National Library of Energy BETA

Sample records for 7-3 8-3 b-16

  1. Beamline 8.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    1 Beamline 8.3.1 Print Tuesday, 20 October 2009 08:55 Multiple-wavelength anomalous diffraction (MAD) and macromolecular crystallography (MX) Scientific discipline: Structural...

  2. Beamline 8.3.2

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    8.3.2 Print Tuesday, 20 October 2009 08:56 Tomography Scientific disciplines: Applied science, biology, earth sciences, energy, environmental sciences, geology, cosmological...

  3. Beamline 8.3.2

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    8.3.2 Print Tomography Scientific disciplines: Applied science, biology, earth sciences, energy, environmental sciences, geology, cosmological chemistry GENERAL BEAMLINE...

  4. Beamline 8.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    8.3.1 Beamline 8.3.1 Print Tuesday, 20 October 2009 08:55 Multiple-wavelength anomalous diffraction (MAD) and macromolecular crystallography (MX) Scientific discipline: Structural biology GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (5.0 tesla, single pole) Energy range 5-17 keV (1% max flux) Monochromator Double flat crystal, Si(111) Measured flux (1.9 GeV, 400 mA) 2.5 x 1011 at 11 keV Resolving power (E/ΔE) 7,000 Divergence (max at sample) 3.0 (h) x

  5. Beamline 8.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    8.3.1 Beamline 8.3.1 Print Tuesday, 20 October 2009 08:55 Multiple-wavelength anomalous diffraction (MAD) and macromolecular crystallography (MX) Scientific discipline: Structural biology GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (5.0 tesla, single pole) Energy range 5-17 keV (1% max flux) Monochromator Double flat crystal, Si(111) Measured flux (1.9 GeV, 400 mA) 2.5 x 1011 at 11 keV Resolving power (E/ΔE) 7,000 Divergence (max at sample) 3.0 (h) x

  6. Beamline 8.3.2

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3.2 Beamline 8.3.2 Print Tuesday, 20 October 2009 08:56 Tomography Scientific disciplines: Applied science, biology, earth sciences, energy, environmental sciences, geology, cosmological chemistry GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (1.9 GeV, 4.37 tesla) Energy range 6-46 keV ML mode Monochromator None or two ML or two Si(111) Flux (1.9 GeV, 500 mA) ~105hv/sec/µm2 in ML mode Resolving power (E/ΔE) White beam/ 1% / 0.02% Endstation 12 x 3 ft

  7. Beamline 7.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7.3.1 Print Photoemission electron microscope PEEM2 Scientific disciplines: Magnetism, materials, surface science, polymers Note: This beamline is NOT open to general users....

  8. Beamline 7.3.3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7.3.3 Beamline 7.3.3 Print Tuesday, 20 October 2009 08:50 Small- and Wide-Angle X-Ray Scattering (SAXS/WAXS/Protein SAXS)* Scientific disciplines: Polymer science, materials science, proteins, surface science GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Bend magnet Energy range 10 keV Monochromator Mo/B4C double multilayer monochromator Measured flux (1.9 GeV, 400 mA) 1012 photons/s Resolving power (E/ΔE) 100 Detectors Pilatus 1M, Pilatus 100K, Pilatus 300KW, 2x ADSC

  9. TableHC8.3.xls

    U.S. Energy Information Administration (EIA) Indexed Site

    7.1 19.0 22.7 22.3 Household Size 1 Person.......................................................................... 30.0 14.7 5.1 5.1 5.1 2 Persons........................................................................ 34.8 12.8 6.1 7.5 8.5 3 Persons........................................................................ 18.4 7.6 3.0 3.8 3.9 4 Persons........................................................................ 15.9 6.8 2.6 3.3 3.1 5

  10. Beamline 7.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7.3.1 Print Photoemission electron microscope PEEM2 Scientific disciplines: Magnetism, materials, surface science, polymers Note: This beamline is NOT open to general users. GENERAL BEAMLINE INFORMATION Operational Yes, but not open to users Source characteristics Bend magnet Energy range 180-1500 eV Monochromator SGM Calculated flux (1.9 GeV, 400 mA) 3 x 1012 photons/s/0.1%BW at 800 eV (linearly polarized) Resolving power (E/ΔE) 1,000 Endstations Photoemission electron microscope (PEEM2)

  11. Beamline 7.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7.3.1 Print Photoemission electron microscope PEEM2 Scientific disciplines: Magnetism, materials, surface science, polymers Note: This beamline is NOT open to general users. GENERAL BEAMLINE INFORMATION Operational Yes, but not open to users Source characteristics Bend magnet Energy range 180-1500 eV Monochromator SGM Calculated flux (1.9 GeV, 400 mA) 3 x 1012 photons/s/0.1%BW at 800 eV (linearly polarized) Resolving power (E/ΔE) 1,000 Endstations Photoemission electron microscope (PEEM2)

  12. Beamline 7.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7.3.1 Print Photoemission electron microscope PEEM2 Scientific disciplines: Magnetism, materials, surface science, polymers Note: This beamline is NOT open to general users. GENERAL BEAMLINE INFORMATION Operational Yes, but not open to users Source characteristics Bend magnet Energy range 180-1500 eV Monochromator SGM Calculated flux (1.9 GeV, 400 mA) 3 x 1012 photons/s/0.1%BW at 800 eV (linearly polarized) Resolving power (E/ΔE) 1,000 Endstations Photoemission electron microscope (PEEM2)

  13. Beamline 7.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7.3.1 Print Photoemission electron microscope PEEM2 Scientific disciplines: Magnetism, materials, surface science, polymers Note: This beamline is NOT open to general users. GENERAL BEAMLINE INFORMATION Operational Yes, but not open to users Source characteristics Bend magnet Energy range 180-1500 eV Monochromator SGM Calculated flux (1.9 GeV, 400 mA) 3 x 1012 photons/s/0.1%BW at 800 eV (linearly polarized) Resolving power (E/ΔE) 1,000 Endstations Photoemission electron microscope (PEEM2)

  14. Beamline 7.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7.3.1 Print Photoemission electron microscope PEEM2 Scientific disciplines: Magnetism, materials, surface science, polymers Note: This beamline is NOT open to general users. GENERAL BEAMLINE INFORMATION Operational Yes, but not open to users Source characteristics Bend magnet Energy range 180-1500 eV Monochromator SGM Calculated flux (1.9 GeV, 400 mA) 3 x 1012 photons/s/0.1%BW at 800 eV (linearly polarized) Resolving power (E/ΔE) 1,000 Endstations Photoemission electron microscope (PEEM2)

  15. Beamline 7.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7.3.1 Print Photoemission electron microscope PEEM2 Scientific disciplines: Magnetism, materials, surface science, polymers Note: This beamline is NOT open to general users. GENERAL BEAMLINE INFORMATION Operational Yes, but not open to users Source characteristics Bend magnet Energy range 180-1500 eV Monochromator SGM Calculated flux (1.9 GeV, 400 mA) 3 x 1012 photons/s/0.1%BW at 800 eV (linearly polarized) Resolving power (E/ΔE) 1,000 Endstations Photoemission electron microscope (PEEM2)

  16. Beamline 7.3.3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7.3.3 Print Small- and Wide-Angle X-Ray Scattering (SAXS/WAXS/Protein SAXS)* Scientific disciplines: Polymer science, materials science, proteins, surface science GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Bend magnet Energy range 10 keV Monochromator Mo/B4C double multilayer monochromator Measured flux (1.9 GeV, 400 mA) 1012 photons/s Resolving power (E/ΔE) 100 Detectors Pilatus 1M, Pilatus 100K, Pilatus 300KW, 2x ADSC Quantum 4u Spot size at sample 1 mm x 0.8 mm

  17. Beamline 7.3.3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7.3.3 Print Small- and Wide-Angle X-Ray Scattering (SAXS/WAXS/Protein SAXS)* Scientific disciplines: Polymer science, materials science, proteins, surface science GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Bend magnet Energy range 10 keV Monochromator Mo/B4C double multilayer monochromator Measured flux (1.9 GeV, 400 mA) 1012 photons/s Resolving power (E/ΔE) 100 Detectors Pilatus 1M, Pilatus 100K, Pilatus 300KW, 2x ADSC Quantum 4u Spot size at sample 1 mm x 0.8 mm

  18. Beamline 7.3.3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7.3.3 Print Small- and Wide-Angle X-Ray Scattering (SAXS/WAXS/Protein SAXS)* Scientific disciplines: Polymer science, materials science, proteins, surface science GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Bend magnet Energy range 10 keV Monochromator Mo/B4C double multilayer monochromator Measured flux (1.9 GeV, 400 mA) 1012 photons/s Resolving power (E/ΔE) 100 Detectors Pilatus 1M, Pilatus 100K, Pilatus 300KW, 2x ADSC Quantum 4u Spot size at sample 1 mm x 0.8 mm

  19. Beamline 7.3.3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7.3.3 Print Small- and Wide-Angle X-Ray Scattering (SAXS/WAXS/Protein SAXS)* Scientific disciplines: Polymer science, materials science, proteins, surface science GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Bend magnet Energy range 10 keV Monochromator Mo/B4C double multilayer monochromator Measured flux (1.9 GeV, 400 mA) 1012 photons/s Resolving power (E/ΔE) 100 Detectors Pilatus 1M, Pilatus 100K, Pilatus 300KW, 2x ADSC Quantum 4u Spot size at sample 1 mm x 0.8 mm

  20. Beamline 7.3.3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7.3.3 Print Small- and Wide-Angle X-Ray Scattering (SAXS/WAXS/Protein SAXS)* Scientific disciplines: Polymer science, materials science, proteins, surface science GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Bend magnet Energy range 10 keV Monochromator Mo/B4C double multilayer monochromator Measured flux (1.9 GeV, 400 mA) 1012 photons/s Resolving power (E/ΔE) 100 Detectors Pilatus 1M, Pilatus 100K, Pilatus 300KW, 2x ADSC Quantum 4u Spot size at sample 1 mm x 0.8 mm

  1. Beamline 7.3.3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7.3.3 Print Small- and Wide-Angle X-Ray Scattering (SAXS/WAXS/Protein SAXS)* Scientific disciplines: Polymer science, materials science, proteins, surface science GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Bend magnet Energy range 10 keV Monochromator Mo/B4C double multilayer monochromator Measured flux (1.9 GeV, 400 mA) 1012 photons/s Resolving power (E/ΔE) 100 Detectors Pilatus 1M, Pilatus 100K, Pilatus 300KW, 2x ADSC Quantum 4u Spot size at sample 1 mm x 0.8 mm

  2. Beamline 7.3.3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3.3 Beamline 7.3.3 Print Tuesday, 20 October 2009 08:50 Small- and Wide-Angle X-Ray Scattering (SAXS/WAXS/Protein SAXS)* Scientific disciplines: Polymer science, materials science, proteins, surface science GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Bend magnet Energy range 10 keV Monochromator Mo/B4C double multilayer monochromator Measured flux (1.9 GeV, 400 mA) 1012 photons/s Resolving power (E/ΔE) 100 Detectors Pilatus 1M, Pilatus 100K, Pilatus 300KW, 2x ADSC

  3. Beamline 7.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7.3.1 Print Photoemission electron microscope PEEM2 Scientific disciplines: Magnetism, materials, surface science, polymers Note: This beamline is NOT open to general users. GENERAL BEAMLINE INFORMATION Operational Yes, but not open to users Source characteristics Bend magnet Energy range 180-1500 eV Monochromator SGM Calculated flux (1.9 GeV, 400 mA) 3 x 1012 photons/s/0.1%BW at 800 eV (linearly polarized) Resolving power (E/ΔE) 1,000 Endstations Photoemission electron microscope (PEEM2)

  4. TableHC7.3.xls

    U.S. Energy Information Administration (EIA) Indexed Site

    Household Size 1 Person..................................................... 30.0 13.5 8.5 4.3 2.0 1.8 5.9 13.1 2 Persons................................................... 34.8 6.0 8.8 7.3 4.4 8.4 3.5 8.4 3 Persons................................................... 18.4 3.1 4.7 3.4 2.5 4.6 2.0 5.8 4 Persons................................................... 15.9 2.2 3.5 3.3 2.7 4.3 2.2 5.1 5 Persons................................................... 7.9 1.1 2.1 1.5 1.1 2.1 1.7 3.7 6 or More

  5. MPI errors from cray-mpich/7.3.0

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    MPI errors from cray-mpich7.3.0 MPI errors from cray-mpich7.3.0 January 6, 2016 by Ankit Bhagatwala A change in the MPICH2 library that now strictly enforces non-overlapping...

  6. b16.xls

    U.S. Energy Information Administration (EIA) Indexed Site

    ... 2,782 938 1,542 2,364 1,628 1,300 1,991 District Heat ......1,884 3,588 3,556 3,401 4,869 Packaged Heating Units ...... 18,021 2,269 ...

  7. b16.pdf

    U.S. Energy Information Administration (EIA) Indexed Site

    ... All Buildings All Buildings Energy Information Administration 1999 Commercial Buildings ... 186 186 Q 1,907 1,907 Q Health Care Complex ......

  8. MPI errors from cray-mpich/7.3.0

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    MPI errors from cray-mpich/7.3.0 MPI errors from cray-mpich/7.3.0 January 6, 2016 by Ankit Bhagatwala A change in the MPICH2 library that now strictly enforces non-overlapping buffers in MPI collectives may cause some MPI applications that use overlapping buffers to fail at runtime. As an example, one of the routines affected is MPI_ALLGATHER. There are several possible fixes. The cleanest one is to specify MPI_IN_PLACE instead of the address of the send buffer for cases where sendbuf and

  9. The cce/8.3.0 C++ compiler may run into a linking error on Edison

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    The cce8.3.0 C++ compiler may run into a linking error on Edison The cce8.3.0 C++ compiler may run into a linking error on Edison July 1, 2014 You may run into the following...

  10. Table 8.3a Useful Thermal Output at Combined-Heat-and-Power Plants: Total (All Sectors), 1989-2011 (Sum of Tables 8.3b and 8.3c; Billion Btu)

    U.S. Energy Information Administration (EIA) Indexed Site

    a Useful Thermal Output at Combined-Heat-and-Power Plants: Total (All Sectors), 1989-2011 (Sum of Tables 8.3b and 8.3c; Billion Btu) Year Fossil Fuels Renewable Energy Other 7 Total Coal 1 Petroleum 2 Natural Gas 3 Other Gases 4 Total Biomass Total Wood 5 Waste 6 1989 323,191 95,675 461,905 92,556 973,327 546,354 30,217 576,571 39,041 1,588,939 1990 362,524 127,183 538,063 140,695 1,168,465 650,572 36,433 687,005 40,149 1,895,619 1991 351,834 112,144 546,755 148,216 1,158,949 623,442 36,649

  11. U.S. Secretary of Energy Concludes Productive G8+3 Energy Ministerial...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Meeting in Japan U.S. Secretary of Energy Concludes Productive G8+3 Energy Ministerial Meeting in Japan June 8, 2008 - 12:51pm Addthis WASHINGTON- U.S. Secretary of Energy ...

  12. LFS Exhibit A General Conditions (Rev. 8.3, 9-27-13)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    on claims shall be paid at the rate established by the Secretary of the Treasury of the United States pursuant to Public Law 92-41 (85 Stat. 97). LFS Ex A (Rev. 8.3, 92713)...

  13. Tax Deduction Qualified Software: EnergyPlus Version 8.3.0

    Broader source: Energy.gov [DOE]

    Provides required documentation that EnergyPlus version 8.3.0 meets Internal Revenue Code §179D, Notice 2006-52, dated June 2, 2006, for calculating commercial building energy and power cost savings.

  14. Acquisition Guide Chapter 7.3:Acquisition Planning in the M&O Environment

    Broader source: Energy.gov [DOE]

    Acquisition Letter 2013-03, Acquisition Planning Considerations for M&O Contracts, has been moved to the Acquisition Guide as chapter (7.3).

  15. Jefferson Lab awards $7.3 million construction contract to Chesapeake firm

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    | Jefferson Lab awards $7.3 million construction contract to Chesapeake firm This artist's rendering shows what the completed addition will look like. A print quality file of this graphic may be downloaded from JPIX. Jefferson Lab awards $7.3 million construction contract to Chesapeake firm June 15, 2004 Newport News, VA. - On June 7, the Department of Energy's Jefferson Lab awarded a $7.3 million construction project to Mid Eastern Builders, Inc. of Chesapeake, Va. The contract is to build

  16. DOE Selects Projects for Up to $7.3 Million for R&D Clean Technology...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Power Projects September 18, 2008 - 3:43pm Addthis WASHINGTON - The U.S. Department of Energy (DOE) today announced the selection of projects for negotiation of award of up to 7.3...

  17. TM Exhibit A General Conditions (Rev. 7.3, 9-27-13)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    on claims shall be paid at the rate established by the Secretary of the Treasury of the United States pursuant to Public Law 92-41 (85 Stat. 97). T&M Ex A (Rev. 7.3, 92713)...

  18. Building America Best Practices Series, Volume 7.3: Guide to Determining

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Climate Regions by County | Department of Energy Series, Volume 7.3: Guide to Determining Climate Regions by County Building America Best Practices Series, Volume 7.3: Guide to Determining Climate Regions by County This report describes the climate zone designations used by the U.S. Department of Energy Building America Program, and is intended to help builders to identify the appropriate climate designation for the counties in which they are building. PDF icon Guide to Determining Climate

  19. MPI-3 Atomic Performance Degradation since cray-mpich/7.3.0

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    MPI-3 Atomic Performance Degradation since cray-mpich/7.3.0 MPI-3 Atomic Performance Degradation since cray-mpich/7.3.0 March 7, 2016 by Thorsten Kurth Apparently, after the integration of MPI-3.2 into cray-mpich, Cray also had to implement a workaround which significantly degrades the performance for short message MPI-3 atomics. In order to solve that problem, set the following two environment variables export MPICH_RMA_OVER_DMAPP=1 export MPICH_RMA_USE_NETWORK_AMO=1 and additionally link your

  20. NCIPO Ex A (Rev. 2.7, 3/26/15) Exhibit A General Conditions

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7, 3/26/15) Exhibit A General Conditions Page 1 of 16 EXHIBIT "A" GENERAL CONDITIONS TABLE OF CONTENTS GC Title Page GC-1B DEFINITIONS (Jan 2010) .......................................................................................................... 2 GC-2B CORRESPONDENCE AND SUBCONTRACT INTERPRETATION (Jan 2010) ....................... 2 GC-5 NOTICE TO PROCEED (Jul 2011) ........................................................................................... 2 GC-6A ORDER OF

  1. Table 8.3b Useful Thermal Output at Combined-Heat-and-Power Plants: Electric Power Sector, 1989-2011 (Subset of Table 8.3a; Billion Btu)

    U.S. Energy Information Administration (EIA) Indexed Site

    b Useful Thermal Output at Combined-Heat-and-Power Plants: Electric Power Sector, 1989-2011 (Subset of Table 8.3a; Billion Btu) Year Fossil Fuels Renewable Energy Other 7 Total Coal 1 Petroleum 2 Natural Gas 3 Other Gases 4 Total Biomass Total Wood 5 Waste 6 1989 12,768 8,013 66,801 2,243 89,825 19,346 4,550 23,896 679 114,400 1990 20,793 9,029 79,905 3,822 113,549 18,091 6,418 24,509 28 138,086 1991 21,239 5,502 82,279 3,940 112,960 17,166 9,127 26,293 590 139,843 1992 27,545 6,123 101,923

  2. Table 8.3c Useful Thermal Output at Combined-Heat-and-Power Plants: Commercial and Industrial Sectors, 1989-2011 (Subset of Table 8.3a; Billion Btu)

    U.S. Energy Information Administration (EIA) Indexed Site

    c Useful Thermal Output at Combined-Heat-and-Power Plants: Commercial and Industrial Sectors, 1989-2011 (Subset of Table 8.3a; Billion Btu) Year Fossil Fuels Renewable Energy Other 7 Total Coal 1 Petroleum 2 Natural Gas 3 Other Gases 4 Total Biomass Total Wood 5 Waste 6 Commercial Sector 8<//td> 1989 13,517 3,896 9,920 102 27,435 145 10,305 10,450 – 37,885 1990 14,670 5,406 15,515 118 35,709 387 10,193 10,580 – 46,289 1991 15,967 3,684 20,809 118 40,578 169 8,980 9,149 1 49,728 1992

  3. DOE Selects Projects for Up to $7.3 Million for R&D Clean Technology Water

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Power Projects | Department of Energy Up to $7.3 Million for R&D Clean Technology Water Power Projects DOE Selects Projects for Up to $7.3 Million for R&D Clean Technology Water Power Projects September 18, 2008 - 3:43pm Addthis WASHINGTON - The U.S. Department of Energy (DOE) today announced the selection of projects for negotiation of award of up to $7.3 million to 14 research teams, with a cost-shared value of over $18 million, under the DOE's competitive solicitation for Advanced

  4. MELCOR computer code manuals: Primer and user`s guides, Version 1.8.3 September 1994. Volume 1

    SciTech Connect (OSTI)

    Summers, R.M.; Cole, R.K. Jr.; Smith, R.C.; Stuart, D.S.; Thompson, S.L.; Hodge, S.A.; Hyman, C.R.; Sanders, R.L.

    1995-03-01

    MELCOR is a fully integrated, engineering-level computer code that models the progression of severe accidents in light water reactor nuclear power plants. MELCOR is being developed at Sandia National Laboratories for the US Nuclear Regulatory Commission as a second-generation plant risk assessment tool and the successor to the Source Term Code Package. A broad spectrum of severe accident phenomena in both boiling and pressurized water reactors is treated in MELCOR in a unified framework. These include: thermal-hydraulic response in the reactor coolant system, reactor cavity, containment, and confinement buildings; core heatup, degradation, and relocation; core-concrete attack; hydrogen production, transport, and combustion; fission product release and transport; and the impact of engineered safety features on thermal-hydraulic and radionuclide behavior. Current uses of MELCOR include estimation of severe accident source terms and their sensitivities and uncertainties in a variety of applications. This publication of the MELCOR computer code manuals corresponds to MELCOR 1.8.3, released to users in August, 1994. Volume 1 contains a primer that describes MELCOR`s phenomenological scope, organization (by package), and documentation. The remainder of Volume 1 contains the MELCOR Users` Guides, which provide the input instructions and guidelines for each package. Volume 2 contains the MELCOR Reference Manuals, which describe the phenomenological models that have been implemented in each package.

  5. Radiological Survey Tool Set for ArcGIS 8.3 and ArcPad 6.0

    SciTech Connect (OSTI)

    ROGER, COTTRELL

    2004-11-30

    The Radiological Control Operations (RCO) group at the Savannah River Site (SRS) is tasked with conducting routine surveys for the detection of radiological contaminants in the environment. The Radiological Survey Tool Set (RSTS) was developed by the Environmental & Geographic Information Systems (EGIS) group of SRS to assist RCO personnel in this survey process. The tool set consists of two major components. The first component is a custom extension for ArcGIS 8.3 that allows the user to interactively create a sampling plan prior to entering the field. Additionally, the extension allows the user to upload field-collected data to the GIS with post-processing functionality. The second component is a custom ArcPad 6.0 applet. This applet provides the user with navigational capabilities to a selected origin point with the help of Global Positioning Systems (GPS) technology, and the recording of the sample data results into a hand-held field computer via ArcPad 6.0 software.

  6. Photolysis rates in correlated overlapping cloud fields: Cloud-J 7.3c

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Prather, M. J.

    2015-08-14

    A new approach for modeling photolysis rates (J values) in atmospheres with fractional cloud cover has been developed and is implemented as Cloud-J – a multi-scattering eight-stream radiative transfer model for solar radiation based on Fast-J. Using observations of the vertical correlation of cloud layers, Cloud-J 7.3c provides a practical and accurate method for modeling atmospheric chemistry. The combination of the new maximum-correlated cloud groups with the integration over all cloud combinations by four quadrature atmospheres produces mean J values in an atmospheric column with root mean square (rms) errors of 4 % or less compared with 10–20 % errorsmore » using simpler approximations. Cloud-J is practical for chemistry–climate models, requiring only an average of 2.8 Fast-J calls per atmosphere vs. hundreds of calls with the correlated cloud groups, or 1 call with the simplest cloud approximations. Another improvement in modeling J values, the treatment of volatile organic compounds with pressure-dependent cross sections, is also incorporated into Cloud-J.« less

  7. Photolysis rates in correlated overlapping cloud fields: Cloud-J 7.3

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Prather, M. J.

    2015-05-27

    A new approach for modeling photolysis rates (J values) in atmospheres with fractional cloud cover has been developed and implemented as Cloud-J – a multi-scattering eight-stream radiative transfer model for solar radiation based on Fast-J. Using observed statistics for the vertical correlation of cloud layers, Cloud-J 7.3 provides a practical and accurate method for modeling atmospheric chemistry. The combination of the new maximum-correlated cloud groups with the integration over all cloud combinations represented by four quadrature atmospheres produces mean J values in an atmospheric column with root-mean-square errors of 4% or less compared with 10–20% errors using simpler approximations. Cloud-Jmore » is practical for chemistry-climate models, requiring only an average of 2.8 Fast-J calls per atmosphere, vs. hundreds of calls with the correlated cloud groups, or 1 call with the simplest cloud approximations. Another improvement in modeling J values, the treatment of volatile organic compounds with pressure-dependent cross sections is also incorporated into Cloud-J.« less

  8. Beamline 8.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Optional unit may be installed in hutch upon advance request. Sample format SBS compliant crystallization trays oriented 90 degrees to gravity. Trays that limit the...

  9. Beamline 8.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    handling automation "Cool Hand Luke" robot accepts all major pin types (Hampton, Yale, SPINE, etc.) and lengths (10-24 mm) and supports "delayed data collection mode" where data...

  10. Beamline 8.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (5.0 tesla, single pole) Energy range 5-17 keV (1% max flux) Monochromator Double flat crystal,...

  11. Beamline 8.3.2

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    INFORMATION Operational Yes Source characteristics Superbend magnet (1.9 GeV, 4.37 tesla) Energy range 6-46 keV ML mode Monochromator None or two ML or two Si(111) Flux (1.9...

  12. Beamline 8.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    1 Print Multiple-wavelength anomalous diffraction (MAD) and macromolecular crystallography (MX) Scientific discipline: Structural biology GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (5.0 tesla, single pole) Energy range 5-17 keV (1% max flux) Monochromator Double flat crystal, Si(111) Measured flux (1.9 GeV, 400 mA) 2.5 x 1011 at 11 keV Resolving power (E/ΔE) 7,000 Divergence (max at sample) 3.0 (h) x 0.35 (v) mrad Endstations Minihutch Detectors 3 x 3

  13. Beamline 8.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    1 Print Multiple-wavelength anomalous diffraction (MAD) and macromolecular crystallography (MX) Scientific discipline: Structural biology GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (5.0 tesla, single pole) Energy range 5-17 keV (1% max flux) Monochromator Double flat crystal, Si(111) Measured flux (1.9 GeV, 400 mA) 2.5 x 1011 at 11 keV Resolving power (E/ΔE) 7,000 Divergence (max at sample) 3.0 (h) x 0.35 (v) mrad Endstations Minihutch Detectors 3 x 3

  14. Beamline 8.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3.1 Print Multiple-wavelength anomalous diffraction (MAD) and macromolecular crystallography (MX) Scientific discipline: Structural biology GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (5.0 tesla, single pole) Energy range 5-17 keV (1% max flux) Monochromator Double flat crystal, Si(111) Measured flux (1.9 GeV, 400 mA) 2.5 x 1011 at 11 keV Resolving power (E/ΔE) 7,000 Divergence (max at sample) 3.0 (h) x 0.35 (v) mrad Endstations Minihutch Detectors 3 x 3

  15. Beamline 8.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    1 Print Multiple-wavelength anomalous diffraction (MAD) and macromolecular crystallography (MX) Scientific discipline: Structural biology GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (5.0 tesla, single pole) Energy range 5-17 keV (1% max flux) Monochromator Double flat crystal, Si(111) Measured flux (1.9 GeV, 400 mA) 2.5 x 1011 at 11 keV Resolving power (E/ΔE) 7,000 Divergence (max at sample) 3.0 (h) x 0.35 (v) mrad Endstations Minihutch Detectors 3 x 3

  16. Beamline 8.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    1 Print Multiple-wavelength anomalous diffraction (MAD) and macromolecular crystallography (MX) Scientific discipline: Structural biology GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (5.0 tesla, single pole) Energy range 5-17 keV (1% max flux) Monochromator Double flat crystal, Si(111) Measured flux (1.9 GeV, 400 mA) 2.5 x 1011 at 11 keV Resolving power (E/ΔE) 7,000 Divergence (max at sample) 3.0 (h) x 0.35 (v) mrad Endstations Minihutch Detectors 3 x 3

  17. Beamline 8.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    1 Print Multiple-wavelength anomalous diffraction (MAD) and macromolecular crystallography (MX) Scientific discipline: Structural biology GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (5.0 tesla, single pole) Energy range 5-17 keV (1% max flux) Monochromator Double flat crystal, Si(111) Measured flux (1.9 GeV, 400 mA) 2.5 x 1011 at 11 keV Resolving power (E/ΔE) 7,000 Divergence (max at sample) 3.0 (h) x 0.35 (v) mrad Endstations Minihutch Detectors 3 x 3

  18. Beamline 8.3.2

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3.2 Print Tomography Scientific disciplines: Applied science, biology, earth sciences, energy, environmental sciences, geology, cosmological chemistry GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (1.9 GeV, 4.37 tesla) Energy range 6-46 keV ML mode Monochromator None or two ML or two Si(111) Flux (1.9 GeV, 500 mA) ~105hv/sec/µm2 in ML mode Resolving power (E/ΔE) White beam/ 1% / 0.02% Endstation 12 x 3 ft optical table in hutch for radiography and

  19. Beamline 8.3.2

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3.2 Print Tomography Scientific disciplines: Applied science, biology, earth sciences, energy, environmental sciences, geology, cosmological chemistry GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (1.9 GeV, 4.37 tesla) Energy range 6-46 keV ML mode Monochromator None or two ML or two Si(111) Flux (1.9 GeV, 500 mA) ~105hv/sec/µm2 in ML mode Resolving power (E/ΔE) White beam/ 1% / 0.02% Endstation 12 x 3 ft optical table in hutch for radiography and

  20. Beamline 8.3.2

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2 Print Tomography Scientific disciplines: Applied science, biology, earth sciences, energy, environmental sciences, geology, cosmological chemistry GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (1.9 GeV, 4.37 tesla) Energy range 6-46 keV ML mode Monochromator None or two ML or two Si(111) Flux (1.9 GeV, 500 mA) ~105hv/sec/µm2 in ML mode Resolving power (E/ΔE) White beam/ 1% / 0.02% Endstation 12 x 3 ft optical table in hutch for radiography and

  1. Beamline 8.3.2

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2 Print Tomography Scientific disciplines: Applied science, biology, earth sciences, energy, environmental sciences, geology, cosmological chemistry GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (1.9 GeV, 4.37 tesla) Energy range 6-46 keV ML mode Monochromator None or two ML or two Si(111) Flux (1.9 GeV, 500 mA) ~105hv/sec/µm2 in ML mode Resolving power (E/ΔE) White beam/ 1% / 0.02% Endstation 12 x 3 ft optical table in hutch for radiography and

  2. Beamline 8.3.2

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2 Print Tomography Scientific disciplines: Applied science, biology, earth sciences, energy, environmental sciences, geology, cosmological chemistry GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (1.9 GeV, 4.37 tesla) Energy range 6-46 keV ML mode Monochromator None or two ML or two Si(111) Flux (1.9 GeV, 500 mA) ~105hv/sec/µm2 in ML mode Resolving power (E/ΔE) White beam/ 1% / 0.02% Endstation 12 x 3 ft optical table in hutch for radiography and

  3. Beamline 8.3.2

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3.2 Print Tomography Scientific disciplines: Applied science, biology, earth sciences, energy, environmental sciences, geology, cosmological chemistry GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (1.9 GeV, 4.37 tesla) Energy range 6-46 keV ML mode Monochromator None or two ML or two Si(111) Flux (1.9 GeV, 500 mA) ~105hv/sec/µm2 in ML mode Resolving power (E/ΔE) White beam/ 1% / 0.02% Endstation 12 x 3 ft optical table in hutch for radiography and

  4. Beamline 8.3.2

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2 Print Tomography Scientific disciplines: Applied science, biology, earth sciences, energy, environmental sciences, geology, cosmological chemistry GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (1.9 GeV, 4.37 tesla) Energy range 6-46 keV ML mode Monochromator None or two ML or two Si(111) Flux (1.9 GeV, 500 mA) ~105hv/sec/µm2 in ML mode Resolving power (E/ΔE) White beam/ 1% / 0.02% Endstation 12 x 3 ft optical table in hutch for radiography and

  5. Beamline 8.3.2

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2 Print Tomography Scientific disciplines: Applied science, biology, earth sciences, energy, environmental sciences, geology, cosmological chemistry GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (1.9 GeV, 4.37 tesla) Energy range 6-46 keV ML mode Monochromator None or two ML or two Si(111) Flux (1.9 GeV, 500 mA) ~105hv/sec/µm2 in ML mode Resolving power (E/ΔE) White beam/ 1% / 0.02% Endstation 12 x 3 ft optical table in hutch for radiography and

  6. Beamline 8.3.2

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2 Print Tomography Scientific disciplines: Applied science, biology, earth sciences, energy, environmental sciences, geology, cosmological chemistry GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (1.9 GeV, 4.37 tesla) Energy range 6-46 keV ML mode Monochromator None or two ML or two Si(111) Flux (1.9 GeV, 500 mA) ~105hv/sec/µm2 in ML mode Resolving power (E/ΔE) White beam/ 1% / 0.02% Endstation 12 x 3 ft optical table in hutch for radiography and

  7. Beamline 8.3.2

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2 Print Tomography Scientific disciplines: Applied science, biology, earth sciences, energy, environmental sciences, geology, cosmological chemistry GENERAL BEAMLINE INFORMATION...

