| Sample search results for: ab5 ab6 ab7 |
| 1 | HEURISTIC SEARCH FOR HAMILTON CYCLES | ||
|
Summary: , (ab)7c((ab)8cb)2(ab)2ac(ab)5ac(ba)6c(ab)2c (ab)3ac(ba)2c(ab)6ca(ba)5c(ab)3c(ba)8bc(ba)8cb 8. 192A... (ba)7cb)2 4. 162B] (abc)6 = (abac)2babc = e, ... |
|||
|
Source: Mohar, Bojan - Department of Mathematics, University of Ljubljana & Simon Fraser University |
|||
|
Collection: Mathematics |
|||
| 2 | ORIGINAL PAPER Cation identity dependence of crown ether photonic crystal | ||
|
Summary: of AB6, AB5, AB4, AB3, AB2 and AB. Thus, at identical ionic strengths the higher the valence... For example, for a mixture of AB2, AB3, AB5, and AB6 (each salt in the mixture has the same strength), based... .2 mM ... |
|||
|
Source: Asher, Sanford A. - Department of Chemistry, University of Pittsburgh |
|||
|
Collection: Chemistry ; Materials Science |
|||
| 3 | Extra Credit Assignment Summer 2011 | ||
|
Summary: that determines which team wins. (AB 5) It is a fact that L{ t}(1) = 0 e-t t dt = 2 . Find L{ t}(s) for all... s > 0. Show your work. (AB 6) You have used the fact that L{f g(t)}(s) = L{f(t)}(s) L{g(t)}(s). Prove... that it is true. (AB 7) Suppose that f(x) ... |
|||
|
Source: Barton, Ariel - Department of Mathematics, Purdue University |
|||
|
Collection: Mathematics |
|||
| 4 | MTH4107 Introduction to Probability 2010/11 Solutions to Exercise Sheet 3 | ||
|
Summary: ). (5) Substituting (5) into (4) and rearranging terms we obtain P(A B) = P(A)+P(B)-2P(AB). (6) · Please... want P(Ac B). By a similar argument to Q2(c) we have P(Ac B) = P(B)-P(AB) = 7/10-1/5 = 1/2. 1 #12;(b... union of A B and AB, Axiom 3 gives P(AB) = P(A B)+P(AB). (4) By Proposition ... |
|||
|
Source: Jackson, Bill - School of Mathematical Sciences, Queen Mary, University of London |
|||
|
Collection: Mathematics |
|||
| 5 | Sechste Satzung zur nderung der Allgemeinen Prfungsordnung fr die Bachelor-und Masterstudiengnge an der Technischen Fakultt der Friedrich- | ||
|
Summary: 7 werden zu Sätzen 5 und 6. c) Abs. 6 wird gestrichen. d) Der bisherige Abs. 7 wird zu Abs. 6. 4... /TechFak - Vom 7. Juni 2011 Aufgrund von Art. 13 Abs. 1 in Verbindung mit Art. 43 Abs. 5 und Art. 61 Abs. 2 des... Satzung ... |
|||
|
Source: Gugat, Martin - Mathematisches Institut, Friedrich-Alexander University Erlangen-Nürnberg |
|||
|
Collection: Mathematics |
|||
| 6 | Satzung zur nderung der Studien-und Prfungsordnung fr den Masterstudiengang ,,Physical Activity and Health" | ||
|
Summary: -Alexander-Universität Erlangen-Nürnberg Vom 31. Januar 2011 Aufgrund von Art. 13 Abs. 1 in Verbindung mit Art. 43 Abs. 5, Art. 58... " ersetzt. 7. § 26 Abs. 1 Satz 2 wird gestrichen. 8. In § 27 Abs. 6 Satz 1 wird Halbsatz 2 gestrichen. 9... gestrichen. bb) In Satz 2 Ziffer 2 werden die Zahlen ,,2-4" durch ... |
|||
|
Source: Gugat, Martin - Mathematisches Institut, Friedrich-Alexander University Erlangen-Nürnberg |
|||
|
