| Sample search results for: abcove ab5 ab6 |
| 1 | Caratteristiche sintetiche di una distribuzione | ||
|
Summary: = 1, 2, allora Var(a# 1 + b# 2 + c) = Var(a# 1 + b# 2 ) = a 2 # 2 1 + b 2 # 2 2 + 2abCov(# 1 , # 2... 1 + b 2 # 2 2 + 2abCov(# 1 , # 2 ) > 0 (a, b) # R 2 . Q è dunque una forma quadratica [in (a, b... + 2abCov(# 1 , # 2 ) con |Cov(# 1 , # 2 )| = # 1 # 2 ; perció, 0 = (a# 1 + b# 2 sign(Cov(# 1 , # 2 |
|||
|
Source: Bassetti, Federico - Dipartimento di Matematica `F. Casorati', Universita' di Pavia |
|||
|
Collection: Mathematics |
|||
| 2 | Supplemental materials to "Reduced Rank Mixed Effects Models for | ||
|
Summary: T ,ab, ,ab . (1) The conditional means are m,ab = E(ab|Y ab) = D,aT BT abcov(Y ab)-1 (Y ab - Babµ,a) (2... ) and m,ab = E(ab|Y ab) = VabT ,abBT abcov(Y ab)-1 (Y ab - Babµ,a). (3) 1 #12;The conditional covariance |
|||
|
Source: Huang, Jianhua - Department of Statistics, Texas A&M University; Zhou, Lan - Department of Statistics, Texas A&M University |
|||
|
Collection: Mathematics |
|||
| 3 | Tentamen Programmeermethoden Maandag 5 januari 2004, 14.0017.00 uur | ||
|
Summary: A wordt voorgesteld. c. Schrijf een functie void som (a,b,c,over) die de char's a en b "modulo 10 optelt |
|||
|
Source: Kosters, Walter - Leiden Institute of Advanced Computer Science, Universiteit Leiden |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 4 | Sankhy a : The Indian Journal of Statistics 2002, Volume 64, Series A, Pt 1, pp 156-166 | ||
|
Summary: #21;q #20; 1. It is easy to see that cov(X; Y ) = E(XY ) E(X)E(Y ) = abcov(P; Q). Therefore... of assuming them to be independent. In this case the cov(X; Y ) = abcov(P; Q) + #27; 2 v where #27; 2 v... exponential distributions 163 cov(X; Y ) = abcov(P; Q) + cov(V; W ). Also, just like in model 1, we could |
|||
|
Source: Manjunath, D. - Department of Electrical Engineering, Indian Institute of Technology Bombay |
|||
|
Collection: Computer Technologies and Information Sciences ; Engineering |
|||
| 5 | A Generalized Interpretation of Pearson's r Rudy A. Gideon | ||
|
Summary: of the covariance function the result cov(ax,by) = abcov(x,y) does not hold, but it is approximately true... - but with a minus sign by the covariance. Then med2 T+ (a,b) - med2 T - (a,b) 4(0.6745)2 P cov(aX,bY) = abcov |
|||
|
Source: Gideon, Rudy A. - Department of Mathematical Sciences, University of Montana |
|||
|
Collection: Mathematics |
|||
| 6 | Kooperation Universitt Wien Kirchliche Pdagogische Hochschule Wien/Krems Universitt Wien/Fakultt fr Mathematik | ||
|
Summary: Günter Hanisch Mittwoch von 17 bis 18.30 Uhr ab 6.10.2010 HS 1 des UZA 2 VO 2st. Ansprechperson: Ao. Univ... 12.40 Uhr ab 5.10.2010 2.05 SE 2st. WS 10/11 Modul ha2-22 Begabungsförderndes Handeln Andrea... 10/11 Modul ha2-25 Unterrichtsbezogene Forschung Barbara Riehs Dienstag von 13.35 bis14.20 Uhr ... |
|||
|
Source: Beiglböck, Mathias - Institut für Diskrete Mathematik und Geometrie, Technische Universität Wien |
|||
|
Collection: Mathematics |
|||
| 7 | ORIGINAL PAPER Cation identity dependence of crown ether photonic crystal | ||
|
Summary: of AB6, AB5, AB4, AB3, AB2 and AB. Thus, at identical ionic strengths the higher the valence... For example, for a mixture of AB2, AB3, AB5, and AB6 (each salt in the mixture has the same strength), based... .2 mM ... |
|||
|
Source: Asher, Sanford A. - Department of Chemistry, University of Pittsburgh |
|||
|
Collection: Chemistry ; Materials Science |
|||
| 8 | {L1, . . . , Ln} unifizierbar gdw. es ex. mit (L1) = ... = (Ln) ist mgu gdw. fur jeden Unifikator ex. Substitution mit = | ||
|
Summary: , brich mit Clash Failure ab. 5. Sonst sei X die Variable und t der Teilterm im anderen Literal. Falls X... in t vorkommt, brich mit Occur Failure ab. 6. Sonst setze = {X/t} und gehe zur¨uck zu Schritt 2. #12;Pr |
|||
|
Source: Ábrahám, Erika - Fachgruppe Informatik, Rheinisch Westfälische Technische Hochschule Aachen (RWTH) |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 9 | Achtung: vorlufige Liste! Ausgabe-Stand: 8. Jul. 2011 15:03 | ||
|
Summary: Examensvorbereitung 1 st., Do, 18 - 20, R 008 Schmidbauer Examensvorbereitung im Plichtfach Examensvertiefungen (ab 6... . Sem.) 21 300 Examensvertiefung im Zivilrecht, P (ab 6. Sem.) 6 st., Di 9-12, H17; Mi 9-12, H17 Roth 2... /11 #12;21 301 Examensvertiefung im Zivilprozessrecht, P (ab ... |
|||
|
Source: Schubart, Christoph - Institut für Zoologie, Universität Regensburg |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 10 | Goal-Based Rule Learning Technical Report, March 2009 | ||
|
Summary: , a rule R AB-covers an example if: the preconditions of rule R are true for the example, goal of R |
|||
|
Source: Guid, Matej - Department of Intelligent Systems, Jozef Stefan Institute |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 11 | Theoretical Population Biology 54, 257 269 (1998) Acidic Deposition, Plant Pests, and the Fate | ||
|
Summary: assume that shading reduces photo- synthesis. This is translated into the term (a&bCOV) NOV with a being... COV a&bCOV COS= mCOV wC+u(1Âe&1) NOS= rmCOV+ fuCOS wN+u(1Âe) wN wN+uÂe \r+ fu wC+u(1Âe&1)+ _ \ g r NIS h |
|||
|
Source: Gatto, Marino - Dipartimento di Elettronica e Informazione, Politecnico di Milano |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 12 | HEURISTIC SEARCH FOR HAMILTON CYCLES | ||
|
Summary: , (ab)7c((ab)8cb)2(ab)2ac(ab)5ac(ba)6c(ab)2c (ab)3ac(ba)2c(ab)6ca(ba)5c(ab)3c(ba)8bc(ba)8cb 8. 192A... (ac)2(ba)10cb(ab)4ac 3 #12;10. 216B] (ab)6 = (ab)2c:(ba)3c = e, ... |
|||
|
Source: Mohar, Bojan - Department of Mathematics, University of Ljubljana & Simon Fraser University |
|||
|
Collection: Mathematics |
|||
| 13 | Amtliche Bekanntmachung Jahrgang 2008 / Nr. 015 | ||
|
Summary: of African Studies (BIGSAS) gemäß Art. 19 Abs. 5 Satz 5 i. V. m. Abs. 6 Satz 1 BayHSchG eingerichtet, die für |
|||
|
Source: Ott, Albrecht - Physikalisches Institut, Universität Bayreuth |
|||
|
Collection: Physics ; Biology and Medicine |
|||
