Palczewski, Krzysztof - Department of Pharmacology, Case Western Reserve University

• Blind Dogs That Can See Pharmacological Treatment of Leber Congenital Amaurosis
• Dual-substrate Specificity Short Chain Retinol Dehydrogenases from the Vertebrate Retina*S
• Lecithin:Retinol Acyltransferase Is Responsible for Amidation of Retinylamine, a Potent Inhibitor of the Retinoid Cycle*
• Changes in Biological Activity and Folding of Guanylate Cyclase-Activating Protein 1 as a Function of Calcium
• Hippocalcin in the olfactory epithelium: a mediator of second messenger signalingq
• -binding proteins in the retina: from discovery to etiology of human disease1
• A concept for G protein activation by G protein-coupled receptor dimers: the transducin/rhodopsin interface
• Z .Biochimica et Biophysica Acta 1342 1997 164174 Calcium binding to recoverin: implications for secondary structure and
• Aberrant Metabolites in Mouse Models of Congenital Blinding Diseases: Formation and Storage of Retinyl Esters
• Journal of Structural Biology 158 (2007) 455462 www.elsevier.com/locate/yjsbi
• Retinyl Ester Storage Particles (Retinosomes) from the Retinal Pigmented Epithelium Resemble Lipid Droplets in Other
• Supplement Jastrzebska et al. Materials and Methods
• 210 nature neuroscience volume 5 no 3 march 2002 Calcium entry into cells through voltage-gated Ca2+ channels
• SUPPLEMENTAL FIGURE LEGENDS SUPPLEMENTAL FIG S1. Lrat-/-
• Accelerated Publications Identification of a Guanylyl Cyclase-Activating Protein-Binding Site within the
• Images of photoreceptors in living primate eyes using adaptive optics two-photon
• THEJOURNALOFCELLBIOLOGY JCB: ARTICLE
• Phosphorylation of RGS9-1 by an Endogenous Protein Kinase in Rod Outer Segments*
• Gene 240 (1999) 2334 www.elsevier.com/locate/gene
• Topology and Membrane Association of Lecithin: Retinol Acyltransferase*S
• THEJOURNALOF BIOLOGICALCHEMISTRY Q 1993by The American Society for Biochemistry and Molecular Biology, Inc.
• The FASEB Journal Silver Anniversary Review Focus on vision: 3 decades of remarkable
• Phototransduction: crystal clear Kevin D. Ridge1
• Role of guanylate cyclase-activating proteins (GCAPs) in setting the flash sensitivity of rod photoreceptors
• Molecular Characterization of a Novel Short-chain Dehydrogenase/ Reductase That Reduces All-trans-retinal*
• Evidence for RPE65-independent vision in the cone-dominated zebrafish retina
• Published: March 30, 2011 r 2011 American Chemical Society 3764 dx.doi.org/10.1021/bi200245t |Biochemistry 2011, 50, 37643776
• Lentiviral Expression of Retinal Guanylate Cyclase-1 (RetGC1) Restores Vision
• Accelerated Publications Light Inhibition of Bovine Retinal Rod Guanylyl Cyclase Mediated by
• Evolutionary analysis of rhodopsin and cone pigments: connecting the three-dimensional structure with spectral tuning and signal transfer
• Structure 18 Supplemental Information
• THEJOURNALof BIOLOGICALCHEMISTRY Vol. 263, No. 28, Issue of October 5, pp. 14067-14073,1988 0 1988by The American Society for Biochemistry andMolecular Biology, Inc. Printed in U.S.A.
• An Acyl-covalent Enzyme Intermediate of Lecithin:Retinol Acyltransferase*S
• A novel GCAP1(N104K) mutation in EF-hand 3 (EF3) linked to autosomal dominant cone dystrophy
• G protein-coupled receptor drug discovery: Implications from the crystal structure of rhodopsin
• Molecular and Cellular Endocrinology 171 (2001) 111117 Pan1b (17bHSD11)-enzymatic activity and distribution in the lung
• SUPPLEMENTAL DATA ISX is a retinoic acid sensitive gatekeeper that controls intestinal
• THEJOURNALOF BIOLOGICALCHEMISTRY 0 1991by The American Society for Biochemistry and Molecular Bioloa, Inc.
