National Library of Energy BETA

Sample records for 7-3 8-3 b-16

  1. Beamline 8.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Beamline 8.3.1 Print Tuesday, 20 October 2009 08:55 Multiple-wavelength anomalous diffraction (MAD) and macromolecular crystallography (MX) Scientific discipline: Structural...

  2. Beamline 8.3.2

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    8.3.2 Print Tomography Scientific disciplines: Applied science, biology, earth sciences, energy, environmental sciences, geology, cosmological chemistry GENERAL BEAMLINE...

  3. Beamline 8.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    8.3.1 Beamline 8.3.1 Print Tuesday, 20 October 2009 08:55 Multiple-wavelength anomalous diffraction (MAD) and macromolecular crystallography (MX) Scientific discipline: Structural biology GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (5.0 tesla, single pole) Energy range 5-17 keV (1% max flux) Monochromator Double flat crystal, Si(111) Measured flux (1.9 GeV, 400 mA) 2.5 x 1011 at 11 keV Resolving power (E/ΔE) 7,000 Divergence (max at sample) 3.0 (h) x

  4. Beamline 8.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3.1 Beamline 8.3.1 Print Tuesday, 20 October 2009 08:55 Multiple-wavelength anomalous diffraction (MAD) and macromolecular crystallography (MX) Scientific discipline: Structural biology GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (5.0 tesla, single pole) Energy range 5-17 keV (1% max flux) Monochromator Double flat crystal, Si(111) Measured flux (1.9 GeV, 400 mA) 2.5 x 1011 at 11 keV Resolving power (E/ΔE) 7,000 Divergence (max at sample) 3.0 (h) x 0.35

  5. Beamline 8.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    1 Beamline 8.3.1 Print Tuesday, 20 October 2009 08:55 Multiple-wavelength anomalous diffraction (MAD) and macromolecular crystallography (MX) Scientific discipline: Structural biology GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (5.0 tesla, single pole) Energy range 5-17 keV (1% max flux) Monochromator Double flat crystal, Si(111) Measured flux (1.9 GeV, 400 mA) 2.5 x 1011 at 11 keV Resolving power (E/ΔE) 7,000 Divergence (max at sample) 3.0 (h) x 0.35

  6. Beamline 8.3.2

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2 Beamline 8.3.2 Print Tuesday, 20 October 2009 08:56 Tomography Scientific disciplines: Applied science, biology, earth sciences, energy, environmental sciences, geology, cosmological chemistry GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (1.9 GeV, 4.37 tesla) Energy range 6-46 keV ML mode Monochromator None or two ML or two Si(111) Flux (1.9 GeV, 500 mA) ~105hv/sec/µm2 in ML mode Resolving power (E/ΔE) White beam/ 1% / 0.02% Endstation 12 x 3 ft

  7. Beamline 7.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7.3.1 Print Photoemission electron microscope PEEM2 Scientific disciplines: Magnetism, materials, surface science, polymers Note: This beamline is NOT open to general users....

  8. Beamline 7.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7.3.1 Print Photoemission electron microscope PEEM2 Scientific disciplines: Magnetism, materials, surface science, polymers Note: This beamline is NOT open to general users. GENERAL BEAMLINE INFORMATION Operational Yes, but not open to users Source characteristics Bend magnet Energy range 180-1500 eV Monochromator SGM Calculated flux (1.9 GeV, 400 mA) 3 x 1012 photons/s/0.1%BW at 800 eV (linearly polarized) Resolving power (E/ΔE) 1,000 Endstations Photoemission electron microscope (PEEM2)

  9. Beamline 7.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7.3.1 Print Photoemission electron microscope PEEM2 Scientific disciplines: Magnetism, materials, surface science, polymers Note: This beamline is NOT open to general users. GENERAL BEAMLINE INFORMATION Operational Yes, but not open to users Source characteristics Bend magnet Energy range 180-1500 eV Monochromator SGM Calculated flux (1.9 GeV, 400 mA) 3 x 1012 photons/s/0.1%BW at 800 eV (linearly polarized) Resolving power (E/ΔE) 1,000 Endstations Photoemission electron microscope (PEEM2)

  10. Beamline 7.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7.3.1 Print Photoemission electron microscope PEEM2 Scientific disciplines: Magnetism, materials, surface science, polymers Note: This beamline is NOT open to general users. GENERAL BEAMLINE INFORMATION Operational Yes, but not open to users Source characteristics Bend magnet Energy range 180-1500 eV Monochromator SGM Calculated flux (1.9 GeV, 400 mA) 3 x 1012 photons/s/0.1%BW at 800 eV (linearly polarized) Resolving power (E/ΔE) 1,000 Endstations Photoemission electron microscope (PEEM2)

  11. Beamline 7.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7.3.1 Print Photoemission electron microscope PEEM2 Scientific disciplines: Magnetism, materials, surface science, polymers Note: This beamline is NOT open to general users. GENERAL BEAMLINE INFORMATION Operational Yes, but not open to users Source characteristics Bend magnet Energy range 180-1500 eV Monochromator SGM Calculated flux (1.9 GeV, 400 mA) 3 x 1012 photons/s/0.1%BW at 800 eV (linearly polarized) Resolving power (E/ΔE) 1,000 Endstations Photoemission electron microscope (PEEM2)

  12. Beamline 7.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7.3.1 Print Photoemission electron microscope PEEM2 Scientific disciplines: Magnetism, materials, surface science, polymers Note: This beamline is NOT open to general users. GENERAL BEAMLINE INFORMATION Operational Yes, but not open to users Source characteristics Bend magnet Energy range 180-1500 eV Monochromator SGM Calculated flux (1.9 GeV, 400 mA) 3 x 1012 photons/s/0.1%BW at 800 eV (linearly polarized) Resolving power (E/ΔE) 1,000 Endstations Photoemission electron microscope (PEEM2)

  13. Beamline 7.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7.3.1 Print Photoemission electron microscope PEEM2 Scientific disciplines: Magnetism, materials, surface science, polymers Note: This beamline is NOT open to general users. GENERAL BEAMLINE INFORMATION Operational Yes, but not open to users Source characteristics Bend magnet Energy range 180-1500 eV Monochromator SGM Calculated flux (1.9 GeV, 400 mA) 3 x 1012 photons/s/0.1%BW at 800 eV (linearly polarized) Resolving power (E/ΔE) 1,000 Endstations Photoemission electron microscope (PEEM2)

  14. Beamline 7.3.3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7.3.3 Print Small- and Wide-Angle X-Ray Scattering (SAXS/WAXS/Protein SAXS)* Scientific disciplines: Polymer science, materials science, proteins, surface science GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Bend magnet Energy range 10 keV Monochromator Mo/B4C double multilayer monochromator Measured flux (1.9 GeV, 400 mA) 1012 photons/s Resolving power (E/ΔE) 100 Detectors Pilatus 1M, Pilatus 100K, Pilatus 300KW, 2x ADSC Quantum 4u Spot size at sample 1 mm x 0.8 mm

  15. Beamline 7.3.3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7.3.3 Print Small- and Wide-Angle X-Ray Scattering (SAXS/WAXS/Protein SAXS)* Scientific disciplines: Polymer science, materials science, proteins, surface science GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Bend magnet Energy range 10 keV Monochromator Mo/B4C double multilayer monochromator Measured flux (1.9 GeV, 400 mA) 1012 photons/s Resolving power (E/ΔE) 100 Detectors Pilatus 1M, Pilatus 100K, Pilatus 300KW, 2x ADSC Quantum 4u Spot size at sample 1 mm x 0.8 mm

  16. Beamline 7.3.3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7.3.3 Print Small- and Wide-Angle X-Ray Scattering (SAXS/WAXS/Protein SAXS)* Scientific disciplines: Polymer science, materials science, proteins, surface science GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Bend magnet Energy range 10 keV Monochromator Mo/B4C double multilayer monochromator Measured flux (1.9 GeV, 400 mA) 1012 photons/s Resolving power (E/ΔE) 100 Detectors Pilatus 1M, Pilatus 100K, Pilatus 300KW, 2x ADSC Quantum 4u Spot size at sample 1 mm x 0.8 mm

  17. Beamline 7.3.3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7.3.3 Print Small- and Wide-Angle X-Ray Scattering (SAXS/WAXS/Protein SAXS)* Scientific disciplines: Polymer science, materials science, proteins, surface science GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Bend magnet Energy range 10 keV Monochromator Mo/B4C double multilayer monochromator Measured flux (1.9 GeV, 400 mA) 1012 photons/s Resolving power (E/ΔE) 100 Detectors Pilatus 1M, Pilatus 100K, Pilatus 300KW, 2x ADSC Quantum 4u Spot size at sample 1 mm x 0.8 mm

  18. Beamline 7.3.3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7.3.3 Print Small- and Wide-Angle X-Ray Scattering (SAXS/WAXS/Protein SAXS)* Scientific disciplines: Polymer science, materials science, proteins, surface science GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Bend magnet Energy range 10 keV Monochromator Mo/B4C double multilayer monochromator Measured flux (1.9 GeV, 400 mA) 1012 photons/s Resolving power (E/ΔE) 100 Detectors Pilatus 1M, Pilatus 100K, Pilatus 300KW, 2x ADSC Quantum 4u Spot size at sample 1 mm x 0.8 mm

  19. Beamline 7.3.3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7.3.3 Print Small- and Wide-Angle X-Ray Scattering (SAXS/WAXS/Protein SAXS)* Scientific disciplines: Polymer science, materials science, proteins, surface science GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Bend magnet Energy range 10 keV Monochromator Mo/B4C double multilayer monochromator Measured flux (1.9 GeV, 400 mA) 1012 photons/s Resolving power (E/ΔE) 100 Detectors Pilatus 1M, Pilatus 100K, Pilatus 300KW, 2x ADSC Quantum 4u Spot size at sample 1 mm x 0.8 mm

  20. Beamline 7.3.3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3.3 Beamline 7.3.3 Print Tuesday, 20 October 2009 08:50 Small- and Wide-Angle X-Ray Scattering (SAXS/WAXS/Protein SAXS)* Scientific disciplines: Polymer science, materials science, proteins, surface science GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Bend magnet Energy range 10 keV Monochromator Mo/B4C double multilayer monochromator Measured flux (1.9 GeV, 400 mA) 1012 photons/s Resolving power (E/ΔE) 100 Detectors Pilatus 1M, Pilatus 100K, Pilatus 300KW, 2x ADSC

  1. Beamline 7.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7.3.1 Print Photoemission electron microscope PEEM2 Scientific disciplines: Magnetism, materials, surface science, polymers Note: This beamline is NOT open to general users. GENERAL BEAMLINE INFORMATION Operational Yes, but not open to users Source characteristics Bend magnet Energy range 180-1500 eV Monochromator SGM Calculated flux (1.9 GeV, 400 mA) 3 x 1012 photons/s/0.1%BW at 800 eV (linearly polarized) Resolving power (E/ΔE) 1,000 Endstations Photoemission electron microscope (PEEM2)

  2. Beamline 7.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7.3.1 Print Photoemission electron microscope PEEM2 Scientific disciplines: Magnetism, materials, surface science, polymers Note: This beamline is NOT open to general users. GENERAL BEAMLINE INFORMATION Operational Yes, but not open to users Source characteristics Bend magnet Energy range 180-1500 eV Monochromator SGM Calculated flux (1.9 GeV, 400 mA) 3 x 1012 photons/s/0.1%BW at 800 eV (linearly polarized) Resolving power (E/ΔE) 1,000 Endstations Photoemission electron microscope (PEEM2)

  3. TableHC7.3.xls

    U.S. Energy Information Administration (EIA) Indexed Site

    Income Relative to Poverty Line Below 100 Percent...... Below Poverty Line Eligible for Federal Assistance 1 80,000 or More Table HC7.3 Household ...

  4. "RSE Table N8.3. Relative Standard Errors for Table N8.3;"

    U.S. Energy Information Administration (EIA) Indexed Site

    3. Relative Standard Errors for Table N8.3;" " Unit: Percents." ,,,"Electricity","Components",,"Natural Gas","Components",,"Steam","Components" " "," ",,,"Electricity",,,"Natural Gas",,,"Steam",," " " "," ",,"Electricity","from Sources",,"Natural Gas","from Sources",,"Steam","from

  5. MPI errors from cray-mpich/7.3.0

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    MPI errors from cray-mpich7.3.0 MPI errors from cray-mpich7.3.0 January 6, 2016 by Ankit Bhagatwala A change in the MPICH2 library that now strictly enforces non-overlapping...

  6. RSE Table 7.3 Relative Standard Errors for Table 7.3

    U.S. Energy Information Administration (EIA) Indexed Site

    3 Relative Standard Errors for Table 7.3;" " Unit: Percents." ,,,"Electricity","Components",,"Natural Gas","Components",,"Steam","Components" " "," ",,,"Electricity",,,"Natural Gas",,,"Steam",," " " "," ",,"Electricity","from Sources",,"Natural Gas","from Sources",,"Steam","from

  7. b16.pdf

    U.S. Energy Information Administration (EIA) Indexed Site

    Buildings With Central Physical Plant All Buildings With Central Physical Plant All Buildings ............................................... 4,657 1,362 142 67,338 26,049 7,101 Building Floorspace (Square Feet) 1,001 to 5,000 .............................................. 2,348 604 Q 6,774 1,706 Q 5,001 to 10,000 ............................................ 1,110 297 Q 8,238 2,211 Q 10,001 to 25,000 .......................................... 708 253 26 11,153 3,965 464 25,001 to 50,000

  8. b16.xls

    U.S. Energy Information Administration (EIA) Indexed Site

    Q Q Q N Food Service ...... 1,654 336 413 421 367 Q Q N Health Care ...... 3,163 Q 254 Q 335 111 683 1,539 Inpatient ...

  9. MPI errors from cray-mpich/7.3.0

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    MPI errors from cray-mpich/7.3.0 MPI errors from cray-mpich/7.3.0 January 6, 2016 by Ankit Bhagatwala A change in the MPICH2 library that now strictly enforces non-overlapping buffers in MPI collectives may cause some MPI applications that use overlapping buffers to fail at runtime. As an example, one of the routines affected is MPI_ALLGATHER. There are several possible fixes. The cleanest one is to specify MPI_IN_PLACE instead of the address of the send buffer for cases where sendbuf and

  10. The cce/8.3.0 C++ compiler may run into a linking error on Edison

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    The cce8.3.0 C++ compiler may run into a linking error on Edison The cce8.3.0 C++ compiler may run into a linking error on Edison July 1, 2014 You may run into the following...

  11. Table 8.3a Useful Thermal Output at Combined-Heat-and-Power Plants: Total (All Sectors), 1989-2011 (Sum of Tables 8.3b and 8.3c; Billion Btu)

    U.S. Energy Information Administration (EIA) Indexed Site

    a Useful Thermal Output at Combined-Heat-and-Power Plants: Total (All Sectors), 1989-2011 (Sum of Tables 8.3b and 8.3c; Billion Btu) Year Fossil Fuels Renewable Energy Other 7 Total Coal 1 Petroleum 2 Natural Gas 3 Other Gases 4 Total Biomass Total Wood 5 Waste 6 1989 323,191 95,675 461,905 92,556 973,327 546,354 30,217 576,571 39,041 1,588,939 1990 362,524 127,183 538,063 140,695 1,168,465 650,572 36,433 687,005 40,149 1,895,619 1991 351,834 112,144 546,755 148,216 1,158,949 623,442 36,649

  12. Energy and Agriculture Depts. Provide $8.3 Million in Funding for Biofuels

    Energy Savers [EERE]

    Research | Department of Energy Agriculture Depts. Provide $8.3 Million in Funding for Biofuels Research Energy and Agriculture Depts. Provide $8.3 Million in Funding for Biofuels Research June 7, 2007 - 1:25pm Addthis WASHINGTON, DC - U.S. Energy Secretary Samuel Bodman and Agriculture Secretary Mike Johanns today announced that the Department of Energy and the Department of Agriculture have jointly selected 11 projects for awards totaling $8.3 million for biobased fuels research that will

  13. Tax Deduction Qualified Software: EnergyPlus Version 8.3.0

    Broader source: Energy.gov [DOE]

    Provides required documentation that EnergyPlus version 8.3.0 meets Internal Revenue Code §179D, Notice 2006-52, dated June 2, 2006, for calculating commercial building energy and power cost savings.

  14. LFS Exhibit A General Conditions (Rev. 8.3, 9-27-13)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    on claims shall be paid at the rate established by the Secretary of the Treasury of the United States pursuant to Public Law 92-41 (85 Stat. 97). LFS Ex A (Rev. 8.3, 92713)...

  15. Building America Best Practices Series, Volume 7.3: Guide to...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Series, Volume 7.3: Guide to Determining Climate Regions by County Building America Best Practices Series, Volume 7.3: Guide to Determining Climate Regions by County This report...

  16. TM Exhibit A General Conditions (Rev. 7.3, 9-27-13)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    on claims shall be paid at the rate established by the Secretary of the Treasury of the United States pursuant to Public Law 92-41 (85 Stat. 97). T&M Ex A (Rev. 7.3, 92713)...

  17. DOE Selects Projects for Up to $7.3 Million for R&D Clean Technology...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Power Projects September 18, 2008 - 3:43pm Addthis WASHINGTON - The U.S. Department of Energy (DOE) today announced the selection of projects for negotiation of award of up to 7.3...

  18. Building America Best Practices Series, Volume 7.3: Guide to Determining

    Energy Savers [EERE]

    Climate Regions by County | Department of Energy Series, Volume 7.3: Guide to Determining Climate Regions by County Building America Best Practices Series, Volume 7.3: Guide to Determining Climate Regions by County This report describes the climate zone designations used by the U.S. Department of Energy Building America Program, and is intended to help builders to identify the appropriate climate designation for the counties in which they are building. PDF icon Guide to Determining Climate

  19. Policy Flash 2013-78 Acquisition Guide Chapter 7.3 Acquisition Planning in

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    the M&O Environment | Department of Energy 8 Acquisition Guide Chapter 7.3 Acquisition Planning in the M&O Environment Policy Flash 2013-78 Acquisition Guide Chapter 7.3 Acquisition Planning in the M&O Environment Questions concerning this policy flash should be directed to Jason Taylor of the Contract and Financial Assistance Policy Division, Office of Policy, Office of Acquisition and Project Management at (202) 287-1560 or at jason.taylor@hq.doe.gov. PDF icon Policy Flash_AG7

  20. Jefferson Lab awards $7.3 million construction contract to Chesapeake firm

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    | Jefferson Lab This artist's rendering shows what the completed addition will look like. A print quality file of this graphic may be downloaded from JPIX. Jefferson Lab awards $7.3 million construction contract to Chesapeake firm June 15, 2004 Newport News, VA. - On June 7, the Department of Energy's Jefferson Lab awarded a $7.3 million construction project to Mid Eastern Builders, Inc. of Chesapeake, Va. The contract is to build a much needed, three-story, 61,000 square-foot addition to

  1. MPI-3 Atomic Performance Degradation since cray-mpich/7.3.0

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    MPI-3 Atomic Performance Degradation since cray-mpich/7.3.0 MPI-3 Atomic Performance Degradation since cray-mpich/7.3.0 March 7, 2016 by Thorsten Kurth Apparently, after the integration of MPI-3.2 into cray-mpich, Cray also had to implement a workaround which significantly degrades the performance for short message MPI-3 atomics. In order to solve that problem, set the following two environment variables export MPICH_RMA_OVER_DMAPP=1 export MPICH_RMA_USE_NETWORK_AMO=1 and additionally link your

  2. Building America Best Practices Series: Volume 7.3, Guide to Determining Climate Regions by County

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    R BUILDING AMERICA BEST PRACTICES SERIES VOLUME 7.3 Guide to Determining Climate Regions by County Pacific Northwest National Laboratory August 2015 BUILDING AMERICA BEST PRACTICES SERIES VOLUME 7.3 High-Performance Home Technologies: Guide to Determining Climate Regions by County PREPARED BY Pacific Northwest National Laboratory Michael C. Baechler Theresa L. Gilbride, Pam C. Cole, Marye G. Hefty, and Kathi Ruiz August 2015 Prepared for the U.S. Department of Energy under Contract DE-AC05-76RLO

  3. NCIPO Ex A (Rev. 2.7, 3/26/15) Exhibit A General Conditions

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7, 3/26/15) Exhibit A General Conditions Page 1 of 16 EXHIBIT "A" GENERAL CONDITIONS TABLE OF CONTENTS GC Title Page GC-1B DEFINITIONS (Jan 2010) .......................................................................................................... 2 GC-2B CORRESPONDENCE AND SUBCONTRACT INTERPRETATION (Jan 2010) ....................... 2 GC-5 NOTICE TO PROCEED (Jul 2011) ........................................................................................... 2 GC-6A ORDER OF

  4. Table 8.3c Useful Thermal Output at Combined-Heat-and-Power Plants: Commercial and Industrial Sectors, 1989-2011 (Subset of Table 8.3a; Billion Btu)

    U.S. Energy Information Administration (EIA) Indexed Site

    c Useful Thermal Output at Combined-Heat-and-Power Plants: Commercial and Industrial Sectors, 1989-2011 (Subset of Table 8.3a; Billion Btu) Year Fossil Fuels Renewable Energy Other 7 Total Coal 1 Petroleum 2 Natural Gas 3 Other Gases 4 Total Biomass Total Wood 5 Waste 6 Commercial Sector 8<//td> 1989 13,517 3,896 9,920 102 27,435 145 10,305 10,450 – 37,885 1990 14,670 5,406 15,515 118 35,709 387 10,193 10,580 – 46,289 1991 15,967 3,684 20,809 118 40,578 169 8,980 9,149 1 49,728 1992

  5. Radiological Survey Tool Set for ArcGIS 8.3 and ArcPad 6.0

    SciTech Connect (OSTI)

    ROGER, COTTRELL

    2004-11-30

    The Radiological Control Operations (RCO) group at the Savannah River Site (SRS) is tasked with conducting routine surveys for the detection of radiological contaminants in the environment. The Radiological Survey Tool Set (RSTS) was developed by the Environmental & Geographic Information Systems (EGIS) group of SRS to assist RCO personnel in this survey process. The tool set consists of two major components. The first component is a custom extension for ArcGIS 8.3 that allows the user to interactively create a sampling plan prior to entering the field. Additionally, the extension allows the user to upload field-collected data to the GIS with post-processing functionality. The second component is a custom ArcPad 6.0 applet. This applet provides the user with navigational capabilities to a selected origin point with the help of Global Positioning Systems (GPS) technology, and the recording of the sample data results into a hand-held field computer via ArcPad 6.0 software.

  6. Photolysis rates in correlated overlapping cloud fields: Cloud-J 7.3

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Prather, M. J.

    2015-05-27

    A new approach for modeling photolysis rates (J values) in atmospheres with fractional cloud cover has been developed and implemented as Cloud-J – a multi-scattering eight-stream radiative transfer model for solar radiation based on Fast-J. Using observed statistics for the vertical correlation of cloud layers, Cloud-J 7.3 provides a practical and accurate method for modeling atmospheric chemistry. The combination of the new maximum-correlated cloud groups with the integration over all cloud combinations represented by four quadrature atmospheres produces mean J values in an atmospheric column with root-mean-square errors of 4% or less compared with 10–20% errors using simpler approximations. Cloud-Jmore » is practical for chemistry-climate models, requiring only an average of 2.8 Fast-J calls per atmosphere, vs. hundreds of calls with the correlated cloud groups, or 1 call with the simplest cloud approximations. Another improvement in modeling J values, the treatment of volatile organic compounds with pressure-dependent cross sections is also incorporated into Cloud-J.« less

  7. Photolysis rates in correlated overlapping cloud fields: Cloud-J 7.3c

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Prather, M. J.

    2015-08-14

    A new approach for modeling photolysis rates (J values) in atmospheres with fractional cloud cover has been developed and is implemented as Cloud-J – a multi-scattering eight-stream radiative transfer model for solar radiation based on Fast-J. Using observations of the vertical correlation of cloud layers, Cloud-J 7.3c provides a practical and accurate method for modeling atmospheric chemistry. The combination of the new maximum-correlated cloud groups with the integration over all cloud combinations by four quadrature atmospheres produces mean J values in an atmospheric column with root mean square (rms) errors of 4 % or less compared with 10–20 % errorsmore » using simpler approximations. Cloud-J is practical for chemistry–climate models, requiring only an average of 2.8 Fast-J calls per atmosphere vs. hundreds of calls with the correlated cloud groups, or 1 call with the simplest cloud approximations. Another improvement in modeling J values, the treatment of volatile organic compounds with pressure-dependent cross sections, is also incorporated into Cloud-J.« less

  8. CI-OFF Ex A (Rev. 0.7, 3/6/15) Exhibit A General Conditions

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7, 3/6/15) Exhibit A General Conditions Page 1 of 11 EXHIBIT "A" GENERAL CONDITIONS TABLE OF CONTENTS GC Title Page GC-A1 COMMERCIAL ITEMS (Aug 2014) ........................................................................................... 2 GC-1B DEFINITIONS (Mar 2012) ......................................................................................................... 4 GC-2B CORRESPONDENCE AND SUBCONTRACT INTERPRETATION (Jan 2010) ....................... 4 GC-6A ORDER OF

  9. DOE Selects Projects for Up to $7.3 Million for R&D Clean Technology Water

    Broader source: Energy.gov (indexed) [DOE]

    Power Projects | Department of Energy WASHINGTON - The U.S. Department of Energy (DOE) today announced the selection of projects for negotiation of award of up to $7.3 million to 14 research teams, with a cost-shared value of over $18 million, under the DOE's competitive solicitation for Advanced Water Power Projects. The projects will advance commercial viability, cost-competitiveness, and market acceptance of new technologies that can harness renewable energy from oceans and rivers. These

  10. Beamline 8.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    1 Print Multiple-wavelength anomalous diffraction (MAD) and macromolecular crystallography (MX) Scientific discipline: Structural biology GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (5.0 tesla, single pole) Energy range 5-17 keV (1% max flux) Monochromator Double flat crystal, Si(111) Measured flux (1.9 GeV, 400 mA) 2.5 x 1011 at 11 keV Resolving power (E/ΔE) 7,000 Divergence (max at sample) 3.0 (h) x 0.35 (v) mrad Endstations Minihutch Detectors 3 x 3

  11. Beamline 8.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    1 Print Multiple-wavelength anomalous diffraction (MAD) and macromolecular crystallography (MX) Scientific discipline: Structural biology GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (5.0 tesla, single pole) Energy range 5-17 keV (1% max flux) Monochromator Double flat crystal, Si(111) Measured flux (1.9 GeV, 400 mA) 2.5 x 1011 at 11 keV Resolving power (E/ΔE) 7,000 Divergence (max at sample) 3.0 (h) x 0.35 (v) mrad Endstations Minihutch Detectors 3 x 3

  12. Beamline 8.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    1 Print Multiple-wavelength anomalous diffraction (MAD) and macromolecular crystallography (MX) Scientific discipline: Structural biology GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (5.0 tesla, single pole) Energy range 5-17 keV (1% max flux) Monochromator Double flat crystal, Si(111) Measured flux (1.9 GeV, 400 mA) 2.5 x 1011 at 11 keV Resolving power (E/ΔE) 7,000 Divergence (max at sample) 3.0 (h) x 0.35 (v) mrad Endstations Minihutch Detectors 3 x 3

  13. Beamline 8.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    1 Print Multiple-wavelength anomalous diffraction (MAD) and macromolecular crystallography (MX) Scientific discipline: Structural biology GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (5.0 tesla, single pole) Energy range 5-17 keV (1% max flux) Monochromator Double flat crystal, Si(111) Measured flux (1.9 GeV, 400 mA) 2.5 x 1011 at 11 keV Resolving power (E/ΔE) 7,000 Divergence (max at sample) 3.0 (h) x 0.35 (v) mrad Endstations Minihutch Detectors 3 x 3

  14. Beamline 8.3.2

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3.2 Print Tomography Scientific disciplines: Applied science, biology, earth sciences, energy, environmental sciences, geology, cosmological chemistry GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (1.9 GeV, 4.37 tesla) Energy range 6-46 keV ML mode Monochromator None or two ML or two Si(111) Flux (1.9 GeV, 500 mA) ~105hv/sec/µm2 in ML mode Resolving power (E/ΔE) White beam/ 1% / 0.02% Endstation 12 x 3 ft optical table in hutch for radiography and

  15. Beamline 8.3.2

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3.2 Print Tomography Scientific disciplines: Applied science, biology, earth sciences, energy, environmental sciences, geology, cosmological chemistry GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (1.9 GeV, 4.37 tesla) Energy range 6-46 keV ML mode Monochromator None or two ML or two Si(111) Flux (1.9 GeV, 500 mA) ~105hv/sec/µm2 in ML mode Resolving power (E/ΔE) White beam/ 1% / 0.02% Endstation 12 x 3 ft optical table in hutch for radiography and

  16. Beamline 8.3.2

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2 Print Tomography Scientific disciplines: Applied science, biology, earth sciences, energy, environmental sciences, geology, cosmological chemistry GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (1.9 GeV, 4.37 tesla) Energy range 6-46 keV ML mode Monochromator None or two ML or two Si(111) Flux (1.9 GeV, 500 mA) ~105hv/sec/µm2 in ML mode Resolving power (E/ΔE) White beam/ 1% / 0.02% Endstation 12 x 3 ft optical table in hutch for radiography and

  17. Beamline 8.3.2

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2 Print Tomography Scientific disciplines: Applied science, biology, earth sciences, energy, environmental sciences, geology, cosmological chemistry GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (1.9 GeV, 4.37 tesla) Energy range 6-46 keV ML mode Monochromator None or two ML or two Si(111) Flux (1.9 GeV, 500 mA) ~105hv/sec/µm2 in ML mode Resolving power (E/ΔE) White beam/ 1% / 0.02% Endstation 12 x 3 ft optical table in hutch for radiography and

  18. Beamline 8.3.2

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2 Print Tomography Scientific disciplines: Applied science, biology, earth sciences, energy, environmental sciences, geology, cosmological chemistry GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (1.9 GeV, 4.37 tesla) Energy range 6-46 keV ML mode Monochromator None or two ML or two Si(111) Flux (1.9 GeV, 500 mA) ~105hv/sec/µm2 in ML mode Resolving power (E/ΔE) White beam/ 1% / 0.02% Endstation 12 x 3 ft optical table in hutch for radiography and

  19. Beamline 8.3.2

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3.2 Print Tomography Scientific disciplines: Applied science, biology, earth sciences, energy, environmental sciences, geology, cosmological chemistry GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (1.9 GeV, 4.37 tesla) Energy range 6-46 keV ML mode Monochromator None or two ML or two Si(111) Flux (1.9 GeV, 500 mA) ~105hv/sec/µm2 in ML mode Resolving power (E/ΔE) White beam/ 1% / 0.02% Endstation 12 x 3 ft optical table in hutch for radiography and

  20. Beamline 8.3.2

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2 Print Tomography Scientific disciplines: Applied science, biology, earth sciences, energy, environmental sciences, geology, cosmological chemistry GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (1.9 GeV, 4.37 tesla) Energy range 6-46 keV ML mode Monochromator None or two ML or two Si(111) Flux (1.9 GeV, 500 mA) ~105hv/sec/µm2 in ML mode Resolving power (E/ΔE) White beam/ 1% / 0.02% Endstation 12 x 3 ft optical table in hutch for radiography and

  1. Beamline 8.3.2

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2 Print Tomography Scientific disciplines: Applied science, biology, earth sciences, energy, environmental sciences, geology, cosmological chemistry GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (1.9 GeV, 4.37 tesla) Energy range 6-46 keV ML mode Monochromator None or two ML or two Si(111) Flux (1.9 GeV, 500 mA) ~105hv/sec/µm2 in ML mode Resolving power (E/ΔE) White beam/ 1% / 0.02% Endstation 12 x 3 ft optical table in hutch for radiography and

  2. Beamline 8.3.2

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2 Print Tomography Scientific disciplines: Applied science, biology, earth sciences, energy, environmental sciences, geology, cosmological chemistry GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (1.9 GeV, 4.37 tesla) Energy range 6-46 keV ML mode Monochromator None or two ML or two Si(111) Flux (1.9 GeV, 500 mA) ~105hv/sec/µm2 in ML mode Resolving power (E/ΔE) White beam/ 1% / 0.02% Endstation 12 x 3 ft optical table in hutch for radiography and

  3. TTW 8-3-06

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3, 2006 WIPP Quick Facts (As of 08-02-06) 4,874 Shipments received since opening 40,242 Cubic meters of waste disposed 81,141 Containers disposed in the underground WTS awards container contracts WTS has awarded contracts to manufacture steel containers that will be used to dispose of TRU waste at WIPP. Peterson, Inc. of Ogden, Utah, was awarded a contract with a potential value of over $13 million for the construction of two types of disposal containers. The Type A containers are designed to

  4. SASproperty8_3_09

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    04/09 Property List for RO Code '13' 1 BARCODE DESCRIPTION MANUF. MODEL COST 0000016386 COMPUTER PERSONAL E4 GATEWAY E4100 P4/2.4 $1,078.38 0000031152 LaCie 2TB Gigabit Et LACIE 300961 $999.00 S7237 KODAK PHOTO CD PLAYE KODAK N/A $449.00 0000017846 PRESS BRIDGE VIDEO/A OPAMP LABS VA-8 $1,195.00 0000021344 COMPUTER GATEWAY E-4 GATEWAY E-4500 D $735.00 0000015660 COMPUTER PERSONAL E- GATEWAY E-4000 P4/1.8 $950.00 0000021059 MACKIE AUDIO MIXER ( MACKIE 1402VLZ PRO $399.00 0000030017 CAMCORDER

  5. Beamline 8.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    1 Print Multiple-wavelength anomalous diffraction (MAD) and macromolecular crystallography (MX) Scientific discipline: Structural biology GENERAL BEAMLINE INFORMATION Operational...

