Home

About

Advanced Search

Browse by Discipline

Scientific Societies

E-print Alerts

Add E-prints

E-print Network
FAQHELPSITE MAPCONTACT US


  Topic List  Advanced Search  
Sample search results for: abc transporter a3

Page:   2  3  4  5 
 
1 ABC transporters: 1, 2 or 4 substrate-binding Tiemen van der Heide and Bert Poolman
 

Summary:  a single receptor fused to a translocator unit is the finding that opuABC from S. coelicolor A3 codes... Chapter 6 65 ABC transporters: 1, 2 or 4 substrate-binding domains? Tiemen van der Heide and Bert... Poolman Summary Two families of ATP-binding Cassette (ABC) ...

  

Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution,

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
2 Gene 221 (1998) 117125 Isolation of an Arabidopsis thaliana cDNA by complementation of a yeast
 

Summary:  spectrophotometer. Absorption maxima expected for the a bands of cytochrome a+a3, b and c are at 602, 558, 546 nm... Gene 221 (1998) 117­125 Isolation of an Arabidopsis thaliana cDNA by complementation of a yeast abc... 1998; Received by B. Dujon Abstract The yeast Abc1 protein acts as a chaperone-like ...

  

Source: Hamel, Patrice - Department of Plant Cellular and Molecular Biology, Ohio State University; Meier, Iris - Department of Plant Cellular and Molecular Biology, Ohio State University

 

Collection: Biology and Medicine

 
3 Summary and concluding ESEARCH on the structure and function of substrate-binding proteins (SBPs)
 

Summary:  -binding proteins (SBPs) of ATP Binding Cassette (ABC) transporters has been ongoing for at least four decades. Our... on the lactococcal oligopeptide binding protein A (OppA), the receptor component of the ABC-transporter oligopeptide... within a voluminous cavity of almost 5000 °A3. ...

  

Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution,

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
4 Bock et al. 2006 Family Summary 1.A.1 Voltage-gated Ion ChannVIC 36 34 2
 

Summary:  .3 Cationic Amino Acid TransAPC 108 putative cationic amino acid transporter CAT 9 8 523 2.A.3.4 Amino Acid... .A.3 P-type ATPase P-ATPase 212 putative Ca2+-transporting P2B-type ATPase ACA 11 11 1108 3.A.3 P... -type ATPase ...

  

Source: Sze, Heven - Department of Cell Biology and Molecular Genetics, University of Maryland at College Park

 

Collection: Biology and Medicine

 
5 Specificity of the oligopeptide ABC transporter The binding specificity of OppA determines the
 

Summary:  Specificity of the oligopeptide ABC transporter 35 Chapter 3 The binding specificity of Opp... A determines the selectivity of the oligopeptide ABC transporter Mark K. Doeven, Rupert Abele, Robert Tampé... ATP- binding cassette (ABC) transporter with a remarkably wide ...

  

Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution,

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
6 ABC transporters: Lessons from a bacterial oligopeptide uptake system
 

Summary:  ABC transporters: Lessons from a bacterial oligopeptide uptake system Mark K. Doeven #12;Cover... by PrintPartners Ipskamp, Enschede #12;RIJKSUNIVERSITEIT GRONINGEN ABC transporters: Lessons from... A determines the selectivity of the oligopeptide ABC transporter 35 ...

  

Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution,

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
7 Nederlandse samenvatting Nederlandse samenvatting voor genteresseerden buiten
 

Summary:  vakgebied Samenvatting ABC transporters zijn eiwitten die betrokken zijn bij de opname van voedingsstoffen... en uitscheiding van schadelijke stoffen in de biologische cel. Defecten in ABC transporters kunnen... bij de mens ernstige ziektes tot gevolg hebben. Te grote activiteit van ABC ...

  

Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution,

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
8 An easy way of transcribing folk and traditional music Version 1.6.1 January '97
 

Summary:  is a six- teenth note, A2 an eighth note, A3 a dotted eighth note, A4 a quarter note, A6 a dotted quarter... the following lines all mean the same thing (the third ver- sion is recommended): L:1/16 a3b cd3 a2b2c2d2 L:1... /8 a3/2b/2 c/2d3/2 abcd L:1/8 a>b c

  

Source: Read, Charles - School of Mathematics, University of Leeds

 

Collection: Mathematics

 
9 2009-taebc ABC-Clio ebooks collection 1203titles ISBN URL
 

Summary:  2009-taebc ABC-Clio ebooks collection 1203titles ISBN URL 1 Arts & Humanities Acquisitions... Bastian, Jeannette Allis Libraries Unlimited Ebooks 2003 http://ebooks.abc- clio.com/?isbn=9780313052378 2... Libraries Unlimited Ebooks 2007 http://ebooks.abc- clio.com/?isbn=9780313094521 3 Arts & Humanities

  

Source: Wu, Yih-Min - Department of Geosciences, National Taiwan University

 

Collection: Geosciences

 
10 ABC SMC for dynamical systems Tina Toni, Michael Stumpf
 

Summary:  particle Tina Toni ABC SMC 26/06/2009 22 / 24 #12;Perturbation kernels Crossover (a1 a2 a3 a4 a5) = x (i) t... ;Perturbation kernels Crossover (a1 a2 a3 a4 a5) Parent chromosomes (b1 b2 b3 b4 b5) (a1 a2 a3 b4 b5) Candidate... -1 = x (j) t-1 = xt ...

  

Source: Robert, Christian P. - Centre De Recherche en Mathématiques de la Décision, Université Paris-Dauphine

 

Collection: Mathematics

 
11 Applied Mathematics Letters 24 (2011) 12511256 Contents lists available at ScienceDirect
 

Summary:  to trigger the induction of ATP-Binding Cassette (ABC) transporters, responsible for the efflux of the drug... of CPT11-induced overexpression of ABC transporters. We then theoretically optimized exposure to CPT11... given as a single agent or combined either with ABC ...

  

Source: Clairambault, Jean - Biologie, Analyse Numérique, Géophysique Team, INRIA Paris-Rocquencourt

 

Collection: Biology and Medicine

 
12 ABC transporters: Lessons from a bacterial oligopeptide uptake system
 

Summary:  ABC transporters: Lessons from a bacterial oligopeptide uptake system Mark K. Doeven #12;Cover... by PrintPartners Ipskamp, Enschede #12;RIJKSUNIVERSITEIT GRONINGEN ABC transporters: Lessons from... A determines the selectivity of the oligopeptide ABC transporter 35 ...