• Light-Driven Cone Arrestin Translocation in Cones of Postnatal Guanylate Cyclase-1 Knockout Mouse Retina
• M 1 2 3 4 Imanishi et al. Supplement Figure 1
• Modulation of Molecular Interactions and Function by Rhodopsin Palmitylation Paul S.-H. Park,*,,
• Mechanisms of Opsin Activation* (Received for publication, March 7, 1996, and in revised form, May 14, 1996)
• Molecular Forms of Human Rhodopsin Kinase (GRK1)* (Received for publication, July 21, 1997, and in revised form, December 9, 1997)
• The biochemical and structural basis for trans-to-cis isomerization of
• Stabilizing Function for Myristoyl Group Revealed by the Crystal Structure of a Neuronal Calcium
• Supplementary figures Noninvasive multiphoton fluorescence microscopy resolves retinol
• Vision Research 38 (1998) 13251333 Reduction of all-trans-retinal limits regeneration of visual pigment
• Retinoids for treatment of retinal Krzysztof Palczewski
• Kinetics of Visual Pigment Regeneration in Excised Mouse Eyes and in Mice with a Targeted Disruption of the Gene Encoding Interphotoreceptor Retinoid-Binding
• Diversity of Guanylate Cyclase-Activating Proteins (GCAPs) in Teleost Fish: Characterization of Three Novel GCAPs (GCAP4, GCAP5, GCAP7) from
• This article was originally published in the Encyclopedia of the Eye, published by Elsevier, and the attached copy is provided by Elsevier for the author's
• Photoreceptor guanylate cyclase variants: cGMP production under control
• The G protein-coupled receptor rhodopsin in the native membrane Dimitrios Fotiadisa;1;
• Conserved waters mediate structural and functional activation of family A (rhodopsin-like)
• This article was originally published in a journal published by Elsevier, and the attached copy is provided by Elsevier for the
• GENOMICS 39, 312322 (1997) ARTICLE NO. GE964513
• Usher syndrome IIIA gene clarin-1 is essential for hair cell function and associated neural activation{
• Structures of Rhodopsin Kinase in Different Ligand States Reveal Key Elements Involved in G Protein-coupled Receptor
• Electrostatic Compensation Restores Trafficking of the Autosomal Recessive Retinitis Pigmentosa E150K Opsin
• Limited Roles of Rdh8, Rdh12, and Abca4 in all-trans-Retinal Clearance in Mouse Retina
• Improvement in Rod and Cone Function in Mouse Model of Fundus albipunctatus after Pharmacologic
• Bartl et al. SUPPLEMENTAL DATA FIG. 1S. Comparison of the FTIR difference spectra of the Meta states of rhodopsin reconstituted
• Structural and Enzymatic Aspects of Rhodopsin Phosphorylation* (Received for publication, July 14, 1995, and in revised form, October 4, 1995)
• Light-Induced Conformational Changes of Rhodopsin Probed by Fluorescent Alexa594 Immobilized on the Cytoplasmic Surface
• Supporting Information Structural basis for three-step sequential catalysis by the cholesterol
• >Fig. 1D_lane 1_Mouse_89-4_clone 2_length=399_WT TGGAAGGTCAATGAGGCTCTTTCGAGAAGCAACAGAGCCTGTTTAGCTGAGAAAACTGA
• Conformational Changes in Guanylate Cyclase-Activating Protein 1 Induced
• Rhodopsin Signaling and Organization in Heterozygote Rhodopsin Knockout Mice*S
• Vertebrate Membrane Proteins: Structure, Function, and Insights from Biophysical Approaches
• Glycobiology vol. 20 no. 12 pp. 16431653, 2010 doi:10.1093/glycob/cwq118
• The FASEB Journal Research Communication Isolation and functional characterization of a stable
• Role of the conserved NPxxY(x)5,6F motif in the rhodopsin ground state and during activation
• Retinyl Ester Formation by Lecithin:Retinol Acyltransferase Is a Key Regulator of Retinoid Homeostasis in
• Recovery of Visual Functions in a Mouse Model of Leber Congenital Received for publication, December 26, 2001, and in revised form, March 7, 2002
• Redundant and unique roles of retinol dehydrogenases in the mouse retina
• The FASEB Journal Research Communication A mitochondrial enzyme degrades carotenoids and
• Subscriber access provided by CASE WESTERN RESERVE UNIV Biochemistry is published by the American Chemical Society. 1155 Sixteenth
• TRENDS in Biochemical Sciences Vol.26 No.5 May 2001 http://tibs.trends.com 0968-0004/01/$ see front matter 2001 Elsevier Science Ltd. All rights reserved. PII: S0968-0004(01)01799-6
• Molecular Characterization of a Third Member of the Guanylyl Cyclase-activating Protein Subfamily*
• BIOLOGY OF REPRODUCTION 84, 336341 (2011) Published online before print 29 September 2010.