  6. Beamline 8.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3.1 Print Multiple-wavelength anomalous diffraction (MAD) and macromolecular crystallography (MX) Scientific discipline: Structural biology GENERAL BEAMLINE INFORMATION Operational...

  7. Beamline 8.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    1 Print Multiple-wavelength anomalous diffraction (MAD) and macromolecular crystallography (MX) Scientific discipline: Structural biology GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (5.0 tesla, single pole) Energy range 5-17 keV (1% max flux) Monochromator Double flat crystal, Si(111) Measured flux (1.9 GeV, 400 mA) 2.5 x 1011 at 11 keV Resolving power (E/ΔE) 7,000 Divergence (max at sample) 3.0 (h) x 0.35 (v) mrad Endstations Minihutch Detectors 3 x 3

  8. Beamline 8.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    1 Print Multiple-wavelength anomalous diffraction (MAD) and macromolecular crystallography (MX) Scientific discipline: Structural biology GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (5.0 tesla, single pole) Energy range 5-17 keV (1% max flux) Monochromator Double flat crystal, Si(111) Measured flux (1.9 GeV, 400 mA) 2.5 x 1011 at 11 keV Resolving power (E/ΔE) 7,000 Divergence (max at sample) 3.0 (h) x 0.35 (v) mrad Endstations Minihutch Detectors 3 x 3

  9. Beamline 8.3.2

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2 Print Tomography Scientific disciplines: Applied science, biology, earth sciences, energy, environmental sciences, geology, cosmological chemistry GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (1.9 GeV, 4.37 tesla) Energy range 6-46 keV ML mode Monochromator None or two ML or two Si(111) Flux (1.9 GeV, 500 mA) ~105hv/sec/µm2 in ML mode Resolving power (E/ΔE) White beam/ 1% / 0.02% Endstation 12 x 3 ft optical table in hutch for radiography and

  10. Beamline 8.3.2

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2 Print Tomography Scientific disciplines: Applied science, biology, earth sciences, energy, environmental sciences, geology, cosmological chemistry GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (1.9 GeV, 4.37 tesla) Energy range 6-46 keV ML mode Monochromator None or two ML or two Si(111) Flux (1.9 GeV, 500 mA) ~105hv/sec/µm2 in ML mode Resolving power (E/ΔE) White beam/ 1% / 0.02% Endstation 12 x 3 ft optical table in hutch for radiography and

  11. Beamline 8.3.2

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2 Print Tomography Scientific disciplines: Applied science, biology, earth sciences, energy, environmental sciences, geology, cosmological chemistry GENERAL BEAMLINE INFORMATION...

  12. Beamline 8.3.2

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3.2 Print Tomography Scientific disciplines: Applied science, biology, earth sciences, energy, environmental sciences, geology, cosmological chemistry GENERAL BEAMLINE INFORMATION...

  13. Beamline 8.3.2

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    disciplines: Applied science, biology, earth sciences, energy, environmental sciences, geology, cosmological chemistry GENERAL BEAMLINE INFORMATION Operational Yes Source...

  14. Beamline 8.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    environment Ambient or 100 K Special notes Computers for data processing and analysis, robotic sample handling available Scientific disciplines Structural biology Scientific...

  15. SASproperty8_3_09

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    09 Property List for RO Code '13' 1 BARCODE DESCRIPTION MANUF. MODEL COST 0000016386 COMPUTER PERSONAL E4 GATEWAY E4100 P42.4 1,078.38 0000031152 LaCie 2TB Gigabit Et LACIE...

  16. Beamline 8.3.1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    BEAMLINE INFORMATION Operational Yes Source characteristics Superbend magnet (5.0 tesla, single pole) Energy range 5-17 keV (1% max flux) Monochromator Double flat crystal,...

  17. Beamline 8.3.2

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    INFORMATION Operational Yes Source characteristics Superbend magnet (1.9 GeV, 4.37 tesla) Energy range 6-46 keV ML mode Monochromator None or two ML or two Si(111) Flux (1.9...

  18. BEAMLINE 7-3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3 CURRENT STATUS: Open SUPPORTED TECHNIQUES: X-ray absorption spectroscopy MAIN SCIENTIFIC DISCIPLINES: Structural Biology % TIME GENERAL USE: 100% SCHEDULING: Proposal Submittal and Scheduling Procedures Current SPEAR and Beam Line Schedules SOURCE: 20-pole, 2-Tesla wiggler, 0.8 mrad beam, side station BEAM LINE SPECIFICATIONS: energy range resolution DE/E spot size (fwhm) flux* angular acceptance unfocused 4600-37000 eV 1 x 10-4 2 x 15 mm2 ~1 x 1012 0.8 mrad *ph/sec @100 mA / 9 keV w 2x15 mm

  19. Site characterization plan: Yucca Mountain Site, Nevada Research and Development Area, Nevada: Volume 4, Part B: Chapter 8, Sections 8.0 through 8.3.1.4

    SciTech Connect (OSTI)

    NONE

    1988-12-01

    This site characterization plan (SCP) has been developed for the candidate repository site at Yucca Mountain in the State of Nevada. The SCP includes a description of the Yucca Mountain site (Chapters 1-5), a conceptual design for the repository (Chapter 6), a description of the packaging to be used for the waste to be emplaced in the repository (Chapter 7), and a description of the planned site characterization activities (Chapter 8). The schedules and milestones presented in Sections 8.3 and 8.5 of the SCP were developed to be consistent with the June 1988 draft Amendment to the DOE`s Mission Plan for the Civilian Radioactive Waste Management Program. The five month delay in the scheduled start of exploratory shaft construction that was announced recently is not reflected in these schedules. 74 figs., 32 tabs.

  20. Table B16. Multibuilding Facilities, Number of Buildings and...

    U.S. Energy Information Administration (EIA) Indexed Site

    .........",349,38,"Q",1851,271,"Q" "Health Care ......",127,29,8,2918,18... or Complex ..",186,186,"Q",1907,1907,"Q" "Health Care Complex ......",72,72,16,2339,23...

  1. Accelerated evolution of the Ly? luminosity function at z ? 7 revealed by the Subaru ultra-deep survey for Ly? emitters at z = 7.3

    SciTech Connect (OSTI)

    Konno, Akira; Ouchi, Masami; Ono, Yoshiaki; Shibuya, Takatoshi; Naito, Yoshiaki; Momose, Rieko; Yuma, Suraphong; Shimasaku, Kazuhiro; Nakajima, Kimihiko; Furusawa, Hisanori; Iye, Masanori

    2014-12-10

    We present the ultra-deep Subaru narrowband imaging survey for Ly? emitters (LAEs) at z = 7.3 in the Subaru/XMM-Newton Deep Survey (SXDS) and Cosmic Evolution Survey (COSMOS) fields (?0.5 deg{sup 2}) with a total integration time of 106 hr. Exploiting our new sharp bandwidth filter, NB101, installed on the Suprime-Cam, we have reached L(Ly?) = 2.4 10{sup 42} erg s{sup 1} (5?) for z = 7.3 LAEs, about four times deeper than previous Subaru z ? 7 studies, which allows us to reliably investigate the evolution of the Ly? luminosity function (LF) for the first time down to the luminosity limit same as those of Subaru z = 3.1-6.6 LAE samples. Surprisingly, we only find three and four LAEs in the SXDS and COSMOS fields, respectively, while one expects a total of ?65 LAEs by our survey in the case of no Ly? LF evolution from z = 6.6 to 7.3. We identify a decrease of the Ly? LF from z = 6.6 to 7.3 at the >90% confidence level from our z = 7.3 Ly? LF with the best-fit Schechter parameters of L{sub Ly?}{sup ?}=2.7{sub ?1.2}{sup +8.0}10{sup 42} erg s{sup ?1} and ?{sup ?}=3.7{sub ?3.3}{sup +17.6}10{sup ?4} Mpc{sup ?3} for a fixed ? = 1.5. Moreover, the evolution of the Ly? LF is clearly accelerated at z > 6.6 beyond the measurement uncertainties including cosmic variance. Because no such accelerated evolution of the UV-continuum LF or the cosmic star formation rate (SFR) is found at z ? 7, but suggested only at z > 8, this accelerated Ly? LF evolution is explained by physical mechanisms different from a pure SFR decrease but related to the Ly? production and escape in the process of cosmic reionization. Because a simple accelerating increase of intergalactic medium neutral hydrogen absorbing Ly? cannot be reconciled with Thomson scattering of optical depth measurements from WMAP and Planck, our findings may support new physical pictures suggested by recent theoretical studies, such as the existence of HI clumpy clouds within cosmic ionized bubbles that are selectively absorbing Ly? and the large ionizing photon escape fraction of galaxies causing weak Ly? emission.

  2. Beamline 7.3.3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3.3 Print Small- and Wide-Angle X-Ray Scattering (SAXS/WAXS/Protein SAXS)* Scientific disciplines: Polymer science, materials science, proteins, surface science GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Bend magnet Energy range 10 keV Monochromator Mo/B4C double multilayer monochromator Measured flux (1.9 GeV, 400 mA) 1012 photons/s Resolving power (E/ΔE) 100 Detectors Pilatus 1M, Pilatus 100K, Pilatus 300KW, 2x ADSC Quantum 4u Spot size at sample 1 mm x 0.8 mm Samples

  3. Beamline 7.3.3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3.3 Print Small- and Wide-Angle X-Ray Scattering (SAXS/WAXS/Protein SAXS)* Scientific disciplines: Polymer science, materials science, proteins, surface science GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Bend magnet Energy range 10 keV Monochromator Mo/B4C double multilayer monochromator Measured flux (1.9 GeV, 400 mA) 1012 photons/s Resolving power (E/ΔE) 100 Detectors Pilatus 1M, Pilatus 100K, Pilatus 300KW, 2x ADSC Quantum 4u Spot size at sample 1 mm x 0.8 mm Samples

  4. Beamline 7.3.3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3.3 Print Small- and Wide-Angle X-Ray Scattering (SAXS/WAXS/Protein SAXS)* Scientific disciplines: Polymer science, materials science, proteins, surface science GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Bend magnet Energy range 10 keV Monochromator Mo/B4C double multilayer monochromator Measured flux (1.9 GeV, 400 mA) 1012 photons/s Resolving power (E/ΔE) 100 Detectors Pilatus 1M, Pilatus 100K, Pilatus 300KW, 2x ADSC Quantum 4u Spot size at sample 1 mm x 0.8 mm Samples

  5. Beamline 7.3.3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3.3 Print Small- and Wide-Angle X-Ray Scattering (SAXS/WAXS/Protein SAXS)* Scientific disciplines: Polymer science, materials science, proteins, surface science GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Bend magnet Energy range 10 keV Monochromator Mo/B4C double multilayer monochromator Measured flux (1.9 GeV, 400 mA) 1012 photons/s Resolving power (E/ΔE) 100 Detectors Pilatus 1M, Pilatus 100K, Pilatus 300KW, 2x ADSC Quantum 4u Spot size at sample 1 mm x 0.8 mm Samples

  6. Beamline 7.3.3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3.3 Print Small- and Wide-Angle X-Ray Scattering (SAXS/WAXS/Protein SAXS)* Scientific disciplines: Polymer science, materials science, proteins, surface science GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Bend magnet Energy range 10 keV Monochromator Mo/B4C double multilayer monochromator Measured flux (1.9 GeV, 400 mA) 1012 photons/s Resolving power (E/ΔE) 100 Detectors Pilatus 1M, Pilatus 100K, Pilatus 300KW, 2x ADSC Quantum 4u Spot size at sample 1 mm x 0.8 mm Samples

  7. Beamline 7.3.3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3.3 Print Small- and Wide-Angle X-Ray Scattering (SAXS/WAXS/Protein SAXS)* Scientific disciplines: Polymer science, materials science, proteins, surface science GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Bend magnet Energy range 10 keV Monochromator Mo/B4C double multilayer monochromator Measured flux (1.9 GeV, 400 mA) 1012 photons/s Resolving power (E/ΔE) 100 Detectors Pilatus 1M, Pilatus 100K, Pilatus 300KW, 2x ADSC Quantum 4u Spot size at sample 1 mm x 0.8 mm Samples

  8. Beamline 7.3.3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3.3 Print Small- and Wide-Angle X-Ray Scattering (SAXS/WAXS/Protein SAXS)* Scientific disciplines: Polymer science, materials science, proteins, surface science GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Bend magnet Energy range 10 keV Monochromator Mo/B4C double multilayer monochromator Measured flux (1.9 GeV, 400 mA) 1012 photons/s Resolving power (E/ΔE) 100 Detectors Pilatus 1M, Pilatus 100K, Pilatus 300KW, 2x ADSC Quantum 4u Spot size at sample 1 mm x 0.8 mm Samples

  9. Beamline 7.3.3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3.3 Print Small- and Wide-Angle X-Ray Scattering (SAXS/WAXS/Protein SAXS)* Scientific disciplines: Polymer science, materials science, proteins, surface science GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Bend magnet Energy range 10 keV Monochromator Mo/B4C double multilayer monochromator Measured flux (1.9 GeV, 400 mA) 1012 photons/s Resolving power (E/ΔE) 100 Detectors Pilatus 1M, Pilatus 100K, Pilatus 300KW, 2x ADSC Quantum 4u Spot size at sample 1 mm x 0.8 mm Samples

  10. Beamline 7.3.3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3.3 Print Small- and Wide-Angle X-Ray Scattering (SAXS/WAXS/Protein SAXS)* Scientific disciplines: Polymer science, materials science, proteins, surface science GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Bend magnet Energy range 10 keV Monochromator Mo/B4C double multilayer monochromator Measured flux (1.9 GeV, 400 mA) 1012 photons/s Resolving power (E/ΔE) 100 Detectors Pilatus 1M, Pilatus 100K, Pilatus 300KW, 2x ADSC Quantum 4u Spot size at sample 1 mm x 0.8 mm Samples

  11. Beamline 7.3.3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3.3 Print Small- and Wide-Angle X-Ray Scattering (SAXS/WAXS/Protein SAXS)* Scientific disciplines: Polymer science, materials science, proteins, surface science GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Bend magnet Energy range 10 keV Monochromator Mo/B4C double multilayer monochromator Measured flux (1.9 GeV, 400 mA) 1012 photons/s Resolving power (E/ΔE) 100 Detectors Pilatus 1M, Pilatus 100K, Pilatus 300KW, 2x ADSC Quantum 4u Spot size at sample 1 mm x 0.8 mm Samples

  12. Beamline 7.3.3

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3.3 Print Small- and Wide-Angle X-Ray Scattering (SAXS/WAXS/Protein SAXS)* Scientific disciplines: Polymer science, materials science, proteins, surface science GENERAL BEAMLINE INFORMATION Operational Yes Source characteristics Bend magnet Energy range 10 keV Monochromator Mo/B4C double multilayer monochromator Measured flux (1.9 GeV, 400 mA) 1012 photons/s Resolving power (E/ΔE) 100 Detectors Pilatus 1M, Pilatus 100K, Pilatus 300KW, 2x ADSC Quantum 4u Spot size at sample 1 mm x 0.8 mm Samples

  13. table8.3_02.xls

    U.S. Energy Information Administration (EIA) Indexed Site

    Number of Establishments by Usage of Cogeneration Technologies, 2002; Level: National Data; Row: NAICS Codes; Column: Usage within Cogeneration Technologies; Unit: Establishment Counts. NAICS Code(a) Subsector and Industry Establishments(b) Establishments with Any Cogeneration Technology in Use(c) In Use(d) Not in Use Don't Know In Use(d) Not in Use Don't Know Total United States RSE Column Factors: 0 1 0.7 0.8 1.7 0.6 0.8 1.7 311 Food 15,089 443 131 13,850 1,109 80 13,729 1,280 311221 Wet Corn

  14. TableHC8.3.xls

    U.S. Energy Information Administration (EIA) Indexed Site

    Income Relative to Poverty Line Below 100 Percent...... 16.6 8.9 2.6 1.6 3.5 100 to 150 Percent......

  15. "Table B16. Employment Size Category, Floorspace for Non-Mall...

    U.S. Energy Information Administration (EIA) Indexed Site

    ... with Cooling ......",56940,9591,5726,7304,10566,7428,6806,9519 "Buildings with Water Heating .",56478,9525,5393,7182,10480,7688,6815,9395 "Buildings with Cooking ...

  16. table7.3_02.xls

    U.S. Energy Information Administration (EIA) Indexed Site

    3 Average Prices of Purchased Electricity, Natural Gas, and Steam, 2002; Level: National and Regional Data; Row: NAICS Codes; Column: Supplier Sources of Purchased Electricity, Natural Gas, and Steam; Unit: U.S. Dollars per Physical Units. Electricity Components Natural Gas Components Steam Components Electricity Natural Gas Steam Electricity from Sources Natural Gas from Sources Steam from Sources Electricity from Local Other than Natural Gas from Local Other than Steam from Local Other than

  17. Structure and microwave dielectric characteristics of lithium-excess Ca{sub 0.6}Nd{sub 0.8/3}TiO{sub 3}/(Li{sub 0.5}Nd{sub 0.5})TiO{sub 3} ceramics

    SciTech Connect (OSTI)

    Zhou, Changrong; Chen, Guohua; Cen, Zhenyong; Yuan, Changlai; Yang, Yun; Li, Weizhou

    2013-11-15

    Graphical abstract: - Highlights: Dense ceramics were fabricated by the conventional solid-state route. Excess-Li addition lowers sintering temperature. Excess-Li addition improves the relative density and microwave dielectric properties. - Abstract: Compositions based on (1?x)Ca{sub 0.6}Nd{sub 8/3}TiO{sub 3}?x(Li{sub 1/2}Nd{sub 1/2})TiO{sub 3} + yLi (CNLNTx + yLi, x = 0.300.60, y = 00.05), suitable for microwave applications have been developed by systematically adding excess lithium in order to tune the microwave dielectric properties and lower sintering temperature. Addition of 0.03 excess-Li simultaneously reduced the sintering temperature and improved the relative density of sintered CNLNTx ceramics. The excess Li addition can compensate the evaporation of Li during sintering process and decrease the secondary phase content. The CNLNTx (x = 0.45) ceramics with 0.03 Li excess sintered at 1190 C have single phase orthorhombic perovskite structure, together with the optimum combination of microwave dielectric properties of ?{sub r} = 129, Q f = 3600 GHz, ?{sub f} = 38 ppm/C. Obviously, excess-Li addition can efficiently decrease the sintering temperature and improve the microwave dielectric properties. The high permittivity and relatively low sintering temperatures of lithium-excess Ca{sub 0.6}Nd{sub 0.8/3}TiO{sub 3}/(Li{sub 0.5}Nd{sub 0.5})TiO{sub 3} ceramics are ideal for the development of low cost ultra-small dielectric loaded antenna.

  18. Experimental Station 7-3 | Stanford Synchrotron Radiation Lightsource

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Spectroscopy Main Scientific Disciplines Biomedical Sciences Structural Molecular Biology Beam Line Specifications Source 20-pole, 2-Tesla wiggler, 0.8 mrad beam, Side station...

  19. SFS Exhibit A (Rev. 8.3, 9-27-13)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3, 9/27/13) Exhibit A General Conditions Page 1 of 17 EXHIBIT "A" GENERAL CONDITIONS TABLE OF CONTENTS GC Title Page GC-1 DEFINITIONS (Aug 2012) .......................................................................................................... 3 GC-2A AUTHORIZED REPRESENTATIVES, COMMUNICATIONS AND NOTICES (Jan 2010) ........................................................................................................................................... 3 GC-3 INDEPENDENT

  20. CPFFS Exhibit A General Conditions (Rev. 8.3, 9-27-13)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    on claims shall be paid at the rate established by the Secretary of the Treasury of the United States pursuant to Public Law 92-41 (85 Stat. 97). GC-37 BANKRUPTCY (Jun 2009) In...

  1. CPFFS Exhibit A General Conditions (Rev. 8.3, 9-27-13)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3, 9/27/13) Exhibit A General Conditions Page 1 of 21 EXHIBIT "A" GENERAL CONDITIONS TABLE OF CONTENTS GC Title Page GC-1 DEFINITIONS (Aug 2012) .......................................................................................................... 3 GC-2A AUTHORIZED REPRESENTATIVES, COMMUNICATIONS AND NOTICES (Jan 2010) ........................................................................................................................................... 3 GC-3 INDEPENDENT

  2. Attachment_4_Table_8.3Summary100-KOperableUnit.pdf

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

  3. Table 8.3b Useful Thermal Output at Combined-Heat-and-Power Plants...

    U.S. Energy Information Administration (EIA) Indexed Site

    Year Fossil Fuels Renewable Energy Other 7 Total Coal 1 Petroleum 2 Natural Gas 3 Other Gases 4 Total Biomass Total Wood 5 Waste 6 1989 12,768 8,013 66,801 2,243 89,825 19,346 ...

  4. U.S. Secretary of Energy Concludes Productive G8+3 Energy Ministerial...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    ... inaugural Five-Country Energy Ministerial in Beijing and in the G8 Ministerial in Russia. ... of China, India and The Republic of Korea Declaration: International Partnership for ...

  5. Microsoft Word - FAL 2015-03 FY2015Approp REV 2 FINAL 8-3

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    ... is a corporation with an unpaid Federal tax liability), the awarding official (e.g., ... In the latter case, the contracting officer would be determining that the offeror lacks ...

  6. Table N8.3. Average Prices of Purchased Electricity, Natural Gas, and Steam,

    U.S. Energy Information Administration (EIA) Indexed Site

    3. Average Prices of Purchased Electricity, Natural Gas, and Steam, 1998;" " Level: National and Regional Data; " " Row: NAICS Codes;" " Column: Supplier Sources of Purchased Electricity, Natural Gas, and Steam;" " Unit: U.S. Dollars per Physical Units." ,,,"Electricity","Components",,"Natural Gas","Components",,"Steam","Components" " ","

  7. LFS Exhibit A General Conditions (Rev. 8.3, 9-27-13)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3, 9/27/13) Exhibit A General Conditions Page 1 of 19 EXHIBIT "A" GENERAL CONDITIONS TABLE OF CONTENTS GC Title Page GC-1 DEFINITIONS (Aug 2012) .......................................................................................................... 3 GC-2A AUTHORIZED REPRESENTATIVES, COMMUNICATIONS AND NOTICES (Jan 2010) ........................................................................................................................................... 3 GC-3 INDEPENDENT

  8. Microsoft Word - FAL 2015-03 FY2015Approp REV 2 FINAL 8-3

    Office of Environmental Management (EM)

    D, Titles III and V, and Division E, Title VII of the Consolidated and Further Continuing Appropriations Act, 2015, Pub. L. No. 113-235. References: Consolidated and Further Continuing Division D, Title III, Sections Appropriations Act, 2015, 301(a), 307 and 310 and Title Pub.L. No. 113-235 V, Section 501; Division E, Title VII, Sections 724, 739, 743,744, 745 and 747 When is this Financial Assistance Letter (FAL) effective? The statutory provisions addressed in this FAL were effective as of the

  9. Buildings Energy Data Book: 8.3 Commercial Sector Water Consumption

    Buildings Energy Data Book [EERE]

    1 Commercial Water Use by Source (Million Gallons per Day) Year 1980 - - - 1985 5,710 1,230 1990 5,900 2,390 1995 6,690 2,890 2000 (3) 7,202 3,111 2005 (3) 7,102 3,068 Note(s): Source(s): 10,314 10,171 1) Public supply water use: water withdrawn by public and private water suppliers that furnish water to at least 25 people or have a minimum of 15 connections. 2) Self-supply water use: Water withdrawn from a groundwater or surface-water source by a user rather than being obtained from a public

  10. Buildings Energy Data Book: 8.3 Commercial Sector Water Consumption

    Buildings Energy Data Book [EERE]

    2 Average Water Use of Commercial and Institutional Establishments (Gallons per Establishment per Day) Average Variation % Total % of CI % Seasonal Daily Use In Use (1) CI Use Customers Use (2) Hotels and Motels 7,113 5.41 5.8% 1.9% 23.1% Laundries/Laundromats 3,290 8.85 4.0% 1.4% 13.4% Car Washes 3,031 3.12 0.8% 0.4% 14.2% Urban Irrigation 2,596 8.73 28.5% 30.2% 86.9% Schools and Colleges 2,117 12.13 8.8% 4.8% 58.0% Hospitals/Medical Offices 1,236 78.5 3.9% 4.2% 23.2% Office Buildings 1,204

  11. Buildings Energy Data Book: 8.3 Commercial Sector Water Consumption

    Buildings Energy Data Book [EERE]

    3 Normalized Annual End Uses of Water in Select Restaurants in Western United States (1) Fixture/End Use (2) Faucets Dishwashing Toilets/Urinals Ice Making Total Indoor Use (3) (4) (4) Building Size (SF) Seats: Meals: Benchmarking Values for Restaurants (6) N Gal./SF/year 90 Gal./meal 90 Gal./seat/day 90 Gal./employee/day 90 Note(s): Source(s): American Water Works Association Research Foundation, Commercial and Institutional End Uses of Water, 2000. 25th Percentile of Users 130 - 331 6 - 9 20 -

  12. Buildings Energy Data Book: 8.3 Commercial Sector Water Consumption

    Buildings Energy Data Book [EERE]

    4 Normalized Annual End Uses of Water in Select Supermarkets in Western United States (1) Fixture/End Use Toilets/Urinals Other/Misc. Indoor (2) Cooling Total Building Size (SF) Benchmarking Values for Supermarkets (3) N Indoor Use with Cooling, gal./SF/year 38 Indoor Use with Cooling, gal./SF/daily transaction 38 Note(s): Source(s): 25th Percentile of Users 52 - 64 9 - 16 1) Water use data for the buildings was collected over a few days. Estimates of annual use were created by accounting for

  13. Buildings Energy Data Book: 8.3 Commercial Sector Water Consumption

    Buildings Energy Data Book [EERE]

    5 Normalized Annual End Uses of Water in Select Hotels in Western United States (Gallons per Room per Year) (1) Fixture/End Use Bathtub (2) Faucets Showers Toilets Leaks Laundry Ice making (3) Other/misc. indoor Total Indoor Use Number of Rooms Logged average daily use, kgal: Peak instantaneous demand, gpm: Benchmarking Values for Hotels N Indoor Use, gal./day/occupied room 98 Cooling Use, gal./year/occupied room 97 Note(s): Source(s): 25th Percentile of Users 60 - 115 7,400 - 41,600 Based on

  14. Buildings Energy Data Book: 8.3 Commercial Sector Water Consumption

    Buildings Energy Data Book [EERE]

    6 Normalized Annual End Uses of Water in Two California High Schools Fixture/End Use Toilet Urinal Faucet Shower Kitchen Misc. uses (2) Cooling Leaks Swimming Pool Total Use Benchmarking Values for Schools (3) N Indoor Use, Gal./sq. ft./year 142 Indoor Use, Gal./school day/student 141 Cooling Use, Gal./sq. ft./year 35 Note(s): Source(s): 8 - 20 1) Water use data for the buildings was collected over a few days. Estimates of annual use were created by accounting for seasonal use and other

  15. U.S. Secretary of Energy Concludes Productive G8+3 Energy Ministerial Meeting in Japan

    Broader source: Energy.gov [DOE]

    WASHINGTON- U.S. Secretary of Energy Samuel W. Bodman today concluded his weekend visit to Aomori, Japan where he participated in the Five-Country and the Group of Eight (G8), China, India and...

  16. Percent of Industrial Natural Gas Deliveries in Florida Represented by the

    U.S. Energy Information Administration (EIA) Indexed Site

    Price (Percent) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 10.5 7.3 5.0 2000's 5.2 3.8 3.8 3.9 3.7 3.4 3.1 3.1 3.0 3.2 2010's 3.0 3.0 2.7 3.2

  17. TM Exhibit A General Conditions (Rev. 7.3, 9-27-13)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3, 9/27/13) Exhibit A General Conditions Page 1 of 20 EXHIBIT "A" GENERAL CONDITIONS TABLE OF CONTENTS GC Title Page GC-1 DEFINITIONS (Aug 2012) .......................................................................................................... 3 GC-2A AUTHORIZED REPRESENTATIVES, COMMUNICATIONS AND NOTICES (Jan 2010) ........................................................................................................................................... 3 GC-3 INDEPENDENT

  18. Subtask 7.3 - The Socioeconomic Impact of Climate Shifts in the Northern Great Plains

    SciTech Connect (OSTI)

    Jaroslav Solc; Tera Buckley; Troy Simonsen

    2007-12-31

    The Energy & Environmental Research Center (EERC) evaluated the water demand response/vulnerability to climate change factors of regional economic sectors in the northern Great Plains. Regardless of the cause of climatic trends currently observed, the research focused on practical evaluation of climate change impact, using water availability as a primary factor controlling long-term regional economic sustainability. Project results suggest that the Upper Missouri, Red River, and Upper Mississippi Watersheds exhibit analogous response to climate change, i.e., extended drought influences water availability in the entire region. The modified trend suggests that the next period for which the Red River Basin can expect a high probability of below normal precipitation will occur before 2050. Agriculture is the most sensitive economic sector in the region; however, analyses confirmed relative adaptability to changing conditions. The price of agricultural commodities is not a good indicator of the economic impact of climate change because production and price do not correlate and are subject to frequent and irregular government intervention. Project results confirm that high water demand in the primary economic sectors makes the regional economy extremely vulnerable to climatic extremes, with a similar response over the entire region. Without conservation-based water management policies, long-term periods of drought will limit socioeconomic development in the region and may threaten even the sustainability of current conditions.

  19. Policy Flash 2013-78 Acquisition Guide Chapter 7.3 Acquisition...

    Broader source: Energy.gov (indexed) [DOE]

    Questions concerning this policy flash should be directed to Jason Taylor of the Contract and Financial Assistance Policy Division, Office of Policy, Office of Acquisition and...