| 14 | (AB 1) Solve the differential equation y = (y + 4x)3 (AB 2) Suppose that we play laser tag in the dark. Two groups of people, the red team and the blue | ||
|
Summary: , u(x, 0) = sin(2x), 0 < x < , ut(x, 0) = 3 sin(5x), 0 < x < . (AB 5) Let u(x, t) be the function you... frequency of the string? (AB 6) A violin's A string is 32 cm long (according to measurements taken in class |
|||
|
Source: Barton, Ariel - Department of Mathematics, Purdue University |
|||
|
Collection: Mathematics |
|||
| 15 | February 3, 2010 18.01 Problem Set 1 | ||
|
Summary: , 5ab, 6a. 3. 1E-1abc, 3, 4a, 5bc, 1J-1e, 1J-2. 4. 1F-1ab, 1F-4, 1F-7bd, 1J-1ak, 1G-4. Part II: 15... ) of the Supplementary Notes (solved in section S). 0. 1A-2a, 3ad, 6b. 1. 1B-1abc, 1C-3bd, 1C-4bd, 1C-5. 2. 1D-1bfgj, 3ab |
|||
|
Source: Vogan, David - Department of Mathematics, Massachusetts Institute of Technology (MIT) |
|||
|
Collection: Mathematics |
|||
| 16 | Verkndungsblatt Nr. 6/2009 Satzung ber ein ergnzendes Hochschulauswahlverfahren | ||
|
Summary: § 6 Abs. 6 Thüringer Hochschulzulassungsgesetz (ThürHZG) vom 16. Dezember 2008 (GVBl. S. 535... Auswahlmaßstäbe gemäß § 6 Abs. 5 Satz 2 Nr. 1 bis 6 ThürHZG zugrunde gelegt wer- den. (2) Die Auswahl der |
|||
|
Source: Seyfarth, Andre - Institute of Sport Science, Friedrich-Schiller Universität Jena |
|||
|
Collection: Engineering ; Biology and Medicine |
|||
| 17 | Sechste Satzung zur nderung der Allgemeinen Prfungsordnung fr die Bachelor-und Masterstudiengnge an der Technischen Fakultt der Friedrich- | ||
|
Summary: /TechFak - Vom 7. Juni 2011 Aufgrund von Art. 13 Abs. 1 in Verbindung mit Art. 43 Abs. 5 und Art. 61 Abs. 2 des... Satzung vom 7. Juli 2010, wird wie folgt geändert: 1. In § 8 Abs. 6 Satz 4 wird das Wort "Rektorin" durch... 7 werden zu Sätzen 5 und 6. c) Abs. 6 ... |
|||
|
Source: Gugat, Martin - Mathematisches Institut, Friedrich-Alexander University Erlangen-Nürnberg |
|||
|
Collection: Mathematics |
|||
| 18 | Demandes de rectification ou d'information faire auprs de Pierre Brard avant le 7/01/2010 dernier dlai GRPE N tudiant CC CC2 | ||
|
Summary: 15 12 9 MAT 20915508 17,8 18 16,50 19,00 14 0,5 15,667 16 16 15 MAT 20700106 abs abs 5,00 abs abs 0... 7 MAT 20800731 abs 5,4 5,75 5,00 abs 0 10,667 12 8 12 MAT 20800394 10,8 10 10,75 10,00 15 0 11 14 9... 10 11 9 10 MIN 20702464 6,01 5,1 6,25 4,00 14 0 9,3333 10 9 9 MIN 20503385 abs ... |
|||
|
Source: Bérard, Pierre - Institut Fourier, Université Joseph Fourier Grenoble-I |
|||
|
Collection: Mathematics |
|||
| 19 | Satzung zur nderung der Studien-und Prfungsordnung fr den Masterstudiengang ,,Physical Activity and Health" | ||
|
Summary: -Alexander-Universität Erlangen-Nürnberg Vom 31. Januar 2011 Aufgrund von Art. 13 Abs. 1 in Verbindung mit Art. 43 Abs. 5, Art. 58... " ersetzt. 7. § 26 Abs. 1 Satz 2 wird gestrichen. 8. In § 27 Abs. 6 Satz 1 wird Halbsatz 2 gestrichen. 9... gestrichen. bb) In Satz 2 Ziffer 2 werden die Zahlen ,,2-4" durch ... |
|||
|
Source: Gugat, Martin - Mathematisches Institut, Friedrich-Alexander University Erlangen-Nürnberg |
|||
|
Collection: Mathematics |
|||
| 20 | Michigan Math. J. 58 (2009) Imprimitive Distance-Transitive Graphs with | ||
|
Summary: or even 1 2 G [7, p. 140] or G [14; 15]. An A-cover of a B-double of the graph H will be called an AB-cover... , according to our definitions, an A-cover, B-double, AB-cover, or BA-double is always a connected distance... , the column A, B, or AB has the entry "×" then G has no A-cover, B-double, or AB-cover (hence BA |
|||
|
Source: Hall, Jonathan I. - Department of Mathematics, Michigan State University |
|||
|
Collection: Mathematics |
|||
| 21 | Amtliche Bekanntmachung Jahrgang 2008 / Nr. 003 | ||
|
Summary: Art. 13 Abs. 1 Satz 2 Halbsatz 2 in Verbindung mit Art. 71 Abs. 6 des Bayerischen Hochschulgesetzes... , in dem das Studium abgeschlossen wird, zu stellen." b) Die bisherigen Abs. 4, 5 und 6 werden die Abs. 5 |
|||
|
Source: Ott, Albrecht - Physikalisches Institut, Universität Bayreuth |
|||
|
Collection: Physics ; Biology and Medicine |
|||
| 22 | Vierte Satzung zur nderung der Fachstudien-und Prfungsordnung fr das Fach Nordische Philologie im Zwei-Fach-Bachelorstudiengang an der | ||
|
Summary: Satzung vom 5. November 2010, wird wie folgt geändert: In § 5 wird nach Abs. 5 folgender neuer Abs. 6 |
|||
|
Source: Gugat, Martin - Mathematisches Institut, Friedrich-Alexander University Erlangen-Nürnberg |
|||
|
Collection: Mathematics |
|||
| 23 | Extra Credit Assignment Summer 2011 | ||
|
Summary: that determines which team wins. (AB 5) It is a fact that L{ t}(1) = 0 e-t t dt = 2 . Find L{ t}(s) for all... s > 0. Show your work. (AB 6) You have used the fact that L{f g(t)}(s) = L{f(t)}(s) L{g(t)}(s). Prove |
|||
|
Source: Barton, Ariel - Department of Mathematics, Purdue University |
|||
|
Collection: Mathematics |
|||
| 24 | MTH4107 Introduction to Probability 2010/11 Solutions to Exercise Sheet 3 | ||
|
Summary: ). (5) Substituting (5) into (4) and rearranging terms we obtain P(A B) = P(A)+P(B)-2P(AB). (6) · Please... union of A B and AB, Axiom 3 gives P(AB) = P(A B)+P(AB). (4) By Proposition 5.6 P(AB) = P(A)+P(B)-P(AB |
|||
|
Source: Jackson, Bill - School of Mathematical Sciences, Queen Mary, University of London |
|||
|
Collection: Mathematics |
|||
| 25 | Satzung zur nderung der Satzung ber die Erhebung von Studienbeitrgen | ||
|
Summary: unberührt." m. Die bisherigen Abs. 5, 6 und 7 werden Abs. 6, 7 und 8. n. Der bisherige Abs. 6 erhält... -Maximilians-Universität München Vom 24. Juli 2009 Auf Grund von Art. 13 Abs. 1 Satz 2 in Verbindung mit Art. 71 Abs. 6 ... |
|||
|
Source: Kersting, Roland - Fakultät für Physik, Ludwig-Maximilians-Universität München |
|||
|
Collection: Physics |
|||
| 26 | Satzung zur nderung von Fachstudien-und Prfungsordnungen in EinFach-und Zwei-Fach-Bachelorstudien-und Masterstudiengngen | ||
|
