- CURRICULUM VITAE Hokto Kazama, Ph.D.
- Nobuhiko Wagatsuma, Dr. Brain Science Institute,
- (Dynamic Bayesian) (HC+Bootstrap)
- Accurate spike sorting of multiunit recording data based on the robust variational Bayesian clustering Takashi Takekawa, Yoshikazu Isomura and Tomoki Fukai Lab. for Neural Circuit Theory, RIKEN Brain Science Institute
- Available Positions for Young Chief Investigator RIKEN Research Center for Allergy and Immunology (RCAI), Yokohama, Japan
- *Corresponding author. E-mail: tfukai@keyaki.cc.u-tokai.ac.jp. Neurocomputing 26}27 (1999) 687}692
- Layer and frequency dependencies of phase response properties of pyramidal neurons in rat motor cortex
- Abstract. Some synapses between cortical pyramidal neurons exhibit a rapid depression of excitatory
- March 14, 2011 Personnel policies related to the Tohoku Earthquake
- Curriculum Vitae Hideyuki Cteau
- May 31, 2011 RIKEN Emergency Headquarters
- March 18, 2011 Personnel policies related to the Tohoku Earthquake
- Curriculum Vitae 2009, August
- Please use this checklist to ensure all application documents are included and place it in the package with the application documents.
- CV Thomas Knpfel, March 2011 Page 1 of 28
- Zebrafish as a model system for study of fear Hitoshi Okamoto MD, PhD
- Relation between Single Neuron and Population Spiking Statistics and Effects on Network Activity
- *Correspondence address: Department of Information-Communication Engineering, Tamagawa Uni-versity, Tamagawagakuen 6-1-1, Machida, Tokyo 194-8610, Japan. Tel.: 81-463-58-1211/4112; fax: 81-463-
- *Corresponding author. Department of Applied Analysis and Complex Dynamical Systems, Graduate School of Informatics, Kyoto University, Kyoto 606-8501 Japan.
- March 18, 2011 Hiroyuki Kamiguchi, M.D., Ph.D.
- Neural Networks Letter A subthreshold MOS circuit for the LotkaVolterra neural network
- Dynamics of Limit-Cycle Oscillators Subject to General Noise Denis S. Goldobin,1,2
- 351-0198 2 1 12 \240
- Cancellation / postponement of scheduled events and symposiums The following events and symposiums have been cancelled or postponed due the March 11
- LETTER Communicated by David Horn A Stochastic Method to Predict the Consequence of Arbitrary
- Re-entry Permit The immigrations at the airports stated below are currently exercising an emergency procedure for re-entry permit
- Flexible traffic control of the synfire-mode transmission by inhibitory modulation: Nonlinear noise reduction
- Neurocomputing 5860 (2004) 235238 www.elsevier.com/locate/neucom
- FAQ regarding RIKEN's radiation monitoring posts Q: Why does RIKEN have radiation monitoring posts?