  20. Table 7.3 Average Prices of Purchased Electricity, Natural Gas, and Steam, 20

    U.S. Energy Information Administration (EIA) Indexed Site

    3 Average Prices of Purchased Electricity, Natural Gas, and Steam, 2002;" " Level: National and Regional Data; " " Row: NAICS Codes;" " Column: Supplier Sources of Purchased Electricity, Natural Gas, and Steam;" " Unit: U.S. Dollars per Physical Units." ,,,"Electricity","Components",,"Natural Gas","Components",,"Steam","Components" " ","

  1. Table 7.3 Average Prices of Purchased Electricity, Natural Gas, and Steam, 2010;

    U.S. Energy Information Administration (EIA) Indexed Site

    3 Average Prices of Purchased Electricity, Natural Gas, and Steam, 2010; Level: National and Regional Data; Row: NAICS Codes; Column: Supplier Sources of Purchased Electricity, Natural Gas, and Steam; Unit: U.S. Dollars per Physical Units. Electricity Components Natural Gas Components Steam Components Electricity Natural Gas Steam Electricity from Sources Natural Gas from Sources Steam from Sources Electricity from Local Other than Natural Gas from Local Other than Steam from Local Other than

  2. Buildings Energy Data Book: 7.3 Efficiency Standards for Residential HVAC

    Buildings Energy Data Book [EERE]

    1 Efficiency Standards for Residential Central Air Conditioners and Heat Pumps (1) Type SEER (3) HSPF (4) Split System Air Conditioners 13.0 -- Split System Heat Pumps 13.0 7.7 Single Package Air Conditioners 13.0 -- Single Package Heat Pumps 13.0 7.7 Through-the-Wall Air Conditioners and Heat Pumps: -Split System (2) 10.9 7.1 -Single Package (2) 10.6 7.0 Small Duct, High Velocity Systems 13.0 7.7 Space Constrained Products -Air Conditioners 12.0 -- -Heat Pumps 12.0 7.4 Note(s): Source(s): 1)

  3. Buildings Energy Data Book: 7.3 Efficiency Standards for Residential HVAC

    Buildings Energy Data Book [EERE]

    2 Efficiency Standards for Residential Furnaces AFUE (%) (2) Furnaces (excluding classes noted below) 78 Mobile Home Furnaces 75 Small Furnaces with input rate < 45,000 Btu/hr (1) - Weatherized (outdoor) 78 - Non-Weatherized (indoor) 78 AFUE (%) (2) Non-Weatherized Gas Furnaces 80 Weatherized Gas Furnaces 81 Mobile Home Oil-Fired Furnaces 75 Mobile home Gas Furnaces 80 Non-Weatherized Oil-Fired Furnaces 82 Weatherized Oil-Fired Furnaces 78 Note(s): 1) Excludes those intended solely for

  4. Buildings Energy Data Book: 7.3 Efficiency Standards for Residential HVAC

    Buildings Energy Data Book [EERE]

    3 Efficiency Standards for Residential Boilers Effective for products manufactured before September 1, 2012 AFUE(%) (1) Boilers (excluding gas steam) Gas Steam Boilers Effective for products manufactured on or after September 1, 2012 (2) AFUE (%) (1) No Constant Burning Pilot Automatic Means for Adjusting Water Temperature Gas Steam No Constant Burning Pilot Oil Hot Water Automatic Means for Adjusting Water Temperature Oil Steam None Electric Hot water Automatic Means for Adjusting Water

  5. " Million Housing Units, Final...

    U.S. Energy Information Administration (EIA) Indexed Site

    ...ed",50.5,6.1,1.9,6.1,5.3,8.3,7.9,7.6,7.3 "SleepStandby Mode When Not ...ed",27.7,3.2,0.9,3.2,2.8,4.2,3.9,4.7,4.6 "SleepStandby Mode When Not ...

  6. Policy Flash 2013-78 Acquisition Guide Chapter 7.3 Acquisition Planning in the M&O Environment

    Broader source: Energy.gov [DOE]

    Questions concerning this policy flash should be directed to Jason Taylor of the Contract and Financial Assistance Policy Division, Office of Policy, Office of Acquisition and Project Management at...

  7. Materials Data on Ba10Ta10(N3O7)3 (SG:47) by Materials Project

    SciTech Connect (OSTI)

    Kristin Persson

    2014-11-02

    Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

  8. 2013-11-19 KCP H-FM&T Mod 0049 (Admin)(7.3.13).pdf

    National Nuclear Security Administration (NNSA)

  9. X:\\Data_Publication\\Pma\\current\\ventura\\pma00.vp

    U.S. Energy Information Administration (EIA) Indexed Site

    1998 January ... 13.5 13.8 27.2 21.1 8.3 56.6 3.7 3.7 7.2 2.8 W 10.0 February ... 14.3 14.6 28.1 22.1 7.5 57.7 3.6 3.7 7.3 2.9 W 10.2 March...

  10. Design and Analysis of RTGs for CRAF and Cassini Missions; two copies - one dated 8/3/1990 and the other dated 11/8/1990.

    SciTech Connect (OSTI)

    Schock, Alfred

    1990-10-08

    The paper describes the design and analysis of Radioisotope Thermoelectric Generators Integrated with JPL's CRAF and Cassini spacecraft. The principal purpose of the CRAF mission is the study of asteroids and comets, and the principal purpose of the Cassini mission is the study of asteroids, Saturn, and its moons (particularly Titan). Both missions will employ the Mariner/Mark-2 spacecraft, and each will be powered by two GPHS-RTGs. JPL's spacecraft designers wish to locate the two RTGs in close proximity to each other, resulting in mutual and unsymmetrical obstruction of their heat rejection paths. To support JPL's design studies, the U.S. Department of Energy asked Fairchild to determine the effect of the RTGs' proximity on their power output. As described in the paper, this required the development of novel analysis methods and computer codes for the coupled thermal and electrical analysis of obstructed RTGs with axial and circumferential temperature, voltage, and current variations. The code was validated against measured data of unobstructed RTG tests, and was used for the detailed analysis of the obstructed CRAF and Cassini RTGs. Also described is a new method for predicting the combined effect of fuel decay and thermoelectric degradation on the output of obstructed RTGs, which accounts for the effect of diminishing temperatures on degradation rates. For the 24-degree separation angle of JPL's original baseline design, and for the 35-degree RTG separation of JPL's revised design, the computed results indicate that the mutually obstructed GPHS/RTGs with standard fuel loading and operating temperatures can comfortably meet the JPL-specified power requirements for the CRAF mission and almost meet the specified requirements for the Cassini mission.

  11. " Million Housing Units, Final...

    U.S. Energy Information Administration (EIA) Indexed Site

    "Air Conditioning",94,40.5,21.2,2.8,3.4,6.7,3.2,5.1,6.9,2.4,4.5,12.4,8.2,4.1 "Water Heating",47.1,27.3,16.1,1.8,1.8,6.2,2.2,4.2,5,1.8,3.1,6.2,4,2.3 "Cooking",71.2,31.7,17.9,2....

  12. " Million Housing Units, Final...

    U.S. Energy Information Administration (EIA) Indexed Site

    ...,3.5,2.9,3.9,3.8,3.8,3 "Air Conditioning",94,10.5,4,10.6,10.5,15.1,14.1,14.7,14.4 "Water Heating",47.1,4.1,1.7,3.8,4.4,8.4,9.2,8,7.5 "Cooking",71.2,7,2.6,6.7,7.8,12.6,11.9,11.4,11....

  13. Table 13. U.S. Refiner Reformulated Motor Gasoline Volumes by...

    U.S. Energy Information Administration (EIA) Indexed Site

    24.1 9.1 61.1 3.9 4.0 7.3 3.1 W 10.4 1998 ... 14.3 14.5 28.6 23.0 8.3 59.9 3.7 3.8 7.4 3.1 W 10.5 See footnotes at end of table. 26 Energy Information...

  14. Percent of Industrial Natural Gas Deliveries in Pennsylvania Represented by

    U.S. Energy Information Administration (EIA) Indexed Site

    the Price (Percent) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2001 17.0 16.4 11.3 10.2 7.7 5.1 7.3 7.5 8.2 8.8 7.3 8.4 2002 8.8 8.3 7.0 5.9 5.7 5.5 4.8 5.0 7.2 7.5 8.1 11.4 2003 8.5 8.5 8.8 7.3 5.7 5.4 5.2 5.0 5.2 5.5 5.9 6.5 2004 7.7 8.1 7.3 6.8 5.3 4.8 4.8 5.1 5.2 4.7 6.5 8.3 2005 8.8 8.4 8.2 7.0 6.1 5.5 5.9 7.1 5.2 5.2 6.7 8.2 2006 8.2 7.3 7.1 5.3 4.8 4.2 4.1 4.1 6.2 4.2 4.6 5.4 2007 6.7 8.5 8.3 5.9 5.6 3.7 3.3 3.2 4.1 3.1 4.5 6.6 2008 7.7 7.3 7.3 6.9 5.7 4.8 4.4 4.3 3.8 3.9

  15. "Table HC10.7 Air-Conditioning Usage Indicators by U.S. Census...

    U.S. Energy Information Administration (EIA) Indexed Site

    ... of Programmable Thermostats" "Adjusts Temperature During Day" "Yes",15.1,2.2,3.8,5.7,3.5 "No",9.9,0.6,3,3.7,2.5 "Adjusts Temperature at Night" "Yes",15.4,2.1,4,5.8,3.5 ...

  16. "Table HC13.7 Air-Conditioning Usage Indicators by South Census...

    U.S. Energy Information Administration (EIA) Indexed Site

    ... of Programmable Thermostats" "Adjusts Temperature During Day" "Yes",15.1,5.7,3.5,0.5,1.8 "No",9.9,3.7,2.1,0.6,1 "Adjusts Temperature at Night" "Yes",15.4,5.8,3.4,0.5,1.9 ...

  17. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    3,018.0 24,299.4 537.1 3,816.4 3,555.1 28,115.8 October... 2,818.6 23,025.5 504.7 3,140.8 3,323.3 26,166.4 November... 2,812.6 26,037.9 555.8...

  18. Operation Greenhouse. Scientific Director's report of atomic-weapon tests at Eniwetok, 1951. Annex 8. 3. Special radar, radio, and photographic studies of weapons effects. Part 1, 2, 3, and 4

    SciTech Connect (OSTI)

    Not Available

    1985-09-01

    Contents include: Part 1--radar-scope photography; Part 2--effects of atomic detonation on radio propagation; Part 3; photographic assessment of bomb damage; Part 4--film fogging studies.

  19. Ohio Share of Total U.S. Natural Gas Delivered to Consumers

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    6.1 5.9 6.1 6.0 6.1 6.3 1993-2014 Commercial 5.2 5.0 5.1 5.0 5.1 5.3 1993-2014 Industrial 3.8 3.9 3.8 3.7 3.7 4.0 1993-2014 Vehicle Fuel 0.5 0.5 0.3 0.3 1.0 1.0 1993-2014 Electric Power 0.5 0.8 1.2 1.9 2.0 2.2

  20. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    2006... 2.8 2.8 7.6 3.6 10.4 6.5 2007 January... 3.8 4.7 8.4 3.9 12.2 8.5 February.. 4.3 3.1 8.5 4.2 12.8 7.3 March..... 3.8 3.0 7.7 4.2 11.5 7.3 April..... 4.6 3.4 8.4 4.7...

  1. S:\\VM3\\RX97\\TBL_LIST.WPD

    Gasoline and Diesel Fuel Update (EIA)

    ... 1.3 Q 0.7 Q Q Q 15.4 Steam or Hot-Water System ...... 7.3 0.8 3.6 2.5 Q 0.2 15.5 ... 9.5 1.9 3.0 4.2 0.2 Q 16.9 Steam or Hot-Water System ...... 5.2 0.6 1.6 3.0 Q Q 17.8 ...

  2. Spectroscopic studies and crystal structure of (E)-N Prime -(2-hydroxy-3-methoxybenzylidene)isonicotinohydrazide

    SciTech Connect (OSTI)

    Ozay, H. Yildiz, M.; Unver, H.; Kiraz, A.

    2013-01-15

    The structure of compound has also been examined cyrstallographically. It crystallizes in the monoclinic space group P2{sub 1}/c with a = 7.673(1), b = 16.251(2), c = 10.874(1) A, {beta} = 110.42(1) Degree-Sign , V = 1270.7(3) A{sup 3}, D{sub x} = 1.418 g cm{sup -3}, R{sub 1} = 0.0349 and wR{sub 2} = 0.0935 [I > 2{sigma}(I)], respectively. The title compound has been synthesized from the reaction of isonicotinohydrazide with 2-hydroxy-3-methoxybenzaldehyde. It has been characterized by using elemental analysis, MS, IR, {sup 1}H NMR, {sup 13}C NMR and UV-Visible spectroscopic techniques.

  3. MiniBooNE

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

     &#8; &#3; &#8; &#3; &#7;&#3;         ! "  #$             ∆ (

  4. Million U.S. Housing Units Total...................................................................

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    111.1 14.7 7.4 12.5 12.5 18.9 18.6 17.3 9.2 Personal Computers Do Not Use a Personal Computer ............... 35.5 5.7 3.3 4.6 4.7 5.8 5.7 4.0 1.7 Use a Personal Computer............................. 75.6 9.0 4.1 7.9 7.8 13.1 12.9 13.3 7.5 Number of Desktop PCs 1.............................................................. 50.3 5.8 2.8 6.1 5.1 9.3 8.7 7.8 4.8 2.............................................................. 16.2 2.2 0.8 1.3 1.8 2.4 2.7 3.2 1.8 3 or

  5. Buildings Energy Data Book: 2.9 Low-Income Housing

    Buildings Energy Data Book [EERE]

    8 FY 2009 Residential Energy Burdens, by Region (1) Northeast South Midwest West Mean Mdn Mean Mean Mdn Mean Mean Mdn Mean Mean Mdn Mean Indvdl Indvdl Group Indvdl Indvdl Group Indvdl Indvdl Group Indvdl Indvdl Group Total U.S. Households 9.0% 5.4% 3.7% 7.7% 4.7% 3.4% 7.1% 4.4% 3.3% 4.9% 3.0% 2.4% Federally Eligible 16.0% 10.9% 11.9% 15.1% 10.1% 11.2% 13.3% 10.2% 10.3% 9.8% 6.3% 7.3% Federally Ineligible 4.4% 3.9% 3.0% 3.9% 3.4% 2.8% 3.5% 3.0% 2.7% 2.8% 2.3% 2.0% Note(s): Source(s): 1) Data are

  6. Summary Slides of ALS Industry Highlights

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Industry Highlights Print No. Slide Beamline Full Web Highlight ALSNews Volume 18 Collaboration Produces World's Best Metrology Tool 6.1.2 01.27.2016 Vol. 369 17 Takeda Advances Diabetes Research at ALS 5.0.2, 5.0.3 06.02.2015 Vol. 364 16 Metrology for Next-Generation Nanopatterning 7.3.3, 11.0.1 01.28.2015 Vol. 360 15 Caribou Biosciences Has Roots at ALS - 09.24.2014 Vol. 357 13 Lithium-Battery Dendrite Growth: A New View 8.3.2 04.30.2014 Vol. 352 12 IBM Probes Material Capabilities at the ALS

  7. ARM-95-002

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2 Platforms for Ocean Measurements An ARM Notebook of Buoys, Vessels, and Rigs December 1993 COMMENT DRAFT Prepared by Battelle Marine Sciences Laboratory CONTENTS 1 .0 2 .0 3 .0 Introduction 1 1 .1 1 .2 1 .3 Notebook Origin 1 Organization 1 How to Use this Notebook 1 ARM Ocean Site 3 2 .1 2 .2 Planned Sites 3 Measurement Strategies 3 Measurement and Instrument Requirements 5 3 .1 3 .2 3 .3 3 .4 3 .5 3 .6 3 .7 3 .8 3 .9 3 .10 3 .11 Introduction 5 Surface Meteorological Observations 5 Surface

  8. Table HC2.11 Home Electronics Characteristics by Type of Housing Unit, 2005

    Gasoline and Diesel Fuel Update (EIA)

    Million U.S. Housing Units Total................................................................... 111.1 72.1 7.6 7.8 16.7 6.9 Personal Computers Do Not Use a Personal Computer ............... 35.5 17.8 3.1 3.7 7.3 3.6 Use a Personal Computer............................. 75.6 54.2 4.5 4.0 9.4 3.4 Number of Desktop PCs 1.............................................................. 50.3 33.9 3.1 3.0 7.6 2.7 2.............................................................. 16.2 12.7 0.9 0.7 1.4

  9. Table HC9.6 Air Conditioning Characteristics by Climate Zone, 2005

    Gasoline and Diesel Fuel Update (EIA)

    6 Air Conditioning Characteristics by Climate Zone, 2005 Million U.S. Housing Units Total......................................................................... 111.1 10.9 26.1 27.3 24.0 22.8 Do Not Have Cooling Equipment........................... 17.8 3.2 4.7 3.6 5.5 0.9 Have Cooling Equipment........................................ 93.3 7.7 21.4 23.7 18.5 21.9 Use Cooling Equipment......................................... 91.4 7.6 21.0 23.4 17.9 21.7 Have Equipment But Do Not Use

  10. TableHC11.12.xls

    Gasoline and Diesel Fuel Update (EIA)

    15.1 5.5 Personal Computers Do Not Use a Personal Computer.................................. 35.5 6.9 5.3 1.6 Use a Personal Computer.............................................. 75.6 13.7 9.8 3.9 Most-Used Personal Computer Type of PC Desk-top Model......................................................... 58.6 10.4 7.3 3.1 Laptop Model............................................................. 16.9 3.3 2.6 0.7 Hours Turned on Per Week Less than 2

  11. Preliminary Release: April 19, 2012

    U.S. Energy Information Administration (EIA) Indexed Site

    5 Total Square Footage of West Homes, by Housing Characteristics, 2009" " Final" ,,"Total Square Footage" ,"Housing Units1","Total2","Heated","Cooled" "Housing Characteristics","Millions","Billions","Billions","Billions" "Total West",24.8,42.4,34.2,19.9 "West Divisions and States" "Mountain",7.9,15.2,13.4,8.7 "Mountain North",3.9,8.3,7.3,3.6

  12. Percent of Industrial Natural Gas Deliveries in Kansas Represented by the

    U.S. Energy Information Administration (EIA) Indexed Site

    Price (Percent) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 9.2 9.9 10.1 2000's 10.4 9.3 10.8 7.9 6.9 6.3 7.3 5.9 7.8 6.7 2010's 7.0 9.5 9.7 9.3 8.3 NA

  13. Percent of Industrial Natural Gas Deliveries in Washington Represented by

    U.S. Energy Information Administration (EIA) Indexed Site

    the Price (Percent) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 23.5 20.1 24.0 2000's 34.5 38.2 27.4 20.1 17.3 15.8 20.2 17.4 12.9 8.7 2010's 8.3 7.5 7.3 6.7 6.5

  14. Percent of Industrial Natural Gas Deliveries in Florida Represented by the

    U.S. Energy Information Administration (EIA) Indexed Site

    Price (Percent) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2001 6.1 4.5 3.5 4.7 5.9 3.6 1.9 2.9 2.5 2.5 3.3 4.0 2002 4.1 4.5 4.1 3.6 3.5 4.2 3.2 3.5 3.9 3.4 3.8 4.4 2003 4.2 5.9 4.4 3.9 3.5 3.7 3.3 2.6 3.7 3.2 4.4 3.3 2004 4.6 3.8 4.2 3.3 3.3 3.7 2.9 3.2 4.4 3.3 4.1 3.6 2005 2.7 4.1 3.8 3.4 3.1 3.2 3.4 3.5 3.4 3.7 3.5 3.6 2006 3.0 2.8 3.0 2.8 2.3 2.4 5.3 2.9 3.0 2.4 4.2 3.1 2007 2.6 3.1 3.5 2.3 2.9 4.0 2.8 2.6 3.6 2.5 3.7 3.6 2008 2.9 3.3 3.4 2.5 2.9 2.4 2.8 2.5 3.2 3.0 3.3 3.3

  15. Kentucky Natural Gas in Underground Storage - Change in Working Gas from

    U.S. Energy Information Administration (EIA) Indexed Site

    Same Month Previous Year (Percent) Percent) Kentucky Natural Gas in Underground Storage - Change in Working Gas from Same Month Previous Year (Percent) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 1991 36.3 23.0 19.6 25.2 19.8 15.5 10.9 5.6 1.2 -2.7 -5.1 -1.7 1992 5.7 8.9 7.7 -0.9 -5.4 -7.3 -8.9 -10.3 -9.2 2.6 8.5 8.4 1993 3.5 -8.1 -14.7 -13.7 -3.8 4.4 9.2 12.9 14.8 3.2 -1.2 -9.6 1994 -25.7 -31.2 -28.1 -20.1 -13.8 -10.6 -7.3 -4.7 -7.2 -4.8 1.4 4.5 1995 14.0 16.7 18.3 14.2 16.8 12.2

  16. Percent of Industrial Natural Gas Deliveries in Arkansas Represented by the

    U.S. Energy Information Administration (EIA) Indexed Site

    Price (Percent) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2001 6.8 10.0 9.1 4.6 6.6 4.9 5.5 3.8 4.0 5.6 5.3 5.4 2002 6.1 6.1 6.5 5.0 4.1 3.9 5.1 3.8 3.8 5.0 4.8 4.9 2003 5.4 5.9 5.8 4.6 4.0 3.8 4.5 5.2 5.9 6.5 6.2 6.1 2004 6.5 6.8 6.3 5.7 5.1 6.0 5.8 4.4 4.9 7.2 7.0 5.0 2005 5.5 6.2 5.6 5.3 4.7 4.6 4.3 3.8 4.6 6.8 5.5 5.1 2006 5.3 5.7 5.2 4.6 4.0 4.1 3.7 3.3 4.1 5.4 5.5 5.8 2007 4.5 5.6 4.4 4.2 3.8 3.8 3.3 3.4 3.7 4.5 4.5 3.7 2008 4.1 4.6 3.9 4.0 3.1 2.8 3.0 2.9 3.2 4.8 5.4 4.4

  17. Percent of Industrial Natural Gas Deliveries in Wyoming Represented by the

    U.S. Energy Information Administration (EIA) Indexed Site

    Price (Percent) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2001 3.6 3.9 3.7 2.8 1.9 2.1 1.8 2.0 2.0 2.3 2.2 1.8 2002 3.3 3.6 3.6 3.0 3.6 2.4 2.6 2.8 2.8 3.2 2.1 2.5 2003 2.4 2.4 2.1 1.8 1.4 1.4 1.4 1.3 1.4 1.4 2.2 2.0 2004 2.0 1.9 2.2 1.9 1.9 1.9 2.7 1.7 2.3 2.0 2.3 2.4 2005 2.8 5.0 5.8 4.5 4.1 3.5 2.8 2.5 2.5 2.8 4.2 4.4 2006 4.4 4.5 4.2 3.9 3.3 2.7 2.2 2.3 2.8 3.3 3.8 3.7 2007 4.3 4.1 3.4 3.7 2.8 2.0 1.5 1.7 1.9 2.9 3.3 3.3 2008 3.8 3.7 3.9 3.9 2.9 2.1 2.0 1.7 2.5 3.0 3.6 3.9

  18. RAPID/Roadmap/19-NV-b | Open Energy Information

    Open Energy Info (EERE)

    to 19-NV-b.16 - Conduct Required Studies The State Engineer may require hydrological, environmental, or other studies to be conducted before approving an application. The party...

  19. TableHC3.1.xls

    Gasoline and Diesel Fuel Update (EIA)

    78.1 64.1 4.2 1.8 2.3 5.7 Census Region and Division Northeast.................................................... 20.6 13.4 10.4 1.4 1.0 0.3 0.4 New England........................................... 5.5 3.8 3.1 Q 0.3 Q Q Middle Atlantic........................................ 15.1 9.6 7.3 1.3 0.6 Q Q Midwest...................................................... 25.6 19.4 16.9 1.0 0.5 0.4 0.7 East North Central.................................. 17.7 13.6 11.7 0.7 0.5 Q 0.3 West North

  20. TableHC4.13.xls

    Gasoline and Diesel Fuel Update (EIA)

    .. 111.1 33.0 8.0 3.4 5.9 14.4 1.2 Indoor Lights Turned On During Summer Number of Lights Turned On Between 1 and 4 Hours per Day......................... 91.8 26.8 6.7 2.8 4.8 11.7 0.9 1........................................................................ 28.6 10.7 1.9 1.2 2.0 5.2 0.4 2........................................................................ 29.5 9.0 2.4 0.7 1.8 3.7 0.3 3........................................................................ 14.7 3.6 1.1 0.4 0.5 1.5 Q

  1. PowerPoint Presentation

    Gasoline and Diesel Fuel Update (EIA)

    LNG World LNG Imports 1964 - 2007 World LNG Imports 1964 - 2007 0 20 40 60 80 100 120 140 160 180 200 1964 1968 1972 1976 1980 1984 1988 1992 1996 2000 2004 Americas Total Europe Total Asia in mtpa 7.7%pa 2 LNG 0 4 8 12 16 1 9 6 8 1 9 7 3 1 9 7 8 1 9 8 3 1 9 8 8 1 9 9 3 1 9 9 8 2 0 0 3 Algeria Trinidad Egypt Nigeria Eq. Guinea M. East Pacific Basin in mtpa US LNG Imports by Source 1968-2007 US LNG Imports by Source 1968-2007 3 LNG Regional LNG Production 1990 - 2007 Regional LNG Production 1990

  2. S U M M A R I E S U.S. Energy Information Administration | State Energy Data 2013: Prices and Expenditures

    Gasoline and Diesel Fuel Update (EIA)

    6 Table E14. Electric Power Sector Energy Expenditure Estimates, 2013 (Million Dollars) State Coal Natural Gas a Petroleum Nuclear Fuel Biomass Electricity Imports c Total Energy d Distillate Fuel Oil Petroleum Coke Residual Fuel Oil Total Wood and Waste b Alabama 1,367.8 1,382.3 14.0 - - 14.0 352.0 9.2 - 3,125.3 Alaska 28.8 160.6 76.8 - 12.2 89.0 - - (s) 278.4 Arizona 934.4 1,034.6 11.3 - - 11.3 302.7 5.5 1.3 2,289.9 Arkansas 771.5 404.1 8.3 - 1.0 9.2 75.7 3.1 - 1,263.7 California 12.1 3,732.2

  3. Million U.S. Housing Units Total.........................................................................

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    .... 111.1 10.9 26.1 27.3 24.0 22.8 Do Not Have Cooling Equipment........................... 17.8 3.2 4.7 3.6 5.5 0.9 Have Cooling Equipment........................................ 93.3 7.7 21.4 23.7 18.5 21.9 Use Cooling Equipment......................................... 91.4 7.6 21.0 23.4 17.9 21.7 Have Equipment But Do Not Use it........................ 1.9 Q 0.4 0.4 0.6 0.3 Type of Air-Conditioning Equipment 2, 3 Central System..................................................... 65.9 4.8

  4. Appendix A. Reference case projections

    Gasoline and Diesel Fuel Update (EIA)

    U.S. Energy Information Administration | International Energy Outlook 2014 Reference case projections Table A4. World petroleum and other liquids production by region and country, Reference case, 2009-40 (million barrels per day) Region History Projections Average annual percent change, 2010-40 2009 2010 2011 2020 2025 2030 2035 2040 OPEC a 34.1 35.4 35.7 38.7 40.7 44.4 48.2 52.1 1.3 Middle East 23.2 24.3 25.9 27.1 28.8 32.2 35.5 38.8 1.6 North Africa 3.8 3.7 2.4 3.5 3.6 3.7 3.8 4.1 0.3 West

  5. A=16 Nuclides

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    6 Publications: revised manuscripts of: Evaluations PDF HTML TUNL evaluation (1993) A = 16 16He, 16Li, 16Be, 16B, 16C, 16N, 16O, 16F, 16Ne, 16Na, 16Mg, 16Al, 16Si FAS evaluation (1986) A = 16 16He, 16Be, 16B, 16C, 16N, 16O, 16F, 16Ne, 16Na, 16Mg, 16Al, 16Si FAS evaluation (1982) A = 16 16He, 16Be, 16B, 16C, 16N, 16O, 16F, 16Ne FAS evaluation (1977) A = 16 16Be, 16B, 16C, 16N, 16O, 16F, 16Ne FAS evaluation (1971) A = 16 16B, 16C, 16N, 16O, 16F, 16Ne FAS evaluation (1959) A = 16 16N, 16O, 16F

  6. FE LNG Exports-v1-aeo2014_8_29_14.xlsx

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    baseline 12 Bcf 16 Bcf 20 Bcf Alt 20 Bcf baseline 12 Bcf 16 Bcf 20 Bcf baseline 12 Bcf 16 Bcf 20 Bcf baseline 12 Bcf 16 Bcf 20 Bcf baseline 12 Bcf 16 Bcf 20 Bcf NATURAL GAS VOLUMES (Tcf) Net Exports 3.6 5.1 6.1 7.0 6.3 4.9 4.9 5.9 6.8 1.8 4.1 5.0 5.8 3.3 5.0 6.0 7.0 3.2 5.0 6.0 7.0 gross imports 2.2 2.3 2.3 2.3 2.3 2.4 2.5 2.4 2.3 2.6 3.0 3.0 3.1 2.3 2.4 2.4 2.4 2.3 2.4 2.4 2.4 gross exports 5.8 7.5 8.5 9.3 8.6 7.3 7.4 8.3 9.2 4.4 7.0 8.0 8.9 5.6 7.4 8.4 9.3 5.5 7.4 8.4 9.3 Dry Production 32.5

  7. Transforming PV Installations Toward Dispatchable, Schedulable Energy Solutions

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    powergui Discrete, Ts = Ts s. loadpoint A B C N docks A B C N Three-Phase Fault1 A B C Three-Phase Fault A B C D3 A B C N C3+D10 A B C N B6 A B C N AAC 3_336-1.2 _336 1 2 A8,9,11 A B C N A45+LP A B C N A38 A B C N A37+2 A B C N A36+1 A B C N 7825N Ain Bin Cin Aout Bout Cout 7685 Ain Bin Cin Aout Bout Cout 3-1/0 7 3-1/0 6.1 3-1/0 5.2 3-1/0 5 3-1/0 4.3 3-1/0 3.5 3-1/0 2.8 3-1/0 2.6 3-1/0 2.4 3-1/0 1.7 3-1/0 1.4 1960 Ain Bin Cin Aout Bout Cout A750 B750 C750 N750 A B C N A B C N A B C N A B C N A B

  8. Microsoft Word - PDEA Appendix B

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Chairman, Council of Athabascan Governments, and Laurie Thomas, President, Gwitchyaa Zhee Corporation and Subsidiaries. B-7 B-8 B-9 B-10 B-11 B-12 B-13 B-14 B-15 B-16 B-17 B-18

  9. Percent of Industrial Natural Gas Deliveries in Indiana Represented by the

    U.S. Energy Information Administration (EIA) Indexed Site

    Price (Percent) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2001 15.1 14.0 7.1 7.1 4.2 3.7 5.2 1.0 5.5 8.3 6.6 10.2 2002 8.4 8.1 10.1 6.4 5.3 6.2 5.3 5.9 6.6 12.5 12.6 12.4 2003 14.2 12.9 8.9 7.2 7.0 5.9 6.2 5.7 9.3 6.2 11.3 9.3 2004 9.2 8.9 8.9 6.9 6.4 6.2 6.9 6.5 7.3 7.9 10.4 11.6 2005 9.8 7.7 9.6 5.8 6.3 5.5 5.5 6.7 8.2 8.2 10.6 8.9 2006 8.2 9.3 7.4 4.3 7.0 5.0 6.4 5.9 6.3 8.2 8.3 8.4 2007 9.3 9.4 5.8 7.6 6.1 5.5 6.0 5.0 6.9 6.8 9.5 9.1 2008 8.4 7.5 7.0 6.7 5.5 4.5 4.7 4.7 5.3

  10. 2005_Run 3-29-05.xls

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    SLAC Shutdown SSRL 2004-2005 SPEAR RUN SCHEDULE AP 7 14 13 10 11 9 30 27 26 28 24 23 25 30 27 28 26 28 29 31 29 2 1 3 4 3 7 1 8 2 1 1 1 4 1 2 4 6 9 10 11 8 3 12 3 AP 4 1 5 7 5 30 19 20 16 17 14 14 20 19 14 17 2 13 5 30 9 10 9 12 3 13 11 10 12 2 1 2 3 10 6 3 7 5 4 MA 10 11 11 9 7 18 12 15 6 1 3 5 5 4 9 8 9 7 3 13 6 7 15 11 14 12 29 User Conf. 17 25 17 16 23 24 30 27 28 26 29 29 29 31 30 8 2004 2005 31 9 15 13 25 22 11 13 11 12 8 5 3 6 MA 8 13 10 12 11 4 6 5 4 2 2 7 24 23 14 31 29 30 27 29 29 30

  11. Appendix A. Reference case projections

    Gasoline and Diesel Fuel Update (EIA)

    6 Appendix C Table C5. World crude and lease condensate a production by region and country, Low Oil Price case, 2009-40 (million barrels per day) Region History Projections Average annual percent change, 2010-40 2009 2010 2011 2020 2025 2030 2035 2040 OPEC b 31.0 32.0 32.2 39.0 44.2 49.9 54.8 60.2 2.1 Middle East 20.8 21.7 23.0 27.1 31.0 35.3 39.3 43.6 2.3 North Africa 3.3 3.2 2.0 3.2 3.4 3.6 3.8 4.1 0.8 West Africa 4.1 4.4 4.3 5.4 6.0 6.7 7.0 7.3 1.7 South America 2.8 2.7 2.8 3.3 3.7 4.2 4.6

