013 - 12:22 Blog entry developer OpenEI maintenance March 8-9, 2013 Rmckeel 8 Mar 2013 - 14:23 Blog entry developer Semantic Mediawiki Semantic Forms update Rmckeel 22 Oct 2012 - 07:23 Blog entry developer Current and historical incentive data available as XML! Rmckeel 11 Sep 2012 - 13:41

410

Electricity Monthly Update  

Gasoline and Diesel Fuel Update (EIA)

Highlights: November 2011 Highlights: November 2011 Warm temperatures across the Eastern half of the continental U.S. led to flat or lower retail sales of electricity during November 2011. Coal-fired generation decreased in every region of the United States when compared to November 2010. Wholesale electricity prices set annual lows across the East coast as well as in the ERCOT portion of Texas in November 2011. Key Indicators Nov. 2011 % Change from Nov. 2010 Total Net Generation (Thousand MWh) 304,268 -0.6% Residential Retail Price (cents/kWh) 11.88 2.2% Retail Sales (Thousand MWh) 273,053 -0.7% Heating Degree-Days 469 -10.3% Natural Gas Price, Henry Hub ($/MMBtu) 3.32 -13.8% Coal Stocks (Thousand Tons) 168,354 8.9% Coal Consumption (Thousand Tons) 66,789 -8.2% Natural Gas Consumption

411

CX-005130: Categorical Exclusion Determination | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

0: Categorical Exclusion Determination 0: Categorical Exclusion Determination CX-005130: Categorical Exclusion Determination Ringold Substation Structure Replacement Project CX(s) Applied: B4.6 Date: 01/21/2011 Location(s): Basin City, Washington Office(s): Bonneville Power Administration Bonneville Power Administration is proposing to replace the single pole structure 8/9 of the Benton-Scooteney No. 1 115-kilovolt (kV) transmission line, the attached vertically mounted disconnect switch, and current guy wiring with a new, 30-foot wide, three-pole transposition structure, a new horizontally mounted disconnect switch, and new guy wiring. In addition, a new 14-foot wide two-pole structure and a new 25?5-foot switch support structure would be installed roughly 30-feet ahead of the substation dead-end and approximately 15-feet ahead of the KD, respectively. There

412

CKBGroup/2013 Workshop and Resources | Open Energy Information  

Open Energy Info (EERE)

CKBGroup/2013 Workshop and Resources CKBGroup/2013 Workshop and Resources < CKBGroup Jump to: navigation, search 2013 Workshop and Resources Home | 2013 Workshop | Previous Events | CKB Snapshots | Collaborative Projects | Shared Tools The 3rd Annual Climate Knowledge Brokers workshop was held in Bonn, between 8-9 June, 2013, co-hosted by GIZ, CDKN and REEEP. A total of 35 participants from 17 organisations took part. A full report on the Workshop, which included discussions on the future ambitions of the CKB Group, is presented to the below: 2013 Workshop Report 2013 Workshop Report Workshop presentations Workshop Introduction Workshop Introduction Understanding Needs, Meeting Demands Understanding Needs, Meeting Demans Collaborating on Climate Adaptation Issues Collaborating on Climate Adaptation Issues

413

Ionic conductivities of lithium phosphorus oxynitride glasses, polycrystals, and thin films  

Science Conference Proceedings (OSTI)

Various lithium phosphorus oxynitrides have been prepared in the form of glasses, polycrystals, and thin films. The structures of these compounds were investigated by X-ray and neutron diffraction, X-ray photoelectron spectroscopy (XPS), and high-performance liquid chromatography (HPLC). The ac impedance measurements indicate a significant improvement of ionic conductivity as the result of incorporation of nitrogen into the structure. In the case of polycrystalline Li{sub 2.88}PO{sub 3.73}N{sub 0.14} with the {gamma}-Li{sub 3}PO{sub 4} structure, the conductivity increased by several orders of magnitude on small addition of nitrogen. The highest conductivities in the bulk glasses and thin films were found to be 3.0 {times} 10{sup -7} and 8.9 {times} 10{sup -7} S{center_dot}cm{sup -1} at 25{degrees}C, respectively.

Wang, B.; Bates, J.B.; Chakoumakos, B.C.; Sales, B.C.; Kwak, B.S.; Zuhr, R.A. [Oak Ridge National Lab., TN (United States); Robertson, J.D. [Univ. of Kentucky, Lexington, KY (United States). Dept. of Chemistry

1994-11-01T23:59:59.000Z

414

IMPACT OF OXYGEN CONCENTRATION ON ZEBRA MUSSEL MORTALITY  

SciTech Connect

These tests have indicated that the bacterium Pseudomonas fluorescens strain CL0145A is effective at killing zebra mussels in environments having dissolved oxygen (DO) concentrations ranging from very low to very high. The results suggest that the highest mussel kill can be achieved in moderately to highly aerated environments, while kill may be 0-20% lower under conditions of very low oxygen. For example, under highly oxygenated conditions 97% kill was achieved while conditions having low DO produced 79% mussel kill. Service water measured in a local power plant indicated that DO concentrations were in the range of 8-9 ppm (e.g., highly aerated) within their pipes. Therefore, we will not expect to see decreases in the efficacy of CL0145A treatments due to oxygen levels within such power plant pipes.

Daniel P. Molloy

2003-01-27T23:59:59.000Z

415

Genomic analysis of heat-shock factor targets in Drosophila  

E-Print Network (OSTI)

ADH-717 AGTAAGGCAGGCAAATAAATTCA GGTGTGCTGTGCTAAAAAAAAAA 896 ADH-718 TAAACGATTATGGCTCGGCG TTGGTTTTTTTTTGGTTGCAGC 878 ADH-719 TGTGGGCGTCTTTACCATTC AGTCTCGGTCGCAGTTCTTAGTA 971 ADH-720 GAAGAGACGAAAAACAAAGTCCA TTGTAGTTGTGAAAGTCATCGTTG 930 ADH-721... .82E-04 FBgn0037001 CG6020 GM13757 0.728 1.721 0.666 1.204 1.000 0.461 0.903 7 0.954963593 0.4146344 6.09E+00 8.89E-04 FBgn0034939 CG2980 LD21694 -0.730 -0.736 -1.271 -0.257 -0.805 -0.461 -0.866 7 -0.732257808 0.3195686 -6.06E+00 9.13E-04 FBgn0010398...

Birch-Machin, Ian; Gao, Shan; Huen, David S; McGirr, Richard; White, Robert A H; Russell, Steven R

2005-06-10T23:59:59.000Z

416

United States Government Department  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1/03 07:45 FAX 301 903 4656 CAPITAL REGION -* FORS FIVEA I002/004 1/03 07:45 FAX 301 903 4656 CAPITAL REGION -* FORS FIVEA I002/004 DOE F 1325 ' (8-69) EFO (07-90) United States Government Department of Eneray memorandum DATE: PR17 2003 Audit Report No.: OAS-L-03-14 REPLY TO ATTN OF: IG-34 (A03PT040) SUBJECT: Audit of the Office of Energy Efficiency and Renewable Energy's (EE) Grants, Subsidies, and Cost Sharing Arrangements TO: Assistant Secretary for Energy Efficiency and Renewable Energy, EE-1 The purpose of this report is to inform you of the results of our review of the Office of Energy Efficiency and Renewable Energy's (EE) incentive payments and cost-share arrangements. The review was initiated in February 2003, and fieldwork was conducted through April 2003 at Department of Energy (Department) Headquarters. Our methodology is described in the attachment to this report.

417

United States Government Department of Energy Memorandum  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

25/03 THU_13:54 FAX 423 241 3897 OIG 25/03 THU_13:54 FAX 423 241 3897 OIG *-- HQ @002 DOxR F 1325.8 E -' (07.90) ' United States Government Department of Energy Memorandum DATE: September 25, 2003 REPLY TO IG-36 (A03SR035) Audit Report No.: OAS-L-03-22 ATTN OF: SUBJECT: Audit of Relocation of Administrative Personnel from A-Area to B-Area at the Savannah River Site TO; Jeffrey M. Allison, Manager, Savannah River Operations Office INTRODUCTION AND OBJECTIVE In an effort to reduce operating costs at the Savannah River Site, the Savannah River Operations Office (Operations Office) is currently moving most of the Federal and Westinghouse Savannah River Company, LLC (Westinghouse) administrative personnel from Building 703-A to Buildings 730-B and 730-1B. Also, in order to make room for Federal employees moving in, about 330 Westinghouse employees within Building 730-B

418

Comparison of the Unique Mobility and DOE-developed ac electric drive systems  

DOE Green Energy (OSTI)

A comparison was made between the most recent DOE-developed AC electric vehicle drive systems and that which is independently under development by Unique Mobility of Golden, Colorado. The DOE-developed AC systems compared in this study are the Single-Shaft Electric Propulsion System (ETX-II) developed by Ford Motor Company and the General Electric Company under contract number DE-AC07-85NV10418, the Dual-Shaft Electric Propulsion (DSEP) System developed by Eaton Corporation under contract number DOE-AC08-84NV-10366, and the anticipated results of the Modular Electric Vehicle (MEV) system currently being developed by Ford and General Electric under contract number DE-AC07-90ID13019. The Unique Mobility brushless DC electric vehicle drive system represents their latest electric drive technology and is being developed in cooperation with BMW Technik Gmbh of Germany. Comparisons of specific volume, specific weight, efficiency and expected vehicle performance are made of the different systems based upon measured system performance data where available. One conclusion presented is that the Unique Mobility drive system under development with BMW appears to provide comparable performance to the AC systems studied.

Cole, G.H.

1993-01-01T23:59:59.000Z

419

X:\L6046\Data_Publication\Pma\current\ventura\pma.vp  

Gasoline and Diesel Fuel Update (EIA)

1999 January ....................... 2.8 2.8 3.3 5.3 - 8.6 0.6 0.6 0.6 0.8 - 1.4 February ..................... 2.9 2.9 3.7 5.2 - 8.9 0.6 0.6 W 0.8 - 1.4 March .......................... 2.6 2.6 3.4 3.8 - 7.2 0.4 0.4 W 0.8 - 1.4 April ............................ 1.6 1.6 NA 2.5 - NA 0.2 0.2 0.2 0.7 - 0.8 May ............................. 1.6 1.6 1.3 2.5 - 3.8 0.2 0.2 W 0.7 - 0.8 June ............................ 1.6 1.6 W 2.9 - 4.2 0.2 0.2 W 0.8 - 0.9 July ............................. 1.6 1.6 W 2.8 - 4.2 0.2 0.2 W W - 0.9 August ........................ 1.6 1.6 W 2.8 - 4.2 0.2 0.2 W 0.7 - 0.8 September .................. 1.6 1.6 1.7 3.2 - 4.9 0.2 0.2 W 0.7 - 0.9 October ....................... 2.0 2.0 3.0 4.2 - 7.2 0.3 0.3 W 0.8 - 1.2 November ................... 2.7 2.7 3.2 5.7 - 8.9 0.6 0.6 W 1.0 - 1.5 December

420

Table 6. U.S. Refiner Motor Gasoline Prices by Grade and Sales Type  

Gasoline and Diesel Fuel Update (EIA)

1996 January ....................... 70.5 69.9 66.3 55.9 52.2 57.7 79.6 79.1 71.7 60.3 - 65.4 February ..................... 70.5 70.0 66.4 57.0 53.0 58.4 79.8 79.3 72.2 61.1 - 66.1 March .......................... 75.8 75.3 70.9 64.0 59.3 64.9 84.7 84.3 77.0 67.9 W 72.0 April ............................ 84.5 83.9 81.0 72.4 66.6 73.2 93.7 93.2 87.0 76.9 - 81.3 May ............................. 89.3 88.8 88.0 72.7 68.0 75.2 99.1 98.6 93.7 77.0 - 84.2 June ............................ 86.9 86.3 85.2 67.4 61.6 70.0 96.5 95.9 91.0 70.6 - 79.4 July ............................. 83.9 83.4 81.9 67.3 62.0 69.4 93.4 93.0 87.6 71.2 - 78.1 August ........................ 81.2 80.7 78.0 66.7 61.5 68.3 90.6 90.2 83.7 70.5 NA 76.1 September .................. 80.8 80.4 76.4 67.7 62.4 68.8 89.8 89.4 82.1 71.5 W 76.1 October .......................