Collection: Mathematics |
|||
| 7 | Satzung zur nderung der Satzung ber die Erhebung von Studienbeitrgen | ||
|
Summary: unberührt." m. Die bisherigen Abs. 5, 6 und 7 werden Abs. 6, 7 und 8. n. Der bisherige Abs. 6 erhält... -Maximilians-Universität München Vom 24. Juli 2009 Auf Grund von Art. 13 Abs. 1 Satz 2 in Verbindung mit Art. 71 Abs. 6 ... |
|||
|
Source: Kersting, Roland - Fakultät für Physik, Ludwig-Maximilians-Universität München |
|||
|
Collection: Physics |
|||
| 8 | Optical Absorptions of New Blue-Light Emitting Oligoquinolines Bearing Pyrenyl and Triphenyl | ||
|
Summary: abs,5 S abs,9 f abs,9 S abs,5 f abs,5 S abs,7 f abs,7 B3LYP 2.89 1.275 3.44 0.501 3.64 0.092 1.98 1... abs,12 S abs,5 f ... |
|||
|
Source: Tretiak, Sergei - Theoretical Division, Los Alamos National Laboratory |
|||
|
Collection: Chemistry ; Materials Science |
|||
| 9 | 2006 New Mexico Farmer Silage Trials | ||
|
Summary: .4596 1.7676 3.4925 1.1844 1.8597 0.7889 Grand Valley 15A50C 8.66 a 27.365 ab 7.25 a 48.25 ab 64.775 a 48... .25 ab 2.01 c 25.29 g 5.64 ab 3103 abc 26869 ab Grand Valley 25R35CRR 8.53 a 25.875 ab 6.85 a 51.57 a 58... .86 bcd 38.495 d 2.74 a 38.14 a 5.22 b 3201 ab 27093 a Grand Valley 23P95PRRR 8.20 a 25.86 ... |
|||
|
Source: Castillo, Steven P. - Klipsch School of Electrical and Computer Engineering, New Mexico State University |
|||
|
Collection: Engineering |
|||
| 10 | Christine Drea, Assistant Professor, Biological | ||
|
Summary: .10594 [abs] 5. Scordato, E.S. & Drea, C.M.. "Scents and sensibility: Information content of olfactory... signals in the ringtailed lemur (Lemur catta)." 2007: 301- 314. doi:10.1016/j.anbehav.2006.08.006 [abs] 6... University Press, 2003: 121-148. [abs] 7. Drea, ... |
|||
|
Source: Zhou, Pei - Departments of Chemistry & Biochemistry, Duke University |
|||
|
Collection: Chemistry ; Biology and Medicine |
|||
| 11 | Randy L. Jirtle, Professor, Department of Radiation | ||
|
Summary: .1 (January, 2003): 321-8. [abs] 5. BA Freking, SK Murphy, AA Wylie, SJ Rhodes, JW Keele, KA Leymaster, RL... .10 (October, 2002): 1496-506. [abs] 6. JK Killian, CM Nolan, AA Wylie, T Li, TH Vu, AR Hoffman, RL Jirtle... , England 10.17 (August, 2001): 1721-8. [abs] 7. ... |
|||
|
Source: Zhou, Pei - Departments of Chemistry & Biochemistry, Duke University |
|||
|
Collection: Chemistry ; Biology and Medicine |
|||
| 12 | MTH 310 Syllabus Fall 2000 CLASS TIME: MWF 10:00 { 10:50 in Addams Hall 220 from 08/21/2000 to 12/01/2000. | ||
|
Summary: changes : L-1 Mon Aug 21 1.1 linear systems and row operations { 1ab,5,6ad L-2 Wed Aug 23 1.2 echelon form... Wed Sep 27 3.3 continued { 6ab,7abc,8,9,10 L-17 Fri Sep 29 3.4 basis of vector space { 3,5,7,8,10 L-18... 4.1 linear transformations { ... |
|||
|
Source: Verschelde, Jan - Department of Mathematics, Statistics, and Computer Science, University of Illinois at Chicago |
|||
|
Collection: Mathematics |