  12. Minnesota Natural Gas in Underground Storage - Change in Working Gas from

    U.S. Energy Information Administration (EIA) Indexed Site

    Same Month Previous Year (Percent) Percent) Minnesota Natural Gas in Underground Storage - Change in Working Gas from Same Month Previous Year (Percent) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 1991 -9.2 15.0 -0.3 -19.3 -19.7 -9.3 -1.7 -4.1 -2.7 -5.2 -8.5 6.3 1992 8.7 18.6 1.8 -25.1 -13.0 -11.2 -9.4 -1.0 0.5 1.8 5.3 -1.4 1993 1.3 -17.1 -29.0 -19.2 -19.0 -13.4 -5.9 -7.8 -2.5 1.2 -1.7 -7.0 1994 -16.3 -4.2 19.8 7.9 8.4 10.5 6.2 9.4 4.5 0.7 3.9 16.7 1995 23.8 4.8 -0.7 11.5 6.8 -3.5

  13. Indiana Natural Gas in Underground Storage - Change in Working Gas from

    U.S. Energy Information Administration (EIA) Indexed Site

    Same Month Previous Year (Percent) Percent) Indiana Natural Gas in Underground Storage - Change in Working Gas from Same Month Previous Year (Percent) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 1991 11.0 5.4 -3.6 -8.8 -7.2 -9.9 -4.3 -0.2 0.9 13.4 2.4 -1.7 1992 -6.0 -4.2 -10.1 -9.5 -13.2 -4.2 4.7 1.9 3.9 -7.0 -6.5 -3.1 1993 1.6 -1.2 8.3 19.7 17.1 12.0 6.3 7.0 2.7 -1.9 -0.1 3.1 1994 -0.3 7.7 13.2 1.4 -4.7 -2.3 0.9 -0.1 -0.7 3.7 11.3 11.2 1995 17.4 9.6 8.0 8.6 11.8 7.0 -3.4 -5.3 -3.3

  14. Buildings Energy Data Book: 3.3 Commercial Sector Expenditures

    Buildings Energy Data Book [EERE]

    5 2015 Commercial Energy End-Use Expenditure Splits, by Fuel Type ($2010 Billion) (1) Natural Petroleum Gas Distil. Resid. LPG Oth(2) Total Coal (3) Electricity Total Percent Lighting 28.4 28.4 16.3% Space Heating 14.6 2.9 1.3 0.1 4.3 0.1 4.7 23.7 13.6% Ventilation 15.1 15.1 8.6% Space Cooling 0.3 14.2 14.5 8.3% Refrigeration 9.9 9.9 5.7% Electronics 8.8 8.8 5.1% Water Heating 4.1 0.7 0.7 2.5 7.3 4.2% Computers 5.3 5.3 3.0% Cooking 1.7 0.6 2.3 1.3% Other (4) 2.9 0.3 3.7 1.4 5.4 22.8 31.1 17.8%

  15. Buildings Energy Data Book: 3.6 Office Building Markets and Companies

    Buildings Energy Data Book [EERE]

    8 Energy Benchmarks for Existing Large Office Buildings, by Selected City and End-Use (thousand Btu per square foot) IECC Post Pre Post Pre Post Pre Post Pre Miami 1A 0.3 0.8 21.9 24.5 0.3 0.2 3.1 3.5 Houston 2A 4.2 4.4 17.7 20.9 0.3 0.3 2.8 3.3 Phoenix 2B 3.0 3.3 16.2 18.3 0.3 0.3 3.2 3.7 Atlanta 3A 6.9 8.5 14.1 17.5 0.4 0.4 2.6 3.2 Los Angeles 3B 2.8 2.9 11.9 13.0 0.4 0.4 2.5 2.7 Las Vegas 3B 4.6 4.7 10.8 13.0 0.3 0.3 2.7 3.3 San Francisco 3C 5.0 6.4 5.6 6.6 0.4 0.4 1.8 2.1 Baltimore 4A 9.8

  16. Buildings Energy Data Book: 3.7 Retail Markets and Companies

    Buildings Energy Data Book [EERE]

    1 2010 Top Retail Companies, by Sales # Stores % Change over Chain ($billion) 2009 Revenues 2010 2009 Stores Wal-Mart Stores, Inc. 419.0 3.4% 8,970 6.0% The Kroger Co. 82.2 7.1% 3,605 -0.4% Costco 76.3 9.1% 572 1.1% The Home Depot 68.0 2.8% 2,248 0.2% Walgreen Co. 67.4 6.4% 8,046 7.3% Target Corp. 67.4 3.1% 1,750 0.6% CVS Caremark 57.3 3.6% 7,182 2.2% Best Buy 50.3 1.2% 4,172 3.7% Lowes Cos. 48.8 3.4% 1,749 2.3% Sears Holdings 43.3 -1.6% 4,038 2.2% Source(s): 2010 Revenues % Change over Chain

  17. Buildings Energy Data Book: 3.7 Retail Markets and Companies

    Buildings Energy Data Book [EERE]

    5 Energy Benchmarks for Existing Retail Buildings, by Selected City and End-Use (thousand Btu per square foot) IECC Post Pre Post Pre Post Pre Miami 1A 0.5 0.7 23.0 25.2 14.3 16.1 Houston 2A 11.6 12.4 16.2 18.9 14.6 16.9 Phoenix 2B 8.3 10.2 17.2 21.3 14.2 17.5 Atlanta 3A 24.9 26.2 9.2 11.2 15.1 17.4 Los Angeles 3B 6.9 7.7 3.3 3.9 13.4 14.1 Las Vegas 3B 15.4 17.9 11.6 14.8 12.7 16.9 San Francisco 3C 22.4 22.5 0.7 1.0 10.6 12.1 Baltimore 4A 43.0 46.9 6.2 7.9 13.3 16.2 Albuquerque 4B 30.2 33.8 5.3

  18. Buildings Energy Data Book: 5.8 Active Solar Systems

    Buildings Energy Data Book [EERE]

    8 Annual New Installations of Grid-Tied Photovoltaic Cells and Modules, by Market (MW) Peak Capacity by Use 2004 2005 2006 2007 2008 2009 2010 Residential 23.4 26.2 36.3 55.9 74.5 150.4 260.9 Non-Residential 30.6 49.0 64.2 96.5 202.4 202.4 343.8 Utility 1.8 0.6 0.2 8.7 21.3 66.6 286.0 Unknown 1.8 3.2 4.0 7.7 12.7 17.7 3.7 Total New Capacity 57.6 79.0 104.7 168.8 310.9 437.1 894.4 Cumulative Capacity 155.1 234.2 338.9 507.7 818.6 Number of Installations 6,873 7,718 Source(s): Sherwood, Larry.

  19. Any Refrig-

    U.S. Energy Information Administration (EIA) Indexed Site

    .........",297,296,283,239,90,219,118,53 "Health Care ......",129,116,23,14,7,... Complex ..",195,131,25,"Q","Q",18,124,19 "Health Care Complex ......",39,32,11,8,3,8,3...

  20. TUNL Nuclear Data Project, HTML Project

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    B 16B is available in the following: HTML for 16B: (1971AJ02), (1977AJ02), (1982AJ01), (1986AJ04), (1993TI07) A = 16 is available for the following: Energy Level Diagrams for A = 16 A = 16 Tables A = 16 References PDF Documents for A = 16 Errata for A = 16 - 17 publications Last modified on 27 May 2015

  1. Microsoft Word - FEA Appendix B

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Athabascan Governments, and Laurie Thomas, President, Gwitchyaa Zhee Corporation and Subsidiaries. B-7 B-8 B-9 B-10 B-11 B-12 B-13 B-14 B-15 B-16 B-17 B-18 B-19 B-20 B-21 B-22 ...

  2. High-pressure single-crystal elasticity study of CO{sub 2} across phase I-III transition

    SciTech Connect (OSTI)

    Zhang, Jin S. Bass, Jay D.; Shieh, Sean R.; Dera, Przemyslaw; Prakapenka, Vitali

    2014-04-07

    Sound velocities and elastic moduli of solid single-crystal CO{sub 2} were measured at pressures up to 11.7(3) GPa by Brillouin spectroscopy. The aggregate adiabatic bulk modulus (K{sub S}), shear modulus (G), and their pressure derivatives for CO{sub 2} Phase I are K{sub S0}?=?3.4(6) GPa, G{sub 0}?=?1.8(2) GPa, (dK{sub S}/dP){sub 0}?=?7.8(3), (dG/dP){sub 0}?=?2.5(1), (d{sup 2}K{sub S}/dP{sup 2}){sub 0}?=??0.23(3) GPa{sup ?1}, and (d{sup 2}G/dP{sup 2}){sub 0}?=??0.10(1) GPa{sup ?1}. A small increase of elastic properties was observed between 9.8(1) and 10.5(3) GPa, in agreement with the CO{sub 2} I-III transition pressure determined from previous x-ray diffraction experiments. Above the transition pressure P{sub T}, we observed a mixture dominated by CO{sub 2}-I, with minor CO{sub 2}-III. The CO{sub 2}-I + III mixture shows slightly increased sound velocities compared to pure CO{sub 2}-I. Elastic anisotropy calculated from the single-crystal elasticity tensor exhibits a decrease with pressure beginning at 7.9(1) GPa, which is lower than P{sub T}. Our results coincide with recent X-ray Raman observations, suggesting that a pressure-induced electronic transition is related to local structural and optical changes.

  3. DUST AND GAS IN THE MAGELLANIC CLOUDS FROM THE HERITAGE HERSCHEL KEY PROJECT. I. DUST PROPERTIES AND INSIGHTS INTO THE ORIGIN OF THE SUBMILLIMETER EXCESS EMISSION

    SciTech Connect (OSTI)

    Gordon, Karl D.; Roman-Duval, Julia; Meixner, Margaret; Bot, Caroline; Babler, Brian; Bernard, Jean-Philippe; Bolatto, Alberto; Jameson, Katherine; Boyer, Martha L.; Clayton, Geoffrey C.; Engelbracht, Charles; Fukui, Yasuo; Galametz, Maud; Galliano, Frederic; Hony, Sacha; Lebouteiller, Vianney; Indebetouw, Remy; Israel, Frank P.; Kawamura, Akiko; and others

    2014-12-20

    The dust properties in the Large and Small Magellanic clouds (LMC/SMC) are studied using the HERITAGE Herschel Key Project photometric data in five bands from 100 to 500?m. Three simple models of dust emission were fit to the observations: a single temperature blackbody modified by a power-law emissivity (SMBB), a single temperature blackbody modified by a broken power-law emissivity (BEMBB), and two blackbodies with different temperatures, both modified by the same power-law emissivity (TTMBB). Using these models, we investigate the origin of the submillimeter excess, defined as the submillimeter emission above that expected from SMBB models fit to observations <200 ?m. We find that the BEMBB model produces the lowest fit residuals with pixel-averaged 500?m submillimeter excesses of 27% and 43% for the LMC and SMC, respectively. Adopting gas masses from previous works, the gas-to-dust ratios calculated from our fitting results show that the TTMBB fits require significantly more dust than are available even if all the metals present in the interstellar medium (ISM) were condensed into dust. This indicates that the submillimeter excess is more likely to be due to emissivity variations than a second population of colder dust. We derive integrated dust masses of (7.3 1.7) 10{sup 5} and (8.3 2.1) 10{sup 4} M {sub ?} for the LMC and SMC, respectively. We find significant correlations between the submillimeter excess and other dust properties; further work is needed to determine the relative contributions of fitting noise and ISM physics to the correlations.

  4. Percent of Industrial Natural Gas Deliveries in Ohio Represented by the

    U.S. Energy Information Administration (EIA) Indexed Site

    Price (Percent) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2001 13.1 9.8 10.4 6.2 3.9 3.4 1.5 4.8 1.2 2.9 5.6 6.4 2002 5.4 6.2 5.4 4.8 1.9 1.7 1.6 2.1 2.5 2.3 4.9 6.7 2003 6.3 7.0 5.4 4.0 1.8 2.4 2.0 1.7 1.7 2.4 3.3 4.6 2004 5.1 5.7 4.0 3.8 2.1 2.3 1.7 2.3 2.2 2.7 3.4 4.5 2005 5.7 6.6 4.5 2.6 2.0 1.6 2.1 2.0 1.9 2.6 3.3 4.8 2006 4.6 4.7 4.0 2.7 2.1 2.2 2.2 2.1 2.2 2.2 3.0 3.5 2007 3.9 4.8 3.5 2.6 1.8 1.8 1.9 1.4 1.5 1.2 2.2 3.7 2008 3.9 4.2 3.5 2.5 1.1 1.7 1.9 1.4 1.4 1.6 2.7 4.1

  5. CED

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ... &17;&16;&19;&18;&21;&20;&23;&22;&25;&24; "B&16;&19;&18; &%&24;0t )&'G1gg&@&24;HG I &16;&19;&18;@9TiG&17;VlWP&18;"PY aIbI3&18;'cXAC ... 3&16;&19;4cb%4&16;&17;0gg%v"4&16;e&21;)&19;49b)3p02"9b b ...

  6. Ensuring Project Success - The Fundamental Art of Managing the...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Ensuring Project Success - The Fundamental Art of Managing the Interfaces August 2009 Presenter: Jeff Smith, Deputy for Operations, Oak Ridge National Laboratory Track 8-3 Topics ...

  7. Sabien Technology Group Plc | Open Energy Information

    Open Energy Info (EERE)

    Sabien Technology Group Plc Jump to: navigation, search Name: Sabien Technology Group Plc Place: Manchester, England, United Kingdom Zip: SK8 3GP Product: Sabien builds and...

  8. Energy Information Administration - Commercial Energy Consumption...

    U.S. Energy Information Administration (EIA) Indexed Site

    500,000 ... 8 3 1 Q Q 3 Q Principal Building Activity Education ... 386 360 21 Q N N N Food Sales...

  9. BPA-2011-01861-FOIA Response

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Scintillation Frame Testing (Absolute Flow) - Scott Bennett, Dan Ramirez, Dan Patla 8. 3D CAM Operation Surveys - Dan Ramirez 9. Chief Joseph Flow Meter Data to GDACS - Scott...

  10. Rugged Renewables EMAT Inc | Open Energy Information

    Open Energy Info (EERE)

    EMAT Inc Jump to: navigation, search Name: Rugged Renewables EMAT Inc Address: Unit 3 Gear House Saltmeadows Road Place: Gateshead Zip: NE8 3AH Region: United Kingdom...

  11. EIA - Household Transportation report: Household Vehicles Energy...

    U.S. Energy Information Administration (EIA) Indexed Site

    National Research Council, Effectiveness and Impact of Corporate Average Fuel Economy (CAFE) Standards (Washington, DC: National Academy of Sciences, 2002), p. 85. 4 8.3 million...

  12. Lysanda Limited | Open Energy Information

    Open Energy Info (EERE)

    CM8 3GA Product: US-based vehicle engineering consultancy with a technology capable of playing a role in vehicle emissions management. References: Lysanda Limited1 This...

  13. ALSNews Vol. 311

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    radiation microtomography at ALS Beamline 8.3.2, researchers investigated changes in crack path and toughening mechanisms in human cortical bone with increased exposure to...

  14. app_b

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    risk, environmental justice, managerial risk (political acceptability), and tech- nology issues. B.8.3.3 Evaluation of Treatment Technologies and Options During the...

  15. Climate Energy | Open Energy Information

    Open Energy Info (EERE)

    Climate Energy Jump to: navigation, search Name: Climate Energy Place: Witham, England, United Kingdom Zip: CM8 3UN Sector: Efficiency Product: Essex, UK, based provider of advice...

  16. Federal Buildings Supplemental Survey 1993

    U.S. Energy Information Administration (EIA) Indexed Site

    Activity Education ... 8 3 2 3 598 333 296 333 Health Care ... 41 20 18 16 14,559 12,538 12,365 11,551...

  17. ALSNews Vol. 316

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    These enzymes are also exploited clinically as targets of antibiotics and anticancer therapeutics. Researchers at ALS Beamline 8.3.1 have created a new molecular model...

  18. X:\\L6046\\Data_Publication\\Pma\\current\\ventura\\pma.vp

    U.S. Energy Information Administration (EIA) Indexed Site

    1999 January ... 12.7 13.0 25.6 21.2 8.2 55.0 3.7 3.8 6.6 2.7 - 9.3 February ... 13.3 13.6 27.3 23.1 8.2 58.7 3.7 3.7 7.0 2.9 W 10.0 March...

  19. Hoisting and Rigging Technical Advisory Committee | Department...

    Energy Savers [EERE]

    of hoisting and rigging safety-related issues; or 3.7.3 Research available literature and develop recommended solutions for DOE unique situations where little or no...

  20. Search for: All records | SciTech Connect

    Office of Scientific and Technical Information (OSTI)

    ... Masahito ; Shirouzu, Mikako ; Takemoto, Chie ; Yokoyama, Shigeyuki ; Department of Biophysics and Biochemistry, Graduate School of Science, The University of Tokyo, 7-3-1 Hongo, ...

  1. Hillsboro Alternative Energy Fund | Open Energy Information

    Open Energy Info (EERE)

    Alternative Energy Fund Jump to: navigation, search Name: Hillsboro Alternative Energy Fund Place: London, England, United Kingdom Zip: SW7 3SS Product: A hedge fund concentrating...

  2. Chapter 7 - Acquisition Planning | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Sourcing Requirements - Update May 2014 PDF icon 7.3 - Acuqisition Planning in the M&O Environment More Documents & Publications Policy Flash 2015-13 ACQUISITION PLANNING ...

  3. 2004 - 06 | Jefferson Lab

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    June 2004 Tue, 06/15/2004 - 2:00pm Jefferson Lab awards $7.3 million construction contract to Chesapeake firm

  4. Order 580.1D

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    580.1D Title: PERSONAL PROPERTY MANAGEMENT Owner: Thomas Wilson, Jr., Office of Institutional Operations Approving Official: Bradley J. Tomer, Chief Operating Officer, Office of the Director {signature} /s/ Bradley J. Tomer Approval Date: 8/3/12 Last Reviewed Date: 8/3/12 Cancellation: Order 580.1C, Personal Property Management TABLE OF CONTENTS 1. PURPOSE ..................................................................................................................................... 2 2.

  5. X:\\L6046\\Data_Publication\\Pma\\current\\ventura\\pma.vp

    U.S. Energy Information Administration (EIA) Indexed Site

    38.4 242.3 8.3 8.4 6.5 13.4 - 19.9 2002 ... 46.2 47.4 46.9 163.0 39.2 249.2 8.3 8.5 7.4 13.4 - 20.8 See footnotes at end of table. 14 Energy...

  6. TOTAL WORKFORCE Males

    National Nuclear Security Administration (NNSA)

    Females Male Female Male Female Male Female Male Female Male Female 0 0 1 2 0 0 0 1 6 2 PAY PLAN SES 2 EN 03 1 NQ (Prof/Tech/Admin) 7 GS 15 1 GS 14 1 DIVERSITY 12 7 58.3% American Indian Alaska Native African American Asian American Pacific Islander Hispanic White 41.7% Associate Administrator of External Affairs (NA-EA) As of September 5, 2015 SES EN 03 NQ GS 15 GS 14 16.7% 8.3% 58.3% 8.3% 8.3% 0.0% 0.0% 8.3% 16.7% 0.0% 0.0% 0.0% 8.3% 50.0% 16.7% Prepared by NNSA Office of Civil Rights

  7. Table 4

    U.S. Energy Information Administration (EIA) Indexed Site

    ght... 16.6 0.7 3.3 5.1 2.6 1.7 1.6 1.7 8.87 Automatic Control... 18.2 0.3 2.2 4.7 3.3 2.5 2.3 2.9 8.90 High...

  8. untitled

    U.S. Energy Information Administration (EIA) Indexed Site

    1,519.2 43,169.0 31,921.8 181,170.4 35,284.7 3,695.7 3,730.6 1,312.7 9,777.3 - February ... 41,542.9 43,193.4 33,387.5 190,746.6 32,975.4 3,638.9...

  9. A=16-17, 1993 evaluation

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    6 - 17 (1993TI07) (Revised Manuscript from 1993) An evaluation of A = 16 - 17 was published in Nuclear Physics A564 (1993) p.1. The version here lacks the introduction and overview tables that appeared in the full version, and is arranged in a different manner. The figures are now present in the pdf documents, and are also available elsewhere on this server (see below). PDF HTML Figures A = 16 16He, 16Li, 16Be, 16B, 16C, 16N, 16O, 16F, 16Ne, 16Na, 16Mg, 16Al, 16Si A = 16 A = 17 17He, 17Li, 17Be,

  10. Table 18. Total Delivered Commercial Energy Consumption, Projected vs. Actual

    Gasoline and Diesel Fuel Update (EIA)

    Total Delivered Commercial Energy Consumption, Projected vs. Actual Projected (quadrillion Btu) 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 AEO 1994 6.8 6.9 6.9 7.0 7.1 7.1 7.2 7.2 7.3 7.3 7.4 7.4 7.4 7.5 7.5 7.5 7.5 7.6 AEO 1995 6.9 6.9 7.0 7.0 7.0 7.1 7.1 7.1 7.1 7.1 7.2 7.2 7.2 7.2 7.3 7.3 7.3 AEO 1996 7.1 7.2 7.2 7.3 7.3 7.4 7.4 7.5 7.6 7.6 7.7 7.7 7.8 7.9 8.0 8.0 8.1 8.2 8.2 AEO 1997 7.4 7.4 7.4 7.5 7.5 7.6 7.7 7.7 7.8 7.8 7.9 7.9

  11. Word Pro - S7

    Gasoline and Diesel Fuel Update (EIA)

    3 Table 7.3a Consumption of Combustible Fuels for Electricity Generation: Total (All Sectors) (Sum of Tables 7.3b and 7.3c) Coal a Petroleum Natural Gas f Other Gases g Biomass Other j Distillate Fuel Oil b Residual Fuel Oil c Other Liquids d Petroleum Coke e Total e Wood h Waste i Thousand Short Tons Thousand Barrels Thousand Short Tons Thousand Barrels Billion Cubic Feet Trillion Btu 1950 Total .................... 91,871 5,423 69,998 NA NA 75,421 629 NA 5 NA NA 1955 Total ....................

  12. Before the Senate Homeland Security and Governmental Affairs...

    Energy Savers [EERE]

    Office of Procurement and Assistance Management, Office of Management Subject: Cost-Plus Award Fee PDF icon 8-3-09FinalTestimony(Simpson).pdf More Documents & Publications...

  13. Principal Characteristics of a Modern Grid

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Proposition Cost to Modernize 165B over 20 years 127B for Distribution 38B for Transmission 8.3B per year (incremental to business-as-usual) Current annual investment - 18B...

  14. V-139: Cisco Network Admission Control Input Validation Flaw...

    Broader source: Energy.gov (indexed) [DOE]

    PROBLEM: Cisco Network Admission Control Input Validation Flaw Lets Remote Users Inject SQL Commands PLATFORM: Cisco NAC Manager versions prior to 4.8.3.1 and 4.9.2 ABSTRACT: A...

  15. --No Title--

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    Q Q Q Q Q Q Q Q Buildings without Cooling ... 4 3 Q 920 935 1,598 3.8 3.3 7.7 Water-Heating Energy Sources Electricity ... 15 42 57...

  16. Natural Gas Weekly Update

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Inc. and the U.S. subsidiary of Nexen of 8.3 million, the highest bid during the sale. Top bidders included several independent oil and gas companies such as Kerr-McGee...

  17. Natural Gas Weekly Update, Printer-Friendly Version

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    Inc. and the U.S. subsidiary of Nexen of 8.3 million, the highest bid during the sale. Top bidders included several independent oil and gas companies such as Kerr-McGee...

  18. School Energy Survey Teacher Guide

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Key Student Guide Page 20 INCANDESCENT BULB HALOGEN COMPACT FLUORESCENT (CFL) LIGHT EMITTING DIODE (LED) Number of bulbs to get 25,000 hours 25 8.3 2.5 1 Cost of bulbs for 25,000...

  19. " Million Housing Units, Final...

    U.S. Energy Information Administration (EIA) Indexed Site

    ... Thermostat" "Adjusts Temperature During Day" "When No One is Home" "Yes",19.1,2.5,4.5,7.9,4.3 "No",13.3,1.8,3.6,5.3,2.7 "Adjusts Temperature During " "Sleeping Hours" ...

  20. " Million Housing Units, Final...

    U.S. Energy Information Administration (EIA) Indexed Site

    ... of Programmable Thermostat" "Reduces Temperature During Day" "Yes",22.1,8,5.8,3.3,3.4,1.5 "No",19.6,7,5.4,2.9,3,1.2 "Reduces Temperature During " "Sleeping Hours" ...

  1. " Million Housing Units, Final...

    U.S. Energy Information Administration (EIA) Indexed Site

    ... of Programmable Thermostat" "Reduces Temperature During Day" "Yes",22.1,3.9,7.1,3.9,4.2,3 "No",19.6,4.2,6.8,3.2,2.9,2.4 "Reduces Temperature During " "Sleeping Hours" ...

  2. Search for: All records | SciTech Connect

    Office of Scientific and Technical Information (OSTI)

    (1) gravitation (1) gravitons (1) luminosity (1) neutron stars (1) polarization (1) ... and assuming a broad fan-like beam a luminosity of 8.3 x 10sup 34 erg ssup -1 and ...

  3. Discovery of Pulsations from the Pulsar J0205 6449 in SNR 3C...

    Office of Scientific and Technical Information (OSTI)

    and assuming a broad fan-like beam a luminosity of 8.3more x 10sup 34 erg ssup ... AND FIELDS; AMPLITUDES; EFFICIENCY; LUMINOSITY; PHOTONS; PULSARS; PULSATIONS; STARS; ...

  4. Acting Deputy Secretary of Energy to Participate in London Energy...

    Broader source: Energy.gov (indexed) [DOE]

    proposed partnership jointly developed by the Group of Eight, People's Republic of China, India and the Republic of Korea (G8+3) energy ministers to provide a forum for...

  5. Size effects in the thermal conductivity of gallium oxide (?...

    Office of Scientific and Technical Information (OSTI)

    2Osub 3 grown via this technique (8.8 3.4 W msup -1 Ksup -1) and large mean free paths compared to typical gate dielectrics commonly used in GaN device contacts. By...

  6. untitled

    U.S. Energy Information Administration (EIA) Indexed Site

    204.8 3,881.7 See footnotes at end of table. Energy Information AdministrationPetroleum Marketing Annual 2008 317 Table 43. Refiner No. 2 Distillate and Fuel Oil Volumes by PAD...

  7. PP-48-3 El Paso Eelctric Company | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    8-3 El Paso Eelctric Company PP-48-3 El Paso Eelctric Company Presidential Permit authorizing El Paso Eelctric Company to construct, operate, and maintain electric transmission...

  8. Beryllium-Associated Worker Registry Data Collection and Management...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ... operation, maintenance, or decommissioning, and which may involve one DOE ... by site) DOE-STD-1187-2007 8 3. *Status Code N New record, D Delete record 4. ...

  9. Microsoft Word - q408.doc

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    relative to the fourth-quarter average for 2003-2007. Return on sales (net income revenue) decreased from 8.3 percent in the fourth quarter of 2007 to 2.5 percent in the...

  10. Mah Presentation

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Surrow (Temple University) using NLO perturbative QCD calculations showed that di- jets located at forward rapidity (2.8 < < 3.7) with transverse momenta of 5 and 8 GeV...

  11. NASEO 2010 Winter Fuels Outlook Conference October 13, 2010...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    warmer than forecast If 10% colder than forecast Heating oil 12 0 25 Natural gas 4 -7 12 Propane 8 -3 18 Electricity -2 -6 2 Average of all fuels 3 -6 10 Source: EIA Short-Term...

  12. " by Census Region, Census Division...

    U.S. Energy Information Administration (EIA) Indexed Site

    ... Heating and Cooling Operations and Minimal Energy Use",121,32,33,40,16," W "," W ... Heating and Cooling Operations and Minimal Energy Use",8,3,2,1,2,0,3,2,0,0,1,0,0,2,4...

  13. COMET TA Floor Plan 100225.vc6

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    West Hall Door Emg Exit W Trench Room 1107 S Structural Beam Rack Argus Chamber Interaction Chamber Work Station 8 3 0 2 - V B L as phere CL 420mm f rom N i nner wall. Lens h...

  14. Additive Manufacturing: Pursuing the Promise

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    ... 57, no. 1 (2008): 5-8. 3 The Economist, "The Printed World: Three- dimensional printing from digital designs," 10 February 2011. www.economist.com node18114221 Thin metal ...

  15. 2014 Wind Market Report | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    4 Wind Market Report 2014 Wind Market Report Addthis 1 of 8 2 of 8 3 of 8 4 of 8 5 of 8 6 of 8 7 of 8 8 of 8

  16. untitled

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    2.4 395.1 39,378.3 15,202.9 236.6 2,326.5 279.4 1,832.8 3,308.2 48,591.7 February ... 73.3 367.3 40,530.5 15,923.9 229.8 3,294.8 287.8 1,820.9 4,299.7...

  17. Presentations

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Research | Plans for NERSC's New Building February 3, 2012 | Author(s): Howard Walter, NERSC | Download File: CRT-NUG-120203.pdf | pdf | 7.3 MB User Requirements Gathered...

  18. X:\\L6046\\Data_Publication\\Pma\\current\\ventura\\pma.vp

    U.S. Energy Information Administration (EIA) Indexed Site

    per Day Motor Gasoline No. 2 Distillate Residual Fuel Oil Figure 5. U.S. Refiner Wholesale Petroleum Product Volumes Propane 7.3% Kero-jet 2.4% Residual Fuel Oil 1.3% Other...

  19. New Morphological Paradigm Uncovered in Organic Solar Cells

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    spectroscopy and scattering studies conducted by North Carolina State University and Cambridge University researchers at ALS Beamlines 5.3.2 and 7.3.3 found a substantial amount...

  20. U-247: EMC Cloud Tiering Appliance Flaw Lets Remote Users Bypass...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    CTA 7.3.1 and later with Hotfix ESA-2012-034 Addthis Related Articles V-045: Adobe ColdFusion Lets Local Users Bypass Sandbox Restrictions V-036: EMC Smarts Network...

  1. Feb

    Office of Scientific and Technical Information (OSTI)

    JAXA, 3-1-1 Yoshinodai, Chuo-ku, Sagamihara, Kanagawa 252-5210, Japan 2 Department of Physics, Graduate School of Science, University of Tokyo, Hongo 7-3-1, Bunkyo, Tokyo...

  2. X:\\L6046\\Data_Publication\\Pma\\current\\ventura\\pma.vp

    U.S. Energy Information Administration (EIA) Indexed Site

    14,123.1 17,492.6 March ... 219.8 - 1,810.8 2,030.7 3,263.8 - 14,671.6 17,935.4 April ... 201.2 - 1,777.9...

  3. RAPID/Roadmap/7 (1) | Open Energy Information

    Open Energy Info (EERE)

    including a PPA for new QFs under 20 MW. 7.3 to 7.4 - Is the Facility an Independent Power Producer That Exclusively Sells to Wholesale Customers? Independent power producers...

  4. Direct-Write of Silicon and Germanium Nanostructures

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    electron microscopes at ALS Beamlines 7.3.1 and 11.0.1. From Sand to Processor Modern electronic integrated circuits are made of silicon. Silicon is the most abundant element...

  5. Slide 1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Wtd. Avg. Int. 7.4% Bureau of Reclamation Appropriations 510 Wtd. Avg. Int. 7.1% Power Marketing Transmission Bonds Issued to Treasury 1,854 Wtd. Avg. Int. 7.3% Bureau of...

  6. FY 2009 Summary Table by Organization

    Office of Environmental Management (EM)

    -34,411 -36,932 -2,521 -7.3% Total, Discretionary Funding... 23,754,228 23,884,824 25,014,956 +1,130,132 +4.7% FY 2009 vs. FY 2008...

  7. Significantly Shorter Fe-S Bond in Cytochrome P450-I is Consistent...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    analyzed at Beam Line 7-3 at SSRL. Extended x-ray absorption fine structure (EXAFS) studies on multiple sets of samples revealed that the Fe-S bond in P450-I was in fact 0.09 ...

  8. Microsoft Word - P450-I bh

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    analyzed at Beam Line 7-3 at SSRL. Extended x-ray absorption fine structure (EXAFS) studies on multiple sets of samples revealed that the Fe-S bond in P450-I was in fact 0.09 ...