Note: This page contains sample records for the topic "8-89 efg 07-90" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

Kentucky Natural Gas in Underground Storage - Change in Working Gas from  

U.S. Energy Information Administration (EIA) Indexed Site

Percent) Percent) Kentucky Natural Gas in Underground Storage - Change in Working Gas from Same Month Previous Year (Percent) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 1991 36.3 23.0 19.6 25.2 19.8 15.5 10.9 5.6 1.2 -2.7 -5.1 -1.7 1992 5.7 8.9 7.7 -0.9 -5.4 -7.3 -8.9 -10.3 -9.2 2.6 8.5 8.4 1993 3.5 -8.1 -14.7 -13.7 -3.8 4.4 9.2 12.9 14.8 3.2 -1.2 -9.6 1994 -25.7 -31.2 -28.1 -20.1 -13.8 -10.6 -7.3 -4.7 -7.2 -4.8 1.4 4.5 1995 14.0 16.7 18.3 14.2 16.8 12.2 7.3 3.3 6.6 5.5 -4.6 -8.7 1996 -14.5 -16.8 -24.3 -29.4 -33.2 -22.0 -13.0 -5.9 -3.8 -3.6 0.9 5.3 1997 5.8 15.5 27.1 28.5 28.0 13.5 3.6 -0.7 -1.1 -0.7 0.2 -3.1 1998 7.5 5.2 -1.0 3.5 9.7 9.1 12.7 12.8 7.3 9.4 12.3 14.5

422

Table 24. Refining Industry Energy Consumption  

Gasoline and Diesel Fuel Update (EIA)

- Corrections to Tables 24 to 32 - Corrections to Tables 24 to 32 Table 24. Refining Industry Energy Consumption 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 2014 2015 2016 2017 2018 2019 2020 2021 2022 2023 2024 2025 2002- 2025 Carbon Dioxide Emissions 4/ (million metric tons) 190.4 185.7 188.0 191.3 207.3 215.6 220.0 222.8 225.1 226.3 228.0 230.7 234.1 237.5 238.5 239.4 239.4 238.6 240.6 240.5 242.2 244.2 245.9 246.3 246.6 1.2% Table 25. Food Industry Energy Consumption 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 2014 2015 2016 2017 2018 2019 2020 2021 2022 2023 2024 2025 2002- 2025 Carbon Dioxide Emissions 3/ (million metric tons) 87.8 89.4 87.5 87.8 89.2 90.2 90.9 91.4 92.2 93.5 94.5 95.7 96.7 97.7 98.6 99.6 100.8 101.9 102.9 104.1 105.4 107.0 108.7 110.3 112.1 1.0% Table 26. Paper Industry Energy Consumption 2001 2002 2003 2004 2005 2006 2007

423

Triterpenoid biosynthesis in Euphorbia lathyris latex  

DOE Green Energy (OSTI)

The structures of triterpenols, not previously been known, from Euphorbia lathyris latex are reported. A method for quantifying very small amounts of these compounds was developed. Concerning the biochemistry of the latex, no exogenous cofactors were required for the biosynthesis and the addition of compounds such as NADPAH and ATP do not stimulate the biosynthesis. The addition of DTE or a similar anti-oxidant was found to help reduce the oxidation of the latex, thus increasing the length of time that the latex remains active. The requirement of a divalent cation and the preference for Mn in the pellet was observed. The effect of several inhibitors on the biosynthesis of the triterpenoids was examined. Mevinolin was found to inhibit the biosynthesis of the triterpenoids from acetate, but not mevalonate. A dixon plot of the inhibition of acetate incorporation showed an I/sub 50/ concentration of 3.2 ..mu..M. Fenpropimorph was found to have little or no effect on the biosynthesis. Tridemorph was found to inhibit the biosynthesis of all of the triterpenoids with an I/sub 50/ of 4 ..mu..M. It was also observed that the cyclopropyl containing triterpenols, cycloartenol and 24-methylenecycloartenol were inhibited much more strongly than those containing an 8-9 double bond, lanosterol and 24-methylenelanosterol. The evidence indicates, but does not definetely prove, that lanosterol and 24-methylenelanosterol are not made from cycloartenol and 24-methylenecycloartenol via a ring-opening enzyme such as cycloeucalenol-obtusifoliol isomerase. The possibilty that cycloartenol is made via lanosterol was investigated by synthesizing 4-R-4-/sup 3/H-mevalonic acid and incubating latex with a mixture of this and /sup 14/C-mevalonic acid. From the /sup 3/H//sup 14/C ratio it was shown that cycloartenol and 24-methylenecycloartenol are not made via an intermediate containing as 8-9 double bond. 88 refs., 15 figs., 30 tabs.

Hawkins, D.R.

1987-11-01T23:59:59.000Z

424

GT Solar Technologies formerly GT Equipment Technologies | Open Energy  

Open Energy Info (EERE)

GT Solar Technologies formerly GT Equipment Technologies GT Solar Technologies formerly GT Equipment Technologies Jump to: navigation, search Name GT Solar Technologies (formerly GT Equipment Technologies) Place Merrimack, New Hampshire Zip 3054 Product US-based manufacturer of turnkey multicrystalline PV wafer, cell, and module fabrication lines; also offers EFG and dentritic growth furnaces. Coordinates 42.872517°, -71.490603° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.872517,"lon":-71.490603,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

425

Dip-coating process. Silicon sheet growth development for the large-area silicon sheet task of the low-cost silicon solar array project. Quarterly report No. 7  

DOE Green Energy (OSTI)

The objective of this research program is to investigate the technical and economic feasibility of producing solar-cell-quality sheet silicon by coating one surface of carbonized ceramic substrates with a thin layer of large-grain polycrystalline silicon from the melt. During the past quarter, significant progress was demonstrated in several areas. Seeded growth of silicon-on-ceramic (SOC) with an EFG ribbon seed was demonstrated. Different types of mullite received from Coors were successfully coated with silicon. A new method of deriving minority carrier diffusion length, L/sub n/, from spectral response measurements was evaluated. ECOMOD cost projections were found to be in good agreement with the interim SAMIS method proposed by JPL. On the less positive side, there was a decrease in cell performance which is believed to be due to an unidentified source of impurities. Also, operation of the new coating system fell behind schedule but is expected to improve in the coming quarter, since construction has now been completed.

Zook, J.D.; Heaps, J.D.; Maciolek, R.B.; Koepke, B.; Butter, C.D.; Schuldt, S.B.

1977-12-30T23:59:59.000Z

426

LSSA Project. Project quarterly report No. 4, January--March 1977  

DOE Green Energy (OSTI)

A preliminary version of a workbook for SAMICS, a uniform costing methodology for manufacturing processes, was published. Continued experimentation with the fluidized bed reactor for production of Si by Zn reduction of SiCl/sub 4/ showed that 78 percent of theoretical conversion efficiency from SiCl/sub 4/ to Si was attainable using a hemispherical bed support, versus 68 percent when using the concise bed support. The EFG process is now producing 2-inch wide ribbon at 2 to 3 inches per minute; however, conversion efficiencies remain low at 2 percent to 3 percent. Work on the CAST process has stopped pending contract negotiation. Materials other than SiO/sub 2/ are being evaluated for the die used in the inverted Stepanov process. Development of low-cost encapsulation materials and systems is continuing. Production process emphasis was shifted to the cost-effectiveness of processes still being considered, and to the sensitivity of these processes to commercially realistic tolerances. Engineering work centered in two primary areas: the finalizing of a substantially updated module design specification, and expanded activity in the development of environmental design requirements. (MHR)

Not Available

1977-01-01T23:59:59.000Z

427

All Price Tables.vp  

Gasoline and Diesel Fuel Update (EIA)

7) 7) August 2009 State Energy Price and Expenditure Estimates 1970 Through 2007 2007 Price and Expenditure Summary Tables Table S1a. Energy Price Estimates by Source, 2007 (Nominal Dollars per Million Btu) State Primary Energy Electric Power Sector e,f Retail Electricity Total Energy e,g Coal Natural Gas a Petroleum Nuclear Fuel Biomass Total e,f,g Distillate Fuel Oil Jet Fuel LPG b Motor Gasoline Residual Fuel Oil Other c Total Wood and Waste d Alabama 2.17 9.06 19.43 16.20 21.84 21.26 8.46 14.19 19.62 0.42 2.71 7.47 2.29 22.46 16.01 Alaska 2.34 5.76 19.43 16.35 28.63 22.14 11.51 23.69 17.97 - 10.51 14.88 4.94 38.96 17.87 Arizona 1.61 8.44 19.84 16.24 27.16 21.95 10.04 11.27 20.50 0.57 10.86 9.61 2.78 25.02 20.72 Arkansas 1.65 9.33 19.63 15.73 21.10 21.54 8.65 18.76 20.42 0.57 2.66 9.45 1.98 20.57

428

Maine Price of Natural Gas Delivered to Residential Consumers (Dollars per  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 1989 6.71 6.77 6.72 7.01 7.21 7.96 8.06 8.47 8.59 7.79 7.59 7.08 1990 7.00 7.95 8.08 8.27 7.77 7.56 8.31 8.37 8.21 7.84 7.04 6.77 1991 6.59 6.60 6.69 6.87 7.01 6.95 7.39 7.76 7.36 6.91 6.95 7.01 1992 6.87 6.79 6.90 7.08 6.78 6.76 7.51 7.65 7.12 6.77 6.89 7.12 1993 6.76 6.90 7.12 7.52 8.12 8.30 8.89 9.06 8.56 7.53 7.89 7.80 1994 7.62 7.75 7.89 8.34 7.82 8.04 8.89 9.41 8.33 7.65 7.64 7.36 1995 7.28 7.23 7.43 7.70 6.60 7.75 8.23 8.37 7.78 7.17 7.21 7.01 1996 7.02 7.78 7.88 8.27 7.62 8.06 8.57 8.90 8.23 7.04 8.05 8.53 1997 8.10 8.66 8.65 9.05 7.95 8.39 9.69 9.25 9.46 7.80 8.21 8.36 1998 7.95 8.27 7.95 8.81 8.72 8.38 9.17 9.19 8.94 7.66 7.45 7.64

429

International Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

1 1 U.S. Energy Information Administration | International Energy Outlook 2013 Low Oil Price case projections Table E4. World liquids consumption by region, Low Oil Price case, 2009-2040 (million barrels per day) Region History Projections Average annual percent change, 2010-2040 2009 2010 2015 2020 2025 2030 2035 2040 OECD OECD Americas 23.1 23.5 24.2 25.1 25.2 25.2 25.7 26.7 0.4 United States a 18.6 18.9 19.4 20.0 19.8 19.6 19.7 20.2 0.2 Canada 2.2 2.2 2.3 2.3 2.3 2.4 2.4 2.5 0.4 Mexico/Chile 2.4 2.4 2.5 2.8 3.0 3.3 3.6 4.0 1.7 OECD Europe 15.0 14.8 13.7 14.5 14.7 15.1 15.4 15.8 0.2 OECD Asia 7.7 7.7 8.3 8.7 8.9 8.9 9.0 9.1 0.5 Japan 4.4 4.4 4.7 4.8 4.8 4.7 4.6 4.5 0.1 South Korea 2.2 2.3 2.5 2.7 2.9 3.0 3.1 3.2 1.2 Australia/NewZealand 1.1 1.1 1.2 1.2 1.2 1.3 1.3 1.4 0.8 Total OECD 45.8 46.0 46.2 48.3 48.8 49.2 50.2 51.5 0.4 Non-OECD Non-OECD Europe and Eurasia

430

Table 7. U.S. Refiner Motor Gasoline Volumes by Grade and Sales Type  

Gasoline and Diesel Fuel Update (EIA)

1994 January ....................... 31.4 32.9 44.3 108.4 22.6 175.3 8.1 8.4 12.1 13.6 0.2 25.9 February ..................... 32.5 34.2 46.7 112.6 21.0 180.2 8.3 8.6 12.2 14.4 0.1 26.7 March .......................... 34.4 36.2 48.0 116.1 21.1 185.3 8.4 8.7 12.8 15.4 0.2 28.4 April ............................ 34.2 35.8 48.0 119.8 24.1 191.9 8.4 8.7 12.9 15.5 0.1 28.6 May ............................. 34.6 36.3 48.2 120.2 24.3 192.7 8.5 8.8 12.9 15.9 0.1 29.0 June ............................ 35.8 37.5 49.2 124.7 24.5 198.4 8.6 8.9 13.3 16.5 0.3 30.1 July ............................. 35.1 36.6 48.4 123.3 21.3 193.0 8.6 8.8 13.0 16.2 0.2 29.5 August ........................ 36.0 37.6 49.0 128.1 25.0 202.0 8.6 8.9 13.0 16.7 0.2 30.0 September .................. 35.1 36.6 47.5 124.8 26.0 198.3 8.3 8.6 12.7 16.0 0.2 28.9 October

431

oil1981.xls  

Gasoline and Diesel Fuel Update (EIA)