  

Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution,

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
13 ATP-binding cassette protein E is involved in gene transcription and translation in Caenorhabditis elegans
 

Summary:  and nucleus, and possibly as a nucleocytoplasmic transporter. In addition, RNAi data suggest that ABCE and NHR... Elsevier Inc. All rights reserved. Keywords: ABC transporter; ABCE; RNase L inhibitor; Caenorhabditis... of the largest protein families in both prokaryotes and eukaryotes. ...

  

Source: Baillie, David - Department of Molecular Biology and Biochemistry, Simon Fraser University

 

Collection: Biology and Medicine

 
14 2000 Macmillan Magazines Ltd NATURE CELL BIOLOGY | VOL 2 | JULY 2000 | www.nature.com/ncb 399
 

Summary:  -binding-cassette transporter 1 (ABC1) has been implicated in processes related to membrane-lipid turnover. Here, using in vivo... -AI. The involvement of ABC1 in Tangier disease implies that the transporter modulates specific removal of cellular... of cytosolic calcium may be associ- ated with ...

  

Source: Institut de Biologie Physico-Chimique CNRS, Physico-Chimie Moléculaire des Membranes Biologiques

 

Collection: Chemistry ; Biology and Medicine

 
15 Genetic Variation in the Proximal Promoter of ABC and SLC Superfamilies: Liver and Kidney Specific Expression
 

Summary:  Polymorphisms PLoS ONE | www.plosone.org 2 September 2009 | Volume 4 | Issue 9 | e6942 #12;transporters; SLC29A3... , involved in the uptake of nucleotides, anti- cancer and anti-viral drugs; SLC17A3, a phosphate transporter... transporters in the ...

  

Source: 

 

Collection: Biology and Medicine ; Biotechnology

 
16 ABC transporters ABC transporter architecture and regulatory roles of
 

Summary:  ABC transporters 9 Chapter 2 ABC transporter architecture and regulatory roles of accessory domains... of the architecture of ABC transporters and dissect the systems in core and accessory domains. The ABC transporter... ). ...

  

Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution,

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
17 Peptides Signal Mitochondrial Stress Janine Kirstein-Miles1 and Richard I. Morimoto1,*
 

Summary:  has now been revealed by Haynes et al. (2010), who show that the ABC family transporter that effluxes... membrane by the ABC transporter, Mdl1. From this point, it had been assumed that these peptides cross... proteases and a GTPase encoding rheB, clpX1 (K07A3.3), ...

  

Source: Morimoto, Richard - Department of Biochemistry, Molecular Biology, and Cell Biology, Northwestern University

 

Collection: Biology and Medicine

 
18 ANNOUNCEMENT Project Atmospheric Brown Cloud (ABC) 2006 TRAINING SCHOOL
 

Summary:  ANNOUNCEMENT Project Atmospheric Brown Cloud (ABC) 2006 TRAINING SCHOOL Project ABC Science... in a special training school conducted by Project ABC during 4-14 December 2006 in Asia. · Lecturures... Course Director" at: For US students: <ABC_Training-School@fiji.ucsd.edu> For Asian students: ...

  

Source: Goldstein, Allen - Department of Environmental Science Policy and Management, University of California at Berkeley

 

Collection: Environmental Sciences and Ecology

 
19 PROTEIN INTERACTIONS AND DISEASE PHENOTYPES IN THE ABC TRANSPORTER SUPERFAMILY
 

Summary:  PROTEIN INTERACTIONS AND DISEASE PHENOTYPES IN THE ABC TRANSPORTER SUPERFAMILY LIBUSHA KELLY1... Francisco, CA 94158, USA. ABC transporter proteins couple the energy of ATP binding and hydrolysis... known ABC transporters in diseases such as cystic fibrosis and ...

  

Source: Sali, Andrej - Department of Biochemistry and Biophysics, University of California at San Francisco

 

Collection: Biology and Medicine ; Biotechnology

 
20 Genome Biology 2004, 5:R15 commentreviewsreportsdepositedresearchrefereedresearchinteractionsinformation
 

Summary:  commentreviewsreportsdepositedresearchrefereedresearchinteractionsinformation Open Access2004Shepset al.Volume 5, Issue 3, Article R15Research The ABC transporter gene family... purpose, provided this notice is preserved along with the article's original URL. The ABC transporter gene... severalgene families ...

  

Source: Baillie, David - Department of Molecular Biology and Biochemistry, Simon Fraser University

 

Collection: Biology and Medicine


Page:   2  3  4  5 
Page:   1  2  3  4  5 
 
21 Ribosome recycling depends on a mechanistic link between the FeS cluster domain and a
 

Summary:  , Lewinson O (2009) ABC transporters: The power to change. Nat Rev Mol Cell Biol 10:218­227. 5. Schmitt L... , Tampé R (2002) Structure and mechanism of ABC transporters. Curr Opin Struct Biol 12:754­760. 6. Hopfner... 25:9859­9873. 8. Hopfner KP, Tainer JA (2003) Rad50/SMC proteins and ...

  

Source: Bedwell, David M. - Department of Microbiology, University of Alabama at Birmingham

 

Collection: Biology and Medicine

 
22 The Circle centre O and radius OH Christopher J Bradley
 

Summary:  c2 + 1) + 8a3 b2 c2 (b + c) + a2 (b4 c2 + 8b3 c3 + b2 (c4 + 1) + 8bc + c2 ) + 8abc(b + c) + b2 c2... + b + c) + a4 bc(b4 c2 + 18b3 c3 + b2 (c4 ­ 1) + 4bc ­ c2 ) + a3 bc(b5 c2 + b4 c3 + b3 (c4 ­ 1) + b2 c... + 2b2 (c4 ­ 2) ­ 7bc ­ 4c2 ) + a3 ...

  

Source: Smith, Geoff - Department of Mathematical Sciences, University of Bath

 

Collection: Mathematics

 
23 The ABC of ABC-transport in the hyperthermophilic
 

Summary:  The ABC of ABC-transport in the hyperthermophilic archaeon Pyrococcus furiosus #12;This work... ;RIJKSUNIVERSITEIT GRONINGEN The ABC of ABC-transport in the hyperthermophilic archaeon Pyrococcus furiosus... by an inducible, high-affinity ABC-transporter 25 Chapter 3 Biochemical evidence ...

  

Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution,

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
24 The ABC of ABC-transport in the hyperthermophilic
 

Summary:  The ABC of ABC-transport in the hyperthermophilic archaeon Pyrococcus furiosus #12;This work... ;RIJKSUNIVERSITEIT GRONINGEN The ABC of ABC-transport in the hyperthermophilic archaeon Pyrococcus furiosus... by an inducible, high-affinity ABC-transporter 25 Chapter 3 Biochemical evidence ...