  9. Document Information

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ... and it is dependent upon when Bechtel Hanford, Inc., prepares a schedule for sending waste. ... Name Org anization Phone 'PN A4 k - C'z 2AA2 WC -726 7&- 3 ...

  10. Weekly Petroleum Status Report

    U.S. Energy Information Administration (EIA) Indexed Site

    ... Refiner and Blender Net Production Finished Motor Gasoline 3 ...... 9,683 10,015 -332 9,024 7.3 9,000 7.6 9,653 9,367 3.1 Finished Motor Gasoline ...

  11. Word Pro - S8.lwp

    U.S. Energy Information Administration (EIA) Indexed Site

    2. * Net generation of electricity includes pumped storage ... Sources: U.S. Energy Information Administration, Monthly Energy Review (March 2015), Tables 7.1, 7.2a, 7.3a, 7.6, ...

  12. Word Pro - S7

    U.S. Energy Information Administration (EIA) Indexed Site

    4 U.S. Energy Information Administration Monthly Energy ... Table 7.3b Consumption of Combustible Fuels for Electricity ... 50,537 7,849 29 220 266 127 2015 January ......

  13. SSRL Beam Lines by Technique | Stanford Synchrotron Radiation...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Beam Lines by Number | SPEAR3 Parameters Supported Technique(s) Beam Line X-ray Absorption Spectroscopy Biological x-ray absorption spectroscopy 2-2, 4-3, 7-3, 9-3, 14-3...

  14. Annual Energy Review 1998

    Gasoline and Diesel Fuel Update (EIA)

    87 Diagram 4. Coal Flow, 1998 (Million Short Tons) Notes Data are preliminary. Totals may not e ual sum of components due to independent rounding. Sources Tables 7.1, 7.2, and 7.3....

  15. Microsoft Word - M127 Word.doc

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7 3. EFFECTIVE DATE (MDY) See Block 16C 4. REQUISITIONPURCHASE REQ. NO. 5. PROJECT NO. (If applicable) 6. ISSUED BY CODE 7. ADMINISTERED BY (If other than Item 6) CODE U.S....

  16. Microsoft Word - SF30_A007 _2_.doc

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7 3. EFFECTIVE DATE (MDY) See Block 16C 4. REQUISITIONPURCHASE REQ. NO. 5. PROJECT NO. (If applicable) 6. ISSUED BY CODE 7. ADMINISTERED BY (If other than Item 6) CODE U.S....

  17. A REVIEW OF THORIUM FUEL REPROCESSING EX

    Office of Scientific and Technical Information (OSTI)

    f - 7 - 3 A REVIEW OF THORIUM FUEL REPROCESSING EX n ERIENCE R. E. Brooksbank W. T. McDuffee R. H. Rainey Oak Ridge National Laboratory* Oak Ridge, Tennessee 37830 - NOTICE - This...

  18. Fermilab | Tevatron | Tevatron Symposium | Agenda

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Technology Facilities Council Download PDF (1.5 MB) | Download PPT (7.3 MB) On the Large Hadron Collider Rolf-Dieter Heuer, CERN Download PDF (2.4 MB) | Download PPT (9.9 MB) ...

  19. Python on Genepool

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Python on Genepool Python on Genepool Using Python on Genepool There are two major branches of Python supported on genepool: python 2.7.3 and python 3.2.3. These packages are...

  20. Open Issues

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Open Issues Open Issues MPI errors from cray-mpich7.3.0 January 6, 2016 by Ankit Bhagatwala A change in the MPICH2 library that now strictly enforces non-overlapping buffers in...

  1. untitled

    U.S. Energy Information Administration (EIA) Indexed Site

    2.7 2.7 3.1 5.7 - 8.8 0.5 0.5 0.3 1.0 - 1.3 March ... 1.9 2.0 2.6 4.6 - 7.3 0.3 0.3 0.2 0.9 - 1.2 April ... 1.7 1.7 1.8 4.1...

  2. Table 11. U.S. Refiner Oxygenated Motor Gasoline Volumes by...

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    1.6 1.6 1.7 3.2 - 4.9 0.2 0.2 W 0.7 - 0.9 October ... 2.0 2.0 3.0 4.2 - 7.2 0.3 0.3 W 0.8 - 1.2 November ... 2.7 2.7 3.2 5.7 -...

  3. X:\\Data_Publication\\Pma\\current\\ventura\\pma00.vp

    U.S. Energy Information Administration (EIA) Indexed Site

    1998 January ... 22.8 24.0 12.1 100.6 30.2 142.9 5.5 5.7 3.1 11.5 - 14.6 February ... 24.4 25.5 12.7 104.6 29.7 147.1 5.5 5.7 3.3 11.7 - 15.0...

  4. TO: Procurement Directors FROM: Director Contract and Financial Assistance Policy Division

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    8 DATE: September 6, 2013 TO: Procurement Directors FROM: Director Contract and Financial Assistance Policy Division Office of Acquisition and Project Management SUBJECT: Acquisition Guide Chapter 7.3: Acquisition Planning in the M&O Environment SUMMARY: Acquisition Letter 2013-03, Acquisition Planning Considerations for M&O Contracts, has been moved to the Acquisition Guide as chapter (7.3). This Flash will be available online at the following website:

  5. Structure of trans-methyl 2-phenylhexahydro-2H-isoxazolo (2,3-a)-pyridine-3-carboxylate

    SciTech Connect (OSTI)

    Ul-Haque, M.; Horne, W.; Ali, S.A. )

    1993-02-01

    The title compound, a 1,3-dipolar cycloaddition product, crystallizes in the monoclinic space group P2[sub 1]/c, with a = 8.199(3), b = 16.908(1), c = 10.248(2) [angstrom],[beta] = 93.58(2)[degrees] and Z = 4. The structure was solved by direct methods and refined by full matrix least squares methods to R = 0.038 for 1687 observed reflections. The stereochemistry of this compound was found to have the [open quotes]ee[close quotes] conformation in the solid state as well as in solution. The piperidine ring in the molecule is in the chair form and the isoxazolidine ring adopts an envelope conformation.

  6. Synthesis, characterization and the crystal structure of a cis-dioxovandium(V) complex of a tridentate Schiff base ligand

    SciTech Connect (OSTI)

    Hai-Xin Liu; Wei Wang; Xin Wang; Min-Yu Tan

    1994-12-01

    The title complex, [VO{sub 2}(C{sub 6}H{sub 5}C(O)CHC(CH{sub 3})NNC(O)CH{sub 2}(NC{sub 5}H{sub 5}))]{center_dot}C{sub 2}H{sub 5}OH, was synthesized and characterized by elemental analysis and spectroscopy. Yellow crystals of the complex are monoclinic, space group P2{sub 1}/a with a = 10.690(2), b = 16.008(3), c = 13.164(4){Angstrom}, {beta} = 107.03(2){degrees}, V = 2153.9(18){Angstrom}{sup 3}, F(000) = 880 and Dc = 1.305 g cm{sup -3} for Z =4. X-ray structure analysis shows that the vanadium coordination number is five and the coordination polyhedron is a distorted trigonal bipyramid.

  7. 16B

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    B Ground-State Decay Evaluated Data Measured Ground-State Γcm(T1/2) for 16B Adopted value: < 190 ps (2003AU02) Measured Mass Excess for 16B Adopted value: 37080 ± 60 keV (2003AU02) Measurements 1995BO10: 14C(14C, 12N), E = 336 MeV; measured particle spectra, σ(θ). 16B deduced levels. 1996KR05: 12C(17C, 16B), (16C, 15B), E = 880 MeV; measured spectra; deduced one-proton stripping σ from ejectile yields. 16B deduced T1/2 upper limit. 2000KA21: 14C(14C, 12N), E ≈ 335 MeV; measured

  8. A novel inorganic-organic compound: Synthesis and structural characterization of tin(II) phenylbis(phosphonate), Sn{sub 2}(PO{sub 3}C{sub 6}H{sub 4}PO{sub 3})

    SciTech Connect (OSTI)

    Subbiah, Ayyappan; Bhuvanesh, Nattamai; Clearfield, Abraham . E-mail: clearfield@mail.chem.tamu.edu

    2005-04-15

    A novel tin(II) phenylbis(phosphonate) compound has been synthesized hydrothermally and its structure has been determined by single crystal X-ray diffraction. The structure is monoclinic, space group P2{sub 1}/c (no. 14), a=4.8094(4), b=16.2871(13), c=6.9107(6)A; {beta}=106.292(6){sup o}, V=519.59(7)A{sup 3}, Z=2. The three-dimensional structure consists of 3-coordinated tin and 4-coordinated phosphorus double layers separated (pillared) by phenyl rings. These phenyl rings are placed 4.8A apart along the a-axis in the structure resulting in lower surface area ({approx}14m{sup 2}/g). The porosity has been increased by replacing phenyl groups by methyl groups ({approx}31m{sup 2}/g)

  9. Word Pro - Untitled1

    Gasoline and Diesel Fuel Update (EIA)

    9 Table 8.3a Useful Thermal Output at Combined-Heat-and-Power Plants: Total (All Sectors), 1989-2011 (Sum of Tables 8.3b and 8.3c; Trillion Btu) Year Fossil Fuels Renewable Energy Other 7 Total Coal 1 Petroleum 2 Natural Gas 3 Other Gases 4 Total Biomass Total Wood 5 Waste 6 1989 323 96 462 93 973 546 30 577 39 1,589 1990 363 127 538 141 1,168 651 36 687 40 1,896 1991 352 112 547 148 1,159 623 37 660 44 1,863 1992 367 117 592 160 1,236 658 40 698 42 1,976 1993 373 129 604 142 1,248 668 45 713 41

  10. Induction and Rejoining of DNA Double Strand Breaks Assessed by H2AX Phosphorylation in Melanoma Cells Irradiated with Proton and Lithium Beams

    SciTech Connect (OSTI)

    Ibanez, Irene L.; Bracalente, Candelaria; Molinari, Beatriz L.; Palmieri, Monica A.; Policastro, Lucia; Kreiner, Andres J.; Burlon, Alejandro A.; Valda, Alejandro; Navalesi, Daniela; Davidson, Jorge; Davidson, Miguel; Vazquez, Monica; Ozafran, Mabel; Duran, Hebe

    2009-07-15

    Purpose: The aim of this study was to evaluate the induction and rejoining of DNA double strand breaks (DSBs) in melanoma cells exposed to low and high linear energy transfer (LET) radiation. Methods and Materials: DSBs and survival were determined as a function of dose in melanoma cells (B16-F0) irradiated with monoenergetic proton and lithium beams and with a gamma source. Survival curves were obtained by clonogenic assay and fitted to the linear-quadratic model. DSBs were evaluated by the detection of phosphorylated histone H2AX ({gamma}H2AX) foci at 30 min and 6 h post-irradiation. Results: Survival curves showed the increasing effectiveness of radiation as a function of LET. {gamma}H2AX labeling showed an increase in the number of foci vs. dose for all the radiations evaluated. A decrease in the number of foci was found at 6 h post-irradiation for low LET radiation, revealing the repair capacity of DSBs. An increase in the size of {gamma}H2AX foci in cells irradiated with lithium beams was found, as compared with gamma and proton irradiations, which could be attributed to the clusters of DSBs induced by high LET radiation. Foci size increased at 6 h post-irradiation for lithium and proton irradiations in relation with persistent DSBs, showing a correlation with surviving fraction. Conclusions: Our results showed the response of B16-F0 cells to charged particle beams evaluated by the detection of {gamma}H2AX foci. We conclude that {gamma}H2AX foci size is an accurate parameter to correlate the rejoining of DSBs induced by different LET radiations and radiosensitivity.

  11. CDT 16.01 was set to default on Edison on 2/3/2016

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    6.01 was set to default on Edison on 2/3/2016 CDT 16.01 was set to default on Edison on 2/3/2016 February 3, 2016 by Zhengji Zhao The Cray Developer Toolkit (CDT) 16.01 was set to default on 2/3/2016. The following software versions are new default on Edison: craype/2.5.1 cray-ga/5.3.0.5 cray-hdf5/1.8.16 cray-hdf5-parallel/1.8.16 cray-mpich/7.3.1 cray-mpich-abi/7.3.1 cray-shmem/7.3.1 craypkg-gen/1.3.3 cce/8.4.3 The intel compiler default was not changed, it is still intel/15.0.1.133. A new

  12. GrndWaterFlow.book

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    0 8.3 Flow Model Sensitivity to Steady-State Temperature Distribution 8.3.1 Introduction The Pahute Mesa CAU flow model spans an area 50 by 53 km with elevations between 3.5 km bmsl to 1.5 km amsl. Within the domain, there are three volcanic caldera complexes and extensive extra-caldera zones as well. Temperatures are not the same everywhere in this model domain. In the flow model, spatial variations in temperature are set by specifying a steady-state, 3-D temperature distribution. The FEHM code

  13. Fact #847: November 17, 2014 Cars were Over 50% of Light Vehicle...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    0.0% 13.6% 2.3% 1.3% 1982 80.3% 0.1% 14.8% 3.2% 1.5% 1983 77.7% 0.3% 15.8% 3.7% 2.5% 1984 76.1% 0.4% 14.6% 4.8% 4.1% 1985 74.6% 0.6% 14.4% 5.9% 4.5% 1986 71.7% 0.4% 16.5% 6.8% ...

  14. "NAICS Code(a)","Energy-Management Activity","No Participation","Participation(b)","Don't Know","Not Applicable"

    U.S. Energy Information Administration (EIA) Indexed Site

    4 Relative Standard Errors for Table 8.4;" " Unit: Percents." "NAICS Code(a)","Energy-Management Activity","No Participation","Participation(b)","Don't Know","Not Applicable" ,,"Total United States" " 311 - 339","ALL MANUFACTURING INDUSTRIES" ,"Full-Time Energy Manager (c)",0.7,4.8,3.9,"--" ,"Set Goals for Improving Energy Efficiency",1.2,2.8,3,"--"

  15. PROJECT MANGEMENT PLAN EXAMPLES Prepare Project Support Plans and

    Office of Environmental Management (EM)

    Quality Assurance Plan Examples Example 64 8.3 QUALITY ASSURANCE This section describes policies and procedures that will be used to meet QA program objectives. This section also develops the strategies PFP will use to ensure the S&M of the PFP inventory, the material stabilization project, the deactivation project, and the dismantlement of the PFP Complex buildings and are completed in a high quality manner. 8.3.1 QA Program The QA program for the PFP Stabilization and Deactivation Project

  16. West Virginia Associated-Dissolved Natural Gas Proved Reserves, Wet After

    U.S. Energy Information Administration (EIA) Indexed Site

    Lease Separation 24 29 52 21 70 32 1979-2014 Adjustments 8 -3 -1 -16 114 -29 1979-2014 Revision Increases 0 3 26 0 2 1 1979-2014 Revision Decreases 5 2 6 13 59 6 1979-2014 Sales 0 7 26 0 0 1 2000-2014 Acquisitions 0 14 33 0 0 0 2000-2014 Extensions 0 3 0 0 0 0 1979-2014 New Field Discoveries 0 0 0 0 0 0 1979-2014 New Reservoir Discoveries in Old Fields 0 0 0 0 0 0 1979-2014 Estimated Production 2 3 3 2 8 3

  17. app_c7

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7 Description of Input and Final Waste Streams C.7-iii DOE/EIS-0287 Idaho HLW & FD EIS TABLE OF CONTENTS Section Page Appendix C.7 Description of Input and Final Waste Streams C.7-1 LIST OF TABLES Table Page C.7-1 Waste processing alternative inputs. C.7-1 C.7-2 Bin set total chemical inventory (fission and activation species decayed to 2016). C.7-2 C.7-3 Bin set total inventory of radionuclides (decayed to 2016). C.7-3 C.7-4 Calculated radionuclides activities for SBW (curies per liter)

  18. untitled

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    Refiner Motor Gasoline Volumes by Grade, Sales Type, PAD District, and State (Thousand Gallons per Day) Geographic Area Month Regular Midgrade Sales to End Users Sales for Resale Sales to End Users Sales for Resale Through Retail Outlets Total a DTW Rack Bulk Through Retail Outlets Total a DTW Rack Bulk United States January ..................................... 41,519.2 43,169.0 31,921.8 181,170.4 35,284.7 3,695.7 3,730.6 1,312.7 9,777.3 - February ................................... 41,542.9

  19. Table HC6.11 Home Electronics Characteristics by Number of Household Members, 2005

    Gasoline and Diesel Fuel Update (EIA)

    1 Home Electronics Characteristics by Number of Household Members, 2005 Total...................................................................... 111.1 30.0 34.8 18.4 15.9 12.0 Personal Computers Do Not Use a Personal Computer ................... 35.5 16.3 9.4 4.0 2.7 3.2 Use a Personal Computer................................ 75.6 13.8 25.4 14.4 13.2 8.8 Number of Desktop PCs 1.................................................................. 50.3 11.9 17.4 8.5 7.3 5.2

  20. TableHC12.3.xls

    Gasoline and Diesel Fuel Update (EIA)

    5.6 17.7 7.9 Household Size 1 Person............................................................... 30.0 7.3 5.0 2.3 2 Persons.............................................................. 34.8 8.4 5.7 2.7 3 Persons.............................................................. 18.4 4.1 3.0 1.1 4 Persons.............................................................. 15.9 3.2 2.2 1.0 5 Persons.............................................................. 7.9 1.8 1.4 0.4 6 or More

  1. Total..........................................................................

    Gasoline and Diesel Fuel Update (EIA)

    7.1 19.0 22.7 22.3 Floorspace (Square Feet) Total Floorspace 1 Fewer than 500................................................... 3.2 2.1 0.6 Q 0.4 500 to 999........................................................... 23.8 13.6 3.7 3.2 3.2 1,000 to 1,499..................................................... 20.8 9.5 3.7 3.4 4.2 1,500 to 1,999..................................................... 15.4 6.6 2.7 2.5 3.6 2,000 to 2,499..................................................... 12.2 5.0 2.1

  2. Word Pro - S7

    Gasoline and Diesel Fuel Update (EIA)

    5 Table 7.3c Consumption of Selected Combustible Fuels for Electricity Generation: Commercial and Industrial Sectors (Subset of Table 7.3a) Commercial Sector a Industrial Sector b Coal c Petroleum d Natural Gas e Biomass Coal c Petroleum d Natural Gas e Other Gases g Biomass Other i Waste f Wood h Waste f Thousand Short Tons Thousand Barrels Billion Cubic Feet Trillion Btu Thousand Short Tons Thousand Barrels Billion Cubic Feet Trillion Btu 1990 Total .................... 417 953 28 15 10,740

  3. Gas Reactor Technology R&D

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    U.S. Department of Energy to Invest up to $7.3 Million for "Deep-Burn" Gas-Reactor Technology R&D Artist's rendering of Nuclear Plant An artist's rendering of the Next Generation Nuclear Plant concept. The U.S. Department of Energy today announced a Funding Opportunity Announcement (FOA) valued at $7.3 million for universities, commercial entities, National Laboratories with expertise in the concept of nuclear fuel "Deep-Burn" in which plutonium and higher transuranics

  4. Table 14a. Average Electricity Prices, Projected vs. Actual

    U.S. Energy Information Administration (EIA) Indexed Site

    a. Average Electricity Prices, Projected vs. Actual" "Projected Price in Constant Dollars" " (constant dollars, cents per kilowatt-hour in ""dollar year"" specific to each AEO)" ,"AEO $ Year",1993,1994,1995,1996,1997,1998,1999,2000,2001,2002,2003,2004,2005,2006,2007,2008,2009,2010,2011,2012,2013 "AEO 1994",1992,6.799,6.7999,6.9,6.9,6.9,6.9,7,7,7.1,7.1,7.2,7.2,7.2,7.3,7.3,7.4,7.5,7.6 "AEO

  5. Georgia Share of Total U.S. Natural Gas Delivered to Consumers

    Gasoline and Diesel Fuel Update (EIA)

    2.5 2.9 2.4 2.4 2.5 2.6 1993-2014 Commercial 1.7 1.9 1.8 1.8 1.7 1.7 1993-2014 Industrial 2.3 2.1 2.1 2.0 2.1 2.1 1993-2014 Vehicle Fuel 3.9 3.2 3.7 3.7 3.3 3.3 1993-2014 Electric Power 2.1 2.4 2.6 3.4 3.4 3.6

  6. untitled

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    817.7 4,658.6 8,375.5 3,857.1 12,193.1 8,515.7 W 441.7 February ... 4,292.8 3,051.0 8,504.3 4,204.9 12,797.0 7,255.9 W 207.6 March ......

  7. Lease Condensate Reserves Extensions

    U.S. Energy Information Administration (EIA) Indexed Site

    50 271 536 729 578 591 2009-2014 Federal Offshore U.S. 6 7 2 1 8 3 2009-2014 Pacific (California) 0 0 0 0 0 0 2009-2014 Gulf of Mexico (Louisiana & Alabama) 5 4 2 1 5 3 2009-2014...

  8. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    2,286.0 1,448.3 1,983.5 1,935.2 4,269.5 3,383.5 November... 2,780.8 2,193.2 2,011.0 873.7 4,791.8 3,067.0 December... 2,949.9 1,863.8 2,511.4...

  9. 20_33_1998.tex

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    33 from (1998TI06): Energy Levels of 20 Na a E x (MeV ± keV) J π ; T τ 1/2 or Γ cm Decay Reactions 0 2 + ; 1 τ 1/2 = 447.9 ± 2.3 ms β - 1, 7, 8 0.596 ± 8 3 + (γ) 7, 8 0.802 ± 7 4 + (γ) 7, 8 0.98425 ± 0.10 1 + (γ) 7, 8, 10 1.346 ± 8 2 - (γ) 7, 8 1.837 ± 7 2 - (γ) 7, 8 1.992 ± 8 3 - (γ) 7, 8 2.057 ± 12 3 + (γ) 8 2.645 ± 6 (3 + , 1 + ) (γ, p) 3, 5, 7, 8 2.849 ± 6 3 + 7, 8 2.983 ± 7 > 3 8 3.001 ± 2 1 + Γ = 19.8 ± 2 keV b p 5, 6, 10 3.067 ± 2 (0 + ) 5, 7, 8 3.086 ± 2

  10. X:\\L6046\\Data_Publication\\Pma\\current\\ventura\\pma.vp

    U.S. Energy Information Administration (EIA) Indexed Site

    5.2 2.3 6.6 4.2 11.9 6.5 2004 ... 3.4 2.9 6.8 3.0 10.2 5.9 NA Not available. Note: Totals may not equal the sum of the components due...

  11. Hanford Sitewide Probabilistic Seismic Hazard Analysis

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    8.0 Seismic Source Characterization .................................................................................................. 8.1 8.1 Building the SSC Model: Overview and Approach ............................................................ 8.1 8.1.1 Criteria for Defining Seismic Sources ....................................................................... 8.1 8.1.2 Data Evaluation Process ............................................................................................ 8.3

  12. " Million Housing Units, Final...

    U.S. Energy Information Administration (EIA) Indexed Site

    ... "Reduces Temperature During Day" "Yes",22.1,18.5,3.6,16.2,1.3,1,0.3,0.4,0.7,0.4,1.2,0.6,"Q" "No",19.6,15.8,3.8,14,1.3,0.8,0.4,0.2,0.6,0.3,1.3,0.5,"Q" "Reduces Temperature During " ...

  13. "Table HC1.4 Cooled Floorspace Usage Indicators, 2005" " ...

    U.S. Energy Information Administration (EIA) Indexed Site

    ... Thermostats" "Reduces Temperature During Day" "Yes",15.1,0.7,2.6,3.4,3,1.7,1.2,2.6 "No",9.9,0.5,2,1.8,1.9,1.1,1,1.6 "Reduces Temperature at Night" "Yes",15.4,0.7,2.8,3.2...

  14. Thermodynamic Data for Biomass Conversion and Waste Incineration

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    S P - 2 7 1 - 2 8 3 9 Notice This report was prepared as a n account of work sponsored by a n agency of t h e United States Government. Neither t h e United S t a t e s Government ...

  15. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    July... 56.0 W 2,426.8 3,049.7 228.9 August... 87.5 W 2,603.4 3,030.7 162.2 September... 232.3 W 4,191.9 3,234.5 244.6 October... 296.1 W...

  16. untitled

    U.S. Energy Information Administration (EIA) Indexed Site

    1,803.8 878.3 2,581.8 - 3,460.2 June ... 15,553.0 16,030.9 12,399.8 66,298.3 8,480.2 87,178.4 1,818.9 1,861.7 872.7 2,577.1 - 3,449.8 July...

  17. Prime Supplier Sales Volumes

    U.S. Energy Information Administration (EIA) Indexed Site

    1,515.4 24,168.6 49,958.8 205,642.8 21,325.8 3,583.5 13,512.4 38,421.7 February ... 150,955.0 13,660.5 51,987.1 216,602.6 25,038.0 1,397.6 14,426.9...

  18. " Million U.S. Housing Units"

    U.S. Energy Information Administration (EIA) Indexed Site

    Turned Off",43.6,8.9,14.4,8.1,6.9,5.3 "Manually Put into Sleep Mode",19.4,3.1,6.9,3.8,3.9,1.8 "CPU Goes to Sleep When PC is Left On" "Yes",9.1,1.1,3.1,2,1.8,1.1 ...

  19. "Table HC4.12 Home Electronics Usage Indicators by Renter-Occupied...

    U.S. Energy Information Administration (EIA) Indexed Site

    Turned Off",43.6,10.8,3.1,0.8,1.6,5,0.3 "Manually Put into Sleep Mode",19.4,4.2,1.2,0.4,0.8,1.8,"Q" "CPU Goes to Sleep When PC is Left On" "Yes",9.1,1.8,0.5,0.3,0.2,0.8,"Q" ...

  20. A=8Be (1979AJ01)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    79AJ01) (See Energy Level Diagrams for 8Be) GENERAL: See also (1974AJ01) and Table 8.3 Table of Energy Levels (in PDF or PS). Shell model: (1973AR1C, 1974KA11, 1975GO07,...

  1. untitled

    Gasoline and Diesel Fuel Update (EIA)

    316.0 30,254.8 10,591.4 149,937.7 37,688.7 198,217.8 3,426.0 3,510.2 1,986.8 8,082.3 - 10,069.1 February ... 31,589.9 32,605.4 11,241.7 157,558.9 40,147.9...

  2. U.S. Gasoline Price Continues to Increase (Short version)

    Gasoline and Diesel Fuel Update (EIA)

    Gasoline Price Continues to Increase (Short version) The U.S. average retail price for regular gasoline rose to $2.27 a gallon on Monday. That's up 8.3 cents from a week ago, based on the weekly price survey by the U.S. Energy Information Administration.

  3. Nuclear Material Control and Accountability

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2011-06-27

    This Order establishes performance objectives, metrics, and requirements for developing, implementing, and maintaining a nuclear material control and accountability program within DOE/NNSA and for DOE-owned materials at other facilities that are exempt from licensing by the Nuclear Regulatory Commission. Cancels DOE M 470.4-6. Admin Chg 1, 8-3-11.

  4. Recovery sequences for a station blackout accident at the Grand Gulf Nuclear Station

    SciTech Connect (OSTI)

    Carbajo, J.J. [Martin Marietta Energy Systems, Oak Ridge, TN (United States)

    1995-12-31

    Recovery sequences for a low-pressure, short term, station blackout severe accident at the Grand Gulf power plant have been investigated using the computer code MELCOR, version 1.8.3 PN. This paper investigates the effect of reflood timing and mass flow rate on accident recovery.

  5. 2009 Annual Employee Survey Results for

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    ... Percentages 19.7% 45.5% 17.6% 8.3% 5.5% 3.3% 100.0% Frequencies 1,038 995 244 73 69 28 2,447 24. My supervisor supports my need to balance work and family issues. Percentages 42.4% ...

  6. A=HTML Project

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    (1974), (1966), (1959) Adobe Reader Download Tables from (2004TI06): Table 8.1 in PS or PDF. Table 8.2 in PS or PDF. Table 8.3 in PS or PDF. Table 8.4 in PS or PDF. Table 8.5 in...

  7. oil1984.xls

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ... Below Poverty Line 100 Percent 2.6 1.8 3.3 98 53 69.1 24 745 0.40 525 186 125 Percent 3.7 ... for 1984. (3) Below 150 percent of poverty line or 60 percent of median State income. ...

  8. Residential Buildings Historical Publications reports, data and...

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    ... Below Poverty Line 100 Percent 2.6 1.8 3.3 98 53 69.1 24 745 0.40 525 186 125 Percent 3.7 ... for 1984. (3) Below 150 percent of poverty line or 60 percent of median State ...

  9. Residential Buildings Historical Publications reports, data and...

    Gasoline and Diesel Fuel Update (EIA)

    ... Below Poverty Line 100 Percent 6.9 4.5 8.3 139 74 89.5 28 640 0.34 413 130 125 Percent 10.2 6.7 12.5 133 71 87.5 30 614 0.33 405 141 Age of Householder Under 25 Years 17.8 12.5 ...

  10. " Million U.S. Housing Units"

    U.S. Energy Information Administration (EIA) Indexed Site

    "Brick",31.3,15,4.8,7.6,3.9 "Wood",20,7.1,4.5,3,5.4 "Stucco",14.8,8.6,1.8,3.3,1.2 "ConcreteConcrete Block",5.3,3.8,0.4,0.7,0.4 "Composition (Shingle)",1.9,0.7,0.4,0.4,0.4...

  11. X:\\L6046\\Data_Publication\\Pma\\current\\ventura\\pma.vp

    U.S. Energy Information Administration (EIA) Indexed Site

    1999 January ... 2.8 2.8 3.3 5.3 - 8.6 0.6 0.6 0.6 0.8 - 1.4 February ... 2.9 2.9 3.7 5.2 - 8.9 0.6 0.6 W 0.8 - 1.4 March...

  12. Microsoft Word - Final report scanned IG-06464.rtf

    Office of Environmental Management (EM)

    Property Disposals at the Yucca Mountain Project DOE/IG-0664 September 2004 REPORT ON PROPERTY DISPOSALS AT THE YUCCA MOUNTAIN PROJECT TABLE OF CONTENTS Property Disposals at Yucca Mountain Details of Finding ...................................................1 Recommendations and Comments........................4 Appendices 1. Objective, Scope, and Methodology..................7 2. Prior Reports.....................................................8 3. Management

  13. Microsoft Word - IG-0648.doc

    Office of Environmental Management (EM)

    REPORT ON THE DEPARTMENT'S REPORTING OF OCCUPATIONAL INJURIES AND ILLNESSES TABLE OF CONTENTS Safety Performance Details of Finding............................................................. 1 Recommendations and Comments ................................. 4 Appendices 1. Objective, Scope, and Methodology .......................... 6 2. Prior Reports.............................................................. 8 3. Example of Data Issues ............................................. 9 4.

  14. Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

    SciTech Connect (OSTI)

    C.A.Reddy, PI

    2005-06-30

    G. lucidum is one of the most important and widely distributed ligninolytic white rot fungi from habitats such as forest soils, agricultural soils, and tropical mangrove ecosystems and produce laccases as an important family of lignin modifying enzymes. Biochemically, laccases are blue multi copper oxidases that couple four electron reduction of molecular oxygen to water. There is a growing interest in the use of laccases for a variety of industrial applications such as bio-pulping and biobleaching as well as in their ability to detoxify a wide variety of toxic environmental pollutants. These key oxidative enzymes are found in all the three domains of life: Eukaryota. Prokarya, and Archaea. Ganoderma lucidum (strain no.103561) produces laccase with some of the highest activity (17,000 micro katals per mg of protein) reported for any laccases to date. Our results showed that this organism produces at least 11 different isoforms of laccase based on variation in mol. weight and/or PI. Our Studies showed that the presence of copper in the medium yields 15- to 20-fold greater levels of enzyme by G. lucidum. Dialysation of extra cellular fluid of G. lucidum against 10mM sodium tartrate (pH5.5) gave an additional 15 to 17 fold stimulation of activity with an observed specific activity of 17,000 {micro}katals/mg protein. Dialysis against acetate buffer gave five fold increase in activity while dialysis against glycine showed inhibition of activity. Purification by FPLC and preparative gel electrophoresis gave purified fractions that resolved into eleven isoforms as separated by isoelectric focusing, and the PI,s were 4.7, 4.6, 4.5, 4.3, 4.2, 4.1, 3.8, 3.7, 3.5, 3.4 and 3.3. Genomic clones of laccase were isolated using G. lucidum DNA as a template and using inverse PCR and forward/reverse primers corresponding to the sequences of the conserved copper binding region in the N-terminal domain of one of the laccases of this organism. Inverse PCR amplication of HindIII digested and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity of 53-55% to Trametes versicolorLAC3 and LAC4. The consensus copper-binding domains found in ot

  15. untitled

    U.S. Energy Information Administration (EIA) Indexed Site

    5,685.5 3,288.7 6,792.5 5,524.5 12,478.0 8,813.2 W W February ... 4,075.7 3,590.9 5,768.7 5,777.4 9,844.4 9,368.4 W W March ... 2,824.0...