- Neuroscience Research 40 (2001) 8796 A possible functional organization of the corticostriatal input
- To all RIKEN personnel On March 11, northeastern Japan was hit by the largest earthquake in our country's
- LETTER Communicated by David Horn A Stochastic Method to Predict the Consequence of Arbitrary
- This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research
- In the aftermath of the Tohoku Pacific Offshore Earthquake The Tohoku Pacific Offshore Earthquake of March 11 was the largest earthquake in
- April 4, 2011 RIKEN Emergency Headquarters
- Micro MacroMeso TGCTCTTATCTTCCTCCCACAGCTC
- CURRICULUM VITAE REIKO MAZUKA
- Abstract: Voltage sensitive Ca2+ channels in brain functions
- Sequence generation in arbitrary temporal patterns from theta-nested gamma oscillations: a model of the basal gangliathalamo-cortical loops
- Neurocomputing 32}33 (2000) 935}939 A model for neural representation of intervals of time
- Neural Networks 23 (2010) 667668 Contents lists available at ScienceDirect
- 17 18 9 20 21 17 18 9 20 21 71,102 67,921 62,334 60,139 59,190 5,531 5,909 5,630 4,464 4,306
- Neurons and neural circuits underlying memory and learning in C. elegans Animals possess an ability of responding to a large repertoire of environmental stimuli for
- current events J. Synchrotron Rad. (2006). 13, 411412 doi:10.1107/S0909049506030470 411
- March 29, 2011 Personnel policies related to the Tohoku Earthquake
- March 15, 2011 Radiation dosage readings from the radiation monitoring posts
- A Neural Correlate of the Processing of Multi-Second Time Intervals in Primate Prefrontal Cortex
- Cellular/Molecular Prototypic Seizure Activity Driven by Mature Hippocampal
- Neural Networks 23 (2010) 752763 Contents lists available at ScienceDirect
- SYNAPTIC MECHANISMS TECHNICAL SPOTLIGHT
- Bidirectional plasticity in fast-spiking GABA circuits by visual experience
- 2009NatureAmerica,Inc.Allrightsreserved. nature neurOSCIenCe advance online publication
- Stochastic Phase Reduction for a General Class of Noisy Limit Cycle Oscillators Jun-nosuke Teramae
- When Does Reward Maximization Lead to Matching Law? Yutaka Sakai1
- LETTER Communicated by Leo Sugrue The Actor-Critic Learning Is Behind the Matching Law
- Structure of Spontaneous UP and DOWN Transitions Self-Organizing in a Cortical Network Model
- Distinct types of ionic modulation of GABA actions in pyramidal cells and interneurons during electrical
- J Comput Neurosci DOI 10.1007/s10827-006-0014-6
- Synchronization of Excitatory Neurons with Strongly Heterogeneous Phase Responses Yasuhiro Tsubo,* Jun-nosuke Teramae, and Tomoki Fukai
- doi:10.1152/jn.00730.200595:2987-3000, 2006. First published 8 February 2006;J Neurophysiol Toru Tsujimoto, Hideki Shimazu and Yoshikazu Isomura
- Journal of Computational Neuroscience 18, 105121, 2005 c 2005 Springer Science + Business Media, Inc. Manufactured in The Netherlands.
- Temporal Characteristics of the Predictive Synchronous Firing Modeled
- Neurocomputing 5860 (2004) 173178 www.elsevier.com/locate/neucom
- INSTITUTE OF PHYSICS PUBLISHING NETWORK: COMPUTATION IN NEURAL SYSTEMS Network: Comput. Neural Syst. 15 (2004) 112 PII: S0954-898X(04)64535-0
- LETTER Communicated by Carson Chow Synchrony of Fast-Spiking Interneurons Interconnected by
- Physiologically realistic modelling of a mechanism for neural representation of intervals of time
- 12 Springer Dear Author
- LETTER Communicated by Alain Destexhe Gamma Rhythmic Bursts: Coherence Control in Networks of
- Neurocomputing 4446 (2002) 103108 www.elsevier.com/locate/neucom
- Neurocomputing 4446 (2002) 473478 www.elsevier.com/locate/neucom
- THE ROLE OF Ca2 -DEPENDENT CATIONIC CURRENT IN
- Neurocomputing 38}40 (2001) 1489}1493 On experimental predictions from a model for a neural
- *Corresponding author. E-mail address: kitano@brain.inf.eng.tamagawa.ac.jp (K. Kitano).