  

Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution,

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
25 Galapagos whales hold pollutant mystery > News in Science (ABC Science) http://www.abc.net.au/science/articles/2010/12/06/3085949.htm[12/6/2010 3:21:02 PM]
 

Summary:  Galapagos whales hold pollutant mystery > News in Science (ABC Science) http://www.abc... pollutant mystery Katherine Nightingale ABC Whales living near the Galapagos Islands appear to have been... , industry, agricultural practices - all of those contaminants end Browse the archiveSearch ABC Science Share

  

Source: Rock, Chris - Department of Biological Sciences, Texas Tech University

 

Collection: Biology and Medicine

 
26 List of publications Jacobs, M. H., T. v.d. Heide, A. J. Driessen, and W. N. Konings. 1996. Glutamate transport in
 

Summary:  .Bacteriol. 182:203-206. Heide, T. v. d. and B. Poolman. 2000. Osmoregulated ABC transport system of Lactococcus... of an ABC transport system for glycine betaine. EMBO J. 20:7022-7032. Wood, J. M., E. Bremer, L. N. Csonka... and function of osmoregulated ABC ...

  

Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution,

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
27 Cellobiose uptake in the hyperthermophilic Archaeon Pyrococcus furiosus is mediated by an inducible,
 

Summary:  by an inducible, high-affinity ABC-transporter Sonja M. Koning, Marieke G. L. Elferink, Wil N. Konings and Arnold... a transporter that belongs to the Opp-family of ABC-transporters. Introduction Pyrococcus species are anaerobic... -dependent ATP- binding cassette (ABC)-transporter (Schlosser et al., 1999). ...

  

Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution,

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
28 Second-order optical response in semiconductors J. E. Sipe and A. I. Shkrebtii
 

Summary:  IN SEMICONDUCTORS #12;certain amount of algebra, which is outlined in Appendix B, we find Jintra a t (2) 2 abc ; , i... 2 abc ; , Eb Ec e i t 36 where 2 abc 2R abc i(¯ 2I abc ~ 2I abc ), with 2 abc ; , e3 8 2 dk 8 3 n... ,m mn a fnm rnm c ,rmn b ...

  

Source: Sipe,J. E. - Department of Physics, University of Toronto

 

Collection: Physics

 
29 On the osmotic signal and osmosensing mechanism of an
 

Summary:  On the osmotic signal and osmosensing mechanism of an ABC transport system #12;2 Voor mijn ouders... Cover: On the osmotic signal and osmosensing mechanism of an ABC transport system Cover design: Tiemen... signal and osmosensing mechanism of an ABC transport system ...

  

Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution,

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
30 Dr. Z.'s Math 250(2), (Fall 2010, RU) Solutions to REAL Quiz #3 (Sept. 30, 2010) 1. (4 pts.) Find A4
 

Summary:  people first did the intermediate step A3 , and then did (A3 )A. One person got so much into it and did A... independent! (b) (1 pt.) If A and B are matrices for which the product A(BC) and the product (AB)C are both... defined, then sometimes ...

  

Source: Zeilberger, Doron - Department of Mathematics, Rutgers University

 

Collection: Mathematics

 
31 Structural Determinants of Metal Specificity in the Zinc Transport Protein ZnuA from Synechocystis 6803
 

Summary:  of bacterial metal transporters belong to the cluster 9 family of ABC transporters. The residues... to that of the SBPs from the two transition metal ABC transporters PsaA and TroA, significant differences in the metal... A is similar to the previously determined structures of the peri- ...

  

Source: Pakrasi, Himadri - Department of Biology, Washington University in St. Louis

 

Collection: Biology and Medicine

 
32 Proton motive force-dependent Hoechst 33342-transport by the ABC transporter LmrA of Lactococcus lactis
 

Summary:  35 Chapter 3 Proton motive force-dependent Hoechst 33342-transport by the ABC transporter Lmr... constructed mutants of the adenosine triphosphate (ATP) binding cassette (ABC)-type MDR transporter Lmr... in the ABC signature motif with an LmrA-mediated Hoechst ...

  

Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution,

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
33 Summary and concluding remarks The archaeon Pyrococcus furiosus
 

Summary:  were studied during this thesis work. Three inducible ATP-binding cassette (ABC-) transport systems... source are all transported by one of these three ABC-transporters. Cellobiose/-Glucoside transport P... of the ABC-transport family (Chapter 2) and ...

  

Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution,

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
34 Peptides 25 (2004) 14251440 Peptide signal molecules and bacteriocins in Gram-negative bacteria: a
 

Summary:  secretion ABC transporter 12 Cvi A3 Chromobacterium violaceum NC 005085 hlyB 709 Hemolysin B 13 Cvi B1... 2021 712 ABC transporter 39 Nsp A2 Nostoc sp. NC 003272 alr1201 722 ABC transporter 40 Nsp ...

  

Source: Leuven, Katholieke Universiteit, Department of Electrical Engineering, SCD Division

 

Collection: Engineering

 
35 Plant Cuticular Lipid Export Requires an ABC Transporter
 

Summary:  Plant Cuticular Lipid Export Requires an ABC Transporter Jamie A. Pighin,1 * Huanquan Zheng,1... caused by a defective peroxisomal aden- osine triphosphate binding cassette (ABC) transporter. We found... that the CER5 gene encodes an ABC transporter localized in the ...

  

Source: Kunst, Ljerka - Department of Botany, University of British Columbia; Western, Tamara L. - Department of Biology, McGill University

 

Collection: Biology and Medicine

 
36 50years of service excellenceyears of service excellenceyears of service excellence 50years of service excellenceyears of service excellenceyears of service excellence
 

Summary:  : Christine LeBlanc, EH&S Date: May 7, 2010 Re: Off-Site Management of Asphalt, Brick & Concrete (ABC) Debris... ______________________________________________________________________________ This memorandum further clarifies the requirements for the off-site management of asphalt, brick and concrete (ABC... of Construction and Demolition ...

  

Source: Prentiss, Mara - Department of Physics, Harvard University

 

Collection: Physics

 
37 Acta Materialia 51 (2003) 64776491 www.actamat-journals.com
 

Summary:  micrographs of the overload fracture surfaces of (a) 3ABC-, (b) 5ABC- and (c) 7ABC-SiC. Fracture in 3ABC and 5... . Transmission electron micrographs near the crack tip in (a) 3ABC, and (b, c) ...

  

Source: Kruzic, Jamie - School of Mechanical, Industrial, and Manufacturing Engineering, Oregon State University; Ritchie, Robert O. - Lawrence Berkeley National Laboratory

 

Collection: Engineering ; Materials Science

 
38 Name:______________________________ February 13th
 

Summary:  to binary b) 11010000011012 to hexadecimal c) A3B16 to decimal #12;4) I have a cat transport vehicle... that can hold 2 kilograms of hot sauce. I have to drive the transport through two checkpoints, each... a checkpoint. a) How many cats can I transport? b) How many bits would be ...