4.6 4.6 11.0 28.9 116 44 87.9 32 1,032 0.39 781 283 Census Region and Division Northeast 8.9 5.9 18.0 158 51 103.5 36 1,405 0.46 923 323 New England 2.4 1.7 5.1 148 50 105.3 36 1,332 0.45 946 327 Middle Atlantic 6.5 4.1 12.8 161 52 102.9 36 1,435 0.46 915 322 Midwest 2.3 2.2 5.1 86 37 79.5 29 751 0.32 693 254 East North Central 1.7 1.7 3.8 79 35 76.8 28 688 0.31 672 243 West North Central 0.6 0.4 1.3 115 40 87.7 33 993 0.35 759 286 South 2.8 2.5 4.7 56 30 50.2 20 497 0.27 448 180 South Atlantic 2.5 2.2 4.2 56 30 49.7 20 500 0.27 445 182 East South Central 0.3 0.3 0.5 55 31 55.4 20 482 0.27 482 171 West South Central Q Q Q 48 56 48.0 11 425 0.49 425 99 West 0.5 0.5 1.2 63 27 58.4 23 548 0.24 511 197 Mountain 0.1 0.1 0.2 45 24 44.6 18 384 0.20 384 153 Pacific 0.5 0.4 1.0 66 27 60.9 23 580 0.24 534 205 Metropolitan Statistical Area Urban 8.9 5.5 16.3 157 53 97.4 37 1,402 0.47 868 331 Central City 4.2 1.8 5.9 229 70 98.5 39 2,051 0.62

432

Percent of Commercial Natural Gas Deliveries in Wisconsin Represented by  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 1989 94.1 94.2 94.5 94.0 92.6 87.7 86.1 84.2 84.2 84.3 91.1 95.0 1990 91.6 91.5 91.9 91.9 90.3 86.5 83.1 82.4 82.6 87.5 90.1 93.3 1991 93.8 92.3 92.9 91.2 88.8 83.8 80.7 84.7 83.6 86.7 91.5 92.1 1992 92.7 92.1 91.6 90.0 85.8 82.3 83.3 84.1 85.2 90.7 93.4 95.1 1993 95.2 96.0 95.3 93.5 92.1 90.8 89.2 88.5 90.0 92.6 95.2 96.0 1994 97.1 97.6 97.4 96.6 91.8 89.9 83.5 87.1 87.8 90.8 94.4 84.4 1995 93.5 94.0 93.2 92.4 90.0 81.8 82.3 84.8 87.3 88.9 93.4 93.6 1996 93.9 94.8 94.0 92.0 89.9 86.1 82.1 83.8 82.4 87.1 90.9 91.8 1997 89.7 88.2 88.5 83.3 77.4 60.6 67.8 55.4 62.9 69.3 85.9 83.2 1998 87.0 81.6 79.8 75.5 55.6 55.5 47.6 48.5 45.5 71.1 74.9 79.2

433

International Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

6 6 Appendix A Table A7. World coal consumption by region, Reference case, 2009-2040 (quadrillion Btu) Region History Projections Average annual percent change, 2010-2040 2009 2010 2015 2020 2025 2030 2035 2040 OECD OECD Americas 21.3 22.5 19.9 20.3 21.1 21.5 21.9 22.2 0.0 United States a 19.6 20.8 18.2 18.6 19.3 19.7 20.1 20.4 -0.1 Canada 1.1 1.1 1.0 1.0 1.0 1.0 1.0 1.0 -0.3 Mexico/Chile 0.5 0.6 0.7 0.7 0.7 0.8 0.8 0.8 1.2 OECD Europe 11.9 12.2 12.2 11.9 11.6 11.3 11.0 10.7 -0.4 OECD Asia 9.4 10.1 10.2 10.1 10.0 9.9 9.9 9.7 -0.1 Japan 4.2 4.8 4.9 4.8 4.7 4.6 4.5 4.3 -0.4 South Korea 2.7 3.0 3.0 3.1 3.2 3.2 3.4 3.5 0.5 Australia/NewZealand 2.4 2.3 2.2 2.2 2.1 2.1 2.0 2.0 -0.6 Total OECD 42.5 44.8 42.2 42.3 42.8 42.7 42.8 42.7 -0.2 Non-OECD Non-OECD Europe and Eurasia 7.7 8.9 8.9 9.5 10.0 10.4 10.7 10.8 0.6 Russia 3.7 4.8 4.9 5.2 5.5 5.6 5.7 5.6 0.5 Other 4.0 4.2 4.1 4.3 4.5 4.8 5.0 5.2 0.8

434

A GIANT SAMPLE OF GIANT PULSES FROM THE CRAB PULSAR  

Science Conference Proceedings (OSTI)

We observed the Crab pulsar with the 43 m telescope in Green Bank, WV over a timespan of 15 months. In total we obtained 100 hr of data at 1.2 GHz and seven hours at 330 MHz, resulting in a sample of about 95,000 giant pulses (GPs). This is the largest sample, to date, of GPs from the Crab pulsar taken with the same telescope and backend and analyzed as one data set. We calculated power-law fits to amplitude distributions for main pulse (MP) and interpulse (IP) GPs, resulting in indices in the range of 2.1-3.1 for MP GPs at 1.2 GHz and in the range of 2.5-3.0 and 2.4-3.1 for MP and IP GPs at 330 MHz. We also correlated the GPs at 1.2 GHz with GPs from the Robert C. Byrd Green Bank Telescope (GBT), which were obtained simultaneously at a higher frequency (8.9 GHz) over a span of 26 hr. In total, 7933 GPs from the 43 m telescope at 1.2 GHz and 39,900 GPs from the GBT were recorded during these contemporaneous observations. At 1.2 GHz, 236 (3%) MP GPs and 23 (5%) IP GPs were detected at 8.9 GHz, both with zero chance probability. Another 15 (4%) low-frequency IP GPs were detected within one spin period of high-frequency IP GPs, with a chance probability of 9%. This indicates that the emission processes at high and low radio frequencies are related, despite significant pulse profile shape differences. The 43 m GPs were also correlated with Fermi {gamma}-ray photons to see if increased pair production in the magnetosphere is the mechanism responsible for GP emission. A total of 92,022 GPs and 393 {gamma}-ray photons were used in this correlation analysis. No significant correlations were found between GPs and {gamma}-ray photons. This indicates that increased pair production in the magnetosphere is likely not the dominant cause of GPs. Possible methods of GP production may be increased coherence of synchrotron emission or changes in beaming direction.

Mickaliger, M. B.; McLaughlin, M. A.; Lorimer, D. R.; Palliyaguru, N. [Department of Physics, West Virginia University, Morgantown, WV 26506 (United States); Langston, G. I. [National Radio Astronomy Observatory, Green Bank, WV 24944 (United States); Bilous, A. V. [Department of Astronomy, University of Virginia, P.O. Box 400325, Charlottesville, VA 22904 (United States); Kondratiev, V. I. [Netherlands Institute for Radio Astronomy (ASTRON), Postbus 2, 7990 AA Dwingeloo (Netherlands); Lyutikov, M. [Department of Physics, Purdue University, 525 Northwestern Avenue, West Lafayette, IN 47907-2036 (United States); Ransom, S. M. [National Radio Astronomy Observatory, Charlottesville, VA 22903 (United States)

2012-11-20T23:59:59.000Z

435

EIA - State Nuclear Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Vermont profile Vermont profile Vermont total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 620 55.0 4,782 72.2 Hydro and Pumped Storage 324 28.7 1,347 20.3 Natural Gas - - 4 0.1 Other Renewable1 84 7.5 482 7.3 Petroleum 100 8.9 5 0.1 Total 1,128 100.0 6,620 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable. - = No data reported. Notes: Totals may not equal sum of components due to independent rounding. Other Renewable: Wood, black liquor, other wood waste, biogenic municipal solid waste, landfill gas, sludge waste, agriculture byproducts, other biomass, geothermal, solar thermal, photovoltaic energy, and wind.

436

eta1440-web.dvi  

NLE Websites -- All DOE Office Websites (Extended Search)

(1405), (1405), η(1475), f 1 (1420), AND f 1 (1510) Revised November 2013 by C. Amsler (Bern) and A. Masoni (INFN Cagliari). The first observation of the η(1440) was made in pp anni- hilation at rest into η(1440)π + π - , η(1440) → KKπ [1]. This state was reported to decay through a 0 (980)π and K ∗ (892)K with roughly equal contributions. The η(1440) was also ob- served in radiative J/ψ(1S) decay into KKπ [2-4] and γρ [5]. There is evidence for the existence of two pseudoscalars in this mass region, the η(1405) and η(1475). The former decays mainly through a 0 (980)π (or direct KKπ) and the latter mainly to K ∗ (892)K. The simultaneous observation of two pseudoscalars is re- ported in three production mechanisms: π - p [6,7]; radiative J/ψ(1S) decay [8,9]; and pp annihilation at rest [10-13]. All of them give values for the masses, widths, and decay modes in reasonable agreement.

437

Arkansas Natural Gas Prices  

Gasoline and Diesel Fuel Update (EIA)

2007 2008 2009 2010 2011 2012 View 2007 2008 2009 2010 2011 2012 View History Wellhead Price 6.61 8.72 3.43 3.84 1967-2010 Pipeline and Distribution Use Price 1967-2005 Citygate Price 8.55 8.88 7.86 6.76 6.27 5.36 1984-2012 Residential Price 13.08 14.09 13.39 11.53 11.46 11.82 1967-2012 Percentage of Total Residential Deliveries included in Prices 100.0 100.0 100.0 100.0 100.0 100.0 1989-2012 Commercial Price 10.07 11.32 10.72 8.89 8.90 7.99 1967-2012 Percentage of Total Commercial Deliveries included in Prices 70.4 64.5 59.4 55.6 51.5 40.2 1990-2012 Industrial Price 9.51 10.56 8.44 7.28 7.44 6.38 1997-2012 Percentage of Total Industrial Deliveries included in Prices 4.2 3.9 3.7 2.8 2.1 1.9 1997-2012 Vehicle Fuel Price 8.39 -- -- -- -- 9.04 1994-2012

438

 

Gasoline and Diesel Fuel Update (EIA)

Oregon Oregon Motor Gasoline 146,328 138,917 138,012 128,012 123,940 125,772 1,517,105 1,568,511 3.4 Regular 131,286 124,315 123,729 113,898 110,947 112,956 1,350,867 1,407,721 4.2 Conventional W 106,842 W 82,565 66,529 67,457 W W NA Oxygenated W NA W 31,333 44,418 45,499 W W NA Reformulated – – – – – – – – – Midgrade 3,864 3,807 3,502 3,435 3,352 3,268 45,545 41,476 -8.9 Conventional W W W 2,414 1,661 1,559 W W NA Oxygenated W W W 1,021 1,691 1,709 W W NA Reformulated – – – – – – – – – Premium 11,178 10,795 10,781 10,679 9,641 9,548 120,693 119,314 -1.1 Conventional W W W 7,751 5,240 5,150 W W NA Oxygenated W W W 2,928 4,401 4,398 W W NA

439

 

Gasoline and Diesel Fuel Update (EIA)

9. Electricity Consumption and Conditional Energy Intensity by Census Division for Non-Mall Buildings, 2003: Part 3 9. Electricity Consumption and Conditional Energy Intensity by Census Division for Non-Mall Buildings, 2003: Part 3 Total Electricity Consumption (billion kWh) Total Floorspace of Buildings Using Electricity (million square feet) Electricity Energy Intensity (kWh/square foot) West South Central Moun- tain Pacific West South Central Moun- tain Pacific West South Central Moun- tain Pacific All Buildings* ............................... 114 56 96 7,449 3,633 7,397 15.3 15.4 13.0 Building Floorspace (Square Feet) 1,001 to 5,000 ................................ 17 7 12 696 437 857 24.1 15.7 14.0 5,001 to 10,000 .............................. 11 5 14 787 404 810 13.4 12.0 16.9 10,001 to 25,000 ............................ 11 10 13 1,267 831 1,232 8.9 11.7 10.3

440

Total Space Heating Water Heating Cook-  

Gasoline and Diesel Fuel Update (EIA)

636 636 580 46 1 Q 114.0 103.9 8.3 0.2 Q Building Floorspace (Square Feet) 1,001 to 5,000 ........................... Q Q Q Q Q Q Q Q Q Q 5,001 to 10,000 .......................... Q Q Q Q Q Q Q Q Q Q 10,001 to 25,000 ........................ Q Q Q Q Q Q Q Q Q Q 25,001 to 50,000 ........................ Q Q Q Q Q Q Q Q Q Q 50,001 to 100,000 ...................... Q Q Q Q Q Q Q Q Q Q 100,001 to 200,000 .................... 165 154 10 Q Q 118.1 109.9 Q Q Q 200,001 to 500,000 .................... 123 112 11 Q Q 121.2 110.2 10.5 Q Q Over 500,000 ............................. 171 147 16 Q Q 93.6 80.6 8.9 Q Q Principal Building Activity Education .................................. 134 122 8 Q Q 116.6 106.6 6.9 Q Q Food Service ............................. N N N N N N N N N N Health Care ............................... Q Q Q Q Q Q Q Q Q Q Inpatient ..................................

