| Sample search results for: abc transporter a3 |
| 1 | ABC transporters: 1, 2 or 4 substrate-binding Tiemen van der Heide and Bert Poolman | ||
|
Summary: a single receptor fused to a translocator unit is the finding that opuABC from S. coelicolor A3 codes... Chapter 6 65 ABC transporters: 1, 2 or 4 substrate-binding domains? Tiemen van der Heide and Bert... Poolman Summary Two families of ATP-binding Cassette (ABC) ... |
|||
|
Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution, |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 2 | Gene 221 (1998) 117125 Isolation of an Arabidopsis thaliana cDNA by complementation of a yeast | ||
|
Summary: spectrophotometer. Absorption maxima expected for the a bands of cytochrome a+a3, b and c are at 602, 558, 546 nm... Gene 221 (1998) 117125 Isolation of an Arabidopsis thaliana cDNA by complementation of a yeast abc... 1998; Received by B. Dujon Abstract The yeast Abc1 protein acts as a chaperone-like ... |
|||
|
Source: Hamel, Patrice - Department of Plant Cellular and Molecular Biology, Ohio State University; Meier, Iris - Department of Plant Cellular and Molecular Biology, Ohio State University |
|||
|
Collection: Biology and Medicine |
|||
| 3 | Summary and concluding ESEARCH on the structure and function of substrate-binding proteins (SBPs) | ||
|
Summary: -binding proteins (SBPs) of ATP Binding Cassette (ABC) transporters has been ongoing for at least four decades. Our... on the lactococcal oligopeptide binding protein A (OppA), the receptor component of the ABC-transporter oligopeptide... within a voluminous cavity of almost 5000 °A3. ... |
|||
|
Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution, |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 4 | Bock et al. 2006 Family Summary 1.A.1 Voltage-gated Ion ChannVIC 36 34 2 | ||
|
Summary: .3 Cationic Amino Acid TransAPC 108 putative cationic amino acid transporter CAT 9 8 523 2.A.3.4 Amino Acid... .A.3 P-type ATPase P-ATPase 212 putative Ca2+-transporting P2B-type ATPase ACA 11 11 1108 3.A.3 P... -type ATPase ... |
|||
|
Source: Sze, Heven - Department of Cell Biology and Molecular Genetics, University of Maryland at College Park |
|||
|
Collection: Biology and Medicine |
|||
| 5 | Specificity of the oligopeptide ABC transporter The binding specificity of OppA determines the | ||
|
Summary: Specificity of the oligopeptide ABC transporter 35 Chapter 3 The binding specificity of Opp... A determines the selectivity of the oligopeptide ABC transporter Mark K. Doeven, Rupert Abele, Robert Tampé... ATP- binding cassette (ABC) transporter with a remarkably wide ... |
|||
|
Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution, |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 6 | ABC transporters: Lessons from a bacterial oligopeptide uptake system | ||
|
Summary: ABC transporters: Lessons from a bacterial oligopeptide uptake system Mark K. Doeven #12;Cover... by PrintPartners Ipskamp, Enschede #12;RIJKSUNIVERSITEIT GRONINGEN ABC transporters: Lessons from... A determines the selectivity of the oligopeptide ABC transporter 35 ... |
|||
|
Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution, |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 7 | Nederlandse samenvatting Nederlandse samenvatting voor genteresseerden buiten | ||
|
Summary: vakgebied Samenvatting ABC transporters zijn eiwitten die betrokken zijn bij de opname van voedingsstoffen... en uitscheiding van schadelijke stoffen in de biologische cel. Defecten in ABC transporters kunnen... bij de mens ernstige ziektes tot gevolg hebben. Te grote activiteit van ABC ... |
|||
|
Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution, |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 8 | An easy way of transcribing folk and traditional music Version 1.6.1 January '97 | ||
|
Summary: is a six- teenth note, A2 an eighth note, A3 a dotted eighth note, A4 a quarter note, A6 a dotted quarter... the following lines all mean the same thing (the third ver- sion is recommended): L:1/16 a3b cd3 a2b2c2d2 L:1... /8 a3/2b/2 c/2d3/2 abcd L:1/8 a>b c |
|||
|
Source: Read, Charles - School of Mathematics, University of Leeds |
|||
|
Collection: Mathematics |
|||
| 9 | 2009-taebc ABC-Clio ebooks collection 1203titles ISBN URL | ||
|
Summary: 2009-taebc ABC-Clio ebooks collection 1203titles ISBN URL 1 Arts & Humanities Acquisitions... Bastian, Jeannette Allis Libraries Unlimited Ebooks 2003 http://ebooks.abc- clio.com/?isbn=9780313052378 2... Libraries Unlimited Ebooks 2007 http://ebooks.abc- clio.com/?isbn=9780313094521 3 Arts & Humanities |
|||
|
Source: Wu, Yih-Min - Department of Geosciences, National Taiwan University |
|||
|
Collection: Geosciences |
|||
| 10 | ABC SMC for dynamical systems Tina Toni, Michael Stumpf | ||
|
Summary: particle Tina Toni ABC SMC 26/06/2009 22 / 24 #12;Perturbation kernels Crossover (a1 a2 a3 a4 a5) = x (i) t... ;Perturbation kernels Crossover (a1 a2 a3 a4 a5) Parent chromosomes (b1 b2 b3 b4 b5) (a1 a2 a3 b4 b5) Candidate... -1 = x (j) t-1 = xt ... |
|||
|
Source: Robert, Christian P. - Centre De Recherche en Mathématiques de la Décision, Université Paris-Dauphine |
|||
|
Collection: Mathematics |
|||
| 11 | Applied Mathematics Letters 24 (2011) 12511256 Contents lists available at ScienceDirect | ||
|
Summary: to trigger the induction of ATP-Binding Cassette (ABC) transporters, responsible for the efflux of the drug... of CPT11-induced overexpression of ABC transporters. We then theoretically optimized exposure to CPT11... given as a single agent or combined either with ABC ... |
|||
|
Source: Clairambault, Jean - Biologie, Analyse Numérique, Géophysique Team, INRIA Paris-Rocquencourt |
|||
|
Collection: Biology and Medicine |
|||
| 12 | ABC transporters: Lessons from a bacterial oligopeptide uptake system | ||
|
Summary: ABC transporters: Lessons from a bacterial oligopeptide uptake system Mark K. Doeven #12;Cover... by PrintPartners Ipskamp, Enschede #12;RIJKSUNIVERSITEIT GRONINGEN ABC transporters: Lessons from... A determines the selectivity of the oligopeptide ABC transporter 35 ... |
|||
|
Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution, |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 13 | ATP-binding cassette protein E is involved in gene transcription and translation in Caenorhabditis elegans | ||
|