  

Source: Beasley, Ryan A. - Department of Engineering Technology and Industrial Distribution, Texas A&M University

 

Collection: Engineering ; Multidisciplinary Databases and Resources

 
39 Summary and concluding remarks Introduction
 

Summary:  (ABC) transporters MsbA, a lipid efflux system that was crystallized in three conformations... of a complete transporter is available yet, The abbreviations used are: ABC, ATP-binding cassette; ECD... by ABC transporters, in particular that of the oligopeptide ...

  

Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution,

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
40 Supplementary Methods, Results, Tables and Figures Systems metabolic engineering of Escherichia coli for L-
 

Summary:  a 664-bp fragment. Another 657-bp fragment was amplified using primers thrA3 and thrA4, containing... fragment was amplified using primers ilvA3 and ilvA4, containing a mutated nucleotide (19th C T) and a Pst... GATTGCGTAATCAGCACCACGAAAATACGGGCGCGTGACATCG thrA3 ...

  

Source: Korea Advanced Institute of Science and Technology, Department of Chemical and Biomolecular Engineering, Metabolic & Biomolecular Engineering National Research Laboratory

 

Collection: Engineering ; Biotechnology


Page:   1  2  3  4  5 
Page:   1  2  3  4  5 
 
41 Asynchronous Bit-stream Compression (ABC) Arkadiy Morgenshtein, Avinoam Kolodny, Ran Ginosar
 

Summary:  and after the transportation along the link. In this section we describe the architecture of the ABC... Asynchronous Bit-stream Compression (ABC) Arkadiy Morgenshtein, Avinoam Kolodny, Ran Ginosar... propose a new technique of Asynchronous Bit-stream Compression (ABC), based on Level Encoded Dual- Rail

  

Source: Kolodny, Avinoam - Department of Electrical Engineering, Technion, Israel Institute of Technology

 

Collection: Engineering

 
42 Macaulay 2 Worksheet Macaulay 2 is a software system devoted to supporting research in algebraic geometry and com-
 

Summary:  {1_S, a, a^2, b, b^2, a*b, a^3, b^3} Describe the default monomial ordering used in Macaulay2... = matrix table(5,5, (i,j) -> S_i^j) factor det(M) S = QQ[a..i]; M = genericMatrix(S,a,3,3) I = ideal det M... I = minors(2,M) transpose mingens I S = QQ[t,a..i]; M = ...

  

Source: Smith, Gregory G. - Department of Mathematics and Statistics, Queen's University (Kingston)

 

Collection: Mathematics

 
43 Peptide transport in microorganisms Specificity and selectivity determinants of peptide
 

Summary:  (ABC) transporters, the latter utilizing single or multiple peptide-binding proteins with overlapping... of their cognate ABC transporters. Besides reviewing the current data on binding specificity and transport... ATP- binding cassette (ABC) ...

  

Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution,

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
44 Copyright 2007 by the Genetics Society of America DOI: 10.1534/genetics.106.066720
 

Summary:  Accepted for publication December 24, 2006 ABSTRACT ABC transporters constitute one of the largest gene... -binding cassette (ABC) transporter proteins con- stitute one of the largest protein families in both prokaryotes... acids into the cell. In eukaryotes, the majority of ABC ...

  

Source: Baillie, David - Department of Molecular Biology and Biochemistry, Simon Fraser University

 

Collection: Biology and Medicine

 
45 Profiling of ABC transporters Justina Clarinda Wolters
 

Summary:  Profiling of ABC transporters Justina Clarinda Wolters #12... by the Netherlands Proteomics Centre (NPC). #12; RIJKSUNIVERSITEIT GRONINGEN Profiling of ABC... transporters Proefschrift ter verkrijging van het doctoraat in de Wiskunde en Natuurwetenschappen

  

Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution,

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
46 General Introduction Chapter 1: General Introduction
 

Summary:  -dependent primary transporters 21 4.1: The ABC superfamily portrait 21 4.2: The substrate-binding domain 22 4... -dependent transporters 27 5.1: Substrate binding 28 5.2: Functional interactions in the binding protein-dependent 30 ABC... -hydrolysis (Fig. 1c). These proteins are members of the ATP-binding ...

  

Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution,

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
47 Nature Macmillan Publishers Ltd 1998 letters to nature
 

Summary:  -binding subunits of ABC transporters is the largest, containing 40 members. The importance of catabolic degradation... /G, osmoprotection protein; Cu2+ , copper-transporting ATPase; +?, cation-transporting ATPase; ?, ABC-transporter... ? Acetate Ethanol PEP fadA ...

  

Source: Badger, Jonathan - Institute for Genomic Research, Rockville

 

Collection: Biotechnology ; Biology and Medicine

 
48 List of publications 1. Poelarends, G.J., Mazurkiewicz, P., Putman, M., Cool, R.H., van Veen,
 

Summary:  .W., and Konings, W.N. (2000). An ABC-type multidrug transporter of Lactococcus lactis possesses an exceptionally... a heterodimeric ABC- type multidrug transporter. Accepted to J. Biol. Chem. 7. Mazurkiewicz, P., Driessen, A... in transport of lipophilic cationic compounds. J. Biol. ...

  

Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution,

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
49 5. Assessment of the Deepwater Flatfish Stock in the Gulf of Alaska (Executive Summary)
 

Summary:  ;2010 2011 2011 2012 M (natural mortality) 0.085 0.085 0.085 0.085 Specified/recommended tier 3a 3a 3a 3a... ABC levels for those years. Dover sole is assessed using an age-structured model and Tier 3... -species ABC and OFL ...

  

Source: NOAA Marine Fisheries Review

 

Collection: Environmental Sciences and Ecology

 
50 Copyright 2007 by the Genetics Society of America DOI: 10.1534/genetics.107.080689
 

Summary:  -binding cassette (ABC) transporter homologous to mammalian multidrug resistance proteins, functions... , another ABC transporter that acts in parallel to MRP-4 for the formation of birefringent material... in the gut granule. ATP-binding cassette (ABC) transporters ...

  

Source: Hermann, Greg J. - Department of Biology, Lewis and Clark College

 

Collection: Biology and Medicine

 
51 RESEARCH ARTICLE Open Access Dynamics of glutamatergic signaling in the
 

Summary:  axonal bundles in the pedunculus and throughout the MBs (Figure 1A3). The a/bc KCs present a high level... and expressing mCD8::GFP. (A1-A3) GFP and Glu expression in 201Y-GAL4 are located both in the a/bc and g lobes... of the pedunculus contains axons of the g ...