|||
| 13 | One-, Two-, and Multi-Fold Origami Axioms Roger C. Alperin and Robert J. Lang | ||
|
Summary: , AL2ab5ab, AL2ab5a7a, AL2ab5a7b, AL2ab7a10a, AL2ab7a10b, AL2ab7aa, AL2ab7ab, AL2a3b8, AL2a3b9, ... |
|||
|
Source: Alperin, Roger C. - Department of Mathematics, San Jose State University |
|||
|
Collection: Mathematics |
|||
| 14 | Deconstructing Commodity Storage Clusters Haryadi S. Gunawi, Nitin Agrawal, | ||
|
Summary: propagate a series of 90-byte (ab5, bc5) and 4-byte acknowledgments (ab6, ab7, bc6, bc7) to each other... No D D bc2 D ab2 D bc4 0 200 400 600 800 abE ab7 ab6 va4 ... |
|||
|
Source: Arpaci-Dusseau, Andrea - Department of Computer Sciences, University of Wisconsin at Madison; Arpaci-Dusseau, Remzi - Department of Computer Sciences, Department of Computer Sciences, University of Wisconsin at Madison |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 15 | Amtliche Bekanntmachung Jahrgang 2010 / Nr. 036 | ||
|
Summary: , alle weiteren Stellen werden ohne Rundung gestrichen." c) Es wird folgender Abs. 5 neu angefügt: ,,(5... ." 3. § 14 wird wie folgt geändert: a) In Abs. 5 wird folgende Nr. 5 neu eingefügt: ,,5. die... ) Abs. 6 erhält folgende neue Fassung: ,,(6) 1 Die Benotung ... |
|||
|
Source: Ott, Albrecht - Physikalisches Institut, Universität Bayreuth |
|||
|
Collection: Physics ; Biology and Medicine |
|||
| 16 | Fnfte Satzung zur nderung der Diplomprfungsordnung | ||
|
Summary: . 1, 2, 3, 4 und 5 werden Abs. 2, 3, 4, 5 und 6. 3. § 4 wird wie folgt geändert: a) Abs. 5 Sätze 3 und... 4 werden aufgehoben. b) Es werden folgende neue Abs. 6 und 7 eingefügt: #12;- 3 - ,,(6) 1 Die... Prüfern zu bewerten." c) Die bisherigen Abs. 6, 7, 8 und 9 ... |
|||
|
Source: Kersting, Roland - Fakultät für Physik, Ludwig-Maximilians-Universität München |
|||
|
Collection: Physics |
|||
| 17 | Amtliche Bekanntmachung Jahrgang 2007 / Nr. 149 | ||
|
Summary: bisherigen Sätze 3 und 4 werden die Sätze 5 und 6. bb) Abs. 5 wird gestrichen. cc) Abs. 6 wird zu Abs. 5. 20... HSchLG" durch den Wortlaut ,,BayHSchPG" ersetzt. b) In § 5 Abs. 7 Satz 3 wird der Passus ,,Artikel 28 Abs. 1 ... |
|||
|
Source: Schmidt, Matthias - Physikalisches Institut, Universität Bayreuth |
|||
|
Collection: Physics ; Materials Science |
|||
| 18 | A Hybrid Heuristic for an Inventory-Routing Claudia Archetti (1) | ||
|
Summary: .5 1397.29 1397.29 4 0.00 abs5n5.dat 5 0.5 999.42 999.42 2 0.00 abs1n10.dat 10 0.5 1743.07 1743.07 10 0... .5 1773.00 1773.00 8 0.00 abs5n10.dat 10 0.5 1938.18 1938.18 10 0.00 abs1n15.dat 15 0.5 2131.04 2131.04 30... .dat 15 0.5 2151.94 2151.94 34 0.00 abs5n15.dat 15 ... |
|||
|
Source: Hertz, Alain - Département de Mathématiques et de Génie Industriel, École Polytechnique de Montréal |
|||
|
Collection: Mathematics |
|||
| 19 | Fakultt Wirtschafts-und Sozialwissenschaften Prfungsausschuss | ||
|