Summary: and nucleus, and possibly as a nucleocytoplasmic transporter. In addition, RNAi data suggest that ABCE and NHR... Elsevier Inc. All rights reserved. Keywords: ABC transporter; ABCE; RNase L inhibitor; Caenorhabditis... of the largest protein families in both prokaryotes and eukaryotes. ... |
|||
|
Source: Baillie, David - Department of Molecular Biology and Biochemistry, Simon Fraser University |
|||
|
Collection: Biology and Medicine |
|||
| 14 | 2000 Macmillan Magazines Ltd NATURE CELL BIOLOGY | VOL 2 | JULY 2000 | www.nature.com/ncb 399 | ||
|
Summary: -binding-cassette transporter 1 (ABC1) has been implicated in processes related to membrane-lipid turnover. Here, using in vivo... -AI. The involvement of ABC1 in Tangier disease implies that the transporter modulates specific removal of cellular... of cytosolic calcium may be associ- ated with ... |
|||
|
Source: Institut de Biologie Physico-Chimique CNRS, Physico-Chimie Moléculaire des Membranes Biologiques |
|||
|
Collection: Chemistry ; Biology and Medicine |
|||
| 15 | Genetic Variation in the Proximal Promoter of ABC and SLC Superfamilies: Liver and Kidney Specific Expression | ||
|
Summary: Polymorphisms PLoS ONE | www.plosone.org 2 September 2009 | Volume 4 | Issue 9 | e6942 #12;transporters; SLC29A3... , involved in the uptake of nucleotides, anti- cancer and anti-viral drugs; SLC17A3, a phosphate transporter... transporters in the ... |
|||
|
Source: |
|||
|
Collection: Biology and Medicine ; Biotechnology |
|||
| 16 | ABC transporters ABC transporter architecture and regulatory roles of | ||
|
Summary: ABC transporters 9 Chapter 2 ABC transporter architecture and regulatory roles of accessory domains... of the architecture of ABC transporters and dissect the systems in core and accessory domains. The ABC transporter... ). ... |
|||
|
Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution, |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 17 | Peptides Signal Mitochondrial Stress Janine Kirstein-Miles1 and Richard I. Morimoto1,* | ||
|
Summary: has now been revealed by Haynes et al. (2010), who show that the ABC family transporter that effluxes... membrane by the ABC transporter, Mdl1. From this point, it had been assumed that these peptides cross... proteases and a GTPase encoding rheB, clpX1 (K07A3.3), ... |
|||
|
Source: Morimoto, Richard - Department of Biochemistry, Molecular Biology, and Cell Biology, Northwestern University |
|||
|
Collection: Biology and Medicine |
|||
| 18 | ANNOUNCEMENT Project Atmospheric Brown Cloud (ABC) 2006 TRAINING SCHOOL | ||
|
Summary: ANNOUNCEMENT Project Atmospheric Brown Cloud (ABC) 2006 TRAINING SCHOOL Project ABC Science... in a special training school conducted by Project ABC during 4-14 December 2006 in Asia. · Lecturures... Course Director" at: For US students: <ABC_Training-School@fiji.ucsd.edu> For Asian students: ... |
|||
|
Source: Goldstein, Allen - Department of Environmental Science Policy and Management, University of California at Berkeley |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 19 | PROTEIN INTERACTIONS AND DISEASE PHENOTYPES IN THE ABC TRANSPORTER SUPERFAMILY | ||
|
Summary: PROTEIN INTERACTIONS AND DISEASE PHENOTYPES IN THE ABC TRANSPORTER SUPERFAMILY LIBUSHA KELLY1... Francisco, CA 94158, USA. ABC transporter proteins couple the energy of ATP binding and hydrolysis... known ABC transporters in diseases such as cystic fibrosis and ... |
|||
|
Source: Sali, Andrej - Department of Biochemistry and Biophysics, University of California at San Francisco |
|||
|
Collection: Biology and Medicine ; Biotechnology |
|||
| 20 | Genome Biology 2004, 5:R15 commentreviewsreportsdepositedresearchrefereedresearchinteractionsinformation | ||
|
Summary: commentreviewsreportsdepositedresearchrefereedresearchinteractionsinformation Open Access2004Shepset al.Volume 5, Issue 3, Article R15Research The ABC transporter gene family... purpose, provided this notice is preserved along with the article's original URL. The ABC transporter gene... severalgene families ... |
|||
|
Source: Baillie, David - Department of Molecular Biology and Biochemistry, Simon Fraser University |
|||
|
Collection: Biology and Medicine |
|||
| 21 | Ribosome recycling depends on a mechanistic link between the FeS cluster domain and a | ||
|
Summary: , Lewinson O (2009) ABC transporters: The power to change. Nat Rev Mol Cell Biol 10:218227. 5. Schmitt L... , Tampé R (2002) Structure and mechanism of ABC transporters. Curr Opin Struct Biol 12:754760. 6. Hopfner... 25:98599873. 8. Hopfner KP, Tainer JA (2003) Rad50/SMC proteins and ... |
|||
|
Source: Bedwell, David M. - Department of Microbiology, University of Alabama at Birmingham |
|||
|
Collection: Biology and Medicine |
|||
| 22 | The Circle centre O and radius OH Christopher J Bradley | ||
|
Summary: c2 + 1) + 8a3 b2 c2 (b + c) + a2 (b4 c2 + 8b3 c3 + b2 (c4 + 1) + 8bc + c2 ) + 8abc(b + c) + b2 c2... + b + c) + a4 bc(b4 c2 + 18b3 c3 + b2 (c4 1) + 4bc c2 ) + a3 bc(b5 c2 + b4 c3 + b3 (c4 1) + b2 c... + 2b2 (c4 2) 7bc 4c2 ) + a3 ... |
|||
|
Source: Smith, Geoff - Department of Mathematical Sciences, University of Bath |
|||
|
Collection: Mathematics |
|||
| 23 | The ABC of ABC-transport in the hyperthermophilic | ||
|
Summary: The ABC of ABC-transport in the hyperthermophilic archaeon Pyrococcus furiosus #12;This work... ;RIJKSUNIVERSITEIT GRONINGEN The ABC of ABC-transport in the hyperthermophilic archaeon Pyrococcus furiosus... by an inducible, high-affinity ABC-transporter 25 Chapter 3 Biochemical evidence ... |
|||
|
Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution, |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 24 | The ABC of ABC-transport in the hyperthermophilic | ||
|
Summary: The ABC of ABC-transport in the hyperthermophilic archaeon Pyrococcus furiosus #12;This work... ;RIJKSUNIVERSITEIT GRONINGEN The ABC of ABC-transport in the hyperthermophilic archaeon Pyrococcus furiosus... by an inducible, high-affinity ABC-transporter 25 Chapter 3 Biochemical evidence ... |
|||
|
Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution, |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 25 | Galapagos whales hold pollutant mystery > News in Science (ABC Science) http://www.abc.net.au/science/articles/2010/12/06/3085949.htm[12/6/2010 3:21:02 PM] | ||
|