  8. Beamline 8.3.2

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3.2 Print Tomography Scientific disciplines: Applied science, biology, earth sciences, energy, environmental sciences, geology, cosmological chemistry GENERAL BEAMLINE INFORMATION...

  9. Beamline 8.3.2

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    disciplines: Applied science, biology, earth sciences, energy, environmental sciences, geology, cosmological chemistry GENERAL BEAMLINE INFORMATION Operational Yes Source...

  10. SASproperty8_3_09

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    04/09 Property List for RO Code '13' 1 BARCODE DESCRIPTION MANUF. MODEL COST 0000016386 COMPUTER PERSONAL E4 GATEWAY E4100 P4/2.4 $1,078.38 0000031152 LaCie 2TB Gigabit Et LACIE 300961 $999.00 S7237 KODAK PHOTO CD PLAYE KODAK N/A $449.00 0000017846 PRESS BRIDGE VIDEO/A OPAMP LABS VA-8 $1,195.00 0000021344 COMPUTER GATEWAY E-4 GATEWAY E-4500 D $735.00 0000015660 COMPUTER PERSONAL E- GATEWAY E-4000 P4/1.8 $950.00 0000021059 MACKIE AUDIO MIXER ( MACKIE 1402VLZ PRO $399.00 0000030017 CAMCORDER

  11. Beamline 8.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    1 Print Multiple-wavelength anomalous diffraction (MAD) and macromolecular crystallography (MX) Scientific discipline: Structural biology GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (5.0 tesla, single pole) Energy range 5-17 keV (1% max flux) Monochromator Double flat crystal, Si(111) Measured flux (1.9 GeV, 400 mA) 2.5 x 1011 at 11 keV Resolving power (E/ΔE) 7,000 Divergence (max at sample) 3.0 (h) x 0.35 (v) mrad Endstations Minihutch Detectors 3 x 3

  12. Beamline 8.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    1 Print Multiple-wavelength anomalous diffraction (MAD) and macromolecular crystallography (MX) Scientific discipline: Structural biology GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (5.0 tesla, single pole) Energy range 5-17 keV (1% max flux) Monochromator Double flat crystal, Si(111) Measured flux (1.9 GeV, 400 mA) 2.5 x 1011 at 11 keV Resolving power (E/ΔE) 7,000 Divergence (max at sample) 3.0 (h) x 0.35 (v) mrad Endstations Minihutch Detectors 3 x 3

  13. Beamline 8.3.2

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2 Print Tomography Scientific disciplines: Applied science, biology, earth sciences, energy, environmental sciences, geology, cosmological chemistry GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (1.9 GeV, 4.37 tesla) Energy range 6-46 keV ML mode Monochromator None or two ML or two Si(111) Flux (1.9 GeV, 500 mA) ~105hv/sec/µm2 in ML mode Resolving power (E/ΔE) White beam/ 1% / 0.02% Endstation 12 x 3 ft optical table in hutch for radiography and

  14. Beamline 8.3.2

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2 Print Tomography Scientific disciplines: Applied science, biology, earth sciences, energy, environmental sciences, geology, cosmological chemistry GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (1.9 GeV, 4.37 tesla) Energy range 6-46 keV ML mode Monochromator None or two ML or two Si(111) Flux (1.9 GeV, 500 mA) ~105hv/sec/µm2 in ML mode Resolving power (E/ΔE) White beam/ 1% / 0.02% Endstation 12 x 3 ft optical table in hutch for radiography and

  15. TTW 8-3-06

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ... By 3:00 p.m. the next day, WIPP Laboratories had results for isotopes of americium, uranium, plutonium and thorium. Not only were the results obtained quickly, Akbazadeh says they ...

  16. SASproperty8_3_09

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    09 Property List for RO Code '13' 1 BARCODE DESCRIPTION MANUF. MODEL COST 0000016386 COMPUTER PERSONAL E4 GATEWAY E4100 P42.4 1,078.38 0000031152 LaCie 2TB Gigabit Et LACIE...

  17. BEAMLINE 7-3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3 CURRENT STATUS: Open SUPPORTED TECHNIQUES: X-ray absorption spectroscopy MAIN SCIENTIFIC DISCIPLINES: Structural Biology % TIME GENERAL USE: 100% SCHEDULING: Proposal Submittal and Scheduling Procedures Current SPEAR and Beam Line Schedules SOURCE: 20-pole, 2-Tesla wiggler, 0.8 mrad beam, side station BEAM LINE SPECIFICATIONS: energy range resolution DE/E spot size (fwhm) flux* angular acceptance unfocused 4600-37000 eV 1 x 10-4 2 x 15 mm2 ~1 x 1012 0.8 mrad *ph/sec @100 mA / 9 keV w 2x15 mm

  18. Site characterization plan: Yucca Mountain Site, Nevada Research and Development Area, Nevada: Volume 4, Part B: Chapter 8, Sections 8.0 through 8.3.1.4

    SciTech Connect (OSTI)

    NONE

    1988-12-01

    This site characterization plan (SCP) has been developed for the candidate repository site at Yucca Mountain in the State of Nevada. The SCP includes a description of the Yucca Mountain site (Chapters 1-5), a conceptual design for the repository (Chapter 6), a description of the packaging to be used for the waste to be emplaced in the repository (Chapter 7), and a description of the planned site characterization activities (Chapter 8). The schedules and milestones presented in Sections 8.3 and 8.5 of the SCP were developed to be consistent with the June 1988 draft Amendment to the DOE`s Mission Plan for the Civilian Radioactive Waste Management Program. The five month delay in the scheduled start of exploratory shaft construction that was announced recently is not reflected in these schedules. 74 figs., 32 tabs.

  19. Accelerated evolution of the Ly? luminosity function at z ? 7 revealed by the Subaru ultra-deep survey for Ly? emitters at z = 7.3

    SciTech Connect (OSTI)

    Konno, Akira; Ouchi, Masami; Ono, Yoshiaki; Shibuya, Takatoshi; Naito, Yoshiaki; Momose, Rieko; Yuma, Suraphong; Shimasaku, Kazuhiro; Nakajima, Kimihiko; Furusawa, Hisanori; Iye, Masanori

    2014-12-10

    We present the ultra-deep Subaru narrowband imaging survey for Ly? emitters (LAEs) at z = 7.3 in the Subaru/XMM-Newton Deep Survey (SXDS) and Cosmic Evolution Survey (COSMOS) fields (?0.5 deg{sup 2}) with a total integration time of 106 hr. Exploiting our new sharp bandwidth filter, NB101, installed on the Suprime-Cam, we have reached L(Ly?) = 2.4 10{sup 42} erg s{sup 1} (5?) for z = 7.3 LAEs, about four times deeper than previous Subaru z ? 7 studies, which allows us to reliably investigate the evolution of the Ly? luminosity function (LF) for the first time down to the luminosity limit same as those of Subaru z = 3.1-6.6 LAE samples. Surprisingly, we only find three and four LAEs in the SXDS and COSMOS fields, respectively, while one expects a total of ?65 LAEs by our survey in the case of no Ly? LF evolution from z = 6.6 to 7.3. We identify a decrease of the Ly? LF from z = 6.6 to 7.3 at the >90% confidence level from our z = 7.3 Ly? LF with the best-fit Schechter parameters of L{sub Ly?}{sup ?}=2.7{sub ?1.2}{sup +8.0}10{sup 42} erg s{sup ?1} and ?{sup ?}=3.7{sub ?3.3}{sup +17.6}10{sup ?4} Mpc{sup ?3} for a fixed ? = 1.5. Moreover, the evolution of the Ly? LF is clearly accelerated at z > 6.6 beyond the measurement uncertainties including cosmic variance. Because no such accelerated evolution of the UV-continuum LF or the cosmic star formation rate (SFR) is found at z ? 7, but suggested only at z > 8, this accelerated Ly? LF evolution is explained by physical mechanisms different from a pure SFR decrease but related to the Ly? production and escape in the process of cosmic reionization. Because a simple accelerating increase of intergalactic medium neutral hydrogen absorbing Ly? cannot be reconciled with Thomson scattering of optical depth measurements from WMAP and Planck, our findings may support new physical pictures suggested by recent theoretical studies, such as the existence of HI clumpy clouds within cosmic ionized bubbles that are selectively absorbing Ly? and the large ionizing photon escape fraction of galaxies causing weak Ly? emission.

  20. Beamline 7.3.3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3.3 Print Small- and Wide-Angle X-Ray Scattering (SAXS/WAXS/Protein SAXS)* Scientific disciplines: Polymer science, materials science, proteins, surface science GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Bend magnet Energy range 10 keV Monochromator Mo/B4C double multilayer monochromator Measured flux (1.9 GeV, 400 mA) 1012 photons/s Resolving power (E/ΔE) 100 Detectors Pilatus 1M, Pilatus 100K, Pilatus 300KW, 2x ADSC Quantum 4u Spot size at sample 1 mm x 0.8 mm Samples

  1. Beamline 7.3.3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3.3 Print Small- and Wide-Angle X-Ray Scattering (SAXS/WAXS/Protein SAXS)* Scientific disciplines: Polymer science, materials science, proteins, surface science GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Bend magnet Energy range 10 keV Monochromator Mo/B4C double multilayer monochromator Measured flux (1.9 GeV, 400 mA) 1012 photons/s Resolving power (E/ΔE) 100 Detectors Pilatus 1M, Pilatus 100K, Pilatus 300KW, 2x ADSC Quantum 4u Spot size at sample 1 mm x 0.8 mm Samples

  2. Beamline 7.3.3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3.3 Print Small- and Wide-Angle X-Ray Scattering (SAXS/WAXS/Protein SAXS)* Scientific disciplines: Polymer science, materials science, proteins, surface science GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Bend magnet Energy range 10 keV Monochromator Mo/B4C double multilayer monochromator Measured flux (1.9 GeV, 400 mA) 1012 photons/s Resolving power (E/ΔE) 100 Detectors Pilatus 1M, Pilatus 100K, Pilatus 300KW, 2x ADSC Quantum 4u Spot size at sample 1 mm x 0.8 mm Samples

  3. Beamline 7.3.3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3.3 Print Small- and Wide-Angle X-Ray Scattering (SAXS/WAXS/Protein SAXS)* Scientific disciplines: Polymer science, materials science, proteins, surface science GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Bend magnet Energy range 10 keV Monochromator Mo/B4C double multilayer monochromator Measured flux (1.9 GeV, 400 mA) 1012 photons/s Resolving power (E/ΔE) 100 Detectors Pilatus 1M, Pilatus 100K, Pilatus 300KW, 2x ADSC Quantum 4u Spot size at sample 1 mm x 0.8 mm Samples

  4. Beamline 7.3.3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3.3 Print Small- and Wide-Angle X-Ray Scattering (SAXS/WAXS/Protein SAXS)* Scientific disciplines: Polymer science, materials science, proteins, surface science GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Bend magnet Energy range 10 keV Monochromator Mo/B4C double multilayer monochromator Measured flux (1.9 GeV, 400 mA) 1012 photons/s Resolving power (E/ΔE) 100 Detectors Pilatus 1M, Pilatus 100K, Pilatus 300KW, 2x ADSC Quantum 4u Spot size at sample 1 mm x 0.8 mm Samples

  5. Beamline 7.3.3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3.3 Print Small- and Wide-Angle X-Ray Scattering (SAXS/WAXS/Protein SAXS)* Scientific disciplines: Polymer science, materials science, proteins, surface science GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Bend magnet Energy range 10 keV Monochromator Mo/B4C double multilayer monochromator Measured flux (1.9 GeV, 400 mA) 1012 photons/s Resolving power (E/ΔE) 100 Detectors Pilatus 1M, Pilatus 100K, Pilatus 300KW, 2x ADSC Quantum 4u Spot size at sample 1 mm x 0.8 mm Samples

  6. Beamline 7.3.3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3.3 Print Small- and Wide-Angle X-Ray Scattering (SAXS/WAXS/Protein SAXS)* Scientific disciplines: Polymer science, materials science, proteins, surface science GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Bend magnet Energy range 10 keV Monochromator Mo/B4C double multilayer monochromator Measured flux (1.9 GeV, 400 mA) 1012 photons/s Resolving power (E/ΔE) 100 Detectors Pilatus 1M, Pilatus 100K, Pilatus 300KW, 2x ADSC Quantum 4u Spot size at sample 1 mm x 0.8 mm Samples

  7. Beamline 7.3.3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3.3 Print Small- and Wide-Angle X-Ray Scattering (SAXS/WAXS/Protein SAXS)* Scientific disciplines: Polymer science, materials science, proteins, surface science GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Bend magnet Energy range 10 keV Monochromator Mo/B4C double multilayer monochromator Measured flux (1.9 GeV, 400 mA) 1012 photons/s Resolving power (E/ΔE) 100 Detectors Pilatus 1M, Pilatus 100K, Pilatus 300KW, 2x ADSC Quantum 4u Spot size at sample 1 mm x 0.8 mm Samples

  8. Beamline 7.3.3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3.3 Print Small- and Wide-Angle X-Ray Scattering (SAXS/WAXS/Protein SAXS)* Scientific disciplines: Polymer science, materials science, proteins, surface science GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Bend magnet Energy range 10 keV Monochromator Mo/B4C double multilayer monochromator Measured flux (1.9 GeV, 400 mA) 1012 photons/s Resolving power (E/ΔE) 100 Detectors Pilatus 1M, Pilatus 100K, Pilatus 300KW, 2x ADSC Quantum 4u Spot size at sample 1 mm x 0.8 mm Samples

  9. Beamline 7.3.3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3.3 Print Small- and Wide-Angle X-Ray Scattering (SAXS/WAXS/Protein SAXS)* Scientific disciplines: Polymer science, materials science, proteins, surface science GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Bend magnet Energy range 10 keV Monochromator Mo/B4C double multilayer monochromator Measured flux (1.9 GeV, 400 mA) 1012 photons/s Resolving power (E/ΔE) 100 Detectors Pilatus 1M, Pilatus 100K, Pilatus 300KW, 2x ADSC Quantum 4u Spot size at sample 1 mm x 0.8 mm Samples

  10. Beamline 7.3.3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3.3 Print Small- and Wide-Angle X-Ray Scattering (SAXS/WAXS/Protein SAXS)* Scientific disciplines: Polymer science, materials science, proteins, surface science GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Bend magnet Energy range 10 keV Monochromator Mo/B4C double multilayer monochromator Measured flux (1.9 GeV, 400 mA) 1012 photons/s Resolving power (E/ΔE) 100 Detectors Pilatus 1M, Pilatus 100K, Pilatus 300KW, 2x ADSC Quantum 4u Spot size at sample 1 mm x 0.8 mm Samples

  11. Beamline 7.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    microscope PEEM2 Scientific disciplines: Magnetism, materials, surface science, polymers Note: This beamline is NOT open to general users. GENERAL BEAMLINE INFORMATION...

  12. table8.3_02.xls

    U.S. Energy Information Administration (EIA) Indexed Site

    Number of Establishments by Usage of Cogeneration Technologies, 2002; Level: National Data; Row: NAICS Codes; Column: Usage within Cogeneration Technologies; Unit: Establishment Counts. NAICS Code(a) Subsector and Industry Establishments(b) Establishments with Any Cogeneration Technology in Use(c) In Use(d) Not in Use Don't Know In Use(d) Not in Use Don't Know Total United States RSE Column Factors: 0 1 0.7 0.8 1.7 0.6 0.8 1.7 311 Food 15,089 443 131 13,850 1,109 80 13,729 1,280 311221 Wet Corn

  13. "RSE Table N8.3. Relative Standard Errors for Table N8.3;...

    U.S. Energy Information Administration (EIA) Indexed Site

    Utility(c)" ,,"Total United States" , 311,"Food",1,1,3,1,1,1,1,1,1 311221," Wet Corn ... ,,"Northeast Census Region" , 311,"Food",3,4,10,5,6,6,6,6,11 311221," Wet Corn ...

  14. Table B16. Multibuilding Facilities, Number of Buildings and Floorspace, 1999

    U.S. Energy Information Administration (EIA) Indexed Site

    6. Multibuilding Facilities, Number of Buildings and Floorspace, 1999" ,"Number of Buildings (thousand)",,,"Total Floorspace (million square feet)" ,"All Buildings","Buildings on Multibuilding Facilities",,"All Buildings","Buildings on Multibuilding Facilities" ,,"All Buildings","With Central Physical Plant",,"All Buildings","With Central Physical Plant" "All Buildings

  15. MO-B-16A-01: Memorial to Donald D. Tolbert - Memorial Lecture

    SciTech Connect (OSTI)

    Morin, R

    2014-06-15

    The Medical Physics community lost one of its prominent leaders in April, 2013 with the passing of Donald D. Tolbert, PhD. He received his Doctorate at the University of Kansas followed by post Doctoral training at Florida State University and the University of Wisconsin. He was Chief of Radiation Therapy Medical Physics at the University of Wisconsin Hospital for 7 years before relocating to Honolulu Hawaii, where he founded the consulting group Mid-Pacific Medical Physics. Don was a leader in both the AAPM and the ACR, chairing the Professional Council and the Commission on Medical Physics. He was active on the AAPM Board of Directors and a member of the ACR Board of Chancellors. Dr. Tolbert's approach to the difficult problems of the times was admired and respected by colleagues in Medical Physics, Radiation Oncology, and Diagnostic Radiology. He always rose above the heated political rhetoric and led the discussion to higher ground. His wisdom was continually sought to solve complicated problems. Following retirement, he returned to homes in Kansas and Colorado, devoting his time to writing about coping with diabetes and providing support for Seniors in Beloit Kansas. Don is survived by his wife, Mattie, his 3 children and 5 grandchildren. He will be greatly missed.

  16. "Table B16. Employment Size Category, Floorspace for Non-Mall Buildings, 2003"

    U.S. Energy Information Administration (EIA) Indexed Site

    6. Employment Size Category, Floorspace for Non-Mall Buildings, 2003" ,"Total Floorspace (million square feet)" ,"All Buildings*","Number of Workers" ,,"Fewer than 5 Workers","5 to 9 Workers","10 to 19 Workers","20 to 49 Workers","50 to 99 Workers","100 to 249 Workers","250 or More Workers" "All Buildings* ...............",64783,15492,6166,7803,10989,7934,6871,9528 "Building

  17. table7.3_02.xls

    U.S. Energy Information Administration (EIA) Indexed Site

    3 Average Prices of Purchased Electricity, Natural Gas, and Steam, 2002; Level: National and Regional Data; Row: NAICS Codes; Column: Supplier Sources of Purchased Electricity, Natural Gas, and Steam; Unit: U.S. Dollars per Physical Units. Electricity Components Natural Gas Components Steam Components Electricity Natural Gas Steam Electricity from Sources Natural Gas from Sources Steam from Sources Electricity from Local Other than Natural Gas from Local Other than Steam from Local Other than

  18. RSE Table 7.3 Relative Standard Errors for Table 7.3

    U.S. Energy Information Administration (EIA) Indexed Site

    ...diates",0,0,0,0,0,0,0,0,0 325193," Ethyl Alcohol ",11,12,0,3,0,4,41,0,78 325199," Other ...diates",0,0,0,0,0,0,0,0,0 325193," Ethyl Alcohol ",0,0,0,0,0,0,0,0,0 325199," Other Basic ...

  19. Structure and microwave dielectric characteristics of lithium-excess Ca{sub 0.6}Nd{sub 0.8/3}TiO{sub 3}/(Li{sub 0.5}Nd{sub 0.5})TiO{sub 3} ceramics

    SciTech Connect (OSTI)

    Zhou, Changrong; Chen, Guohua; Cen, Zhenyong; Yuan, Changlai; Yang, Yun; Li, Weizhou

    2013-11-15

    Graphical abstract: - Highlights: Dense ceramics were fabricated by the conventional solid-state route. Excess-Li addition lowers sintering temperature. Excess-Li addition improves the relative density and microwave dielectric properties. - Abstract: Compositions based on (1?x)Ca{sub 0.6}Nd{sub 8/3}TiO{sub 3}?x(Li{sub 1/2}Nd{sub 1/2})TiO{sub 3} + yLi (CNLNTx + yLi, x = 0.300.60, y = 00.05), suitable for microwave applications have been developed by systematically adding excess lithium in order to tune the microwave dielectric properties and lower sintering temperature. Addition of 0.03 excess-Li simultaneously reduced the sintering temperature and improved the relative density of sintered CNLNTx ceramics. The excess Li addition can compensate the evaporation of Li during sintering process and decrease the secondary phase content. The CNLNTx (x = 0.45) ceramics with 0.03 Li excess sintered at 1190 C have single phase orthorhombic perovskite structure, together with the optimum combination of microwave dielectric properties of ?{sub r} = 129, Q f = 3600 GHz, ?{sub f} = 38 ppm/C. Obviously, excess-Li addition can efficiently decrease the sintering temperature and improve the microwave dielectric properties. The high permittivity and relatively low sintering temperatures of lithium-excess Ca{sub 0.6}Nd{sub 0.8/3}TiO{sub 3}/(Li{sub 0.5}Nd{sub 0.5})TiO{sub 3} ceramics are ideal for the development of low cost ultra-small dielectric loaded antenna.

  20. Table 7.3 Average Prices of Purchased Electricity, Natural...

    U.S. Energy Information Administration (EIA) Indexed Site

    ...3.89,3.83,4.44,0,4.44,0.9 325193," Ethyl Alcohol ",0.04,0.041,0.031,3.67,3.93,3.55,4.55,5....23,5.05,"W","W",0,"W",0.9 325193," Ethyl Alcohol ",0.109,0.109,0,1.08,1.08,0,0,0,0,0.7 ...

  1. Experimental Station 7-3 | Stanford Synchrotron Radiation Lightsource

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Spectroscopy Main Scientific Disciplines Biomedical Sciences Structural Molecular Biology Beam Line Specifications Source 20-pole, 2-Tesla wiggler, 0.8 mrad beam, Side station...

  2. Buildings Energy Data Book: 8.3 Commercial Sector Water Consumption

    Buildings Energy Data Book [EERE]

    1 Commercial Water Use by Source (Million Gallons per Day) Year 1980 - - - 1985 5,710 1,230 1990 5,900 2,390 1995 6,690 2,890 2000 (3) 7,202 3,111 2005 (3) 7,102 3,068 Note(s): Source(s): 10,314 10,171 1) Public supply water use: water withdrawn by public and private water suppliers that furnish water to at least 25 people or have a minimum of 15 connections. 2) Self-supply water use: Water withdrawn from a groundwater or surface-water source by a user rather than being obtained from a public

  3. Buildings Energy Data Book: 8.3 Commercial Sector Water Consumption

    Buildings Energy Data Book [EERE]

    2 Average Water Use of Commercial and Institutional Establishments (Gallons per Establishment per Day) Average Variation % Total % of CI % Seasonal Daily Use In Use (1) CI Use Customers Use (2) Hotels and Motels 7,113 5.41 5.8% 1.9% 23.1% Laundries/Laundromats 3,290 8.85 4.0% 1.4% 13.4% Car Washes 3,031 3.12 0.8% 0.4% 14.2% Urban Irrigation 2,596 8.73 28.5% 30.2% 86.9% Schools and Colleges 2,117 12.13 8.8% 4.8% 58.0% Hospitals/Medical Offices 1,236 78.5 3.9% 4.2% 23.2% Office Buildings 1,204

  4. Buildings Energy Data Book: 8.3 Commercial Sector Water Consumption

    Buildings Energy Data Book [EERE]

    3 Normalized Annual End Uses of Water in Select Restaurants in Western United States (1) Fixture/End Use (2) Faucets Dishwashing Toilets/Urinals Ice Making Total Indoor Use (3) (4) (4) Building Size (SF) Seats: Meals: Benchmarking Values for Restaurants (6) N Gal./SF/year 90 Gal./meal 90 Gal./seat/day 90 Gal./employee/day 90 Note(s): Source(s): American Water Works Association Research Foundation, Commercial and Institutional End Uses of Water, 2000. 25th Percentile of Users 130 - 331 6 - 9 20 -

  5. Buildings Energy Data Book: 8.3 Commercial Sector Water Consumption

    Buildings Energy Data Book [EERE]

    4 Normalized Annual End Uses of Water in Select Supermarkets in Western United States (1) Fixture/End Use Toilets/Urinals Other/Misc. Indoor (2) Cooling Total Building Size (SF) Benchmarking Values for Supermarkets (3) N Indoor Use with Cooling, gal./SF/year 38 Indoor Use with Cooling, gal./SF/daily transaction 38 Note(s): Source(s): 25th Percentile of Users 52 - 64 9 - 16 1) Water use data for the buildings was collected over a few days. Estimates of annual use were created by accounting for

  6. Buildings Energy Data Book: 8.3 Commercial Sector Water Consumption

    Buildings Energy Data Book [EERE]

    5 Normalized Annual End Uses of Water in Select Hotels in Western United States (Gallons per Room per Year) (1) Fixture/End Use Bathtub (2) Faucets Showers Toilets Leaks Laundry Ice making (3) Other/misc. indoor Total Indoor Use Number of Rooms Logged average daily use, kgal: Peak instantaneous demand, gpm: Benchmarking Values for Hotels N Indoor Use, gal./day/occupied room 98 Cooling Use, gal./year/occupied room 97 Note(s): Source(s): 25th Percentile of Users 60 - 115 7,400 - 41,600 Based on

  7. Buildings Energy Data Book: 8.3 Commercial Sector Water Consumption

    Buildings Energy Data Book [EERE]

    6 Normalized Annual End Uses of Water in Two California High Schools Fixture/End Use Toilet Urinal Faucet Shower Kitchen Misc. uses (2) Cooling Leaks Swimming Pool Total Use Benchmarking Values for Schools (3) N Indoor Use, Gal./sq. ft./year 142 Indoor Use, Gal./school day/student 141 Cooling Use, Gal./sq. ft./year 35 Note(s): Source(s): 8 - 20 1) Water use data for the buildings was collected over a few days. Estimates of annual use were created by accounting for seasonal use and other

  8. 1.8.3 Site system engineering FY 1997 program plan

    SciTech Connect (OSTI)

    Grygiel, M.L.

    1996-09-13

    The FY 1997 Multi-Year Work Plan (MYWP) technical baseline describes the functions to be accomplished and the technical standards that govern the work. The following information is provided in this FY 1997 MYWP: technical baseline, work breakdown structure, schedule baseline, cost baseline, and execution year.

  9. Microsoft Word - FAL 2015-03 FY2015Approp REV 2 FINAL 8-3

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    ... VII. Section 743 Confidentiality Agreements Prohibiting Whistleblower Activities VIII. Section 744 Unpaid Federal Tax Liability IX. Section 745 Felony Criminal Violations X. ...

  10. LFS Exhibit A General Conditions (Rev. 8.3, 9-27-13)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3, 9/27/13) Exhibit A General Conditions Page 1 of 19 EXHIBIT "A" GENERAL CONDITIONS TABLE OF CONTENTS GC Title Page GC-1 DEFINITIONS (Aug 2012) .......................................................................................................... 3 GC-2A AUTHORIZED REPRESENTATIVES, COMMUNICATIONS AND NOTICES (Jan 2010) ........................................................................................................................................... 3 GC-3 INDEPENDENT

  11. SFS Exhibit A (Rev. 8.3, 9-27-13)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3, 9/27/13) Exhibit A General Conditions Page 1 of 17 EXHIBIT "A" GENERAL CONDITIONS TABLE OF CONTENTS GC Title Page GC-1 DEFINITIONS (Aug 2012) .......................................................................................................... 3 GC-2A AUTHORIZED REPRESENTATIVES, COMMUNICATIONS AND NOTICES (Jan 2010) ........................................................................................................................................... 3 GC-3 INDEPENDENT

  12. CPFFS Exhibit A General Conditions (Rev. 8.3, 9-27-13)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3, 9/27/13) Exhibit A General Conditions Page 1 of 21 EXHIBIT "A" GENERAL CONDITIONS TABLE OF CONTENTS GC Title Page GC-1 DEFINITIONS (Aug 2012) .......................................................................................................... 3 GC-2A AUTHORIZED REPRESENTATIVES, COMMUNICATIONS AND NOTICES (Jan 2010) ........................................................................................................................................... 3 GC-3 INDEPENDENT

  13. CPFFS Exhibit A General Conditions (Rev. 8.3, 9-27-13)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    on claims shall be paid at the rate established by the Secretary of the Treasury of the United States pursuant to Public Law 92-41 (85 Stat. 97). GC-37 BANKRUPTCY (Jun 2009) In...