Summary: Teilzeitstudium ausge- schlossen (gem. § 4 Abs. 5 der Prüfungsord- nung). 2. Das Anmeldeverfahren a) Vorgespräch... Fakultätsorgan (gem. §14 Abs. 5 S. 1 der Prüfungsordnung). Die endgültige und verbindliche The- menausgabe zur... , dass die Frist der Bearbeitung eingehalten werden kann (§ 14 ... |
|||
|
Source: Kurtz, Stefan - Center for Bioinformatics, Universität Hamburg |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 20 | Amtliche Bekanntmachung Jahrgang 2011 / Nr. 001 | ||
|
Summary: : Studium Generale" angefügt. 2. § 2 wird wie folgt geändert: a) Abs. 5 Satz 1 erhält eine Nummerierung und... Studium Generale absolviert werden (vgl. Anhang 3)." b) Abs. 7 wird gestrichen. 3. In § 3 wird folgender... Abs. 5 neu angefügt: *) Mit allen Personen- ... |
|||
|
Source: Ott, Albrecht - Physikalisches Institut, Universität Bayreuth |
|||
|
Collection: Physics ; Biology and Medicine |
|||
| 21 | Molecular Ecology Notes (2002), 2, 316319 doi:10.1046/j.1471-8278 .2002.00227.x 2002 Blackwell Science Ltd | ||
|
Summary: 427928 Ab6 F: TGCGGAAGCGAAAGAATCTGCTG R: GACTTGCCACACCCTATGACGTA 65 (CA)12 285 5 AJ427929 Ab7 F... (CA)7 113 8 AJ427927 Ab5 F: GTTGCCCGGTCGGATATACGTTTC R: CACACCCCCATACACTCACAGACT 65 (TG)18 112 > 1 AJ... ). Preliminary tests also indicate that some loci amplify in ... |
|||
|
Source: Halligan, Daniel - Institute of Evolutionary Biology, University of Edinburgh |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 22 | Amtliche Bekanntmachung Jahrgang 2009 / Nr. 083 | ||
|
Summary: wird gemäß Art. 19 Abs. 5 Satz 5 i.V.m. Abs. 6 Satz 1 BayHSchG die Bayreuther Graduiertenschule für... 35 werden zu den §§ 21 bis 39. 2. In § 3 Abs. 7 Satz 4 wird die Zahl ,,24" durch die Zahl ,,29 |
|||
|
Source: Ott, Albrecht - Physikalisches Institut, Universität Bayreuth |
|||
|
Collection: Physics ; Biology and Medicine |
|||
| 23 | urbino worldwide campus applied computer scienceComputer Architecture | ||
|
Summary: 'c' + a (c' + b) 5 literals (complement) = a'c' + a c' + ab 6 literals (distributive) = (a' + a) c' + ab 5... 'bc' + ab'c' + abc' + abc 15 literals f = a'c' + ab'c' + ab 7 literals f = a'c' + ab'c' + abc' + abc 11... (distributive) = a'c' + ab'c' + ... |
|||
|
Source: Bogliolo, Alessandro - Dipartimento di Matematica, Fisica e Informatica, Universita di Urbino "Carlo Bo" |
|||
|
Collection: Computer Technologies and Information Sciences ; Engineering |
|||
| 24 | Vol. 2003, No. 15 (2003-CG-110), pp. 55-60, 2003 2 14 f9084@kki.yamanashi.ac.jp, f8058@kki.yamanashi.ac.jp, ohbuchi@acm.org | ||
|
Summary: .2 0.4 0.6 0.8 1 D2 AD2 AD2abs 7. AD2AD2abs 6 3 AD2AD2absAD2 2 AD2abs 4 AD2AD2absOsadaD2[1] D... . 15 (2003-CG-110), pp. 55-60, 2003 2 14 - 5 - 2AD2AD2abs Nearest Neighbor 1 AD2abs6a6b 5 AD2AD2abs... L1 38% 49% 58% 0.68s L2 38% 51% 60% 0.70s 37% 50% 54% ... |
|||
|