Summary: Erlangen-Nürnberg Vom 5. November 2010 Aufgrund von Art. 13 Abs. 1, Art. 43 Abs. 5, Art. 58 Abs. 1 und Art... und Pädagogik der Paragraph ,,28 Abs. 5" durch den Paragraphen ,,30 Abs. 5" ersetzt. 3. In § 6 der FPO... Paragraphen ,,7" und in Abs. 3 die Zahlen und ... |
|||
|
Source: Gugat, Martin - Mathematisches Institut, Friedrich-Alexander University Erlangen-Nürnberg |
|||
|
Collection: Mathematics |
|||
| 27 | Optical Absorptions of New Blue-Light Emitting Oligoquinolines Bearing Pyrenyl and Triphenyl | ||
|
Summary: abs,12 S abs,5 f abs,5 S abs,12 f abs,12 TPSS 2.21 0.473 2.58 0.392 3.17 0.334 1.85 1.112 2.19 0.610 2... .56 0.536 3.15 0.400 1.86 1.761 S abs,5 f abs,5 S abs,11 f abs,11 S abs,5 f ... |
|||
|
Source: Tretiak, Sergei - Theoretical Division, Los Alamos National Laboratory |
|||
|
Collection: Chemistry ; Materials Science |
|||
| 28 | Alumni House, D-5 Andersen Auditorium (Haas School of Business), C-2 | ||
|
Summary: abs,12 S abs,5 f abs,5 S abs,12 f abs,12 TPSS 2.21 0.473 2.58 0.392 3.17 0.334 1.85 1.112 2.19 0.610 2... .56 0.536 3.15 0.400 1.86 1.761 S abs,5 f abs,5 S abs,11 f abs,11 S abs,5 f ... |
|||
|
Source: Boyer, Elizabeth W. - Department of Environmental Science Policy and Management, University of California at Berkeley |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 29 | UNIVERSIT DEGLI STUDI DI PAVIA FACOLT DI SCIENZE MM FF NN | ||
|
Summary: abs,12 S abs,5 f abs,5 S abs,12 f abs,12 TPSS 2.21 0.473 2.58 0.392 3.17 0.334 1.85 1.112 2.19 0.610 2... .56 0.536 3.15 0.400 1.86 1.761 S abs,5 f abs,5 S abs,11 f abs,11 S abs,5 f ... |
|||
|
Source: Bassetti, Federico - Dipartimento di Matematica `F. Casorati', Universita' di Pavia |
|||
|
Collection: Mathematics |
|||
| 30 | UNIVERSIT DEGLI STUDI DI PAVIA FACOLT DI SCIENZE MM FF NN | ||
|
Summary: abs,12 S abs,5 f abs,5 S abs,12 f abs,12 TPSS 2.21 0.473 2.58 0.392 3.17 0.334 1.85 1.112 2.19 0.610 2... .56 0.536 3.15 0.400 1.86 1.761 S abs,5 f abs,5 S abs,11 f abs,11 S abs,5 f ... |
|||
|
Source: Bassetti, Federico - Dipartimento di Matematica `F. Casorati', Universita' di Pavia |
|||
|
Collection: Mathematics |
|||
| 31 | UNIVERSIT DEGLI STUDI DI PAVIA FACOLT DI SCIENZE MM FF NN | ||
|
Summary: abs,12 S abs,5 f abs,5 S abs,12 f abs,12 TPSS 2.21 0.473 2.58 0.392 3.17 0.334 1.85 1.112 2.19 0.610 2... .56 0.536 3.15 0.400 1.86 1.761 S abs,5 f abs,5 S abs,11 f abs,11 S abs,5 f ... |
|||
|
Source: Bassetti, Federico - Dipartimento di Matematica `F. Casorati', Universita' di Pavia |
|||
|
Collection: Mathematics |
|||
| 32 | Molecular Ecology (2007) 16, 24742487 doi: 10.1111/j.1365-294X.2007.03330.x 2007 Centre National de la Recherche Scientifique | ||
|
Summary: abs,12 S abs,5 f abs,5 S abs,12 f abs,12 TPSS 2.21 0.473 2.58 0.392 3.17 0.334 1.85 1.112 2.19 0.610 2... .56 0.536 3.15 0.400 1.86 1.761 S abs,5 f abs,5 S abs,11 f abs,11 S abs,5 f ... |
|||
|
Source: David, Patrice - Centre dEcologie Fonctionnelle et Evolutive |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 33 | Amtliche Bekanntmachung Jahrgang 2007 / Nr. 149 | ||
|
Summary: bisherigen Sätze 3 und 4 werden die Sätze 5 und 6. bb) Abs. 5 wird gestrichen. cc) Abs. 6 wird zu Abs. 5. 20... Nrn. 2, 3 und 4" durch den Pas- sus ,,Art. 46 Nr. 2" ersetzt. d) In § 10 Abs. 6 werden folgende Sätze... : a) ... |
|||
|
Source: Schmidt, Matthias - Physikalisches Institut, Universität Bayreuth |
|||
|
Collection: Physics ; Materials Science |
|||
| 34 | A Hybrid Heuristic for an Inventory-Routing Claudia Archetti (1) | ||
|
Summary: .5 1397.29 1397.29 4 0.00 abs5n5.dat 5 0.5 999.42 999.42 2 0.00 abs1n10.dat 10 0.5 1743.07 1743.07 10 0... .5 1773.00 1773.00 8 0.00 abs5n10.dat 10 0.5 1938.18 1938.18 10 0.00 abs1n15.dat 15 0.5 2131.04 2131.04 30... .dat 15 0.5 2151.94 2151.94 34 0.00 abs5n15.dat 15 ... |
|||
|
Source: Hertz, Alain - Département de Mathématiques et de Génie Industriel, École Polytechnique de Montréal |
|||
|
Collection: Mathematics |
|||
| 35 | Fnfte Satzung zur nderung der Diplomprfungsordnung | ||
|
Summary: . 1, 2, 3, 4 und 5 werden Abs. 2, 3, 4, 5 und 6. 3. § 4 wird wie folgt geändert: a) Abs. 5 Sätze 3 und... 4 werden aufgehoben. b) Es werden folgende neue Abs. 6 und 7 eingefügt: #12;- 3 - ,,(6) 1 Die... Prüfern zu bewerten." c) Die bisherigen Abs. 6, 7, 8 und 9 ... |
|||
|
Source: Kersting, Roland - Fakultät für Physik, Ludwig-Maximilians-Universität München |
|||
|
Collection: Physics |
|||
| 36 | Deconstructing Commodity Storage Clusters Haryadi S. Gunawi, Nitin Agrawal, | ||
|
Summary: propagate a series of 90-byte (ab5, bc5) and 4-byte acknowledgments (ab6, ab7, bc6, bc7) to each other... No D D bc2 D ab2 D bc4 0 200 400 600 800 abE ab7 ab6 va4 ab5 ab4 ab3 va3 va2 ab2 ab1 ab0 Send... /ReceiveTime(ms) Packet ... |
|||
|
Source: Arpaci-Dusseau, Andrea - Department of Computer Sciences, University of Wisconsin at Madison; Arpaci-Dusseau, Remzi - Department of Computer Sciences, Department of Computer Sciences, University of Wisconsin at Madison |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 37 | DOI: 10.1126/science.285.5428.727 , 727 (1999);285Science | ||
|
Summary: ). Two selected mAbs, 5C6 and 1D11, stained NKL and the V 1 T-cell clones and blocked binding of bio... pattern of bio-sMICA (Fig. 2) (10). The mAbs 5C6 and 1D11 cross-blocked surface binding (13). Thus, MICA... data (15), matched the expression of MICR. Immunoprecipitations with mAbs ... |
|||
|
Source: Spies, Thomas - Basic Sciences Division, Fred Hutchinson Cancer Research Center |
|||
|
Collection: Biology and Medicine |
|||
| 38 | K=Knowledge S=Skill AB=Attitude/Behavior | ||
|
Summary: =Attitude/Behavior Institutional Learning Objectives: AB5 Recognize the need to engage in lifelong learning to stay abreast... of relevant scientific advances. AB6 The ability to recognize personal educational needs and to select |
|||
|
Source: Cinabro, David - Department of Physics and Astronomy, Wayne State University |
|||
|
Collection: Physics |
|||
| 39 | Zweite Satzung zur nderung der Promotionsordnung | ||
|