  16. RR UECX I DEUEetdJ16 T LEMON7 ILL =@I9 V

    Office of Legacy Management (LM)

    CMIU AM) ACCOUWfdBlLtTY mu--., ci.. . ,..' TRANsFERf?ED TO STATtON 8yL F' D RFF RD hi& AC (tFw 110 78 ;)I 00 756-I rtoaJ40 Qf+?WZ u g F:. :.- ;-* -c 5 % r, "c;' a t-7 3:...

  17. Table 5.2. U.S. per Household Vehicle-Miles Traveled, Vehicle...

    U.S. Energy Information Administration (EIA) Indexed Site

    75,000 or More ... 8.2 2.3 28.5 1,443 1,692 5.2 Below Poverty Line 100 Percent ... 9.0 1.4 14.7 769 890 7.3 125...

  18. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    2,594.6 10,871.8 6,296.5 May... 2,002.5 2,475.3 8,351.0 3,536.7 10,353.5 6,011.9 June... 3,900.5 2,579.0 7,996.7 3,017.5 11,897.2 5,596.5...

  19. High-Pressure MOF Research Yields Structural Insights

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    The O1-Zn1-O2' internal angle increases from 109.54(8) to 114.7(3). ': -x+1,-y+1,-z+2. By applying up to 9.9 GPa of external applied pressure in increments increasing from...

  20. Natural Gas Weekly Update, Printer-Friendly Version

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    by Bentek, as imports rose by 5.7 percent, up to 1.7 Bcf on Wednesday. Northeast power burn rose to almost 8.5 Bcf on Wednesday (compared to 7.3 Bcf on Monday), and Bentek data...

  1. Natural Gas Weekly Update

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    by Bentek, as imports rose by 5.7 percent, up to 1.7 Bcf on Wednesday. Northeast power burn rose to almost 8.5 Bcf on Wednesday (compared to 7.3 Bcf on Monday), and Bentek data...

  2. Utah Coalbed Methane Proved Reserves, Reserves Changes, and Production

    U.S. Energy Information Administration (EIA) Indexed Site

    893 725 718 679 518 523 2000-2013 Adjustments 0 8 9 7 -3 2009-2013 Revision Increases 9 77 46 21 69 2009-2013 Revision Decreases 110 30 31 134 11 2009-2013 Sales 0 0 130 0 0...

  3. City of Boulder, Nevada (Utility Company) | Open Energy Information

    Open Energy Info (EERE)

    493 9,053 6,776 320 4,454 895 813 13,507 7,671 2008-01 453.321 8,322 6,779 272.7 3,666 888 726.021 11,988 7,667 References "EIA Form EIA-861 Final Data File for 2010 -...

  4. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    16,485.2 46.0 1,002.6 PAD District I January... W 80.4 9,382.3 3,401.9 54.4 1,666.3 February... W 80.3 9,338.7 3,323.3 53.1 1,374.4 March... W 85.0...

  5. untitled

    U.S. Energy Information Administration (EIA) Indexed Site

    ... 2.6 2.9 8.2 3.7 10.8 6.6 November ... 3.0 2.4 8.0 4.9 11.1 7.3 December ... 3.1 4.8 6.8 5.4 10.0 10.2...

  6. untitled

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    ... 69,239.3 43,647.5 112,886.8 2,053.4 1,593.7 3,647.0 Subdistrict IA January ... 2,785.7 12,016.8 14,802.5 37.2 334.4...

  7. "Table HC15.5 Space Heating Usage Indicators by Four Most Populated...

    U.S. Energy Information Administration (EIA) Indexed Site

    ... of Programmable Thermostats" "Reduces Temperature During Day" "Yes",18.6,1.2,0.8,1.4,2.4 "No",14.5,0.8,1.1,1,2.9 "Reduces Temperature at Night" "Yes",21.5,1.4,1,1.7,3.2 ...

  8. "Table HC12.5 Space Heating Usage Indicators by Midwest Census...

    U.S. Energy Information Administration (EIA) Indexed Site

    ... "Use of Programmable Thermostats" "Reduces Temperature During Day" "Yes",18.6,4.7,3.5,1.2 "No",14.5,3.6,2.5,1.1 "Reduces Temperature at Night" "Yes",21.5,5.4,3.9,1.5 ...

  9. " Million Housing Units, Final"

    U.S. Energy Information Administration (EIA) Indexed Site

    ... "Adjusts Temperature During Day" "When No One is Home" "Yes",19.1,1.9,3.1,3.5,2.9,2.2,1.7,3.9,1.4 "No",13.3,1.8,2.3,2.7,1.7,1.6,1,2.3,1.3 "Adjusts Temperature During " ...

  10. " Million Housing Units, Final...

    U.S. Energy Information Administration (EIA) Indexed Site

    ... Thermostat" "Reduces Temperature During Day" "Yes",22.1,2.2,3.4,3.9,3.4,2.6,1.9,4.6,1.9 "No",19.6,2.7,3.9,3.8,2.7,2.2,1.3,3,2 "Reduces Temperature During " "Sleeping Hours" ...

  11. " Million Housing Units, Final...

    U.S. Energy Information Administration (EIA) Indexed Site

    ... "Adjusts Temperature During Day" "When No One is Home" "Yes",19.1,1.3,0.4,1.7,1.6,2.7,3.4,4,4.1 "No",13.3,0.8,0.4,1.2,1.4,2,2.1,2.5,3 "Adjusts Temperature During " ...

  12. " Million U.S. Housing Units"

    U.S. Energy Information Administration (EIA) Indexed Site

    ... Thermostats" "Reduces Temperature During Day" "Yes",18.6,2.1,1.1,2,1.7,2.6,3.7,3.2,2.3 "No",14.5,1.3,1,1.3,1.4,2.6,2.3,2.5,2.1 "Reduces Temperature at Night" ...

  13. " Million U.S. Housing Units"

    U.S. Energy Information Administration (EIA) Indexed Site

    ... of Programmable Thermostats" "Adjusts Temperature During Day" "Yes",15.1,2.5,5.4,2.7,2.8,1.8 "No",9.9,2,2.9,2,1.7,1.3 "Adjusts Temperature at Night" "Yes",15.4,2.3,5.5,2.7,3,1.9 ...

  14. "Table HC14.5 Space Heating Usage Indicators by West Census...

    U.S. Energy Information Administration (EIA) Indexed Site

    ... "Use of Programmable Thermostats" "Reduces Temperature During Day" "Yes",18.6,4.8,1.7,3.1 "No",14.5,4.4,0.9,3.4 "Reduces Temperature at Night" "Yes",21.5,5.9,1.9,3.9 ...

  15. "Table HC1.3 Heated Floorspace Usage Indicators, 2005" " ...

    U.S. Energy Information Administration (EIA) Indexed Site

    ... Thermostats" "Reduces Temperature During Day" "Yes",18.6,0.4,2.6,3.7,3.7,2,"6 1.9",3.6 "No",14.5,0.7,2.3,3,2.6,1,"6 1.5",2.5 "Reduces Temperature at Night" ...

  16. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    2,803.5 23,127.6 260.7 3,192.1 3,064.2 26,319.6 July... 2,791.6 21,818.2 225.2 3,933.5 3,016.8 25,751.6 August... 2,778.1 22,800.2 260.6 3,760.9...

  17. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    1,980.8 1,991.4 2,256.6 5,462.7 - 7,719.4 September... 2,148.4 2,160.1 2,818.6 5,634.9 - 8,453.6 October... 3,212.7 3,226.0 3,969.5 7,032.5 - 11,002.0...

  18. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    9,876.0 17,425.6 30,942.7 4,309.2 52,677.5 PAD District I January... 2,925.5 3,030.7 8,165.5 10,848.8 1,193.2 20,207.5 February... 3,137.7 3,249.8 8,604.8...

  19. Table

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    1.0 fs 5, 7, 9, 14, 15, 19, 20, 23, 24, 25 5.2409 0.3 5 2 + 3.25 0.30 ps 4, 5, 6, 7, 9, 14, 15, 18, 19, 20, 23, 24, 25, 27 g +0.248 0.026 6.1763 1.7 3 2 -...

  20. " Million Housing Units, Final...

    U.S. Energy Information Administration (EIA) Indexed Site

    ...0.5,10.8,7.5,2,1.7,0.9,2.9,3.3,1,1.6,0.7 "SleepStandby Mode When Not ...,5.7,3.8,1.2,0.8,0.5,1.3,1.9,0.5,0.9,0.4 "SleepStandby Mode When Not ...

  1. " Million Housing Units, Final"

    U.S. Energy Information Administration (EIA) Indexed Site

    ...ed",50.5,7.2,12.2,10.3,7.5,4.7,3,5.6,5.6 "SleepStandby Mode When Not ...ed",27.7,2.2,4.2,5.1,4.1,3.6,2.6,5.8,1.9 "SleepStandby Mode When Not ...

  2. " Million Housing Units, Final...

    U.S. Energy Information Administration (EIA) Indexed Site

    When Not Used",50.5,32.7,3.3,3.7,8.2,2.5 "SleepStandby Mode When Not ... When Not Used",27.7,20.6,1.6,1.5,3.1,0.9 "SleepStandby Mode When Not ...

  3. " Million Housing Units, Final...

    U.S. Energy Information Administration (EIA) Indexed Site

    When Not Used",50.5,11.9,16.7,8.5,7.4,6 "SleepStandby Mode When Not ... When Not Used",27.7,3.1,9.1,5.7,5.4,4.4 "SleepStandby Mode When Not ...

  4. "Table HC3.12 Home Electronics Usage Indicators by Owner-Occupied...

    U.S. Energy Information Administration (EIA) Indexed Site

    Off",43.6,32.9,27.5,1.6,0.8,0.9,2 "Manually Put into Sleep Mode",19.4,15.2,13.1,0.9,0.3,0.4,0.6 "CPU Goes to Sleep When PC is Left On" "Yes",9.1,7.3,6.6,0.3,"Q","Q",0.2 ...

  5. Attachment FY2011-9 | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Attachment FY2011-9 Attachment FY2011-9 FFRDC Determination for a Contract Competition More Documents & Publications Policy Flash 2013-30 Acquisition Letter on Acquisition Planning Considerations for Management and Operating Contracts Policy Flash 2013-78 Acquisition Guide Chapter 7.3 Acquisition Planning in the M&O Environment Chapter 7 - Acquisition Planning

  6. Gasoline prices up this week (short version)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    short version) The U.S. average retail price for regular gasoline rose to $3.61 a gallon on Monday. That's up 7.3 cents from a week ago and up 25.4 cents from two weeks ago, based on the weekly price survey by the U.S. Energy Information Administration.

  7. U.S. gasoline prices continue to decrease (short version)

    Gasoline and Diesel Fuel Update (EIA)

    short version) The U.S. average retail price for regular gasoline fell to $2.44 a gallon on Monday. That's down 7.3 cents from a week ago, based on the weekly price survey by the U.S. Energy Information Administration.

  8. U.S. gasoline prices continue to decrease (short version)

    Gasoline and Diesel Fuel Update (EIA)

    gasoline prices continue to decrease (short version) The U.S. average retail price for regular gasoline fell to $2.82 a gallon on Monday. That's down 7.3 cents from a week ago, based on the weekly price survey by the U.S. Energy Information Administration.

  9. MicroPact icomplaints No Fear Reporting

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    total complaints filed. 2004 2005 2006 2007 2008 Race 3 1 4 7 6 0 Color 0 1 1 2 3 0 Religion 0 0 1 0 1 0 Reprisal 0 0 0 0 0 0 Sex 2 1 4 6 7 3 PDA 0 0 0 0 0 0 National Origin 0 3...

  10. MicroPact icomplaints No Fear Reporting

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    total complaints filed. 2005 2006 2007 2008 2009 Race 1 4 7 6 0 3 Color 1 1 2 3 0 2 Religion 0 1 0 1 0 2 Reprisal 0 0 0 0 0 0 Sex 1 4 6 7 3 2 PDA 0 0 0 0 0 0 2010 Quarter 4 Page...

  11. Table 46. Refiner No. 2 Distillate, Diesel Fuel, and Fuel Oil...

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    25,794.3 125,232.3 November ... 14,453.5 66,101.3 8,392.5 14,607.4 22,846.0 80,708.7 3,071.6 38,342.1 25,917.7 119,050.8 December ......

  12. "Table A40. Average Prices of Selected Purchased Energy Sources...

    U.S. Energy Information Administration (EIA) Indexed Site

    ...0.054,0.42,0.76,2.93,0.62,32.21,1.7 2011," Meat Packing Plants",0.047,0.34,0.79,2.47,0.45,...,0.072,0.46,0.7,3.57,0.73,52.87,3.6 2011," Meat Packing Plants",0.058," W ",0.6,3.06," W ...

  13. Table B36. Refrigeration Equipment, Number of Buildings and Floorspace...

    U.S. Energy Information Administration (EIA) Indexed Site

    ...9,334,261,90,273,1851,1783,1576,514,1287 "Health Care ......",127,12,7,3,10,29... ..",186,9,"Q","Q",8,1907,408,"Q","Q",346 "Health Care Complex ......",72,10,8,2,6,2339...

  14. CX-010410: Categorical Exclusion Determination

    Office of Energy Efficiency and Renewable Energy (EERE)

    Oracle to Tucson 115 Kilovolt Transmission Line, Cross Arm Replacements at Structure 2/5 and 7/3 CX(s) Applied: B1.3 Date: 05/02/2013 Location(s): Arizona, Arizona Offices(s): Western Area Power Administration-Desert Southwest Region

  15. Unconventional Resources Technology Advisory Committee

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    1 Unconventional Resources Technology Advisory Committee Comments and Recommendations 2014 Annual Plan November 2013 Attachment 3 2 TABLE OF CONTENTS 1.0 INTRODUCTION..............................................................................................................3 2.0 EXECUTIVE SUMMARY AND RECOMMENDATION HIGHLIGHTS .................5 3.0 TOPICAL REPORTS .......................................................................................................7 3.1 POLICY FINDINGS AND

  16. Unconventional Resources Technology Advisory Committee

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    1 Unconventional Resources Technology Advisory Committee Comments and Recommendations 2014 Annual Plan December 2013 2 TABLE OF CONTENTS 1.0 INTRODUCTION..............................................................................................................3 2.0 EXECUTIVE SUMMARY AND RECOMMENDATION HIGHLIGHTS .................5 3.0 TOPICAL REPORTS .......................................................................................................7 3.1 POLICY FINDINGS AND

  17. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    1,914.5 104546.6 4,183.1 15,517.3 1,198.3 1,385.1 February... 12,374.3 100750.4 3,769.0 14,266.9 1,521.6 1,840.1 March... 12,435.2 104913.7 3,177.6 15,977.5...

  18. II

    Office of Legacy Management (LM)

    LIST OF FIGURES 1 General location of Granite City, Illinois . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6 2 General location of the South Plant facility, Granite City Steel Division, Granite City, Illinois . . . . . . . . . . . . . . . ' . . . . . . . . . . 7 3 Diagram of the New Betatron Building, Granite City Steel facility, Granite City, Illinois. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8 4 View looking north northwest at the New

  19. I

    Office of Legacy Management (LM)

    'a! , + : ; fa- . . . c2 ..- - . . . . . . . . . . . . . . . ( i i : ; i - 3 = -*..A - - I . ; > . . . . . . . . . . , ' ; ! . . . . . . . . . . . . , . . . . . . . . . . . P i v ~ - R - 6 . ( . i % ' . * ,. : . . , . . . . . . . . . . . , . . . . . . , , . . - _ ' . . I , - 3 . I 5 6 7 3 . : : i': . PuL 5 3 - 3 . . ,! . , - . - . . . . . I - . c . 1 .-.> -., ! ; < : : A . . . . . . . . I . . . . . . ..... ----&- ,.<.. . ........ I . - c ' . . . - COPY w n Investigation

  20. oil1981.xls

    Gasoline and Diesel Fuel Update (EIA)

    ... Below Poverty Line 100 Percent 1.5 1.1 2.1 101 53 71.8 25 902 0.47 639 220 125 Percent 2.4 1.7 3.3 108 55 76.3 28 958 0.48 677 250 per Total per Square per per per Total Total ...

  1. Residential Buildings Historical Publications reports, data and...

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    ... Below Poverty Line 100 Percent 8.1 4.8 9.0 135 73 81.0 27 767 0.41 459 154 125 Percent 11.5 7.3 13.7 126 67 79.3 27 719 0.38 452 156 Age of Householder Under 25 Years 16.4 10.7 ...

  2. Table HC1.1.1 Housing Unit Characteristics by

    U.S. Energy Information Administration (EIA) Indexed Site

    od",20,18,47.8,18.6,33,18.4,16.5,14.4 "Stucco",14.8,13.3,29.6,11.5,19.8,11,12.7,11.1 "ConcreteConcrete Block",5.3,4.8,10.4,4.1,6.7,3.7,6.3,5.5 "Composition (Shingle)",1.9,1.7,4.7,...

  3. " Million U.S. Housing Units"

    U.S. Energy Information Administration (EIA) Indexed Site

    "Wood",20,4.1,1.1,2,2.1,3.2,3.9,2.7,1 "Stucco",14.8,1.3,1.1,1.6,1.5,2.7,3.2,2.3,1.2 "ConcreteConcrete Block",5.3,"Q","Q",0.9,0.8,1.1,0.8,0.5,0.7 "Composition...

  4. TableHC5.1.xls

    U.S. Energy Information Administration (EIA) Indexed Site

    ... 14.8 1.3 1.1 1.6 1.5 2.7 3.2 2.3 1.2 ConcreteConcrete Block... 5.3 Q Q 0.9 0.8 1.1 0.8 0.5 0.7 Composition...

  5. Assumptions to the Annual Energy Outlook 2015

    U.S. Energy Information Administration (EIA) Indexed Site

    ... 1.0 1.0 Canada 4.5 3.9 3.9 3.7 3.6 3.5 Mexico 1.0 1.5 1.5 1.5 1.5 3.1 South America ... Barbaro, Ralph and Schwartz,Seth, Review of the Annual Energy Outlook 2002 Reference Case ...

  6. Subject: Cost and Price Analysis | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Subject: Cost and Price Analysis Subject: Cost and Price Analysis PDF icon Subject: Cost and Price Analysis More Documents & Publications Subject: Cost and Price Analysis Policy Flash 2013-78 Acquisition Guide Chapter 7.3 Acquisition Planning in the M&O Environment Policy Flash 2013-30 Acquisition Letter on Acquisition Planning Considerations for Management and Operating Contracts

  7. IWARS Final

    Office of Environmental Management (EM)

    DOE/IG-0631 Audit Report Implementation of Indications, Warning, Analysis and Reporting Capability December 2003 Reporting Cyber Security Incidents Details of Finding ........................................................................1 Recommendations and Comments .............................................4 Appendices 1. Objective, Scope, and Methodology ......................................6 2. Prior Audit Reports .................................................................7 3.

  8. Petroleum Marketing Monthly

    U.S. Energy Information Administration (EIA) Indexed Site

    ... 2.9 - 3.2 September 21.0 21.3 18.0 225.2 22.4 265.5 1.8 1.8 0.3 2.7 - 3.1 October 21.2 ... U.S. Energy Information Administration | Petroleum Marketing Monthly 16 March 2016 Table ...

  9. 368371.pdf

    Office of Legacy Management (LM)

    . . . . . . . . _ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . -. . . . ~~ ~ ~~ ~~ --- -- NVO-273 MVO- -2 7 3 DE89 0 0 8 2 1 0 c LONG-TERM HYDROLOGIC MONITORING PROGRAM RULISON EVENT S I T E GRAND VALLEY, COLORADO - _ _ _ _ - DISCLAIMER This report was prepared as an actaunt of work sponsored by an agency of the United States Government. Neither the United States

  10. Association

    National Nuclear Security Administration (NNSA)

    abetion of uj392here1oject will ondoc50ented reswithin re a uj3swithinj-426 of a Contents 1.0 Introduction ......................................................................................................................... 7 2.0 Methodology used to Develop Influence Factors ............................................................... 7 ' 3.0 Accident Rates .................................................................................................................... 9 3.1 General

  11. Word Pro - Untitled1

    Gasoline and Diesel Fuel Update (EIA)

    9 Table 7.6 Coal Stocks by Sector, Selected Years, End of Year 1949-2011 (Million Short Tons) Year Producers and Distributors Consumers Total Residential and Commercial Sectors Industrial Sector Transportation Sector Electric Power Sector 2 Total Coke Plants Other 1 Total 1949 NA 1.4 10.0 16.1 26.0 3 ( ) 22.1 49.5 49.5 1950 NA 2.5 16.8 26.2 43.0 3 ( ) 31.8 77.3 77.3 1955 NA 1.0 13.4 15.9 29.3 3 ( ) 41.4 71.7 71.7 1960 NA .7 11.1 11.6 22.8 3 ( ) 51.7 75.2 75.2 1965 NA .4 10.6 13.1 23.8 3 ( ) 54.5

  12. Word Pro - Untitled1

    Gasoline and Diesel Fuel Update (EIA)

    0 U.S. Energy Information Administration / Annual Energy Review 2011 Table 8.3b Useful Thermal Output at Combined-Heat-and-Power Plants: Electric Power Sector, 1989-2011 (Subset of Table 8.3a; Trillion Btu) Year Fossil Fuels Renewable Energy Other 7 Total Coal 1 Petroleum 2 Natural Gas 3 Other Gases 4 Total Biomass Total Wood 5 Waste 6 1989 13 8 67 2 90 19 5 24 1 114 1990 21 9 80 4 114 18 6 25 (s) 138 1991 21 6 82 4 113 17 9 26 1 140 1992 28 6 102 5 140 17 8 25 2 167 1993 30 8 107 3 147 16 8 24

  13. Word Pro - Untitled1

    Gasoline and Diesel Fuel Update (EIA)

    1 Table 8.3c Useful Thermal Output at Combined-Heat-and-Power Plants: Commercial and Industrial Sectors, Selected Years, 1989-2011 (Subset of Table 8.3a; Trillion Btu) Year Fossil Fuels Renewable Energy Other 7 Total Coal 1 Petroleum 2 Natural Gas 3 Other Gases 4 Total Biomass Total Wood 5 Waste 6 Commercial Sector 8 1989 14 4 10 (s) 27 (s) 10 10 - 38 1990 15 5 16 (s) 36 (s) 10 11 - 46 1995 17 3 29 - 48 (s) 15 15 (s) 63 1996 20 3 33 R - 55 1 17 18 - 73 1997 22 4 40 (s) 66 1 19 20 - 86 1998 20 5

  14. UPDATING THE NRC STANDARD REVIEW PLAN - CHAPTER 8 - ELECTRICAL SYSTEMS

    SciTech Connect (OSTI)

    SULLIVAN,K.

    2007-06-24

    The Standard Review Plan (SRP) (Reference 2), provides guidance to the regulatory staff of the Nuclear Regulatory Commission (NRC) on performing their safety reviews of applications to construct or operate nuclear power plants, and applications to approve standard designs and sites for nuclear power plants. Chapter 8 of the SRP provides guidance related to the review of station electrical distribution systems described by the applicant in its Design Control Document (DCD) or Safety Analysis Report (SAR). As part of the 2006-2007 SAR update, all sections in this Chapter (8.1, 8.2, 8.3.1, 8.3.2, Appendix 8A, and Appendix 8B) were revised to incorporate new analyses, design approaches, and the lessons learned from the review of the AP 1000 design certification and to assure consistency with the draft Regulatory Guide DG-1145, ''Combined License Applications for Nuclear Power Plants (LWR Edition)''.

  15. Wilkinson Barker Knauer Memo

    Broader source: Energy.gov (indexed) [DOE]

    3 0 0 N S T R E E T , N W S U I T E 7 0 0 W A S H I N G T O N , D C 2 0 0 3 7 T E L 2 0 2 . 7 8 3 . 4 1 4 1 F A X 2 0 2 . 7 8 3 . 5 8 5 1 W W W . W B K L A W . C O M November 29, 2013 MEMORANDUM To: DOE Ex Parte Communications (expartecommunications@hq.doe.gov ) From: Scott Blake Harris Re: Energy Conservation Program for Consumer Products and Certain Commercial and Industrial Equipment: Proposed Determination of Computer Servers as a Covered Consumer Product, EERE-2013-BT-DET-0034 Pursuant to

  16. Buildings Energy Data Book: 1.4 Environmental Data

    Buildings Energy Data Book [EERE]

    4 2025 Buildings Energy End-Use Carbon Dioxide Emissions Splits, by Fuel Type (Million Metric Tons) (1) Natural Petroleum Gas Distil. Resid. LPG Oth(2) Total Coal Electricity (3) Total Percent Space Heating (4) 263.3 35.5 6.3 15.2 2.0 59.0 6.1 98.9 427.3 19.2% Space Cooling 1.8 258.7 260.5 11.7% Lighting 245.4 245.4 11.0% Water Heating 97.7 5.7 2.5 8.3 97.6 203.7 9.2% Refrigeration (5) 129.5 129.5 5.8% Electronics (6) 122.6 122.6 5.5% Ventilation (7) 94.4 94.4 4.2% Computers 68.8 68.8 3.1% Wet

  17. Buildings Energy Data Book: 5.1 Building Materials/Insulation

    Buildings Energy Data Book [EERE]

    4 "Green Roofs" Completed by Year (Thousand SF) Extensive Intensive Mixed Total 2004 917 406 4.9 1,327 2005 1,785 488 198.7 2,472 2006 1,957 1,033 73.8 3,064 2007 - - - 2,408 2008 - - - 3,182 2009 - - - - 2010 3,109 172 312 4,341 Extensive Intensive Mixed Total 2004 777.1 405.8 3.924 1,187 2005 1,570 476.4 102.9 2,150 2006 - - - - 2007 - - - 1,953 2008 - - - 2,647 Note(s): Source(s): North America United States 1) Extensive: soil depth of less than 6 inches. 2) Intensive: soil depth

  18. Topoisomerase II Structure Suggests Novel DNA Cleavage Mechanism

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Topoisomerase II Structure Suggests Novel DNA Cleavage Mechanism Print Type II topoisomerases are molecular machines that regulate DNA supercoiling and separate interlocked chromosomes. These enzymes are also exploited clinically as targets of antibiotics and anticancer therapeutics. Researchers at ALS Beamline 8.3.1 imaged type II topoisomerase's ordinarily short-lived state in which it is linked to a DNA's nucleic acid segment through its active site tyrosine, cleaving the DNA. Details of this

  19. Topoisomerase II Structure Suggests Novel DNA Cleavage Mechanism

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Topoisomerase II Structure Suggests Novel DNA Cleavage Mechanism Print Type II topoisomerases are molecular machines that regulate DNA supercoiling and separate interlocked chromosomes. These enzymes are also exploited clinically as targets of antibiotics and anticancer therapeutics. Researchers at ALS Beamline 8.3.1 imaged type II topoisomerase's ordinarily short-lived state in which it is linked to a DNA's nucleic acid segment through its active site tyrosine, cleaving the DNA. Details of this

  20. Topoisomerase II Structure Suggests Novel DNA Cleavage Mechanism

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Topoisomerase II Structure Suggests Novel DNA Cleavage Mechanism Print Type II topoisomerases are molecular machines that regulate DNA supercoiling and separate interlocked chromosomes. These enzymes are also exploited clinically as targets of antibiotics and anticancer therapeutics. Researchers at ALS Beamline 8.3.1 imaged type II topoisomerase's ordinarily short-lived state in which it is linked to a DNA's nucleic acid segment through its active site tyrosine, cleaving the DNA. Details of this

  1. Topoisomerase II Structure Suggests Novel DNA Cleavage Mechanism

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Topoisomerase II Structure Suggests Novel DNA Cleavage Mechanism Print Type II topoisomerases are molecular machines that regulate DNA supercoiling and separate interlocked chromosomes. These enzymes are also exploited clinically as targets of antibiotics and anticancer therapeutics. Researchers at ALS Beamline 8.3.1 imaged type II topoisomerase's ordinarily short-lived state in which it is linked to a DNA's nucleic acid segment through its active site tyrosine, cleaving the DNA. Details of this

  2. Topoisomerase II Structure Suggests Novel DNA Cleavage Mechanism

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Topoisomerase II Structure Suggests Novel DNA Cleavage Mechanism Topoisomerase II Structure Suggests Novel DNA Cleavage Mechanism Print Wednesday, 26 January 2011 00:00 Type II topoisomerases are molecular machines that regulate DNA supercoiling and separate interlocked chromosomes. These enzymes are also exploited clinically as targets of antibiotics and anticancer therapeutics. Researchers at ALS Beamline 8.3.1 imaged type II topoisomerase's ordinarily short-lived state in which it is linked

  3. Topoisomerase II Structure Suggests Novel DNA Cleavage Mechanism

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Topoisomerase II Structure Suggests Novel DNA Cleavage Mechanism Print Type II topoisomerases are molecular machines that regulate DNA supercoiling and separate interlocked chromosomes. These enzymes are also exploited clinically as targets of antibiotics and anticancer therapeutics. Researchers at ALS Beamline 8.3.1 imaged type II topoisomerase's ordinarily short-lived state in which it is linked to a DNA's nucleic acid segment through its active site tyrosine, cleaving the DNA. Details of this

  4. Topoisomerase II Structure Suggests Novel DNA Cleavage Mechanism

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Topoisomerase II Structure Suggests Novel DNA Cleavage Mechanism Print Type II topoisomerases are molecular machines that regulate DNA supercoiling and separate interlocked chromosomes. These enzymes are also exploited clinically as targets of antibiotics and anticancer therapeutics. Researchers at ALS Beamline 8.3.1 imaged type II topoisomerase's ordinarily short-lived state in which it is linked to a DNA's nucleic acid segment through its active site tyrosine, cleaving the DNA. Details of this

  5. UPC Bug Reports

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    » UPC Bug Reports UPC Bug Reports Deadlock during first touch of upc_alloc'd remote memory when target is in upc_barrier [updated] October 16, 2014 Status: This has been reported to Cray (811537) and a workaround is available. Fixed in CCE 8.3.5. Read the full post Subscribe via RSS Subscribe Browse by Date October 2014 Last edited: 2016-02-01 08:06:39

  6. Bonneville Power Admin (Washington) | Open Energy Information

    Open Energy Info (EERE)

    78,670.305 8 2008-12 3,057.253 82,875.13 8 3,057.253 82,875.13 8 2008-11 2,331.04 68,329.679 2,331.04 68,329.679 2008-10 2,177.036 64,661.237 8 2,177.036 64,661.237 8...

  7. ALSNews Vol. 341

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    1 Print Space-Age Ceramics Get Their Toughest Test Advanced ceramic composites can withstand the ultrahigh operating temperatures of jet and gas-turbine engines, but analysis of these materials at such temperatures has been a challenge. Now, a testing facility at Beamline 8.3.2 enables microtomography of ceramic composites under controlled loads at temperatures above 1600°C. Read more and watch a video about this research... Contact: Rob Ritchie Flipping Photoelectron Spins in Topological

  8. ALSNews Vol. 341

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    1 Print Space-Age Ceramics Get Their Toughest Test Advanced ceramic composites can withstand the ultrahigh operating temperatures of jet and gas-turbine engines, but analysis of these materials at such temperatures has been a challenge. Now, a testing facility at Beamline 8.3.2 enables microtomography of ceramic composites under controlled loads at temperatures above 1600°C. Read more and watch a video about this research... Contact: Rob Ritchie Flipping Photoelectron Spins in Topological

  9. ALSNews Vol. 341

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    1 Print Space-Age Ceramics Get Their Toughest Test Advanced ceramic composites can withstand the ultrahigh operating temperatures of jet and gas-turbine engines, but analysis of these materials at such temperatures has been a challenge. Now, a testing facility at Beamline 8.3.2 enables microtomography of ceramic composites under controlled loads at temperatures above 1600°C. Read more and watch a video about this research... Contact: Rob Ritchie Flipping Photoelectron Spins in Topological

  10. ALSNews Vol. 341

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    1 Print Space-Age Ceramics Get Their Toughest Test Advanced ceramic composites can withstand the ultrahigh operating temperatures of jet and gas-turbine engines, but analysis of these materials at such temperatures has been a challenge. Now, a testing facility at Beamline 8.3.2 enables microtomography of ceramic composites under controlled loads at temperatures above 1600°C. Read more and watch a video about this research... Contact: Rob Ritchie Flipping Photoelectron Spins in Topological

  11. ALS Ceramics Materials Research Advances Engine Performance

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ALS Ceramics Materials Research Advances Engine Performance ALS Ceramics Materials Research Advances Engine Performance Print Thursday, 27 September 2012 00:00 ritchie ceramics This 3D image of a ceramic composite specimen imaged under load at 1750C shows the detailed fracture patterns that researchers are able to view using ALS Beamline 8.3.2. The vertical white lines are the individual silicon carbide fibers in this sample about 500 microns in diameter. LBNL senior materials scientist and U.C.

  12. ALSNews Vol. 311

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    1 Print Irradiation Effects on Human Cortical Bone Fracture Behavior The role irradiation plays in high-exposure bone fracturing experiments, and how it affects the properties of bone tissue, are not fully understood. To better predict fracturing in bone, researchers must understand the role of sustained irradiation damage at different size scales within bone. Using synchrotron radiation microtomography at ALS Beamline 8.3.2, researchers investigated changes in crack path and toughening

  13. ALSNews Vol. 311

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    1 Print Irradiation Effects on Human Cortical Bone Fracture Behavior The role irradiation plays in high-exposure bone fracturing experiments, and how it affects the properties of bone tissue, are not fully understood. To better predict fracturing in bone, researchers must understand the role of sustained irradiation damage at different size scales within bone. Using synchrotron radiation microtomography at ALS Beamline 8.3.2, researchers investigated changes in crack path and toughening

  14. ALSNews Vol. 324

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ALSNews Vol. 324 Print Bioactive Glass Scaffolds for Bone Regeneration Natural materials are renowned for their unique combination of outstanding mechanical properties and exquisite microstructure. Researchers at Beamline 8.3.2 have created bioactive glass scaffolds that mirror nature's efficient materials and may provide a means for previously problematic bone regeneration in large, load-bearing limbs. Read more... Contact: Q. Fu Direct Imaging of Antiferromagnetic Vortex States Despite

  15. ALSNews Vol. 324

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ALSNews Vol. 324 Print Bioactive Glass Scaffolds for Bone Regeneration Natural materials are renowned for their unique combination of outstanding mechanical properties and exquisite microstructure. Researchers at Beamline 8.3.2 have created bioactive glass scaffolds that mirror nature's efficient materials and may provide a means for previously problematic bone regeneration in large, load-bearing limbs. Read more... Contact: Q. Fu Direct Imaging of Antiferromagnetic Vortex States Despite

  16. ALSNews Vol. 326

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    6 Print Dynein's Motor Domain Shows Ring-Shaped Motor, Buttress Following a previous study that revealed the structure of dynein's microtubule binding domain, a new study from ALS Beamline 8.3.1 now shows details of dynein's motor domain. In addition to defining a large, ring-shaped motor, researchers found an intriguing and unanticipated feature called the buttress which may be critical in coupling ATP hydrolysis to dynein's movement along microtubule tracks. Read more... Contact: Andrew Carter

  17. ALSNews Vol. 326

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    6 Print Dynein's Motor Domain Shows Ring-Shaped Motor, Buttress Following a previous study that revealed the structure of dynein's microtubule binding domain, a new study from ALS Beamline 8.3.1 now shows details of dynein's motor domain. In addition to defining a large, ring-shaped motor, researchers found an intriguing and unanticipated feature called the buttress which may be critical in coupling ATP hydrolysis to dynein's movement along microtubule tracks. Read more... Contact: Andrew Carter

  18. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    2006... 315.6 0.5 15.2 39.4 1.4 1.3 2007 January... 297.6 0.4 15.2 48.6 2.3 1.8 February.. 310.3 0.4 15.9 50.8 3.3 1.8 March..... 316.4 0.4 16.5 39.3 1.4 0.7 April........

  19. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    2006 January... 26.3 27.1 6.5 128.9 27.7 163.1 February.. 28.1 29.0 6.7 137.0 36.5 180.2 March..... 28.5 29.4 7.1 140.5 30.2 177.8 April..... 29.7 30.7 8.3 144.1 39.3 191.7...

  20. TableHC14.1.xls

    Gasoline and Diesel Fuel Update (EIA)

    4.1 Housing Unit Characteristics by West Census Region, 2005 Total......................................................................... 111.1 24.2 7.6 16.6 Urban/Rural Location (as Self-Reported) City....................................................................... 47.1 12.8 3.2 9.6 Town..................................................................... 19.0 3.0 1.1 1.9 Suburbs................................................................ 22.7 4.9 1.6 3.3

  1. " "," ",,," Steam Turbines Supplied by Either Conventional or Fluidized Bed Boilers",,,"Conventional Combusion Turbines with Heat Recovery",,,"Combined-Cycle Combusion Turbines",,,"Internal Combusion Engines with Heat Recovery",,," Steam Turbines Supplied by Heat Recovered from High-Temperature Processes",,,," "

    U.S. Energy Information Administration (EIA) Indexed Site

    3 Relative Standard Errors for Table 8.3;" " Unit: Percents." " "," ",,," Steam Turbines Supplied by Either Conventional or Fluidized Bed Boilers",,,"Conventional Combusion Turbines with Heat Recovery",,,"Combined-Cycle Combusion Turbines",,,"Internal Combusion Engines with Heat Recovery",,," Steam Turbines Supplied by Heat Recovered from High-Temperature Processes",,,," " " "," "

  2. HICEV America: Hydrogen Internal Combustion Engine Vehicle (HICEV) Technical Specifications

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    HICEV AMERICA: HYDROGEN INTERNAL COMBUSTION ENGINE VEHICLE (HICEV) TECHNICAL SPECIFICATIONS Revision 0 November 1, 2004 Prepared by Electric Transportation Applications HICEV America Vehicle Specification i TABLE OF CONTENTS Minimum Vehicle Requirements 1 1. Regulatory Requirements 7 2. Chassis 8 3. Vehicle Characteristics 10 4. Drive System 11 5. Vehicle Performance 12 6. Hydrogen Fuel Storage System (HFSS) 14 7. Additional Vehicle Systems 17 8. Documentation 18 Appendices Appendix A - Vehicle

  3. Northeast Oklahoma Electric Coop, Inc | Open Energy Information

    Open Energy Info (EERE)

    9 4,191 47,726 38,381 2008-06 2,799 30,435 34,457 905 10,285 3,864 65 989 9 3,769 41,709 38,330 2008-05 2,698 29,812 34,370 813 9,209 3,864 58 871 8 3,569 39,892 38,242 2008-04...

  4. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    2,820.9 8,632.3 11,318.0 1,490.2 21,440.5 May... 2,770.5 2,910.0 8,818.6 11,598.3 1,530.5 21,947.4 June... 2,911.8 3,043.5 8,933.3 11,631.1 1,407.9...

  5. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    6.3 369.5 42,342.6 13,619.4 252.4 3,890.6 February... 85.1 434.6 45,204.7 13,690.6 284.8 3,639.8 March... 100.1 527.1 45,773.1 14,427.9 128.0 2,013.4...

  6. _Part II - Contract Clauses

    National Nuclear Security Administration (NNSA)

    09/30/2015 to Mod 0588 Contract DE-AC04-94AL85000 Modification No. M202 Page I - 1 Part II - Contract Clauses Section I TABLE OF CONTENTS 1. FAR 52.202-1 DEFINITIONS (JAN 2012) (REPLACED M473) ............................................................. 8 2. FAR 52.203-3 GRATUITIES (APR 1984) ................................................................................................. 8 3. FAR 52.203-5 COVENANT AGAINST CONTINGENT FEES (APR 1984) ........................................... 9

  7. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    ... 4.0 4.1 9.4 5.2 0.9 15.5 1995 ... 2.5 2.5 3.8 W W 8.1 1996 ... 2.4 2.5 2.6 2.9 W 5.6 1997 ... 2.2 2.2 1.8 3.1 - 4.9 1998 January... 3.0 3.0 2.8 5.3 -...

  8. UPC Bug Reports

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Reports UPC Bug Reports Viewing entries posted in October 2014 Deadlock during first touch of upc_alloc'd remote memory when target is in upc_barrier [updated] October 16, 2014 Status: This has been reported to Cray (811537) and a workaround is available. Fixed in CCE 8.3.5. Read the full post Subscribe via RSS Subscribe Browse by Date October 2014 Last edited: 2016-02-01 08:06:39

  9. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    2001 ... 16.3 16.7 32.7 30.0 9.0 71.7 2002 January... 15.9 16.2 33.4 27.5 7.4 68.3 February.. 16.6 16.9 34.0 28.6 6.7 69.2 March..... 16.5 16.9 34.5 29.7 8.3 72.5 April........

  10. Table 3. U.S. Refiner Volumes of Petroleum Products to End...

    Gasoline and Diesel Fuel Update (EIA)

    1993 January ... 53.8 0.1 39.3 4.9 0.3 0.8 19.8 3.4 23.2 0.8 20.8 February ... 57.3 0.2 39.2 5.2 0.3 0.9 20.5 3.7 24.2 0.9 21.4 March...

  11. Table 3. U.S. Refiner Volumes of Petroleum Products to End...

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    1997 January ... 54.4 0.1 46.0 3.2 0.5 0.8 22.0 3.8 25.9 0.6 13.8 February ... 57.3 0.1 47.8 3.7 0.4 0.6 22.3 2.8 25.1 0.4 14.1 March...

  12. FY16-FY20 Strategic Plan

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    -FY20 Strategic Plan Exceptional service in the national interest Sandia National Laboratories is a multi-program laboratory managed and operated by Sandia Corporation, a wholly owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energy's National Nuclear Security Administration under contract DE-AC04-94AL85000. SAND2015-6199 dp. www.strategicplan.sandia.gov 8/3/2015C www.strategicplan.sandia.gov 1 Message from the President

  13. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    114.2 406.0 45,968.1 11,079.0 534.5 5,366.3 February... 146.6 499.8 47,800.3 10,256.4 357.8 3,591.8 March... 150.3 518.6 48,152.6 10,316.6 365.5 2,056.1...

  14. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    2.4 395.1 39,378.3 15,202.9 236.6 2,326.5 February... 73.3 367.3 40,530.5 15,923.9 229.8 3,294.8 March... 93.0 449.9 40,393.5 16,485.4 120.1 1,351.5...

  15. ,,,"with Any"," Steam Turbines Supplied by Either Conventional or Fluidized Bed Boilers",,,"Conventional Combusion Turbines with Heat Recovery",,,"Combined-Cycle Combusion Turbines",,,"Internal Combusion Engines with Heat Recovery",,," Steam Turbines Supplied by Heat Recovered from High-Temperature Processes",,,," "

    U.S. Energy Information Administration (EIA) Indexed Site

    3 Relative Standard Errors for Table 8.3;" " Unit: Percents." ,,,"Establishments" ,,,"with Any"," Steam Turbines Supplied by Either Conventional or Fluidized Bed Boilers",,,"Conventional Combusion Turbines with Heat Recovery",,,"Combined-Cycle Combusion Turbines",,,"Internal Combusion Engines with Heat Recovery",,," Steam Turbines Supplied by Heat Recovered from High-Temperature Processes",,,," "

  16. ALS Ceramics Materials Research Advances Engine Performance

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ALS Ceramics Materials Research Advances Engine Performance ALS Ceramics Materials Research Advances Engine Performance Print Thursday, 27 September 2012 00:00 ritchie ceramics This 3D image of a ceramic composite specimen imaged under load at 1750C shows the detailed fracture patterns that researchers are able to view using ALS Beamline 8.3.2. The vertical white lines are the individual silicon carbide fibers in this sample about 500 microns in diameter. LBNL senior materials scientist and U.C.

  17. Duct and cladding alloy

    DOE Patents [OSTI]

    Korenko, Michael K. (Rockville, MD)

    1983-01-01

    An austenitic alloy having good thermal stability and resistance to sodium corrosion at 700.degree. C. consists essentially of 35-45% nickel 7.5-14% chromium 0.8-3.2% molybdenum 0.3-1.0% silicon 0.2-1.0% manganese 0-0.1% zirconium 2.0-3.5% titanium 1.0-2.0% aluminum 0.02-0.1% carbon 0-0.01% boron and the balance iron.

  18. Motor Gasoline Sales to End Users, Total Refiner Sales Volumes

    U.S. Energy Information Administration (EIA) Indexed Site

    49,797.6 44,697.0 39,002.1 29,725.8 24,722.5 21,633.6 1983-2014 East Coast (PADD 1) 16,574.2 14,548.8 12,347.0 9,304.0 6,838.8 3,815.2 1994-2014 New England (PADD 1A) 1,764.3...

  19. Percent of Industrial Natural Gas Deliveries in New York Represented...

    Gasoline and Diesel Fuel Update (EIA)

    Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 12.7 8.3 14.3 2000's 11.3 10.8 11.0 10.6 10.7 14.7 11.7 12.3 11.4 11.7 2010's 10.6 7.9 6.8 6.3...

  20. Buildings and Energy in the 1980's (TABLES)

    U.S. Energy Information Administration (EIA) Indexed Site

    8.3 Food Sales and Service . . . 1,770 685 3,982 2,652 387.03 2.25 1.50 5.81 3.87 9.7 Health Care . . . . . . . . . . . . 1,955 730 3,592 2,392 373.42 1.84 1.22 4.92 3.28 8.7...

  1. YMGI Through-the-Wall Air Conditioner Determined Noncompliant With Energy

    Broader source: Energy.gov (indexed) [DOE]

    Efficiency Standard | Department of Energy U.S. Department of Energy's Office of Enforcement issued a Notice of Noncompliance Determination (Notice) on October 11, 2012, to YMGI Group, LLC (YMGI) regarding through-the-wall split system central air conditioner basic model TTWC-18K-31B. DOE enforcement testing revealed that this model operates at a Seasonal Energy Efficiency Rating (SEER) of 8.3. The current federal standard requires that through-the-wall split system central air conditioners

  2. Microsoft Word - Tran Waste final report 2-8-05.doc

    Office of Environmental Management (EM)

    Transuranic Waste Management at Los Alamos National Laboratory DOE/IG-0673 February 2005 REPORT ON TRANSURANIC WASTE MANAGEMENT AT LOS ALAMOS NATIONAL LABORATORY TABLE OF CONTENTS Legacy Transuranic Waste Disposal Details of Finding 1 Recommendations and Comments 4 Appendices 1. Objective, Scope, and Methodology 6 2. Transuranic Waste Storage 8 3. Prior Audit Reports 10 4. Management Comments 11 Legacy Transuranic Waste Disposal Page 1 Details of Finding Background Los Alamos National Laboratory

  3. 2014 Wind Technologies Market Report Highlights

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Wind Technologies Market Report Highlights August 2015 Prepared for the U.S. Department of Energy Wind and Water Power Technologies Office Prepared by Lawrence Berkeley National Laboratory Berkeley, California 2014 WIND TECHNOLOGIES MARKET REPORT HIGHLIGHTS 2 Introduction The United States remains a top installer of wind energy capacity. Wind power additions rebounded in 2014, with 4,854 megawatts (MW) of new capacity added in the United States representing $8.3 billion in new investments. In

  4. City of Coffeyville, Kansas (Utility Company) | Open Energy Informatio...

    Open Energy Info (EERE)

    2008-07 0.509 5.916 5,274 0.678 7.397 996 2.354 53.424 10 3.541 66.737 6,280 2008-06 0.403 4.364 5,271 0.594 6.837 994 2.206 47.998 8 3.203 59.199 6,273 2008-05 0.297 3.218 5,293...

  5. Microsoft Word - Chapter 13 - 021711

    National Nuclear Security Administration (NNSA)

    3: Index 13-1 CHAPTER 13: INDEX A Advisory Council on Historic Preservation ..................................................... 5-66, 7-8, 10-22, E-2 Air Quality Control Region (AQCR) ............................................................. 4-1, 4-21, 11-1, 11-13 Alternate Financed Facility ........................................................................................1-26, 3-8, 3-32 American Conference of Governmental Industrial Hygienists (ACGIH) ... 5-30, 5-79, D-25, D-26

  6. Buildings Energy Data Book

    Buildings Energy Data Book [EERE]

    8.1 Buildings Sector Water Consumption 8.2 Residential Sector Water Consumption 8.3 Commercial Sector Water Consumption 8.4 WaterSense 8.5 Federal Government Water Usage 9Market Transformation Glossary Acronyms and Initialisms Technology Descriptions Building Descriptions Other Data Books Biomass Energy Transportation Energy Power Technologies Hydrogen Download the Entire Book Skip down to the tables This chapter includes data on water use in commercial and residential buildings and the energy

  7. Buildings Energy Data Book: 3.2 Commercial Sector Characteristics

    Buildings Energy Data Book [EERE]

    4 Share of Commercial Floorspace, by Census Region and Vintage, as of 2003 (Percent) Region Prior to 1960 1960 to 1989 1990 to 2003 Total Northeast 9% 8% 3% 20% Midwest 8% 11% 6% 25% South 5% 18% 14% 37% West 3% 9% 5% 18% 100% Source(s): EIA, 2003 Commercial Buildings Energy Consumption Survey: Building Characteristics Tables, Oct. 2006, Table A2, p. 3-4

  8. Synthesis, structure and magnetic properties of a new iron phosphonate-oxalate with 3D framework: [Fe(O{sub 3}PCH{sub 3})(C{sub 2}O{sub 4}){sub 0.5}(H{sub 2}O)

    SciTech Connect (OSTI)

    Zhang Yangyang [Applied Catalysis Laboratory, Dalian Institute of Chemical Physics, Chinese Academy of Sciences, Dalian 116023 (China); Qi Yue [Applied Catalysis Laboratory, Dalian Institute of Chemical Physics, Chinese Academy of Sciences, Dalian 116023 (China); Zhang Ying [Applied Catalysis Laboratory, Dalian Institute of Chemical Physics, Chinese Academy of Sciences, Dalian 116023 (China); Liu Ziyu [Applied Catalysis Laboratory, Dalian Institute of Chemical Physics, Chinese Academy of Sciences, Dalian 116023 (China); Zhao Yinfeng [Applied Catalysis Laboratory, Dalian Institute of Chemical Physics, Chinese Academy of Sciences, Dalian 116023 (China); Liu Zhongmin [Applied Catalysis Laboratory, Dalian Institute of Chemical Physics, Chinese Academy of Sciences, Dalian 116023 (China)]. E-mail: liuzm@dicp.ac.cn

    2007-08-07

    A new iron phosphonate-oxalate [Fe(O{sub 3}PCH{sub 3})(C{sub 2}O{sub 4}){sub 0.5}(H{sub 2}O)] (1), has been synthesized under hydrothermal condition. The single-crystal X-ray diffraction studies reveal that 1 consists of layers of vertex-linked FeO{sub 6} octahedra and O{sub 3}PC tetrahedra, which are further connected by bis-chelate oxalate bridges, giving to a 3D structure with 10-membered channels. Crystal data: monoclinic, P2{sub 1}/n (no. 14), a=4.851(2)A, b=16.803(7)A, c=7.941(4)A, {beta}=107.516(6){sup o}, V=617.2(5)A{sup 3}, Z=4, R{sub 1}=0.0337 and wR{sub 2}=0.0874 for 1251 reflections [I>2{sigma}(I)]. Mossbauer spectroscopy measurement confirms the existence of high-spin Fe(III) in 1. Magnetic studies show that 1 exhibits weak ferromagnetism with T{sub N}=30K due to a weak spin canting.

  9. Metastatic Melanoma Induced Metabolic Changes in C57BL/6J Mouse Stomach Measured by 1H NMR Spectroscopy

    SciTech Connect (OSTI)

    Hu, M; Wang, Xiliang

    2014-12-05

    Melanoma is a malignant tumor of melanocytes with high capability of invasion and rapid metastasis to other organs. Malignant melanoma is the most common metastatic malignancy found in gastrointestinal tract (GI). To the best of our knowledge, previous studies of melanoma in gastrointestinal tract are all clinical case reports. In this work, 1H NMR-based metabolomics approach is used to investigate the metabolite profiles differences of stomach tissue extracts of metastatic B16-F10 melanoma in C57BL/6J mouse and search for specific metabolite biomarker candidates. Principal Component Analysis (PCA), an unsupervised multivariate data analysis method, is used to detect possible outliers, while Orthogonal Projection to Latent Structure (OPLS), a supervised multivariate data analysis method, is employed to evaluate important metabolites responsible for discriminating the control and the melanoma groups. Both PCA and OPLS results reveal that the melanoma group can be well separated from its control group. Among the 50 identified metabolites, it is found that the concentrations of 19 metabolites are statistically and significantly changed with the levels of O-phosphocholine and hypoxanthine down-regulated while the levels of isoleucine, leucine, valine, isobutyrate, threonine, cadaverine, alanine, glutamate, glutamine, methionine, citrate, asparagine, tryptophan, glycine, serine, uracil, and formate up-regulated in the melanoma group. These significantly changed metabolites are associated with multiple biological pathways and may be potential biomarkers for metastatic melanoma in stomach.

  10. Phenotype-genotype variability in the human CYP3A locus as assessed by the probe drug quinine and analyses of variant CYP3A4 alleles

    SciTech Connect (OSTI)

    Rodriguez-Antona, Cristina . E-mail: cristina.rodriguez-antona@cnio.es; Sayi, Jane G.; Gustafsson, Lars L.; Bertilsson, Leif; Ingelman-Sundberg, Magnus

    2005-12-09

    The human cytochrome P450 3A (CYP3A) enzymes, which metabolize 50% of currently used therapeutic drugs, exhibit great interindividual differences in activity that have a major impact on drug treatment outcome, but hitherto no genetic background importantly contributing to this variation has been identified. In this study we show that CYP3A4 mRNA and hnRNA contents with a few exceptions vary in parallel in human liver, suggesting that mechanisms affecting CYP3A4 transcription, such as promoter polymorphisms, are relevant for interindividual differences in CYP3A4 expression. Tanzanian (n = 143) healthy volunteers were phenotyped using quinine as a CYP3A probe and the results were used for association studies with CYP3A4 genotypes. Carriers of CYP3A4*1B had a significantly lower activity than those with CYP3A4*1 whereas no differences were seen for five other SNPs investigated. Nuclear proteins from the B16A2 hepatoma cells were found to bind with less affinity to the CYP3A4*1B element around -392 bp as compared to CYP3A4*1. The data indicate the existence of a genetic CYP3A4 polymorphism with functional importance for interindividual differences in enzyme expression.

  11. Ground-State Decays for Nuclei A = 3 - 20

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Ground State Beta-Decay and Particle Unbound Resonances Data for A = 3 - 20 Nuclei Go to the Text Only section below if you prefer to view the nuclides in a text list. 18Mg 19Mg 20Mg 17Na 18Na 19Na 20Na 15Ne 16Ne 17Ne 18Ne 19Ne 20Ne 14F 15F 16F 17F 18F 19F 20F 11O 12O 13O 14O 15O 16O 17O 18O 19O 20O 10N 11N 12N 13N 14N 15N 16N 17N 18N 19N 20N 7C 8C 9C 10C 11C 12C 13C 14C 15C 16C 17C 18C 19C 20C 6B 7B 8B 9B 10B 11B 12B 13B 14B 15B 16B 17B 18B 19B 20B 5Be 6Be 7Be 8Be 9Be 10Be 11Be 12Be 13Be 14Be

  12. Metastatic Melanoma Induced Metabolic Changes in C57BL/6J Mouse Stomach Measured by 1H NMR Spectroscopy

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Hu, M; Wang, Xiliang

    2014-12-05

    Melanoma is a malignant tumor of melanocytes with high capability of invasion and rapid metastasis to other organs. Malignant melanoma is the most common metastatic malignancy found in gastrointestinal tract (GI). To the best of our knowledge, previous studies of melanoma in gastrointestinal tract are all clinical case reports. In this work, 1H NMR-based metabolomics approach is used to investigate the metabolite profiles differences of stomach tissue extracts of metastatic B16-F10 melanoma in C57BL/6J mouse and search for specific metabolite biomarker candidates. Principal Component Analysis (PCA), an unsupervised multivariate data analysis method, is used to detect possible outliers, while Orthogonalmore » Projection to Latent Structure (OPLS), a supervised multivariate data analysis method, is employed to evaluate important metabolites responsible for discriminating the control and the melanoma groups. Both PCA and OPLS results reveal that the melanoma group can be well separated from its control group. Among the 50 identified metabolites, it is found that the concentrations of 19 metabolites are statistically and significantly changed with the levels of O-phosphocholine and hypoxanthine down-regulated while the levels of isoleucine, leucine, valine, isobutyrate, threonine, cadaverine, alanine, glutamate, glutamine, methionine, citrate, asparagine, tryptophan, glycine, serine, uracil, and formate up-regulated in the melanoma group. These significantly changed metabolites are associated with multiple biological pathways and may be potential biomarkers for metastatic melanoma in stomach.« less

  13. CDT 15.12 was set to default on Edison on 12/23/2015

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    12 was set to default on Edison on 12/23/2015 CDT 15.12 was set to default on Edison on 12/23/2015 December 30, 2015 The Cray Developer Toolkit (CDT) 15.12 was set to default on 12/23/2015. The following software versions are now new default on Edison: craype/2.5.0 cray-ccdb/1.0.7 cray-ga/5.3.0.4 cray-hdf5-parallel/1.8.14 cray-hdf5/1.8.14 cray-lgdb/2.4.5 cray-libsci/13.3.0 cray-mpich-abi/7.3.0 cray-mpich/7.3.0 cray-netcdf-hdf5parallel/4.3.3.1 cray-netcdf/4.3.3.1 cray-parallel-netcdf/1.6.1

  14. Hopper Featured Announcements

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    March 2011 New software set to default March 23, 2011 by Helen He We have set new default versions for the following software after the OS upgrade on 3/23: --- xt-mpich2 and xt-shmem 5.2.1 (changed from 5.1.5.1) --- cce 7.3.3 (changed from 7.3.1) --- xt-libsci 10.5.01 (changed from 10.5.0) --- ga 4.3.3 (changed from 4.3.2) --- hdf5 and hdf5-parallel 1.8.5.0 (changed from 1.8.4.1) --- petsc and petsc-complex 3.1.05 (changed from 3.1.04) Read the full post Rebooting some Hopper login nodes this

  15. U.S. Reformulated Gasoline Refiner Sales Volumes

    Gasoline and Diesel Fuel Update (EIA)

    9,331.7 9,442.5 9,360.9 9,430.0 9,073.4 9,085.2 1994-2015 Through Retail Outlets 9,295.1 9,403.6 9,321.7 9,389.3 9,036.4 9,053.7 1994-2015 Sales for Resale, Total NA NA NA NA NA NA 1994-2015 DTW 17,766.1 18,339.1 18,231.1 18,226.6 17,803.3 17,962.0 1994-2015 Rack 75,636.6 76,320.1 75,500.8 76,496.7 74,672.7 74,554.3 1994-2015 Bulk 2,882.1 3,194.7 3,274.1 2,910.9 3,714.7 3,244.5

  16. Office of Fossil Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    and Gas Global Security and Supply Division of Natural Gas Regulatory Activities Phone: 202-586-9478 Email: ngreports@hq.doe.gov 2014 Jan Feb March April May June July Aug Sept Oct Nov Dec TOTAL Egypt - - - - - - - - - - - - - Nigeria - - - - - - - - - - - - - Norway - - - - - - - - - 2.6 - 3.0 5.6 Qatar - - - - - - - - - - - - - Trinidad 6.2 3.8 2.7 3.0 - 7.1 6.3 1.6 2.9 4.3 - 5.0 42.8 Yemen 2.3 - - - 2.8 - - - 2.9 - - - 8.0 Undetermined * - - - - - 2.7 - - - - - - 2.7 TOTAL 8.5 3.8 2.7 3.0 2.8

  17. 17_02_1993.tex

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    from (1993TI07): Energy levels of 17 N a E x in 17 N (MeV ± keV) J π ; T τ or Γ Decay Reactions 0 1 2 - ; 3 2 τ 1/2 = 4.173 ± 0.004 sec β - b 1, 2, 3, 4, 5, 6, 7, 8 1.3739 ± 0.3 3 2 - τ m = 93 ± 35 fsec γ 3, 5, 6, 7, 8 1.8496 ± 0.3 1 2 + 41 +20 -9 psec γ 3, 5, 6, 7, 8 1.9068 ± 0.3 5 2 - 11 ± 2 psec γ 3, 4, 5, 6, 7, 8 2.5260 ± 0.5 5 2 + 33 ± 3 psec γ 3, 4, 5, 7, 8 3.1289 ± 0.5 7 2 - 275 ± 80 psec γ 3, 5, 7, 8 3.2042 ± 0.9 3 2 - < 30 fsec γ 3, 5, 7, 8 3.6287 ± 0.7 ( 7

  18. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    1996... 2.4 2.5 2.6 2.9 W 5.6 1997 January... 3.7 3.7 2.9 4.5 - 7.4 February.. 3.6 3.7 2.9 4.2 - 7.1 March..... 2.1 2.1 1.9 2.3 - 4.1 April..... 0.9 0.9 0.5 1.6 - 2.1...

  19. CDT 15.12 was set to default on Edison on 12/23/2015

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    7.3.0 cray-tpsl-641.5.2 cray-tpsl1.5.2 cray-trilinos11.12.1.5 craype2.5.0 craypkg-gen1.3.2 fftw3.3.4.6 iobuf2.0.6 papi5.4.1.3 parallel-netcdf1.3.1 perftools-lite6.3.1...

  20. The influence of molecular orientation on organic bulk heterojunction solar

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    cells The influence of molecular orientation on organic bulk heterojunction solar cells The influence of molecular orientation on organic bulk heterojunction solar cells Print Monday, 28 April 2014 09:03 Work done on ALS Beamlines 11.0.1.2, 7.3.3, and 5.3.2.2. reveals that preferential orientation of polymer chains with respect to the fullerene domain leads to a high photovoltaic performance. Featured on the cover of Nature Photonics 8. Article link

  1. SSRL HEADLINES Mar 2007

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    9 March, 2007 __________________________________________________________________________ Contents of this Issue: Science Highlight - Taming a Potent Toxin Science Highlight - Ancient Warriors and the Origin of Chinese Purple Stanford-Caltech Collaboration Creates New X-ray "Molecular Observatory" Rapid Access Beam Time for SMB XAS BL7-3 SSRL School on Hard X-ray Scattering: Techniques in Materials and Environmental Sciences 2007 Ultrafast Summer School - June 18-22 SMB XAS Short Course

  2. X:\\L6046\\Data_Publication\\Pma\\current\\ventura\\pma.vp

    U.S. Energy Information Administration (EIA) Indexed Site

    2001 ... 62.0 0.1 49.7 3.6 0.2 0.3 22.9 3.0 26.0 0.4 14.8 2002 January ... 60.2 0.1 46.2 3.3 0.2 0.5 20.2 3.2 23.3 0.5 10.5...

  3. Weatherization Assistance Program

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Weatherization Assistance Program State Energy Advisory Board Meeting Washington, DC Robert C. Adams DOE Weatherization Assistance Program 1 | WAP Training & Technical Assistance Tools and Resources eere.energy.gov Weatherization Assistance Program Background * The WAP leads the nation in advancing technology, research and work practices related to making residential energy upgrades cost effective, safe and comprehensive * Over 7.3 million low-income dwelling units have been weatherized

  4. untitled

    U.S. Energy Information Administration (EIA) Indexed Site

    2006 ... 28.9 29.8 7.3 143.7 37.4 188.4 2.9 2.9 0.5 9.3 - 9.7 2007 January ... 27.8 28.4 6.8 143.1 33.2 183.1 2.6 2.6 0.5 8.9 - 9.4...

  5. untitled

    U.S. Energy Information Administration (EIA) Indexed Site

    2006 ... 17.7 18.0 26.8 45.7 3.4 75.9 2.5 2.5 1.9 1.5 - 3.4 2007 January ... 16.3 16.5 26.0 44.0 2.4 72.4 2.4 2.4 1.7 1.4 - 3.1...

  6. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    2006... 28.9 29.8 7.3 143.7 37.4 188.4 2007 January... 27.8 28.4 6.8 143.1 33.2 183.1 February.. 29.0 29.7 7.1 149.5 36.3 192.9 March..... 29.3 29.9 7.2 152.7 37.3 197.2...