Note: This page contains sample records for the topic "8-89 efg 07-90" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

Kansas Natural Gas Summary  

Gasoline and Diesel Fuel Update (EIA)

69 6.85 3.16 4.23 1967-2010 69 6.85 3.16 4.23 1967-2010 Pipeline and Distribution Use 1967-2005 Citygate 8.27 8.85 6.12 6.08 5.53 4.74 1984-2012 Residential 12.97 13.00 11.10 10.61 9.93 10.13 1967-2012 Commercial 12.04 12.24 10.01 9.65 8.89 8.82 1967-2012 Industrial 7.17 9.42 4.59 5.49 5.28 3.95 1997-2012 Vehicle Fuel -- -- -- -- 9.87 9.00 1994-2012 Electric Power 6.31 8.11 4.13 5.05 4.79 3.28 1997-2012 Dry Proved Reserves (Billion Cubic Feet) Proved Reserves as of 12/31 3,982 3,557 3,279 3,673 3,486 1977-2011 Adjustments 79 -6 224 140 125 1977-2011 Revision Increases 407 334 212 687 152 1977-2011 Revision Decreases 221 498 403 166 240 1977-2011 Sales 65 17 2 17 124 2000-2011 Acquisitions 63 30 1 23 122 2000-2011

442

Alaska Natural Gas Summary  

Gasoline and Diesel Fuel Update (EIA)

5.63 7.39 2.93 3.17 1967-2010 5.63 7.39 2.93 3.17 1967-2010 Exports 6.21 7.69 8.59 12.19 12.88 15.71 1989-2012 Pipeline and Distribution Use 1970-2005 Citygate 6.75 6.74 8.22 6.67 6.53 6.14 1988-2012 Residential 8.68 8.72 10.23 8.89 8.77 8.47 1967-2012 Commercial 7.57 8.66 9.51 8.78 8.09 8.09 1967-2012 Industrial 4.67 5.49 4.02 4.23 3.84 5.11 1997-2012 Electric Power 3.58 W W W 5.04 4.32 1997-2012 Dry Proved Reserves (Billion Cubic Feet) Proved Reserves as of 12/31 11,917 7,699 9,101 8,838 9,424 1977-2011 Adjustments 1 -3 3 1 -1 1977-2011 Revision Increases 2,147 184 1,868 622 928 1977-2011 Revision Decreases 112 4,068 108 452 206 1977-2011 Sales 10 0 5 131 36 2000-2011 Acquisitions 6 0 0 0 221 2000-2011 Extensions

443

Microsoft Word - appa.docx  

Gasoline and Diesel Fuel Update (EIA)

1. Liquid fuels supply and disposition 1. Liquid fuels supply and disposition (million barrels per day, unless otherwise noted) Supply and disposition Reference case Annual growth 2011-2040 (percent) 2010 2011 2020 2025 2030 2035 2040 Crude oil Domestic crude production 1 ................................... 5.47 5.67 7.47 6.79 6.30 6.26 6.13 0.3% Alaska ................................................................. 0.60 0.57 0.49 0.35 0.38 0.35 0.41 -1.1% Lower 48 states .................................................. 4.88 5.10 6.98 6.44 5.92 5.91 5.72 0.4% Net imports ............................................................ 9.17 8.89 6.82 7.05 7.36 7.37 7.57 -0.6% Gross imports ..................................................... 9.21 8.94 6.82 7.05 7.36 7.37 7.57 -0.6%

444

 

Gasoline and Diesel Fuel Update (EIA)

4. Electricity Consumption and Expenditure Intensities for Non-Mall Buildings, 2003 4. Electricity Consumption and Expenditure Intensities for Non-Mall Buildings, 2003 Electricity Consumption Electricity Expenditures per Building (thousand kWh) per Square Foot (kWh) per Worker (thousand kWh) Distribution of Building-Level Intensities (kWh/square foot) 25th Per- centile Median 75th Per- centile per Building (thousand dollars) per Square Foot (dollars) per kWh (dollars) All Buildings* ............................... 202 14.1 12.2 3.6 8.2 17.1 15.7 1.09 0.078 Building Floorspace (Square Feet) 1,001 to 5,000 ................................ 47 17.8 11.4 3.8 8.9 20.3 4.3 1.63 0.092 5,001 to 10,000 .............................. 92 12.4 10.3 3.8 7.4 14.5 8.7 1.18 0.095 10,001 to 25,000 ............................ 164 10.5 11.1 2.9 6.3 13.4 13.8 0.88 0.084

445

Milagro Contributions to XXVI International Cosmic Ray Conference  

SciTech Connect

Milagrito, a prototype for the Milagro detector, operated for 15 months in 1997--8 and collected 8.9 x 10{sup 9} events. It was the first extensive air shower (EAS) array sensitive to showers initiated by primaries with energy below 1 TeV. The shadows of the sun and moon observed with cosmic rays can be used to study systematic pointing shifts and measure the angular resolution of EAS arrays. Below a few TeV, the paths of cosmic rays coming toward the earth are bent by the helio- and geo-magnetic fields. This is expected to distort and displace the shadows of the sun and the moon. The moon shadow, offset from the nominal (unreflected) position, has been observed with high statistical significance in Milagrito. This can be used to establish energy calibrations, as well as to search for the anti-matter content of the VHE cosmic ray flux. The shadow of the sun has also been observed with high significance.

Hoffman, C.M.; Haines, T.J.; Sinnis, G.; Miller, R.S.; Thompson, N.T.

1999-08-01T23:59:59.000Z

446

Electronic and magnetic phase diagram of [Beta]Fe[subscript1.01]Se with superconductivity at 36.7 K under pressure  

Science Conference Proceedings (OSTI)

The discovery of new high-temperature superconductors based on FeAs has led to a new 'gold rush' in high-T{sub C} superconductivity. All of the new superconductors share the same common structural motif of FeAs layers and reach T{sub C} values up to 55 K. Recently, superconductivity has been reported in FeSe, which has the same iron pnictide layer structure, but without separating layers. Here, we report the magnetic and electronic phase diagram of {beta}-Fe{sub 1.01}Se as a function of temperature and pressure. The superconducting transition temperature increases from 8.5 to 36.7 K under an applied pressure of 8.9 GPa. It then decreases at higher pressures. A marked change in volume is observed at the same time as T{sub C} rises, owing to a collapse of the separation between the Fe{sub 2}Se{sub 2} layers. No static magnetic ordering is observed for the whole p-T phase diagram. We also report that at higher pressures (starting around 7 GPa and completed at 38 GPa), Fe{sub 1.01}Se transforms to a hexagonal NiAs-type structure and exhibits non-magnetic behavior.

Medvedev, S.; McQueen, T.M.; Troyan, I.A.; Palasyuk, T.; Eremets, M.I.; Cava, R.J.; Naghavi, S.; Casper, F.; Ksenofontov, V.; Wortmann, G.; Felser, C.; (Paderborn); (MXPL-M); (Mainz); (Princeton)

2010-09-17T23:59:59.000Z

447

High efficiency cadmium and zinc telluride-based thin film solar cells  

DOE Green Energy (OSTI)

Polycrystalline Cd{sub 1-x}Zn{sub x}Te and Cd{sub 1-x}Mn{sub x}Te films with a band gap of 1.7 eV were successfully grown on glass/SnO{sub 2}/CdS substrates by molecular beam epitaxy (MBE) and metal-organic chemical vapor deposition (MOCVD), respectively. Polycrystalline Cd{sub 1-x}Zn{sub x}Te films grown by MBE resulted in uniform composition and sharp interfaces. However, polycrystalline Cd{sub 1-x}Mn{sub x}Te films grown by MOCVD showed nonuniform compositions and evidence of manganese accumulation at the Cd{sub 1-x}Mn{sub x}Te/CdS interface. We found that manganese interdiffuses and replaces cadmium in the CdS film. By improving the CdTe/CdS interface and, thus, reducing the collection function effects, the efficiency of the MOCVD CdTe cell can be improved to about 13.5%. MBE-grown CdTe cells also produced 8%--9% efficiencies. The standard CdTe process was not optimum for ternary films and resulted in a decrease in the band gap. Recent results indicate that CdCl{sub 2} + ZnCl{sub 2} chemical treatment may prevent the band-gap reduction, and that chromate etch (rather than bromine etch) may provide the solution to contact resistance in the ternary cells.

Rohatgi, A.; Summers, C.J.; Erbil, A.; Sudharsanan, R.; Ringel, S. (Georgia Inst. of Tech., Atlanta, GA (USA). School of Electrical Engineering)

1990-10-01T23:59:59.000Z

448

Table HC1-3a. Housing Unit Characteristics by Household Income,  

U.S. Energy Information Administration (EIA) Indexed Site

3a. Housing Unit Characteristics by Household Income, 3a. Housing Unit Characteristics by Household Income, Million U.S. Households, 2001 Housing Unit Characteristics RSE Column Factor: Total 2001 Household Income Below Poverty Line Eli- gible for Fed- eral Assist- ance 1 RSE Row Factors Less than $14,999 $15,000 to $29,999 $30,000 to $49,999 $50,000 or More 0.6 1.3 1.1 1.0 0.9 1.4 1.0 Total ............................................... 107.0 18.7 22.9 27.1 38.3 15.0 33.8 3.3 Census Region and Division Northeast ...................................... 20.3 3.3 4.2 4.9 7.8 2.6 6.8 6.4 New England .............................. 5.4 0.8 1.1 1.3 2.3 0.6 1.6 9.9 Middle Atlantic ............................ 14.8 2.6 3.2 3.5 5.6 2.0 5.2 7.7 Midwest ......................................... 24.5 3.7 5.2 6.8 8.9 2.8 7.4 5.8 East North Central ......................

449

SAS Output  

U.S. Energy Information Administration (EIA) Indexed Site

0. Net Generation from Natural Gas 0. Net Generation from Natural Gas by State, by Sector, 2012 and 2011 (Thousand Megawatthours) Electric Power Sector Census Division and State All Sectors Electric Utilities Independent Power Producers Commercial Sector Industrial Sector Year 2012 Year 2011 Percentage Change Year 2012 Year 2011 Year 2012 Year 2011 Year 2012 Year 2011 Year 2012 Year 2011 New England 62,490 63,236 -1.2% 345 357 58,757 59,763 901 700 2,488 2,416 Connecticut 16,537 15,188 8.9% 6 NM 15,801 14,715 397 211 333 227 Maine 6,044 6,877 -12.1% 0 0 4,057 4,850 26 0.26 1,960 2,026 Massachusetts 24,672 25,940 -4.9% 278 240 23,812 25,120 416 443 166 136 New Hampshire 7,050 6,658 5.9% 58 80 6,947 6,552 16 0 29 26 Rhode Island 8,185 8,571 -4.5% 0 0 8,140 8,525 45 46 0 0

450

ac_household2001.pdf  

U.S. Energy Information Administration (EIA) Indexed Site

9a. Air Conditioning by Northeast Census Region, 9a. Air Conditioning by Northeast Census Region, Million U.S. Households, 2001 Air Conditioning Characteristics RSE Column Factor: Total U.S. Northeast Census Region RSE Row Factors Total Census Division Middle Atlantic New England 0.5 1.0 1.2 1.8 Households With Electric Air-Conditioning Equipment ...................... 82.9 14.5 11.3 3.2 3.3 Air Conditioners Not Used ........................... 2.1 0.3 0.3 Q 28.3 Households Using Electric Air-Conditioning 1 ........................................ 80.8 14.2 11.1 3.2 3.4 Type of Electric Air-Conditioning Used Central Air-Conditioning 2 ............................ 57.5 5.7 4.9 0.8 8.9 Without a Heat Pump ................................ 46.2 5.2 4.5 0.7 9.2 With a Heat Pump .....................................

451

table6.4_02.xls  

U.S. Energy Information Administration (EIA) Indexed Site

4 Consumption Ratios of Fuel, 2002; 4 Consumption Ratios of Fuel, 2002; Level: National Data; Row: Employment Sizes within NAICS Codes; Column: Energy-Consumption Ratios; Unit: Varies. Consumption Consumption per Dollar Consumption per Dollar of Value RSE NAICS per Employee of Value Added of Shipments Row Code(a) Economic Characteristic(b) (million Btu) (thousand Btu) (thousand Btu) Factors Total United States RSE Column Factors: 1.1 1 1 311 - 339 ALL MANUFACTURING INDUSTRIES Employment Size Under 50 395.7 4.3 2.3 3.6 50-99 663.4 6.8 3.3 5 100-249 905.8 7.9 3.8 3.6 250-499 1,407.1 11.1 5.1 4.3 500-999 1,999.6 12.4 5.9 5.6 1000 and Over 1,597.7 8.5 3.9 2.5 Total 1,172.2 8.9 4.2 2 311 FOOD Employment Size Under 50 893.5 6.6 2.4

452

Total.............................................................................  