Summary: Abs. 1 Satz 1 Nr. 1 BayHSchPG" ersetzt. b) In Abs. 5 wird ,,Art. 50" durch ,,Art. 41 Abs. 2" ersetzt... . rer. pol. h. c.) gemäß § 1 Abs. 6 verleihen. (2) 1 Voraussetzung für die Verleihung des Dr. phil. h. c |
|||
|
Source: Kersting, Roland - Fakultät für Physik, Ludwig-Maximilians-Universität München |
|||
|
Collection: Physics |
|||
| 40 | MAP4307 Applied Complex Variables Spring 2011 Professor David Rollins | ||
|
Summary: ,5,6,7,9,10,12,15 Chapter 3 3.1: 1,2,3ab, 4, 5ab, 6,11bcd, 13abc, 15 3.2: 4,5ace, 7,8,9abdf, 10,13,14,15,17,19 3.3: 1... ,7,8,9,10,14 4.2: 3ab, 5,6,8, 11, 13,14, 15 4.3: 1,2,3,7,11,12 4.4: 9,10abd, 12-20 4.5: 1-4, 7,8,10,11 4.6: 2 |
|||
|
Source: Kaup, David J. - Department of Mathematics, University of Central Florida |
|||
|
Collection: Mathematics |
|||
| 41 | Esercizi reti combinatorie e sequenziali | ||
|
Summary: + A)C + AB 5 SOLUZIONE : schema della rete combinatoria A B fC f = (B + A)C + AB 6 Una ALU Progettare |
|||
|
Source: Rossi, Francesca - Dipartimento di Matematica Pura e Applicata, Università degli Studi di Padova |
|||
|
Collection: Mathematics |
|||
| 42 | Christine Drea, Assistant Professor, Biological | ||
|
Summary: .10594 [abs] 5. Scordato, E.S. & Drea, C.M.. "Scents and sensibility: Information content of olfactory... signals in the ringtailed lemur (Lemur catta)." 2007: 301- 314. doi:10.1016/j.anbehav.2006.08.006 [abs] 6 |
|||
|
Source: Zhou, Pei - Departments of Chemistry & Biochemistry, Duke University |
|||
|
Collection: Chemistry ; Biology and Medicine |
|||
| 43 | Randy L. Jirtle, Professor, Department of Radiation | ||
|
Summary: .1 (January, 2003): 321-8. [abs] 5. BA Freking, SK Murphy, AA Wylie, SJ Rhodes, JW Keele, KA Leymaster, RL... .10 (October, 2002): 1496-506. [abs] 6. JK Killian, CM Nolan, AA Wylie, T Li, TH Vu, AR Hoffman, RL Jirtle |
|||
|
Source: Zhou, Pei - Departments of Chemistry & Biochemistry, Duke University |
|||
|
Collection: Chemistry ; Biology and Medicine |
|||
| 44 | Wayne State University, School of Medicine Medical Student Competencies and Institutional Learning Objectives | ||
|
Summary: =Attitude/Behavior Institutional Learning Objectives: AB5 Recognize the need to engage in lifelong learning to stay abreast... of relevant scientific advances. AB6 The ability to recognize personal educational needs and to select |
|||
|
Source: Finley Jr., Russell L. - Center for Molecular Medicine and Genetics, Wayne State University |
|||
|
Collection: Biology and Medicine |
|||
| 45 | Ab5* abelian groups Definition 1. A subset D of a poset A is called upper (lower) directed | ||
|
Summary: Ab5* abelian groups Definition 1. A subset D of a poset A is called upper (lower) directed if each... of submodules of a module is called (see [2]) an inverse family of submodules. Definition 2. A module M is Ab5... and every lower directed subset D L. Hence, a module M is ... |
|||
|
Source: Cãlugãreanu, Grigore - Faculty of Mathematics and Computer Science, Babes-Bolyai University |
|||
|
Collection: Mathematics |
|||
| 46 | Amtliche Bekanntmachung Jahrgang 2011 / Nr. 001 | ||
|
Summary: : Studium Generale" angefügt. 2. § 2 wird wie folgt geändert: a) Abs. 5 Satz 1 erhält eine Nummerierung und... Abs. 5 neu angefügt: *) Mit allen Personen- und Funktionsbezeichnungen sind Männer und Frauen... ,,weiterer Termin" ersetzt. b) In Abs. 5 Satz 1 wird ... |
|||
|
Source: Ott, Albrecht - Physikalisches Institut, Universität Bayreuth |
|||
|
Collection: Physics ; Biology and Medicine |
|||
| 47 | Amtliche Mitteilungen FernUniversitt in Hagen | ||
|
Summary: gestrichen. 3. § 11 Abs. 5 Der Absatz 5 erhält folgenden neuen Text: ,,In Modul M6 ,,Praxis psychologischer... abbricht, kann die Modulprüfung im Modul 6 nicht ablegen." § 11 Abs. 6 Der bisherige Absatz 5 erhält... folgende Fassung sowie die Zählung ,,Abs. 6" ... |
|||
|
Source: Güting, Ralf Hartmut - Fakultät für Mathematik und Informatik, FernUniversität in Hagen |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 48 | Amtliche Bekanntmachung Jahrgang 2010 / Nr. 036 | ||
|
Summary: , alle weiteren Stellen werden ohne Rundung gestrichen." c) Es wird folgender Abs. 5 neu angefügt: ,,(5... ." 3. § 14 wird wie folgt geändert: a) In Abs. 5 wird folgende Nr. 5 neu eingefügt: ,,5. die... ) Abs. 6 erhält folgende neue Fassung: ,,(6) 1 Die Benotung ... |
|||
|
Source: Ott, Albrecht - Physikalisches Institut, Universität Bayreuth |
|||
|
Collection: Physics ; Biology and Medicine |
|||
| 49 | Vierte Satzung zur nderung der Prfungsordnung | ||
|
Summary: entsprechend. 8 Bei der Bewertung der schriftlichen Prüfung nach Abs. 5 Satz 1 ist von der verminderten Zahl... gestellten Prüfungsfragen zutreffend beantwortet hat." b) Es werden folgende Abs. 6 bis 8 angefügt: ,,(6) 1... zwischen null und n liegt, von insgesamt n Antwortvorschlägen ist richtig ,,x ... |
|||
|
Source: Kersting, Roland - Fakultät für Physik, Ludwig-Maximilians-Universität München |
|||
|
Collection: Physics |
|||
| 50 | 2. eine als ausreichend befundene, im Rahmen eines universitren Studiengangs gefertigte Diplomarbeit, | ||
|
Summary: (Art. 23 BayLBG) geltenden Bedingungen (Zweiter Teil §§ 36 bis 110d) ab. 6 Satz 5 gilt entsprechend... Zwischenprüfung kann eine andere, in § 83 Abs. 5 genannte Prüfung aner- kannt werden. (5) 1 Wer die Erste... die Zeugnisse über die bestandenen akademischen Zwischenprüfungen gemäß § 31 ... |
|||
|
Source: Ott, Albrecht - Physikalisches Institut, Universität Bayreuth |
|||
|
Collection: Physics ; Biology and Medicine |
|||
| 51 | 2006 New Mexico Farmer Silage Trials | ||
|
Summary: .25 ab 2.01 c 25.29 g 5.64 ab 3103 abc 26869 ab Grand Valley 25R35CRR 8.53 a 25.875 ab 6.85 a 51.57 a 58... .76 a 45.645 abc 57.94 bcde 45.645 abc 2.495 ab 35.035 ab 5.555 ab 3060 abc 24761 ab Grand Valley 23B50CRRY... Pioneer 31G91RR 8.1423 abcde 22.985 bcd 6.84 ab 44.04 fgh 59.28 a 69.4897 ab 2.415 a 34.28 ... |
|||
|
Source: Castillo, Steven P. - Klipsch School of Electrical and Computer Engineering, New Mexico State University |
|||
|
Collection: Engineering |
|||