Summary: Galapagos whales hold pollutant mystery > News in Science (ABC Science) http://www.abc... pollutant mystery Katherine Nightingale ABC Whales living near the Galapagos Islands appear to have been... , industry, agricultural practices - all of those contaminants end Browse the archiveSearch ABC Science Share |
|||
|
Source: Rock, Chris - Department of Biological Sciences, Texas Tech University |
|||
|
Collection: Biology and Medicine |
|||
| 26 | List of publications Jacobs, M. H., T. v.d. Heide, A. J. Driessen, and W. N. Konings. 1996. Glutamate transport in | ||
|
Summary: .Bacteriol. 182:203-206. Heide, T. v. d. and B. Poolman. 2000. Osmoregulated ABC transport system of Lactococcus... of an ABC transport system for glycine betaine. EMBO J. 20:7022-7032. Wood, J. M., E. Bremer, L. N. Csonka... and function of osmoregulated ABC ... |
|||
|
Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution, |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 27 | Cellobiose uptake in the hyperthermophilic Archaeon Pyrococcus furiosus is mediated by an inducible, | ||
|
Summary: by an inducible, high-affinity ABC-transporter Sonja M. Koning, Marieke G. L. Elferink, Wil N. Konings and Arnold... a transporter that belongs to the Opp-family of ABC-transporters. Introduction Pyrococcus species are anaerobic... -dependent ATP- binding cassette (ABC)-transporter (Schlosser et al., 1999). ... |
|||
|
Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution, |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 28 | Second-order optical response in semiconductors J. E. Sipe and A. I. Shkrebtii | ||
|
Summary: IN SEMICONDUCTORS #12;certain amount of algebra, which is outlined in Appendix B, we find Jintra a t (2) 2 abc ; , i... 2 abc ; , Eb Ec e i t 36 where 2 abc 2R abc i(¯ 2I abc ~ 2I abc ), with 2 abc ; , e3 8 2 dk 8 3 n... ,m mn a fnm rnm c ,rmn b ... |
|||
|
Source: Sipe,J. E. - Department of Physics, University of Toronto |
|||
|
Collection: Physics |
|||
| 29 | On the osmotic signal and osmosensing mechanism of an | ||
|
Summary: On the osmotic signal and osmosensing mechanism of an ABC transport system #12;2 Voor mijn ouders... Cover: On the osmotic signal and osmosensing mechanism of an ABC transport system Cover design: Tiemen... signal and osmosensing mechanism of an ABC transport system ... |
|||
|
Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution, |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 30 | Dr. Z.'s Math 250(2), (Fall 2010, RU) Solutions to REAL Quiz #3 (Sept. 30, 2010) 1. (4 pts.) Find A4 | ||
|
Summary: people first did the intermediate step A3 , and then did (A3 )A. One person got so much into it and did A... independent! (b) (1 pt.) If A and B are matrices for which the product A(BC) and the product (AB)C are both... defined, then sometimes ... |
|||
|
Source: Zeilberger, Doron - Department of Mathematics, Rutgers University |
|||
|
Collection: Mathematics |
|||
| 31 | Structural Determinants of Metal Specificity in the Zinc Transport Protein ZnuA from Synechocystis 6803 | ||
|
Summary: of bacterial metal transporters belong to the cluster 9 family of ABC transporters. The residues... to that of the SBPs from the two transition metal ABC transporters PsaA and TroA, significant differences in the metal... A is similar to the previously determined structures of the peri- ... |
|||
|
Source: Pakrasi, Himadri - Department of Biology, Washington University in St. Louis |
|||
|
Collection: Biology and Medicine |
|||
| 32 | Proton motive force-dependent Hoechst 33342-transport by the ABC transporter LmrA of Lactococcus lactis | ||
|
Summary: 35 Chapter 3 Proton motive force-dependent Hoechst 33342-transport by the ABC transporter Lmr... constructed mutants of the adenosine triphosphate (ATP) binding cassette (ABC)-type MDR transporter Lmr... in the ABC signature motif with an LmrA-mediated Hoechst ... |
|||
|
Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution, |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 33 | Summary and concluding remarks The archaeon Pyrococcus furiosus | ||
|
Summary: were studied during this thesis work. Three inducible ATP-binding cassette (ABC-) transport systems... source are all transported by one of these three ABC-transporters. Cellobiose/-Glucoside transport P... of the ABC-transport family (Chapter 2) and ... |
|||
|
Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution, |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 34 | Peptides 25 (2004) 14251440 Peptide signal molecules and bacteriocins in Gram-negative bacteria: a | ||
|
Summary: secretion ABC transporter 12 Cvi A3 Chromobacterium violaceum NC 005085 hlyB 709 Hemolysin B 13 Cvi B1... 2021 712 ABC transporter 39 Nsp A2 Nostoc sp. NC 003272 alr1201 722 ABC transporter 40 Nsp ... |
|||
|
Source: Leuven, Katholieke Universiteit, Department of Electrical Engineering, SCD Division |
|||
|
Collection: Engineering |
|||
| 35 | Plant Cuticular Lipid Export Requires an ABC Transporter | ||
|
Summary: Plant Cuticular Lipid Export Requires an ABC Transporter Jamie A. Pighin,1 * Huanquan Zheng,1... caused by a defective peroxisomal aden- osine triphosphate binding cassette (ABC) transporter. We found... that the CER5 gene encodes an ABC transporter localized in the ... |
|||
|
Source: Kunst, Ljerka - Department of Botany, University of British Columbia; Western, Tamara L. - Department of Biology, McGill University |
|||
|
Collection: Biology and Medicine |
|||
| 36 | 50years of service excellenceyears of service excellenceyears of service excellence 50years of service excellenceyears of service excellenceyears of service excellence | ||
|
Summary: : Christine LeBlanc, EH&S Date: May 7, 2010 Re: Off-Site Management of Asphalt, Brick & Concrete (ABC) Debris... ______________________________________________________________________________ This memorandum further clarifies the requirements for the off-site management of asphalt, brick and concrete (ABC... of Construction and Demolition ... |
|||
|
Source: Prentiss, Mara - Department of Physics, Harvard University |
|||
|
Collection: Physics |
|||
| 37 | Acta Materialia 51 (2003) 64776491 www.actamat-journals.com | ||
|
Summary: micrographs of the overload fracture surfaces of (a) 3ABC-, (b) 5ABC- and (c) 7ABC-SiC. Fracture in 3ABC and 5... . Transmission electron micrographs near the crack tip in (a) 3ABC, and (b, c) ... |
|||
|
Source: Kruzic, Jamie - School of Mechanical, Industrial, and Manufacturing Engineering, Oregon State University; Ritchie, Robert O. - Lawrence Berkeley National Laboratory |