  14. Microsoft Word - FAL 2015-03 FY2015Approp REV 2 FINAL 8-3

    Energy Savers [EERE]

    D, Titles III and V, and Division E, Title VII of the Consolidated and Further Continuing Appropriations Act, 2015, Pub. L. No. 113-235. References: Consolidated and Further Continuing Division D, Title III, Sections Appropriations Act, 2015, 301(a), 307 and 310 and Title Pub.L. No. 113-235 V, Section 501; Division E, Title VII, Sections 724, 739, 743,744, 745 and 747 When is this Financial Assistance Letter (FAL) effective? The statutory provisions addressed in this FAL were effective as of the

  15. Energy and Agriculture Depts. Provide $8.3 Million in Funding...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    ... OBER manages a diverse portfolio of research to develop fundamental biological information and to advance technology in support of DOE's missions in biology, medicine and the ...

  16. Attachment_4_Table_8.3Summary100-KOperableUnit.pdf

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

  17. Table N8.3. Average Prices of Purchased Electricity, Natural...

    U.S. Energy Information Administration (EIA) Indexed Site

    Electricity, Natural Gas, and Steam, 1998;" " Level: National and Regional Data; " " Row: NAICS Codes;" " Column: Supplier Sources of Purchased Electricity, Natural Gas, ...

  18. Floorspace

    U.S. Energy Information Administration (EIA) Indexed Site

    .........",4.6,4.7,4.9,4.8,5.1,4.6,5 "High Intensity Discharge .....",4.8,4.9,5.3,4.4,5.2,4.8.........",3.8,3.8,4.1,3.7,3.6,3.7,3.7 "Energy Management and" " Control System (EMCS) ...

  19. U.S. Secretary of Energy Concludes Productive G8+3 Energy Ministerial Meeting in Japan

    Broader source: Energy.gov [DOE]

    WASHINGTON- U.S. Secretary of Energy Samuel W. Bodman today concluded his weekend visit to Aomori, Japan where he participated in the Five-Country and the Group of Eight (G8), China, India and...

  20. Buildings Energy Data Book: 7.3 Efficiency Standards for Residential HVAC

    Buildings Energy Data Book [EERE]

    1 Efficiency Standards for Residential Central Air Conditioners and Heat Pumps (1) Type SEER (3) HSPF (4) Split System Air Conditioners 13.0 -- Split System Heat Pumps 13.0 7.7 Single Package Air Conditioners 13.0 -- Single Package Heat Pumps 13.0 7.7 Through-the-Wall Air Conditioners and Heat Pumps: -Split System (2) 10.9 7.1 -Single Package (2) 10.6 7.0 Small Duct, High Velocity Systems 13.0 7.7 Space Constrained Products -Air Conditioners 12.0 -- -Heat Pumps 12.0 7.4 Note(s): Source(s): 1)

  1. Buildings Energy Data Book: 7.3 Efficiency Standards for Residential HVAC

    Buildings Energy Data Book [EERE]

    2 Efficiency Standards for Residential Furnaces AFUE (%) (2) Furnaces (excluding classes noted below) 78 Mobile Home Furnaces 75 Small Furnaces with input rate < 45,000 Btu/hr (1) - Weatherized (outdoor) 78 - Non-Weatherized (indoor) 78 AFUE (%) (2) Non-Weatherized Gas Furnaces 80 Weatherized Gas Furnaces 81 Mobile Home Oil-Fired Furnaces 75 Mobile home Gas Furnaces 80 Non-Weatherized Oil-Fired Furnaces 82 Weatherized Oil-Fired Furnaces 78 Note(s): 1) Excludes those intended solely for

  2. Buildings Energy Data Book: 7.3 Efficiency Standards for Residential HVAC

    Buildings Energy Data Book [EERE]

    3 Efficiency Standards for Residential Boilers Effective for products manufactured before September 1, 2012 AFUE(%) (1) Boilers (excluding gas steam) Gas Steam Boilers Effective for products manufactured on or after September 1, 2012 (2) AFUE (%) (1) No Constant Burning Pilot Automatic Means for Adjusting Water Temperature Gas Steam No Constant Burning Pilot Oil Hot Water Automatic Means for Adjusting Water Temperature Oil Steam None Electric Hot water Automatic Means for Adjusting Water

  3. Policy Flash 2013-78 Acquisition Guide Chapter 7.3 Acquisition...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Jason Taylor of the Contract and Financial Assistance Policy Division, Office of Policy, Office of Acquisition and Project Management at (202) 287-1560 or at jason.taylor@hq.doe....

  4. Policy Flash 2013-78 Acquisition Guide Chapter 7.3 Acquisition...

    Broader source: Energy.gov (indexed) [DOE]

    Questions concerning this policy flash should be directed to Jason Taylor of the Contract and Financial Assistance Policy Division, Office of Policy, Office of Acquisition and...

  5. Building America Best Practices Series: Volume 7.3, Guide to...

    Energy Savers [EERE]

    ... ID Owyhee Cold 5 B ID Payette Cold 5 B ID Power Cold 5 B ID Shoshone Cold 5 B ID Teton ... IL Richland Mixed-Humid 4 A IL Rock Island Cold 5 A IL Saline Mixed-Humid 4 A IL Sangamon ...

  6. TM Exhibit A General Conditions (Rev. 7.3, 9-27-13)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    TM 12 Glimpses into Sandia National Laboratories' Advanced Simulation & Computing Program This folder provides short descriptions of some projects funded by the Advanced Simulation & Computing (ASC) Program at Sandia National Laboratories. A tri-laboratory program, ASC's emphasis is on high performance computing. Established in 1995 as an essential element of the U. S. National Nuclear Security Administration's (NNSA) Stockpile Stewardship Program (SSP), ASC provides advanced simulation

  7. Building America Best Practices Series, Volume 7.3: Guide to...

    Broader source: Energy.gov (indexed) [DOE]

    climate zone designations used by the U.S. Department of Energy Building America Program, and is intended to help builders to identify the appropriate climate designation for the ...

  8. Subtask 7.3 - The Socioeconomic Impact of Climate Shifts in the Northern Great Plains

    SciTech Connect (OSTI)

    Jaroslav Solc; Tera Buckley; Troy Simonsen

    2007-12-31

    The Energy & Environmental Research Center (EERC) evaluated the water demand response/vulnerability to climate change factors of regional economic sectors in the northern Great Plains. Regardless of the cause of climatic trends currently observed, the research focused on practical evaluation of climate change impact, using water availability as a primary factor controlling long-term regional economic sustainability. Project results suggest that the Upper Missouri, Red River, and Upper Mississippi Watersheds exhibit analogous response to climate change, i.e., extended drought influences water availability in the entire region. The modified trend suggests that the next period for which the Red River Basin can expect a high probability of below normal precipitation will occur before 2050. Agriculture is the most sensitive economic sector in the region; however, analyses confirmed relative adaptability to changing conditions. The price of agricultural commodities is not a good indicator of the economic impact of climate change because production and price do not correlate and are subject to frequent and irregular government intervention. Project results confirm that high water demand in the primary economic sectors makes the regional economy extremely vulnerable to climatic extremes, with a similar response over the entire region. Without conservation-based water management policies, long-term periods of drought will limit socioeconomic development in the region and may threaten even the sustainability of current conditions.

  9. Table 7.3 Average Prices of Purchased Electricity, Natural Gas...

    U.S. Energy Information Administration (EIA) Indexed Site

    of Purchased Electricity, Natural Gas, and Steam, 2010; Level: National and Regional Data; Row: NAICS Codes; Column: Supplier Sources of Purchased Electricity, Natural Gas, and ...

  10. X:\\Data_Publication\\Pma\\current\\ventura\\pma00.vp

    U.S. Energy Information Administration (EIA) Indexed Site

    1998 January ... 13.5 13.8 27.2 21.1 8.3 56.6 3.7 3.7 7.2 2.8 W 10.0 February ... 14.3 14.6 28.1 22.1 7.5 57.7 3.6 3.7 7.3 2.9 W 10.2 March...

  11. CI-OFF Ex A (Rev. 0.7, 3/6/15) Exhibit A General Conditions

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Page 1 of 11 EXHIBIT "A" GENERAL CONDITIONS TABLE OF CONTENTS GC Title Page GC-A1 COMMERCIAL ITEMS (Aug 2014) ......

  12. Materials Data on Ba10Ta10(N3O7)3 (SG:47) by Materials Project

    SciTech Connect (OSTI)

    Kristin Persson

    2014-11-02

    Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

  13. Policy Flash 2013-78 Acquisition Guide Chapter 7.3 Acquisition Planning in the M&O Environment

    Broader source: Energy.gov [DOE]

    Questions concerning this policy flash should be directed to Jason Taylor of the Contract and Financial Assistance Policy Division, Office of Policy, Office of Acquisition and Project Management at...

  14. 2013-11-19 KCP H-FM&T Mod 0049 (Admin)(7.3.13).pdf

    National Nuclear Security Administration (NNSA)

  15. Design and Analysis of RTGs for CRAF and Cassini Missions; two copies - one dated 8/3/1990 and the other dated 11/8/1990.

    SciTech Connect (OSTI)

    Schock, Alfred

    1990-10-08

    The paper describes the design and analysis of Radioisotope Thermoelectric Generators Integrated with JPL's CRAF and Cassini spacecraft. The principal purpose of the CRAF mission is the study of asteroids and comets, and the principal purpose of the Cassini mission is the study of asteroids, Saturn, and its moons (particularly Titan). Both missions will employ the Mariner/Mark-2 spacecraft, and each will be powered by two GPHS-RTGs. JPL's spacecraft designers wish to locate the two RTGs in close proximity to each other, resulting in mutual and unsymmetrical obstruction of their heat rejection paths. To support JPL's design studies, the U.S. Department of Energy asked Fairchild to determine the effect of the RTGs' proximity on their power output. As described in the paper, this required the development of novel analysis methods and computer codes for the coupled thermal and electrical analysis of obstructed RTGs with axial and circumferential temperature, voltage, and current variations. The code was validated against measured data of unobstructed RTG tests, and was used for the detailed analysis of the obstructed CRAF and Cassini RTGs. Also described is a new method for predicting the combined effect of fuel decay and thermoelectric degradation on the output of obstructed RTGs, which accounts for the effect of diminishing temperatures on degradation rates. For the 24-degree separation angle of JPL's original baseline design, and for the 35-degree RTG separation of JPL's revised design, the computed results indicate that the mutually obstructed GPHS/RTGs with standard fuel loading and operating temperatures can comfortably meet the JPL-specified power requirements for the CRAF mission and almost meet the specified requirements for the Cassini mission.

  16. Percent of Industrial Natural Gas Deliveries in Florida Represented by the

    U.S. Energy Information Administration (EIA) Indexed Site

    Price (Percent) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 10.5 7.3 5.0 2000's 5.2 3.8 3.8 3.9 3.7 3.4 3.1 3.1 3.0 3.2 2010's 3.0 3.0 2.7 3.2 3.5 NA

  17. Percent of Industrial Natural Gas Deliveries in Pennsylvania Represented by

    U.S. Energy Information Administration (EIA) Indexed Site

    the Price (Percent) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2001 17.0 16.4 11.3 10.2 7.7 5.1 7.3 7.5 8.2 8.8 7.3 8.4 2002 8.8 8.3 7.0 5.9 5.7 5.5 4.8 5.0 7.2 7.5 8.1 11.4 2003 8.5 8.5 8.8 7.3 5.7 5.4 5.2 5.0 5.2 5.5 5.9 6.5 2004 7.7 8.1 7.3 6.8 5.3 4.8 4.8 5.1 5.2 4.7 6.5 8.3 2005 8.8 8.4 8.2 7.0 6.1 5.5 5.9 7.1 5.2 5.2 6.7 8.2 2006 8.2 7.3 7.1 5.3 4.8 4.2 4.1 4.1 6.2 4.2 4.6 5.4 2007 6.7 8.5 8.3 5.9 5.6 3.7 3.3 3.2 4.1 3.1 4.5 6.6 2008 7.7 7.3 7.3 6.9 5.7 4.8 4.4 4.3 3.8 3.9

  18. Table 13. U.S. Refiner Reformulated Motor Gasoline Volumes by...

    U.S. Energy Information Administration (EIA) Indexed Site

    24.1 9.1 61.1 3.9 4.0 7.3 3.1 W 10.4 1998 ... 14.3 14.5 28.6 23.0 8.3 59.9 3.7 3.8 7.4 3.1 W 10.5 See footnotes at end of table. 26 Energy Information...

  19. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    3,018.0 24,299.4 537.1 3,816.4 3,555.1 28,115.8 October... 2,818.6 23,025.5 504.7 3,140.8 3,323.3 26,166.4 November... 2,812.6 26,037.9 555.8...

  20. "Table A51. Selected Energy Operating Ratios for Total Energy...

    U.S. Energy Information Administration (EIA) Indexed Site

    "20-39","ALL INDUSTRY GROUPS" ,"Employment Size " ," Under 50",273.2,4.9,2.3,3.2,"W",7.3 ," 50-99",494.5,7.8,3.4,2.4,12.5,7.8 ," 100-249",782.5,11,4.8,5.9,10.4,5 ," ...

  1. Table 7. Electric power industry emissions estimates, 1990 through...

    U.S. Energy Information Administration (EIA) Indexed Site

    ...624,46333,22809,24652,23826,52838,57853 "Nitrogen oxide (short tons)" ...,9.6,10.9,9.9,6.4,9.5,2.8,3.2,3,6.1,7.3 "Nitrogen oxide",1.3,1.4,1,1.1,1.1,1.7,1.4,1.4,1.4...

  2. Slide 1

    U.S. Energy Information Administration (EIA) Indexed Site

    The evolution of IEA statistics over time The evolution of IEA statistics over time 0 10 20 30 40 50 60 70 80 1 9 7 1 1 9 7 3 1 9 7 5 1 9 7 7 1 9 7 9 1 9 8 1 1 9 8 3 1 9 8 5 1 9 8 ...

  3. Operation Greenhouse. Scientific Director's report of atomic-weapon tests at Eniwetok, 1951. Annex 8. 3. Special radar, radio, and photographic studies of weapons effects. Part 1, 2, 3, and 4

    SciTech Connect (OSTI)

    Not Available

    1985-09-01

    Contents include: Part 1--radar-scope photography; Part 2--effects of atomic detonation on radio propagation; Part 3; photographic assessment of bomb damage; Part 4--film fogging studies.

  4. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    2006... 2.8 2.8 7.6 3.6 10.4 6.5 2007 January... 3.8 4.7 8.4 3.9 12.2 8.5 February.. 4.3 3.1 8.5 4.2 12.8 7.3 March..... 3.8 3.0 7.7 4.2 11.5 7.3 April..... 4.6 3.4 8.4 4.7...

  5. International Energy Outlook 2013

    Gasoline and Diesel Fuel Update (EIA)

    4 Appendix F Table F10. Total Non-OECD delivered energy consumption by end-use sector and fuel, 2010-2040 (quadrillion Btu) Sector/fuel Projections Average annual percent change, 2010-2040 2010 2015 2020 2025 2030 2035 2040 Residential Liquids 5.1 5.4 5.2 5.1 5.1 5.0 4.9 -0.2 Natural gas 7.9 8.9 10.4 12.3 14.3 16.2 17.9 2.8 Coal 3.8 3.7 3.7 3.8 3.8 3.8 3.7 -0.1 Electricity 7.0 9.0 11.4 14.0 16.9 20.0 23.3 4.1 Total 23.9 27.0 30.8 35.1 40.0 45.0 49.8 2.5 Commercial Liquids 1.9 1.8 1.8 1.9 1.9 1.8

  6. Spectroscopic studies and crystal structure of (E)-N Prime -(2-hydroxy-3-methoxybenzylidene)isonicotinohydrazide

    SciTech Connect (OSTI)

    Ozay, H. Yildiz, M.; Unver, H.; Kiraz, A.

    2013-01-15

    The structure of compound has also been examined cyrstallographically. It crystallizes in the monoclinic space group P2{sub 1}/c with a = 7.673(1), b = 16.251(2), c = 10.874(1) A, {beta} = 110.42(1) Degree-Sign , V = 1270.7(3) A{sup 3}, D{sub x} = 1.418 g cm{sup -3}, R{sub 1} = 0.0349 and wR{sub 2} = 0.0935 [I > 2{sigma}(I)], respectively. The title compound has been synthesized from the reaction of isonicotinohydrazide with 2-hydroxy-3-methoxybenzaldehyde. It has been characterized by using elemental analysis, MS, IR, {sup 1}H NMR, {sup 13}C NMR and UV-Visible spectroscopic techniques.

  7. TableHC7.1.xls

    U.S. Energy Information Administration (EIA) Indexed Site

    111.1 26.7 28.8 20.6 13.1 22.0 16.6 38.6 Census Region and Division Northeast.................................................. 20.6 4.9 5.4 3.5 2.4 4.3 3.2 8.1 New England......................................... 5.5 1.3 1.3 1.0 0.6 1.2 0.7 2.3 Middle Atlantic...................................... 15.1 3.7 4.1 2.5 1.8 3.1 2.5 5.8 Midwest.................................................... 25.6 6.5 6.6 4.7 3.0 4.8 3.5 9.4 East North Central................................ 17.7 4.7 4.3 3.2 2.2

  8. Buildings Energy Data Book: 2.9 Low-Income Housing

    Buildings Energy Data Book [EERE]

    8 FY 2009 Residential Energy Burdens, by Region (1) Northeast South Midwest West Mean Mdn Mean Mean Mdn Mean Mean Mdn Mean Mean Mdn Mean Indvdl Indvdl Group Indvdl Indvdl Group Indvdl Indvdl Group Indvdl Indvdl Group Total U.S. Households 9.0% 5.4% 3.7% 7.7% 4.7% 3.4% 7.1% 4.4% 3.3% 4.9% 3.0% 2.4% Federally Eligible 16.0% 10.9% 11.9% 15.1% 10.1% 11.2% 13.3% 10.2% 10.3% 9.8% 6.3% 7.3% Federally Ineligible 4.4% 3.9% 3.0% 3.9% 3.4% 2.8% 3.5% 3.0% 2.7% 2.8% 2.3% 2.0% Note(s): Source(s): 1) Data are

  9. Appendix A: Reference case projections

    U.S. Energy Information Administration (EIA) Indexed Site

    U.S. Energy Information Administration | International Energy Outlook 2016 Reference case projections Table A6. World natural gas consumption by region, Reference case, 2011-40 (trillion cubic feet) Region History Projections Average annual percent change, 2012-40 2011 2012 2020 2025 2030 2035 2040 OECD OECD Americas 30.8 31.8 32.8 34.3 36.5 38.2 40.1 0.8 United States a 24.5 25.5 26.1 26.9 28.1 28.8 29.7 0.5 Canada 3.7 3.7 3.9 4.2 4.7 5.2 5.6 1.5 Mexico and Chile 2.6 2.6 2.8 3.2 3.6 4.2 4.8

  10. Table HC2.11 Home Electronics Characteristics by Type of Housing Unit, 2005

    U.S. Energy Information Administration (EIA) Indexed Site

    Million U.S. Housing Units Total................................................................... 111.1 72.1 7.6 7.8 16.7 6.9 Personal Computers Do Not Use a Personal Computer ............... 35.5 17.8 3.1 3.7 7.3 3.6 Use a Personal Computer............................. 75.6 54.2 4.5 4.0 9.4 3.4 Number of Desktop PCs 1.............................................................. 50.3 33.9 3.1 3.0 7.6 2.7 2.............................................................. 16.2 12.7 0.9 0.7 1.4

  11. TableHC11.12.xls

    U.S. Energy Information Administration (EIA) Indexed Site

    15.1 5.5 Personal Computers Do Not Use a Personal Computer.................................. 35.5 6.9 5.3 1.6 Use a Personal Computer.............................................. 75.6 13.7 9.8 3.9 Most-Used Personal Computer Type of PC Desk-top Model......................................................... 58.6 10.4 7.3 3.1 Laptop Model............................................................. 16.9 3.3 2.6 0.7 Hours Turned on Per Week Less than 2

  12. TableHC2.1.xls

    U.S. Energy Information Administration (EIA) Indexed Site

    Total.............................................................. 111.1 78.1 64.1 4.2 1.8 2.3 5.7 Census Region and Division Northeast.................................................... 20.6 13.4 10.4 1.4 1.0 0.3 0.4 New England........................................... 5.5 3.8 3.1 Q 0.3 Q Q Middle Atlantic........................................ 15.1 9.6 7.3 1.3 0.6 Q Q Midwest...................................................... 25.6 19.4 16.9 1.0 0.5 0.4 0.7 East North

  13. TableHC2.11.xls

    U.S. Energy Information Administration (EIA) Indexed Site

    Million U.S. Housing Units Total................................................................... 111.1 72.1 7.6 7.8 16.7 6.9 Personal Computers Do Not Use a Personal Computer ............... 35.5 17.8 3.1 3.7 7.3 3.6 Use a Personal Computer............................. 75.6 54.2 4.5 4.0 9.4 3.4 Number of Desktop PCs 1.............................................................. 50.3 33.9 3.1 3.0 7.6 2.7 2.............................................................. 16.2 12.7 0.9 0.7 1.4

  14. TableHC9.3.xls

    U.S. Energy Information Administration (EIA) Indexed Site

    10.9 26.1 27.3 24.0 22.8 Household Size 1 Person................................................................ 30.0 2.6 7.9 7.3 6.5 5.8 2 Persons.............................................................. 34.8 4.3 7.7 8.2 7.1 7.5 3 Persons.............................................................. 18.4 1.8 4.2 4.8 3.9 3.7 4 Persons.............................................................. 15.9 1.2 3.7 4.0 3.9 2.9 5 Persons..............................................................

  15. Percent of Industrial Natural Gas Deliveries in Kansas Represented by the

    U.S. Energy Information Administration (EIA) Indexed Site

    Price (Percent) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 9.2 9.9 10.1 2000's 10.4 9.3 10.8 7.9 6.9 6.3 7.3 5.9 7.8 6.7 2010's 7.0 9.5 9.7 9.3 8.3 NA

  16. Percent of Industrial Natural Gas Deliveries in Washington Represented by

    U.S. Energy Information Administration (EIA) Indexed Site

    the Price (Percent) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 23.5 20.1 24.0 2000's 34.5 38.2 27.4 20.1 17.3 15.8 20.2 17.4 12.9 8.7 2010's 8.3 7.5 7.3 6.7 6.5 NA

  17. Preliminary Release: April 19, 2012

    U.S. Energy Information Administration (EIA) Indexed Site

    5 Total Square Footage of West Homes, by Housing Characteristics, 2009" " Final" ,,"Total Square Footage" ,"Housing Units1","Total2","Heated","Cooled" "Housing Characteristics","Millions","Billions","Billions","Billions" "Total West",24.8,42.4,34.2,19.9 "West Divisions and States" "Mountain",7.9,15.2,13.4,8.7 "Mountain North",3.9,8.3,7.3,3.6

  18. Appendix A: Reference case projections

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Japan 4.4 4.7 4.0 3.9 3.8 3.7 3.6 -0.9 South Korea 2.3 2.3 2.5 2.5 2.5 2.6 2.7 0.5 Australia and New Zealand 1.2 1.2 1.4 1.4 1.4 1.5 1.5 0.8 Total OECD 46.0 45.5 46.8 46.7 46.9 ...

  19. Appendix A: Reference case projections

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Japan 4.3 4.6 4.5 4.4 4.3 4.2 4.0 -0.5 South Korea 3.2 3.0 3.7 3.8 3.8 4.0 4.3 1.2 Australia and New Zealand 2.1 2.1 2.0 1.9 1.9 1.9 1.9 -0.4 Total OECD 43.6 41.8 43.7 44.0 43.3 ...

  20. Percent of Industrial Natural Gas Deliveries in Florida Represented by the

    U.S. Energy Information Administration (EIA) Indexed Site

    Price (Percent) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2001 6.1 4.5 3.5 4.7 5.9 3.6 1.9 2.9 2.5 2.5 3.3 4.0 2002 4.1 4.5 4.1 3.6 3.5 4.2 3.2 3.5 3.9 3.4 3.8 4.4 2003 4.2 5.9 4.4 3.9 3.5 3.7 3.3 2.6 3.7 3.2 4.4 3.3 2004 4.6 3.8 4.2 3.3 3.3 3.7 2.9 3.2 4.4 3.3 4.1 3.6 2005 2.7 4.1 3.8 3.4 3.1 3.2 3.4 3.5 3.4 3.7 3.5 3.6 2006 3.0 2.8 3.0 2.8 2.3 2.4 5.3 2.9 3.0 2.4 4.2 3.1 2007 2.6 3.1 3.5 2.3 2.9 4.0 2.8 2.6 3.6 2.5 3.7 3.6 2008 2.9 3.3 3.4 2.5 2.9 2.4 2.8 2.5 3.2 3.0 3.3 3.3

  1. Kentucky Natural Gas in Underground Storage - Change in Working Gas from

    U.S. Energy Information Administration (EIA) Indexed Site

    Same Month Previous Year (Percent) Percent) Kentucky Natural Gas in Underground Storage - Change in Working Gas from Same Month Previous Year (Percent) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 1991 36.3 23.0 19.6 25.2 19.8 15.5 10.9 5.6 1.2 -2.7 -5.1 -1.7 1992 5.7 8.9 7.7 -0.9 -5.4 -7.3 -8.9 -10.3 -9.2 2.6 8.5 8.4 1993 3.5 -8.1 -14.7 -13.7 -3.8 4.4 9.2 12.9 14.8 3.2 -1.2 -9.6 1994 -25.7 -31.2 -28.1 -20.1 -13.8 -10.6 -7.3 -4.7 -7.2 -4.8 1.4 4.5 1995 14.0 16.7 18.3 14.2 16.8 12.2

  2. Percent of Industrial Natural Gas Deliveries in Wyoming Represented by the

    U.S. Energy Information Administration (EIA) Indexed Site

    Price (Percent) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2001 3.6 3.9 3.7 2.8 1.9 2.1 1.8 2.0 2.0 2.3 2.2 1.8 2002 3.3 3.6 3.6 3.0 3.6 2.4 2.6 2.8 2.8 3.2 2.1 2.5 2003 2.4 2.4 2.1 1.8 1.4 1.4 1.4 1.3 1.4 1.4 2.2 2.0 2004 2.0 1.9 2.2 1.9 1.9 1.9 2.7 1.7 2.3 2.0 2.3 2.4 2005 2.8 5.0 5.8 4.5 4.1 3.5 2.8 2.5 2.5 2.8 4.2 4.4 2006 4.4 4.5 4.2 3.9 3.3 2.7 2.2 2.3 2.8 3.3 3.8 3.7 2007 4.3 4.1 3.4 3.7 2.8 2.0 1.5 1.7 1.9 2.9 3.3 3.3 2008 3.8 3.7 3.9 3.9 2.9 2.1 2.0 1.7 2.5 3.0 3.6 3.9

  3. Fire Protection

    Energy Savers [EERE]

    ... Requirements DOE Administrative Records Schedule 18, ... DOE-STD-1020-2012, Natural Phenomena Hazards Design ... Code on Nuclear Air and Gas Treatment ASME B16.3, ...

  4. RAPID/Roadmap/19-NV-b | Open Energy Information

    Open Energy Info (EERE)

    to 19-NV-b.16 - Conduct Required Studies The State Engineer may require hydrological, environmental, or other studies to be conducted before approving an application. The party...

  5. TableHC3.1.xls

    U.S. Energy Information Administration (EIA) Indexed Site

    78.1 64.1 4.2 1.8 2.3 5.7 Census Region and Division Northeast.................................................... 20.6 13.4 10.4 1.4 1.0 0.3 0.4 New England........................................... 5.5 3.8 3.1 Q 0.3 Q Q Middle Atlantic........................................ 15.1 9.6 7.3 1.3 0.6 Q Q Midwest...................................................... 25.6 19.4 16.9 1.0 0.5 0.4 0.7 East North Central.................................. 17.7 13.6 11.7 0.7 0.5 Q 0.3 West North

  6. TableHC4.13.xls

    U.S. Energy Information Administration (EIA) Indexed Site

    .. 111.1 33.0 8.0 3.4 5.9 14.4 1.2 Indoor Lights Turned On During Summer Number of Lights Turned On Between 1 and 4 Hours per Day......................... 91.8 26.8 6.7 2.8 4.8 11.7 0.9 1........................................................................ 28.6 10.7 1.9 1.2 2.0 5.2 0.4 2........................................................................ 29.5 9.0 2.4 0.7 1.8 3.7 0.3 3........................................................................ 14.7 3.6 1.1 0.4 0.5 1.5 Q

  7. TableHC7.13.xls

    U.S. Energy Information Administration (EIA) Indexed Site

    111.1 26.7 28.8 20.6 13.1 22.0 16.6 38.6 Indoor Lights Turned On During Summer Number of Lights Turned On Between 1 and 4 Hours per Day............ 91.8 20.8 23.6 17.0 11.3 19.1 13.0 30.7 1........................................................... 28.6 9.4 9.1 4.5 2.4 3.2 5.7 12.6 2........................................................... 29.5 6.8 8.0 5.8 3.7 5.2 4.2 10.2 3........................................................... 14.7 2.7 3.1 3.0 2.5 3.4 1.7 4.1

  8. PowerPoint Presentation

    U.S. Energy Information Administration (EIA) Indexed Site

    LNG World LNG Imports 1964 - 2007 World LNG Imports 1964 - 2007 0 20 40 60 80 100 120 140 160 180 200 1964 1968 1972 1976 1980 1984 1988 1992 1996 2000 2004 Americas Total Europe Total Asia in mtpa 7.7%pa 2 LNG 0 4 8 12 16 1 9 6 8 1 9 7 3 1 9 7 8 1 9 8 3 1 9 8 8 1 9 9 3 1 9 9 8 2 0 0 3 Algeria Trinidad Egypt Nigeria Eq. Guinea M. East Pacific Basin in mtpa US LNG Imports by Source 1968-2007 US LNG Imports by Source 1968-2007 3 LNG Regional LNG Production 1990 - 2007 Regional LNG Production 1990

  9. S U M M A R I E S U.S. Energy Information Administration | State Energy Data 2013: Prices and Expenditures

    Gasoline and Diesel Fuel Update (EIA)

    6 Table E14. Electric Power Sector Energy Expenditure Estimates, 2013 (Million Dollars) State Coal Natural Gas a Petroleum Nuclear Fuel Biomass Electricity Imports c Total Energy d Distillate Fuel Oil Petroleum Coke Residual Fuel Oil Total Wood and Waste b Alabama 1,367.8 1,382.3 14.0 - - 14.0 352.0 9.2 - 3,125.3 Alaska 28.8 160.6 76.8 - 12.2 89.0 - - (s) 278.4 Arizona 934.4 1,034.6 11.3 - - 11.3 302.7 5.5 1.3 2,289.9 Arkansas 771.5 404.1 8.3 - 1.0 9.2 75.7 3.1 - 1,263.7 California 12.1 3,732.2

  10. FE LNG Exports-v1-aeo2014_8_29_14.xlsx

    U.S. Energy Information Administration (EIA) Indexed Site

    baseline 12 Bcf 16 Bcf 20 Bcf Alt 20 Bcf baseline 12 Bcf 16 Bcf 20 Bcf baseline 12 Bcf 16 Bcf 20 Bcf baseline 12 Bcf 16 Bcf 20 Bcf baseline 12 Bcf 16 Bcf 20 Bcf NATURAL GAS VOLUMES (Tcf) Net Exports 3.6 5.1 6.1 7.0 6.3 4.9 4.9 5.9 6.8 1.8 4.1 5.0 5.8 3.3 5.0 6.0 7.0 3.2 5.0 6.0 7.0 gross imports 2.2 2.3 2.3 2.3 2.3 2.4 2.5 2.4 2.3 2.6 3.0 3.0 3.1 2.3 2.4 2.4 2.4 2.3 2.4 2.4 2.4 gross exports 5.8 7.5 8.5 9.3 8.6 7.3 7.4 8.3 9.2 4.4 7.0 8.0 8.9 5.6 7.4 8.4 9.3 5.5 7.4 8.4 9.3 Dry Production 32.5

  11. Microsoft Word - PDEA Appendix B

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Chairman, Council of Athabascan Governments, and Laurie Thomas, President, Gwitchyaa Zhee Corporation and Subsidiaries. B-7 B-8 B-9 B-10 B-11 B-12 B-13 B-14 B-15 B-16 B-17 B-18

  12. NNSA 2014 Stewardship Science Academic Programs Annual

    National Nuclear Security Administration (NNSA)

    ...green: L 5, black: L 10, and red: L 15 m), for laser pulse duration of 1ps (Figure 1a) and 3ps (Figure 1b). 16 National Nuclear Security Administration RESEARCH High Energy ...