| 52 | Das Mitteilungsblatt erscheint jeweils am 1. und 3. Mittwoch jeden Monats. Eigentmer, Herausgeber, Vervielfltigung und Vertrieb: Zentrale Verwaltung der Universitt Innsbruck, Innrain 52, A-6020 | ||
|
Summary: wissenschaftlichen Mitarbeiter im Forschungs- und Lehrbetrieb gemäß § 41 Abs. 5 Z. 2 UOG 1993 68. Kundmachung der... mit der selbständigen Erledigung bestimmter Angelegenheiten gem. § 43 Abs. 6 UOG 93 71. Ausschreibung... 1993 Am 10. November 1999 hat eine von Dr. Ludwig CALL gemäß § 18 ... |
|||
|
Source: Middeldorp, Aart - Institut für Informatik, Universität Innsbruck |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 53 | ! "#$%! &' $($)$%'0 $% &12(3456372)8' 8@9AB CED FHGI43 | ||
|
Summary: % §0 ¨ÿ$©1¢¡23)©4% ¡% §6587 9ÿ¡ @ÿ¡AB £¢¡(6C ¨¡2D(6©¦0% § EGF¦HPI (!¨AD©¦2Q)AD#$!¨)#$AD © RS©¦AD© #¡2T... S ABv© AD ¢ (6 2B)AB©¦ ¦§5©¦(§Yg@¢3 ¨ S©¦§65 ¨ÿ58§ ¨¡ !© AD 2V!hþæÿ¡ P%¤g AD% ¦ © AD 2D(67 ( ÿ... ¡§6 % #Xÿ¡©$¢ ¥¤¦ A ÿ¡ © ... |
|||
|
Source: New York at Stoney Brook, State University of - Department of Applied Mathematics and Statistics |
|||
|
Collection: Mathematics |
|||
| 54 | Incorporating Heterogeneous Distance Metrics Within Block Layout Design Gultekin Ozdemir | ||
|
Summary: 6 AB1 AB2 AB3 AB4 AB5 AB6 Euclidean 100 0 0 50 25 25 100 0 0 14.52 14.52 17.74 Rectilinear 0 100 0... None found* - AB4 569.23 1069.11 AB5 590.06 1477.86 AB6 571.66 1239.75 * See footnote 3. Table 4. Total... cost comparisons. ... |
|||
|
Source: Smith, Alice E. - Department of Industrial and Systems Engineering, Auburn University |
|||
|
Collection: Engineering |
|||
| 55 | M:FoodMicrobiology JFS M: Food Microbiology and Safety | ||
|
Summary: .59 ± 0.17a,A 6.39 ± 0.25a,A 6.47 ± 0.12a,A 4 6.73 ± 0.12a,A 5.66 ± 0.53a,B 6.00 ± 0.32a,AB 5.75 ± 0.40a,AB... 5.95 ± 0.40a,AB -20 6.73 ± 0.12a,A 5.79 ± 0.44a,B 6.02 ± 0.28a,AB 5.65 ± 0.36a,B 5.97 ± 0.37a... .10a,B 6.51 ± 0.17a,B 6.50 ± 0.17ab,B 6.68 ± ... |
|||
|
Source: Tang, Juming - Department of Biological Systems Engineering, Washington State University |
|||
|
Collection: Engineering |
|||
| 56 | Vol. 2003, No. 15 (2003-CG-110), pp. 55-60, 2003 2 14 f9084@kki.yamanashi.ac.jp, f8058@kki.yamanashi.ac.jp, ohbuchi@acm.org | ||
|
Summary: . 15 (2003-CG-110), pp. 55-60, 2003 2 14 - 5 - 2AD2AD2abs Nearest Neighbor 1 AD2abs6a6b 5 AD2AD2abs... .2 0.4 0.6 0.8 1 D2 AD2 AD2abs 7. AD2AD2abs 6 3 AD2AD2absAD2 2 AD2abs 4 AD2AD2absOsadaD2[1] D... L1 38% 49% 58% 0.68s L2 38% 51% 60% 0.70s 37% 50% 54% 0.77s 1 2 3 4 5 6a. AD2 1 2 3 4 5 6b. ... |
|||
|
Source: Ohbuchi, Ryutarou - Computer Science Department, Yamanashi University |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 57 | Amtliche Bekanntmachung Jahrgang 2010 / Nr. 011 | ||
|
Summary: Satz 3 wird die Zahl ,,18" durch die Zahl ,,17" ersetzt. c) In Abs. 5 Satz 1 wird in der Klammer die... Zahl ,,22" durch die Zahl ,,21" ersetzt. d) Abs. 6 wird wie folgt geändert: aa) Satz 1 erhält folgende... Zentralen Universitätsverwaltung, Universität Bayreuth 4 b) Abs. ... |
|||
|
Source: Ott, Albrecht - Physikalisches Institut, Universität Bayreuth |
|||
|
Collection: Physics ; Biology and Medicine |
|||
| 58 | Charmonium production in PbPb collisions Nora De Marcob | ||
|
Summary: and it describes the ordinary nuclear absorption of charmonia (abs = 6.4 ± 0.8 mb). It is clear from the figure... and sulphur data where 0=0.17 fm-3 is the nuclear matter average density. The exponential fit leads to abs = 5... -Pb collisions. Figure 1. The BµµJ//Drell-Y an ratio ver- sus ET . rescaled to ... |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 59 | Brookhaven National Laboratory/LIGHT SOURCES DIRECTORATE Subject: VACUUM PROCEDURES FOR BEAMLINE U-11 | ||
|
Summary: and it describes the ordinary nuclear absorption of charmonia (abs = 6.4 ± 0.8 mb). It is clear from the figure... and sulphur data where 0=0.17 fm-3 is the nuclear matter average density. The exponential fit leads to abs = 5... -Pb collisions. Figure 1. The BµµJ//Drell-Y an ratio ver- sus ET . rescaled to ... |
|||
|
Source: Brookhaven National Laboratory, Environmental Chemistry Division, Department of Applied Science; Ohta, Shigemi - Theory Group, Institute of Particle and Nuclear Studies, High Energy Accelerator Research Organization (KEK) |
|||
|
Collection: Environmental Sciences and Ecology ; Physics |
|||
| 60 | Molecular Ecology Notes (2002), 2, 316319 doi:10.1046/j.1471-8278 .2002.00227.x 2002 Blackwell Science Ltd | ||
|
Summary: (CA)7 113 8 AJ427927 Ab5 F: GTTGCCCGGTCGGATATACGTTTC R: CACACCCCCATACACTCACAGACT 65 (TG)18 112 > 1 AJ... 427928 Ab6 F: TGCGGAAGCGAAAGAATCTGCTG R: GACTTGCCACACCCTATGACGTA 65 (CA)12 285 5 AJ427929 Ab7 F... ). Preliminary tests also indicate that some loci amplify in other coccinellid species. Three loci (Ab1, ... |
|||
|
Source: Halligan, Daniel - Institute of Evolutionary Biology, University of Edinburgh |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 61 | AN INT~ATIONAL DELPHI POLL ON FUTURE TRENDS IN "INFORMATION LINGUISTICS" | ||
|
Summary: hal ha2 sol so3 so3 so4 il5 illI illI il5 in4 in5 in5 in4 ab2 ab6 ab6 ab5 trl tr5 tr6 trl re3 re3 re4... 7 il4 i16 i15 in6 in3 in3 in6 ab4 ab5 ab5 ... |
|||
|
Source: Association for Computational Linguistics (ACL) Anthology |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 62 | One-, Two-, and Multi-Fold Origami Axioms Roger C. Alperin and Robert J. Lang | ||
|
Summary: , AL2a910b, AL2a10aaa, AL2a10aab, AL2a10abb, AL2a10bbb, AL2ab10aa, AL2ab10ab, AL2ab5a10a, AL2ab5a10b... , AL2ab5ab, AL2ab5a7a, AL2ab5a7b, AL2ab7a10a, AL2ab7a10b, AL2ab7aa, AL2ab7ab, ... |
|||
|
Source: Alperin, Roger C. - Department of Mathematics, San Jose State University |
|||
|
Collection: Mathematics |
|||
| 63 | Special cases of Schonflies-singular planar Stewart Gough platforms | ||
|
Summary: and bi = b3Bi/B3 for i = 4,5 with K1 = |A,B,Ba,Bb,a|6 2, K2 = |A,B,Ba,Bb,b|6 2, K4 = |A,B,Ba,Bb,Ab|6 2... ,A,B,Ba,Bb,a,b,Ab)6 1 = 5. Proof. We can choose coordinate systems such that Mi = (Ai,Bi,0) and mi... For the discussion of this system of equations we distinguish two cases: 1. rk(b,B,Bb)5 2 = 3: We get ... |