• Mechanical Properties of Bovine Rhodopsin and Bacteriorhodopsin: Possible Roles in Folding and Function
• BioMed Central Page 1 of 20
• Eur. J. Biochem. 252, 591 599 (1998) FEBS 1998
• PURIFICATION OF THE G PROTEIN-COUPLED RECEPTOR RHODOPSIN FOR STRUCTURAL STUDIES
• Structure of the rhodopsin dimer: a working model for G-protein-coupled receptors
• ABCA4 disease progression and a proposed strategy for gene therapy
• Supporting Information Kiser et al. 10.1073/pnas.0906600106
• Stereospecificity of Retinol Saturase: Absolute Configuration, Synthesis, and Biological Evaluation of Dihydroretinoids
• Expression of Functional G Protein-Coupled Receptors in Photoreceptors of Transgenic Xenopus laeVis
• PII: S1350-9462(01)00002-7 Confronting Complexity: the Interlink of Phototransduction
• Papers of the Week Insight into Human Blinding Disease
• Long-Term Restoration of Rod and Cone Vision by Single Dose rAAV-Mediated Gene Transfer to the Retina
• SUPPLEMENTARY METHODS AND FIGURES Enzymes: Asp-N endoproteinase was purchased from Roche Applied Science (Mannheim,
• Effects of Long-Term Administration of 9-cis-Retinyl Acetate on Visual Function in Mice
• Supporting Information Angel et al. 10.1073/pnas.0903545106
• Structural waters define a functional channel mediating activation of the GPCR, rhodopsin
• Calcium-Sensitive Particulate Guanylyl Cyclase as a Modulator of cAMP in Olfactory Receptor Neurons
• CRYSTALLIZATION NOTE X-Ray Diffraction Analysis of Three-Dimensional Crystals of Bovine
• Functional and Structural Characterization of Rhodopsin Oligomers*S
• Clarin-1, Encoded by the Usher Syndrome III Causative Gene, Forms a Membranous Microdomain
• BREAKTHROUGHS AND VIEWS Calcium-Binding Proteins: Intracellular Sensors
• , -Carotene Decreases Peroxisome Proliferator Receptor Activity and Reduces Lipid Storage Capacity of Adipocytes in
• A heptahelical transmembrane bundle is a common structural feature of G-protein-coupled receptors (GPCRs) and bacterial
• Insight into Human Blinding Disease Sanae Sakami
• Probing Mechanisms of Photoreceptor Degeneration in a New Mouse Model of the Common Form of Autosomal
• Efficient Coupling of Transducin to Monomeric Rhodopsin in a Phospholipid Bilayer*S
• Functional Reconstitution of Photoreceptor Guanylate Cyclase with Native and Mutant Forms of Guanylate Cyclase-Activating Protein 1
• Table SI. Proteomic analysis of lipid droplet Fraction 1. Shown are proteins associated with lipid bodies purified by sucrose gradient centrifugation from bovine RPE (Fraction 1). These were identified by MS/MS analysis of peptides resulting from in gel t
• A Functional Kinase Homology Domain Is Essential for the Activity of Photoreceptor Guanylate Cyclase 1*S
• Legends for Supplement Figures Figure 1, supplement. Expression of a short Adfp mRNA variant in the RPE of Adfp2-
• Structural Characterization of the Rod cGMP Phosphodiesterase 6
• Retinopathy in Mice Induced by Disrupted All-trans-retinal Clearance*S
• SUPPLEMENTAL DATA FOR Impact of retinal disease-associated RPE65 mutations on retinoid isomerization
• BIOINFORMATICS APPLICATIONS NOTE Vol. 26 no. 14 2010, pages 18041805
• (01991by The American Society for Biochemistry OF BIOLOGICALCHEMISTRY
• Calcium-sensitive Regions of GCAP1 as Observed by Chemical Modifications, Fluorescence, and EPR Spectroscopies*
• Autosomal Recessive Retinitis Pigmentosa and E150K Mutation in the Opsin Gene*S
• Sequestration of Retinyl Esters Is Essential for Retinoid Signaling in the Zebrafish Embryo*
• Isomerization of all-trans-Retinol to cis-Retinols in Bovine Retinal Pigment Epithelial Cells: Dependence on the Specificity of Retinoid-Binding Proteins
• Current Topics Sequence Analyses of G-Protein-Coupled Receptors: Similarities to Rhodopsin
• Figure S1. Spectral properties of Rho. A, UV-visible absorbance spectra of Rho purified by -extraction. Spectra are shown of ground state Rho (black line), photoactivated Rho* (grey
• Evaluation of 9-cis-Retinyl Acetate Therapy Tadao Maeda,1,2
• THEJOURNALOF BlOLOCICALCHEMISTRY Q 1991 by The American Society for Biochemistry and Molecular Biology, Inc.
• Activation of Retinoic Acid Receptors by DihydroretinoidsS Alexander R. Moise, Susana Alvarez, Marta Domnguez, Rosana Alvarez, Marcin Golczak,
• Signaling States of Rhodopsin FORMATION OF THE STORAGE FORM, METARHODOPSIN III, FROM ACTIVE METARHODOPSIN II*
• Pharmacological and rAAV Gene Therapy Rescue of Visual Functions in a Blind Mouse
• The FASEB Journal Research Communication ISX is a retinoic acid-sensitive gatekeeper that controls
• Identification of Protein Kinase C Isozymes Responsible for the Phosphorylation of Photoreceptor-specific RGS9-1 at Ser475
• 1444 VOLUME 16 | NUMBER 12 | DECEMBER 2010 nature medicine t e c h n i ca l r e p o rt s
• Impact of Retinal Disease-Associated RPE65 Mutations on Retinoid Isomerization Grzegorz Bereta,
• Heterologous Expression of the Adenosine A1 Receptor in Transgenic Mouse Ning Li,, David Salom,, Li Zhang,,# Tim Harris,,4 Juan A. Ballesteros,,O Marcin Golczak, Beata Jastrzebska,
• Crystal structure of native RPE65, the retinoid isomerase of the visual cycle
• Role of Bulk Water in Hydrolysis of the Rhodopsin Chromophore*
• Supporting information Heterogeneous N-terminal Acylation of Retinal Proteins
• Toll-like Receptor 3 Is Required for Development of Retinopathy Caused by Impaired All-trans-retinal Clearance
• SUPPLEMENTAL DATA Supplemental Procedures
• pubs.acs.org/biochemistry Published on Web 01/25/2011 r 2011 American Chemical Society 1940 Biochemistry 2011, 50, 19401949
• Activation of G protein-Coupled Receptor Kinase 1 Involves Interactions Between its N-terminal Region and its
• Structural Basis for Three-step Sequential Catalysis by the Cholesterol Side Chain Cleavage Enzyme CYP11A1*S
• pubs.acs.org/BiochemistryPublished on Web 10/12/2010r 2010 American Chemical Society Biochemistry 2010, 49, 94259427 9425
• Oligomeric forms of G protein-coupled receptors (GPCRs)
• SUPPLEMENTARY DATA ,-Carotene Decreases Peroxisome Proliferator Receptor Activity and Reduces Lipid
• Visualization of Retinoid Storage and Trafficking by Two-Photon Microscopy
• Molecular Biology and Analytical Chemistry Methods Used to Probe the Retinoid Cycle
• Palmitoylation stabilizes unliganded rod opsin Akiko Maedaa,b,1
• Biochem. J. (2010) 428, 110 (Printed in Great Britain) doi:10.1042/BJ20100270 1 REVIEW ARTICLE
• Supplement Figures Figure S1. LC-MS/MS analysis of DROL isolated from the liver of RetSat+/+ mice. Endogenous
• Importance of Membrane Structural Integrity for RPE65 Retinoid Isomerization Activity*
• 25:8-15, 2010. doi:10.1152/physiol.00038.2009Physiology Brian M. Kevany and Krzysztof Palczewski
• pubs.acs.org/BiochemistryPublished on Web 01/04/2010r 2010 American Chemical Society Biochemistry 2010, 49, 827834 827
• electronic reprint Acta Crystallographica Section F
• 17261 Long-snouted, many-horned tyrannosaurid discovered 17284 From the mouths of babes
• all-trans-retinol pmol/100mgplasma
• Structure of cone photoreceptors Debarshi Mustafi a
• pubs.acs.org/BiochemistryPublished on Web 05/04/2009r 2009 American Chemical Society Biochemistry 2009, 48, 51595170 5159
• Loss of cone photoreceptors caused by chromophore depletion is partially prevented
• Involvement of All-trans-retinal in Acute Light-induced Retinopathy of Mice*S
• REVIEW ARTICLE Chemokine receptors and other G protein-coupled receptors
• Supplemental Information. Supplemental Text
• Topology of Class A G Protein-Coupled Receptors: Insights Gained from Crystal Structures of Rhodopsins,
• Structural Insights into Ca2 -dependent Regulation of
• SUPPLEMENTAL METHODS Guanosine 5'-3-O-(thio)triphosphate (GTPS) and 9-cis-retinal were purchased from Sigma
• Different Properties of the Native and Reconstituted Heterotrimeric G Protein Thomas E. Angel,
• Retinyl Ester Homeostasis in the Adipose Differentiation-related Protein-deficient Retina*S
• Neurobiology of Disease Trafficking of Membrane-Associated Proteins to Cone
• Metabolic Basis of Visual Cycle Inhibition by Retinoid and Nonretinoid Compounds in the Vertebrate Retina*
• Cell Metabolism RBP4 Disrupts Vitamin A Uptake Homeostasis
• Cell Metabolism, Volume 7 Supplemental Data
• Activation of G ProteinCoupled Receptors
• Supporting Information: Experimental procedures
• The Molecular Basis of Retinoid Absorption A GENETIC DISSECTION*
• SUPPLEMENTARY DATA Structures of Rhodopsin Kinase in Different Ligand States Reveal Key
• GUANYLATE CYCLASE-ACTIVATING PROTEINS AND RETINA DISEASE
• Human cone photoreceptor dependence on RPE65 isomerase
• protein structure communications Acta Cryst. (2007). F63, 457461 doi:10.1107/S1744309107020295 457
• Specificity of Zebrafish Retinol Saturase: Formation of All-trans-13,14-dihydroretinol and All-trans-7,8-dihydroretinol
• Crystal structure of a photoactivated deprotonated intermediate of rhodopsin Jastrzebska, Tim Harris, Juan A. Ballesteros, and Krzysztof Palczewski
• DOI: 10.1002/cbic.200600207 The Role of the 11-cis-Retinal Ring Methyl
• Figure S1. Time-dependent efficacy of Ret-acetamide in inhibition of the chromophore production. The 48 h dark-adapted C57BL/6 mice were gavaged once
• ORIGINAL ARTICLE Copyright 2006 by Humana Press Inc.
• G ProteinCoupled Receptor Rhodopsin
• Inner retinal photoreception independent of the visual retinoid cycle
• The Crystal Structure of GCAP3 Suggests Molecular Mechanism of GCAP-linked Cone Dystrophies
• Rhodopsin self-associates in asolectin liposomes Steven E. Mansoor*, Krzysztof Palczewski
• Detecting Molecular Interactions that Stabilize Native Bovine Rhodopsin
• PLoS Medicine | www.plosmedicine.org 001 Imagine the eye is like a camera.The shutter,like the iris of
• A Critical Role of CaBP4 in the Cone Synapse Tadao Maeda,1
• Retinoid Absorption and Storage Is Impaired in Mice Lacking Lecithin:Retinol Acyltransferase (LRAT)*
• Partial Agonism in a G Protein-coupled Receptor ROLE OF THE RETINAL RING STRUCTURE IN RHODOPSIN ACTIVATION*S
• Imaging G proteincoupled receptor islands Paul S-H Park & Krzysztof Palczewski
• The supramolecular structure of the GPCR rhodopsin in solution and native disc membranes
• Current Topics Oligomerization of G Protein-Coupled Receptors: Past, Present, and Future
• Functional Characterization of Rhodopsin Monomers and Dimers in Detergents*S
• Jastrzebska et al. Peripherin
• A Naturally Occurring Mutation of the Opsin Gene (T4R) in Dogs Affects Glycosylation and Stability of the G
• Identification of All-trans-Retinol:All-trans-13,14-dihydroretinol Received for publication, August 10, 2004, and in revised form, September 7, 2004
• Figure 1. Single flash ERG responses of increasing intensity for WT and Rho+/-mice in light-adapted conditions. Serial responses to increasing flash stimuli obtained
• 27. We thank G. Superti-Furga and J. Krijnse-Locker for providing monoclonal antibody (mAb) 3-27, Src-GFP,
• Guanylate cyclase-activating proteins: structure, function, and diversityq
• TheJournalofCellBiology The Rockefeller University Press, 0021-9525/2004/08/447/7 $8.00
• Impairment of the Transient Pupillary Light Reflex Mice and Humans with Leber
• Lecithin-retinol Acyltransferase Is Essential for Accumulation of All-trans-Retinyl Esters in the Eye and in the Liver*
• TheJournalofCellBiology The Rockefeller University Press, 0021-9525/2004/02/373/11 $8.00
• Annu. Rev. Physiol. 2003. 65:85179 doi: 10.1146/annurev.physiol.65.092101.142611
• n vertebrate retinal photoreceptors, the rod outer-segment disc membranes con-
• fortwoweeks.Thespidersweresubsequently presented with equally sized live and dead
• SUPPORTING INFORMATION FOR WORLD WIDE WEB EDITION Figure 1, supplement. Sequence length analysis of the members of GPCR family
• Evaluation of the role of the retinal G protein-coupled receptor (RGR) in the vertebrate retina in vivo
• Pharmacological Chaperone-mediated in Vivo Folding and Stabilization of the P23H-opsin Mutant Associated with
• Ligand Channeling within a G-protein-coupled Receptor THE ENTRY AND EXIT OF RETINALS IN NATIVE OPSIN*
• occlusion or retinal ischemia commonly occurs in blood disorders, hypertension, retinal vasculitis, reti-
• Novel targeting strategy for generating mouse models with defects in the retinoid cycle
• Retinoid cycle in the vertebrate retina: experimental approaches and mechanisms of isomerization
• The retinoid cycle and retina disease Rhodopsin, the best studied G protein-coupled re-
• Soluble Fusion Proteins between Single Transmembrane Photoreceptor Guanylyl Cyclases and Their Activators
• 0014-2980/02/0808-2300$17.50+.50/0 WILEY-VCH Verlag GmbH, D-69451 Weinheim, 2002 Vaccination with recoverin, a cancer-associated