Source: Ohbuchi, Ryutarou - Computer Science Department, Yamanashi University |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 25 | Das Mitteilungsblatt erscheint jeweils am 1. und 3. Mittwoch jeden Monats. Eigentmer, Herausgeber, Vervielfltigung und Vertrieb: Zentrale Verwaltung der Universitt Innsbruck, Innrain 52, A-6020 | ||
|
Summary: wissenschaftlichen Mitarbeiter im Forschungs- und Lehrbetrieb gemäß § 41 Abs. 5 Z. 2 UOG 1993 68. Kundmachung der... mit der selbständigen Erledigung bestimmter Angelegenheiten gem. § 43 Abs. 6 UOG 93 71. Ausschreibung... . 1 UOG 93 iVm § 43 Abs. 7 UOG 93, für ... |
|||
|
Source: Middeldorp, Aart - Institut für Informatik, Universität Innsbruck |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 26 | Vierte Satzung zur nderung der Diplomprfungsordnung | ||
|
Summary: Klammerzusatz ,,(Abs. 5)" ersetzt. 11. In § 22 Abs. 1 Satz 2 Halbsatz 2 wird ,,Abs. 6" durch ,,Abs. 5" ersetzt... ) Abs. 6 erhält folgende Fassung: ,,(6) 1 Für mathematische Teilprüfungen können Prüfer nur diejenigen... ... |
|||
|
Source: Kersting, Roland - Fakultät für Physik, Ludwig-Maximilians-Universität München |
|||
|
Collection: Physics |
|||
| 27 | Feb 47:55 AM Sets & Venn Diagrams | ||
|
Summary: = ? #12;5 Feb 59:45 AM Feb 59:44 AM Homework: Sec. 2.2 #13,4ab, 5ab, 7, 8, 9, 12, 15, 25, 26, 27, 28, 34... of elements that can be in AB? the greatest number? n(AB)=0 n(AB)=3 n(AB)=7 B n(B)=7A n(A)=10 B n(B)=7 A n |
|||
|
Source: Hasenbank, Jon - Mathematics Department, University of Wisconsin-La Crosse |
|||
|
Collection: Mathematics ; Multidisciplinary Databases and Resources |
|||
| 28 | Sechste Satzung zur nderung der Fachprfungsordnung fr den Bachelor-und Masterstudiengang Wirtschaftsingenieurwesen | ||
|
Summary: , zuletzt geändert durch Satzung vom 9. März 2011, wird wie folgt geändert: 1. § 35 Abs. 5 und § 36 Abs. 7... 5. August 2011 Aufgrund von Art. 13 Abs. 1 in Verbindung mit Art. 43 Abs. 5 und Art. 61 Abs. 2 des |
|||
|
Source: Gugat, Martin - Mathematisches Institut, Friedrich-Alexander University Erlangen-Nürnberg |
|||
|
Collection: Mathematics |
|||
| 29 | Kooperation Universitt Wien Kirchliche Pdagogische Hochschule Wien/Krems Universitt Wien/Fakultt fr Mathematik | ||
|
Summary: Günter Hanisch Mittwoch von 17 bis 18.30 Uhr ab 6.10.2010 HS 1 des UZA 2 VO 2st. Ansprechperson: Ao. Univ... 12.40 Uhr ab 5.10.2010 2.05 SE 2st. WS 10/11 Modul ha2-22 Begabungsförderndes Handeln Andrea... 10/11 Modul ha2-25 Unterrichtsbezogene Forschung Barbara Riehs Dienstag von 13.35 bis14.20 Uhr ... |
|||
|
Source: Beiglböck, Mathias - Institut für Diskrete Mathematik und Geometrie, Technische Universität Wien |
|||
|
Collection: Mathematics |
|||
| 30 | Laboratory 4.2. Objective: You will simulate and build a 3-bit arithmetic logic unit (ALU), shown | ||
|
Summary: Günter Hanisch Mittwoch von 17 bis 18.30 Uhr ab 6.10.2010 HS 1 des UZA 2 VO 2st. Ansprechperson: Ao. Univ... 12.40 Uhr ab 5.10.2010 2.05 SE 2st. WS 10/11 Modul ha2-22 Begabungsförderndes Handeln Andrea... 10/11 Modul ha2-25 Unterrichtsbezogene Forschung Barbara Riehs Dienstag von 13.35 bis14.20 Uhr ... |