U.S. Energy Information Administration (EIA) Indexed Site

Do Not Have Cooling Equipment............................... Do Not Have Cooling Equipment............................... 17.8 8.5 2.7 2.6 4.0 Have Cooling Equipment............................................ 93.3 38.6 16.2 20.1 18.4 Use Cooling Equipment............................................. 91.4 37.8 15.9 19.8 18.0 Have Equipment But Do Not Use it............................ 1.9 0.9 0.3 0.3 0.4 Type of Air-Conditioning Equipment 1, 2 Central System........................................................ 65.9 25.8 10.9 16.6 12.5 Without a Heat Pump............................................. 53.5 21.2 9.7 13.7 8.9 With a Heat Pump................................................. 12.3 4.6 1.2 2.8 3.6 Window/Wall Units.................................................. 28.9 13.4 5.6 3.9 6.1 1 Unit.....................................................................

453

II-GRR at GRC - Analyses slides.pptx  

Open Energy Info (EERE)

Overview Overview Kate Young Kermit Witherbee NREL October 2, 2012 2 | US DOE Geothermal Program eere.energy.gov Schedule * Progress shown by dark bands after each jurisdiction * Target dates are shown for development of materials and upcoming meetings Roadmap D evelopment S tatus Mee2ngs* 25% 50% 75% 100% Reviewed & P rinted Mee4ng #1 Agency Follow--- up Mee4ng #2 Federal 5/3 6/7 California 6/14 6/27 Nevada 6/29 7/12 7/24 Hawaii 7/13 7/26 8/7 Alaska 7/27 8/9 8/21 Idaho 8/10 8/23 9/4 Utah 8/24 9/6 9/18 Oregon 9/1 9/13 9/25 Montana 9/14 9/20 NA * M ee4ng # 1: M eet w ith a gencies t o i ntroduce p roject a nd r eview d eveloped fl owcharts M ee4ng # 2: M eet w ith i ndustry t o i ntroduce p roject a nd g et f eedback o n p ermiRng c oncerns; m eet w ith a gencies a nd i ndustry t

454

FY 2012 Summary Table by Organization  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

5 5 Department of Energy Budget by Organization (discretionary dollars in thousands) FY 2010 FY 2011 FY 2011 FY 2012 Current Cong. Annualized Cong. Approp. Request CR Request $ % National Security Weapons Activities* 6,386,371 7,008,835 7,008,835 7,629,716 +620,881 +8.9% Defense Nuclear Nonproliferation* 2,131,382 2,687,167 2,136,709 2,549,492 -137,675 -5.1% Naval Reactors* 945,133 1,070,486 945,133 1,153,662 +83,176 +7.8% Office of the Administrator* 410,754 448,267 410,754 450,060 +1,793 +0.4% Total, National Nuclear Security Administration* 9,873,640 11,214,755 10,501,431 11,782,930 +568,175 +5.1% Energy and Environment Energy Efficiency and Renewable Energy 2,216,392 2,355,473 2,242,500 3,200,053 +983,661 +44.4% Electricity Delivery and Energy Reliability 168,484 185,930 171,982 237,717 +69,233 +41.1%

455

table6.3_02.xls  

U.S. Energy Information Administration (EIA) Indexed Site

3 Consumption Ratios of Fuel, 2002; 3 Consumption Ratios of Fuel, 2002; Level: National Data; Row: Values of Shipments within NAICS Codes; Column: Energy-Consumption Ratios; Unit: Varies. Consumption Consumption per Dollar Consumption per Dollar of Value RSE NAICS per Employee of Value Added of Shipments Row Code(a) Economic Characteristic(b) (million Btu) (thousand Btu) (thousand Btu) Factors Total United States RSE Column Factors: 1 1 1 311 - 339 ALL MANUFACTURING INDUSTRIES Value of Shipments and Receipts (million dollars) Under 20 281.0 3.9 2.2 3 20-49 583.7 6.1 3.0 4.6 50-99 889.2 8.1 3.8 4.9 100-249 1,268.8 8.7 4.1 4.6 250-499 2,146.6 11.2 5.3 7.6 500 and Over 3,807.1 12.5 5.4 2.3 Total 1,172.2 8.9 4.2 2 311 FOOD Value of Shipments and Receipts

456

EIA - State Nuclear Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Wisconsin profile Wisconsin profile Wisconsin total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 1,584 8.9 13,281 20.7 Coal 8,063 45.2 40,169 62.5 Hydro and Pumped Storage 492 2.8 2,112 3.3 Natural Gas 6,110 34.3 5,497 8.5 Other 1 21 0.1 63 0.1 Other Renewable1 775 4.3 2,474 3.8 Petroleum 790 4.4 718 1.1 Total 17,836 100.0 64,314 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable. Notes: Totals may not equal sum of components due to independent rounding.

457

Level: National and Regional Data; Row: NAICS Codes; Column: Energy Sources and Shipments;  

U.S. Energy Information Administration (EIA) Indexed Site

Coke and Shipments Net Residual Distillate Natural LPG and Coal Breeze of Energy Sources NAICS Total(b) Electricity(c) Fuel Oil Fuel Oil(d) Gas(e) NGL(f) (million (million Other(g) Produced Onsite(h) Code(a) Subsector and Industry (trillion Btu) (million kWh) (million bbl) (million bbl) (billion cu ft) (million bbl) short tons) short tons) (trillion Btu) (trillion Btu) Total United States RSE Column Factors: 0.9 1 1.2 1.8 1 1.6 0.8 0.9 1.2 0.4 311 Food 1,123 67,521 2 3 567 1 8 * 89 0 311221 Wet Corn Milling 217 6,851 * * 59 * 5 0 11 0 31131 Sugar 112 725 * * 22 * 2 * 46 0 311421 Fruit and Vegetable Canning 47 1,960 * * 35 * 0 0 1 0 312 Beverage and Tobacco Products 105 7,639 * * 45 * 1 0 11 0 3121 Beverages 85 6,426 * * 41 * * 0 10 0 3122 Tobacco 20 1,213 * * 4 * * 0 1 0 313 Textile Mills 207 25,271 1 * 73 * 1 0 15 0 314

458

Table 10. Major U.S. Coal Producers, 2012 U.S. Energy Information Administration | Annual Coal Report 2012  

U.S. Energy Information Administration (EIA) Indexed Site

Major U.S. Coal Producers, 2012 Major U.S. Coal Producers, 2012 U.S. Energy Information Administration | Annual Coal Report 2012 Table 10. Major U.S. Coal Producers, 2012 U.S. Energy Information Administration | Annual Coal Report 2012 Rank Controlling Company Name Production (thousand short tons) Percent of Total Production 1 Peabody Energy Corp 192,563 18.9 2 Arch Coal Inc 136,992 13.5 3 Alpha Natural Resources LLC 104,306 10.3 4 Cloud Peak Energy 90,721 8.9 5 CONSOL Energy Inc 55,752 5.5 6 Alliance Resource Operating Partners LP 35,406 3.5 7 Energy Future Holdings Corp 31,032 3.1 8 Murray Energy Corp 29,216 2.9 9 NACCO Industries Inc 28,207 2.8 10 Patriot Coal Corp 23,946 2.4 11 Peter Kiewit Sons Inc 22,725 2.2 12 Westmoreland Coal Co 22,215 2.2 13 BHP Billiton Ltd 12,580 1.2 14 Walter Energy Inc 11,220 1.1 15 Cline Group (The) 9,230

459

Microsoft Word - 20050821_Appendix_A.doc  

U.S. Energy Information Administration (EIA) Indexed Site

2. U.S. Average Vehicle-Miles Traveled by NHTS Household Composition 2. U.S. Average Vehicle-Miles Traveled by NHTS Household Composition 2 , 2001 (Thousand Miles per Household) ENERGY INFORMATION ADMINISTRATION / HOUSEHOLD VEHICLES ENERGY USE: LATEST A N D TRENDS 93 No Children Youngest Child 0-5 Youngest Child 6-15 Youngest Child 16-21 No Children (Retired) 2001 Household Characteristics One adult 2+ adults One adult 2+ adults One adult 2+ adults One adult 2+ adults One adult 2+ adults Total.............................. 13.3 27.2 16.2 28.7 17.9 31.6 23.3 37.2 7.8 18.5 Census Region and Division Northeast......................... 12.6 24.4 13.0 26.6 15.6 29.1 23.4 38.8 7.8 16.3 New England...................... 12.9 25.3 8.9 30.0 18.3 30.1 20.4 41.8 7.6 18.2

460

Word Pro - Untitled1  

U.S. Energy Information Administration (EIA) Indexed Site

4 4 U.S. Energy Information Administration / Annual Energy Review 2011 Table 8.12a Electric Noncoincident Peak Load and Capacity Margin: Summer Peak Period, 1986-2011 (Megawatts, Except as Noted) Year Noncoincident Peak Load 1 by North American Electric Reliability Corporation (NERC) 2 Regional Assessment Area Capacity Margin 21 (percent) Eastern Interconnection ERCOT 4 Western Inter- connection All Inter- connections FRCC 5 NPCC 6 Balance of Eastern Region 3 ECAR 7,8 MAAC 8,9 MAIN 8,10 MAPP 11 MISO 12 MRO 13 PJM 14 RFC 8,15 SERC 16 SPP 17 Subtotal TRE 18 WECC 19 Total 20 1986 - - 39,026 69,606 37,564 35,943 - - - - 21,029 - - - - 105,570 47,123 316,835 39,335 81,787 476,983 NA 1987 - - 42,651 72,561 40,526 37,446 - - - - 23,162 - - - - 109,798 47,723 331,216 39,339 82,967

Note: This page contains sample records for the topic "8-89 efg 07-90" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

State Nuclear Profiles 2010  

U.S. Energy Information Administration (EIA) Indexed Site

63 63 Wisconsin Wisconsin total electric power industry, summer capacity and net generation, by energy source, 2010 Nuclear 1,584 8.9 13,281 20.7 Coal 8,063 45.2 40,169 62.5 Hydro and Pumped Storage 492 2.8 2,112 3.3 Natural Gas 6,110 34.3 5,497 8.5 Other 1 21 0.1 63 0.1 Other Renewable 1 775 4.3 2,474 3.8 Petroleum 790 4.4 718 1.1 Total 17,836 100.0 64,314 100.0 Other Renewable: Wood, black liquor, other wood waste, biogenic municipal solid waste, landfill gas, sludge waste, agriculture byproducts, other biomass, geothermal, solar thermal, photovoltaic energy, and wind. Source: Form EIA-860, "Annual Electric Generator Report," and Form EIA-923, "Power Plant Operations Report." Share of State total (percent) 1 Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal

462

appl_household2001.pdf  

U.S. Energy Information Administration (EIA) Indexed Site

4a. Appliances by Type of Housing Unit, 4a. Appliances by Type of Housing Unit, Million U.S. Households, 2001 Appliance Types and Characteristics RSE Column Factor: Total Type of Housing Unit RSE Row Factors Single-Family Apartments in Buildings With Mobile Home Two to Four Units Five or More Units 0.4 0.5 1.7 1.6 1.9 Total ............................................... 107.0 73.7 9.5 17.0 6.8 4.2 Kitchen Appliances Cooking Appliances Oven ........................................... 101.7 69.1 9.4 16.7 6.6 4.3 1 ................................................ 95.2 63.7 8.9 16.2 6.3 4.3 2 or More .................................. 6.5 5.4 0.4 0.4 0.2 15.9 Most Used Oven ........................ 101.7 69.1 9.4 16.7 6.6 4.3 Electric ...................................... 63.0 43.3 5.2 10.9 3.6

463

Table HC9.11 Home Electronics Characteristics by Climate Zone, 2005  

U.S. Energy Information Administration (EIA) Indexed Site

11 Home Electronics Characteristics by Climate Zone, 2005 11 Home Electronics Characteristics by Climate Zone, 2005 Million U.S. Housing Units Total................................................................... 111.1 10.9 26.1 27.3 24.0 22.8 Personal Computers Do Not Use a Personal Computer ............... 35.5 3.2 8.3 8.9 7.7 7.5 Use a Personal Computer............................. 75.6 7.8 17.8 18.4 16.3 15.3 Number of Desktop PCs 1.............................................................. 50.3 5.1 12.4 11.9 10.5 10.4 2.............................................................. 16.2 1.8 3.4 4.2 3.6 3.2 3 or More................................................. 9.0 0.9 2.0 2.3 2.2 1.7 Number of Laptop PCs 1.............................................................. 22.5 2.1 4.9 5.8 5.1 4.6 2..............................................................

464

Million U.S. Housing Units Total............................................................................  