  

Source: Ecole Polytechnique, Centre de mathématiques

 

Collection: Mathematics

 
52 Article: CJB/2011/125 Properties of the Extangential Triangle
 

Summary:  ­ a, c + a ­ b, 0), N1(0, a + b + c, a ­ b ­ c), N2(a + b + c, 0, b ­ c ­ a). 3. The extangential... )(b + c)2 , (3.1) y = ­ b2 (a + b + c), (3.2) z = c2 (b + c ­ a). (3.3) The line LJ1 may now be seen... )2 , (3.4) y = b2 (b + c ­ a), (3.5) z = ­ c2 (a + b + ...

  

Source: Smith, Geoff - Department of Mathematical Sciences, University of Bath

 

Collection: Mathematics

 
53 Expression Analysis of ABC Transporters Reveals Differential Functions of Tandemly Duplicated Genes in
 

Summary:  Expression Analysis of ABC Transporters Reveals Differential Functions of Tandemly Duplicated Genes... , BC Canada V5Z 1L6 We have previously identified 60 predicted ABC transporter genes... region for a neighbouring gene. q 2004 Elsevier Ltd. All rights reserved. Keywords: ABC ...

  

Source: Baillie, David - Department of Molecular Biology and Biochemistry, Simon Fraser University

 

Collection: Biology and Medicine

 
54 6 Triangles 6.1 Congruence
 

Summary:  A See Section 6.5.1. 2. sin2 A+ cos2 A = 1, thus sinA = p 1 ,cos2 A. 3. a2 = b2 + c2 ,2bccosA, thus cos... noncollinear points A;B;C, 4ABC is de ned to be AB BC AC. Refer to page 132 to con rm your understanding... angles, and side opposite an angle. De nition: Given two triangles 4ABC ...

  

Source: Lee, Carl - Department of Mathematics, University of Kentucky

 

Collection: Mathematics

 
55 A Simple Counterexample to the Finite Axiomatizability
 

Summary:  is shown in Fig. 2 with the row containing (a3,b4,c6) deleted. In this case, it need not be the case that a... ; a1 b1 c1 d1 a1 b2 c2 d1 a2 b2 c3 d1 a2 b3 c4 d1 a3 b3 c5 d1 a3 b4 c6 d1 a4 b4 c7 d1 a4 b5 c8 d1... c2 d1 a2 b2 c3 d1 a2 b3 c4 d1 ...

  

Source: Hegner, Stephen J. - Department of Computing Science, Umeå Universitet

 

Collection: Computer Technologies and Information Sciences

 
56 A genomic survey of the distribution of ABC-transporters in the hyperthermophilic archaeal Pyrococcus species
 

Summary:  Chapter 5 1 A genomic survey of the distribution of ABC-transporters in the hyperthermophilic... of ABC-transport systems. Of the seventeen to nineteen ABC-transporters present per species, eight... , phosphoenolpyruvate (PEP)- dependent phosphotransferase systems (PTS), and ATP-binding cassette (ABC-) ...

  

Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution,

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
57 Relaxations of the ABC conjecture using integer k'th roots Version: 18th July 2004
 

Summary:  = (u, v1) and applying ABC-(k,µ) to obtain the same inequality for a1, and hence for a. 3. From (1... Therefore vn ,a a3n( 1 1/ +1 + 1 k ) Choose = 1 2 and 1 = log 2/(8 log a) and (k, ) so that 3( 1 1/ + 1 + 1... Relaxations of the ABC conjecture using integer k'th ...

  

Source: Broughan, Kevin A. - Department of Mathematics, University of Waikato

 

Collection: Mathematics

 
58 Nederlandse samenvatting voor geinteresseerden buiten dit
 

Summary:  als transporteiwitten. Een speciale categorie membraaneiwitten zijn de ABC-transport eiwitten. ABC... membraan uit te voeren. ABC- transport eiwitten zijn te vinden in alle organismen, en hebben een belangri... stoffen. De ABC-transport eiwitten zijn normaal gesproken opgebouwd uit drie ...

  

Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution,

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
59 THIS DOCUMENT IS PROVIDED AS A GUIDE FOR CONSIDERING THE RANGE OF ISSUES RELATED TO DEVELOPING INTERNATIONAL PROGRAMS. ANSWERS
 

Summary:  be included? How many? o Is laundry service provided? Transportation o For what transportation costs will ABC... RELATED SERVICES Between Company/University ABC [City, Country] And California State University, Fullerton... , Fullerton ("University") and Company/University ABC ...

  

Source: de Lijser, Peter - Department of Chemistry and Biochemistry, California State University, Fullerton

 

Collection: Chemistry

 
60 Journal de Th'eorie des Nombres de Bordeaux, to appear. SHARPER ABC-BASED BOUNDS
 

Summary:  avgAdegradA + 3 avgA6=Bdegradgcd{A, B}. On the other hand, e #S avgAdegrad A - #S2avgA6... Journal de Th'eorie des Nombres de Bordeaux, to appear. SHARPER ABC... h. Voloch pointed out an application of the Stothers-Mason ABC theorem in t* *his

  

Source: Bernstein, Daniel - Department of Computer Science, University of Illinois at Chicago

 

Collection: Computer Technologies and Information Sciences


Page:   1  2  3  4  5 
Page:   1  2  3  4  5 
 
61 New Pathways in Folding of the Tetrahymena Group I Rick Russell and Daniel Herschlag*
 

Summary:  0.1a 0.40a 1.1 Æ 0.3b 0.54 Æ 0.05b 50 6.0 Æ 1.5a 5.1a 3.4 Æ 1.2a 50 mM NaÁMops (pH 7.0) (determined... of the periph- eral element P5abc. This, along with other results, has suggested that P5abc may serve... cleavage activity as a readout for native state formation and investigate the effect of ...

  

Source: Herschlag, Dan - Department of Biochemistry, Stanford University

 

Collection: Biology and Medicine

 
62 Discussion and concluding remarks General introduction
 

Summary:  activated transporters. A detailed study of the osmoregulated ATP- binding cassette (ABC) transporter Opu... into the mechanism rooting the osmotic activation of OpuA and to prove that this `two-component ABC transporter... in the membrane and/or the orientation after reconstitution is ...

  

Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution,

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
63 Farmer Brown is standing in the middle of his perfectly circular field feeling very content. It is midnight and there is no moon and unknown to the farmer,
 

Summary:  at midnight. As soon as there are martians at points A,B,C such that triangle ABC contains the center... of the field, Farmer Brown will be teleported to the waiting space-ship and transported off to spend the rest

  

Source: Carnegie Mellon University, School of Computer Science

 

Collection: Computer Technologies and Information Sciences

 
64 La contribution d'une nouvelle mthode la modlisation des cots: le
 

Summary:  (A) and Kanthal (A). 3 La prise en compte de la notion de « supply-chain management » est toutefois relativement... La contribution d'une nouvelle méthode à la modélisation des coûts: le Time-Driven ABC Le cas d... (Time-Driven ABC) a été introduit récemment par Kaplan et Anderson. Cette méthode a ...