- Neurocomputing 38}40 (2001) 615}619 Neuronal analog-digital information transformation
- VOLUME 86, NUMBER 17 P H Y S I C A L R E V I E W L E T T E R S 23 APRIL 2001 Neural Mechanism for a Cognitive Timer
- BioSystems 55 (2000) 5964 A model for neural representation of temporal duration
- Jun-nosuke Teramae Deputy Laboratory Head,
- Yasuhiro Tsubo, Ph. D. Postdoctoral Researcher,
- CURRICULUM VITAE Name: Siu Kang, PhD , ,
- March 11, 2011 RIKEN Emergency Headquarters
- March 14, 2011 Report on situation at RIKEN following the Tohoku Earthquake
- March 30, 2011 Akihiro Fujita, Director
- Form 1 FY2012 RIKEN Initiative Research Program Unit Leader Application
- After sealing this completed form in an envelope, write on the envelope in red ink "Advisor Recommendation" then place the envelope in with the application, or you may have it mailed separately by your advisor. If the
- 2001 Special issue FokkerPlanck approach to the pulse packet propagation in synre chain
- Two-State Membrane Potential Transitions of Striatal Spiny Neurons as Evidenced by Numerical Simulations and
- J. theor. Biol. (2002) 217, 114 doi:10.1006/yjtbi.3024, available online at http://www.idealibrary.com on
- Protein Data Bank Single Molecules
- 10:30 am, March 16, 2011 Radiation dosage readings from the radiation monitoring posts
- March 22, 2011 Personnel policies related to the Tohoku Earthquake
- Hirase CV (June 2011) Name: Hajime Hirase, Ph.D.
- Systematic exploration of transcriptional networks: putting the function in functional genomics. Genevieve Konopka and Daniel H. Geschwind. Program in Neurogenetics, Department of
- Temporal Precision of Spike Response to Fluctuating Input in Pulse-Coupled Networks of Oscillating Neurons
- Biol Cybern (2008) 99:105114 DOI 10.1007/s00422-008-0246-9
- Progress of Theoretical Physics, Vol. 109, No. 1, January 2003 System-Size Effects on the Collective Dynamics of Cell Populations
- Robust variational Bayes with wavelet transform improves accuracy and
- Robust and accurate spike sorting with matching pursuit and variational Bayesian clustering Introduction
- Typeset with jpsj2.cls Full Paper Controlling synfire chain by inhibitory synaptic input
- COMPUTATIONAL NEUROSCIENCE NEUROREPORT 0959-4965 & Lippincott Williams & Wilkins Vol 11 No 16 9 November 2000 3457
- Special Postdoctoral Researcher Laboratory for Neural Circuit Theory
- Progress of Theoretical Physics Supplement 1 Synchronization properties of slow cortical oscillations
- Effective long-time phase dynamics of limit-cycle oscillators driven by weak colored noise
- Flexible traffic control of the synfire-mode transmission by inhibitory modulation nonlinear noise reduction
- Neurocomputing 5254 (2003) 285288 www.elsevier.com/locate/neucom
- Variability v.s. synchronicity of neuronal activity in local cortical network models with different wiring topologies
- Update from the RIKEN emergency Headquarters March 24, 2011
- Random and systematic dilutions of synaptic connections in a neural network with a nonmonotonic response function
- Recurrent Network Models for Perfect Temporal Integration of Fluctuating Correlated Inputs
- Neurocomputing 4446 (2002) 343351 www.elsevier.com/locate/neucom
- LEARNING AND MEMORY IN NEURONAL CIRCUITS OF FEAR Andreas Lthi
- J Comput Neurosci (2007) 22:301312 DOI 10.1007/s10827-006-0014-6
- doi:10.1152/jn.00238.200595:2013-2019, 2006. First published 7 December 2005;J Neurophysiol Yoko Fujiwara-Tsukamoto, Yoshikazu Isomura and Masahiko Takada
- 360 Progress of Theoretical Physics Supplement No. 161, 2006 Noise Induced Phase Synchronization
- 2001 Special issue FokkerPlanck approach to the pulse packet propagation in synre chain
- Opening Hours of Wako Campus welfare facilities related to the recent earthquake Welfare Section 3/31(Thu) 4/1(Fri) 4/4(Mon)
- Curriculum Vitae Kensuke Arai
- Robustness of the Noise-Induced Phase Synchronization in a General Class of Limit Cycle Oscillators
- Communicated by Bard Ermentrout A Simple Neural Network Exhibiting Selective Activation
- RIKEN Borrowing and Reproduction Request Form Name of person in charge (applicant)
- Interplay between a phase response curve and spike-timing-dependent plasticity leading to wireless clustering
- Molecular and cellular cognition: integrating explanations of behavior and developing treatments for cognitive disorders
- Tsutomu Hashikawa Head, Support Unit for Neuromorphological Analysis
- Neural Networks 19 (2006) 10911105 www.elsevier.com/locate/neunet
- This leaflet was created with support from the following organizations: Fujitsu Ltd.; Industrial Committee for Super Computing Promotion (ICSCP); Institute for Molecular Science (IMS);
- J Comput Neurosci (2007) 23:189200 DOI 10.1007/s10827-007-0027-9
- Plan for energy conservation measures at the Wako campus for FY 2011 (revised)
- Synchrony of limit-cycle oscillators induced by random external impulses Hiroya Nakao,* Ken-suke Arai, and Ken Nagai
- Strong desynchronizing effects of weak noise in globally coupled systems Jun-nosuke Teramae and Yoshiki Kuramoto
- Self-organization of memory activity through spike-timing-dependent plasticity
- Name of Applicant RIKEN Initiative Research Program Unit Leader
- Neural Circuit Genetics of Hippocampal Memory in Mice
- Atsushi Iriki received his Ph.D. in Neurophysiology from Tokyo Medical and Dental University in 1986. He held research associate positions at the Tokyo Medical and
- September 1st CURRICULUM VITAE
- Sequential associative memory with nonuniformity of the layer sizes Jun-nosuke Teramae* and Tomoki Fukai
- Neuron 52, 871882, December 7, 2006 2006 Elsevier Inc. DOI 10.1016/j.neuron.2006.10.023 Integration and Segregation of Activity
- A1. Hideyuki Kato and Satoru Saito, Generalization of Boson-Fermion Equivalence and Fay's Addition Theorem, Lett. Math. Phys., 18 (1989) 177-183, /October/No.3.
- Controlling Synfire Chain by Inhibitory Synaptic Input Takashi SHINOZAKI1
- Behavioral/Systems/Cognitive Balanced Excitatory and Inhibitory Inputs to Cortical
- Neural Networks Letter Self-organized two-state membrane potential transitions in a network
- Hannah Monyer Genetic modification of interneuron activity and their role in hippocampus-
- Near Scale-Free Dynamics in Neural Population Activity of Waking/Sleeping Rats Revealed by Multiscale Analysis
- Temporal Integration by Stochastic Recurrent Network Dynamics With Bimodal Neurons
- A Method to Construct Visual Recognition Algorithms on the Basis of Neural Activity Data
- COMPUTATIONAL NEUROSCIENCE A neuron in V2 or V4 is known to respond strongly to a bar
- current events 686 doi:10.1107/S0909049511022898 J. Synchrotron Rad. (2011). 18, 686687
- July 8, 2011 Harima Institute
- 1963 11 23 47 179-0072
- 1530-1720 1720-1930Poster session
- June 22, 2011 RIKEN Emergency Headquarters
- July 4, 2011 Sendai Facility
- Funding Program for World-Leading Innovative R&D on Science and Technology (FIRST) Strategic Exploitation of Neuro-Genetics for Emergence of the Mind
- Publications (Tomoki FUKAI) 1. Wagatsuma N, Potjans TC, Diesmann M, Fukai T (2011) Layer-dependent attentional
- Publications (Tomoki FUKAI) 1. Wagatsuma N, Potjans TC, Diesmann M, Fukai T (2011) Layer-dependent attentional
- CPU128GFLOPS 8 10PetaFLOPS
- NMFLAB for Signal Processing Toolbox for
- Nonnegative Matrix and Tensor Factorizations
- Emergency power-saving measures for summer 2011: AICS Advanced Institute for Computational Sciences
- Dendritic Slow Dynamics Enables Localized Cortical Activity to Switch between Mobile and Immobile Modes
- p87,p91,p92 p97 p103 p106 p97,p103,p106
- June 1, 2011 CURRICULUM VITAE
- June 30, 2011 RIKEN Tsukuba Institute
- Emergency power-saving measures for summer 2011: Yokohama June 24, 2011
- June 17, 2011 RIKEN Kobe Institute
- Curriculum Vitae Name: Takaomi C. Saido
- October 11, 2011 Hiroyuki Kamiguchi, M.D., Ph.D.
- Curriculum Vitae Taro Toyoizumi, Ph.D.
- Chitoshi Itakura Director, Research Resources Center,
- Hidenori Kimura, D. Eng. Director, RIKEN BSI-TOYOTA Collaboration Center (BTCC)
- Original set Submit this checklist together with your application
- A Method to Construct Visual Recognition Algorithms on the Basis of Neural Activity Data
- FY 2012 JRAApplication Applicant (Head of RIKEN host laboratory)
- VISITING RIKEN BSI RIKEN Brain Science Institute 2-1 Hirosawa Wako City, Saitama 351-0198 JAPAN
- FY 2012 JRAApplication Applicant (Head of RIKEN host laboratory)
- Influences of membrane properties on phase response curve and synchronization stability in a model globus
- A b o u t u s In life sciences research, we are asked to contribute to a safe and secure lifestyle and to overcome the
- Curriculum Vitae Name: Jun Tani, Ph.D.
- Shingo Shimoda Unit leader
- 1963 11 23 47 179-0072
- Shigeyoshi Itohara Senior Team Leader, Laboratory for Behavioral Genetics
- Behavioral/Systems/Cognitive Hippocampal Polysynaptic Computation
- Masanori Murayama Date of birth: 26 October 1977
- Stability versus Neuronal Specialization for STDP: Long-Tail Weight Distributions Solve the Dilemma
- Neural Networks 24 (2011) 950960 Contents lists available at SciVerse ScienceDirect
- FY 2012 JRAApplication Applicant (Head of RIKEN host laboratory)
- BSI JST teramae@riken.jp)
- Dendritic Slow Dynamics Enables Localized Cortical Activity to Switch between Mobile and Immobile Modes
- II. Germline Stem Cells and their Differential Regulation: towards Production of Recombinant Model Animals
- Lecture 13, 16 Monday, July 9, and Tuesday, July 10 Gustavo Deco
- The 6th RIKEN Advisory Council Members Core RAC Members
- (ISLiM) 2011 (2011.12.21-22) (ISLiM) 2011 (2011.12.21-22)
- The Seventh RIKEN Advisory Council InterContinental Tokyo Bay, April 22 24, 2009
- How I Became an Associate Chief Scientist I was particularly attracted by the fact that with this position I would
- SuperheavySuperheavy Element LaboratoryElement Laboratory Associate Chief ScientistAssociate Chief Scientist
- RSC Seminar "Biological studies with photon light sources present and future perspectives (I)" An ultimate goal for life science is understanding of cellular functions by "looking" at
- Recommendations Meeting of the RIKEN Advisory Council (RAC)
- The 8th RIKEN Advisory Council October 25-28, 2011, InterContinental Tokyo Bay
- THE INSTITUTE OF ELECTRONICS, INFORMATION AND COMMUNICATION ENGINEERS
- (ISLiM) 2011 (2011.12.21-22) (ISLiM) 2011 (2011.12.21-22)
- as of 7 Apr 06 The 6th RAC Meeting
- 1963 11 23 48 179-0072
- Curriculum Vitae Hideyuki Cteau
- RIKEN Advisory Council RIKEN Advisory Council: 7 -9 June 2004: Tokyo, Japan
- Available Positions for Young Chief Investigators RIKEN Research Center for Allergy and Immunology (RCAI), Yokohama, Japan
- (ISLiM) 2011 (2011.12.21-22) Platypus MM/CG
- RIKEN: Leading Japanese Science to Global Pre-eminence.
- RIKEN: LAYING THE FOUNDATION FOR CREATIVE ADVANCEMENT
- (ISLiM) 2011 (2011.12.21-22) M-1: Platypus-MM/CG
- Members of the 7th RIKEN Advisory Council Name Main position and title
- Colwell, Rita R. Distinguished University Professor