U.S. Energy Information Administration (EIA) Indexed Site

Personal Computers Personal Computers Do Not Use a Personal Computer......................... 35.5 3.2 8.3 8.9 7.7 7.5 Use a Personal Computer...................................... 75.6 7.8 17.8 18.4 16.3 15.3 Most-Used Personal Computer Type of PC Desk-top Model................................................. 58.6 6.2 14.3 14.2 12.1 11.9 Laptop Model.................................................... 16.9 1.6 3.5 4.3 4.2 3.4 Hours Turned on Per Week Less than 2 Hours............................................. 13.6 1.3 3.6 3.0 3.1 2.6 2 to 15 Hours.................................................... 29.1 3.2 6.8 7.1 6.0 6.0 16 to 40 Hours................................................... 13.5 1.6 3.3 3.6 2.5 2.5 41 to 167 Hours................................................. 6.3 0.6 1.2 1.4 1.8 1.3 On All the Time.................................................

465

TableHC2.10.xls  

U.S. Energy Information Administration (EIA) Indexed Site

Coventional Oven Coventional Oven Use an Oven......................................................... 109.6 71.3 7.4 7.7 16.4 6.8 More Than Once a Day..................................... 8.9 5.7 0.5 0.6 1.3 0.7 Once a Day....................................................... 19.2 13.3 1.3 1.4 2.1 1.0 Between Once a Day and Once a Week........... 32.0 22.7 2.1 1.8 4.0 1.5 Once a Week.................................................... 19.1 12.2 1.2 1.3 3.0 1.4 Less than Once a Week.................................... 30.3 17.3 2.3 2.6 5.9 2.2 Do Not Use an Oven............................................. 1.5 0.7 Q Q 0.4 Q Microwave Oven Use a Microwave Oven......................................... 97.7 65.3 6.6 6.3 13.3 6.2 Most or all Food Cooked................................... 8.3 5.1 0.8 0.6 1.2 0.7 About Half of All Food Cooked..........................

466

siteaplotm.cdr  

Office of Legacy Management (LM)

Site Site A/Plot M Decommissioned Reactor Site. This site is managed by the U.S. Department of Energy Office of Legacy Management. Site Description and History The Site A/Plot M Decommissioned Reactor Site is located in the Palos Forest Preserve in Cook County, Illinois, 20 miles southwest of Chicago. The site is underlain by 100 feet of glacial till overlying dolomite bedrock. About 8.9 million people live within 50 miles of the site; the population within a 5-mile radius is about 150,000. The Site A/Plot M area is the former site of Argonne National Laboratory and its predecessor, the University of Chicago Metallurgical Laboratory, which was part of the World War II Manhattan Engineer District. In 1942, the U.S. Army Corps of Engineers leased 1,025 acres of land in the Palos Forest Preserve from the Forest Preserve District of Cook County. The newly constructed laboratory used two locations

467

Newman.ppt  

NLE Websites -- All DOE Office Websites (Extended Search)

Large---Scale Large---Scale Geophysical Imaging and Simula7on Gregory A N ewman Lawrence B erkeley N a0onal L aboratory Geophysics D epartment NERSC BES Requirements for 2017 October 8-9, 2013 Gaithersburg, MD Why HPC => Time to Solution * Why i s t his i mportant? - More S cience C an G et D one - More B reakthroughs - More P ublica0ons - More R ealis0c M odels - More U nderstanding - End M ember S imula0ons - Time S ensi0ve D ecisions GEOPHYSICIAL I MAGING * Seismic - 3D R everse T ime M igra0on * Large S cale C omputa0ons: 1 ,000s C ores, W eeks o f P rocessing - 3D E las0c a nd A cousitc F ull W aveform I nversion * Itera0ve r everse 0 me m igra0on * Promises M uch G reater I mage F idelity * Formidable N umerical I ssues - L ocal M inima, V ery G ood S tar0ng M odels Required * Fron0er

468

 

Gasoline and Diesel Fuel Update (EIA)

Oregon Oregon Motor Gasoline 106,552 112,818 127,713 121,599 126,592 126,169 738,087 721,443 -2.8 Regular 92,915 98,586 112,315 107,152 113,569 111,791 641,081 636,328 -1.3 Conventional W 61,721 W W W W W W NA Oxygenated W 36,865 W W W W W W NA Reformulated – – – – – – – – – Midgrade 4,270 4,425 4,362 4,106 3,739 3,923 31,157 24,825 -20.8 Conventional 2,157 2,245 W W W W W W NA Oxygenated 2,113 2,180 W W W W W W NA Reformulated – – – – – – – – – Premium 9,367 9,807 11,036 10,341 9,284 10,455 65,849 60,290 -8.9 Conventional W 5,377 9,727 W W W W W NA Oxygenated W 4,430 1,309 W W W W W NA Reformulated – – – – – – – – –

469

RyneRevised.ppt  

NLE Websites -- All DOE Office Websites (Extended Search)

Robert Robert D . R yne LBNL NERSC BES Requirements for 2017 October 8-9, 2013 Gaithersburg, MD Present and Future Computing Requirements for "Frontiers in Accelerator Design: Advanced Modeling for Next-Generation BES Accelerators" (repo m669) 1. P roject D escrip6on PI: R obert R yne ( LBNL) Senior p ersonnel: J i Q iang ( LBNL), C ho N g ( SLAC), B ruce C arlsten ( LANL) * repo m 669 s upports B ES a ccelerator d esign * concept e xplora6on; a ccelerator s ystem & a ccelerator component d esign; c ode d evelopment * This p resenta6on f ocuses o n b eam d ynamics m odeling f or future l ight s ources, e specially X ---ray F ree E lectron L asers (XFELs) The LCLS XFEL is a spectacular success γε x,y = 0.4 µm (slice) I pk = 3.0 kA σ E /E = 0.01% (slice) What is so challenging about future XFEL modeling?

470

Arkansas Natural Gas Summary  

Gasoline and Diesel Fuel Update (EIA)

6.61 8.72 3.43 3.84 1967-2010 6.61 8.72 3.43 3.84 1967-2010 Pipeline and Distribution Use 1967-2005 Citygate 8.55 8.88 7.86 6.76 6.27 5.36 1984-2012 Residential 13.08 14.09 13.39 11.53 11.46 11.82 1967-2012 Commercial 10.07 11.32 10.72 8.89 8.90 7.99 1967-2012 Industrial 9.51 10.56 8.44 7.28 7.44 6.38 1997-2012 Vehicle Fuel 8.39 -- -- -- -- 9.04 1994-2012 Electric Power 7.04 9.23 4.14 5.11 W 3.19 1997-2012 Dry Proved Reserves (Billion Cubic Feet) Proved Reserves as of 12/31 3,305 5,626 10,869 14,178 16,370 1977-2011 Adjustments -27 -64 5 -34 728 1977-2011 Revision Increases 321 1,249 1,912 1,072 631 1977-2011 Revision Decreases 146 189 621 301 324 1977-2011 Sales 298 19 54 393 6,760 2000-2011 Acquisitions 280 5 36 807 6,880 2000-2011

471

c13.xls  

Gasoline and Diesel Fuel Update (EIA)

25th 25th Per- centile Median 75th Per- centile per Building (thousand dollars) per Square Foot (dollars) per kWh (dollars) All Buildings* .................................. 202 14.1 12.2 3.6 8.2 17.1 15.7 1.09 0.078 Building Floorspace (Square Feet) 1,001 to 5,000 ................................... 47 17.8 11.4 3.8 8.9 20.3 4.3 1.63 0.092 5,001 to 10,000 ................................. 92 12.4 10.3 3.8 7.4 14.5 8.7 1.18 0.095 10,001 to 25,000 ............................... 164 10.5 11.1 2.9 6.3 13.4 13.8 0.88 0.084 25,001 to 50,000 ............................... 439 12.2 11.6 3.8 8.8 16.2 33.6 0.94 0.077 50,001 to 100,000 ............................. 927 13.1 14.1 4.5 9.9 17.0 68.0 0.97 0.073 100,001 to 200,000 ........................... 2,181 15.7 12.2 5.3 13.0 23.4 146.4 1.05 0.067 200,001 to 500,000 ...........................

472

State Nuclear Profiles 2010  

Gasoline and Diesel Fuel Update (EIA)

60 60 Vermont Vermont total electric power industry, summer capacity and net generation, by energy source, 2010 Nuclear 620 55.0 4,782 72.2 Hydro and Pumped Storage 324 28.7 1,347 20.3 Natural Gas - - 4 0.1 Other Renewable 1 84 7.5 482 7.3 Petroleum 100 8.9 5 0.1 Total 1,128 100.0 6,620 100.0 - = No data reported. Source: Form EIA-860, "Annual Electric Generator Report," and Form EIA-923, "Power Plant Operations Report." Share of State total (percent) 1 Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable. Notes: Totals may not equal sum of components due to independent rounding. Other Renewable: Wood, black liquor, other wood waste, biogenic municipal solid waste, landfill gas, sludge waste, agriculture byproducts,

473

X:\L6046\Data_Publication\Pma\current\ventura\pma.vp  

Gasoline and Diesel Fuel Update (EIA)

57.6 57.6 141.7 138.5 147.8 74.2 124.3 147.5 87.4 February ............................... 144.4 128.1 125.7 135.3 61.2 109.6 131.3 69.8 March .................................... 134.7 116.6 114.2 126.9 54.7 101.2 117.3 61.7 April ...................................... 130.3 114.2 109.4 124.7 54.2 100.6 111.6 59.5 May ....................................... 130.1 112.7 106.8 126.3 52.4 104.2 104.5 56.9 June ...................................... 118.9 107.6 101.8 120.9 49.0 97.2 97.2 50.0 July ....................................... 109.6 102.8 96.0 115.0 43.8 88.8 89.0 44.5 August .................................. 105.6 99.1 93.2 113.9 44.6 85.4 88.6 46.1 September ............................ 109.5 97.8 92.1 109.0 42.6 84.4 87.4 47.3 October ................................. 111.6 97.4 93.7 105.1 42.9

474

State Electricity Profiles - Energy Information Administration  

U.S. Energy Information Administration (EIA) Indexed Site

Name Average Retail Price (cents/kWh) Net Summer Capacity (MW) Net Generation (MWh) Total Retail Sales (MWh) Name Average Retail Price (cents/kWh) Net Summer Capacity (MW) Net Generation (MWh) Total Retail Sales (MWh) Alabama 8.89 32,417 152,150,512 90,862,645 Alaska 14.76 2,067 6,759,576 6,247,038 Arizona 9.69 26,392 111,750,957 72,831,737 Arkansas 7.28 15,981 61,000,185 48,194,285 California 13.01 67,328 204,125,596 258,525,414 Colorado 9.15 13,777 50,720,792 52,917,786 Connecticut 17.39 8,284 33,349,623 30,391,766 Delaware 11.97 3,389 5,627,645 11,605,932 District of Columbia 13.35 790 199,858 11,876,995 Florida 10.58 59,147 229,095,935 231,209,614 Georgia 8.87 36,636 137,576,941 140,671,580 Hawaii 25.12 2,536 10,836,036 10,016,509 Idaho 6.54 3,990 12,024,564 22,797,668 Illinois 9.13 44,127 201,351,872 144,760,674

475

Weekly Petroleum Status Report  

U.S. Energy Information Administration (EIA) Indexed Site

1 1 Appendix A Table A1. Petroleum Supply Summary, November 2013 (derived from weekly data) Category November 2013 October 2013 Difference November 2012 Percent Change WPSR to PSM Comparison September 2013 PSM September 2013 Difference Stocks (Million Barrels) Total Stocks (Including SPR) 1 ..................... 1,785.1 1,812.9 -27.7 1,788.3 -0.2 1,822.7 1,831.6 -8.9 Crude Oil ................................................... 1,078.8 1,081.4 -2.6 1,066.8 1.1 1,063.6 1,067.1 -3.6 SPR 2 ...................................................... 696.0 696.0 0.0 695.0 0.2 696.0 696.0 0.0 Commercial ............................................ 382.8 385.4 -2.6 371.9 2.9 367.6 371.2 -3.6 Products .................................................... 706.3 731.4 -25.1 721.5 -2.1 759.1 764.5 -5.3 Total Motor Gasoline ..............................