|||
|
Collection: Engineering ; Materials Science |
|||
| 38 | Name:______________________________ February 13th | ||
|
Summary: to binary b) 11010000011012 to hexadecimal c) A3B16 to decimal #12;4) I have a cat transport vehicle... that can hold 2 kilograms of hot sauce. I have to drive the transport through two checkpoints, each... a checkpoint. a) How many cats can I transport? b) How many bits would be ... |
|||
|
Source: Beasley, Ryan A. - Department of Engineering Technology and Industrial Distribution, Texas A&M University |
|||
|
Collection: Engineering ; Multidisciplinary Databases and Resources |
|||
| 39 | Summary and concluding remarks Introduction | ||
|
Summary: (ABC) transporters MsbA, a lipid efflux system that was crystallized in three conformations... of a complete transporter is available yet, The abbreviations used are: ABC, ATP-binding cassette; ECD... by ABC transporters, in particular that of the oligopeptide ... |
|||
|
Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution, |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 40 | Supplementary Methods, Results, Tables and Figures Systems metabolic engineering of Escherichia coli for L- | ||
|
Summary: a 664-bp fragment. Another 657-bp fragment was amplified using primers thrA3 and thrA4, containing... fragment was amplified using primers ilvA3 and ilvA4, containing a mutated nucleotide (19th C T) and a Pst... GATTGCGTAATCAGCACCACGAAAATACGGGCGCGTGACATCG thrA3 ... |
|||
|
Source: Korea Advanced Institute of Science and Technology, Department of Chemical and Biomolecular Engineering, Metabolic & Biomolecular Engineering National Research Laboratory |
|||
|
Collection: Engineering ; Biotechnology |
|||
| 41 | Asynchronous Bit-stream Compression (ABC) Arkadiy Morgenshtein, Avinoam Kolodny, Ran Ginosar | ||
|
Summary: and after the transportation along the link. In this section we describe the architecture of the ABC... Asynchronous Bit-stream Compression (ABC) Arkadiy Morgenshtein, Avinoam Kolodny, Ran Ginosar... propose a new technique of Asynchronous Bit-stream Compression (ABC), based on Level Encoded Dual- Rail |
|||
|
Source: Kolodny, Avinoam - Department of Electrical Engineering, Technion, Israel Institute of Technology |
|||
|
Collection: Engineering |
|||
| 42 | Macaulay 2 Worksheet Macaulay 2 is a software system devoted to supporting research in algebraic geometry and com- | ||
|
Summary: {1_S, a, a^2, b, b^2, a*b, a^3, b^3} Describe the default monomial ordering used in Macaulay2... = matrix table(5,5, (i,j) -> S_i^j) factor det(M) S = QQ[a..i]; M = genericMatrix(S,a,3,3) I = ideal det M... I = minors(2,M) transpose mingens I S = QQ[t,a..i]; M = ... |
|||
|
Source: Smith, Gregory G. - Department of Mathematics and Statistics, Queen's University (Kingston) |
|||
|
Collection: Mathematics |
|||
| 43 | Peptide transport in microorganisms Specificity and selectivity determinants of peptide | ||
|
Summary: (ABC) transporters, the latter utilizing single or multiple peptide-binding proteins with overlapping... of their cognate ABC transporters. Besides reviewing the current data on binding specificity and transport... ATP- binding cassette (ABC) ... |
|||
|
Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution, |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 44 | Copyright 2007 by the Genetics Society of America DOI: 10.1534/genetics.106.066720 | ||
|
Summary: Accepted for publication December 24, 2006 ABSTRACT ABC transporters constitute one of the largest gene... -binding cassette (ABC) transporter proteins con- stitute one of the largest protein families in both prokaryotes... acids into the cell. In eukaryotes, the majority of ABC ... |
|||
|
Source: Baillie, David - Department of Molecular Biology and Biochemistry, Simon Fraser University |
|||
|
Collection: Biology and Medicine |
|||
| 45 | Profiling of ABC transporters Justina Clarinda Wolters | ||
|
Summary: Profiling of ABC transporters Justina Clarinda Wolters #12... by the Netherlands Proteomics Centre (NPC). #12; RIJKSUNIVERSITEIT GRONINGEN Profiling of ABC... transporters Proefschrift ter verkrijging van het doctoraat in de Wiskunde en Natuurwetenschappen |
|||
|
Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution, |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 46 | General Introduction Chapter 1: General Introduction | ||
|
Summary: -dependent primary transporters 21 4.1: The ABC superfamily portrait 21 4.2: The substrate-binding domain 22 4... -dependent transporters 27 5.1: Substrate binding 28 5.2: Functional interactions in the binding protein-dependent 30 ABC... -hydrolysis (Fig. 1c). These proteins are members of the ATP-binding ... |
|||
|
Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution, |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 47 | Nature Macmillan Publishers Ltd 1998 letters to nature | ||
|
Summary: -binding subunits of ABC transporters is the largest, containing 40 members. The importance of catabolic degradation... /G, osmoprotection protein; Cu2+ , copper-transporting ATPase; +?, cation-transporting ATPase; ?, ABC-transporter... ? Acetate Ethanol PEP fadA ... |
|||
|
Source: Badger, Jonathan - Institute for Genomic Research, Rockville |
|||
|
Collection: Biotechnology ; Biology and Medicine |
|||
| 48 | List of publications 1. Poelarends, G.J., Mazurkiewicz, P., Putman, M., Cool, R.H., van Veen, | ||
|
Summary: .W., and Konings, W.N. (2000). An ABC-type multidrug transporter of Lactococcus lactis possesses an exceptionally... a heterodimeric ABC- type multidrug transporter. Accepted to J. Biol. Chem. 7. Mazurkiewicz, P., Driessen, A... in transport of lipophilic cationic compounds. J. Biol. ... |
|||
|
Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution, |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 49 | 5. Assessment of the Deepwater Flatfish Stock in the Gulf of Alaska (Executive Summary) | ||
|
Summary: ;2010 2011 2011 2012 M (natural mortality) 0.085 0.085 0.085 0.085 Specified/recommended tier 3a 3a 3a 3a... ABC levels for those years. Dover sole is assessed using an age-structured model and Tier 3... -species ABC and OFL ... |
|||
|
Source: NOAA Marine Fisheries Review |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 50 | Copyright 2007 by the Genetics Society of America DOI: 10.1534/genetics.107.080689 | ||
|
Summary: -binding cassette (ABC) transporter homologous to mammalian multidrug resistance proteins, functions... , another ABC transporter that acts in parallel to MRP-4 for the formation of birefringent material... in the gut granule. ATP-binding cassette (ABC) transporters ... |
|||
|
Source: Hermann, Greg J. - Department of Biology, Lewis and Clark College |
|||
|
Collection: Biology and Medicine |
|||
| 51 | RESEARCH ARTICLE Open Access Dynamics of glutamatergic signaling in the | ||
|
Summary: axonal bundles in the pedunculus and throughout the MBs (Figure 1A3). The a/bc KCs present a high level... and expressing mCD8::GFP. (A1-A3) GFP and Glu expression in 201Y-GAL4 are located both in the a/bc and g lobes... of the pedunculus contains axons of the g ... |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 52 | Article: CJB/2011/125 Properties of the Extangential Triangle | ||
|
Summary: a, c + a b, 0), N1(0, a + b + c, a b c), N2(a + b + c, 0, b c a). 3. The extangential... )(b + c)2 , (3.1) y = b2 (a + b + c), (3.2) z = c2 (b + c a). (3.3) The line LJ1 may now be seen... )2 , (3.4) y = b2 (b + c a), (3.5) z = c2 (a + b + ... |
|||
|
Source: Smith, Geoff - Department of Mathematical Sciences, University of Bath |
|||
|
Collection: Mathematics |
|||
| 53 | Expression Analysis of ABC Transporters Reveals Differential Functions of Tandemly Duplicated Genes in | ||
|
Summary: Expression Analysis of ABC Transporters Reveals Differential Functions of Tandemly Duplicated Genes... , BC Canada V5Z 1L6 We have previously identified 60 predicted ABC transporter genes... region for a neighbouring gene. q 2004 Elsevier Ltd. All rights reserved. Keywords: ABC ... |
|||
|
Source: Baillie, David - Department of Molecular Biology and Biochemistry, Simon Fraser University |
|||
|
Collection: Biology and Medicine |
|||
| 54 | 6 Triangles 6.1 Congruence | ||
|
Summary: A See Section 6.5.1. 2. sin2 A+ cos2 A = 1, thus sinA = p 1 ,cos2 A. 3. a2 = b2 + c2 ,2bccosA, thus cos... noncollinear points A;B;C, 4ABC is de ned to be AB BC AC. Refer to page 132 to con rm your understanding... angles, and side opposite an angle. De nition: Given two triangles 4ABC ... |
|||
|
Source: Lee, Carl - Department of Mathematics, University of Kentucky |
|||
|
Collection: Mathematics |
|||
| 55 | A Simple Counterexample to the Finite Axiomatizability | ||
|
Summary: is shown in Fig. 2 with the row containing (a3,b4,c6) deleted. In this case, it need not be the case that a... ; a1 b1 c1 d1 a1 b2 c2 d1 a2 b2 c3 d1 a2 b3 c4 d1 a3 b3 c5 d1 a3 b4 c6 d1 a4 b4 c7 d1 a4 b5 c8 d1... c2 d1 a2 b2 c3 d1 a2 b3 c4 d1 ... |
|||
|
Source: Hegner, Stephen J. - Department of Computing Science, Umeå Universitet |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 56 | A genomic survey of the distribution of ABC-transporters in the hyperthermophilic archaeal Pyrococcus species | ||
|
Summary: Chapter 5 1 A genomic survey of the distribution of ABC-transporters in the hyperthermophilic... of ABC-transport systems. Of the seventeen to nineteen ABC-transporters present per species, eight... , phosphoenolpyruvate (PEP)- dependent phosphotransferase systems (PTS), and ATP-binding cassette (ABC-) ... |
|||
|
Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution, |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 57 | Relaxations of the ABC conjecture using integer k'th roots Version: 18th July 2004 | ||
|
Summary: = (u, v1) and applying ABC-(k,µ) to obtain the same inequality for a1, and hence for a. 3. From (1... Therefore vn ,a a3n( 1 1/ +1 + 1 k ) Choose = 1 2 and 1 = log 2/(8 log a) and (k, ) so that 3( 1 1/ + 1 + 1... Relaxations of the ABC conjecture using integer k'th ... |
|||
|
Source: Broughan, Kevin A. - Department of Mathematics, University of Waikato |
|||
|
Collection: Mathematics |
|||
| 58 | Nederlandse samenvatting voor geinteresseerden buiten dit | ||
|
Summary: als transporteiwitten. Een speciale categorie membraaneiwitten zijn de ABC-transport eiwitten. ABC... membraan uit te voeren. ABC- transport eiwitten zijn te vinden in alle organismen, en hebben een belangri... stoffen. De ABC-transport eiwitten zijn normaal gesproken opgebouwd uit drie ... |
|||
|
Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution, |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 59 | THIS DOCUMENT IS PROVIDED AS A GUIDE FOR CONSIDERING THE RANGE OF ISSUES RELATED TO DEVELOPING INTERNATIONAL PROGRAMS. ANSWERS | ||
|
Summary: be included? How many? o Is laundry service provided? Transportation o For what transportation costs will ABC... RELATED SERVICES Between Company/University ABC [City, Country] And California State University, Fullerton... , Fullerton ("University") and Company/University ABC ... |
|||
|
Source: de Lijser, Peter - Department of Chemistry and Biochemistry, California State University, Fullerton |
|||
|
Collection: Chemistry |
|||
| 60 | Journal de Th'eorie des Nombres de Bordeaux, to appear. SHARPER ABC-BASED BOUNDS | ||
|
Summary: avgAdegradA + 3 avgA6=Bdegradgcd{A, B}. On the other hand, e #S avgAdegrad A - #S2avgA6... Journal de Th'eorie des Nombres de Bordeaux, to appear. SHARPER ABC... h. Voloch pointed out an application of the Stothers-Mason ABC theorem in t* *his |
|||
|
Source: Bernstein, Daniel - Department of Computer Science, University of Illinois at Chicago |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 61 | New Pathways in Folding of the Tetrahymena Group I Rick Russell and Daniel Herschlag* | ||
|
Summary: 0.1a 0.40a 1.1 Æ 0.3b 0.54 Æ 0.05b 50 6.0 Æ 1.5a 5.1a 3.4 Æ 1.2a 50 mM NaÁMops (pH 7.0) (determined... of the periph- eral element P5abc. This, along with other results, has suggested that P5abc may serve... cleavage activity as a readout for native state formation and investigate the effect of ... |
|||
|
Source: Herschlag, Dan - Department of Biochemistry, Stanford University |
|||
|
Collection: Biology and Medicine |
|||
| 62 | Discussion and concluding remarks General introduction | ||
|
Summary: activated transporters. A detailed study of the osmoregulated ATP- binding cassette (ABC) transporter Opu... into the mechanism rooting the osmotic activation of OpuA and to prove that this `two-component ABC transporter... in the membrane and/or the orientation after reconstitution is ... |
|||
|
Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution, |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 63 | Farmer Brown is standing in the middle of his perfectly circular field feeling very content. It is midnight and there is no moon and unknown to the farmer, | ||
|
Summary: at midnight. As soon as there are martians at points A,B,C such that triangle ABC contains the center... of the field, Farmer Brown will be teleported to the waiting space-ship and transported off to spend the rest |
|||
|
Source: Carnegie Mellon University, School of Computer Science |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 64 | La contribution d'une nouvelle mthode la modlisation des cots: le | ||
|
Summary: (A) and Kanthal (A). 3 La prise en compte de la notion de « supply-chain management » est toutefois relativement... La contribution d'une nouvelle méthode à la modélisation des coûts: le Time-Driven ABC Le cas d... (Time-Driven ABC) a été introduit récemment par Kaplan et Anderson. Cette méthode a ... |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 65 | !"#$%&'()(*"&*(&"*+,-&#./0.(1/'/,&"/2" 34-$&3'#56*7"&&/82#9:&%;%<$(.="(*($=2.=+> 7**?:@@444=$(.="(*($=2.=+>@ABC@%;%@ | ||
|
Summary: ,'(%&(#+'(<'0(?(9%!'-'(#32'<()*(%,'(0&9(A+3(#+'3 0-'(%72)-#0(#)("<(0$$ ! 6,%'&,'('C2'-%7'<("<%&1(#+'(;"#)<"=(%&(#+' ;... )>+$+',1)#%+)-1+(?4)%7""+$,-4)3@9=+$)#-3,3&+- ... |
|||
|
Source: Griffiths, Gwyn - National Oceanography Centre, Southampton & School of Engineering Sciences, University of Southampton |
|||
|
Collection: Engineering ; Geosciences |
|||
| 66 | MATHEMATIQUES RENFORCEES -RAPPELS DE GEOMETRIE EUCLIDIENNE 1. Le plan euclidien et ses isometries | ||
|
Summary: B). Soit = ^ABC et = ^CDE. On note + l'angle obtenu en transportant par une transformation... qui entra^ine P a. 3.8 P' A B a M P Fig. 4 D´efinition 3.9. Un cercle o et une droite r sont s... 1, . . . A4. Si A1A2 A3A4 alors A1A2 ... |
|||
|
Source: Costantino, Francesco - Institut de Recherche Mathématique Avancée, Université Louis Pasteur |
|||
|
Collection: Mathematics |
|||
| 67 | What happens when you reflect a Triangle in any Line Christopher J Bradley | ||
|
Summary: .4) The line through B' parallel to CA has equation (d h)x + (c a)y = b(d h) e(c a). (3.5) The line... A' C'B' O' P D' Simson line of D 1. Introduction #12;2 In the figure a triangle ABC and its... circumcircle are shown together with a reflection line L and the image triangle A'B'C'. What ... |
|||
|
Source: Smith, Geoff - Department of Mathematical Sciences, University of Bath |
|||
|
Collection: Mathematics |
|||
| 68 | Fundamentals of Propulsion Designation: Required course for AE | ||
|
Summary: of thermodynamics, transport processes, and compressible flow fundamentals in the operation of rockets. [1a, 3c, 5e... turbines). [1a, 3c, 5e, 9i, AE12] Objective 2: Provide students with an understanding of the use... , and nozzle. [1a, 3c, 5e, ... |
|||
|
Source: Krstic, Miroslav - Department of Mechanical and Aerospace Engineering, University of California at San Diego |
|||
|
Collection: Engineering |
|||
| 69 | 5-4079-01-P1 RIGHT-OF-WAY COST ESTIMATING TOOL | ||
|
Summary: Acquisition Cost Estimating Planning Tool AUGUST 2006 Performing Organization: Center for Transportation... Organization: Texas Department of Transportation Research and Technology Implementation Office P.O. Box 5080... Austin, Texas 78763-5080 Performed in cooperation with the Texas Department of Transportation |
|||
|
Source: Texas at Austin, University of - Center for Transportation Research |
|||
|
Collection: Energy Storage, Conversion and Utilization |
|||
| 70 | Atmosphere. Korean Meteorological Society Vol.20,No.4(2010)pp.519-530 | ||
|
Summary: @snu.ac.kr NOTE #12;520 204(2010) (Nakajima et al., 2007; Ramanathan et al., 2007a), 3... 2010) Abstract : In this paper we review current research on Atmospheric Brown Clouds (ABCs... and satellite observation. The first experimental observation with UAVs in Korea, Cheju ABC Plume ... |
|||
|
Source: Yoon, Soon-Chang - School of Earth and Environmental Sciences, Seoul National University |
|||
|
Collection: Geosciences ; Environmental Sciences and Ecology |
|||
| 71 | Assessment of the Pacific Ocean Perch Stock in the Eastern Bering Sea and Aleutian Islands Paul D. Spencer and James N. Ianelli | ||
|
Summary: in the following table: 2008 Projection 2009 Projection 2009 2010 2010 2011 M 0.060 -- 0.060 -- Tier 3a -- 3a -- B... ,817 t. For 2010, we recommend a maximum permissible ABC of 18,859 t based upon the updated projection... .057 0.057 0.057 0.057 Fofl (F35%) 0.068 0.068 0.068 0.068 Max ABC (mt, yield at F40%) ... |
|||
|
Source: NOAA Marine Fisheries Review |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 72 | NAROM -Norwegian Centre for Space-related Education Rev. 18.10.11 | ||
|
Summary: balloons and the radiation belts JR Conference room ABC Together with CaNoRock IV 1930 Transport back... room ABC 1400 - 1415 Transport to ALOMAR AH ARR Transport 1415 - 1500 Presentation of ALOMAR Zuguang... Responsible Place Note 2300 Arrival Grønnbua/check in AH Grønnbua ... |
|||
|
Source: Johansen, Tom Henning - Department of Physics, Universitetet i Oslo |
|||
|
Collection: Materials Science |
|||
| 73 | Functional hot spots in human ATP-binding cassette transporter | ||
|
Summary: (ABC) transporter superfamily consists of 48 integral membrane proteins that couple the action of ATP... of the majority of ABC transporter nsSNPs has yet to be experimentally characterized. Here, we combine... ABC transporters. First, the disease associations of 39 ... |
|||
|
Source: Sali, Andrej - Department of Biochemistry and Biophysics, University of California at San Francisco |
|||
|
Collection: Biology and Medicine ; Biotechnology |
|||
| 74 | Chapter 1 An introduction to adenine nucleotidebinding proteins Adenosine triphosphate | ||
|
Summary: binding cassette (ABC) transport ATPases has been the focus of this thesis and these proteins... through ligandgated ion channels [16]. Transport ATPases The P, V and FATPases together with the ABC... of an electrochemical ion gradient [19]. The class of ABC ... |
|||
|
Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution, |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 75 | Psychosis and autism as diametrical disorders of the social brain | ||
|
Summary: ,94) Hyperlexia (95,96) Dyslexia (97,98) Key references: (1) Anderson et al. 2007; (2) Wahlbeck et al. 2001a; (3 |
|||
|
Source: Haig, David - Department of Organismic and Evolutionary Biology, Harvard University |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 76 | The ABC Core Model for Usage Control: Integrating Authorizations, oBligations, and | ||
|
Summary: Bligations) UCONC (Conditions) UCONAB UCONAC UCONBC UCONABC (a) preA0 preA1 preA3 onA0 onA2 onA3 (b) preB0 preB1 pre... is started. UCONpreA3 is pre-authorization model with an optional post-update procedure. A post... The ... |
|||
|
Source: Sandhu, Ravi - Department of Information and Software Engineering, George Mason University |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 77 | List of publications List of publications | ||
|
Summary: , B. (2006) ABC transporter architecture and regulatory roles of accessory domains. FEBS Letters 580... -reconstituted ABC transporters. Methods Enzymol. 400, 429-459. Doeven, M. K., Kok, J., and Poolman, B. (2005... ) Specificity and selectivity of peptide transport in Lactococcus lactis ... |
|||
|
Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution, |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 78 | Thermophilic P-loop transport ATPases: Enzyme function and energetics at high temperature | ||
|
Summary: Thermodynamics of the ATP hydrolysis cycle of GlcV, the Nucleotide Binding Domain of the Glucose ABC transporter... of the Glucose ABC Transporter of Sulfolobus solfataricus 65 Chapter 5 Summary and concluding remarks 81 Chapter... Thermophilic P-loop transport ATPases: Enzyme function ... |
|||
|
Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution, |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 79 | Multidrug and peptide export in Lactococcus lactis | ||
|
Summary: transport by the ABC transporter LmrA of Lactococcus lactis 35 Chapter 4 Effect of the calcium channel... , and of the ABC transporter NisT in the lantibiotics secretion. #12;8 Introduction In Gram-positive bacteria... the cytoplasmic membrane. Many MDR transporters ... |
|||
|
Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution, |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 80 | Math 510 Exam 1 Solutions Feb 26, 2007 | ||
|
Summary: Math 510 Exam 1 Solutions Feb 26, 2007 1. (a) (3 pts) State the definition of isometry. An isometry... line is. 2. (a) (3 pts) State the definition of great circle. A great circle is a circle on the surface... . (a) (10 pts) If ABC is true than the following are false: BAC, CAB, ACB, and ... |
|||
|
Source: Tuba, Imre - Department of Mathematics and Statistics, San Diego State University |
|||
|
Collection: Mathematics |
|||
| 81 | 137. oei, o oioo apaoo k > 1 a c apai ca k(k2 -k -1) | ||
|
Summary: inequality holds bcd a3 + 3bcd + cda b3 + 3cda + dab c3 + 3dab + abc d3 + 3abc + 1. (V. Yasinskyy, Vinnytsa... ¬¨¨p) 138. o¢e¤iâì, éo ¤«ï ¤o¢i«ì¨x ¤o¤aâ¨x ¤i¨ý c¨x ç¨ce« a, b, c, d ¢¨ªoãõâcìï epi¢- icâì bcd a3 + 3bcd... + cda b3 + ... |
|||
|
Source: Mazorchuk, Volodymyr - Matematiska institutionen, Uppsala Universitet |
|||
|
Collection: Mathematics |
|||
| 82 | Sugar Transport in (Hyper-)Thermophilic Archaea Sonja M. Koning, Sonja-Verena Albers, Wil N. Konings and Arnold J. M. | ||
|
Summary: at the expense of PEP; and iii) ATP binding cassette (ABC) transport, where the substrate is first bound... . Schematic overview of the different transport classes, namely secondary (A), PTS (B), and ABC (C). #12... ;Introduction 4 2.2. Binding protein dependent ABC- type ... |
|||
|
Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution, |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 83 | General introduction I. General features of cell volume control | ||
|
Summary: to an osmotic upshift are substrate-binding protein-dependent ABC transporters, which use ATP as source... of the system for another transport cycle. The osmoregulated ABC transporters belong to the OTCN family (26... biochemical evidence is not available, the osmoregulated ... |
|||
|
Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution, |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 84 | Zentralblatt MATH Database 1931 2008 c 2008 European Mathematical Society, FIZ Karlsruhe & Springer-Verlag | ||
|
Summary: product A3 (a, b, c) {abc} A is called a JB -triple if it satisfies the following conditions (i... )(iv): (i) {abc} is symmetric and bilinear in a, c and conjugate linear in b; (ii) {xy{abc}} = {{xya... } = a 3 . Every C -algebra is a JB -triple via {abc} = 1 2 (ab ... |
|||
|
Source: Stachó, László - Bolyai Institute, University of Szeged |
|||
|
Collection: Mathematics |
|||
| 85 | Optical rectification and shift currents in GaAs and GaP response: Below and above the band gap | ||
|
Summary: , 2 abc - ; , where 0, within the independent particle approximation for the electron dynamics... . Particularly interesting is the limit 2 abc 0; ,- . In addition to the usual near-dc interband rectification... current, shift and injection currents, associated with actual divergences in 2 abc 0; ,- , are taken |
|||
|
Source: Sipe,J. E. - Department of Physics, University of Toronto |
|||
|
Collection: Physics |
|||
| 86 | MATH 3450 Test 2 PRACTICE PROBLEMS NON-EUCLIDEAN GEOMETRY: Parallelism Theorem in Absolute Geometry and its con- | ||
|
Summary: through the h-points A(3, 2) and B(4, V~). (b) Show that tile h-line found in (a) is parallel to the h... mZBAD. Let ¢,ABCD be a convex quadrilateral. The defect of the ~ABC is 7.5 and ~ACD '~ #12... Euclidean? 6. Two regular pentagons have equal defects. Show they must be congruent. 7. Suppose that /',ABC |
|||
|
Source: Ionel, Marianty - Department of Mathematics, University of Toledo |
|||
|
Collection: Mathematics |
|||
| 87 | Candida Drug Resistance Protein 1, a Major Multidrug ATP Binding Cassette Transporter of Candida albicans, Translocates Fluorescent Phospholipids in a | ||
|
Summary: . Overexpression of the multidrug transporter Cdr1p (Can- dida drug resistance protein 1), a member of the ABC1... , thus facilitating cell survival (4-6). Cdr1p, like other ABC transporters, uses ATP hydrolysis to power... the transport of substrates across membranes. Also, like most ... |
|||
|
Source: Menon, Anant K. - Menon Lab, Weill Medical College, Cornell University |
|||
|
Collection: Biology and Medicine |
|||
| 88 | Function of prokaryotic and eukaryotic ABC proteins in lipid transport Antje Pohla,b | ||
|