|||
|
Source: Nawratil, Georg - Institut für Diskrete Mathematik und Geometrie, Technische Universität Wien |
|||
|
Collection: Engineering ; Computer Technologies and Information Sciences |
|||
| 64 | Amtliche Bekanntmachung Jahrgang 2009 / Nr. 083 | ||
|
Summary: wird gemäß Art. 19 Abs. 5 Satz 5 i.V.m. Abs. 6 Satz 1 BayHSchG die Bayreuther Graduiertenschule für |
|||
|
Source: Ott, Albrecht - Physikalisches Institut, Universität Bayreuth |
|||
|
Collection: Physics ; Biology and Medicine |
|||
| 65 | SPORTINSTITUT UNIVERSITTS | ||
|
Summary: Abende ab 5. Oktober 76. Mi. 18.30 - 19.55, VH Ferd.Marklstr.: Grundkenntnisse Marion Danner 77. Mi. 20... .00 - 19.55, 6 Termine ab 4. Oktober Josef Horner 116. Di. 20.00 - 21.55, 6 Termine ab 4. Okt., ab 5b... Vorstieg Jo Horner 118. Do. 18.00 - 19.55, 6 Termine ab ... |
|||
|
Source: Jüttler, Bert - Institut für Angewandte Geometrie, Johannes Kepler Universität Linz |
|||
|
Collection: Mathematics |
|||
| 66 | MTH 310 Syllabus Fall 2000 CLASS TIME: MWF 10:00 { 10:50 in Addams Hall 220 from 08/21/2000 to 12/01/2000. | ||
|
Summary: changes : L-1 Mon Aug 21 1.1 linear systems and row operations { 1ab,5,6ad L-2 Wed Aug 23 1.2 echelon form... { no classes L-41 Mon Nov 27 6.5 quadratic forms { 1ab,6acef L-42 Wed Nov 29 6.6 positive de#12;nite matrices |
|||
|
Source: Verschelde, Jan - Department of Mathematics, Statistics, and Computer Science, University of Illinois at Chicago |
|||
|
Collection: Mathematics |
|||
| 67 | AMTLICHE MITTEILUNGEN FERNUNIVERSITAT | ||
|
Summary: 'ch die Zahl "63" ersetzt. c) In Abs. 5 Satz 3 wird die Zahl "56" durch die Zahl "63" ersetzt. 3. § 8 wird... "91" ersetzt. 5. In § 10 Abs. 1 wird die Zahl "56" durch die Zahl "63" ersetzt. 6. § 11 Abs. 5 erhält... 'ch die Zahl "63" ersetzt. c) In Abs. 5 Satz 3 ... |
|||
|
Source: Güting, Ralf Hartmut - Fakultät für Mathematik und Informatik, FernUniversität in Hagen |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 68 | Vierte Satzung zur nderung der Diplomprfungsordnung | ||
|
Summary: Klammerzusatz ,,(Abs. 5)" ersetzt. 11. In § 22 Abs. 1 Satz 2 Halbsatz 2 wird ,,Abs. 6" durch ,,Abs. 5" ersetzt... ) Abs. 6 erhält folgende Fassung: ,,(6) 1 Für mathematische Teilprüfungen können Prüfer nur diejenigen... ... |
|||
|
Source: Kersting, Roland - Fakultät für Physik, Ludwig-Maximilians-Universität München |
|||
|
Collection: Physics |
|||
| 69 | Fakultt Wirtschafts-und Sozialwissenschaften Prfungsausschuss | ||
|
Summary: Teilzeitstudium ausge- schlossen (gem. § 4 Abs. 5 der Prüfungsord- nung). 2. Das Anmeldeverfahren a) Vorgespräch... Fakultätsorgan (gem. §14 Abs. 5 S. 1 der Prüfungsordnung). Die endgültige und verbindliche The- menausgabe zur... . §14 Abs. 5 S. 2 der ... |
|||
|
Source: Kurtz, Stefan - Center for Bioinformatics, Universität Hamburg |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 70 | D I E N S T B L A T T DER HOCHSCHULEN DES SAARLANDES | ||
|
Summary: Verlaufe des Studiums spezielle interdisziplinäre Lehr- veranstaltungen (gemäß § 20 Abs. 6 Ziff. 4 und § 23... Abs. 5 Ziff. 9) absol- viert und die Teilnahme an Lehrveranstaltungen in weiteren Fächern der... fachgebundene Studienberechtigung gemäß § 82 Abs. ... |
|||
|
Source: Huber, Patrick - Technische Physik, Universität des Saarlandes |
|||
|
Collection: Physics ; Materials Science |
|||
| 71 | Diplomprfungsordnung fr den integrierten Studiengang Maschinenbau | ||
|
Summary: ausreichend. (5) Für die Prüfer und Beisitzer gilt § 5 Abs. 6 Sätze 2 und 3 entsprechend. § 7 Anrechnung von... in Absatz 3 genannten Voraussetzungen werden im Falle des § 7 Abs. 6 durch entsprechende Feststellungen im... § 12 Abs. 5. (5) Gegenstand der ... |
|||
|
Source: Hellebrand, Sybille - Fakultät für Elektrotechnik, Informatik und Mathematik, Universität Paderborn |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 72 | Amtliche Bekanntmachung Jahrgang 2010 / Nr. 032 | ||
|
Summary: . 3 wird der Passus ,,(Anhänge 1 und 2)" durch den Passus ,,(Anhang)" ersetzt. b) In Abs. 6 wird die... ,,10 bis 21" durch den Passus ,,G1 bis G6" ersetzt. b) Es werden folgende neue Abs. 5 und 6 eingefügt... Ausführungen entsprechend." c) Die bisherigen Abs. 5 und ... |
|||
|
Source: Ott, Albrecht - Physikalisches Institut, Universität Bayreuth |
|||
|
Collection: Physics ; Biology and Medicine |
|||
| 73 | Zweite Satzung zur nderung der Studien-und Prfungsordnung fr das Bachelorstudium der Biologie und das Masterstudium der Zell-und | ||
|
Summary: . August 2011 Aufgrund von Art. 13 Abs. 1 in Verbindung mit Art. 43 Abs. 5, Art. 58 Abs. 1 und Art. 61 Abs... werden." 2. In § 8 Abs. 6 Satz 2 wird das Wort ,,Rektorin" durch das Wort ,,Präsidentin" und das Wort... , elektronischer Fassung" eingefügt. b) In Abs. 5 ... |
|||
|
Source: Gugat, Martin - Mathematisches Institut, Friedrich-Alexander University Erlangen-Nürnberg |
|||
|
Collection: Mathematics |
|||
| 74 | Ordnung fr die Bachelorprfung in Mathematik an der Technischen Universitt Kaiserslautern | ||
|
Summary: . Abs. 5 Satz 3 und 4 gilt entsprechend. (7) Leistungen gemäß Abs. 4 kann nur erbringen, wer zum... obliegen unter Wahrung der Vorschriften von § 25 Abs. 5 HochSchG die Organisation der Prüfungen und die ihm... (1) Die Modulprüfungen in den mathematischen Blöcken (§ 2 Abs. ... |
|||
|
Source: Pinnau, René - Fachbereich Mathematik, Technische Universität Kaiserslautern |
|||
|
Collection: Mathematics |
|||
| 75 | Veranstaltungsverzeichnis Sommersemester 2011 | ||
|
Summary: Unterrichtsqualität Pädagogische Schulentwicklung nach Dr. H. Klippert 3.1186 S ab 5. Sem. Do 14:0016:00 15/133 WPK... Pädagogische Schulentwicklung nach Dr. H. Klippert 3.1186 S ab 5. Sem. Do 14:0016:00 15/133 Beer, K... Schulentwicklung nach Dr. H. Klippert 3.1186 S ab ... |
|||
|
Source: Steinhoff, Heinz-Jürgen - Fachbereich Physik, Universität Osnabrück |
|||
|
Collection: Biology and Medicine ; Physics |
|||