476

Property:NEPA Completion Notes | Open Energy Information  

Open Energy Info (EERE)

Completion Notes Completion Notes Jump to: navigation, search Property Name NEPA Completion Notes Property Type Text Pages using the property "NEPA Completion Notes" Showing 25 pages using this property. (previous 25) (next 25) B BLM-NV-WN-ES-08-01-1310, NV-020-08-01 + 8/2: Data reviewed for completion C CA-017-05-051 + 8/9 Data entry complete. Attached FONSI does not seem to be fully related to the attached EA. The FONSI is for a geothermal well and slimhole exploration project and the EA is for a pipeline project. Need to add Public Health and Safety as a resource 8/22/13 - The 'FONSI/DR is actually for EA CA-170-02-15 Bassalt Canyon..dated Jan 2002 KW 8/26/13 - I deleted the FONSI from this page. Filename is incorrect for the file and stands as "CA-017-05-51-EA-DR -FONSI.pdf," Andrew Gentile. Unable to find Final EA or FONSI online. When RMP added, add "Inyo National Forest "Land and Resource Management Plan" (LRMP) 1988"

477

Appendix A  

Gasoline and Diesel Fuel Update (EIA)

1. Petroleum and other liquids supply and disposition 1. Petroleum and other liquids supply and disposition (million barrels per day, unless otherwise noted) Supply and disposition Reference case Annual growth 2012-2040 (percent) 2011 2012 2020 2025 2030 2035 2040 Crude oil Domestic crude production 1 ................................... 5.66 6.49 9.55 9.00 8.30 7.87 7.48 0.5% Alaska ................................................................. 0.57 0.53 0.44 0.33 0.24 0.38 0.26 -2.5% Lower 48 states .................................................. 5.09 5.96 9.12 8.68 8.06 7.49 7.22 0.7% Net imports ............................................................ 8.89 8.43 5.79 6.05 6.64 7.15 7.74 -0.3% Gross imports ..................................................... 8.94 8.49 5.94 6.18 6.77 7.27 7.87 -0.3%

478

c19.xls  

Gasoline and Diesel Fuel Update (EIA)

14 14 56 96 7,449 3,633 7,397 15.3 15.4 13.0 Building Floorspace (Square Feet) 1,001 to 5,000 ................................... 17 7 12 696 437 857 24.1 15.7 14.0 5,001 to 10,000 ................................. 11 5 14 787 404 810 13.4 12.0 16.9 10,001 to 25,000 ............................... 11 10 13 1,267 831 1,232 8.9 11.7 10.3 25,001 to 50,000 ............................... 12 7 12 897 511 1,088 13.6 13.2 11.0 50,001 to 100,000 ............................. 16 5 12 1,314 374 922 12.1 12.7 13.3 100,001 to 200,000 ........................... 20 Q 13 1,096 Q 895 18.2 Q 14.5 200,001 to 500,000 ........................... 12 5 11 659 Q 827 18.4 14.3 13.5 Over 500,000 .................................... Q Q 9 Q Q 766 Q Q 12.4 Principal Building Activity Education .......................................... 15 6 11 1,198 640 1,027 12.8 9.4

479

C:\ANNUAL\Vol2chps.v8\ANNUAL2.VP  

Gasoline and Diesel Fuel Update (EIA)

4 4 Energy Information Administration / Historical Natural Gas Annual 1930 Through 2000 33. Prices of Natural Gas Deliveries to Industrial Consumers by State, 1993-1998 (Dollars per Thousand Cubic Feet) Table State Firm Interruptible Total Average Price Percentage of Total Volume Delivered Average Price Percentage of Total Volume Delivered Total Average Price Percentage of Total Volume Delivered 1993 Alabama ...................... 3.72 29.2 3.06 26.7 3.28 27.5 Alaska.......................... 1.29 72.5 1.36 10.3 1.29 70.6 Arizona ........................ 3.98 24.9 4.79 26.9 4.02 25.0 Arkansas ..................... 3.27 11.5 3.40 28.0 3.31 13.8 California ..................... 2.91 28.8 0.71 8.9 2.82 26.4 Colorado...................... 2.48 27.6 2.28 42.0 2.35 35.6 Connecticut ................. 5.85 74.2 3.67 70.7 4.77 72.4 Delaware .....................

480

EIA - State Nuclear Profiles  

Gasoline and Diesel Fuel Update (EIA)

Wisconsin profile Wisconsin profile Wisconsin total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 1,584 8.9 13,281 20.7 Coal 8,063 45.2 40,169 62.5 Hydro and Pumped Storage 492 2.8 2,112 3.3 Natural Gas 6,110 34.3 5,497 8.5 Other 1 21 0.1 63 0.1 Other Renewable1 775 4.3 2,474 3.8 Petroleum 790 4.4 718 1.1 Total 17,836 100.0 64,314 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable. Notes: Totals may not equal sum of components due to independent rounding.

Note: This page contains sample records for the topic "8-89 efg 07-90" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

Energy Information Administration - Commercial Energy Consumption Survey-  

Gasoline and Diesel Fuel Update (EIA)

0. Consumption and Gross Energy Intensity by Climate Zonea for Non-Mall Buildings, 2003 0. Consumption and Gross Energy Intensity by Climate Zonea for Non-Mall Buildings, 2003 Sum of Major Fuel Consumption (trillion Btu) Total Floorspace of Buildings (million square feet) Energy Intensity for Sum of Major Fuels (thousand Btu/ square foot) Zone 1 Zone 2 Zone 3 Zone 4 Zone 5 Zone 1 Zone 2 Zone 3 Zone 4 Zone 5 Zone 1 Zone 2 Zone 3 Zone 4 Zone 5 All Buildings* ........................... 990 1,761 1,134 1,213 724 10,622 17,335 11,504 15,739 9,584 93.2 101.6 98.5 77.0 75.5 Building Floorspace (Square Feet) 1,001 to 5,000 ............................ 143 187 90 170 95 1,313 1,709 1,010 1,915 975 108.7 109.6 88.8 89.0 97.9 5,001 to 10,000 .......................... 110 137 91 156 69 1,248 1,725 1,077 2,024 959 88.1 79.3 84.6 77.1 71.7

482

NETL: SECA Core Technology Program - SOFC Seal Meeting  

NLE Websites -- All DOE Office Websites (Extended Search)

SECA Core Technology Program - SOFC Seal Meeting SECA Core Technology Program - SOFC Seal Meeting July 8-9, 2003 Table of Contents Disclaimer Papers and Presentations Overviews Sandia Capabilities SBIR Projects Issues/Requirements Products Agenda [PDF-29KB] Participants [PDF-7KB] Disclaimer This report was prepared as an account of work sponsored by an agency of the United States Government. Neither the United States Government or any agency thereof, nor any of their employees, makes any warranty, express or implied, or assumes any legal liability or responsibility for the accuracy, completeness, or usefulness of any information, apparatus, product, or process disclosed, or represents that its use would not infringe privately owned rights. Reference herein to any specific commercial product, process, or service by trade name, trademark, manufacturer, or otherwise does not necessarily constitute or imply its endorsement, recommendation, or favoring by the United States Government or any agency thereof. The views and opinions of authors expressed herein do not necessarily state or reflect those of the United States Government or any agency thereof.

483

S:\VM3\RX97\TBL_LIST.WPD [PFP#201331587]  

U.S. Energy Information Administration (EIA) Indexed Site

b. Home Office Equipment by Four Most Populated States, b. Home Office Equipment by Four Most Populated States, Percent of U.S. Households, 1997 Home Office Equipment RSE Column Factor: Total Four Most Populated States RSE Row Factors New York California Texas Florida 0.4 1.1 1.1 1.5 1.3 Total .............................................................. 100.0 100.0 100.0 100.0 100.0 0.0 Households Using Office Equipment ......................................... 79.3 79.4 77.6 75.1 79.4 1.9 Personal Computers ................................... 35.1 31.6 39.9 36.7 33.2 5.9 Number of PCs 1 ................................................................ 29.2 27.1 31.0 30.9 26.2 7.9 2 or more ................................................... 5.9 4.5 8.9 5.8 7.0 16.6 Modem Connecting PC to Telephone Line ......................................

484

SAS Output  

U.S. Energy Information Administration (EIA) Indexed Site

2. Consumption of Nautral Gas for Electricity Generation by State, by Sector, 2. Consumption of Nautral Gas for Electricity Generation by State, by Sector, 2012 and 2011 (Million Cubic Feet) Electric Power Sector Census Division and State All Sectors Electric Utilities Independent Power Producers Commercial Sector Industrial Sector Year 2012 Year 2011 Percentage Change Year 2012 Year 2011 Year 2012 Year 2011 Year 2012 Year 2011 Year 2012 Year 2011 New England 460,887 461,590 -0.2% 3,652 4,218 428,781 432,350 8,630 6,287 19,824 18,735 Connecticut 120,380 110,546 8.9% 69 730 113,620 105,965 3,952 2,061 2,739 1,790 Maine 44,424 49,352 -10% 0 0 28,456 33,555 307 12 15,662 15,785 Massachusetts 184,330 190,063 -3.0% 2,792 2,393 176,497 182,865 3,749 3,761 1,293 1,045 New Hampshire 50,678 46,927 8.0% 754 1,046 49,655 45,765 139 0 131 115

485

Word Pro - Untitled1  

U.S. Energy Information Administration (EIA) Indexed Site

5 5 Table 8.12b Electric Noncoincident Peak Load and Capacity Margin: Winter Peak Period, 1986-2011 (Megawatts, Except as Noted) Year Noncoincident Peak Load 1 by North American Electric Reliability Corporation (NERC) 2 Regional Assessment Area Capacity Margin 21 (percent) Eastern Interconnection ERCOT 4 Western Inter- connection All Inter- connections FRCC 5 NPCC 6 Balance of Eastern Region 3 ECAR 7,8 MAAC 8,9 MAIN 8,10 MAPP 11 MISO 12 MRO 13 PJM 14 RFC 8,15 SERC 16 SPP 17 Subtotal TRE 18 WECC 19 Total 20 1986 - - 37,976 64,561 32,807 28,036 - - - - 18,850 - - - - 101,849 33,877 279,980 28,730 76,171 422,857 NA 1987 - - 41,902 68,118 35,775 30,606 - - - - 19,335 - - - - 105,476 34,472 293,782 31,399 81,182 448,265 NA 1988 - - 42,951 67,771 36,363 30,631 - - - - 20,162 - - - -

486

Property:CompletionNotes | Open Energy Information  

Open Energy Info (EERE)

CompletionNotes CompletionNotes Jump to: navigation, search Property Name CompletionNotes Property Type Text Description List of data that still needs to be researched and entered for the NEPA document Subproperties This property has the following 2 subproperties: C CA-96062042 D DOI-BLM-CA-ES-2013-002+1793-EIS Pages using the property "CompletionNotes" Showing 25 pages using this property. (previous 25) (next 25) B BLM-NV-WN-ES-08-01-1310, NV-020-08-01 + 8/2: Data reviewed for completion C CA-017-05-051 + 8/9 Data entry complete. Attached FONSI does not seem to be fully related to the attached EA. The FONSI is for a geothermal well and slimhole exploration project and the EA is for a pipeline project. Need to add Public Health and Safety as a resource 8/22/13 - The 'FONSI/DR is actually for EA CA-170-02-15 Bassalt Canyon..dated Jan 2002 KW 8/26/13 - I deleted the FONSI from this page. Filename is incorrect for the file and stands as "CA-017-05-51-EA-DR -FONSI.pdf," Andrew Gentile. Unable to find Final EA or FONSI online. When RMP added, add "Inyo National Forest "Land and Resource Management Plan" (LRMP) 1988"

487

tfm_BESPowerpoint.ppt  

NLE Websites -- All DOE Office Websites (Extended Search)

for for Sampling d iffusive d ynamics o n l ong 0 mescales, and s imula0ng t he c oupled dynamics o f e lectrons a nd n uclei Thomas M iller Caltech NERSC BES Requirements for 2017 October 8-9, 2013 Gaithersburg, MD 1. P roject D escrip0on T homas F . M iller / C altech * Summarize y our p roject(s) a nd i ts s cien0fic o bjec0ves through 2 017 * Our p resent f ocus i s: * To u nderstand r eac0ve t unneling i n e nzyme---catalyzed hydrogen---transfer, e lectron---transfer, a nd p roton---coupled electron t ransfer r eac0ons. * To u nderstanding a nd c ontrolling p rotein t arge0ng a nd protein e xpression i n c ells, a t t he a mino a cid l evel. * By 2 017 w e e xpect t o d evelop a nd u 0lize n ew methods t o a chieve t hese f ocuses. 2. C omputa0onal S trategies * We a pproach t his p roblem c omputa0onally a t a h igh l evel b

488

Idaho National Laboratory Description, Chellenges, Technology, Issues, and Needs  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

i f th Hi i f th Hi h L l W t (HLW) P Overview of the High Level Waste (HLW) Program at the Id h N ti l L b t (INL) Sit Idaho National Laboratory (INL) Site Description Challenges Technology Issues and Needs Description, Challenges, Technology, Issues, and Needs 1 April 1, 2008 INL Site HLW is in Dry Storage in the Form of Calcine 8 9M ll f li id HLW t d t 4400 bi t f * 8-9M gallons of liquid HLW were converted to 4400 cubic meters of granular solid (calcine) through a fluidized bed calcination process - 7 to 1 volume reduction achieved * Average particle size is 0.4 cm * Bulk density is about 1 5 to 1 8 g/cc * Bulk density is about 1.5 to 1.8 g/cc - Contains roughly 44 metric tons heavy metal * Calcine is stored in 43 bins in 6 concrete-shielded binsets with one spare p - 7 th set of bins - intended for calcined SBW