  13. Eastern Shoshone Tribe - Wind Feasibility Study on the Wind River...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    RMP line) Met Tower Locations Boysen Peak Crow Creek upper Big Horn Flats Stagner Mtn. ... Percentage of Time at Speed & Direction 5 . 1 4 . 7 3 . 9 4 . 1 4 . 9 4 . 7 3 . 7 3 . 6 3 ...

  14. DOE-HDBK-1169-2003; DOE Handbook Nuclear Air Cleaning Handbook

    Energy Savers [EERE]

    ... 8-1 8.2 Proof of Design - HEPA Filter Design Qualification testing for Nuclear Service ......8-3 8.3 Manufacturer's Quality Control - ...

  15. Percent of Industrial Natural Gas Deliveries in Indiana Represented by the

    U.S. Energy Information Administration (EIA) Indexed Site

    Price (Percent) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2001 15.1 14.0 7.1 7.1 4.2 3.7 5.2 1.0 5.5 8.3 6.6 10.2 2002 8.4 8.1 10.1 6.4 5.3 6.2 5.3 5.9 6.6 12.5 12.6 12.4 2003 14.2 12.9 8.9 7.2 7.0 5.9 6.2 5.7 9.3 6.2 11.3 9.3 2004 9.2 8.9 8.9 6.9 6.4 6.2 6.9 6.5 7.3 7.9 10.4 11.6 2005 9.8 7.7 9.6 5.8 6.3 5.5 5.5 6.7 8.2 8.2 10.6 8.9 2006 8.2 9.3 7.4 4.3 7.0 5.0 6.4 5.9 6.3 8.2 8.3 8.4 2007 9.3 9.4 5.8 7.6 6.1 5.5 6.0 5.0 6.9 6.8 9.5 9.1 2008 8.4 7.5 7.0 6.7 5.5 4.5 4.7 4.7 5.3

  16. Buildings Energy Data Book: 3.3 Commercial Sector Expenditures

    Buildings Energy Data Book [EERE]

    5 2015 Commercial Energy End-Use Expenditure Splits, by Fuel Type ($2010 Billion) (1) Natural Petroleum Gas Distil. Resid. LPG Oth(2) Total Coal (3) Electricity Total Percent Lighting 28.4 28.4 16.3% Space Heating 14.6 2.9 1.3 0.1 4.3 0.1 4.7 23.7 13.6% Ventilation 15.1 15.1 8.6% Space Cooling 0.3 14.2 14.5 8.3% Refrigeration 9.9 9.9 5.7% Electronics 8.8 8.8 5.1% Water Heating 4.1 0.7 0.7 2.5 7.3 4.2% Computers 5.3 5.3 3.0% Cooking 1.7 0.6 2.3 1.3% Other (4) 2.9 0.3 3.7 1.4 5.4 22.8 31.1 17.8%

  17. Buildings Energy Data Book: 3.6 Office Building Markets and Companies

    Buildings Energy Data Book [EERE]

    8 Energy Benchmarks for Existing Large Office Buildings, by Selected City and End-Use (thousand Btu per square foot) IECC Post Pre Post Pre Post Pre Post Pre Miami 1A 0.3 0.8 21.9 24.5 0.3 0.2 3.1 3.5 Houston 2A 4.2 4.4 17.7 20.9 0.3 0.3 2.8 3.3 Phoenix 2B 3.0 3.3 16.2 18.3 0.3 0.3 3.2 3.7 Atlanta 3A 6.9 8.5 14.1 17.5 0.4 0.4 2.6 3.2 Los Angeles 3B 2.8 2.9 11.9 13.0 0.4 0.4 2.5 2.7 Las Vegas 3B 4.6 4.7 10.8 13.0 0.3 0.3 2.7 3.3 San Francisco 3C 5.0 6.4 5.6 6.6 0.4 0.4 1.8 2.1 Baltimore 4A 9.8

  18. Buildings Energy Data Book: 3.7 Retail Markets and Companies

    Buildings Energy Data Book [EERE]

    1 2010 Top Retail Companies, by Sales # Stores % Change over Chain ($billion) 2009 Revenues 2010 2009 Stores Wal-Mart Stores, Inc. 419.0 3.4% 8,970 6.0% The Kroger Co. 82.2 7.1% 3,605 -0.4% Costco 76.3 9.1% 572 1.1% The Home Depot 68.0 2.8% 2,248 0.2% Walgreen Co. 67.4 6.4% 8,046 7.3% Target Corp. 67.4 3.1% 1,750 0.6% CVS Caremark 57.3 3.6% 7,182 2.2% Best Buy 50.3 1.2% 4,172 3.7% Lowes Cos. 48.8 3.4% 1,749 2.3% Sears Holdings 43.3 -1.6% 4,038 2.2% Source(s): 2010 Revenues % Change over Chain

  19. Buildings Energy Data Book: 3.7 Retail Markets and Companies

    Buildings Energy Data Book [EERE]

    5 Energy Benchmarks for Existing Retail Buildings, by Selected City and End-Use (thousand Btu per square foot) IECC Post Pre Post Pre Post Pre Miami 1A 0.5 0.7 23.0 25.2 14.3 16.1 Houston 2A 11.6 12.4 16.2 18.9 14.6 16.9 Phoenix 2B 8.3 10.2 17.2 21.3 14.2 17.5 Atlanta 3A 24.9 26.2 9.2 11.2 15.1 17.4 Los Angeles 3B 6.9 7.7 3.3 3.9 13.4 14.1 Las Vegas 3B 15.4 17.9 11.6 14.8 12.7 16.9 San Francisco 3C 22.4 22.5 0.7 1.0 10.6 12.1 Baltimore 4A 43.0 46.9 6.2 7.9 13.3 16.2 Albuquerque 4B 30.2 33.8 5.3

  20. Buildings Energy Data Book: 5.8 Active Solar Systems

    Buildings Energy Data Book [EERE]

    8 Annual New Installations of Grid-Tied Photovoltaic Cells and Modules, by Market (MW) Peak Capacity by Use 2004 2005 2006 2007 2008 2009 2010 Residential 23.4 26.2 36.3 55.9 74.5 150.4 260.9 Non-Residential 30.6 49.0 64.2 96.5 202.4 202.4 343.8 Utility 1.8 0.6 0.2 8.7 21.3 66.6 286.0 Unknown 1.8 3.2 4.0 7.7 12.7 17.7 3.7 Total New Capacity 57.6 79.0 104.7 168.8 310.9 437.1 894.4 Cumulative Capacity 155.1 234.2 338.9 507.7 818.6 Number of Installations 6,873 7,718 Source(s): Sherwood, Larry.

  1. Total...........................................................

    U.S. Energy Information Administration (EIA) Indexed Site

    26.7 28.8 20.6 13.1 22.0 16.6 38.6 Floorspace (Square Feet) Total Floorspace 1 Fewer than 500................................... 3.2 1.9 0.9 Q Q Q 1.3 2.3 500 to 999........................................... 23.8 10.5 7.3 3.3 1.4 1.2 6.6 12.9 1,000 to 1,499..................................... 20.8 5.8 7.0 3.8 2.2 2.0 3.9 8.9 1,500 to 1,999..................................... 15.4 3.1 4.2 3.4 2.0 2.7 1.9 5.0 2,000 to 2,499..................................... 12.2 1.7 2.7 2.9 1.8 3.2 1.1 2.8

  2. Indiana Natural Gas in Underground Storage - Change in Working Gas from

    U.S. Energy Information Administration (EIA) Indexed Site

    Same Month Previous Year (Percent) Percent) Indiana Natural Gas in Underground Storage - Change in Working Gas from Same Month Previous Year (Percent) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 1991 11.0 5.4 -3.6 -8.8 -7.2 -9.9 -4.3 -0.2 0.9 13.4 2.4 -1.7 1992 -6.0 -4.2 -10.1 -9.5 -13.2 -4.2 4.7 1.9 3.9 -7.0 -6.5 -3.1 1993 1.6 -1.2 8.3 19.7 17.1 12.0 6.3 7.0 2.7 -1.9 -0.1 3.1 1994 -0.3 7.7 13.2 1.4 -4.7 -2.3 0.9 -0.1 -0.7 3.7 11.3 11.2 1995 17.4 9.6 8.0 8.6 11.8 7.0 -3.4 -5.3 -3.3

  3. oil1984.xls

    Gasoline and Diesel Fuel Update (EIA)

    Total U.S. Households 17.5 13.8 32.0 91 39 71.9 27 697 0.30 550 203 Census Region and Division Northeast 9.5 6.6 18.2 141 51 97.3 35 1,066 0.38 734 266 New England 2.5 1.9 5.6 140 49 108.8 39 1,105 0.38 856 306 Middle Atlantic 7.0 4.6 12.6 142 52 93.2 34 1,050 0.38 690 252 Midwest 2.6 2.3 5.1 55 25 49.1 19 420 0.19 376 143 East North Central 2.0 1.8 3.8 54 25 49.0 18 413 0.19 376 141 West North Central 0.6 0.5 1.2 58 25 49.5 19 445 0.19 377 148 South 4.6 4.2 7.3 39 22 35.0 13 315 0.18 285 108

  4. International Energy Outlook 2013

    Gasoline and Diesel Fuel Update (EIA)

    6 Appendix F Table F2. Total OECD delivered energy consumption by end-use sector and fuel, 2010-2040 (quadrillion Btu) Sector/fuel Projections Average annual percent change, 2010-2040 2010 2015 2020 2025 2030 2035 2040 Residential Liquids 4.3 4.0 3.9 3.8 3.7 3.5 3.4 -0.8 Natural gas 12.0 11.9 12.2 12.5 12.8 12.9 12.9 0.3 Coal 0.8 0.8 0.7 0.7 0.7 0.6 0.6 -1.4 Electricity 10.6 11.1 11.7 12.5 13.2 13.9 14.6 1.1 Total 28.2 28.1 29.0 29.9 30.8 31.3 32.0 0.4 Commercial Liquids 2.6 2.4 2.4 2.3 2.3 2.2

  5. 2005_Run 3-29-05.xls

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    SLAC Shutdown SSRL 2004-2005 SPEAR RUN SCHEDULE AP 7 14 13 10 11 9 30 27 26 28 24 23 25 30 27 28 26 28 29 31 29 2 1 3 4 3 7 1 8 2 1 1 1 4 1 2 4 6 9 10 11 8 3 12 3 AP 4 1 5 7 5 30 19 20 16 17 14 14 20 19 14 17 2 13 5 30 9 10 9 12 3 13 11 10 12 2 1 2 3 10 6 3 7 5 4 MA 10 11 11 9 7 18 12 15 6 1 3 5 5 4 9 8 9 7 3 13 6 7 15 11 14 12 29 User Conf. 17 25 17 16 23 24 30 27 28 26 29 29 29 31 30 8 2004 2005 31 9 15 13 25 22 11 13 11 12 8 5 3 6 MA 8 13 10 12 11 4 6 5 4 2 2 7 24 23 14 31 29 30 27 29 29 30

  6. " Row: Employment Sizes within NAICS Codes...

    U.S. Energy Information Administration (EIA) Indexed Site

    " 311 - 339","ALL MANUFACTURING INDUSTRIES" ,"Employment Size" ," Under 50",507.3,6.7,3.4,2.6 ," 50-99",561.6,6.7,3.2,3 ," 100-249",913.6,9.2,4.4,2 ," ...

  7. Percent of Industrial Natural Gas Deliveries in Ohio Represented by the

    U.S. Energy Information Administration (EIA) Indexed Site

    Price (Percent) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2001 13.1 9.8 10.4 6.2 3.9 3.4 1.5 4.8 1.2 2.9 5.6 6.4 2002 5.4 6.2 5.4 4.8 1.9 1.7 1.6 2.1 2.5 2.3 4.9 6.7 2003 6.3 7.0 5.4 4.0 1.8 2.4 2.0 1.7 1.7 2.4 3.3 4.6 2004 5.1 5.7 4.0 3.8 2.1 2.3 1.7 2.3 2.2 2.7 3.4 4.5 2005 5.7 6.6 4.5 2.6 2.0 1.6 2.1 2.0 1.9 2.6 3.3 4.8 2006 4.6 4.7 4.0 2.7 2.1 2.2 2.2 2.1 2.2 2.2 3.0 3.5 2007 3.9 4.8 3.5 2.6 1.8 1.8 1.9 1.4 1.5 1.2 2.2 3.7 2008 3.9 4.2 3.5 2.5 1.1 1.7 1.9 1.4 1.4 1.6 2.7 4.1

  8. High-pressure single-crystal elasticity study of CO{sub 2} across phase I-III transition

    SciTech Connect (OSTI)

    Zhang, Jin S. Bass, Jay D.; Shieh, Sean R.; Dera, Przemyslaw; Prakapenka, Vitali

    2014-04-07

    Sound velocities and elastic moduli of solid single-crystal CO{sub 2} were measured at pressures up to 11.7(3) GPa by Brillouin spectroscopy. The aggregate adiabatic bulk modulus (K{sub S}), shear modulus (G), and their pressure derivatives for CO{sub 2} Phase I are K{sub S0}?=?3.4(6) GPa, G{sub 0}?=?1.8(2) GPa, (dK{sub S}/dP){sub 0}?=?7.8(3), (dG/dP){sub 0}?=?2.5(1), (d{sup 2}K{sub S}/dP{sup 2}){sub 0}?=??0.23(3) GPa{sup ?1}, and (d{sup 2}G/dP{sup 2}){sub 0}?=??0.10(1) GPa{sup ?1}. A small increase of elastic properties was observed between 9.8(1) and 10.5(3) GPa, in agreement with the CO{sub 2} I-III transition pressure determined from previous x-ray diffraction experiments. Above the transition pressure P{sub T}, we observed a mixture dominated by CO{sub 2}-I, with minor CO{sub 2}-III. The CO{sub 2}-I + III mixture shows slightly increased sound velocities compared to pure CO{sub 2}-I. Elastic anisotropy calculated from the single-crystal elasticity tensor exhibits a decrease with pressure beginning at 7.9(1) GPa, which is lower than P{sub T}. Our results coincide with recent X-ray Raman observations, suggesting that a pressure-induced electronic transition is related to local structural and optical changes.

  9. DUST AND GAS IN THE MAGELLANIC CLOUDS FROM THE HERITAGE HERSCHEL KEY PROJECT. I. DUST PROPERTIES AND INSIGHTS INTO THE ORIGIN OF THE SUBMILLIMETER EXCESS EMISSION

    SciTech Connect (OSTI)

    Gordon, Karl D.; Roman-Duval, Julia; Meixner, Margaret; Bot, Caroline; Babler, Brian; Bernard, Jean-Philippe; Bolatto, Alberto; Jameson, Katherine; Boyer, Martha L.; Clayton, Geoffrey C.; Engelbracht, Charles; Fukui, Yasuo; Galametz, Maud; Galliano, Frederic; Hony, Sacha; Lebouteiller, Vianney; Indebetouw, Remy; Israel, Frank P.; Kawamura, Akiko; and others

    2014-12-20

    The dust properties in the Large and Small Magellanic clouds (LMC/SMC) are studied using the HERITAGE Herschel Key Project photometric data in five bands from 100 to 500?m. Three simple models of dust emission were fit to the observations: a single temperature blackbody modified by a power-law emissivity (SMBB), a single temperature blackbody modified by a broken power-law emissivity (BEMBB), and two blackbodies with different temperatures, both modified by the same power-law emissivity (TTMBB). Using these models, we investigate the origin of the submillimeter excess, defined as the submillimeter emission above that expected from SMBB models fit to observations <200 ?m. We find that the BEMBB model produces the lowest fit residuals with pixel-averaged 500?m submillimeter excesses of 27% and 43% for the LMC and SMC, respectively. Adopting gas masses from previous works, the gas-to-dust ratios calculated from our fitting results show that the TTMBB fits require significantly more dust than are available even if all the metals present in the interstellar medium (ISM) were condensed into dust. This indicates that the submillimeter excess is more likely to be due to emissivity variations than a second population of colder dust. We derive integrated dust masses of (7.3 1.7) 10{sup 5} and (8.3 2.1) 10{sup 4} M {sub ?} for the LMC and SMC, respectively. We find significant correlations between the submillimeter excess and other dust properties; further work is needed to determine the relative contributions of fitting noise and ISM physics to the correlations.

  10. Microsoft Word - FEA Appendix B

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Athabascan Governments, and Laurie Thomas, President, Gwitchyaa Zhee Corporation and Subsidiaries. B-7 B-8 B-9 B-10 B-11 B-12 B-13 B-14 B-15 B-16 B-17 B-18 B-19 B-20 B-21 B-22 ...

  11. TUNL Nuclear Data Project, HTML Project

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    B 16B is available in the following: HTML for 16B: (1971AJ02), (1977AJ02), (1982AJ01), (1986AJ04), (1993TI07) A = 16 is available for the following: Energy Level Diagrams for A = 16 A = 16 Tables A = 16 References PDF Documents for A = 16 Errata for A = 16 - 17 publications Last modified on 11 May 2016

  12. Association

    National Nuclear Security Administration (NNSA)

    ......... 7 ' 3.0 Accident Rates ......13 4. Frequencies of Accident Types (TIFA 1980-1989, tractor ...

  13. Association

    National Nuclear Security Administration (NNSA)

    This report describes the development of accident rate influence factors as related to the ......... 7 ' 3.0 Accident Rates ......

  14. ALSNews Vol. 311

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    radiation microtomography at ALS Beamline 8.3.2, researchers investigated changes in crack path and toughening mechanisms in human cortical bone with increased exposure to...

  15. untitled

    Office of Environmental Management (EM)

    ... S5.8.2 Specific Criteria (or Guidelines) ... S5.8.3 Required Waste Management Features......In this guidance, standards indicate a degree or level ...

  16. Energy Information Administration - Commercial Energy Consumption...

    U.S. Energy Information Administration (EIA) Indexed Site

    500,000 ... 8 3 1 Q Q 3 Q Principal Building Activity Education ... 386 360 21 Q N N N Food Sales...

  17. ENVIRONMENTAL MANAGEMENT ADVISORY BOARD U.S. DEPARTMENT OF ENERGY

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    ... Especially the following: Continued cleanup of radioactive and chemical waste resulting from the Manhattan Project and Cold War activities Goal 3, Strategic Objective 8 3 ...

  18. BPA-2011-01861-FOIA Response

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Scintillation Frame Testing (Absolute Flow) - Scott Bennett, Dan Ramirez, Dan Patla 8. 3D CAM Operation Surveys - Dan Ramirez 9. Chief Joseph Flow Meter Data to GDACS - Scott...

  19. " "," ",,," Steam Turbines Supplied by Either Conventional or...

    U.S. Energy Information Administration (EIA) Indexed Site

    3 Relative Standard Errors for Table 8.3;" " Unit: Percents." " "," ",,," Steam Turbines Supplied by Either Conventional or Fluidized Bed Boilers",,,"Conventional Combusion ...

  20. ,,,"with Any"," Steam Turbines Supplied by Either Conventional...

    U.S. Energy Information Administration (EIA) Indexed Site

    3 Relative Standard Errors for Table 8.3;" " Unit: Percents." ,,,"Establishments" ,,,"with Any"," Steam Turbines Supplied by Either Conventional or Fluidized Bed ...

  1. Microsoft Word - 14-3532 - EMENDED

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ... 119 4.8.3 Dose from Air Emissions ......136 5.5 Hydrogen and Methane Monitoring ... sample inlet located upstream from the active panel(s). ...

  2. ALSNews Vol. 316

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    These enzymes are also exploited clinically as targets of antibiotics and anticancer therapeutics. Researchers at ALS Beamline 8.3.1 have created a new molecular model...

  3. Rugged Renewables EMAT Inc | Open Energy Information

    Open Energy Info (EERE)

    EMAT Inc Jump to: navigation, search Name: Rugged Renewables EMAT Inc Address: Unit 3 Gear House Saltmeadows Road Place: Gateshead Zip: NE8 3AH Region: United Kingdom...

  4. Federal Buildings Supplemental Survey 1993

    U.S. Energy Information Administration (EIA) Indexed Site

    Activity Education ... 8 3 2 3 598 333 296 333 Health Care ... 41 20 18 16 14,559 12,538 12,365 11,551...

  5. Lysanda Limited | Open Energy Information

    Open Energy Info (EERE)

    CM8 3GA Product: US-based vehicle engineering consultancy with a technology capable of playing a role in vehicle emissions management. References: Lysanda Limited1 This...

  6. Sabien Technology Group Plc | Open Energy Information

    Open Energy Info (EERE)

    Sabien Technology Group Plc Jump to: navigation, search Name: Sabien Technology Group Plc Place: Manchester, England, United Kingdom Zip: SK8 3GP Product: Sabien builds and...

  7. EIA - Household Transportation report: Household Vehicles Energy...

    U.S. Energy Information Administration (EIA) Indexed Site

    National Research Council, Effectiveness and Impact of Corporate Average Fuel Economy (CAFE) Standards (Washington, DC: National Academy of Sciences, 2002), p. 85. 4 8.3 million...

  8. Climate Energy | Open Energy Information

    Open Energy Info (EERE)

    Climate Energy Jump to: navigation, search Name: Climate Energy Place: Witham, England, United Kingdom Zip: CM8 3UN Sector: Efficiency Product: Essex, UK, based provider of advice...

  9. X:\\L6046\\Data_Publication\\Pma\\current\\ventura\\pma.vp

    U.S. Energy Information Administration (EIA) Indexed Site

    1999 January ... 12.7 13.0 25.6 21.2 8.2 55.0 3.7 3.8 6.6 2.7 - 9.3 February ... 13.3 13.6 27.3 23.1 8.2 58.7 3.7 3.7 7.0 2.9 W 10.0 March...

  10. EuTZn (T=Pd, Pt, Au) with TiNiSi-type structure-Magnetic properties and {sup 151}Eu Moessbauer spectroscopy

    SciTech Connect (OSTI)

    Mishra, Trinath; Hermes, Wilfried; Harmening, Thomas; Eul, Matthias; Poettgen, Rainer

    2009-09-15

    The europium compounds EuTZn (T=Pd, Pt, Au) were synthesized from the elements in sealed tantalum tubes in an induction furnace. These intermetallics crystallize with the orthorhombic TiNiSi-type structure, space group Pnma. The structures were investigated by X-ray diffraction on powders and single crystals: a=732.3(2), b=448.5(2), c=787.7(2) pm, R{sub 1}/wR{sub 2}=0.0400/0.0594, 565 F{sup 2} values for EuPdZn, a=727.8(3), b=443.7(1), c=781.7(3) pm, R{sub 1}/wR{sub 2}=0.0605/0.0866, 573 F{sup 2} values for EuPtZn, and a=747.4(2), b=465.8(2), c=789.1(4) pm, R{sub 1}/wR{sub 2}=0.0351/0.0590, 658 F{sup 2} values for EuAuZn, with 20 variables per refinement. Together the T and zinc atoms build up three-dimensional [TZn] networks with short T-Zn distances. The EuTZn compounds show Curie-Weiss behavior in the temperature range from 75 to 300 K with mu{sub eff}=7.97(1), 7.70(1), and 7.94(1) mu{sub B}/Eu atom and theta{sub P}=18.6(1), 34.9(1), and 55.5(1) K for T=Pd, Pt, and Au, respectively, indicating divalent europium. Antiferromagntic ordering was detected at 15.1(3) K for EuPdZn and canted ferromagnetic ordering at 21.2(3) and 51.1(3) K for EuPtZn and EuAuZn. {sup 151}Eu Moessbauer spectroscopic measurements confirm the divalent nature of the europium atoms by isomer shift values ranging from -8.22(8) (EuPtZn) to -9.23(2) mm/s (EuAuZn). At 4.2 K full magnetic hyperfine field splitting is observed in all three compounds due to magnetic ordering of the europium magnetic moments. - Graphical abstract: Europium coordination in EuPdZn, EuPtZn, and EuAuZn.

  11. Hoisting and Rigging Technical Advisory Committee | Department...

    Energy Savers [EERE]

    of hoisting and rigging safety-related issues; or 3.7.3 Research available literature and develop recommended solutions for DOE unique situations where little or no...

  12. Word Pro - Untitled1

    Gasoline and Diesel Fuel Update (EIA)

    3 Table 7.3 Coal Consumption by Sector, Selected Years, 1949-2011 (Million Short Tons) Year Residential Sector 1 Commercial Sector 1 Industrial Sector Transportation Sector ...

  13. Emergency Response Health & Safety Manual

    Office of Scientific and Technical Information (OSTI)

    ......... 20 2.4.2.2 Engineering Controls......and Human Consumption...... 54 3.7.3 Food and Beverage Consumption ...

  14. 2004 - 06 | Jefferson Lab

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    6 Jun 2004 Tue, 2004-06-15 14:00 Jefferson Lab awards $7.3 million construction contract to Chesapeake firm

  15. Hillsboro Alternative Energy Fund | Open Energy Information

    Open Energy Info (EERE)

    Alternative Energy Fund Jump to: navigation, search Name: Hillsboro Alternative Energy Fund Place: London, England, United Kingdom Zip: SW7 3SS Product: A hedge fund concentrating...

  16. Order 580.1D

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    580.1D Title: PERSONAL PROPERTY MANAGEMENT Owner: Thomas Wilson, Jr., Office of Institutional Operations Approving Official: Bradley J. Tomer, Chief Operating Officer, Office of the Director {signature} /s/ Bradley J. Tomer Approval Date: 8/3/12 Last Reviewed Date: 8/3/12 Cancellation: Order 580.1C, Personal Property Management TABLE OF CONTENTS 1. PURPOSE ..................................................................................................................................... 2 2.

  17. X:\\L6046\\Data_Publication\\Pma\\current\\ventura\\pma.vp

    U.S. Energy Information Administration (EIA) Indexed Site

    38.4 242.3 8.3 8.4 6.5 13.4 - 19.9 2002 ... 46.2 47.4 46.9 163.0 39.2 249.2 8.3 8.5 7.4 13.4 - 20.8 See footnotes at end of table. 14 Energy...

  18. "Table A50. Selected Energy Operating Ratios for Total Energy...

    U.S. Energy Information Administration (EIA) Indexed Site

    ," 20-49",531,8.3,3.7,0.6,10.3,6.3 ," 50-99",702.8,9.2,4.2,4.6,12.3,5 ," 100-249",1365.5,13,6.1,16.4,10,4.4 ," 250-499",2680.8,20.3,9.4,24.5,12.8,3.9 ," 500 and ...

  19. "Table A45. Selected Energy Operating Ratios for Total Energy...

    U.S. Energy Information Administration (EIA) Indexed Site

    " ,"(million dollars)" ," Under 20",251.8,4.6,2.5,0.4,12.8,5.6 ," 20-49",507.8,6.8,3.2,0.3,8.4,6.8 ," 50-99",748.2,8.2,3.8,1.7,8.8,4.1 ," 100-249",1252.4,10.6,5.2,13.1,9.8,3.6 ," ...

  20. " Row: Employment Sizes within NAICS Codes...

    U.S. Energy Information Administration (EIA) Indexed Site

    " 311 - 339","ALL MANUFACTURING INDUSTRIES" ,"Employment Size" ," Under 50",395.7,4.3,2.3,3.6 ," 50-99",663.4,6.8,3.3,5 ," 100-249",905.8,7.9,3.8,3.6 ," 250-499",1407.1,11.1,5....

  1. Table 7. Electric power industry emissions estimates, 1990 through...

    U.S. Energy Information Administration (EIA) Indexed Site

    ...581,67316,56272,60840,60087,65822,78727 "Nitrogen oxide (short tons)" ...8,3.1,2.5,2.5,3.8,4,3,2.3,2.5,2.8,3,3.9 "Nitrogen oxide",0.5,0.5,0.5,0.4,0.5,0.5,0.7,0.7,1...

  2. TOTAL WORKFORCE Males

    National Nuclear Security Administration (NNSA)

    Females Male Female Male Female Male Female Male Female Male Female 0 0 1 2 0 0 0 1 6 2 PAY PLAN SES 2 EN 03 1 NQ (Prof/Tech/Admin) 7 GS 15 1 GS 14 1 DIVERSITY 12 7 58.3% American Indian Alaska Native African American Asian American Pacific Islander Hispanic White 41.7% Associate Administrator of External Affairs (NA-EA) As of September 5, 2015 SES EN 03 NQ GS 15 GS 14 16.7% 8.3% 58.3% 8.3% 8.3% 0.0% 0.0% 8.3% 16.7% 0.0% 0.0% 0.0% 8.3% 50.0% 16.7% Prepared by NNSA Office of Civil Rights

  3. Million U.S. Housing Units Total...............................

    U.S. Energy Information Administration (EIA) Indexed Site

    ... Digital Video Disc Players (DVD)...... ) 89.3 25.8 6.8 2.8 4.5 11.0 0.8 1...... 56.4 16.9 4.0 1.7 3.4 7.3 0.5 ...

  4. untitled

    U.S. Energy Information Administration (EIA) Indexed Site

    1,519.2 43,169.0 31,921.8 181,170.4 35,284.7 3,695.7 3,730.6 1,312.7 9,777.3 - February ... 41,542.9 43,193.4 33,387.5 190,746.6 32,975.4 3,638.9...

  5. Table 4

    U.S. Energy Information Administration (EIA) Indexed Site

    ght... 16.6 0.7 3.3 5.1 2.6 1.7 1.6 1.7 8.87 Automatic Control... 18.2 0.3 2.2 4.7 3.3 2.5 2.3 2.9 8.90 High...

  6. Table 18. Total Delivered Commercial Energy Consumption, Projected vs. Actual

    U.S. Energy Information Administration (EIA) Indexed Site

    Total Delivered Commercial Energy Consumption, Projected vs. Actual Projected (quadrillion Btu) 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 AEO 1994 6.8 6.9 6.9 7.0 7.1 7.1 7.2 7.2 7.3 7.3 7.4 7.4 7.4 7.5 7.5 7.5 7.5 7.6 AEO 1995 6.9 6.9 7.0 7.0 7.0 7.1 7.1 7.1 7.1 7.1 7.2 7.2 7.2 7.2 7.3 7.3 7.3 AEO 1996 7.1 7.2 7.2 7.3 7.3 7.4 7.4 7.5 7.6 7.6 7.7 7.7 7.8 7.9 8.0 8.0 8.1 8.2 8.2 AEO 1997 7.4 7.4 7.4 7.5 7.5 7.6 7.7 7.7 7.8 7.8 7.9 7.9

  7. A=16-17, 1993 evaluation

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    6 - 17 (1993TI07) (Revised Manuscript from 1993) An evaluation of A = 16 - 17 was published in Nuclear Physics A564 (1993) p.1. The version here lacks the introduction and overview tables that appeared in the full version, and is arranged in a different manner. The figures are now present in the pdf documents, and are also available elsewhere on this server (see below). PDF HTML Figures A = 16 16He, 16Li, 16Be, 16B, 16C, 16N, 16O, 16F, 16Ne, 16Na, 16Mg, 16Al, 16Si A = 16 A = 17 17He, 17Li, 17Be,

  8. Formic acid fuel cells and catalysts

    DOE Patents [OSTI]

    Masel, Richard I.; Larsen, Robert; Ha, Su Yun

    2010-06-22

    An exemplary fuel cell of the invention includes a formic acid fuel solution in communication with an anode (12, 134), an oxidizer in communication with a cathode (<b>16, 135) electrically linked to the anode, and an anode catalyst that includes Pd. An exemplary formic acid fuel cell membrane electrode assembly (130) includes a proton-conducting membrane (131) having opposing first (132) and second surfaces (133), a cathode catalyst on the second membrane surface, and an anode catalyst including Pd on the first surface.

  9. Word Pro - S7

    U.S. Energy Information Administration (EIA) Indexed Site

    3 Table 7.3a Consumption of Combustible Fuels for Electricity Generation: Total (All Sectors) (Sum of Tables 7.3b and 7.3c) Coal a Petroleum Natural Gas f Other Gases g Biomass Other j Distillate Fuel Oil b Residual Fuel Oil c Other Liquids d Petroleum Coke e Total e Wood h Waste i Thousand Short Tons Thousand Barrels Thousand Short Tons Thousand Barrels Billion Cubic Feet Trillion Btu 1950 Total .................... 91,871 5,423 69,998 NA NA 75,421 629 NA 5 NA NA 1955 Total ....................

  10. 2014 Wind Market Report | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    4 Wind Market Report 2014 Wind Market Report Addthis 1 of 8 2 of 8 3 of 8 4 of 8 5 of 8 6 of 8 7 of 8 8 of 8

  11. U.S. Energy Information Administration (EIA)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    year when these prices increased much more by 8.3 percent. Coal prices at independent power producers for 2010 increased to 41.49 per short ton, an increase of 3.9 percent. The...

  12. COMET TA Floor Plan 100225.vc6

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    West Hall Door Emg Exit W Trench Room 1107 S Structural Beam Rack Argus Chamber Interaction Chamber Work Station 8 3 0 2 - V B L as phere CL 420mm f rom N i nner wall. Lens h...

  13. HSRL mass estimate based on CALIPSO

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    NASA B-200 King Air ARCTASISDAC Operations and Science Richard Ferrare, Chris Hostetler, ... hours science *5 flights coordinated with NASA DC-8 *3 flights coordinated with NASA P-3 ...

  14. School Energy Survey Teacher Guide

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Key Student Guide Page 20 INCANDESCENT BULB HALOGEN COMPACT FLUORESCENT (CFL) LIGHT EMITTING DIODE (LED) Number of bulbs to get 25,000 hours 25 8.3 2.5 1 Cost of bulbs for 25,000...

  15. What Does the Sun Give Us: Science Projects in Renewable Energy...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    The second column lists the science content standard, as well as any other strong areas. ... Project Key Standards Grades Pizza Box Oven E-Design 6-8 (3-5 if given Web site first) ...

  16. Before the Senate Homeland Security and Governmental Affairs...

    Energy Savers [EERE]

    Office of Procurement and Assistance Management, Office of Management Subject: Cost-Plus Award Fee PDF icon 8-3-09FinalTestimony(Simpson).pdf More Documents & Publications...

  17. NASEO 2010 Winter Fuels Outlook Conference October 13, 2010...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    warmer than forecast If 10% colder than forecast Heating oil 12 0 25 Natural gas 4 -7 12 Propane 8 -3 18 Electricity -2 -6 2 Average of all fuels 3 -6 10 Source: EIA Short-Term...

  18. ALSNews Vol. 344

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    discharging dynamics of lithium iron phosphate, a promising positive battery electrode. ... Beamline 8.3.2 and the science done there is now on the ALS YouTube channel. Watch it now ...

  19. ALSNews Vol. 346

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    service" at the ALS. Industry@ALS: Environmental Remediation Gets Fired Up with Biochar biochar Using ALS Beamlines 10.3.2 and 8.3.2, the Environmental Protection Agency...

  20. U.S. Gasoline Price Continues to Increase (Long version)

    U.S. Energy Information Administration (EIA) Indexed Site

    That's up 8.3 cents from a week ago, based on the weekly price survey by the U.S. Energy Information Administration. Pump prices were highest in the West Coast states at 2.62 a ...

  1. U.S. Gasoline Price Continues to Increase (Short version)

    U.S. Energy Information Administration (EIA) Indexed Site

    price for regular gasoline rose to 2.27 a gallon on Monday. That's up 8.3 cents from a week ago, based on the weekly price survey by the U.S. Energy Information Administration.

  2. BERAC Meeting March 9-11, 2011 Washington, DC | U.S. DOE Office...

    Office of Science (SC) Website

    Warren Washington .pptx file (29.0MB), The Present and Future of Climate Modeling William ... Gary Geernaert .pptx file (8.3MB), Climate and Environmental Sciences Division Update ...

  3. Office of Wind and Hydropower Technologies Wind Energy Program...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    ... Comment Program Response EPRI-Alden Fish-Friendly Turbine 3.8 3.6 X Focuses on DOE ... improve turbine design and hydropower operations to minimize impact on fish. No response. ...

  4. Acting Deputy Secretary of Energy to Participate in London Energy...

    Broader source: Energy.gov (indexed) [DOE]

    proposed partnership jointly developed by the Group of Eight, People's Republic of China, India and the Republic of Korea (G8+3) energy ministers to provide a forum for...

  5. "NAICS Code(a)","Energy-Management Activity","No Participation...

    U.S. Energy Information Administration (EIA) Indexed Site

    8.4;" " Unit: Percents." "NAICS Code(a)","Energy-Management Activity","No ... MANUFACTURING INDUSTRIES" ,"Full-Time Energy Manager (c)",0.7,4.8,3.9,"--" ,"Set Goals ...

  6. Natural Gas Weekly Update

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Inc. and the U.S. subsidiary of Nexen of 8.3 million, the highest bid during the sale. Top bidders included several independent oil and gas companies such as Kerr-McGee...

  7. Natural Gas Weekly Update, Printer-Friendly Version

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    Inc. and the U.S. subsidiary of Nexen of 8.3 million, the highest bid during the sale. Top bidders included several independent oil and gas companies such as Kerr-McGee...

  8. Word Pro - Untitled1

    U.S. Energy Information Administration (EIA) Indexed Site

    Table 8.3c Useful Thermal Output at Combined-Heat-and-Power Plants: Commercial and ... combined-heat-and-power (CHP) plants. 9 Industrial combined-heat-and-power (CHP) plants. ...

  9. Word Pro - Untitled1

    U.S. Energy Information Administration (EIA) Indexed Site

    Table 8.3a Useful Thermal Output at Combined-Heat-and-Power Plants: Total (All Sectors), ... Notes: * Data do not include electric utility combined-heat-and-power (CHP) plants. * See ...

  10. Word Pro - Untitled1

    U.S. Energy Information Administration (EIA) Indexed Site

    Table 8.3b Useful Thermal Output at Combined-Heat-and-Power Plants: Electric Power Sector, ... Notes: * Data are for combined-heat-and-power (CHP) plants within the NAICS 22 category ...

  11. V-139: Cisco Network Admission Control Input Validation Flaw...

    Broader source: Energy.gov (indexed) [DOE]

    PROBLEM: Cisco Network Admission Control Input Validation Flaw Lets Remote Users Inject SQL Commands PLATFORM: Cisco NAC Manager versions prior to 4.8.3.1 and 4.9.2 ABSTRACT: A...

  12. ALSNews Vol. 336

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Wood scientist and ALS user Jesse Paris is getting an intimate, 3-D view of adhesive penetration in wood-composite structures thanks to ALS Beamline 8.3.2. He and...

  13. ALSNews Vol. 336

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    composites Wood scientist and ALS user Jesse Paris is getting an intimate, 3-D view of adhesive penetration in wood-composite structures thanks to ALS Beamline 8.3.2. He and...

  14. untitled

    U.S. Energy Information Administration (EIA) Indexed Site

    204.8 3,881.7 See footnotes at end of table. Energy Information AdministrationPetroleum Marketing Annual 2008 317 Table 43. Refiner No. 2 Distillate and Fuel Oil Volumes by PAD...

  15. --No Title--

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    Q Q Q Q Q Q Q Q Buildings without Cooling ... 4 3 Q 920 935 1,598 3.8 3.3 7.7 Water-Heating Energy Sources Electricity ... 15 42 57...

  16. Mah Presentation

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Surrow (Temple University) using NLO perturbative QCD calculations showed that di- jets located at forward rapidity (2.8 < < 3.7) with transverse momenta of 5 and 8 GeV...

  17. a1.xls

    U.S. Energy Information Administration (EIA) Indexed Site

    All Buildings ...... 3.8 3.1 4.0 Building Floorspace (Square Feet) 1,001 to 5,000 ...... 5.7 5.6 1.3 5,001 to 10,000 ...

  18. Quality Work Plan Checklist and Resources - Section 3

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    ... Online Tool Multifamily V.5.3 andor V.8.3 3 Does your training plan include a strategy to ensure QCIs working in multifamily buildings attend and receive a successful evaluation ...

  19. untitled

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    2.4 395.1 39,378.3 15,202.9 236.6 2,326.5 279.4 1,832.8 3,308.2 48,591.7 February ... 73.3 367.3 40,530.5 15,923.9 229.8 3,294.8 287.8 1,820.9 4,299.7...

  20. Word Pro - Untitled1

    U.S. Energy Information Administration (EIA) Indexed Site

    ... 2.6 39.6 2003 20.8 3.5 1.8 .3 1.3 .5 2.8 2.0 1.8 1.1 1.5 2.1 15.1 (s) 3.6 43.0 2004 17.8 ... Note: Totals may not equal sum of components due to independent rounding. Web Page: For ...

  1. Significantly Shorter Fe-S Bond in Cytochrome P450-I is Consistent...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    analyzed at Beam Line 7-3 at SSRL. Extended x-ray absorption fine structure (EXAFS) studies on multiple sets of samples revealed that the Fe-S bond in P450-I was in fact 0.09 ...

  2. Microsoft Word - P450-I bh

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    analyzed at Beam Line 7-3 at SSRL. Extended x-ray absorption fine structure (EXAFS) studies on multiple sets of samples revealed that the Fe-S bond in P450-I was in fact 0.09 ...

  3. Feb

    Office of Scientific and Technical Information (OSTI)

    JAXA, 3-1-1 Yoshinodai, Chuo-ku, Sagamihara, Kanagawa 252-5210, Japan 2 Department of Physics, Graduate School of Science, University of Tokyo, Hongo 7-3-1, Bunkyo, Tokyo...

  4. TableHC11.13.xls

    Gasoline and Diesel Fuel Update (EIA)

    Energy-Efficient Bulbs Used...... 31.1 5.2 3.6 1.6 ... Energy-Efficient Bulbs Used...... 27.9 4.7 3.3 1.4 ...

  5. A New Route to Nano Self-Assembly

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    to the surface of a block copolymer and be repositioned to another location along the polymeric chain. SAXS studies of the samples, performed at ALS Beamline 7.3.3, confirmed...

  6. X:\\L6046\\Data_Publication\\Pma\\current\\ventura\\pma.vp

    U.S. Energy Information Administration (EIA) Indexed Site

    14,123.1 17,492.6 March ... 219.8 - 1,810.8 2,030.7 3,263.8 - 14,671.6 17,935.4 April ... 201.2 - 1,777.9...

  7. RAPID/Roadmap/7 (1) | Open Energy Information

    Open Energy Info (EERE)

    including a PPA for new QFs under 20 MW. 7.3 to 7.4 - Is the Facility an Independent Power Producer That Exclusively Sells to Wholesale Customers? Independent power producers...

  8. GROUND LEVEL INVESTIGATION OF ANOMALOUS RADIATION LEVELS IN NIAGARA...

    Office of Legacy Management (LM)

    ;v ;);;J; '9;) -i, - 'L." ; i--j -7,) ;3 i, Work performed by Health and Safety Research Division Oak Ridge National Laboratory Oak Ridge, Tennessee 37630 O&J. 2,7 +, 7&y'...

  9. Fermilab | Tevatron | Tevatron Symposium | Agenda

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Technology Facilities Council Download PDF (1.5 MB) | Download PPT (7.3 MB) On the Large Hadron Collider Rolf-Dieter Heuer, CERN Download PDF (2.4 MB) | Download PPT (9.9 MB) ...

  10. [PFP#290050360

    Office of Legacy Management (LM)

    ... Samples in a Medium Test Positive for a Chemical . . . . . . . . . . . . . . 5-10 5.3.4 ... . . . . . . . . . . . 5-19 5.7.3 Compare Chemical Concentrations with Naturally Occurring ...

  11. Mon Valley work plan

    Office of Legacy Management (LM)

    ... . . . . . . . 9-8 9.7.3 Management of Spills . . . . . . . ... IDW investigation-derived waste in. inch(es) Kd ... Water-level information indicates that the ground-water ...

  12. Workbook Contents

    U.S. Energy Information Administration (EIA) Indexed Site

    Date:","5312016" ,"Excel File Name:","petpnppctaepllyrypctm.xls" ,"Available from Web Page:","http:... Gases (Percent)" 33984,3.2,2.7,3,,3.1,3.4,2.3,,3.8,4.1,4.9...

  13. Presentations

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    | pdf | 348 KB Differences Between Hopper and Franklin October 18, 2010 | Author(s): Harvey Wasserman | Download File: NUG-Oct2010-hjw.pdf | pdf | 7.3 MB Hardware concepts and...

  14. Microsoft Word - Deep-Burn awards news release _2_.doc

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    RELEASE Tim Jackson, DOE-Idaho Operations Office Wednesday, July 23, 2008 (208) 526-8484 U.S. Department of Energy Awards 7.3 million for "Deep-Burn" Gas-Reactor Technology...

  15. U-247: EMC Cloud Tiering Appliance Flaw Lets Remote Users Bypass...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    CTA 7.3.1 and later with Hotfix ESA-2012-034 Addthis Related Articles V-045: Adobe ColdFusion Lets Local Users Bypass Sandbox Restrictions V-036: EMC Smarts Network...

  16. U.S. gasoline prices continue to decrease (long version)

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    That's down 7.3 cents from a week ago, based on the weekly price survey by the U.S. Energy Information Administration. Pump prices were highest in the West Coast states at 3.09 a ...

  17. file://C:\\Documents%20and%20Settings\\VM3\\My%20Documents\\hc6-10a

    U.S. Energy Information Administration (EIA) Indexed Site

    37.6 Have Equipment But | Do Not Use It...... 0.4 Q Q Q | 36.8 | Adequacy of Insulation | Well Insulated...... 42.6 10.5 7.3 3.2 | 3.2 Adequately ...

  18. Annual Energy Review 1998

    Gasoline and Diesel Fuel Update (EIA)

    87 Diagram 4. Coal Flow, 1998 (Million Short Tons) Notes Data are preliminary. Totals may not e ual sum of components due to independent rounding. Sources Tables 7.1, 7.2, and 7.3....

  19. X:\\L6046\\Data_Publication\\Pma\\current\\ventura\\pma.vp

    U.S. Energy Information Administration (EIA) Indexed Site

    per Day Motor Gasoline No. 2 Distillate Residual Fuel Oil Figure 5. U.S. Refiner Wholesale Petroleum Product Volumes Propane 7.3% Kero-jet 2.4% Residual Fuel Oil 1.3% Other...

  20. set3.pdf

    Gasoline and Diesel Fuel Update (EIA)

    ... 117 Q Q 24 19 13 7 3 2 District Chilled Water ...... 50 Q Q ... 828 611 223 134 55 21 7 Buildings with Water Heating ...... 3,239 1,456 ...

  1. ALSNews Vol. 343

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    profile on Floyd that ran last year. Young ALS Researcher Featured on NBC Bay Area Polite Stewart, Jr. recently joined the ALS to work on Beamline 7.3.3, and has attracted...

  2. New Morphological Paradigm Uncovered in Organic Solar Cells

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    spectroscopy and scattering studies conducted by North Carolina State University and Cambridge University researchers at ALS Beamlines 5.3.2 and 7.3.3 found a substantial amount...

  3. DoD Energy Innovation on Military Installations

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Facility Energy 49% 32% 8% 7% 3% 1% 0% Electricity Natural Gas Fuel Oil Coal Steam LPG Other Test Bed Focus 4 Smart Secure Installation Energy Management * Microgrids * Energy ...

  4. homeoffice_household2001.pdf

    U.S. Energy Information Administration (EIA) Indexed Site

    ... RSE Column Factor: Total 2001 Household Income Below Poverty Line Eli- gible for Fed- eral ... 29.1 5.3 22.7 3.8 1 Below 150 percent of poverty line or 60 percent of median State ...

  5. U.S. gasoline prices decreases for 16th week in a row; breaking...

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    for regular gasoline fell 7.3 cents from a week ago to 2.07 a gallon on Monday. This marks a record of 16 consecutive weeks of price drops and breaks the previous record set at...

  6. Direct-Write of Silicon and Germanium Nanostructures

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    electron microscopes at ALS Beamlines 7.3.1 and 11.0.1. From Sand to Processor Modern electronic integrated circuits are made of silicon. Silicon is the most abundant element...

  7. Presentations

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Research | Plans for NERSC's New Building February 3, 2012 | Author(s): Howard Walter, NERSC | Download File: CRT-NUG-120203.pdf | pdf | 7.3 MB User Requirements Gathered...

  8. Slide 1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Wtd. Avg. Int. 7.4% Bureau of Reclamation Appropriations 510 Wtd. Avg. Int. 7.1% Power Marketing Transmission Bonds Issued to Treasury 1,854 Wtd. Avg. Int. 7.3% Bureau of...

  9. TableHC6.6.xls

    U.S. Energy Information Administration (EIA) Indexed Site

    Air-Conditioning Equipment 1, 2 Central System...... 65.9 15.3 22.6 10.7 9.9 7.3 Without a Heat Pump......

  10. Appliance and Equipment Standards Program | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    in effect since 1987 will reach nearly 2 trillion, with a cumulative reduction of about 7.3 billion tons of carbon dioxide emissions, equivalent to the annual greenhouse gas ...

  11. CONTRACTNO.: DE-X13-96GJ87335 TASK ORDER NO.: h

    Office of Legacy Management (LM)

    ... M. Widdop, MACTEC-ERS LSHP 7.3 (A. Garcia) cc WO: Contract File (J. Dearborn) Wind Direction (ESE) above ground surface; analyzed quart Sand and Gravel (90 day) exposure ...

  12. Microsoft Word - M127 Word.doc

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7 3. EFFECTIVE DATE (MDY) See Block 16C 4. REQUISITIONPURCHASE REQ. NO. 5. PROJECT NO. (If applicable) 6. ISSUED BY CODE 7. ADMINISTERED BY (If other than Item 6) CODE U.S....

  13. Microsoft Word - SF30_A007 _2_.doc

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7 3. EFFECTIVE DATE (MDY) See Block 16C 4. REQUISITIONPURCHASE REQ. NO. 5. PROJECT NO. (If applicable) 6. ISSUED BY CODE 7. ADMINISTERED BY (If other than Item 6) CODE U.S....

  14. Python on Genepool

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Python on Genepool Python on Genepool Using Python on Genepool There are two major branches of Python supported on genepool: python 2.7.3 and python 3.2.3. These packages are...

  15. Down-regulation of Rab5 decreases characteristics associated with maintenance of cell transformation

    SciTech Connect (OSTI)

    Silva, Patricio; Soto, Nicolás; Díaz, Jorge; Mendoza, Pablo; Díaz, Natalia; Quest, Andrew F.G.; Torres, Vicente A.

    2015-08-21

    The early endosomal protein Rab5 is highly expressed in tumor samples, although a causal relationship between Rab5 expression and cell transformation has not been established. Here, we report the functional effects of targeting endogenous Rab5 with specific shRNA sequences in different tumor cell lines. Rab5 down-regulation in B16-F10 cells decreased tumor formation by subcutaneous injection into C57/BL6 mice. Accordingly, Rab5 targeting in B16-F10 and A549, but not MDA-MB-231 cells was followed by decreased cell proliferation, increased apoptosis and decreased anchorage-independent growth. These findings suggest that Rab5 expression is required to maintain characteristics associated with cell transformation. - Highlights: • Rab5 is important to the maintenance of cell transformation characteristics. • Down-regulation of Rab5 decreases cell proliferation and increases apoptosis in different cancer cells. • Rab5 is required for anchorage-independent growth and tumorigenicity in-vivo.

  16. untitled

    U.S. Energy Information Administration (EIA) Indexed Site

    2.7 2.7 3.1 5.7 - 8.8 0.5 0.5 0.3 1.0 - 1.3 March ... 1.9 2.0 2.6 4.6 - 7.3 0.3 0.3 0.2 0.9 - 1.2 April ... 1.7 1.7 1.8 4.1...

  17. Table 11. U.S. Refiner Oxygenated Motor Gasoline Volumes by...

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    1.6 1.6 1.7 3.2 - 4.9 0.2 0.2 W 0.7 - 0.9 October ... 2.0 2.0 3.0 4.2 - 7.2 0.3 0.3 W 0.8 - 1.2 November ... 2.7 2.7 3.2 5.7 -...

  18. X:\\Data_Publication\\Pma\\current\\ventura\\pma00.vp

    U.S. Energy Information Administration (EIA) Indexed Site

    1998 January ... 22.8 24.0 12.1 100.6 30.2 142.9 5.5 5.7 3.1 11.5 - 14.6 February ... 24.4 25.5 12.7 104.6 29.7 147.1 5.5 5.7 3.3 11.7 - 15.0...

  19. app_c8

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    8 Description of Activities and Impacts at the Hanford Site C.8-iii DOE/EIS-0287 Idaho HLW & FD EIS TABLE OF CONTENTS Section Page Appendix C.8 Description of Activities and Impacts at the Hanford Site C.8-1 C.8.1 Introduction C.8-1 C.8.2 Description of Alternative Treatment of INEEL Waste at Hanford C.8-2 C.8.2.1 Introduction C.8-2 C.8.2.2 Minimum INEEL Processing Alternative C.8-2 C.8.2.3 Construction C.8-2 C.8.2.4 Operations C.8-3 C.8.3 Affected Environment C.8-5 C.8.3.1 Geology and Soils

  20. 16B

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    B Ground-State Decay Evaluated Data Measured Ground-State Γcm(T1/2) for 16B Adopted value: < 190 ps (2003AU02) Measured Mass Excess for 16B Adopted value: 37080 ± 60 keV (2003AU02) Measurements 1995BO10: 14C(14C, 12N), E = 336 MeV; measured particle spectra, σ(θ). 16B deduced levels. 1996KR05: 12C(17C, 16B), (16C, 15B), E = 880 MeV; measured spectra; deduced one-proton stripping σ from ejectile yields. 16B deduced T1/2 upper limit. 2000KA21: 14C(14C, 12N), E ≈ 335 MeV; measured

  1. Structure of trans-methyl 2-phenylhexahydro-2H-isoxazolo (2,3-a)-pyridine-3-carboxylate

    SciTech Connect (OSTI)

    Ul-Haque, M.; Horne, W.; Ali, S.A. )

    1993-02-01

    The title compound, a 1,3-dipolar cycloaddition product, crystallizes in the monoclinic space group P2[sub 1]/c, with a = 8.199(3), b = 16.908(1), c = 10.248(2) [angstrom],[beta] = 93.58(2)[degrees] and Z = 4. The structure was solved by direct methods and refined by full matrix least squares methods to R = 0.038 for 1687 observed reflections. The stereochemistry of this compound was found to have the [open quotes]ee[close quotes] conformation in the solid state as well as in solution. The piperidine ring in the molecule is in the chair form and the isoxazolidine ring adopts an envelope conformation.

  2. Synthesis, characterization and the crystal structure of a cis-dioxovandium(V) complex of a tridentate Schiff base ligand

    SciTech Connect (OSTI)

    Hai-Xin Liu; Wei Wang; Xin Wang; Min-Yu Tan

    1994-12-01

    The title complex, [VO{sub 2}(C{sub 6}H{sub 5}C(O)CHC(CH{sub 3})NNC(O)CH{sub 2}(NC{sub 5}H{sub 5}))]{center_dot}C{sub 2}H{sub 5}OH, was synthesized and characterized by elemental analysis and spectroscopy. Yellow crystals of the complex are monoclinic, space group P2{sub 1}/a with a = 10.690(2), b = 16.008(3), c = 13.164(4){Angstrom}, {beta} = 107.03(2){degrees}, V = 2153.9(18){Angstrom}{sup 3}, F(000) = 880 and Dc = 1.305 g cm{sup -3} for Z =4. X-ray structure analysis shows that the vanadium coordination number is five and the coordination polyhedron is a distorted trigonal bipyramid.

  3. A novel inorganic-organic compound: Synthesis and structural characterization of tin(II) phenylbis(phosphonate), Sn{sub 2}(PO{sub 3}C{sub 6}H{sub 4}PO{sub 3})

    SciTech Connect (OSTI)

    Subbiah, Ayyappan; Bhuvanesh, Nattamai; Clearfield, Abraham . E-mail: clearfield@mail.chem.tamu.edu

    2005-04-15

    A novel tin(II) phenylbis(phosphonate) compound has been synthesized hydrothermally and its structure has been determined by single crystal X-ray diffraction. The structure is monoclinic, space group P2{sub 1}/c (no. 14), a=4.8094(4), b=16.2871(13), c=6.9107(6)A; {beta}=106.292(6){sup o}, V=519.59(7)A{sup 3}, Z=2. The three-dimensional structure consists of 3-coordinated tin and 4-coordinated phosphorus double layers separated (pillared) by phenyl rings. These phenyl rings are placed 4.8A apart along the a-axis in the structure resulting in lower surface area ({approx}14m{sup 2}/g). The porosity has been increased by replacing phenyl groups by methyl groups ({approx}31m{sup 2}/g)

  4. Induction and Rejoining of DNA Double Strand Breaks Assessed by H2AX Phosphorylation in Melanoma Cells Irradiated with Proton and Lithium Beams

    SciTech Connect (OSTI)

    Ibanez, Irene L.; Bracalente, Candelaria; Molinari, Beatriz L.; Palmieri, Monica A.; Policastro, Lucia; Kreiner, Andres J.; Burlon, Alejandro A.; Valda, Alejandro; Navalesi, Daniela; Davidson, Jorge; Davidson, Miguel; Vazquez, Monica; Ozafran, Mabel; Duran, Hebe

    2009-07-15

    Purpose: The aim of this study was to evaluate the induction and rejoining of DNA double strand breaks (DSBs) in melanoma cells exposed to low and high linear energy transfer (LET) radiation. Methods and Materials: DSBs and survival were determined as a function of dose in melanoma cells (B16-F0) irradiated with monoenergetic proton and lithium beams and with a gamma source. Survival curves were obtained by clonogenic assay and fitted to the linear-quadratic model. DSBs were evaluated by the detection of phosphorylated histone H2AX ({gamma}H2AX) foci at 30 min and 6 h post-irradiation. Results: Survival curves showed the increasing effectiveness of radiation as a function of LET. {gamma}H2AX labeling showed an increase in the number of foci vs. dose for all the radiations evaluated. A decrease in the number of foci was found at 6 h post-irradiation for low LET radiation, revealing the repair capacity of DSBs. An increase in the size of {gamma}H2AX foci in cells irradiated with lithium beams was found, as compared with gamma and proton irradiations, which could be attributed to the clusters of DSBs induced by high LET radiation. Foci size increased at 6 h post-irradiation for lithium and proton irradiations in relation with persistent DSBs, showing a correlation with surviving fraction. Conclusions: Our results showed the response of B16-F0 cells to charged particle beams evaluated by the detection of {gamma}H2AX foci. We conclude that {gamma}H2AX foci size is an accurate parameter to correlate the rejoining of DSBs induced by different LET radiations and radiosensitivity.

  5. CDT 16.01 was set to default on Edison on 2/3/2016

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    6.01 was set to default on Edison on 2/3/2016 CDT 16.01 was set to default on Edison on 2/3/2016 February 3, 2016 by Zhengji Zhao The Cray Developer Toolkit (CDT) 16.01 was set to default on 2/3/2016. The following software versions are new default on Edison: craype/2.5.1 cray-ga/5.3.0.5 cray-hdf5/1.8.16 cray-hdf5-parallel/1.8.16 cray-mpich/7.3.1 cray-mpich-abi/7.3.1 cray-shmem/7.3.1 craypkg-gen/1.3.3 cce/8.4.3 The intel compiler default was not changed, it is still intel/15.0.1.133. A new

  6. West Virginia Associated-Dissolved Natural Gas Proved Reserves, Wet After

    U.S. Energy Information Administration (EIA) Indexed Site

    Lease Separation 24 29 52 21 70 32 1979-2014 Adjustments 8 -3 -1 -16 114 -29 1979-2014 Revision Increases 0 3 26 0 2 1 1979-2014 Revision Decreases 5 2 6 13 59 6 1979-2014 Sales 0 7 26 0 0 1 2000-2014 Acquisitions 0 14 33 0 0 0 2000-2014 Extensions 0 3 0 0 0 0 1979-2014 New Field Discoveries 0 0 0 0 0 0 1979-2014 New Reservoir Discoveries in Old Fields 0 0 0 0 0 0 1979-2014 Estimated Production 2 3 3 2 8 3

  7. Total....................................................................................

    U.S. Energy Information Administration (EIA) Indexed Site

    Cooking Appliances Frequency of Hot Meals Cooked 3 or More Times A Day................................................. 8.2 3.0 1.6 0.3 1.1 2 Times A Day.............................................................. 24.6 8.3 4.2 1.3 2.7 Once a Day................................................................... 42.3 15.0 8.1 2.7 4.2 A Few Times Each Week............................................. 27.2 10.9 6.0 1.8 3.1 About Once a Week..................................................... 3.9

  8. Fact #847: November 17, 2014 Cars were Over 50% of Light Vehicle...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    0.0% 13.6% 2.3% 1.3% 1982 80.3% 0.1% 14.8% 3.2% 1.5% 1983 77.7% 0.3% 15.8% 3.7% 2.5% 1984 76.1% 0.4% 14.6% 4.8% 4.1% 1985 74.6% 0.6% 14.4% 5.9% 4.5% 1986 71.7% 0.4% 16.5% 6.8% ...

  9. GrndWaterFlow.book

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    0 8.3 Flow Model Sensitivity to Steady-State Temperature Distribution 8.3.1 Introduction The Pahute Mesa CAU flow model spans an area 50 by 53 km with elevations between 3.5 km bmsl to 1.5 km amsl. Within the domain, there are three volcanic caldera complexes and extensive extra-caldera zones as well. Temperatures are not the same everywhere in this model domain. In the flow model, spatial variations in temperature are set by specifying a steady-state, 3-D temperature distribution. The FEHM code

  10. PROJECT MANGEMENT PLAN EXAMPLES Prepare Project Support Plans and

    Office of Environmental Management (EM)

    Quality Assurance Plan Examples Example 64 8.3 QUALITY ASSURANCE This section describes policies and procedures that will be used to meet QA program objectives. This section also develops the strategies PFP will use to ensure the S&M of the PFP inventory, the material stabilization project, the deactivation project, and the dismantlement of the PFP Complex buildings and are completed in a high quality manner. 8.3.1 QA Program The QA program for the PFP Stabilization and Deactivation Project

  11. Table HC6.11 Home Electronics Characteristics by Number of Household Members, 2005

    U.S. Energy Information Administration (EIA) Indexed Site

    1 Home Electronics Characteristics by Number of Household Members, 2005 Total...................................................................... 111.1 30.0 34.8 18.4 15.9 12.0 Personal Computers Do Not Use a Personal Computer ................... 35.5 16.3 9.4 4.0 2.7 3.2 Use a Personal Computer................................ 75.6 13.8 25.4 14.4 13.2 8.8 Number of Desktop PCs 1.................................................................. 50.3 11.9 17.4 8.5 7.3 5.2

  12. TableHC12.3.xls

    U.S. Energy Information Administration (EIA) Indexed Site

    5.6 17.7 7.9 Household Size 1 Person............................................................... 30.0 7.3 5.0 2.3 2 Persons.............................................................. 34.8 8.4 5.7 2.7 3 Persons.............................................................. 18.4 4.1 3.0 1.1 4 Persons.............................................................. 15.9 3.2 2.2 1.0 5 Persons.............................................................. 7.9 1.8 1.4 0.4 6 or More

  13. Total..........................................................................

    U.S. Energy Information Administration (EIA) Indexed Site

    7.1 19.0 22.7 22.3 Floorspace (Square Feet) Total Floorspace 1 Fewer than 500................................................... 3.2 2.1 0.6 Q 0.4 500 to 999........................................................... 23.8 13.6 3.7 3.2 3.2 1,000 to 1,499..................................................... 20.8 9.5 3.7 3.4 4.2 1,500 to 1,999..................................................... 15.4 6.6 2.7 2.5 3.6 2,000 to 2,499..................................................... 12.2 5.0 2.1

  14. app_c7

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7 Description of Input and Final Waste Streams C.7-iii DOE/EIS-0287 Idaho HLW & FD EIS TABLE OF CONTENTS Section Page Appendix C.7 Description of Input and Final Waste Streams C.7-1 LIST OF TABLES Table Page C.7-1 Waste processing alternative inputs. C.7-1 C.7-2 Bin set total chemical inventory (fission and activation species decayed to 2016). C.7-2 C.7-3 Bin set total inventory of radionuclides (decayed to 2016). C.7-3 C.7-4 Calculated radionuclides activities for SBW (curies per liter)

  15. Appendix A. Reference case projections

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    9.7 15.3 15.2 14.2 13.8 13.5 1.2 Canada 3.4 3.6 3.7 5.4 6.4 7.3 7.8 8.0 2.7 Mexico and Chile 3.0 3.0 3.0 3.1 3.4 3.7 3.9 4.2 1.1 OECD Europe 4.9 4.6 4.3 3.3 3.2 3.2 3.2 3.4 -1.0...

  16. Appendix A: Reference case projections

    Gasoline and Diesel Fuel Update (EIA)

    4.3 5.0 5.4 5.5 5.7 5.8 1.1 South Korea 1.7 2.1 2.2 2.4 2.7 3.0 2.1 Australia and New Zealand -0.7 -1.7 -2.2 -2.7 -3.2 -3.8 6.3 Total OECD 13.4 13.7 13.3 12.5 12.1 12.0 -0.4 ...

  17. Gas Reactor Technology R&D

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    U.S. Department of Energy to Invest up to $7.3 Million for "Deep-Burn" Gas-Reactor Technology R&D Artist's rendering of Nuclear Plant An artist's rendering of the Next Generation Nuclear Plant concept. The U.S. Department of Energy today announced a Funding Opportunity Announcement (FOA) valued at $7.3 million for universities, commercial entities, National Laboratories with expertise in the concept of nuclear fuel "Deep-Burn" in which plutonium and higher transuranics

  18. Word Pro - S7

    U.S. Energy Information Administration (EIA) Indexed Site

    4 U.S. Energy Information Administration / Monthly Energy Review May 2016 Table 7.3b Consumption of Combustible Fuels for Electricity Generation: Electric Power Sector (Subset of Table 7.3a) Coal a Petroleum Natural Gas f Other Gases g Biomass Other j Distillate Fuel Oil b Residual Fuel Oil c Other Liquids d Petroleum Coke e Total e Wood h Waste i Thousand Short Tons Thousand Barrels Thousand Short Tons Thousand Barrels Billion Cubic Feet Trillion Btu 1950 Total .................... 91,871 5,423

  19. Word Pro - S7

    U.S. Energy Information Administration (EIA) Indexed Site

    5 Table 7.3c Consumption of Selected Combustible Fuels for Electricity Generation: Commercial and Industrial Sectors (Subset of Table 7.3a) Commercial Sector a Industrial Sector b Coal c Petroleum d Natural Gas e Biomass Coal c Petroleum d Natural Gas e Other Gases g Biomass Other i Waste f Wood h Waste f Thousand Short Tons Thousand Barrels Billion Cubic Feet Trillion Btu Thousand Short Tons Thousand Barrels Billion Cubic Feet Trillion Btu 1990 Total .................... 417 953 28 15 10,740

  20. untitled

    Gasoline and Diesel Fuel Update (EIA)

    316.0 30,254.8 10,591.4 149,937.7 37,688.7 198,217.8 3,426.0 3,510.2 1,986.8 8,082.3 - 10,069.1 February ... 31,589.9 32,605.4 11,241.7 157,558.9 40,147.9...

  1. Hanford Sitewide Probabilistic Seismic Hazard Analysis

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    8.0 Seismic Source Characterization .................................................................................................. 8.1 8.1 Building the SSC Model: Overview and Approach ............................................................ 8.1 8.1.1 Criteria for Defining Seismic Sources ....................................................................... 8.1 8.1.2 Data Evaluation Process ............................................................................................ 8.3

  2. California Dry Natural Gas Proved Reserves

    U.S. Energy Information Administration (EIA) Indexed Site

    Extensions 450 12 73 8 3 0 1977-2014 New Field Discoveries 1 1 0 4 0 0 1977-2014 New Reservoir Discoveries in Old Fields 0 0 0 9 2 2 1977-2014 Estimated Production 239 243 311 200 ...

  3. Michigan Crude Oil plus Lease Condensate Proved Reserves

    U.S. Energy Information Administration (EIA) Indexed Site

    Acquisitions 0 0 0 1 0 0 2009-2014 Extensions 0 0 0 0 0 0 2009-2014 New Field Discoveries 10 0 8 3 0 0 2009-2014 New Reservoir Discoveries in Old Fields 5 0 1 1 2 1 2009-2014 ...

  4. ALS Beamlines Directory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    G. Meigs (510) 495-2249 x2083 8.3.2 Superbend Hard x-ray microtomography 6-46keV D. Parkinson (510) 495-2856 A. MacDowell (510) 486-4276 BL Web Site x2005 9.0.2 U10 Chemical...

  5. X:\\L6046\\Data_Publication\\Pma\\current\\ventura\\pma.vp

    U.S. Energy Information Administration (EIA) Indexed Site

    1999 January ... 2.8 2.8 3.3 5.3 - 8.6 0.6 0.6 0.6 0.8 - 1.4 February ... 2.9 2.9 3.7 5.2 - 8.9 0.6 0.6 W 0.8 - 1.4 March...

  6. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    July... 56.0 W 2,426.8 3,049.7 228.9 August... 87.5 W 2,603.4 3,030.7 162.2 September... 232.3 W 4,191.9 3,234.5 244.6 October... 296.1 W...

  7. untitled

    U.S. Energy Information Administration (EIA) Indexed Site

    1,803.8 878.3 2,581.8 - 3,460.2 June ... 15,553.0 16,030.9 12,399.8 66,298.3 8,480.2 87,178.4 1,818.9 1,861.7 872.7 2,577.1 - 3,449.8 July...

  8. Word Pro - Untitled1

    U.S. Energy Information Administration (EIA) Indexed Site

    55 208 42 192 115 1,093 46 114 46 2,971 1985 504 291 159 45 202 34 182 111 1,127 43 99 ... 228 81 454 298 6 26 1,194 77 17 8 3 10 115 1985 89 218 62 359 299 8 13 1,048 77 16 10 3 9 ...

  9. A=HTML Project

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    (1974), (1966), (1959) Adobe Reader Download Tables from (2004TI06): Table 8.1 in PS or PDF. Table 8.2 in PS or PDF. Table 8.3 in PS or PDF. Table 8.4 in PS or PDF. Table 8.5 in...

  10. DE-RW0000005

    Energy Savers [EERE]

    ... 5.2.2.G Site Access Roads 3.b 5.2.2.H Truck and Rail Staging Yards 3.b 5.2.3 IOC ... Track, and Maintain the Light and Heavy-Duty Vehicle Fleet 4.a 8.3.16 Manage, Track, ...

  11. Microsoft Word - SECTION_J_Appendix_C_Small_Buss_Subcont_Plan...

    Energy Savers [EERE]

    ... 5.2.2.G Site Access Roads 3.b 5.2.2.H Truck and Rail Staging Yards 3.b 5.2.3 IOC ... Track, and Maintain the Light and Heavy-Duty Vehicle Fleet 4.a 8.3.16 Manage, Track, ...

  12. Middle School Academic Competition - Round Robin | U.S. DOE Office...

    Office of Science (SC) Website

    ... Team 1 2 3 4 5 6 7 8 Total Points 1. Hopkins Junior High School 2 2 2 2 2 0 2 12 2. Sycamore School 0 2 2 2 0 0 2 8 3. Norris Middle School 0 0 2 2 0 0 2 6 4. Commack Middle School ...

  13. appl_household2001.pdf

    U.S. Energy Information Administration (EIA) Indexed Site

    ... Q Q Q Q Q NF Video Cassette Recorders (VCRs) and DVD Players ...... 29.3 9.3 6.4 12.6 1.0 7.2 1 ...... 18.9 5.3 4.0 8.9 0.7 8.3 2 ...

  14. appl_household2001.pdf

    U.S. Energy Information Administration (EIA) Indexed Site

    ... 0.3 0.4 1.3 13.2 Both ...... 1.9 1.6 Q Q Q 30.6 Video Cassette Recorders (VCRs) and DVD Players ...... 96.1 67.8 8.3 14.0 6.0 4.6 1 ...

  15. Fuel Tables.indd

    Gasoline and Diesel Fuel Update (EIA)

    ... 5,247.8 3,577.2 9,403.0 900.6 8,384.5 27,513.2 a Transportation use of natural gas is gas consumed in the operation of pipelines, primarily in compressors, and as vehicle fuel. ...

  16. Summary Slides of ALS Science Highlights

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ... Dynamics 12.0.2 06.25.2008 Vol. 288 166 Iron Spin Transition 12.2.2 04.30.2008 Vol. 286 ... 11.0.2 05.25.2005 Vol. 253 98 Ammonia Channel 8.3.1 05.25.2005 Vol. 253 97 Cobaltites ...

  17. file://C:\\Documents%20and%20Settings\\VM3\\My%20Documents\\hc6-6a...

    U.S. Energy Information Administration (EIA) Indexed Site

    Q | 38.5 | Adequacy of Insulation | Well Insulated...... 10.3 2.0 2.2 5.8 0.2 | 12.5 Adequately Insulated...... 12.8 3.6 2.4 6.5 0.4 | 10.4 Poorly ...

  18. file://C:\\Documents%20and%20Settings\\VM3\\My%20Documents\\hc6-11a

    U.S. Energy Information Administration (EIA) Indexed Site

    It...... 0.4 Q Q Q Q | 40.0 | Adequacy of Insulation | Well Insulated...... 42.6 15.8 8.3 3.0 4.5 | 4.9 Adequately Insulated...... 43.1 16.3 8.5 ...

  19. Fact #697: October 17, 2011 Comparison of Vehicles per Thousand...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Europe, East 370 363.9 Europe, West 528.8 583.3 India 8.3 ... Data Book: Edition 30, ORNL-6986, June 2011. Vehicles per Thousand People in the United States, 1990 and 2009 Year U.S. ...

  20. Recovery sequences for a station blackout accident at the Grand Gulf Nuclear Station

    SciTech Connect (OSTI)

    Carbajo, J.J. [Martin Marietta Energy Systems, Oak Ridge, TN (United States)

    1995-12-31

    Recovery sequences for a low-pressure, short term, station blackout severe accident at the Grand Gulf power plant have been investigated using the computer code MELCOR, version 1.8.3 PN. This paper investigates the effect of reflood timing and mass flow rate on accident recovery.

  1. A=8Be (1979AJ01)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    79AJ01) (See Energy Level Diagrams for 8Be) GENERAL: See also (1974AJ01) and Table 8.3 Table of Energy Levels (in PDF or PS). Shell model: (1973AR1C, 1974KA11, 1975GO07,...

  2. X:\\L6046\\Data_Publication\\Pma\\current\\ventura\\pma.vp

    U.S. Energy Information Administration (EIA) Indexed Site

    5.2 2.3 6.6 4.2 11.9 6.5 2004 ... 3.4 2.9 6.8 3.0 10.2 5.9 NA Not available. Note: Totals may not equal the sum of the components due...

  3. Residential Buildings Historical Publications reports, data and...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ... Below Poverty Line 100 Percent 2.6 1.8 3.3 98 53 69.1 24 745 0.40 525 186 125 Percent 3.7 ... for 1984. (3) Below 150 percent of poverty line or 60 percent of median State ...

  4. " Row: Employment Sizes within NAICS Codes...

    U.S. Energy Information Administration (EIA) Indexed Site

    " 311 - 339","ALL MANUFACTURING INDUSTRIES" ,"Employment Size" ," Under 50",625.5,3.3,1.7 ," 50-99",882.3,5.8,2.5 ," 100-249",1114.9,5.8,2.5 ," 250-499",2250.4,8,3.7 ," ...

  5. "Table A46. Selected Energy Operating Ratios for Total Energy...

    U.S. Energy Information Administration (EIA) Indexed Site

    "20-39","ALL INDUSTRY GROUPS" ,"Employment Size " ," Under 50",312.4,4.4,2.2,0.6,14.6,7.5 ," 50-99",599.4,8.1,3.7,1.3,8.1,8.4 ," 100-249",726.9,9.1,4.2,4.9,8.3,3.7 ," ...

  6. "Table A48. Selected Energy Operating Ratios for Total Energy...

    U.S. Energy Information Administration (EIA) Indexed Site

    "Value of Shipments and Receipts" "(million dollars)" " Under 20",251.8,4.6,2.5,0.4,12.8,5.6 " 20-49",507.8,6.8,3.2,0.3,8.4,6.8 " 50-99",748.2,8.2,3.8,1.7,8.8,4.1 " ...

  7. Lease Condensate Reserves Extensions

    U.S. Energy Information Administration (EIA) Indexed Site

    50 271 536 729 578 591 2009-2014 Federal Offshore U.S. 6 7 2 1 8 3 2009-2014 Pacific (California) 0 0 0 0 0 0 2009-2014 Gulf of Mexico (Louisiana & Alabama) 5 4 2 1 5 3 2009-2014...

  8. Microsoft Word - Final report scanned IG-06464.rtf

    Energy Savers [EERE]

    Property Disposals at the Yucca Mountain Project DOE/IG-0664 September 2004 REPORT ON PROPERTY DISPOSALS AT THE YUCCA MOUNTAIN PROJECT TABLE OF CONTENTS Property Disposals at Yucca Mountain Details of Finding ...................................................1 Recommendations and Comments........................4 Appendices 1. Objective, Scope, and Methodology..................7 2. Prior Reports.....................................................8 3. Management

  9. 20_33_1998.tex

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    33 from (1998TI06): Energy Levels of 20 Na a E x (MeV ± keV) J π ; T τ 1/2 or Γ cm Decay Reactions 0 2 + ; 1 τ 1/2 = 447.9 ± 2.3 ms β - 1, 7, 8 0.596 ± 8 3 + (γ) 7, 8 0.802 ± 7 4 + (γ) 7, 8 0.98425 ± 0.10 1 + (γ) 7, 8, 10 1.346 ± 8 2 - (γ) 7, 8 1.837 ± 7 2 - (γ) 7, 8 1.992 ± 8 3 - (γ) 7, 8 2.057 ± 12 3 + (γ) 8 2.645 ± 6 (3 + , 1 + ) (γ, p) 3, 5, 7, 8 2.849 ± 6 3 + 7, 8 2.983 ± 7 > 3 8 3.001 ± 2 1 + Γ = 19.8 ± 2 keV b p 5, 6, 10 3.067 ± 2 (0 + ) 5, 7, 8 3.086 ± 2

  10. "Characteristic(a)","Total","Fuel Oil","Fuel Oil(b)","Natural...

    U.S. Energy Information Administration (EIA) Indexed Site

    "Value of Shipments and Receipts" "(million dollars)" " Under 20",8.3,"X",43.6,17.5,52.5,0... " Not Ascertained (f)",0,"X","X","X","X","X","X",0 "Total",0.5,0,40.6,0....

  11. Nuclear Material Control and Accountability

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2011-06-27

    This Order establishes performance objectives, metrics, and requirements for developing, implementing, and maintaining a nuclear material control and accountability program within DOE/NNSA and for DOE-owned materials at other facilities that are exempt from licensing by the Nuclear Regulatory Commission. Cancels DOE M 470.4-6. Admin Chg 1, 8-3-11.

  12. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    2,286.0 1,448.3 1,983.5 1,935.2 4,269.5 3,383.5 November... 2,780.8 2,193.2 2,011.0 873.7 4,791.8 3,067.0 December... 2,949.9 1,863.8 2,511.4...

  13. Prime Supplier Sales Volumes

    U.S. Energy Information Administration (EIA) Indexed Site

    1,515.4 24,168.6 49,958.8 205,642.8 21,325.8 3,583.5 13,512.4 38,421.7 February ... 150,955.0 13,660.5 51,987.1 216,602.6 25,038.0 1,397.6 14,426.9...

  14. untitled

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    817.7 4,658.6 8,375.5 3,857.1 12,193.1 8,515.7 W 441.7 February ... 4,292.8 3,051.0 8,504.3 4,204.9 12,797.0 7,255.9 W 207.6 March ......

  15. Table 7. Electric power industry emissions estimates, 1990 through...

    U.S. Energy Information Administration (EIA) Indexed Site

    ...9,113584,94753,82613,86399,85365,109237 "Nitrogen oxide (short tons)" ...4.9,5.1,5.2,5.1,5.6,4.4,4.1,4.1,4.3,5.5 "Nitrogen oxide",2,2.1,2.2,2.9,2.8,3.2,3.5,3.7,4,4...

  16. Table 7. Electric power industry emissions estimates, 1990 through...

    U.S. Energy Information Administration (EIA) Indexed Site

    ...0793,153217,148070,146967,190426,147068 "Nitrogen oxide (short tons)" ...8,12,11.6,14.5,10.5,10.3,10.2,13.8,10.9 "Nitrogen oxide",2.7,2.8,2.8,3,3.3,3.8,4.3,4.7,4.9...

  17. Table 7. Electric power industry emissions estimates, 1990 through...

    U.S. Energy Information Administration (EIA) Indexed Site

    ...6397,143396,135654,132721,130647,126421 "Nitrogen oxide (short tons)" ...6,1.7,1.9,2.6,3.3,3.5,3.6,4,4,3.8,3.9,4 "Nitrogen oxide",1,1,0.9,1.1,1.1,1.2,1.4,1.5,1.6,1...

  18. Table 7. Electric power industry emissions estimates, 1990 through...

    U.S. Energy Information Administration (EIA) Indexed Site

    ...8162,273797,259611,175375,129536,123261 "Nitrogen oxide (short tons)" ...4.6,4.7,5.1,4.7,4.5,6.9,6.6,4.8,3.5,3.2 "Nitrogen oxide",1.6,1.6,1.6,1.6,1.6,1.7,1.8,2.1,2...

  19. Table 7. Electric power industry emissions estimates, 1990 through...

    U.S. Energy Information Administration (EIA) Indexed Site

    ...787,33518,29992,32988,30223,28179,31687 "Nitrogen oxide (short tons)" ...1.9,1.7,1.9,1.9,2,2,1.7,1.9,1.8,1.8,1.9 "Nitrogen oxide",2.6,2.9,2.8,3.1,3.6,3.5,3.1,3.4,3...

  20. Table 7. Electric power industry emissions estimates, 1990 through...

    U.S. Energy Information Administration (EIA) Indexed Site

    ...569,16497052,16568052,16912118,17043393 "Nitrogen oxide (short tons)" ...7,8.2,8.5,8.3,8.1,9.8,10.3,10.7,11,11.2 "Nitrogen oxide",1.2,1.2,1.2,1.3,1.3,1.3,1.8,1.9,2...

  1. Table 7. Electric power industry emissions estimates, 1990 through...

    U.S. Energy Information Administration (EIA) Indexed Site

    ...2100354,2178585,2210524,2255308,2219783 "Nitrogen oxide (short tons)" ...7,20.9,21,17.7,31.9,32.2,32.1,33.7,34.7 "Nitrogen oxide",1.6,1.5,1.5,2,1.9,1.8,3.2,3.2,3.2...

  2. S:\\VM3\\RX97\\TBL_LIST.WPD

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    53.5 3.4 7.8 3.8 0.7 8.6 Central Warm-Air Furnace ...... 38.4 1.8 ... 7.5 Q 0.8 0.3 0.5 24.4 Central Warm-Air Furnace ...... 10.7 Q 1.4 ...

  3. George Taylor, Ph.D. Founder, Palmetto Energy Institute Senior...

    Gasoline and Diesel Fuel Update (EIA)

    Non-Dispatchable Technologies Wind 33 82.5 9.8 3.8 96.0 Solar PV 25 140.7 7.7 4.3 152.7 ... Background * In December 2012, ATI published a report on "The Hidden Costs of Wind ...

  4. N O T I C E

    Office of Scientific and Technical Information (OSTI)

    ... B3) where Q R e 2 4 g D 3 p 8 ( p - p 8 ; 3 4 and Re pv,D (B20) (B21) J? g is gas viscosity. Note that C d Re 2 is independent of velocity. Therefore to find v tf first calculate ...

  5. Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

    SciTech Connect (OSTI)

    C.A.Reddy, PI

    2005-06-30

    G. lucidum is one of the most important and widely distributed ligninolytic white rot fungi from habitats such as forest soils, agricultural soils, and tropical mangrove ecosystems and produce laccases as an important family of lignin modifying enzymes. Biochemically, laccases are blue multi copper oxidases that couple four electron reduction of molecular oxygen to water. There is a growing interest in the use of laccases for a variety of industrial applications such as bio-pulping and biobleaching as well as in their ability to detoxify a wide variety of toxic environmental pollutants. These key oxidative enzymes are found in all the three domains of life: Eukaryota. Prokarya, and Archaea. Ganoderma lucidum (strain no.103561) produces laccase with some of the highest activity (17,000 micro katals per mg of protein) reported for any laccases to date. Our results showed that this organism produces at least 11 different isoforms of laccase based on variation in mol. weight and/or PI. Our Studies showed that the presence of copper in the medium yields 15- to 20-fold greater levels of enzyme by G. lucidum. Dialysation of extra cellular fluid of G. lucidum against 10mM sodium tartrate (pH5.5) gave an additional 15 to 17 fold stimulation of activity with an observed specific activity of 17,000 {micro}katals/mg protein. Dialysis against acetate buffer gave five fold increase in activity while dialysis against glycine showed inhibition of activity. Purification by FPLC and preparative gel electrophoresis gave purified fractions that resolved into eleven isoforms as separated by isoelectric focusing, and the PI,s were 4.7, 4.6, 4.5, 4.3, 4.2, 4.1, 3.8, 3.7, 3.5, 3.4 and 3.3. Genomic clones of laccase were isolated using G. lucidum DNA as a template and using inverse PCR and forward/reverse primers corresponding to the sequences of the conserved copper binding region in the N-terminal domain of one of the laccases of this organism. Inverse PCR amplication of HindIII digested and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity of 53-55% to Trametes versicolorLAC3 and LAC4. The consensus copper-binding domains found in ot

  6. Preliminary Release: March 28, 2011",,,,,,,,,,,,"Released: April...

    U.S. Energy Information Administration (EIA) Indexed Site

    ... "Cable",36.5,13.2,11.3,4.4,5,2.6 "Satellite",2.7,1,0.8,0.3,0.4,0.2 "DSLFiber ... apply)" "Cable",1.8,4.1,4.2,4.4,7,8.6 "Satellite",7.3,11,15.1,20.3,16.9,31.6 "DSLFiber ...

  7. Table

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    1.0 fs 5, 7, 9, 14, 15, 19, 20, 23, 24, 25 5.2409 0.3 5 2 + 3.25 0.30 ps 4, 5, 6, 7, 9, 14, 15, 18, 19, 20, 23, 24, 25, 27 g +0.248 0.026 6.1763 1.7 3 2 -...

  8. Utah Coalbed Methane Proved Reserves, Reserves Changes, and Production

    U.S. Energy Information Administration (EIA) Indexed Site

    893 725 718 679 518 523 2000-2013 Adjustments 0 8 9 7 -3 2009-2013 Revision Increases 9 77 46 21 69 2009-2013 Revision Decreases 110 30 31 134 11 2009-2013 Sales 0 0 130 0 0...

  9. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    2,803.5 23,127.6 260.7 3,192.1 3,064.2 26,319.6 July... 2,791.6 21,818.2 225.2 3,933.5 3,016.8 25,751.6 August... 2,778.1 22,800.2 260.6 3,760.9...

  10. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    1,980.8 1,991.4 2,256.6 5,462.7 - 7,719.4 September... 2,148.4 2,160.1 2,818.6 5,634.9 - 8,453.6 October... 3,212.7 3,226.0 3,969.5 7,032.5 - 11,002.0...

  11. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    9,876.0 17,425.6 30,942.7 4,309.2 52,677.5 PAD District I January... 2,925.5 3,030.7 8,165.5 10,848.8 1,193.2 20,207.5 February... 3,137.7 3,249.8 8,604.8...

  12. SSRL BEAM PORT SCHEDULE

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ... 8019 -Greven 8019 -Greven 8019 -Greven 2679 -Que 2679 -Que 8831E-Latimer *1E59 -Shafer *1E59 -Shafer *1E59 -Shafer *1E59 -Shafer 7-3 Wig-Side 2679 -Que Change>8831E B-S24>S21 ...

  13. Unconventional Resources Technology Advisory Committee

    Energy Savers [EERE]

    1 Unconventional Resources Technology Advisory Committee Comments and Recommendations 2014 Annual Plan November 2013 Attachment 3 2 TABLE OF CONTENTS 1.0 INTRODUCTION..............................................................................................................3 2.0 EXECUTIVE SUMMARY AND RECOMMENDATION HIGHLIGHTS .................5 3.0 TOPICAL REPORTS .......................................................................................................7 3.1 POLICY FINDINGS AND

  14. Unconventional Resources Technology Advisory Committee

    Energy Savers [EERE]

    1 Unconventional Resources Technology Advisory Committee Comments and Recommendations 2014 Annual Plan December 2013 2 TABLE OF CONTENTS 1.0 INTRODUCTION..............................................................................................................3 2.0 EXECUTIVE SUMMARY AND RECOMMENDATION HIGHLIGHTS .................5 3.0 TOPICAL REPORTS .......................................................................................................7 3.1 POLICY FINDINGS AND

  15. Gasoline prices up this week (short version)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    short version) The U.S. average retail price for regular gasoline rose to 3.61 a gallon on Monday. That's up 7.3 cents from a week ago and up 25.4 cents from two weeks ago, based...

  16. untitled

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    ... 69,239.3 43,647.5 112,886.8 2,053.4 1,593.7 3,647.0 Subdistrict IA January ... 2,785.7 12,016.8 14,802.5 37.2 334.4...

  17. MicroPact icomplaints No Fear Reporting

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    total complaints filed. 2004 2005 2006 2007 2008 Race 3 1 4 7 6 0 Color 0 1 1 2 3 0 Religion 0 0 1 0 1 0 Reprisal 0 0 0 0 0 0 Sex 2 1 4 6 7 3 PDA 0 0 0 0 0 0 National Origin 0 3...

  18. MicroPact icomplaints No Fear Reporting

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    total complaints filed. 2005 2006 2007 2008 2009 Race 1 4 7 6 0 3 Color 1 1 2 3 0 2 Religion 0 1 0 1 0 2 Reprisal 0 0 0 0 0 0 Sex 1 4 6 7 3 2 PDA 0 0 0 0 0 0 2010 Quarter 4 Page...

  19. Next Release Date: August 2013

    Gasoline and Diesel Fuel Update (EIA)

    9. Renewable commercial and industrial sector net summer capacity by energy source and State, 2009 (megawatts) Landfill Gas/MSW 1 Other Biomass 2 Alabama - - - 591 - - - 591 591 Alaska - - - - - - - - - Arizona - - - - - - - - - Arkansas - - 2 312 - - - 314 314 California 6 13 64 156 - - - 233 239 Colorado - - - - - - - - - Connecticut - - - - - - - - - Delaware - - - - - - - - - District of Columbia - - - - - - - - - Florida - - 66 284 - - - 350 350 Georgia 7 3 - 587 - - - 590 597 Hawaii 5 60 3

  20. S:\\VM3\\RX97\\TBL_LIST.WPD [PFP#201331587

    U.S. Energy Information Administration (EIA) Indexed Site

    ... Video Cassette Recorders (VCR's) ...... 88.9 5.9 10.3 6.0 4.8 1.7 1 ...... 56.3 4.1 6.7 3.5 2.7 4.2 2 ...

  1. City of Boulder, Nevada (Utility Company) | Open Energy Information

    Open Energy Info (EERE)

    493 9,053 6,776 320 4,454 895 813 13,507 7,671 2008-01 453.321 8,322 6,779 272.7 3,666 888 726.021 11,988 7,667 References "EIA Form EIA-861 Final Data File for 2010 -...

  2. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    16,485.2 46.0 1,002.6 PAD District I January... W 80.4 9,382.3 3,401.9 54.4 1,666.3 February... W 80.3 9,338.7 3,323.3 53.1 1,374.4 March... W 85.0...

  3. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    2,594.6 10,871.8 6,296.5 May... 2,002.5 2,475.3 8,351.0 3,536.7 10,353.5 6,011.9 June... 3,900.5 2,579.0 7,996.7 3,017.5 11,897.2 5,596.5...

  4. 368371.pdf

    Office of Legacy Management (LM)

    . . . . . . . . _ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . -. . . . ~~ ~ ~~ ~~ --- -- NVO-273 MVO- -2 7 3 DE89 0 0 8 2 1 0 c LONG-TERM HYDROLOGIC MONITORING PROGRAM RULISON EVENT S I T E GRAND VALLEY, COLORADO - _ _ _ _ - DISCLAIMER This report was prepared as an actaunt of work sponsored by an agency of the United States Government. Neither the United States

  5. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    1,914.5 104546.6 4,183.1 15,517.3 1,198.3 1,385.1 February... 12,374.3 100750.4 3,769.0 14,266.9 1,521.6 1,840.1 March... 12,435.2 104913.7 3,177.6 15,977.5...

  6. Table 5.2. U.S. per Household Vehicle-Miles Traveled, Vehicle...

    U.S. Energy Information Administration (EIA) Indexed Site

    75,000 or More ... 8.2 2.3 28.5 1,443 1,692 5.2 Below Poverty Line 100 Percent ... 9.0 1.4 14.7 769 890 7.3 125...

  7. Table 46. Refiner No. 2 Distillate, Diesel Fuel, and Fuel Oil...

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    25,794.3 125,232.3 November ... 14,453.5 66,101.3 8,392.5 14,607.4 22,846.0 80,708.7 3,071.6 38,342.1 25,917.7 119,050.8 December ......

  8. untitled

    U.S. Energy Information Administration (EIA) Indexed Site

    ... 2.6 2.9 8.2 3.7 10.8 6.6 November ... 3.0 2.4 8.0 4.9 11.1 7.3 December ... 3.1 4.8 6.8 5.4 10.0 10.2...

  9. Natural Gas Weekly Update, Printer-Friendly Version

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    by Bentek, as imports rose by 5.7 percent, up to 1.7 Bcf on Wednesday. Northeast power burn rose to almost 8.5 Bcf on Wednesday (compared to 7.3 Bcf on Monday), and Bentek data...

  10. Natural Gas Weekly Update

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    by Bentek, as imports rose by 5.7 percent, up to 1.7 Bcf on Wednesday. Northeast power burn rose to almost 8.5 Bcf on Wednesday (compared to 7.3 Bcf on Monday), and Bentek data...

  11. U.S. gasoline prices continue to decrease (short version)

    U.S. Energy Information Administration (EIA) Indexed Site

    short version) The U.S. average retail price for regular gasoline fell to $2.44 a gallon on Monday. That's down 7.3 cents from a week ago, based on the weekly price survey by the U.S. Energy Information Administration.

  12. U.S. gasoline prices continue to decrease (short version)

    U.S. Energy Information Administration (EIA) Indexed Site

    gasoline prices continue to decrease (short version) The U.S. average retail price for regular gasoline fell to $2.82 a gallon on Monday. That's down 7.3 cents from a week ago, based on the weekly price survey by the U.S. Energy Information Administration.

  13. homeoffice_household2001.pdf

    U.S. Energy Information Administration (EIA) Indexed Site

    RSE Column Factor: Total 2001 Household Income Below Poverty Line Eli- gible for Fed- eral ... 29.1 5.3 22.7 3.8 1 Below 150 percent of poverty line or 60 percent of median State income

  14. CX-010410: Categorical Exclusion Determination

    Broader source: Energy.gov [DOE]

    Oracle to Tucson 115 Kilovolt Transmission Line, Cross Arm Replacements at Structure 2/5 and 7/3 CX(s) Applied: B1.3 Date: 05/02/2013 Location(s): Arizona, Arizona Offices(s): Western Area Power Administration-Desert Southwest Region

  15. MONTICELLO PROJECTS

    Office of Legacy Management (LM)

    ... 415,933 410,277 Average treatment rate, gpm 9.6 9.2 7.3 7.0 ... N TEMPERATURE ( F) I RAIN (in 1 WIND SPEED (nip h) HEAT COOL AVG MEAN DEG DEG WIND DOM DAY TEMP HIGH TIME LOW TIME ...

  16. untitled

    U.S. Energy Information Administration (EIA) Indexed Site

    5,685.5 3,288.7 6,792.5 5,524.5 12,478.0 8,813.2 W W February ... 4,075.7 3,590.9 5,768.7 5,777.4 9,844.4 9,368.4 W W March ... 2,824.0...

  17. II

    Office of Legacy Management (LM)

    LIST OF FIGURES 1 General location of Granite City, Illinois . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6 2 General location of the South Plant facility, Granite City Steel Division, Granite City, Illinois . . . . . . . . . . . . . . . ' . . . . . . . . . . 7 3 Diagram of the New Betatron Building, Granite City Steel facility, Granite City, Illinois. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8 4 View looking north northwest at the New

  18. " Row: NAICS Codes; Column: Energy-Consumption...

    U.S. Energy Information Administration (EIA) Indexed Site

    ...ates",11541.3,36.8,12.6,1 325193," Ethyl Alcohol ",26688.9,65.4,24.4,8.4 325199," Other ...ediates",4378.2,8.9,4.1,1 325193," Ethyl Alcohol ",2378.4,7.3,1.6,1 325199," Other Basic ...

  19. Buildings Energy Data Book: 1.4 Environmental Data

    Buildings Energy Data Book [EERE]

    4 2025 Buildings Energy End-Use Carbon Dioxide Emissions Splits, by Fuel Type (Million Metric Tons) (1) Natural Petroleum Gas Distil. Resid. LPG Oth(2) Total Coal Electricity (3) Total Percent Space Heating (4) 263.3 35.5 6.3 15.2 2.0 59.0 6.1 98.9 427.3 19.2% Space Cooling 1.8 258.7 260.5 11.7% Lighting 245.4 245.4 11.0% Water Heating 97.7 5.7 2.5 8.3 97.6 203.7 9.2% Refrigeration (5) 129.5 129.5 5.8% Electronics (6) 122.6 122.6 5.5% Ventilation (7) 94.4 94.4 4.2% Computers 68.8 68.8 3.1% Wet

  20. Buildings Energy Data Book: 5.1 Building Materials/Insulation

    Buildings Energy Data Book [EERE]

    4 "Green Roofs" Completed by Year (Thousand SF) Extensive Intensive Mixed Total 2004 917 406 4.9 1,327 2005 1,785 488 198.7 2,472 2006 1,957 1,033 73.8 3,064 2007 - - - 2,408 2008 - - - 3,182 2009 - - - - 2010 3,109 172 312 4,341 Extensive Intensive Mixed Total 2004 777.1 405.8 3.924 1,187 2005 1,570 476.4 102.9 2,150 2006 - - - - 2007 - - - 1,953 2008 - - - 2,647 Note(s): Source(s): North America United States 1) Extensive: soil depth of less than 6 inches. 2) Intensive: soil depth

  1. West Virginia Dry Natural Gas Production (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    Lease Separation 24 29 52 21 70 32 1979-2014 Adjustments 8 -3 -1 -16 114 -29 1979-2014 Revision Increases 0 3 26 0 2 1 1979-2014 Revision Decreases 5 2 6 13 59 6 1979-2014 Sales 0 7 26 0 0 1 2000-2014 Acquisitions 0 14 33 0 0 0 2000-2014 Extensions 0 3 0 0 0 0 1979-2014 New Field Discoveries 0 0 0 0 0 0 1979-2014 New Reservoir Discoveries in Old Fields 0 0 0 0 0 0 1979-2014 Estimated Production 2 3 3 2 8 3 Production

    20 220 139 107 113 76 2005-2014 Adjustments 0 0 -1 1 0 -2 2009-2014

  2. Summary Slides of ALS Science Highlights

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Summary Slides of ALS Science Highlights Print No. Slide Beamline Full Web Highlight ALSNews Volume 331 Shutting Out Ebola and Other Viruses 8.3.1, 5.0.2 05.11.2016 Vol. 372 330 An Atomic-Level Understanding of Copper-Based... 11.0.2 05.11.2016 Vol. 372 329 A New Universal Parameter for Superconductivity 10.0.1 04.14.2016 Vol. 371 328 Exploring the Repeat-Protein Universe 8.2.1, 8.3.1, 12.3.1 04.14.2016 Vol. 371 327 Aerosol Oxidation Speeds Up in Smoggy Air 9.0.2 02.24.2016 Vol. 370 326 MOFs and

  3. UPDATING THE NRC STANDARD REVIEW PLAN - CHAPTER 8 - ELECTRICAL SYSTEMS

    SciTech Connect (OSTI)

    SULLIVAN,K.

    2007-06-24

    The Standard Review Plan (SRP) (Reference 2), provides guidance to the regulatory staff of the Nuclear Regulatory Commission (NRC) on performing their safety reviews of applications to construct or operate nuclear power plants, and applications to approve standard designs and sites for nuclear power plants. Chapter 8 of the SRP provides guidance related to the review of station electrical distribution systems described by the applicant in its Design Control Document (DCD) or Safety Analysis Report (SAR). As part of the 2006-2007 SAR update, all sections in this Chapter (8.1, 8.2, 8.3.1, 8.3.2, Appendix 8A, and Appendix 8B) were revised to incorporate new analyses, design approaches, and the lessons learned from the review of the AP 1000 design certification and to assure consistency with the draft Regulatory Guide DG-1145, ''Combined License Applications for Nuclear Power Plants (LWR Edition)''.

  4. Wind Vision Chapter 1: Introduction to the Wind Vision

    Office of Environmental Management (EM)

    3 0 0 N S T R E E T , N W S U I T E 7 0 0 W A S H I N G T O N , D C 2 0 0 3 7 T E L 2 0 2 . 7 8 3 . 4 1 4 1 F A X 2 0 2 . 7 8 3 . 5 8 5 1 W W W . W B K L A W . C O M November 29, 2013 MEMORANDUM To: DOE Ex Parte Communications (expartecommunications@hq.doe.gov ) From: Scott Blake Harris Re: Energy Conservation Program for Consumer Products and Certain Commercial and Industrial Equipment: Proposed Determination of Computer Servers as a Covered Consumer Product, EERE-2013-BT-DET-0034 Pursuant to

  5. Summary Slides of ALS Science Highlights

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Science Highlights Print No. Slide Beamline Full Web Highlight ALSNews Volume 331 Shutting Out Ebola and Other Viruses 8.3.1, 5.0.2 05.11.2016 Vol. 372 330 An Atomic-Level Understanding of Copper-Based... 11.0.2 05.11.2016 Vol. 372 329 A New Universal Parameter for Superconductivity 10.0.1 04.14.2016 Vol. 371 328 Exploring the Repeat-Protein Universe 8.2.1, 8.3.1, 12.3.1 04.14.2016 Vol. 371 327 Aerosol Oxidation Speeds Up in Smoggy Air 9.0.2 02.24.2016 Vol. 370 326 MOFs and COFs Perform as

  6. Summary Slides of ALS Science Highlights

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Summary Slides of ALS Science Highlights Print No. Slide Beamline Full Web Highlight ALSNews Volume 331 Shutting Out Ebola and Other Viruses 8.3.1, 5.0.2 05.11.2016 Vol. 372 330 An Atomic-Level Understanding of Copper-Based... 11.0.2 05.11.2016 Vol. 372 329 A New Universal Parameter for Superconductivity 10.0.1 04.14.2016 Vol. 371 328 Exploring the Repeat-Protein Universe 8.2.1, 8.3.1, 12.3.1 04.14.2016 Vol. 371 327 Aerosol Oxidation Speeds Up in Smoggy Air 9.0.2 02.24.2016 Vol. 370 326 MOFs and

  7. Draft Site-Wide Environmental Impact Statement Nevada Appendix D | National

    National Nuclear Security Administration (NNSA)

    Nuclear Security Administration D Attachment Size BLM 2010 69.59 MB BN 1999 15.21 MB BSC 2007 1.38 MB CEMP 2009 113.93 KB Clark County 2010 67.44 KB DOD 2004 2.56 MB DOE 1994 6.28 MB DOE 1998 17.4 MB DOE 1999 8.3 MB DOE 2000 8.3 MB DOE 2001 41.31 MB DOE 2002 100.79 MB DOE 2003 3.12 MB DOE 2004 2.56 MB DOE 2005 8.23 MB DOE 2006 2.75 MB DOE 2007 9.23 MB DOE 2008b 117.5 KB DOE 2008c 14.64 MB DOE 2008d 137.99 MB DOE 2008e 137.99 MB DOE 2008f 4.73 MB DOE 2008g 1.57 MB DOE 2009a 30.23 MB DOE 2009b

  8. Buildings Energy Data Book

    Buildings Energy Data Book [EERE]

    8.1 Buildings Sector Water Consumption 8.2 Residential Sector Water Consumption 8.3 Commercial Sector Water Consumption 8.4 WaterSense 8.5 Federal Government Water Usage 9Market Transformation Glossary Acronyms and Initialisms Technology Descriptions Building Descriptions Other Data Books Biomass Energy Transportation Energy Power Technologies Hydrogen Download the Entire Book Skip down to the tables This chapter includes data on water use in commercial and residential buildings and the energy

  9. Buildings Energy Data Book: 3.2 Commercial Sector Characteristics

    Buildings Energy Data Book [EERE]

    4 Share of Commercial Floorspace, by Census Region and Vintage, as of 2003 (Percent) Region Prior to 1960 1960 to 1989 1990 to 2003 Total Northeast 9% 8% 3% 20% Midwest 8% 11% 6% 25% South 5% 18% 14% 37% West 3% 9% 5% 18% 100% Source(s): EIA, 2003 Commercial Buildings Energy Consumption Survey: Building Characteristics Tables, Oct. 2006, Table A2, p. 3-4

  10. Topoisomerase II Structure Suggests Novel DNA Cleavage Mechanism

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Topoisomerase II Structure Suggests Novel DNA Cleavage Mechanism Print Type II topoisomerases are molecular machines that regulate DNA supercoiling and separate interlocked chromosomes. These enzymes are also exploited clinically as targets of antibiotics and anticancer therapeutics. Researchers at ALS Beamline 8.3.1 imaged type II topoisomerase's ordinarily short-lived state in which it is linked to a DNA's nucleic acid segment through its active site tyrosine, cleaving the DNA. Details of this

  11. Topoisomerase II Structure Suggests Novel DNA Cleavage Mechanism

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Topoisomerase II Structure Suggests Novel DNA Cleavage Mechanism Print Type II topoisomerases are molecular machines that regulate DNA supercoiling and separate interlocked chromosomes. These enzymes are also exploited clinically as targets of antibiotics and anticancer therapeutics. Researchers at ALS Beamline 8.3.1 imaged type II topoisomerase's ordinarily short-lived state in which it is linked to a DNA's nucleic acid segment through its active site tyrosine, cleaving the DNA. Details of this

  12. UPC Bug Reports

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    » UPC Bug Reports UPC Bug Reports Deadlock during first touch of upc_alloc'd remote memory when target is in upc_barrier [updated] October 16, 2014 Status: This has been reported to Cray (811537) and a workaround is available. Fixed in CCE 8.3.5. Read the full post Subscribe via RSS Subscribe Browse by Date October 2014 Last edited: 2016-04-29 11:34:42

  13. TableHC14.1.xls

    U.S. Energy Information Administration (EIA) Indexed Site

    4.1 Housing Unit Characteristics by West Census Region, 2005 Total......................................................................... 111.1 24.2 7.6 16.6 Urban/Rural Location (as Self-Reported) City....................................................................... 47.1 12.8 3.2 9.6 Town..................................................................... 19.0 3.0 1.1 1.9 Suburbs................................................................ 22.7 4.9 1.6 3.3

  14. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    2001 ... 16.3 16.7 32.7 30.0 9.0 71.7 2002 January... 15.9 16.2 33.4 27.5 7.4 68.3 February.. 16.6 16.9 34.0 28.6 6.7 69.2 March..... 16.5 16.9 34.5 29.7 8.3 72.5 April........

  15. Table 3. U.S. Refiner Volumes of Petroleum Products to End...

    Gasoline and Diesel Fuel Update (EIA)

    1993 January ... 53.8 0.1 39.3 4.9 0.3 0.8 19.8 3.4 23.2 0.8 20.8 February ... 57.3 0.2 39.2 5.2 0.3 0.9 20.5 3.7 24.2 0.9 21.4 March...

  16. Table 3. U.S. Refiner Volumes of Petroleum Products to End...

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    1997 January ... 54.4 0.1 46.0 3.2 0.5 0.8 22.0 3.8 25.9 0.6 13.8 February ... 57.3 0.1 47.8 3.7 0.4 0.6 22.3 2.8 25.1 0.4 14.1 March...

  17. FY16-FY20 Strategic Plan

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    -FY20 Strategic Plan Exceptional service in the national interest Sandia National Laboratories is a multi-program laboratory managed and operated by Sandia Corporation, a wholly owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energy's National Nuclear Security Administration under contract DE-AC04-94AL85000. SAND2015-6199 dp. www.strategicplan.sandia.gov 8/3/2015C www.strategicplan.sandia.gov 1 Message from the President

  18. Topoisomerase II Structure Suggests Novel DNA Cleavage Mechanism

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Topoisomerase II Structure Suggests Novel DNA Cleavage Mechanism Print Type II topoisomerases are molecular machines that regulate DNA supercoiling and separate interlocked chromosomes. These enzymes are also exploited clinically as targets of antibiotics and anticancer therapeutics. Researchers at ALS Beamline 8.3.1 imaged type II topoisomerase's ordinarily short-lived state in which it is linked to a DNA's nucleic acid segment through its active site tyrosine, cleaving the DNA. Details of this

  19. Topoisomerase II Structure Suggests Novel DNA Cleavage Mechanism

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Topoisomerase II Structure Suggests Novel DNA Cleavage Mechanism Print Type II topoisomerases are molecular machines that regulate DNA supercoiling and separate interlocked chromosomes. These enzymes are also exploited clinically as targets of antibiotics and anticancer therapeutics. Researchers at ALS Beamline 8.3.1 imaged type II topoisomerase's ordinarily short-lived state in which it is linked to a DNA's nucleic acid segment through its active site tyrosine, cleaving the DNA. Details of this

  20. Topoisomerase II Structure Suggests Novel DNA Cleavage Mechanism

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Topoisomerase II Structure Suggests Novel DNA Cleavage Mechanism Print Type II topoisomerases are molecular machines that regulate DNA supercoiling and separate interlocked chromosomes. These enzymes are also exploited clinically as targets of antibiotics and anticancer therapeutics. Researchers at ALS Beamline 8.3.1 imaged type II topoisomerase's ordinarily short-lived state in which it is linked to a DNA's nucleic acid segment through its active site tyrosine, cleaving the DNA. Details of this

  1. Topoisomerase II Structure Suggests Novel DNA Cleavage Mechanism

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Topoisomerase II Structure Suggests Novel DNA Cleavage Mechanism Print Type II topoisomerases are molecular machines that regulate DNA supercoiling and separate interlocked chromosomes. These enzymes are also exploited clinically as targets of antibiotics and anticancer therapeutics. Researchers at ALS Beamline 8.3.1 imaged type II topoisomerase's ordinarily short-lived state in which it is linked to a DNA's nucleic acid segment through its active site tyrosine, cleaving the DNA. Details of this

  2. Topoisomerase II Structure Suggests Novel DNA Cleavage Mechanism

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Topoisomerase II Structure Suggests Novel DNA Cleavage Mechanism Topoisomerase II Structure Suggests Novel DNA Cleavage Mechanism Print Wednesday, 26 January 2011 00:00 Type II topoisomerases are molecular machines that regulate DNA supercoiling and separate interlocked chromosomes. These enzymes are also exploited clinically as targets of antibiotics and anticancer therapeutics. Researchers at ALS Beamline 8.3.1 imaged type II topoisomerase's ordinarily short-lived state in which it is linked

  3. Ensuring Project Success - The Fundamental Art of Managing the Interfaces |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Department of Energy Ensuring Project Success - The Fundamental Art of Managing the Interfaces Ensuring Project Success - The Fundamental Art of Managing the Interfaces August 2009 Presenter: Jeff Smith, Deputy for Operations, Oak Ridge National Laboratory Track 8-3 Topics Covered: Oak Ridge National Laboratory evolved from the Manhattan Project ORNL is DOE's largest science and energy laboratory Our scope of activities today has no precedent in ORNL's history Two DOE Energy Frontier

  4. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    114.2 406.0 45,968.1 11,079.0 534.5 5,366.3 February... 146.6 499.8 47,800.3 10,256.4 357.8 3,591.8 March... 150.3 518.6 48,152.6 10,316.6 365.5 2,056.1...

  5. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    2.4 395.1 39,378.3 15,202.9 236.6 2,326.5 February... 73.3 367.3 40,530.5 15,923.9 229.8 3,294.8 March... 93.0 449.9 40,393.5 16,485.4 120.1 1,351.5...

  6. Northeast Oklahoma Electric Coop, Inc | Open Energy Information

    Open Energy Info (EERE)

    9 4,191 47,726 38,381 2008-06 2,799 30,435 34,457 905 10,285 3,864 65 989 9 3,769 41,709 38,330 2008-05 2,698 29,812 34,370 813 9,209 3,864 58 871 8 3,569 39,892 38,242 2008-04...

  7. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    2,820.9 8,632.3 11,318.0 1,490.2 21,440.5 May... 2,770.5 2,910.0 8,818.6 11,598.3 1,530.5 21,947.4 June... 2,911.8 3,043.5 8,933.3 11,631.1 1,407.9...

  8. Motor Gasoline Sales to End Users, Total Refiner Sales Volumes

    Gasoline and Diesel Fuel Update (EIA)

    29,725.8 24,722.5 21,633.6 25,454.1 1983-2015 East Coast (PADD 1) 14,548.8 12,347.0 9,304.0 6,838.8 3,815.2 8,406.0 1994-2015 New England (PADD 1A) 1,424.3 1,070.8 W W W W ...

  9. PP-48-3 El Paso Eelctric Company | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    8-3 El Paso Eelctric Company PP-48-3 El Paso Eelctric Company Presidential Permit authorizing El Paso Eelctric Company to construct, operate, and maintain electric transmission facilities at the U.S.- Mexico Border. PDF icon PP-48-3 El Paso Eelctric Company More Documents & Publications PP-92 El Paso Electric Company (EPE) PP-40 Citizens Utilities Company PP-76 The Vermont Electric Transmission

  10. 2014 Wind Technologies Market Report Highlights

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Wind Technologies Market Report Highlights August 2015 Prepared for the U.S. Department of Energy Wind and Water Power Technologies Office Prepared by Lawrence Berkeley National Laboratory Berkeley, California 2014 WIND TECHNOLOGIES MARKET REPORT HIGHLIGHTS 2 Introduction The United States remains a top installer of wind energy capacity. Wind power additions rebounded in 2014, with 4,854 megawatts (MW) of new capacity added in the United States representing $8.3 billion in new investments. In

  11. Duct and cladding alloy

    DOE Patents [OSTI]

    Korenko, Michael K.

    1983-01-01

    An austenitic alloy having good thermal stability and resistance to sodium corrosion at 700.degree. C. consists essentially of 35-45% nickel 7.5-14% chromium 0.8-3.2% molybdenum 0.3-1.0% silicon 0.2-1.0% manganese 0-0.1% zirconium 2.0-3.5% titanium 1.0-2.0% aluminum 0.02-0.1% carbon 0-0.01% boron and the balance iron.

  12. _Part II - Contract Clauses

    National Nuclear Security Administration (NNSA)

    09/30/2015 to Mod 0588 Contract DE-AC04-94AL85000 Modification No. M202 Page I - 1 Part II - Contract Clauses Section I TABLE OF CONTENTS 1. FAR 52.202-1 DEFINITIONS (JAN 2012) (REPLACED M473) ............................................................. 8 2. FAR 52.203-3 GRATUITIES (APR 1984) ................................................................................................. 8 3. FAR 52.203-5 COVENANT AGAINST CONTINGENT FEES (APR 1984) ........................................... 9

  13. ALS Ceramics Materials Research Advances Engine Performance

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ALS Ceramics Materials Research Advances Engine Performance ALS Ceramics Materials Research Advances Engine Performance Print Thursday, 27 September 2012 00:00 ritchie ceramics This 3D image of a ceramic composite specimen imaged under load at 1750C shows the detailed fracture patterns that researchers are able to view using ALS Beamline 8.3.2. The vertical white lines are the individual silicon carbide fibers in this sample about 500 microns in diameter. LBNL senior materials scientist and U.C.

  14. City of Coffeyville, Kansas (Utility Company) | Open Energy Informatio...

    Open Energy Info (EERE)

    2008-07 0.509 5.916 5,274 0.678 7.397 996 2.354 53.424 10 3.541 66.737 6,280 2008-06 0.403 4.364 5,271 0.594 6.837 994 2.206 47.998 8 3.203 59.199 6,273 2008-05 0.297 3.218 5,293...

  15. Bonneville Power Admin (Washington) | Open Energy Information

    Open Energy Info (EERE)

    78,670.305 8 2008-12 3,057.253 82,875.13 8 3,057.253 82,875.13 8 2008-11 2,331.04 68,329.679 2,331.04 68,329.679 2008-10 2,177.036 64,661.237 8 2,177.036 64,661.237 8...

  16. Percent of Industrial Natural Gas Deliveries in Arkansas Represented...

    Gasoline and Diesel Fuel Update (EIA)

    Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 10.7 9.5 10.1 2000's 8.3 6.0 5.0 5.4 5.9 5.2 4.8 4.2 3.9 3.7 2010's 2.8 2.1 1.8 1.7 1.8...

  17. Hanford Site - 100-KR-4 | Department of Energy

    Office of Environmental Management (EM)

    KR-4 Hanford Site - 100-KR-4 July 1, 2014 - 12:00pm Addthis US Department of Energy Groundwater Database Groundwater Master Report InstallationName, State: Hanford Site, WA Responsible DOE Office: Office of Environmental Management Plume Name: 100-KR-4 Remediation Contractor: CHPRC PBS Number: 30 Report Last Updated: July 2014 with CY2013 data Contaminants Halogenated VOCs/SVOCs Present?: Yes VOC Name Concentration (ppb) Regulatory Driver Cleanup Requirement TCE 8.3 Yes 5 (DWS) Fuel Present? No

  18. ALS Ceramics Materials Research Advances Engine Performance

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ALS Ceramics Materials Research Advances Engine Performance ALS Ceramics Materials Research Advances Engine Performance Print Thursday, 27 September 2012 00:00 ritchie ceramics This 3D image of a ceramic composite specimen imaged under load at 1750C shows the detailed fracture patterns that researchers are able to view using ALS Beamline 8.3.2. The vertical white lines are the individual silicon carbide fibers in this sample about 500 microns in diameter. LBNL senior materials scientist and U.C.

  19. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    ... 4.0 4.1 9.4 5.2 0.9 15.5 1995 ... 2.5 2.5 3.8 W W 8.1 1996 ... 2.4 2.5 2.6 2.9 W 5.6 1997 ... 2.2 2.2 1.8 3.1 - 4.9 1998 January... 3.0 3.0 2.8 5.3 -...

  20. Buildings and Energy in the 1980's (TABLES)

    U.S. Energy Information Administration (EIA) Indexed Site

    8.3 Food Sales and Service . . . 1,770 685 3,982 2,652 387.03 2.25 1.50 5.81 3.87 9.7 Health Care . . . . . . . . . . . . 1,955 730 3,592 2,392 373.42 1.84 1.22 4.92 3.28 8.7...

  1. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    2006... 315.6 0.5 15.2 39.4 1.4 1.3 2007 January... 297.6 0.4 15.2 48.6 2.3 1.8 February.. 310.3 0.4 15.9 50.8 3.3 1.8 March..... 316.4 0.4 16.5 39.3 1.4 0.7 April........

  2. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    2006 January... 26.3 27.1 6.5 128.9 27.7 163.1 February.. 28.1 29.0 6.7 137.0 36.5 180.2 March..... 28.5 29.4 7.1 140.5 30.2 177.8 April..... 29.7 30.7 8.3 144.1 39.3 191.7...

  3. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    6.3 369.5 42,342.6 13,619.4 252.4 3,890.6 February... 85.1 434.6 45,204.7 13,690.6 284.8 3,639.8 March... 100.1 527.1 45,773.1 14,427.9 128.0 2,013.4...

  4. WATER-LITHIUM BROMIDE DOUBLE-EFFECT ABSORPTION COOLING ANALYSIS

    Office of Scientific and Technical Information (OSTI)

    ... 9 3 . 5 5 9 9 t 8 3 2 - 1 0 2 5 . 0 5 7 f t3B3 9.14021 C C l - 7 8 4 4 3 3 0 r S C C ... ( P I ) ) + T * B H l + C C l X <-BB-SQRT(t38*BH-4. * A A + C C ) ) 2 a A A C O M P ...

  5. UPC Bug Reports

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Reports UPC Bug Reports Viewing entries posted in October 2014 Deadlock during first touch of upc_alloc'd remote memory when target is in upc_barrier [updated] October 16, 2014 Status: This has been reported to Cray (811537) and a workaround is available. Fixed in CCE 8.3.5. Read the full post Subscribe via RSS Subscribe Browse by Date October 2014 Last edited: 2016-04-29 11:34:42

  6. Hopper Featured Announcements

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    March 2011 New software set to default March 23, 2011 by Helen He We have set new default versions for the following software after the OS upgrade on 3/23: --- xt-mpich2 and xt-shmem 5.2.1 (changed from 5.1.5.1) --- cce 7.3.3 (changed from 7.3.1) --- xt-libsci 10.5.01 (changed from 10.5.0) --- ga 4.3.3 (changed from 4.3.2) --- hdf5 and hdf5-parallel 1.8.5.0 (changed from 1.8.4.1) --- petsc and petsc-complex 3.1.05 (changed from 3.1.04) Read the full post Rebooting some Hopper login nodes this

  7. CDT 15.12 was set to default on Edison on 12/23/2015

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    12 was set to default on Edison on 12/23/2015 CDT 15.12 was set to default on Edison on 12/23/2015 December 30, 2015 The Cray Developer Toolkit (CDT) 15.12 was set to default on 12/23/2015. The following software versions are now new default on Edison: craype/2.5.0 cray-ccdb/1.0.7 cray-ga/5.3.0.4 cray-hdf5-parallel/1.8.14 cray-hdf5/1.8.14 cray-lgdb/2.4.5 cray-libsci/13.3.0 cray-mpich-abi/7.3.0 cray-mpich/7.3.0 cray-netcdf-hdf5parallel/4.3.3.1 cray-netcdf/4.3.3.1 cray-parallel-netcdf/1.6.1

  8. " Million U.S. Housing Units"

    U.S. Energy Information Administration (EIA) Indexed Site

    3 Household Characteristics by U.S. Census Region, 2005" " Million U.S. Housing Units" ,"Housing Units (millions)","U.S. Census Region" "Household Characteristics",,"Northeast","Midwest","South","West" "Total",111.1,20.6,25.6,40.7,24.2 "Household Size" "1 Person",30,5.5,7.3,11.5,5.7 "2 Persons",34.8,6.5,8.4,12.5,7.4 "3 Persons",18.4,3.4,4.1,7,3.9 "4

  9. 17_02_1993.tex

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    from (1993TI07): Energy levels of 17 N a E x in 17 N (MeV ± keV) J π ; T τ or Γ Decay Reactions 0 1 2 - ; 3 2 τ 1/2 = 4.173 ± 0.004 sec β - b 1, 2, 3, 4, 5, 6, 7, 8 1.3739 ± 0.3 3 2 - τ m = 93 ± 35 fsec γ 3, 5, 6, 7, 8 1.8496 ± 0.3 1 2 + 41 +20 -9 psec γ 3, 5, 6, 7, 8 1.9068 ± 0.3 5 2 - 11 ± 2 psec γ 3, 4, 5, 6, 7, 8 2.5260 ± 0.5 5 2 + 33 ± 3 psec γ 3, 4, 5, 7, 8 3.1289 ± 0.5 7 2 - 275 ± 80 psec γ 3, 5, 7, 8 3.2042 ± 0.9 3 2 - < 30 fsec γ 3, 5, 7, 8 3.6287 ± 0.7 ( 7

  10. Metastatic Melanoma Induced Metabolic Changes in C57BL/6J Mouse Stomach Measured by 1H NMR Spectroscopy

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Hu, M; Wang, Xiliang

    2014-12-05

    Melanoma is a malignant tumor of melanocytes with high capability of invasion and rapid metastasis to other organs. Malignant melanoma is the most common metastatic malignancy found in gastrointestinal tract (GI). To the best of our knowledge, previous studies of melanoma in gastrointestinal tract are all clinical case reports. In this work, 1H NMR-based metabolomics approach is used to investigate the metabolite profiles differences of stomach tissue extracts of metastatic B16-F10 melanoma in C57BL/6J mouse and search for specific metabolite biomarker candidates. Principal Component Analysis (PCA), an unsupervised multivariate data analysis method, is used to detect possible outliers, while Orthogonalmore » Projection to Latent Structure (OPLS), a supervised multivariate data analysis method, is employed to evaluate important metabolites responsible for discriminating the control and the melanoma groups. Both PCA and OPLS results reveal that the melanoma group can be well separated from its control group. Among the 50 identified metabolites, it is found that the concentrations of 19 metabolites are statistically and significantly changed with the levels of O-phosphocholine and hypoxanthine down-regulated while the levels of isoleucine, leucine, valine, isobutyrate, threonine, cadaverine, alanine, glutamate, glutamine, methionine, citrate, asparagine, tryptophan, glycine, serine, uracil, and formate up-regulated in the melanoma group. These significantly changed metabolites are associated with multiple biological pathways and may be potential biomarkers for metastatic melanoma in stomach.« less

  11. 1H NMR Metabolomics Study of Metastatic Melanoma in C57BL/6J Mouse Spleen

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Wang, Xuan; Hu, Mary Y.; Feng, Ju; Liu, Maili; Hu, Jian Z.