• ChemBioChem 2002, 3, 963 967 2002 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 1439-4227/02/03/10 $ 20.00+.50/0 963 Crystal Structure of Rhodopsin
• Crystal structure of rhodopsin: a template for cone visual pigments and other G protein-coupled receptors
• Isomerization of 11-cis-Retinoids to All-trans-retinoids in Vitro and Received for publication, June 22, 2001, and in revised form, October 1, 2001
• Characterization of a Dehydrogenase Activity Responsible for Oxidation of 11-cis-Retinol in the Retinal Pigment Epithelium of
• Current Topics Advances in Determination of a High-Resolution Three-Dimensional Structure of
• Gene Transfer Mediated by Recombinant Baculovirus into Mouse Eye
• Rod and cone visual cycle consequences of a null mutation in the 11-cis-retinol dehydrogenase gene in man
• Stereoisomeric Specificity of the Retinoid Cycle in the Vertebrate Retina*
• Crystal Structure of Rhodopsin: A G ProteinCoupled Receptor
• MOLECULAR AND CELLULAR BIOLOGY, 0270-7306/00/$04.00 0
• The ADP ribosylation factor nucleotide exchange factor ARNO promotes -arrestin release necessary
• Five Members of a Novel Ca2 -binding Protein (CABP) Subfamily
• Isomerization of all-trans-9-and 13-Desmethylretinol by Retinal Pigment Epithelial Hartmut Stecher, Oleg Prezhdo, Joydip Das,| Rosalie K. Crouch,| and Krzysztof Palczewski*,,,
• A novel form of rhodopsin kinase from chicken retina and pineal gland1 Xinyu ZhaoaYc
• Conformational Changes in Guanylyl Cyclase-activating Protein 1 (GCAP1) and Its Tryptophan Mutants as a Function
• -Arrestin-dependent Desensitization of Luteinizing Hormone/Choriogonadotropin Receptor Is Prevented
• Proc. Natl. Acad. Sci. USA Vol. 96, pp. 493498, January 1999
• Identification of a single phosphorylation site within octopus rhodopsin Photochemistry and Photobiology; Augusta; Dec 1998; Hiroshi Ohguro;Norihiko Yoshida;Hideo
• Molecular Cell, Vol. 2, 129133, July, 1998, Copyright 1998 by Cell Press GCAP1(Y99C) Mutant Is Constitutively Active
• Functional Differences in the Interaction of Arrestin and Its Splice Variant, p44 Alexander Pulvermuller, Dieter Maretzki, Maria Rudnicka-Nawrot, W. Clay Smith,|
• Exp. Eye Res. (1996) 63, 599602 LETTER TO THE EDITORS
• Opsin/all-trans-Retinal Complex Activates Transducin by Different Mechanisms Than Photolyzed Rhodopsin
• THEJOURNALOF BIOLOGICALCHEMISTRY 0 1994by The American Societyfor Biochemistry and Molecular Biology, Inc
• THEJOURNALOF BIOLCGICALCHEMISTRY 0 1994by The American Societyfo1' Biochemistry and Molecular Biology, Inc.
• THEJOURNALOF BIOLOGICALCHEMISTRY (01991by The American Society for Biochemistry andMolecular Biology, Inc.
• Volume 261, number 1, 117-120 FEBS 08116 February 1990 Synthetic phosphopeptides are substrates for casein kinase II
• Volume 266, number 1,2, 102-104 FEBS 08513 June 1990 X-Ray crystal structure of sangivamycin, a potent inhibitor of protein
• Communication Vol. 264 No. 27 Issue of September 25 p 1577&15773,1989 THEJOURNAL OF BIOLOGICALCHEMISTRY
• This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research
• doi:10.1152/ajpendo.00491.2009 298:862-870, 2010. First published Dec 29, 2009;Am J Physiol Endocrinol Metab
• THEJOURNALOF BIOLOGICALCHEMISTRY 0 1992by The American Society for Biochemistry and Molecular Biology, Inc.
• Binding to EF Hands 1 and 3 Is Essential for the Interaction of Apoptosis-Linked Gene-2 with Alix/AIP1 in Ocular Melanoma
• THEJOURNALOF BIOLOGICALCHEMISTRY 0 1994by TheAmerican Society for Biochemistry and Molecular Biology, Inc.