489

CHANGING TIMES  

NLE Websites -- All DOE Office Websites (Extended Search)

6, 2011 6, 2011 Kailey Yarmer Slide 2 Southwestern Power Administration Sub-agreement Distribution District Number of Sub-agreements District MWs $ Fort Worth 8 89 14,776,000 Kansas City 14 205 11,440,570 Little Rock 46 1,069 51,810,300 St. Louis 11 58 3,552,000 Tulsa 55 584 91,217,000 Vicksburg 18 169 11,345,000 Total 152 2,174 $184,140,870 Slide 3 Southwestern Power Administration Completed Sub-agreements District Number of Completed Sub-agreements $ Fort Worth 6 1,895,000 Kansas City 11 4,510,570 Little Rock 39 43,604,300 St. Louis 8 2,768,000 Tulsa 41 22,132,000 Vicksburg 11 3,051,000 Total 116 $77,960,870 Slide 4 Southwestern Power Administration Sub-agreement Status Status Number of Sub-agreements Complete 116 90% Complete 8 50 - 80% Complete 11 10 - 50% Complete 17 Total 152 In Development - 2008 3 In Development - 2009 3 In Development -

490

U.S. Energy Information Administration (EIA) - Sector  

Gasoline and Diesel Fuel Update (EIA)

3. Comparisons of liquids projections, 2025, 2035, and 2040 3. Comparisons of liquids projections, 2025, 2035, and 2040 (million barrels per day, except where noted) Other projections Projection 2011 AEO2013 Reference case EVA INFORUMa IEAb,c ExxonMobila IHSGIa 2025 Average U.S. imported RAC (2011 dollars per barrel) 102.65 113.48 -- 126.18 -- -- 91.38 Brent spot price (2011 dollars per barrel) 111.26 117.36 78.18 136.77 135.70c -- -- U.S. WTI crude oil price (2011 dollars per barrel) 94.86 115.36 -- -- -- -- 93.05 Domestic production 7.88 9.96 12.08 -- -- -- 9.52 Crude oil 5.67 6.79 8.44 8.57 -- -- 6.86 Alaska 0.57 0.35 0.36 -- -- -- -- Natural gas liquids 2.22 3.17 3.64 -- -- -- 2.66 Total net imports 8.58 7.01 -- 7.08 -- -- 5.98 Crude oil 8.89 7.05 -- 7.08 -- -- 7.36

491

EIA - State Nuclear Profiles  

Gasoline and Diesel Fuel Update (EIA)

Vermont profile Vermont profile Vermont total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 620 55.0 4,782 72.2 Hydro and Pumped Storage 324 28.7 1,347 20.3 Natural Gas - - 4 0.1 Other Renewable1 84 7.5 482 7.3 Petroleum 100 8.9 5 0.1 Total 1,128 100.0 6,620 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable. - = No data reported. Notes: Totals may not equal sum of components due to independent rounding. Other Renewable: Wood, black liquor, other wood waste, biogenic municipal solid waste, landfill gas, sludge waste, agriculture byproducts, other biomass, geothermal, solar thermal, photovoltaic energy, and wind.

492

Alaska Natural Gas Prices  

Gasoline and Diesel Fuel Update (EIA)

2007 2008 2009 2010 2011 2012 View 2007 2008 2009 2010 2011 2012 View History Wellhead Price 5.63 7.39 2.93 3.17 1967-2010 Exports Price 6.21 7.69 8.59 12.19 12.88 15.71 1989-2012 Pipeline and Distribution Use Price 1970-2005 Citygate Price 6.75 6.74 8.22 6.67 6.53 6.14 1988-2012 Residential Price 8.68 8.72 10.23 8.89 8.77 8.47 1967-2012 Percentage of Total Residential Deliveries included in Prices 100.0 100.0 100.0 100.0 100.0 100.0 1989-2012 Commercial Price 7.57 8.66 9.51 8.78 8.09 8.09 1967-2012 Percentage of Total Commercial Deliveries included in Prices 76.0 74.9 85.3 87.7 88.6 94.9 1990-2012 Industrial Price 4.67 5.49 4.02 4.23 3.84 5.11 1997-2012 Percentage of Total Industrial Deliveries included in Prices 70.0 78.2 72.5 70.5 60.8 100.0 1997-2012

493

Residential Buildings Historical Publications reports, data and housing  

Gasoline and Diesel Fuel Update (EIA)

0 0 Average of Major Energy Sources Residential Buildings Consumption Expenditures Total per per per per Total Total Floorspace per Square per Household per Square per Household Households Number (billion Building Foot Household Member Building Foot Household Member Characteristics (million) (million) sq. ft.) (million Btu) (thousand Btu) (million Btu) (million Btu) (dollars) (dollars) (dollars) (dollars) Total U.S. Households 81.6 65.4 142.5 143 65 114.1 41 1,156 0.53 926 330 Census Region and Division Northeast 17.7 12.3 34.8 199 70 138.3 49 1,874 0.66 1,301 459 New England 4.3 2.9 8.9 197 65 134.4 47 1,964 0.65 1,341 466 Middle Atlantic 13.4 9.3 26.0 200 72 139.5 49 1,846 0.66 1,288 456

494

Kansas Natural Gas Prices  

Gasoline and Diesel Fuel Update (EIA)

2007 2008 2009 2010 2011 2012 View 2007 2008 2009 2010 2011 2012 View History Wellhead Price 5.69 6.85 3.16 4.23 1967-2010 Pipeline and Distribution Use Price 1967-2005 Citygate Price 8.27 8.85 6.12 6.08 5.53 4.74 1984-2012 Residential Price 12.97 13.00 11.10 10.61 9.93 10.13 1967-2012 Percentage of Total Residential Deliveries included in Prices 100.0 100.0 100.0 100.0 100.0 100.0 1989-2012 Commercial Price 12.04 12.24 10.01 9.65 8.89 8.82 1967-2012 Percentage of Total Commercial Deliveries included in Prices 64.8 64.9 65.7 66.0 62.6 59.7 1990-2012 Industrial Price 7.17 9.42 4.59 5.49 5.28 3.95 1997-2012 Percentage of Total Industrial Deliveries included in Prices 5.9 7.8 6.7 7.0 9.5 8.8 1997-2012 Vehicle Fuel Price -- -- -- -- 9.87 9.00 1994-2012

495

Microsoft PowerPoint - Proceedings Cover Sheets  

NLE Websites -- All DOE Office Websites (Extended Search)

Hitting the Climate Wall Hitting the Climate Wall Annual Carbon Commitment All Existing Energy Sources 0 1 2 3 4 5 6 7 8 9 10 Annual Lifetime New Pwr 2005 Lifetime New Pwr 2010 Lifetime New Pwr 2015 Billion tonnes C New Coal New Coal New Coal New Gas New Gas New Gas Lifetime Emissions of Annual New Fossil Investment 6.8 6.6 7.9 8.9 Source: new fossil capacity, IEA, WEO 2004 New Coal Build by Decade 0 200 400 600 800 G W C o a l Other Developing 43 90 128 India 16 48 79 China 150 168 226 Transition 1 11 19 OECD 12 184 218 2003-2010 2011-2020 2021-2030 Source: IEA, WEO 2004 221 500 670 Incremental new coal capacity by decade New Coal Plant Emissions Equal All Historic Coal CO 2 145 143 0 50 100 150 1751-2000 Total Coal New Coal Plants Lifetime Emissions Billion tonnes Carbon Source: ORNL, CDIAC; IEA, WEO 2004 27% of remaining budget for 450 ppm Fossil is Pulling Ahead

496

U.S. Energy Information Administration (EIA) - Sector  

Gasoline and Diesel Fuel Update (EIA)

3. Comparisons of liquids projections, 2025, 2035, and 2040 3. Comparisons of liquids projections, 2025, 2035, and 2040 (million barrels per day, except where noted) Other projections Projection 2011 AEO2013 Reference case EVA INFORUMa IEAb,c ExxonMobila IHSGIa 2025 Average U.S. imported RAC (2011 dollars per barrel) 102.65 113.48 -- 126.18 -- -- 91.38 Brent spot price (2011 dollars per barrel) 111.26 117.36 78.18 136.77 135.70c -- -- U.S. WTI crude oil price (2011 dollars per barrel) 94.86 115.36 -- -- -- -- 93.05 Domestic production 7.88 9.96 12.08 -- -- -- 9.52 Crude oil 5.67 6.79 8.44 8.57 -- -- 6.86 Alaska 0.57 0.35 0.36 -- -- -- -- Natural gas liquids 2.22 3.17 3.64 -- -- -- 2.66 Total net imports 8.58 7.01 -- 7.08 -- -- 5.98 Crude oil 8.89 7.05 -- 7.08 -- -- 7.36

497

 

Gasoline and Diesel Fuel Update (EIA)

Subdistrict IA Subdistrict IA Motor Gasoline 461,983 490,382 472,638 505,168 518,672 520,748 3,417,154 3,434,470 0.0 Regular 353,719 388,272 371,031 393,423 410,259 408,801 2,466,016 2,677,900 8.1 Conventional 77,773 76,905 72,198 84,129 87,896 94,206 454,002 567,253 24.4 Oxygenated – – – – – – – – – Reformulated 275,946 311,367 298,833 309,294 322,363 314,595 2,012,014 2,110,647 4.4 Midgrade 41,541 40,340 38,119 42,058 42,183 43,139 346,783 290,093 -16.7 Conventional 6,665 5,449 5,263 6,834 6,874 7,701 49,839 45,611 -8.9 Oxygenated – – – – – – – – – Reformulated 34,876 34,891 32,856 35,224 35,309 35,438 296,944 244,482 -18.1 Premium 66,723 61,770 63,488 69,687 66,230 68,808 604,355 466,477 -23.2

498

 

Gasoline and Diesel Fuel Update (EIA)

9 December 9 December 2009 January 2010 February 2010 March 2010 April 2010 Cumulative Year To Date 2009 Cumulative Year To Date 2010 Adjusted Year To Date % Change1 United States Motor Gasoline 10,595,653 11,183,334 10,395,207 9,851,756 11,242,824 11,144,981 42,594,767 42,634,768 0.1 Regular 9,186,805 9,685,059 9,021,930 8,535,040 9,751,214 9,660,571 36,721,980 36,968,755 0.7 Conventional 6,106,928 6,452,065 5,960,433 5,681,206 6,470,265 6,450,200 24,198,332 24,562,104 1.5 Reformulated 3,079,877 3,232,994 3,061,497 2,853,834 3,280,949 3,210,371 12,523,648 12,406,651 -0.9 Midgrade 464,446 489,811 452,262 430,593 472,620 468,316 2,002,265 1,823,791 -8.9 Conventional 345,467 364,262 338,572 327,635 357,875 357,125 1,499,825 1,381,207 -7.9

499

Nebraska Natural Gas Prices  

Gasoline and Diesel Fuel Update (EIA)

2007 2008 2009 2010 2011 2012 View 2007 2008 2009 2010 2011 2012 View History Wellhead Price 4.86 6.22 2.97 3.98 1967-2010 Pipeline and Distribution Use Price 1967-2005 Citygate Price 7.67 8.12 5.87 5.62 5.11 4.31 1984-2012 Residential Price 11.15 11.11 9.34 8.95 8.84 8.68 1967-2012 Percentage of Total Residential Deliveries included in Prices 85.7 87.1 87.8 87.4 87.3 85.8 1989-2012 Commercial Price 9.16 9.62 7.44 7.08 6.69 6.19 1967-2012 Percentage of Total Commercial Deliveries included in Prices 63.9 57.5 61.3 60.6 60.6 55.8 1990-2012 Industrial Price 7.97 9.12 6.02 5.85 5.61 4.34 1997-2012 Percentage of Total Industrial Deliveries included in Prices 9.7 10.2 8.9 8.2 7.6 6.8 1997-2012 Vehicle Fuel Price 15.10 15.29 1994-2012 Electric Power Price

500

State Nuclear Profiles 2010  

Gasoline and Diesel Fuel Update (EIA)

63 63 Wisconsin Wisconsin total electric power industry, summer capacity and net generation, by energy source, 2010 Nuclear 1,584 8.9 13,281 20.7 Coal 8,063 45.2 40,169 62.5 Hydro and Pumped Storage 492 2.8 2,112 3.3 Natural Gas 6,110 34.3 5,497 8.5 Other 1 21 0.1 63 0.1 Other Renewable 1 775 4.3 2,474 3.8 Petroleum 790 4.4 718 1.1 Total 17,836 100.0 64,314 100.0 Other Renewable: Wood, black liquor, other wood waste, biogenic municipal solid waste, landfill gas, sludge waste, agriculture byproducts, other biomass, geothermal, solar thermal, photovoltaic energy, and wind. Source: Form EIA-860, "Annual Electric Generator Report," and Form EIA-923, "Power Plant Operations Report." Share of State total (percent) 1 Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal