Home

About

Advanced Search

Browse by Discipline

Scientific Societies

E-print Alerts

Add E-prints

E-print Network
FAQHELPSITE MAPCONTACT US


  Advanced Search  

 
Table S1. Primers used for PCR in this study Primer Name Nucleotide sequence 5' 3' Sense and Position
 

Summary: Table S1. Primers used for PCR in this study
Primer Name Nucleotide sequence 5' ­ 3' Sense and Position
RABV P gene
RabPfor CTACTTCTCCGGGGAAACCAGAAG + 1249-12721
RabPrev GGRAGCCAYAGGTCRTCGTCAT - 2596-25751
RabP967 GAGATGGCNGARGAGACTGTWGA + 1568-15901
RabP995 CCTTAACTATGTCRTCAAGRTTCA - 2230-22081
COX1 locus
COXF2 TCAACCAACCACAAAGACATTGGCAC + 5929-59542
COXR1 TAGACTTCTGGGTGGCCAAAGAATCA - 6635-66102
1
indicated positions refer to the reference PV strain (GenBank accession number M13215)
2
indicated positions refer to the human COX1 gene (GenBank accession number NC_001807)
Table S2. Details of clones used to design primer pairs used for MSAT amplification and scoring.
Locus # Clone ID # Primer sequence 5' ­ 3' and sense MSAT motif Amplicon (bp)
1 BS45E7 [M13]1
TGGGCAAAAGTTTCTTCAGG + (GT)18 162
CAGTTGGTCCGACAGTTGTG -
2 BS45H6 [M13]AGGGCCAGACAGCTGATAAA + (TG)19 208

  

Source: Aris-Brosou, Stéphane - Department of Biology, University of Ottawa

 

Collections: Biology and Medicine