  

Source: Ecole Polytechnique, Centre de mathématiques

 

Collection: Mathematics

 
65 !"#$%&'()(*"&*(&"*+,-&#./0.(1/'/,&"/2" 34-$&3'#56*7"&&/82#9:&%;%<$(.="(*($=2.=+> 7**?:@@444=$(.="(*($=2.=+>@ABC@%;%@
 

Summary:  ,'(%&(#+'(<'0(?(9%!'-'&#(#32'<()*(%,'(0&9(A+3(#+'3 0-'(%72)-#0&#(#)("<(0$$ ! 6,%'&,'('C2'-%7'&#<("<%&1(#+'(;"#)<"=(%&(#+' ;�... )>+$+',1)#%+)-1+(?4)%7""+$,-4)3@9=+$)#-3,3&+- ...

  

Source: Griffiths, Gwyn - National Oceanography Centre, Southampton & School of Engineering Sciences, University of Southampton

 

Collection: Engineering ; Geosciences

 
66 MATHEMATIQUES RENFORCEES -RAPPELS DE GEOMETRIE EUCLIDIENNE 1. Le plan euclidien et ses isometries
 

Summary:  B). ­ Soit = ^ABC et = ^CDE. On note + l'angle obtenu en transportant par une transformation... qui entra^ine P a. 3.8 P' A B a M P Fig. 4 D´efinition 3.9. Un cercle o et une droite r sont s... 1, . . . A4. Si A1A2 A3A4 alors A1A2 ...

  

Source: Costantino, Francesco - Institut de Recherche Mathématique Avancée, Université Louis Pasteur

 

Collection: Mathematics

 
67 What happens when you reflect a Triangle in any Line Christopher J Bradley
 

Summary:  .4) The line through B' parallel to CA has equation (d ­ h)x + (c ­ a)y = b(d ­ h) ­ e(c ­ a). (3.5) The line... A' C'B' O' P D' Simson line of D 1. Introduction #12;2 In the figure a triangle ABC and its... circumcircle are shown together with a reflection line L and the image triangle A'B'C'. What ...

  

Source: Smith, Geoff - Department of Mathematical Sciences, University of Bath

 

Collection: Mathematics

 
68 Fundamentals of Propulsion Designation: Required course for AE
 

Summary:  of thermodynamics, transport processes, and compressible flow fundamentals in the operation of rockets. [1a, 3c, 5e... turbines). [1a, 3c, 5e, 9i, AE12] Objective 2: Provide students with an understanding of the use... , and nozzle. [1a, 3c, 5e, ...

  

Source: Krstic, Miroslav - Department of Mechanical and Aerospace Engineering, University of California at San Diego

 

Collection: Engineering

 
69 5-4079-01-P1 RIGHT-OF-WAY COST ESTIMATING TOOL
 

Summary:  Acquisition Cost Estimating Planning Tool AUGUST 2006 Performing Organization: Center for Transportation... Organization: Texas Department of Transportation Research and Technology Implementation Office P.O. Box 5080... Austin, Texas 78763-5080 Performed in cooperation with the Texas Department of Transportation

  

Source: Texas at Austin, University of - Center for Transportation Research

 

Collection: Energy Storage, Conversion and Utilization

 
70 Atmosphere. Korean Meteorological Society Vol.20,No.4(2010)pp.519-530
 

Summary:  @snu.ac.kr NOTE #12;520 204(2010) (Nakajima et al., 2007; Ramanathan et al., 2007a), 3... 2010) Abstract : In this paper we review current research on Atmospheric Brown Clouds (ABCs... and satellite observation. The first experimental observation with UAVs in Korea, Cheju ABC Plume ...

  

Source: Yoon, Soon-Chang - School of Earth and Environmental Sciences, Seoul National University

 

Collection: Geosciences ; Environmental Sciences and Ecology

 
71 Assessment of the Pacific Ocean Perch Stock in the Eastern Bering Sea and Aleutian Islands Paul D. Spencer and James N. Ianelli
 

Summary:  in the following table: 2008 Projection 2009 Projection 2009 2010 2010 2011 M 0.060 -- 0.060 -- Tier 3a -- 3a -- B... ,817 t. For 2010, we recommend a maximum permissible ABC of 18,859 t based upon the updated projection... .057 0.057 0.057 0.057 Fofl (F35%) 0.068 0.068 0.068 0.068 Max ABC (mt, yield at F40%) ...

  

Source: NOAA Marine Fisheries Review

 

Collection: Environmental Sciences and Ecology

 
72 NAROM -Norwegian Centre for Space-related Education Rev. 18.10.11
 

Summary:  balloons and the radiation belts JR Conference room ABC Together with CaNoRock IV 1930 Transport back... room ABC 1400 - 1415 Transport to ALOMAR AH ARR Transport 1415 - 1500 Presentation of ALOMAR Zuguang... Responsible Place Note 2300 Arrival Grønnbua/check in AH Grønnbua ...

  

Source: Johansen, Tom Henning - Department of Physics, Universitetet i Oslo

 

Collection: Materials Science

 
73 Functional hot spots in human ATP-binding cassette transporter
 

Summary:  (ABC) transporter superfamily consists of 48 integral membrane proteins that couple the action of ATP... of the majority of ABC transporter nsSNPs has yet to be experimentally characterized. Here, we combine... ABC transporters. First, the disease associations of 39 ...

  

Source: Sali, Andrej - Department of Biochemistry and Biophysics, University of California at San Francisco

 

Collection: Biology and Medicine ; Biotechnology

 
74 Chapter 1 An introduction to adenine nucleotidebinding proteins Adenosine triphosphate
 

Summary:  binding cassette (ABC) transport ATPases has been the focus of this thesis and these proteins... through ligandgated ion channels [16]. Transport ATPases The P, V and FATPases together with the ABC... of an electrochemical ion gradient [19]. The class of ABC ...

  

Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution,

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
75 Psychosis and autism as diametrical disorders of the social brain
 

Summary:  ,94) Hyperlexia (95,96) Dyslexia (97,98) Key references: (1) Anderson et al. 2007; (2) Wahlbeck et al. 2001a; (3

  

Source: Haig, David - Department of Organismic and Evolutionary Biology, Harvard University

 

Collection: Environmental Sciences and Ecology

 
76 The ABC Core Model for Usage Control: Integrating Authorizations, oBligations, and
 

Summary:  Bligations) UCONC (Conditions) UCONAB UCONAC UCONBC UCONABC (a) preA0 preA1 preA3 onA0 onA2 onA3 (b) preB0 preB1 pre... is started. UCONpreA3 is pre-authorization model with an optional post-update procedure. A post... The ...

  

Source: Sandhu, Ravi - Department of Information and Software Engineering, George Mason University

 

Collection: Computer Technologies and Information Sciences

 
77 List of publications List of publications
 

Summary:  , B. (2006) ABC transporter architecture and regulatory roles of accessory domains. FEBS Letters 580... -reconstituted ABC transporters. Methods Enzymol. 400, 429-459. Doeven, M. K., Kok, J., and Poolman, B. (2005... ) Specificity and selectivity of peptide transport in Lactococcus lactis ...

  

Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution,

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
78 Thermophilic P-loop transport ATPases: Enzyme function and energetics at high temperature
 

Summary:  Thermodynamics of the ATP hydrolysis cycle of GlcV, the Nucleotide Binding Domain of the Glucose ABC transporter... of the Glucose ABC Transporter of Sulfolobus solfataricus 65 Chapter 5 Summary and concluding remarks 81 Chapter... Thermophilic P-loop transport ATPases: Enzyme function ...

  

Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution,

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
79 Multidrug and peptide export in Lactococcus lactis
 

Summary:  transport by the ABC transporter LmrA of Lactococcus lactis 35 Chapter 4 Effect of the calcium channel... , and of the ABC transporter NisT in the lantibiotics secretion. #12;8 Introduction In Gram-positive bacteria... the cytoplasmic membrane. Many MDR transporters ...

  

Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution,

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
80 Math 510 Exam 1 Solutions Feb 26, 2007
 

Summary:  Math 510 Exam 1 Solutions Feb 26, 2007 1. (a) (3 pts) State the definition of isometry. An isometry... line is. 2. (a) (3 pts) State the definition of great circle. A great circle is a circle on the surface... . (a) (10 pts) If ABC is true than the following are false: BAC, CAB, ACB, and ...

  

Source: Tuba, Imre - Department of Mathematics and Statistics, San Diego State University

 

Collection: Mathematics


Page:   1  2  3  4  5 
Page:   1  2  3  4  5 
 
81 137. oei, o oioo apaoo k > 1 a c apai ca k(k2 -k -1)
 

Summary:  inequality holds bcd a3 + 3bcd + cda b3 + 3cda + dab c3 + 3dab + abc d3 + 3abc + 1. (V. Yasinskyy, Vinnytsa... ¬¨¨p) 138. o¢e¤iâì, éo ¤«ï ¤o¢i«ì¨x ¤o¤aâ¨x ¤i¨ý c¨x ç¨ce« a, b, c, d ¢¨ªoãõâcìï epi¢- icâì bcd a3 + 3bcd... + cda b3 + ...

  

Source: Mazorchuk, Volodymyr - Matematiska institutionen, Uppsala Universitet

 

Collection: Mathematics

 
82 Sugar Transport in (Hyper-)Thermophilic Archaea Sonja M. Koning, Sonja-Verena Albers, Wil N. Konings and Arnold J. M.
 

Summary:  at the expense of PEP; and iii) ATP binding cassette (ABC) transport, where the substrate is first bound... . Schematic overview of the different transport classes, namely secondary (A), PTS (B), and ABC (C). #12... ;Introduction 4 2.2. Binding protein dependent ABC- type ...

  

Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution,

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
83 General introduction I. General features of cell volume control
 

Summary:  to an osmotic upshift are substrate-binding protein-dependent ABC transporters, which use ATP as source... of the system for another transport cycle. The osmoregulated ABC transporters belong to the OTCN family (26... biochemical evidence is not available, the osmoregulated ...

  

Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution,

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
84 Zentralblatt MATH Database 1931 2008 c 2008 European Mathematical Society, FIZ Karlsruhe & Springer-Verlag
 

Summary:  product A3 (a, b, c) {abc} A is called a JB -triple if it satisfies the following conditions (i... )­(iv): (i) {abc} is symmetric and bilinear in a, c and conjugate linear in b; (ii) {xy{abc}} = {{xya... } = a 3 . Every C -algebra is a JB -triple via {abc} = 1 2 (ab ...

  

Source: Stachó, László - Bolyai Institute, University of Szeged

 

Collection: Mathematics

 
85 Optical rectification and shift currents in GaAs and GaP response: Below and above the band gap
 

Summary:  , 2 abc - ; , where 0, within the independent particle approximation for the electron dynamics... . Particularly interesting is the limit 2 abc 0; ,- . In addition to the usual near-dc interband rectification... current, shift and injection currents, associated with actual divergences in 2 abc 0; ,- , are taken

  

Source: Sipe,J. E. - Department of Physics, University of Toronto

 

Collection: Physics

 
86 MATH 3450 Test 2 PRACTICE PROBLEMS NON-EUCLIDEAN GEOMETRY: Parallelism Theorem in Absolute Geometry and its con-
 

Summary:  through the h-points A(3, 2) and B(4, V~). (b) Show that tile h-line found in (a) is parallel to the h... mZBAD. Let ¢,ABCD be a convex quadrilateral. The defect of the ~ABC is 7.5 and ~ACD '~ #12... Euclidean? 6. Two regular pentagons have equal defects. Show they must be congruent. 7. Suppose that /',ABC

  

Source: Ionel, Marianty - Department of Mathematics, University of Toledo

 

Collection: Mathematics

 
87 Candida Drug Resistance Protein 1, a Major Multidrug ATP Binding Cassette Transporter of Candida albicans, Translocates Fluorescent Phospholipids in a
 

Summary:  . Overexpression of the multidrug transporter Cdr1p (Can- dida drug resistance protein 1), a member of the ABC1... , thus facilitating cell survival (4-6). Cdr1p, like other ABC transporters, uses ATP hydrolysis to power... the transport of substrates across membranes. Also, like most ...

  

Source: Menon, Anant K. - Menon Lab, Weill Medical College, Cornell University

 

Collection: Biology and Medicine

 
88 Function of prokaryotic and eukaryotic ABC proteins in lipid transport Antje Pohla,b
 

Summary:  Review Function of prokaryotic and eukaryotic ABC proteins in lipid transport Antje Pohla... of the ABC protein families A, B, C, D and G are mutated in a number of lipid transport and metabolism... and further transport to specific sites. Additionally, lipid ...

  

Source: Institut de Biologie Physico-Chimique CNRS, Physico-Chimie Moléculaire des Membranes Biologiques

 

Collection: Chemistry ; Biology and Medicine

 
89 The Daily Task List Date: July 19, 2010
 

Summary:  The Daily Task List Date: July 19, 2010 ABC Daily Tasks A1 Planning and Solitude A2 Exercise A3... for the living room Date: July 20, 2010 ABC Daily Tasks A1 Planning and Solitude A2 Exercise RH A3 Make copies... contacts) 7/20/10.A2 Unable to exercise today because ...

  

Source: Carmichael, Owen - Computer Science Department, University of California, Davis

 

Collection: Engineering

 
90 SHARPER ABC-BASED BOUNDS FOR CONGRUENT POLYNOMIALS
 

Summary:  this inequality over all choices of A, B* *, C to see that d > 2 degh - 3 avgAdegradA + 3 avgA6=Bdegradgcd{A, B... SHARPER ABC-BASED BOUNDS FOR CONGRUENT POLYNOMIALS... modulo another polynomial h. Voloch pointed out an application of the Stothers-Mason ABC ...

  

Source: Bernstein, Daniel - Department of Computer Science, University of Illinois at Chicago

 

Collection: Computer Technologies and Information Sciences

 
91 A Simple Counterexample to the Finite Axiomatizability
 

Summary:  . This situation is shown in Fig. 2 with the row containing (a 3 , b 4 , c 6 ) deleted. In this case, it need... is assumed to be infinite. Let P ABC = (R[ABC],p ABC ) denote the view which is the projection onto... the attributes ABC. For any n > 0, let r(n) ...

  

Source: Hegner, Stephen J. - Department of Computing Science, Umeå Universitet

 

Collection: Computer Technologies and Information Sciences

 
92 "Extreme Project Management" One World Trade
 

Summary:  and construction of a variety of commercial, institutional and transportation facilities across the country... . Please check the links below for recent interviews of Ms. Tollner: Interview on ABC http://www.abc2news.com/dpp/news/national/abc

  

Source: Guiltinan, Mark - Department of Horticulture, Pennsylvania State University

 

Collection: Biotechnology

 
93 10-10-08 02:29Lab 4: Boolean Algebra, RAM (U.Crete, CS-120) Page 1 of 12http://www.csd.uoc.gr/~hy120/10f/lab04_karn_ram.html
 

Summary:  ), A' [ ] ( A), §3.3. Boole, , " Boole" (Boolean variables). , Boole... ): ' , / Venn, : A(B+C) = AB + AC A+(BC) = (A+B)(A+C) , A B C, A B A C... Morgan, : , . , DeMorgan ( ), . , : ...

  

Source: Markatos, Evangelos P. - Department of Computer Science, University of Crete

 

Collection: Computer Technologies and Information Sciences

 
94 09-10-09 19:08Lab 4: Boolean Algebra, RAM (U.Crete, CS-120) Page 1 of 12http://www.csd.uoc.gr/~hy120/09f/lab04_karn_ram.html
 

Summary:  ), A' [ ] ( A), §3.3. Boole, , " Boole" (Boolean variables). , Boole... ): ' , / Venn, : A(B+C) = AB + AC A+(BC) = (A+B)(A+C) , A B C, A B A C... Morgan, : , . , DeMorgan ( ), . , : ...

  

Source: Markatos, Evangelos P. - Department of Computer Science, University of Crete

 

Collection: Computer Technologies and Information Sciences

 
95 University of Windsor Mathematics Practice Problems Solutions 1. The function f has the property that for each real number x,
 

Summary:  . Solution: We can equivalently prove that, a3a b3b c3c (abc)a+b+c Or, a3a b3b c3c (abc)a+b+c 1 WLOG... (abc)a+b+c = a3a b3b c3c aa+b+cba+b+cca+b+c = a3a-(a+b+c) ...

  

Source: Yee, Wai Ling - Department of Mathematics and Statistics, University of Windsor

 

Collection: Mathematics

 
96 Boolean games revisited: compact preference representation in games Elise Bonzon, bonzon@irit.fr
 

Summary:  is acyclic then G has one and only one SPNE. Let G = (A,V,,) with A = {1,2}, V = {a,b,c}, 1 = {a,c}, 2 = {b... }, 1 = a;(¬b,c) , 2 = (¬b,¬c);¬a . P1 Disc abc abc abc abc abc abc abc ...

  

Source: Bonzon, Elise - UFR de Mathématiques et Informatique, Université René Descartes

 

Collection: Computer Technologies and Information Sciences

 
97 behorende bij het proefschrift "Relationships between MDR proteins, bacteriocin production and proteolysis in
 

Summary:  production and proteolysis in Lactococcus lactis" Olivera Gajic 1. The "flip-flop" model for ABC transporters... not hold truth for all members of the MDR-ABC transporter family. (Chang and Roth [2001] Science 293: 1793... , that was proposed by Chang and Roth on basis of the x-ray structure of the E. coli ...

  

Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution,

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
98 List of publications Harms, N., Ras, J., Koning, S., Reijnders, W. N. M., Stouthamer, A. H., van Spanning, R.
 

Summary:  in the hyperthermophilic archaeon Pyrococcus furiosus is mediated by an inducible, high-affinity ABC transporter. J... , A. J. M. (2002) Biochemical evidence for the presence of two -glucoside ABC-transport systems... transport in (hyper)thermophilic archaea. Res. Microbiol. 153:61-67. Koning, S. M., Konings, ...

  

Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution,

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
99 News in Science -Ancient bacteria take a breath -07/02/2000 http://www.abc.net.au/cgi-bin/common/printfriendly.pl?/science/news/st... 1 of 2 3/5/2008 12:55 PM
 

Summary:  News in Science - Ancient bacteria take a breath - 07/02/2000 http://www.abc.net... in Science - Ancient bacteria take a breath - 07/02/2000 [This is the print version of story http://www.abc... relative hemoglobin (the main protein in the red blood cell) play an essential role in oxygen transport

  

Source: Alam, Maqsudul - Department of Microbiology, University of Hawai'i at Manoa

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
100 Ubungen zur Elementargeometrie Musterl osungen
 

Summary:  # ist die Parallele zu BC. 6.3 Hier die (leicht variierte) L˜osung von Julius Fohgrub: A B C A1 A2 A3 B3... ) d(B 3 B 2 )/d(AA 3 ) = n.Vor. d(B 0 B 3 )/d(AA 3 ) d(B 3 B 2 )/d(A 3 A 2 ) = TV (B 3 , A 3 , B) TV... .2 benutzen) (#) TV (A,B,C # )TV (B,C,A # )TV (C,A,B # ) =-1. Umkehrung. ...

  

Source: Wotzlaw, Lorenz - Fachbereich Mathematik und Informatik, Freie Universität Berlin

 

Collection: Mathematics


Page:   1  2  3  4  5