  7. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    2006... 17.7 18.0 26.8 45.7 3.4 75.9 2007 January... 16.3 16.5 26.0 44.0 2.4 72.4 February.. 16.9 17.1 27.3 44.2 1.8 73.4 March..... 17.1 17.4 27.9 45.4 2.8 76.2 April........

  8. TableHC12.1.xls

    Gasoline and Diesel Fuel Update (EIA)

    2.1 Housing Unit Characteristics by Midwest Census Region, 2005 Total......................................................................... 111.1 25.6 17.7 7.9 Urban/Rural Location (as Self-Reported) City....................................................................... 47.1 9.7 7.3 2.4 Town..................................................................... 19.0 5.0 2.9 2.1 Suburbs................................................................ 22.7 5.7 4.3 1.4

  9. TableHC12.8.xls

    Gasoline and Diesel Fuel Update (EIA)

    Number of Water Heaters 1............................................................................... 106.3 24.5 17.1 7.4 2 or More.................................................................. 3.7 0.9 0.5 0.4 Do Not Use Hot Water.............................................. 1.1 Q Q Q Housing Units Served by Main Water Heater One Housing Unit..................................................... 99.7 23.5 16.2 7.3 Two or More Housing Units....................................... 10.3 1.9

  10. TableHC14.13.xls

    Gasoline and Diesel Fuel Update (EIA)

    4.2 7.6 16.6 Indoor Lights Turned On During Summer Number of Lights Turned On Between 1 and 4 Hours per Day........................... 91.8 19.5 6.1 13.4 1.......................................................................... 28.6 6.1 1.7 4.4 2.......................................................................... 29.5 6.3 1.8 4.5 3.......................................................................... 14.7 3.1 1.1 2.0

  11. untitled

    Gasoline and Diesel Fuel Update (EIA)

    1.8 1.8 1.1 6.2 - 7.3 0.2 0.2 0.1 0.9 - 1.0 2006 January ... 1.9 2.0 1.6 6.8 - 8.4 0.2 0.2 0.1 0.9 - 1.0 February ... 1.9 1.9 1.5 7.2 -...

  12. Table 13. U.S. Refiner Reformulated Motor Gasoline Volumes by...

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    12.0 69.2 3.4 3.5 6.9 3.1 W 10.1 December ... 14.8 15.1 31.7 29.5 10.8 72.0 3.6 3.7 7.3 3.3 W 10.7 1999 ... 14.5 14.8 29.8 26.1 9.6...

  13. X:\\L6046\\Data_Publication\\Pma\\current\\ventura\\pma.vp

    U.S. Energy Information Administration (EIA) Indexed Site

    3.2 5.0 2.0 - 7.0 December ... 17.0 17.3 31.2 31.5 6.2 69.0 3.2 3.3 4.9 2.0 - 6.9 2002 ... 16.9 17.2 33.1 30.4 8.2 71.7 3.3 3.3 5.6...

  14. " Million Housing Units, Final...

    U.S. Energy Information Administration (EIA) Indexed Site

    ...5,3.6,2.5,1.5,3.1,3.5 "Air Conditioning",94,18.3,22.3,17.9,11.9,8.1,5.1,10.4,12.8 "Water Heating",47.1,11.4,12.8,8.9,5.6,3.2,1.7,3.5,8.2 "Cooking",71.2,14.2,17.1,13.4,9.2,6,3.5,7.7...

  15. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    18.5 385.5 47,187.8 11,484.4 323.4 4,406.3 February... 130.0 502.6 47,884.7 11,440.1 306.7 3,893.8 March... 146.1 614.9 47,658.3 12,534.7 293.1 2,924.7...

  16. untitled

    U.S. Energy Information Administration (EIA) Indexed Site

    2004 January ... 23.5 24.3 8.8 122.8 28.1 159.7 3.5 3.6 1.0 9.2 - 10.2 February ... 24.8 25.7 9.4 125.2 28.6 163.2 3.6 3.7 1.0 9.8 - 10.8...

  17. A REVIEW OF THORIUM FUEL REPROCESSING EX

    Office of Scientific and Technical Information (OSTI)

    f - 7 - 3 A REVIEW OF THORIUM FUEL REPROCESSING EX n ERIENCE R. E. Brooksbank W. T. McDuffee R. H. Rainey Oak Ridge National Laboratory* Oak Ridge, Tennessee 37830 - NOTICE - This report was prepared as an account of work sponsoied by the United States Government. Neither the United States *101 the United Statei Department or Energy, not any of their employees, nor any of their contractors, subcontractors, or their employees, makes any warranty, express or implied, 01 anumes any legal liability

  18. " Million U.S. Housing Units"

    U.S. Energy Information Administration (EIA) Indexed Site

    Off",43.6,5,2.5,5.1,4.9,7.9,7.1,7.2,4 "Manually Put into Sleep Mode",19.4,2.6,1,1.8,1.8,2.7,3.5,3.7,2.3 "CPU Goes to Sleep When PC is Left On" "Yes",9.1,1,0.3,0.8,0.8,1.9,1.5,1.9,0...

  19. SSRL HEADLINES April 2007

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    0 April, 2007 __________________________________________________________________________ Contents of this Issue: Science Highlight - Revealing the Molecular Origins of Life Science Highlight - Closing in on Dangerous Infections Low Emittance Lattice for Brighter Beam Rapid Access Beam Time for SMB XAS BL7-3 - Online Application Now Available! New SSRL Faculty Chair and Vice-Chair Appointed Aaron Lindenberg Appointed to Faculty Position SSRL Users' Executive Committee Meeting Upcoming Schools,

  20. U.S. gasoline prices decreases for 16th week in a row; breaking previous record set in 2008 (short version)

    Gasoline and Diesel Fuel Update (EIA)

    gasoline prices decreases for 16th week in a row; breaking previous record set in 2008 (short version) The U.S. average retail price for regular gasoline fell 7.3 cents from a week ago to $2.07 a gallon on Monday. This marks a record of 16 consecutive weeks of price drops and breaks the previous record set at the end of 2008, based on the weekly price survey by the U.S. Energy Information Administration.

  1. June 1, 2011

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    June 1, 2011 June 1, 2011 Print Monday, 23 May 2011 15:37 regina soufli Multilayer thin films: From Earth to space Regina Soufli, Lawrence Livermore National Laboratory glenn waychunas Molecular aspects of carbon sequestration: What synchrotron work can tell us Glenn Waychunas, Earth Sciences Division, Beamlines 12.2.2 and 7.3.3 gilles Is all soot created equal? Mary Gilles, Chemical Sciences Division, Beamline 11.0.2

  2. Refiner and Blender Net Production of Distillate Fuel Oil > 15 pmm to 500

    Gasoline and Diesel Fuel Update (EIA)

    ppm Sulfur 123 157 137 142 148 149 1993-2016 PADD 1 25 31 21 16 31 15 1993-2016 PADD 2 0 13 5 -4 7 3 1993-2016 PADD 3 86 93 66 96 93 101 1993-2016 PADD 4 0 8 -4 0 -4 5 1993-2016 PADD 5 12 13 50 34 21 25 1993

  3. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    2001 ... 2.2 2.2 2.5 4.8 - 7.3 2002 January... 2.9 2.9 3.2 5.8 - 9.0 February.. 2.9 2.9 3.0 5.4 - 8.4 March..... 2.1 2.1 2.7 4.1 - 6.8 April..... 1.5 1.5 2.0 3.7 - 5.8...

  4. Ohio Proved Nonproducing Reserves

    U.S. Energy Information Administration (EIA) Indexed Site

    5 1 1 2 7 3 1996-2014 Lease Condensate (million bbls) 0 0 1 6 11 35 1998-2014 Total Gas (billion cu ft) 68 19 54 252 1,072 3,504 1996-2014 Nonassociated Gas (billion cu ft) 67 14 50 246 1,015 3,498 1996-2014 Associated Gas (billion cu ft) 1 5 4 6 57 6

  5. C:\ANNUAL\Vol2chps.v8\ANNUAL2.VP

    Gasoline and Diesel Fuel Update (EIA)

    44 Energy Information Administration / Historical Natural Gas Annual 1930 Through 2000 33. Prices of Natural Gas Deliveries to Industrial Consumers by State, 1993-1998 (Dollars per Thousand Cubic Feet) Table State Firm Interruptible Total Average Price Percentage of Total Volume Delivered Average Price Percentage of Total Volume Delivered Total Average Price Percentage of Total Volume Delivered 1993 Alabama ...................... 3.72 29.2 3.06 26.7 3.28 27.5 Alaska..........................

  6. 8B

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    (BA66A) (1989BA31) 0 < 5% > 7.3 3.0 80% 5.54 5.72 5.617 a 5.64 b 5.77 11.7 11% c 4.6 16.63 d 2.9 3.33 a) Taking T12 774 ms, Q 17.979 - 2.90. b) And B. Zimmerman,...

  7. 13O

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    a (1970ES03) b (2005KN02) a 0 12- 88.1 3.4 c 89.2 2.2 88.7 2.0 4.10 0.02 c 4.08 0.02 f 4.08 0.02 3.51 32- observed 1.5597 0.0010 100 100 100 10.7 3.1...

  8. Connecticut Natural Gas Delivered for the Account of Others

    Gasoline and Diesel Fuel Update (EIA)

    1,080 1,156 1,438 1,364 2,199 2,096 1999-2014 % of All Resi. Deliveries for the Acct. of Others 2.5 2.7 3.2 3.3 4.7 4.1 2007-2014 Commercial Deliveries 12,324 14,068 15,519 14,774...

  9. Building America Webinar: Opportunities in Large Data Collection and

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Analysis-Presentation #3 | Department of Energy 3 Building America Webinar: Opportunities in Large Data Collection and Analysis-Presentation #3 This is the third presentation, Indoor Temperature and Humidity Data Collection and Analysis, in the webinar on April 16, 2014. PDF icon BA_Webinar_Booten_Metzger_Norton_4-16-14.pdf More Documents & Publications Building America Webinar: Opportunities in Large Data Collection and Analysis Building America Best Practices Series, Volume 7.3: Guide

  10. Microsoft Word - S05993_CY2009 Annual Rpt.doc

    Office of Legacy Management (LM)

    7 3.1.2 Routine Monitoring 3.1.2.1 POC Monitoring This objective deals with monitoring discharges from the terminal ponds into Woman and Walnut creeks and streamflow at the additional POCs downstream at Indiana Street to demonstrate compliance with RFLMA surface-water-quality standards (see RFLMA Attachment 2, Table 1). Water-quality data at POCs are reportable under RFLMA when the applicable compliance parameters are greater than the corresponding Table 1 values (see Appendix D). Terminal pond

  11. Residential Buildings Historical Publications reports, data and...

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    ... Below Poverty Line 100 Percent 1.5 1.1 2.1 101 53 71.8 25 902 0.47 639 220 125 Percent 2.4 1.7 3.3 108 55 76.3 28 958 0.48 677 250 Age of Householder Under 25 Years 3.5 2.4 5.9 123 ...

  12. Overview

    Energy Savers [EERE]

    -------------------------Chapter 7.3 (September, 2013) ACQUISITION PLANNING IN THE M&O ENVIRONMENT Overview The purpose of this chapter is to discuss the unique acquisition planning and approval requirements associated with the Management and Operating (M&O) form of contract. References 1. FAR Part 7 Acquisition Planning 2. FAR Subpart 17.6 Management and Operating Contracts 3. DEAR 970.1706 Management and Operating Contracts 4. DOE Acquisition Guide, Chapter 7.1 Acquisition Planning 5.

  13. X:\\Data_Publication\\Pma\\current\\ventura\\pma00.vp

    U.S. Energy Information Administration (EIA) Indexed Site

    3.0 388.5 43,197.7 16,871.4 323.8 4,310.9 462.7 3,430.4 4,159.1 44,833.7 February ... 161.9 456.4 46,718.6 17,076.8 277.2 3,402.7 452.9 2,453.4 3,847.8...

  14. Guidelines for Home Energy Professionals Project (Fact Sheet), Guidelines For Home Energy Professionals, Energy Efficiency & Renewable Energy (EERE)

    Energy Savers [EERE]

    Guidelines for Home Energy Professionals Project The U.S. Department of Energy and the home energy upgrade industry collaborate to define high-quality work and develop highly qualified workers. The U.S. Department of Energy's (DOE) Weatherization Assistance Program (WAP) was created in 1976 and has weatherized more than 7.3 million households since its inception. Throughout the years, private industry, public utilities, municipalities, and states have also implemented numerous home energy

  15. Table 45. Refiner Volumes of Aviation Fuels, Kerosene, No. 1...

    U.S. Energy Information Administration (EIA) Indexed Site

    54.8 419.0 45,096.6 8,762.5 604.1 4,549.2 615.6 3,730.7 3,926.0 38,286.0 February ... 179.4 498.6 44,645.3 9,079.3 849.8 4,868.6 600.3 2,983.7 4,000.8...

  16. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    1996... 10.7 11.1 26.1 20.5 8.0 54.6 1997 January... 11.3 11.8 27.2 19.8 7.3 54.3 February.. 12.1 12.6 28.3 20.7 6.9 55.9 March..... 12.4 12.9 28.4 21.2 7.4 57.0 April........

  17. FTCP Quarterly Report on Federal Technical Capability, July 3, 2014 |

    Office of Environmental Management (EM)

    Department of Energy July 3, 2014 FTCP Quarterly Report on Federal Technical Capability, July 3, 2014 This Quarterly Report on the Federal Technical Capability Program (FTCP) contains information on the status of qualifications in the Technical Qualification Program (TQP) and technical skill gaps, on a quarterly basis. Report also displays trend data for overall TQP qualification and staffing shortfalls. PDF icon Quarterly Report on Federal Technical Capability 7-3-2014 More Documents &

  18. 06 Run R1.xls

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    16 11 14 AP 7 8 8 15 16 13 AP 12 11 14 MA 1 6 AP 1 16 MA 6 8 9 2 9 12 MA AP 21 25 26 24 23 22 20 Dwn 4pm 24 26 29 28 27 27 28 29 30 2 4 3 10 3 8 9 26 27 23 24 25 3 MA 7 3 3 4 1 1...

  19. MEMORANDU TO: FILE FHOM: SUBJECT:

    Office of Legacy Management (LM)

    ' .- _. I _ ' 1.3 7 -3 , MEMORANDU TO: FILE FHOM: SUBJECT: Curre"t: Ll&k&&d ________ l- ; if yes, date contacted ___ 0 Production scale testing Cl Pilot Scale 0 Bench Scale Process 0 Theoretical Studies 0 Sample & Analysis 0 Production 0 Disposal /Storage TYPE OF CONTRACT --------------_- 0 Prime 13 Subcontract& 0 Purchase Order 0 Cl Facility Type 0 Manufacturing 0 University 0 Research Organization *i Government Sponsored Facility 0 Other --------------_-----_ Other

  20. Microsoft Word - Final Report 7-10-08.doc

    Office of Environmental Management (EM)

    Management Controls over Monitoring and Closeout of Small Business Innovation Research Phase II Grants OAS-M-08-09 July 2008 REPORT ON MANAGEMENT CONTROLS OVER MONITORING AND CLOSEOUT OF SMALL BUSINESS INNOVATION RESEARCH PHASE II GRANTS TABLE OF CONTENTS SBIR Phase II Grants Details of Finding 1 Recommendations and Comments 3 Appendices 1. Objective, Scope, and Methodology 5 2. Related Audit Report 7 3. Management Comments 8 SBIR PHASE II GRANTS Page 1 Details of Finding Grant Administration

  1. Buildings Energy Data Book

    Buildings Energy Data Book [EERE]

    7.1 National Legislation 7.2 Federal Tax Incentives 7.3 Efficiency Standards for Residential HVAC 7.4 Efficiency Standards for Commercial HVAC 7.5 Efficiency Standards for Residential Appliances 7.6 Efficiency Standards for Lighting 7.7 Water Use Standards 7.8 State Building Energy Codes 8Water 9Market Transformation Glossary Acronyms and Initialisms Technology Descriptions Building Descriptions Other Data Books Biomass Energy Transportation Energy Power Technologies Hydrogen Download the Entire

  2. Buildings Energy Data Book: 2.2 Residential Sector Characteristics

    Buildings Energy Data Book [EERE]

    6 Residential Heated Floorspace, as of 2005 (Percent of Total Households) Floorspace (SF) Fewer than 500 6% 500 to 999 26% 1,000 to 1,499 24% 1,500 to 1,999 16% 2,000 to 2,499 9% 2,500 to 2,999 7% 3,000 or more 11% Total 100% Source(s): EIA, 2005 Residential Energy Consumption Survey, Oct. 2008, Table HC1-3.

  3. Synthesis and crystal structure of (NH{sub 4}){sub 3}[UO{sub 2}(CH{sub 3}COO){sub 3}]{sub 2}[UO{sub 2}(CH{sub 3}COO)(NCS){sub 2}(H{sub 2}O)

    SciTech Connect (OSTI)

    Serezhkina, L. B.; Peresypkina, E. V.; Virovets, A. V.; Karasev, M. O.

    2010-01-15

    Single crystals of the compound (NH{sub 4}){sub 3}[UO{sub 2}(CH{sub 3}COO){sub 3}]{sub 2}[UO{sub 2}(CH{sub 3}COO)(NCS){sub 2}(H{sub 2}O)] (I) are synthesized, and their structure is investigated using X-ray diffraction. Compound I crystallizes in the monoclinic system with the unit cell parameters a = 18.3414(6) A, b = 16.3858(7) A, c = 12.4183(5) A, {beta} = 92.992(1){sup o}, space group C2/c, Z = 4, V = 3727.1(3) A{sup 3}, and R = 0.0253. The uranium-containing structural units of crystals I are mononuclear complexes of two types with an island structure, i.e., the [UO{sub 2}(CH{sub 3}COO){sub 3}]{sup -} anionic complexes belonging to the crystal-chemical group (AB{sub 3}{sup 01} = UO{sub 2}{sup 2+}, B{sup 01} = CH{sub 3}COO{sup -}) of the uranyl complexes and the [UO{sub 2}(CH{sub 3}COO)(NCS){sub 2}(H{sub 2}O)]{sup -} anionic complexes belonging to the crystal-chemical group AB{sup 01}M{sub 3}{sup 1} (A = UO{sub 2}{sup 2+}, B{sup 01} = CH{sub 3}COO{sup -}, M{sup 1} = NCS{sup -} or H{sub 2}O).

  4. Studies of Secondary Melanoma on C57BL/6J Mouse Liver Using 1H NMR Metabolomics

    SciTech Connect (OSTI)

    Feng, Ju; Isern, Nancy G.; Burton, Sarah D.; Hu, Jian Z.

    2013-10-31

    NMR metabolomics, consisting of solid state high resolution (hr) magic angle spinning (MAS) 1H NMR (1H hr-MAS), liquid state high resolution 1H-NMR, and principal components analysis (PCA) has been used to study secondary metastatic B16-F10 melanoma in C57BL/6J mouse liver . The melanoma group can be differentiated from its control group by PCA analysis of the absolute concentrations or by the absolute peak intensities of metabolites from either 1H hr-MAS NMR data on intact liver tissues or liquid state 1H-NMR spectra on liver tissue extracts. In particular, we found that the absolute concentrations of alanine, glutamate, creatine, creatinine, fumarate and cholesterol are elevated in the melanoma group as compared to controls, while the absolute concentrations of succinate, glycine, glucose, and the family of linear lipids including long chain fatty acids, total choline and acylglycerol are decreased. The ratio of glycerophosphocholine to phosphocholine is increased by about 1.5 fold in the melanoma group, while the absolute concentration of total choline is actually lower in melanoma mice. These results suggest the following picture in secondary melanoma metastasis: Linear lipid levels are decreased by beta oxidation in the melanoma group, which contributes to an increase in the synthesis of cholesterol, and also provides an energy source input for TCA cycle. These findings suggest a link between lipid oxidation, the TCA cycle and the hypoxia-inducible factors (HIF) signal pathway in tumor metastases. Thus this study indicates that the metabolic profile derived from NMR analysis can provide a valuable bio-signature of malignancy and cell hypoxia in metastatic melanoma.

  5. A new anti-tumor strategy based on in vivo tumstatin overexpression after plasmid electrotransfer in muscle

    SciTech Connect (OSTI)

    Thevenard, Jessica; Mir, Lluis M.; Dupont-Deshorgue, Aurlie; Monboisse, Jean-Claude; Brassart-Pasco, Sylvie

    2013-03-22

    Highlights: ? A new therapeutic strategy based on tumstatin in vivo overexpression is proposed. ? pVAX1tumstatin electrotransfer in muscle mediates protein expression in muscle. ? A substantial expression of tumstatin is detected in the serum of electrotransfected mice. ? Tumstatin overexpression decreases tumor growth and increases mouse survival. -- Abstract: The NC1 domains from the different ?(IV) collagen chains were found to exert anti-tumorigenic and/or anti-angiogenic activities. A limitation to the therapeutic use of these matrikines is the large amount of purified recombinant proteins, in the milligram range in mice that should be administered daily throughout the experimental procedures. In the current study, we developed a new therapeutic approach based on tumstatin (NC1?3(IV)) overexpression in vivo in a mouse melanoma model. Gene electrotransfer of naked plasmid DNA (pDNA) is particularly attractive because of its simplicity, its lack of immune responsiveness and its safety. The pDNA electrotransfer in muscle mediates a substantial gene expression that lasts several months. A pVAX1 vector containing the tumstatin cDNA was injected into the legs of C57BL/6 mice and submitted to electrotranfer. Sera were collected at different times and tumstatin was quantified by ELISA. Tumstatin secretion reached a plateau at day 21 with an expression level of 12 ?g/mL. For testing the effects of tumstatin expression on tumor growth in vivo, B16F1 melanoma cells were subcutaneously injected in mice 7 days after empty pVAX1 (Mock) or pVAX1tumstatin electrotransfer. Tumstatin expression triggered a large decrease in tumor growth and an increase in mouse survival. This new therapeutic approach seems promising to inhibit tumor progression in vivo.

  6. Constraining the Ly? escape fraction with far-infrared observations of Ly? emitters

    SciTech Connect (OSTI)

    Wardlow, Julie L.; Calanog, J.; Cooray, A.; Malhotra, S.; Zheng, Z.; Rhoads, J.; Finkelstein, S.; Bock, J.; Bridge, C.; Ciardullo, R.; Gronwall, C.; Conley, A.; Farrah, D.; Gawiser, E.; Heinis, S.; Ibar, E.; Ivison, R. J.; Marsden, G.; Oliver, S. J.; Riechers, D.; and others

    2014-05-20

    We study the far-infrared properties of 498 Ly? emitters (LAEs) at z = 2.8, 3.1, and 4.5 in the Extended Chandra Deep Field-South, using 250, 350, and 500 ?m data from the Herschel Multi-tiered Extragalactic Survey and 870 ?m data from the LABOCA ECDFS Submillimeter Survey. None of the 126, 280, or 92 LAEs at z = 2.8, 3.1, and 4.5, respectively, are individually detected in the far-infrared data. We use stacking to probe the average emission to deeper flux limits, reaching 1? depths of ?0.1 to 0.4 mJy. The LAEs are also undetected at ?3? in the stacks, although a 2.5? signal is observed at 870 ?m for the z = 2.8 sources. We consider a wide range of far-infrared spectral energy distributions (SEDs), including an M82 and an Sd galaxy template, to determine upper limits on the far-infrared luminosities and far-infrared-derived star formation rates of the LAEs. These star formation rates are then combined with those inferred from the Ly? and UV emission to determine lower limits on the LAEs' Ly? escape fraction (f {sub esc}(Ly?)). For the Sd SED template, the inferred LAEs f {sub esc}(Ly?) are ? 30% (1?) at z = 2.8, 3.1, and 4.5, which are all significantly higher than the global f {sub esc}(Ly?) at these redshifts. Thus, if the LAEs f {sub esc}(Ly?) follows the global evolution, then they have warmer far-infrared SEDs than the Sd galaxy template. The average and M82 SEDs produce lower limits on the LAE f {sub esc}(Ly?) of ?10%-20% (1?), all of which are slightly higher than the global evolution of f {sub esc}(Ly?), but consistent with it at the 2?-3? level.

  7. Manufacturing Energy and Carbon Footprint - Sector: Cement (NAICS 327310), October 2012 (MECS 2006)

    Broader source: Energy.gov (indexed) [DOE]

    0 Nonprocess Losses 471 154 Steam Distribution Losses 4 5 Nonprocess Energy 341 Electricity Generation Steam Generation 471 0 Prepared for the Advanced Manufacturing Office (AMO) by Energetics Incorporated 14 353 41 Generation and Transmission Losses Generation and Transmission Losses 0 89 Onsite Generation 367 345 37 382 130 0 26 0.0 7.8 7.8 3.4 3.4 27.2 34.1 1.1 39 30.8 38.6 0.1 Fuel Total Energy Total Primary Energy Use: Total Combustion Emissions: TBtu MMT CO 2 e Energy use data source: 2006

  8. South Carolina Natural Gas Delivered for the Account of Others

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    1,429 1,748 1,973 2,007 1,969 1,832 1987-2014 % of All Comm. Deliveries for the Acct. of Others 6.5 7.2 8.9 9.4 8.3 7.2 1989-2014 Industrial Deliveries 33,892 39,347 42,026 44,529 45,587 46,989 1982-2014 % of All Ind. Deliveries for the Acct. of Others 52.4 53.6 54.6 54.9 54.4 56.4

  9. U.S. Sales for Resale Refiner Residual Fuel Oil and No. 4 Fuel Sales

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    Volumes 9,792.0 10,714.0 12,200.6 8,833.1 9,020.9 8,044.4 1983-2014 Sulfur Less Than or Equal to 1% 2,860.6 2,583.8 3,410.3 2,073.8 2,296.2 2,427.5 1983-2014 Sulfur Greater Than 1% 6,931.4 8,130.3 8,790.3 6,759.3 6,724.7 5,616.9 1983-2014 No. 4 Fuel Oil 121.3 W 103.7 W 104.8 100.8

  10. 2D MODIFICATION OF A CONTRACT

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    8 3. EFFECTIVE DATE (M/D/Y) See Block 16C 4. REQUISITION/PURCHASE REQ. NO. See Block 14 5. PROJECT NO. (If applicable) 6. ISSUED BY CODE 7. ADMINISTERED BY (If other than Item 6) CODE U.S. Department of Energy Office of River Protection P. O. Box 450, MS H6-60 Richland, WA 99352 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, State and ZIP code) 9A. AMENDMENT OF SOLICITATION NO. Bechtel National, Inc. 2435 Stevens Center Place 9B. DATED (SEE ITEM 11) Richland, WA 99352 10A. MODIFICATION

  11. 2D MODIFICATION OF A CONTRACT

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    8 3. EFFECTIVE DATE (M/D/Y) See Block 16C 4. REQUISITION/PURCHASE REQ. NO. 03RV14136.005 5. PROJECT NO. (If applicable) 6. ISSUED BY CODE 7. ADMINISTERED BY (If other than Item 6) CODE U.S. Department of Energy Office of River Protection P. O. Box 450, MS H6-60 Richland, WA 99352 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, State and ZIP code) 9A. AMENDMENT OF SOLICITATION NO. Bechtel National, Inc. 2435 Stevens Center 9B. DATED (SEE ITEM 11) Richland, WA 99352 10A. MODIFICATION OF

  12. Table HC6.10 Home Appliances Usage Indicators by Number of Household Members, 2005

    Gasoline and Diesel Fuel Update (EIA)

    0 Home Appliances Usage Indicators by Number of Household Members, 2005 Total.............................................................................. 111.1 30.0 34.8 18.4 15.9 12.0 Cooking Appliances Frequency of Hot Meals Cooked 3 or More Times A Day........................................... 8.2 1.4 1.9 1.4 1.0 2.4 2 Times A Day........................................................ 24.6 4.3 7.6 4.3 4.8 3.7 Once a Day............................................................ 42.3 9.9

  13. Table HC9.11 Home Electronics Characteristics by Climate Zone, 2005

    Gasoline and Diesel Fuel Update (EIA)

    11 Home Electronics Characteristics by Climate Zone, 2005 Million U.S. Housing Units Total................................................................... 111.1 10.9 26.1 27.3 24.0 22.8 Personal Computers Do Not Use a Personal Computer ............... 35.5 3.2 8.3 8.9 7.7 7.5 Use a Personal Computer............................. 75.6 7.8 17.8 18.4 16.3 15.3 Number of Desktop PCs 1.............................................................. 50.3 5.1 12.4 11.9 10.5 10.4

  14. Total...............................................................

    Gasoline and Diesel Fuel Update (EIA)

    0.7 21.7 6.9 12.1 Personal Computers Do Not Use a Personal Computer ........... 35.5 14.2 7.2 2.8 4.2 Use a Personal Computer......................... 75.6 26.6 14.5 4.1 7.9 Number of Desktop PCs 1.......................................................... 50.3 18.2 10.0 2.9 5.3 2.......................................................... 16.2 5.5 3.0 0.7 1.8 3 or More............................................. 9.0 2.9 1.5 0.5 0.8 Number of Laptop PCs

  15. Total...............................................................

    Gasoline and Diesel Fuel Update (EIA)

    47.1 19.0 22.7 22.3 Personal Computers Do Not Use a Personal Computer ........... 35.5 16.9 6.5 4.6 7.6 Use a Personal Computer......................... 75.6 30.3 12.5 18.1 14.7 Number of Desktop PCs 1.......................................................... 50.3 21.1 8.3 10.7 10.1 2.......................................................... 16.2 6.2 2.8 4.1 3.0 3 or More............................................. 9.0 2.9 1.4 3.2 1.6 Number of Laptop PCs

  16. Total...................................................................

    Gasoline and Diesel Fuel Update (EIA)

    Air-Conditioning Equipment 1, 2 Central System............................................... 65.9 47.5 4.0 2.8 7.9 3.7 Without a Heat Pump.................................. 53.5 37.8 3.4 2.2 7.0 3.1 With a Heat Pump....................................... 12.3 9.7 0.6 0.5 1.0 0.6 Window/Wall Units.......................................... 28.9 14.9 2.3 3.5 6.0 2.1 1 Unit........................................................... 14.5 6.6 1.0 1.6 4.2 1.2 2

  17. Total.......................................................................

    Gasoline and Diesel Fuel Update (EIA)

    0.6 15.1 5.5 Personal Computers Do Not Use a Personal Computer ................... 35.5 6.9 5.3 1.6 Use a Personal Computer................................ 75.6 13.7 9.8 3.9 Number of Desktop PCs 1.................................................................. 50.3 9.3 6.8 2.5 2.................................................................. 16.2 2.9 1.9 1.0 3 or More..................................................... 9.0 1.5 1.1 0.4 Number of Laptop PCs

  18. Total...........................................................................

    Gasoline and Diesel Fuel Update (EIA)

    0.6 15.1 5.5 Do Not Have Cooling Equipment............................. 17.8 4.0 2.4 1.7 Have Cooling Equipment.......................................... 93.3 16.5 12.8 3.8 Use Cooling Equipment........................................... 91.4 16.3 12.6 3.7 Have Equipment But Do Not Use it.......................... 1.9 0.3 Q Q Air-Conditioning Equipment 1, 2 Central System........................................................ 65.9 6.0 5.2 0.8 Without a Heat

  19. Total.............................................................................

    Gasoline and Diesel Fuel Update (EIA)

    Cooking Appliances Frequency of Hot Meals Cooked 3 or More Times A Day......................................... 8.2 1.4 1.0 0.4 2 Times A Day...................................................... 24.6 5.8 3.5 2.3 Once a Day........................................................... 42.3 10.7 7.8 2.9 A Few Times Each Week...................................... 27.2 5.6 4.0 1.6 About Once a Week.............................................. 3.9 0.9 0.6 0.3 Less Than Once a

  20. Total.................................................................................

    Gasoline and Diesel Fuel Update (EIA)

    ... 111.1 20.6 15.1 5.5 Do Not Have Cooling Equipment................................. 17.8 4.0 2.4 1.7 Have Cooling Equipment............................................. 93.3 16.5 12.8 3.8 Use Cooling Equipment............................................... 91.4 16.3 12.6 3.7 Have Equipment But Do Not Use it............................. 1.9 0.3 Q Q Type of Air-Conditioning Equipment 1, 2 Central System.......................................................... 65.9 6.0 5.2 0.8 Without a Heat