    2014-04-03

    Melanoma is a malignant tumor of melanocytes. Although extensive investigations have been done to study metabolic changes in primary melanoma in vivo and in vitro, little effort has been devoted to metabolic profiling of metastatic tumors in organs other than lymph nodes. In this work, NMR-based metabolomics combined with multivariate data analysis is used to study metastatic B16-F10 melanoma in C57BL/6J mouse spleen. Principal Component Analysis (PCA), an unsupervised multivariate data analysis method, is used to detect possible outliers, while Orthogonal Projection to Latent Structure (OPLS), a supervised multivariate data analysis method, is employed to find important metabolites responsible formore » discriminating the control and the melanoma groups. Two different strategies, i.e., spectral binning and spectral deconvolution, are used to reduce the original spectral data before statistical analysis. Spectral deconvolution is found to be superior for identifying a set of discriminatory metabolites between the control and the melanoma groups, especially when the sample size is small. OPLS results show that the melanoma group can be well separated from its control group. It is found that taurine, glutamate, aspartate, O-Phosphoethanolamine, niacinamide ,ATP, lipids and glycerol derivatives are decreased statistically and significantly while alanine, malate, xanthine, histamine, dCTP, GTP, thymidine, 2'-Deoxyguanosine are statistically and significantly elevated. These significantly changed metabolites are associated with multiple biological pathways and may be potential biomarkers for metastatic melanoma in spleen.« less

  12. Synthesis, structure and magnetic properties of a new iron phosphonate-oxalate with 3D framework: [Fe(O{sub 3}PCH{sub 3})(C{sub 2}O{sub 4}){sub 0.5}(H{sub 2}O)

    SciTech Connect (OSTI)

    Zhang Yangyang [Applied Catalysis Laboratory, Dalian Institute of Chemical Physics, Chinese Academy of Sciences, Dalian 116023 (China); Qi Yue [Applied Catalysis Laboratory, Dalian Institute of Chemical Physics, Chinese Academy of Sciences, Dalian 116023 (China); Zhang Ying [Applied Catalysis Laboratory, Dalian Institute of Chemical Physics, Chinese Academy of Sciences, Dalian 116023 (China); Liu Ziyu [Applied Catalysis Laboratory, Dalian Institute of Chemical Physics, Chinese Academy of Sciences, Dalian 116023 (China); Zhao Yinfeng [Applied Catalysis Laboratory, Dalian Institute of Chemical Physics, Chinese Academy of Sciences, Dalian 116023 (China); Liu Zhongmin [Applied Catalysis Laboratory, Dalian Institute of Chemical Physics, Chinese Academy of Sciences, Dalian 116023 (China)]. E-mail: liuzm@dicp.ac.cn

    2007-08-07

    A new iron phosphonate-oxalate [Fe(O{sub 3}PCH{sub 3})(C{sub 2}O{sub 4}){sub 0.5}(H{sub 2}O)] (1), has been synthesized under hydrothermal condition. The single-crystal X-ray diffraction studies reveal that 1 consists of layers of vertex-linked FeO{sub 6} octahedra and O{sub 3}PC tetrahedra, which are further connected by bis-chelate oxalate bridges, giving to a 3D structure with 10-membered channels. Crystal data: monoclinic, P2{sub 1}/n (no. 14), a=4.851(2)A, b=16.803(7)A, c=7.941(4)A, {beta}=107.516(6){sup o}, V=617.2(5)A{sup 3}, Z=4, R{sub 1}=0.0337 and wR{sub 2}=0.0874 for 1251 reflections [I>2{sigma}(I)]. Mossbauer spectroscopy measurement confirms the existence of high-spin Fe(III) in 1. Magnetic studies show that 1 exhibits weak ferromagnetism with T{sub N}=30K due to a weak spin canting.

  13. Ground-State Decays for Nuclei A = 3 - 20

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Ground State Beta-Decay and Particle Unbound Resonances Data for A = 3 - 20 Nuclei Go to the Text Only section below if you prefer to view the nuclides in a text list. 18Mg 19Mg 20Mg 17Na 18Na 19Na 20Na 15Ne 16Ne 17Ne 18Ne 19Ne 20Ne 14F 15F 16F 17F 18F 19F 20F 11O 12O 13O 14O 15O 16O 17O 18O 19O 20O 10N 11N 12N 13N 14N 15N 16N 17N 18N 19N 20N 7C 8C 9C 10C 11C 12C 13C 14C 15C 16C 17C 18C 19C 20C 6B 7B 8B 9B 10B 11B 12B 13B 14B 15B 16B 17B 18B 19B 20B 5Be 6Be 7Be 8Be 9Be 10Be 11Be 12Be 13Be 14Be

  14. Phenotype-genotype variability in the human CYP3A locus as assessed by the probe drug quinine and analyses of variant CYP3A4 alleles

    SciTech Connect (OSTI)

    Rodriguez-Antona, Cristina . E-mail: cristina.rodriguez-antona@cnio.es; Sayi, Jane G.; Gustafsson, Lars L.; Bertilsson, Leif; Ingelman-Sundberg, Magnus

    2005-12-09

    The human cytochrome P450 3A (CYP3A) enzymes, which metabolize 50% of currently used therapeutic drugs, exhibit great interindividual differences in activity that have a major impact on drug treatment outcome, but hitherto no genetic background importantly contributing to this variation has been identified. In this study we show that CYP3A4 mRNA and hnRNA contents with a few exceptions vary in parallel in human liver, suggesting that mechanisms affecting CYP3A4 transcription, such as promoter polymorphisms, are relevant for interindividual differences in CYP3A4 expression. Tanzanian (n = 143) healthy volunteers were phenotyped using quinine as a CYP3A probe and the results were used for association studies with CYP3A4 genotypes. Carriers of CYP3A4*1B had a significantly lower activity than those with CYP3A4*1 whereas no differences were seen for five other SNPs investigated. Nuclear proteins from the B16A2 hepatoma cells were found to bind with less affinity to the CYP3A4*1B element around -392 bp as compared to CYP3A4*1. The data indicate the existence of a genetic CYP3A4 polymorphism with functional importance for interindividual differences in enzyme expression.

  15. Metastatic Melanoma Induced Metabolic Changes in C57BL/6J Mouse Stomach Measured by 1H NMR Spectroscopy

    SciTech Connect (OSTI)

    Hu, M; Wang, Xiliang

    2014-12-05

    Melanoma is a malignant tumor of melanocytes with high capability of invasion and rapid metastasis to other organs. Malignant melanoma is the most common metastatic malignancy found in gastrointestinal tract (GI). To the best of our knowledge, previous studies of melanoma in gastrointestinal tract are all clinical case reports. In this work, 1H NMR-based metabolomics approach is used to investigate the metabolite profiles differences of stomach tissue extracts of metastatic B16-F10 melanoma in C57BL/6J mouse and search for specific metabolite biomarker candidates. Principal Component Analysis (PCA), an unsupervised multivariate data analysis method, is used to detect possible outliers, while Orthogonal Projection to Latent Structure (OPLS), a supervised multivariate data analysis method, is employed to evaluate important metabolites responsible for discriminating the control and the melanoma groups. Both PCA and OPLS results reveal that the melanoma group can be well separated from its control group. Among the 50 identified metabolites, it is found that the concentrations of 19 metabolites are statistically and significantly changed with the levels of O-phosphocholine and hypoxanthine down-regulated while the levels of isoleucine, leucine, valine, isobutyrate, threonine, cadaverine, alanine, glutamate, glutamine, methionine, citrate, asparagine, tryptophan, glycine, serine, uracil, and formate up-regulated in the melanoma group. These significantly changed metabolites are associated with multiple biological pathways and may be potential biomarkers for metastatic melanoma in stomach.

  16. Draft Site-Wide Environmental Impact Statement Nevada References - Main 2 |

    National Nuclear Security Administration (NNSA)

    National Nuclear Security Administration 2 Attachment Size blm 2004b 16.08 MB blm 2008b 27.87 MB blm 2009c 113.78 MB blm 2010a 69.59 MB blm 2010b 37.73 MB blm 2010d 5.65 MB blm doe 2010 163.03 MB cccp 2006 48.47 MB cccp 2007 18.06 MB crs 2009 760.34 KB doe 1995a 422.48 KB doe 1996b 245.67 MB doe 2002e 1.44 MB doe 2004d 20.69 MB doe 2004e 16.83 MB doe 2006f 1.83 MB doe 2007a 33.28 MB doe 2007b 9.37 MB doe 2007c 17.58 MB doe 2007d 211.72 KB doe 2007e 4.98 MB doe 2007f 36.95 MB doe 2008a 152.22

  17. Buildings Energy Data Book

    Buildings Energy Data Book [EERE]

    7.1 National Legislation 7.2 Federal Tax Incentives 7.3 Efficiency Standards for Residential HVAC 7.4 Efficiency Standards for Commercial HVAC 7.5 Efficiency Standards for Residential Appliances 7.6 Efficiency Standards for Lighting 7.7 Water Use Standards 7.8 State Building Energy Codes 8Water 9Market Transformation Glossary Acronyms and Initialisms Technology Descriptions Building Descriptions Other Data Books Biomass Energy Transportation Energy Power Technologies Hydrogen Download the Entire

  18. Buildings Energy Data Book: 2.2 Residential Sector Characteristics

    Buildings Energy Data Book [EERE]

    6 Residential Heated Floorspace, as of 2005 (Percent of Total Households) Floorspace (SF) Fewer than 500 6% 500 to 999 26% 1,000 to 1,499 24% 1,500 to 1,999 16% 2,000 to 2,499 9% 2,500 to 2,999 7% 3,000 or more 11% Total 100% Source(s): EIA, 2005 Residential Energy Consumption Survey, Oct. 2008, Table HC1-3.

  19. The influence of molecular orientation on organic bulk heterojunction solar

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    cells The influence of molecular orientation on organic bulk heterojunction solar cells The influence of molecular orientation on organic bulk heterojunction solar cells Print Monday, 28 April 2014 09:03 Work done on ALS Beamlines 11.0.1.2, 7.3.3, and 5.3.2.2. reveals that preferential orientation of polymer chains with respect to the fullerene domain leads to a high photovoltaic performance. Featured on the cover of Nature Photonics 8. Article link

  20. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    1996... 10.7 11.1 26.1 20.5 8.0 54.6 1997 January... 11.3 11.8 27.2 19.8 7.3 54.3 February.. 12.1 12.6 28.3 20.7 6.9 55.9 March..... 12.4 12.9 28.4 21.2 7.4 57.0 April........

  1. Alternative Fuels Data Center

    Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

    11 2 2 1 3 2 Massachusetts 5 4 5 3 3 8 8 1 1 0 3 1 Michigan 3 2 5 4 4 8 6 0 0 0 0 0 Minnesota 8 13 3 3 2 8 7 3 0 1 3 1 Mississippi 3 3 6 5 1 2 2 0 2 1 1 0 Missouri 8 7 7 8 6 6 2 1 ...

  2. TableHC10.3.xls

    U.S. Energy Information Administration (EIA) Indexed Site

    20.6 25.6 40.7 24.2 Household Size 1 Person.......................................................................... 30.0 5.5 7.3 11.5 5.7 2 Persons........................................................................ 34.8 6.5 8.4 12.5 7.4 3 Persons........................................................................ 18.4 3.4 4.1 7.0 3.9 4 Persons........................................................................ 15.9 3.0 3.2 5.6 4.0 5

  3. TableHC12.1.xls

    U.S. Energy Information Administration (EIA) Indexed Site

    2.1 Housing Unit Characteristics by Midwest Census Region, 2005 Total......................................................................... 111.1 25.6 17.7 7.9 Urban/Rural Location (as Self-Reported) City....................................................................... 47.1 9.7 7.3 2.4 Town..................................................................... 19.0 5.0 2.9 2.1 Suburbs................................................................ 22.7 5.7 4.3 1.4

  4. TableHC12.8.xls

    U.S. Energy Information Administration (EIA) Indexed Site

    Number of Water Heaters 1............................................................................... 106.3 24.5 17.1 7.4 2 or More.................................................................. 3.7 0.9 0.5 0.4 Do Not Use Hot Water.............................................. 1.1 Q Q Q Housing Units Served by Main Water Heater One Housing Unit..................................................... 99.7 23.5 16.2 7.3 Two or More Housing Units....................................... 10.3 1.9

  5. SSRL HEADLINES April 2007

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    0 April, 2007 __________________________________________________________________________ Contents of this Issue: Science Highlight - Revealing the Molecular Origins of Life Science Highlight - Closing in on Dangerous Infections Low Emittance Lattice for Brighter Beam Rapid Access Beam Time for SMB XAS BL7-3 - Online Application Now Available! New SSRL Faculty Chair and Vice-Chair Appointed Aaron Lindenberg Appointed to Faculty Position SSRL Users' Executive Committee Meeting Upcoming Schools,

  6. SSRL HEADLINES Mar 2007

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    9 March, 2007 __________________________________________________________________________ Contents of this Issue: Science Highlight - Taming a Potent Toxin Science Highlight - Ancient Warriors and the Origin of Chinese Purple Stanford-Caltech Collaboration Creates New X-ray "Molecular Observatory" Rapid Access Beam Time for SMB XAS BL7-3 SSRL School on Hard X-ray Scattering: Techniques in Materials and Environmental Sciences 2007 Ultrafast Summer School - June 18-22 SMB XAS Short Course

  7. Table 45. Refiner Volumes of Aviation Fuels, Kerosene, No. 1...

    U.S. Energy Information Administration (EIA) Indexed Site

    54.8 419.0 45,096.6 8,762.5 604.1 4,549.2 615.6 3,730.7 3,926.0 38,286.0 February ... 179.4 498.6 44,645.3 9,079.3 849.8 4,868.6 600.3 2,983.7 4,000.8...

  8. X:\\Data_Publication\\Pma\\current\\ventura\\pma00.vp

    U.S. Energy Information Administration (EIA) Indexed Site

    3.0 388.5 43,197.7 16,871.4 323.8 4,310.9 462.7 3,430.4 4,159.1 44,833.7 February ... 161.9 456.4 46,718.6 17,076.8 277.2 3,402.7 452.9 2,453.4 3,847.8...

  9. Connecticut Natural Gas Delivered for the Account of Others

    Gasoline and Diesel Fuel Update (EIA)

    1,080 1,156 1,438 1,364 2,199 2,096 1999-2014 % of All Resi. Deliveries for the Acct. of Others 2.5 2.7 3.2 3.3 4.7 4.1 2007-2014 Commercial Deliveries 12,324 14,068 15,519 14,774...

  10. Percent of Industrial Natural Gas Deliveries in Maine Represented...

    U.S. Energy Information Administration (EIA) Indexed Site

    Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 91.4 87.4 78.2 2000's 13.1 8.1 10.7 10.5 1.7 3.1 0.9 0.8 0.8 1.2 2010's 0.6 0.5 0.4 0.9 1.9...

  11. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    2001 ... 2.2 2.2 2.5 4.8 - 7.3 2002 January... 2.9 2.9 3.2 5.8 - 9.0 February.. 2.9 2.9 3.0 5.4 - 8.4 March..... 2.1 2.1 2.7 4.1 - 6.8 April..... 1.5 1.5 2.0 3.7 - 5.8...

  12. MEMORANDU TO: FILE FHOM: SUBJECT:

    Office of Legacy Management (LM)

    ' .- _. I _ ' 1.3 7 -3 , MEMORANDU TO: FILE FHOM: SUBJECT: Curre"t: Ll&k&&d ________ l- ; if yes, date contacted ___ 0 Production scale testing Cl Pilot Scale 0 Bench Scale Process 0 Theoretical Studies 0 Sample & Analysis 0 Production 0 Disposal /Storage TYPE OF CONTRACT --------------_- 0 Prime 13 Subcontract& 0 Purchase Order 0 Cl Facility Type 0 Manufacturing 0 University 0 Research Organization *i Government Sponsored Facility 0 Other --------------_-----_ Other

  13. Ohio Proved Nonproducing Reserves

    U.S. Energy Information Administration (EIA) Indexed Site

    5 1 1 2 7 3 1996-2014 Lease Condensate (million bbls) 0 0 1 6 11 35 1998-2014 Total Gas (billion cu ft) 68 19 54 252 1,072 3,504 1996-2014 Nonassociated Gas (billion cu ft) 67 14 50 246 1,015 3,498 1996-2014 Associated Gas (billion cu ft) 1 5 4 6 57 6

  14. Next Release Date: August 2013

    Gasoline and Diesel Fuel Update (EIA)

    2. Renewable commercial and industrial sector net summer capacity by energy source and State, 2010 (megawatts) Landfill Gas/MSW 1 Other Biomass 2 Alabama - - - 583 - - - 583 583 Alaska - - - - - - - - - Arizona - - - - - - - - - Arkansas - - 2 312 - - - 314 314 California 6 13 64 159 - 2 - 238 244 Colorado - - - - - 2 6 8 8 Connecticut - - - - - - - - - Delaware - - - - - - - - - District of Columbia - - - - - - - - - Florida - - 66 277 - - - 343 343 Georgia 7 3 4 600 - - - 607 614 Hawaii 10 60

  15. Overview

    Energy Savers [EERE]

    -------------------------Chapter 7.3 (September, 2013) ACQUISITION PLANNING IN THE M&O ENVIRONMENT Overview The purpose of this chapter is to discuss the unique acquisition planning and approval requirements associated with the Management and Operating (M&O) form of contract. References 1. FAR Part 7 Acquisition Planning 2. FAR Subpart 17.6 Management and Operating Contracts 3. DEAR 970.1706 Management and Operating Contracts 4. DOE Acquisition Guide, Chapter 7.1 Acquisition Planning 5.

  16. MicroPact icomplaints » No Fear Reporting

    National Nuclear Security Administration (NNSA)

    1 0 2 0 1 1 Reprisal 11 3 5 4 10 7 Sex 7 3 2 1 6 4 PDA 0 0 0 0 0 0 National Origin ... 0 0 0 Reprisal 0 0 0 0 1 100 0 0 1 100 0 0 Sex 0 0 0 0 0 0 0 0 1 100 0 0 PDA 0 0 0 0 0 0 0 ...

  17. MicroPact icomplaints » No Fear Reporting

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Religion 0 1 0 2 0 1 Reprisal 0 0 0 0 0 0 Sex 6 7 3 2 1 6 PDA 0 0 0 0 0 0 2012 Quarter 4 ... 0 0 Reprisal 1 100 0 0 0 0 1 100 0 0 1 100 Sex 0 0 0 0 0 0 0 0 0 0 1 100 PDA 0 0 0 0 0 0 0 ...

  18. MicroPact icomplaints » No Fear Reporting

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Religion 1 0 1 0 2 0 Reprisal 0 0 0 0 0 0 Sex 4 6 7 3 2 1 PDA 0 0 0 0 0 0 2011 Quarter 4 ... 0 0 0 Reprisal 0 0 1 100 0 0 0 0 1 100 0 0 Sex 0 0 0 0 0 0 0 0 0 0 0 0 PDA 0 0 0 0 0 0 0 0 ...

  19. Percent of Industrial Natural Gas Deliveries in Colorado Represented...

    Gasoline and Diesel Fuel Update (EIA)

    Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 7.3 7.6 7.1 2000's 1.8 0.7 1.2 0.9 0.8 0.6 0.6 0.5 0.6 0.5 2010's 5.2 7.5 6.8 7.2 7.7...

  20. Information Repository

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3 Information Repository Documents WIPP Annual Waste Minimization Report Transmittal of the Waste Isolation Pilot Plant Annual Waste Minimization Report, dated November 14, 2013 Class 1 Permit Modifications and NMED Responses Class 1 Modification, August 29, 2013 WIPP Hazardous Waste Facility Permit EPA I.D. Number NM4890139088. (1. revise a course outline; 2. revise table and panel figures to include Panel 7; 3. update description related to Type B Packages; and 4. update TRUPACT-II and

  1. June 1, 2011

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    June 1, 2011 June 1, 2011 Print Monday, 23 May 2011 15:37 regina soufli Multilayer thin films: From Earth to space Regina Soufli, Lawrence Livermore National Laboratory glenn waychunas Molecular aspects of carbon sequestration: What synchrotron work can tell us Glenn Waychunas, Earth Sciences Division, Beamlines 12.2.2 and 7.3.3 gilles Is all soot created equal? Mary Gilles, Chemical Sciences Division, Beamline 11.0.2

  2. X:\\L6046\\Data_Publication\\Pma\\current\\ventura\\pma.vp

    U.S. Energy Information Administration (EIA) Indexed Site

    2001 ... 62.0 0.1 49.7 3.6 0.2 0.3 22.9 3.0 26.0 0.4 14.8 2002 January ... 60.2 0.1 46.2 3.3 0.2 0.5 20.2 3.2 23.3 0.5 10.5...

  3. Residential Buildings Historical Publications reports, data and...

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    ... Below Poverty Line 100 Percent 1.5 1.1 2.1 101 53 71.8 25 902 0.47 639 220 125 Percent 2.4 1.7 3.3 108 55 76.3 28 958 0.48 677 250 Age of Householder Under 25 Years 3.5 2.4 5.9 123 ...

  4. untitled

    Gasoline and Diesel Fuel Update (EIA)

    1.8 1.8 1.1 6.2 - 7.3 0.2 0.2 0.1 0.9 - 1.0 2006 January ... 1.9 2.0 1.6 6.8 - 8.4 0.2 0.2 0.1 0.9 - 1.0 February ... 1.9 1.9 1.5 7.2 -...

  5. Table 13. U.S. Refiner Reformulated Motor Gasoline Volumes by...

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    12.0 69.2 3.4 3.5 6.9 3.1 W 10.1 December ... 14.8 15.1 31.7 29.5 10.8 72.0 3.6 3.7 7.3 3.3 W 10.7 1999 ... 14.5 14.8 29.8 26.1 9.6...

  6. X:\\L6046\\Data_Publication\\Pma\\current\\ventura\\pma.vp

    U.S. Energy Information Administration (EIA) Indexed Site

    3.2 5.0 2.0 - 7.0 December ... 17.0 17.3 31.2 31.5 6.2 69.0 3.2 3.3 4.9 2.0 - 6.9 2002 ... 16.9 17.2 33.1 30.4 8.2 71.7 3.3 3.3 5.6...

  7. 06 Run R1.xls

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    16 11 14 AP 7 8 8 15 16 13 AP 12 11 14 MA 1 6 AP 1 16 MA 6 8 9 2 9 12 MA AP 21 25 26 24 23 22 20 Dwn 4pm 24 26 29 28 27 27 28 29 30 2 4 3 10 3 8 9 26 27 23 24 25 3 MA 7 3 3 4 1 1...

  8. untitled

    U.S. Energy Information Administration (EIA) Indexed Site

    2006 ... 28.9 29.8 7.3 143.7 37.4 188.4 2.9 2.9 0.5 9.3 - 9.7 2007 January ... 27.8 28.4 6.8 143.1 33.2 183.1 2.6 2.6 0.5 8.9 - 9.4...

  9. untitled

    U.S. Energy Information Administration (EIA) Indexed Site

    2006 ... 17.7 18.0 26.8 45.7 3.4 75.9 2.5 2.5 1.9 1.5 - 3.4 2007 January ... 16.3 16.5 26.0 44.0 2.4 72.4 2.4 2.4 1.7 1.4 - 3.1...

  10. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    2006... 28.9 29.8 7.3 143.7 37.4 188.4 2007 January... 27.8 28.4 6.8 143.1 33.2 183.1 February.. 29.0 29.7 7.1 149.5 36.3 192.9 March..... 29.3 29.9 7.2 152.7 37.3 197.2...

  11. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    2006... 17.7 18.0 26.8 45.7 3.4 75.9 2007 January... 16.3 16.5 26.0 44.0 2.4 72.4 February.. 16.9 17.1 27.3 44.2 1.8 73.4 March..... 17.1 17.4 27.9 45.4 2.8 76.2 April........

  12. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    18.5 385.5 47,187.8 11,484.4 323.4 4,406.3 February... 130.0 502.6 47,884.7 11,440.1 306.7 3,893.8 March... 146.1 614.9 47,658.3 12,534.7 293.1 2,924.7...

  13. Microsoft Word - Final Report 7-10-08.doc

    Energy Savers [EERE]

    Management Controls over Monitoring and Closeout of Small Business Innovation Research Phase II Grants OAS-M-08-09 July 2008 REPORT ON MANAGEMENT CONTROLS OVER MONITORING AND CLOSEOUT OF SMALL BUSINESS INNOVATION RESEARCH PHASE II GRANTS TABLE OF CONTENTS SBIR Phase II Grants Details of Finding 1 Recommendations and Comments 3 Appendices 1. Objective, Scope, and Methodology 5 2. Related Audit Report 7 3. Management Comments 8 SBIR PHASE II GRANTS Page 1 Details of Finding Grant Administration

  14. untitled

    U.S. Energy Information Administration (EIA) Indexed Site

    2004 January ... 23.5 24.3 8.8 122.8 28.1 159.7 3.5 3.6 1.0 9.2 - 10.2 February ... 24.8 25.7 9.4 125.2 28.6 163.2 3.6 3.7 1.0 9.8 - 10.8...

  15. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    1996... 2.4 2.5 2.6 2.9 W 5.6 1997 January... 3.7 3.7 2.9 4.5 - 7.4 February.. 3.6 3.7 2.9 4.2 - 7.1 March..... 2.1 2.1 1.9 2.3 - 4.1 April..... 0.9 0.9 0.5 1.6 - 2.1...

  16. EIA - Renewable Electricity State Profiles

    U.S. Energy Information Administration (EIA) Indexed Site

    Georgia Renewable Electricity Profile 2010 Georgia profile Table 1. Summary Renewable Electric Power Industry Statistics (2010) Primary Renewable Energy Capacity Source Hydro Conventional Primary Renewable Energy Generation Source Hydro Conventional Capacity (megawatts) Value Percent of State Total Total Net Summer Electricity Capacity 36,636 100.0 Total Net Summer Renewable Capacity 2,689 7.3 Geothermal - - Hydro Conventional 2,052 5.6 Solar - - Wind - - Wood/Wood Waste 617 1.7 MSW/Landfill Gas

  17. Microsoft Word - S05993_CY2009 Annual Rpt.doc

    Office of Legacy Management (LM)

    7 3.1.2 Routine Monitoring 3.1.2.1 POC Monitoring This objective deals with monitoring discharges from the terminal ponds into Woman and Walnut creeks and streamflow at the additional POCs downstream at Indiana Street to demonstrate compliance with RFLMA surface-water-quality standards (see RFLMA Attachment 2, Table 1). Water-quality data at POCs are reportable under RFLMA when the applicable compliance parameters are greater than the corresponding Table 1 values (see Appendix D). Terminal pond

  18. Building America Webinar: Opportunities in Large Data Collection and

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Analysis-Presentation #3 | Department of Energy 3 Building America Webinar: Opportunities in Large Data Collection and Analysis-Presentation #3 This is the third presentation, Indoor Temperature and Humidity Data Collection and Analysis, in the webinar on April 16, 2014. PDF icon BA_Webinar_Booten_Metzger_Norton_4-16-14.pdf More Documents & Publications Building America Webinar: Opportunities in Large Data Collection and Analysis Building America Best Practices Series, Volume 7.3: Guide

  19. CDT 15.12 was set to default on Edison on 12/23/2015

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7.3.0 cray-tpsl-641.5.2 cray-tpsl1.5.2 cray-trilinos11.12.1.5 craype2.5.0 craypkg-gen1.3.2 fftw3.3.4.6 iobuf2.0.6 papi5.4.1.3 parallel-netcdf1.3.1 perftools-lite6.3.1...

  20. Constraining the Ly? escape fraction with far-infrared observations of Ly? emitters

    SciTech Connect (OSTI)

    Wardlow, Julie L.; Calanog, J.; Cooray, A.; Malhotra, S.; Zheng, Z.; Rhoads, J.; Finkelstein, S.; Bock, J.; Bridge, C.; Ciardullo, R.; Gronwall, C.; Conley, A.; Farrah, D.; Gawiser, E.; Heinis, S.; Ibar, E.; Ivison, R. J.; Marsden, G.; Oliver, S. J.; Riechers, D.; and others

    2014-05-20

    We study the far-infrared properties of 498 Ly? emitters (LAEs) at z = 2.8, 3.1, and 4.5 in the Extended Chandra Deep Field-South, using 250, 350, and 500 ?m data from the Herschel Multi-tiered Extragalactic Survey and 870 ?m data from the LABOCA ECDFS Submillimeter Survey. None of the 126, 280, or 92 LAEs at z = 2.8, 3.1, and 4.5, respectively, are individually detected in the far-infrared data. We use stacking to probe the average emission to deeper flux limits, reaching 1? depths of ?0.1 to 0.4 mJy. The LAEs are also undetected at ?3? in the stacks, although a 2.5? signal is observed at 870 ?m for the z = 2.8 sources. We consider a wide range of far-infrared spectral energy distributions (SEDs), including an M82 and an Sd galaxy template, to determine upper limits on the far-infrared luminosities and far-infrared-derived star formation rates of the LAEs. These star formation rates are then combined with those inferred from the Ly? and UV emission to determine lower limits on the LAEs' Ly? escape fraction (f {sub esc}(Ly?)). For the Sd SED template, the inferred LAEs f {sub esc}(Ly?) are ? 30% (1?) at z = 2.8, 3.1, and 4.5, which are all significantly higher than the global f {sub esc}(Ly?) at these redshifts. Thus, if the LAEs f {sub esc}(Ly?) follows the global evolution, then they have warmer far-infrared SEDs than the Sd galaxy template. The average and M82 SEDs produce lower limits on the LAE f {sub esc}(Ly?) of ?10%-20% (1?), all of which are slightly higher than the global evolution of f {sub esc}(Ly?), but consistent with it at the 2?-3? level.