Home

About

Advanced Search

Browse by Discipline

Scientific Societies

E-print Alerts

Add E-prints

E-print Network
FAQHELPSITE MAPCONTACT US


  Advanced Search  

 
A Computing Model for Large-Scale Reconfigurable Systems
 

Summary: A Computing Model for Large-Scale
Reconfigurable Systems
Carl Ebeling, Scott Hauck, Larry Ruzzo, Corey Olson,
Maria Kim, Cooper Clausen, Boris Kogon
University of Washington
A Computing Model for Large-Scale
Reconfigurable Systems
Or "How do you program 10,000 FPGAs?"
A Talk in Two Parts
Part I
Genome Reassembly Problem
Part II
A new programming model for reconfigurable computing
3 billion base pairs
ATTCACCATTACGCGAGCGATATATACACGCGATCGCGCGTACTGTACGCGAACCGCCTCATATCGGCTAGDATTCACCATTACGCGAGCGATATATACACGCGATCGCGCGTACTGTACGCGAACCGCCTCATA
TCGGCTAGDATTCACCATTACGCGAGCGATATATACACGCGATCGCGCGTACTGTACGCGAACCGCCTCATATCGGCTAGDATTCACCATTACGCGAGCGATATATACACGCGATCGCGCGTACTGTACGCGAAC
CGCCTCATATCGGCTAGDATTCACCATTACGCGAGCGATATATACACGCGATCGCGCGTACTGTACGCGAACCGCCTCATATCGGCTAGDATTCACCATTACGCGAGCGATATATACACGCGATCGCGCGTACTG
TACGCGAACCGCCTCATATCGGCTAGDATTCACCATTACGCGAGCGATATATACACGCGATCGCGCGTACTGTACGCGAACCGCCTCATATCGGCTAGDATTCACCATTACGCGAGCGATATATACACGCGATCG
CGCGTACTGTACGCGAACCGCCTCATATCGGCTAGDATTCACCATTACGCGAGCGATATATACACGCGATCGCGCGTACTGTACGCGAACCGCCTCATATCGGCTAGDATTCACCATTACGCGAGCGATATATAC
ACGCGATCGCGCGTACTGTACGCGAACCGCCTCATATCGGCTAGDATTCACCATTACGCGAGCGATATATACACGCGATCGCGCGTACTGTACGCGAACCGCCTCATATCGGCTAGDATTCACCATTACGCGAGC

  

Source: Anderson, Richard - Department of Computer Science and Engineering, University of Washington at Seattle

 

Collections: Computer Technologies and Information Sciences