• Annu. Rev. Biophys. Biomol. Struct. 2003. 32:37597 doi: 10.1146/annurev.biophys.32.110601.142520
• SUPPORTING INFORMATION LEGENDS TO SUPPLEMENTAL FIGURES
• A Novel Mutation (I143NT) in Guanylate Cyclase-Activating Protein 1 (GCAP1) Associated
• Supporting Information Maeda et al. 10.1073/pnas.1000640107
• Supplementary Methods: Chicken iris preparation. White leghorn E15 embryos (maintained at 39o
• Effects of Potent Inhibitors of the Retinoid Cycle on Visual Function and Photoreceptor Protection from
• The FASEB Journal Research Communication Increased adiposity in the retinol saturase-knockout
• Organization of the G Protein-coupled Receptors Rhodopsin and Opsin in Native Membranes*
• Evaluation of Potential Therapies for a Mouse Model of Human Age-Related Macular Degeneration Caused by
• Membrane-binding and enzymatic properties of RPE65 Philip D. Kiser, Krzysztof Palczewski*
• Progress in Retinal and Eye Research 22 (2003) 417434 Rhodopsin phosphorylation: 30 years later
• Figure 1, supplement. Expression of WT/E150K opsin in HEK293 cells. Immunoblot of WT/E150K opsins probed with anti-Rho 1D4 antibody. Molecular weight markers (in
• -binding proteins in the retina: structure, function, and the etiology
• Rapid restoration of visual pigment and function with oral retinoid in a mouse model of childhood blindness
• Accelerated Publications Calcium Modulation of Bovine Photoreceptor Guanylate Cyclase
• Identification of a family of calcium sensors as protein ligands of inositol trisphosphate
• Structural Biology of Membrane Proteins David Salom and Krzysztof Palczewski
• Supporting information Posttranslational modifications of the photoreceptor-specific ABC transporter ABCA4
• Published: May 20, 2011 r 2011 American Chemical Society 5590 dx.doi.org/10.1021/bi200491b |Biochemistry 2011, 50, 55905600
• Posttranslational Modifications of the Photoreceptor-Specific ABC Transporter ABCA4
• Author's personal copy Key enzymes of the retinoid (visual) cycle in vertebrate retina
• ASSOCIATE EDITOR: DIANNE M. PEREZ The Significance of G Protein-Coupled Receptor
• Dietary 9-cis-, -Carotene Fails to Rescue Vision in Mouse Models of Leber Congenital AmaurosisS
• Supplemental data Dietary 9-cis-,-carotene fails to rescue vision in mouse models of
• Sponge Transgenic Mouse Model Reveals Important Roles for the MicroRNA-183 (miR-183)/96/182 Cluster in Postmitotic
• Detergents Stabilize the Conformation of Phosphodiesterase 6 Bo Y. Baker and Krzysztof Palczewski*
• Rhodopsintransducin heteropentamer: Three-dimensional structure and biochemical characterization
• Chemistry and Biology of Published, JBC Papers in Press, November 10, 2011, DOI 10.1074/jbc.R111.301150
• Supporting Information Post-translational Modifications of Serotonin Type 4 Receptor Heterologously Expressed in
• Supporting Information Imaging of protein crystals with two-photon microscopy
• The FASEB Journal Research Communication Light-sensitive coupling of rhodopsin and melanopsin
• Supplementary Figure S1. IHC of TG worms expressing (b)opsin in neurons and in muscles. a-g, Representative IHC images of live day 1 TG worms expressing (b)opsin in neurons Alexa-488-
• Supplementary Information Primary amines protect against retinal degeneration in
• Supplementary Figure S1. Light-associated motor responses of worms expressing (b)opsin in neurons. a, Vigorously crawling TG animals pre-incubated with 10 M 9-cis-retinal and expressing
• 170 nature chemical biology | vol 8 | february 2012 | www.nature.com/naturechemicalbiology published online: 25 december 2011 | doi: 10.1038/nchembio.759
• Mechanism of All-trans-retinal Toxicity: Implications for Stargardt's Disease and Age-related Macular Degeneration
• Mechanism of All-trans-retinal Toxicity with Implications for Stargardt Disease and Age-related Macular Degeneration*S
• Post-Translational Modifications of the Serotonin Type 4 Receptor Heterologously Expressed in Mouse Rod Cells
• Thematic Minireview Series on Focus on Vision Published, JBC Papers in Press, November 10, 2011, DOI 10.1074/jbc.R111.322347
• The FASEB Journal Research Communication Heterologous expression of functional G-protein-coupled
• Imaging of Protein Crystals with Two-Photon Microscopy Pius Padayatti,