Summary: Review Function of prokaryotic and eukaryotic ABC proteins in lipid transport Antje Pohla... of the ABC protein families A, B, C, D and G are mutated in a number of lipid transport and metabolism... and further transport to specific sites. Additionally, lipid ... |
|||
|
Source: Institut de Biologie Physico-Chimique CNRS, Physico-Chimie Moléculaire des Membranes Biologiques |
|||
|
Collection: Chemistry ; Biology and Medicine |
|||
| 89 | The Daily Task List Date: July 19, 2010 | ||
|
Summary: The Daily Task List Date: July 19, 2010 ABC Daily Tasks A1 Planning and Solitude A2 Exercise A3... for the living room Date: July 20, 2010 ABC Daily Tasks A1 Planning and Solitude A2 Exercise RH A3 Make copies... contacts) 7/20/10.A2 Unable to exercise today because ... |
|||
|
Source: Carmichael, Owen - Computer Science Department, University of California, Davis |
|||
|
Collection: Engineering |
|||
| 90 | SHARPER ABC-BASED BOUNDS FOR CONGRUENT POLYNOMIALS | ||
|
Summary: this inequality over all choices of A, B* *, C to see that d > 2 degh - 3 avgAdegradA + 3 avgA6=Bdegradgcd{A, B... SHARPER ABC-BASED BOUNDS FOR CONGRUENT POLYNOMIALS... modulo another polynomial h. Voloch pointed out an application of the Stothers-Mason ABC ... |
|||
|
Source: Bernstein, Daniel - Department of Computer Science, University of Illinois at Chicago |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 91 | A Simple Counterexample to the Finite Axiomatizability | ||
|
Summary: . This situation is shown in Fig. 2 with the row containing (a 3 , b 4 , c 6 ) deleted. In this case, it need... is assumed to be infinite. Let P ABC = (R[ABC],p ABC ) denote the view which is the projection onto... the attributes ABC. For any n > 0, let r(n) ... |
|||
|
Source: Hegner, Stephen J. - Department of Computing Science, Umeå Universitet |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 92 | "Extreme Project Management" One World Trade | ||
|
Summary: and construction of a variety of commercial, institutional and transportation facilities across the country... . Please check the links below for recent interviews of Ms. Tollner: Interview on ABC http://www.abc2news.com/dpp/news/national/abc |
|||
|
Source: Guiltinan, Mark - Department of Horticulture, Pennsylvania State University |
|||
|
Collection: Biotechnology |
|||
| 93 | 10-10-08 02:29Lab 4: Boolean Algebra, RAM (U.Crete, CS-120) Page 1 of 12http://www.csd.uoc.gr/~hy120/10f/lab04_karn_ram.html | ||
|
Summary: ), A' [ ] ( A), §3.3. Boole, , " Boole" (Boolean variables). , Boole... ): ' , / Venn, : A(B+C) = AB + AC A+(BC) = (A+B)(A+C) , A B C, A B A C... Morgan, : , . , DeMorgan ( ), . , : ... |
|||
|
Source: Markatos, Evangelos P. - Department of Computer Science, University of Crete |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 94 | 09-10-09 19:08Lab 4: Boolean Algebra, RAM (U.Crete, CS-120) Page 1 of 12http://www.csd.uoc.gr/~hy120/09f/lab04_karn_ram.html | ||
|
Summary: ), A' [ ] ( A), §3.3. Boole, , " Boole" (Boolean variables). , Boole... ): ' , / Venn, : A(B+C) = AB + AC A+(BC) = (A+B)(A+C) , A B C, A B A C... Morgan, : , . , DeMorgan ( ), . , : ... |
|||
|
Source: Markatos, Evangelos P. - Department of Computer Science, University of Crete |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 95 | University of Windsor Mathematics Practice Problems Solutions 1. The function f has the property that for each real number x, | ||
|
Summary: . Solution: We can equivalently prove that, a3a b3b c3c (abc)a+b+c Or, a3a b3b c3c (abc)a+b+c 1 WLOG... (abc)a+b+c = a3a b3b c3c aa+b+cba+b+cca+b+c = a3a-(a+b+c) ... |
|||
|
Source: Yee, Wai Ling - Department of Mathematics and Statistics, University of Windsor |
|||
|
Collection: Mathematics |
|||
| 96 | Boolean games revisited: compact preference representation in games Elise Bonzon, bonzon@irit.fr | ||
|
Summary: is acyclic then G has one and only one SPNE. Let G = (A,V,,) with A = {1,2}, V = {a,b,c}, 1 = {a,c}, 2 = {b... }, 1 = a;(¬b,c) , 2 = (¬b,¬c);¬a . P1 Disc abc abc abc abc abc abc abc ... |
|||
|
Source: Bonzon, Elise - UFR de Mathématiques et Informatique, Université René Descartes |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 97 | behorende bij het proefschrift "Relationships between MDR proteins, bacteriocin production and proteolysis in | ||
|
Summary: production and proteolysis in Lactococcus lactis" Olivera Gajic 1. The "flip-flop" model for ABC transporters... not hold truth for all members of the MDR-ABC transporter family. (Chang and Roth [2001] Science 293: 1793... , that was proposed by Chang and Roth on basis of the x-ray structure of the E. coli ... |
|||
|
Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution, |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 98 | List of publications Harms, N., Ras, J., Koning, S., Reijnders, W. N. M., Stouthamer, A. H., van Spanning, R. | ||
|
Summary: in the hyperthermophilic archaeon Pyrococcus furiosus is mediated by an inducible, high-affinity ABC transporter. J... , A. J. M. (2002) Biochemical evidence for the presence of two -glucoside ABC-transport systems... transport in (hyper)thermophilic archaea. Res. Microbiol. 153:61-67. Koning, S. M., Konings, ... |
|||
|
Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution, |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 99 | News in Science -Ancient bacteria take a breath -07/02/2000 http://www.abc.net.au/cgi-bin/common/printfriendly.pl?/science/news/st... 1 of 2 3/5/2008 12:55 PM | ||
|
Summary: News in Science - Ancient bacteria take a breath - 07/02/2000 http://www.abc.net... in Science - Ancient bacteria take a breath - 07/02/2000 [This is the print version of story http://www.abc... relative hemoglobin (the main protein in the red blood cell) play an essential role in oxygen transport |
|||
|
Source: Alam, Maqsudul - Department of Microbiology, University of Hawai'i at Manoa |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 100 | Ubungen zur Elementargeometrie Musterl osungen | ||
|
Summary: # ist die Parallele zu BC. 6.3 Hier die (leicht variierte) Losung von Julius Fohgrub: A B C A1 A2 A3 B3... ) d(B 3 B 2 )/d(AA 3 ) = n.Vor. d(B 0 B 3 )/d(AA 3 ) d(B 3 B 2 )/d(A 3 A 2 ) = TV (B 3 , A 3 , B) TV... .2 benutzen) (#) TV (A,B,C # )TV (B,C,A # )TV (C,A,B # ) =-1. Umkehrung. ... |
|||
|
Source: Wotzlaw, Lorenz - Fachbereich Mathematik und Informatik, Freie Universität Berlin |
|||
|
Collection: Mathematics |
|||