| 76 | Konsolidierte Fassung der Universitt Bayreuth: Der Text dieser Satzung ist nach dem aktuellen Stand sorgfltig erstellt; gleichwohl sind | ||
|
Summary: ) ge- mäß Art. 19 Abs. 5 Satz 5 i. V. m. Abs. 6 Satz 1 BayHSchG eingerichtet, die für die Fakultät für... An der Universität Bayreuth wird gemäß Art. 19 Abs. 5 Satz 5 i.V.m. Abs. 6 Satz 1 BayHSchG die Bayreuther... . 21 ... |
|||
|
Source: Schmidt, Matthias - Physikalisches Institut, Universität Bayreuth |
|||
|
Collection: Physics ; Materials Science |
|||
| 77 | BBuuiillddiinngg EEnneerrggyy EEffffiicciieennccyy PPrrooggrraamm Center for Energy Efficiency and Renewable Energy | ||
|
Summary: : 0.196 Rf : 0.340 Rb : 0.343 Abs 1: 0.280 Abs 2: 0.130 Abs 3: 0.054 Abs 4: Abs 5: Abs 6: SHGCc: 0... : 0.196 Rf : 0.340 Rb : 0.343 Abs 1: 0.280 Abs 2: 0.130 Abs 3: 0.054 Abs 4: Abs 5: Abs 6: SHGCc: 0 |
|||
|
Source: Massachusetts at Amherst, University of - Center for Energy Efficiency and Renewable Energy, Building Energy Efficiency Program |
|||
|
Collection: Energy Storage, Conversion and Utilization |
|||
| 78 | Ordnung fr die Diplomprfung in Mathematik, Technomathematik und Wirtschaftsmathematik | ||
|
Summary: , der unmittelbar nach Be- kanntgabe des Prüfungsergebnisses (§ 5 Abs. 6 Satz 2) zu stellen ist, die... Prüfungsstoff im Umfang von einer Semester- wochenstunde werden vergeben 1. im Studienschwerpunkt (§ 1 Abs. 6... geltenden Fristen (§ 13 Abs. 2 Satz 2 und 3, § 10 Abs. ... |
|||
|
Source: Krumke, Sven O. - Fachbereich Mathematik, Technische Universität Kaiserslautern |
|||
|
Collection: Mathematics |
|||
| 79 | D I E N S T B L A T T DER HOCHSCHULEN DES SAARLANDES | ||
|
Summary: (§ 7, § 9, § 11, § 14 Abs. 6, § 17 Abs. 5 und § 18 Abs. 2) abhängt, ist diese Entscheidung spätestens... fachgebundene Studienberechtigung gemäß § 82 Abs. 5 UG besitzt. (2) Die Zulassung zu Prüfungen ist beim... verlangen, dass die Entscheidungen nach ... |
|||
|
Source: Huber, Patrick - Technische Physik, Universität des Saarlandes |
|||
|
Collection: Physics ; Materials Science |
|||
| 80 | PHYSICAL REVIEW A 84, 056301 (2011) Comment on "Information flow of quantum states interacting with closed timelike curves" | ||
|
Summary: obtain a state |+ + |k AB 1 2 |00 00|AB + 1 2 |11 11|AB |+ + |n-k-1 AB , (5) where we do not trace out... that it corresponds to preparation of a state 1 2 |00 00|n AB + 1 2 |1- 1-|n AB (6) and inputting n B particles |
|||
|
Source: Wójcik, Antoni - Faculty of Physics, Adam Mickiewicz University |
|||
|
Collection: Physics |
|||
| 81 | Fondamenti di Informatica (Modulo B) #include <iostream.h> | ||
|
Summary: obtain a state |+ + |k AB 1 2 |00 00|AB + 1 2 |11 11|AB |+ + |n-k-1 AB , (5) where we do not trace out... that it corresponds to preparation of a state 1 2 |00 00|n AB + 1 2 |1- 1-|n AB (6) and inputting n B particles |
|||
|
Source: Sperduti, Alessandro - Dipartimento di Matematica Pura e Applicata, Università degli Studi di Padova |
|||
|
Collection: Mathematics |
|||
| 82 | BBuuiillddiinngg EEnneerrggyy EEffffiicciieennccyy PPrrooggrraamm Center for Energy Efficiency and Renewable Energy | ||
|
Summary: .201 Rb : 0.207 Tsol : 0.391 Rf : 0.234 Rb : 0.284 Abs 1: 0.224 Abs 2: 0.105 Abs 3: 0.046 Abs 4: Abs 5... : Abs 6: SHGCc: 0.485 SCc: 0.56 Temperature Distribution (degrees F) for '6 HM88' Condensation Env |
|||
|
Source: Massachusetts at Amherst, University of - Center for Energy Efficiency and Renewable Energy, Building Energy Efficiency Program |
|||
|
Collection: Energy Storage, Conversion and Utilization |
|||
| 83 | urbino worldwide campus applied computer scienceComputer Architecture | ||
|
Summary: 'c' + a (c' + b) 5 literals (complement) = a'c' + a c' + ab 6 literals (distributive) = (a' + a) c' + ab 5 |
|||
|
Source: Bogliolo, Alessandro - Dipartimento di Matematica, Fisica e Informatica, Universita di Urbino "Carlo Bo" |
|||
|
Collection: Computer Technologies and Information Sciences ; Engineering |
|||
| 84 | IMRN International Mathematics Research Notices 2002, No. 15 | ||
|
Summary: of the fiber which is a punctured torus. Since (ab)6 = 1, we have a-1 = b(ab)5 and b-1 = (ab)5 a, hence by our... the K3 surface (compare [8]) which is usually denoted by E(2). Notice that, since (ab)-1 = (ab)5... , rather ... |
|||
|
Source: Ozbagci, Burak - Department of Mathematics, Koc University |
|||
|
Collection: Mathematics |
|||
| 85 | ON THE TOPOLOGY OF COMPACT STEIN SURFACES SELMAN AKBULUT AND BURAK OZBAGCI | ||
|
Summary: is a punctured torus. K -1 -1 Figure 2. PALF induced by trefoil Since (ab)6 = 1, we have a-1 = b(ab)5 and b-1... )-1 = (ab)5 , rather then using the algorithm we can write in a shorter way abb-1 a-1 = (ab)6... = ... |
|||
|
Source: Akbulut, Selman - Department of Mathematics, Michigan State University |
|||
|
Collection: Mathematics |
|||
| 86 | Rheumatoid Arthritis-Associated Gene-Gene Interaction Network for Rheumatoid Arthritis Candidate Genes | ||
|
Summary: is a punctured torus. K -1 -1 Figure 2. PALF induced by trefoil Since (ab)6 = 1, we have a-1 = b(ab)5 and b-1... )-1 = (ab)5 , rather then using the algorithm we can write in a shorter way abb-1 a-1 = (ab)6... = ... |
|||
|
Source: Lo, Shaw-Hwa - Department of Statistics, Columbia University |
|||
|
Collection: Biotechnology ; Mathematics |
|||
| 87 | Evaluation of products for the suppression of citrus canker | ||
|
Summary: ;Rate/A 2006 2007 2008 2009 2010 2006 2007 2008 2009 2010 grapefruit 1 Untreated x x x x x 42 ab 5.5 bc... 2006 25.5 a 31Actinovate plus omega plujs 2006 53 ab 32kasumin 2006 46.3 ab 6Qxidate 1/200 v/v (1... 2006 2007 2008 2009 2010 grapefruit 1 Untreated x x x x x 42 ab ... |
|||
|
Source: Cline, Kenneth C. - Horticultural Sciences Department, University of Florida |
|||
|
Collection: Biology and Medicine |
|||
| 88 | The HSP90 family of genes in the human genome: Insights into their divergence and evolution | ||
|
Summary: .3 FLC 3 505 (505) 58.26 +/À +/À +/À + +/À N/A HSP90AB5P HSP90AB5PNP HSP90AB5PPN HSP90AB5PNN 3+ p12.3 FLC... 1 74 (74) 8.38 À +/À À À +/À N/A HSP90AB6P ... |
|||
|
Source: Monteiro, Antónia - Center for Genomics and Proteomics, Yale University |
|||
|
Collection: Biotechnology ; Biology and Medicine |
|||
| 89 | Light scattering properties of spheroidal particles Shoji Asano | ||
|
Summary: .3 FLC 3 505 (505) 58.26 +/À +/À +/À + +/À N/A HSP90AB5P HSP90AB5PNP HSP90AB5PPN HSP90AB5PNN 3+ p12.3 FLC... 1 74 (74) 8.38 À +/À À À +/À N/A HSP90AB6P ... |
|||
|
Source: Goddard Institute for Space Studies (NASA) |
|||
|
Collection: Environmental Sciences and Ecology ; Geosciences |
|||
| 90 | MTH6104 Algebraic Structures II Problem Sheet 9 Solutions | ||
|
Summary: .3 FLC 3 505 (505) 58.26 +/À +/À +/À + +/À N/A HSP90AB5P HSP90AB5PNP HSP90AB5PPN HSP90AB5PNN 3+ p12.3 FLC... 1 74 (74) 8.38 À +/À À À +/À N/A HSP90AB6P ... |
|||
|
Source: Cameron, Peter - School of Mathematical Sciences, Queen Mary, University of London |
|||
|
Collection: Mathematics |
|||
| 91 | TdL-Durchfhrungshinweise vom 18. August 2006 | ||
|
Summary: .....................................................................................................22 5.3 Zu § 5 Abs. 5 TVÜ - Teilzeitbeschäftigte ..................................................23... 5.4 Zu § 5 Abs. 6 TVÜ - Berücksichtigung von Zeiten ohne Vergütung/ Lohn im Oktober 2006... .7.3 ... |
|||
|
Source: Pfeifer, Holger - Institut für Künstliche Intelligenz, Universität Ulm |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 92 | 2007 Wisconsin Turfgrass Research Reports | ||
|
Summary: .....................................................................................................22 5.3 Zu § 5 Abs. 5 TVÜ - Teilzeitbeschäftigte ..................................................23... 5.4 Zu § 5 Abs. 6 TVÜ - Berücksichtigung von Zeiten ohne Vergütung/ Lohn im Oktober 2006... .7.3 ... |
|||
|
Source: Bent, Andrew F. - Department of Plant Pathology, University of Wisconsin at Madison |
|||
|
Collection: Biology and Medicine |
|||
| 93 | DYNAMICS OF THE DEGREE SIX LANDEN TRANSFORMATION | ||
|
Summary: in (1.6) are independent of the variables c, d and e so they define a map 6(a, b) = ab + 5a + 5b + 9 (a... the fixed points of the map 6 defined in (1.7). These points satisfy ab + 5a + 5b + 9 (a + b + 2)4/3 = a(6... of 6, namely a = cd + 5c + 5d + 9 n4 c = ab + 5a + ... |
|||
|
Source: Chamberland, Marc - Department of Mathematics and Computer Science, Grinnell College |
|||
|
Collection: Mathematics |
|||
| 94 | Prfungsordnung der Universitt Stuttgart fr die akademische Abschlussprfung in den Magisterstudiengngen (Magisterordnung), Allgemeine Bestimmungen | ||
|
Summary: - soweit die Notensysteme vergleichbar sind - zu übernehmen und entsprechend § 13 Abs. 5 und Abs. 6 in die... jeweils bessere Ergebnis. (7) Bei der Berechnung der Semester nach Abs. 5 und 6 bleiben Zeiten der... unberücksichtigt. Die Frist nach ... |
|||
|
Source: Möbius, Bernd - Institut für Maschinelle Sprachverarbeitung, Universität Stuttgart |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 95 | Supplementary Table 1: This table lists the order of stimuli along the x-axis of each tuning curve. Stimuli are listed in order from left to | ||
|
Summary: 9 water 5 water 4 empty vial 5 empty vial 7 #12;100 ms 1 mV ab5 sensillum recording: Or67d-Gal4;UAS... -DTl (using Gal4 line from ref. 15) A B A A B B B A B A B A ab5 sensillum recording: Or67d-Gal4;UAS-DTl (using... Figure 1. In Or67d-Gal4 flies, Gal4 is expressed ectopically in ... |
|||
|
Source: Wilson, Rachel - Department of Neurobiology, Harvard University |
|||
|
Collection: Biology and Medicine |
|||
| 96 | Nichtamtliche Lesefassung der Prfungsordnung Prfungsordnung der Universitt Mannheim | ||
|
Summary: Bereichsnote geht zusätzlich zu den nach § 6 Abs. 5 errechneten Noten in die Gesamtnote ein. § 6 Abs. 6 gilt... . (6) Die Gesamtnote der Master-Prüfung wird aus den Noten gemäß § 6 Abs. 5 sowie der Note der Master... sich aus mehreren Prüfungsleistungen laut ... |
|||
|
Source: Mannheim, Universität - Institut für Informatik, Forschungsgruppe Datenbanken |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 97 | Aharonov-Bohm 1.1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 | ||
|
Summary: . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5 1.2.4 AB . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6 1.2.5 Landauer... .286 -0.284 -0.282 -0.280 Center Gate Voltage (V) Experiment 167mK 30mK 4.6: 30 mK ( ) 26 #12;5 Fano AB 5... .1 3 Fano ... |
|||
|
Source: Katsumoto, Shingo - Institute for Solid State Physics, University of Tokyo |
|||
|
Collection: Materials Science |
|||
| 98 | zur nderung der Prfungsordnung fr den Modellstudiengang Bachelor in Informatik | ||
|
Summary: Kandidatin oder der Kandidat sich in einem anderen Prüfungsverfahren befindet." b) Abs. 5 Satz 2 wird... ) In Abs. 6 Satz 1 wird das Wort ,,gewichtete" gestrichen. 6. In § 17 Abs. 10 Satz 1 werden die Worte ,,im... : ,,(5) Für Jungstudierende nach § 65 Abs. 6 HG, ... |
|||
|
Source: Güting, Ralf Hartmut - Fakultät für Mathematik und Informatik, FernUniversität in Hagen |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 99 | HYDROLOGICAL PROCESSES Hydrol. Process. 19, 115135 (2005) | ||
|
Summary: Upwellling occurred AB1 AB2 AB3 ML3 AB4 ML1 ML2 ML4 AB6 SG2SG1 AB5 SG3 -250 -200 -150 -100 -50 0 50 100 150... 210 while Q was falling, and AB5 continued until JD219, during which time snowfall and low... temperatures occurred. ... |
|||
|
Source: Moorman, Brian - Department of Geography, University of Calgary |
|||
|
Collection: Geosciences |
|||
| 100 | Application of Sparse NMR Restraints to Large-Scale Protein Structure Prediction | ||
|
Summary: ab 6.48 4 10 0 5.37 2 17 2 4.52 2 1dcjA 81 ab 2.72 1 10 0 2.6 1 20 0 2.57 4 1ip9A 85 ab 5.3 3 11 0 5... .7 1 1ncs_ 47 ab 3.84 5 6 0 3.34 4 12 0 2.89 1 1tih_ 53 ab 5.6 1 7 0 5.34 5 13 0 4.66 3 1dax_ 64 ab 2... 3.55 1 1ha6A 70 ab ... |
|||
|
Source: Skolnick, Jeff - Center for the Study of Systems Biology, Georgia Institute of Technology |
|||
|
Collection: Chemistry ; Biology and Medicine |
|||