|||
|
Source: Sasaki, Galen H. - Department of Electrical Engineering, University of Hawai'i at Manoa |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 31 | Dritte Satzung zur nderung der Habilitationsordnung der Friedrich-Alexander-Universitt Erlangen-Nrnberg | ||
|
Summary: -Nürnberg Vom 28. September 2009 Aufgrund von Art. 13 Abs. 1 Satz 2 in Verbindung mit Art. 65 Abs. 7 Satz 1 des... geändert: In § 7 Abs. 5 werden folgende Sätze 3 und 4 eingefügt: ,,3 Der Fakultätsrat kann das Fachmentorat |
|||
|
Source: Gugat, Martin - Mathematisches Institut, Friedrich-Alexander University Erlangen-Nürnberg |
|||
|
Collection: Mathematics |
|||
| 32 | {L1, . . . , Ln} unifizierbar gdw. es ex. mit (L1) = ... = (Ln) ist mgu gdw. fur jeden Unifikator ex. Substitution mit = | ||
|
Summary: , brich mit Clash Failure ab. 5. Sonst sei X die Variable und t der Teilterm im anderen Literal. Falls X... in t vorkommt, brich mit Occur Failure ab. 6. Sonst setze = {X/t} und gehe zur¨uck zu Schritt 2. #12;Pr |
|||
|
Source: Ábrahám, Erika - Fachgruppe Informatik, Rheinisch Westfälische Technische Hochschule Aachen (RWTH) |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 33 | Fondamenti di Informatica (Modulo B) #include <iostream.h> | ||
|
Summary: , brich mit Clash Failure ab. 5. Sonst sei X die Variable und t der Teilterm im anderen Literal. Falls X... in t vorkommt, brich mit Occur Failure ab. 6. Sonst setze = {X/t} und gehe zur¨uck zu Schritt 2. #12;Pr |
|||
|
Source: Sperduti, Alessandro - Dipartimento di Matematica Pura e Applicata, Università degli Studi di Padova |
|||
|
Collection: Mathematics |
|||
| 34 | ! "#$%! &' $($)$%'0 $% &12(3456372)8' 8@9AB CED FHGI43 | ||
|
Summary: ¢ ¡AB©¦ ¨AB5 % 2B#¡AD ¨C ¨)2vAD©¦ ÿ¡ 75¥W 10% !81S©¦¡ )©!tÿ0% A g % !¨D AB(7 Tÿ¡ 4S©¦AD f2D0% !¨ 4(p... % §0 ¨ÿ$©1¢¡23)©4% ¡% §6587 9ÿ¡ @ÿ¡AB £¢¡(6C ¨¡2D(6©¦0% § EGF¦HPI (!¨AD©¦2Q)AD#$!¨)#$AD © RS©¦AD© #¡2T... S ... |
|||
|
Source: New York at Stoney Brook, State University of - Department of Applied Mathematics and Statistics |
|||
|
Collection: Mathematics |
|||
| 35 | 2007 Wisconsin Turfgrass Research Reports | ||
|
Summary: ¢ ¡AB©¦ ¨AB5 % 2B#¡AD ¨C ¨)2vAD©¦ ÿ¡ 75¥W 10% !81S©¦¡ )©!tÿ0% A g % !¨D AB(7 Tÿ¡ 4S©¦AD f2D0% !¨ 4(p... % §0 ¨ÿ$©1¢¡23)©4% ¡% §6587 9ÿ¡ @ÿ¡AB £¢¡(6C ¨¡2D(6©¦0% § EGF¦HPI (!¨AD©¦2Q)AD#$!¨)#$AD © RS©¦AD© #¡2T... S ... |
|||
|
Source: Bent, Andrew F. - Department of Plant Pathology, University of Wisconsin at Madison |
|||
|
Collection: Biology and Medicine |
|||
| 36 | Achtung: vorlufige Liste! Ausgabe-Stand: 8. Jul. 2011 15:03 | ||
|
Summary: Examensvorbereitung 1 st., Do, 18 - 20, R 008 Schmidbauer Examensvorbereitung im Plichtfach Examensvertiefungen (ab 6... . Sem.) 21 300 Examensvertiefung im Zivilrecht, P (ab 6. Sem.) 6 st., Di 9-12, H17; Mi 9-12, H17 Roth 2... /11 #12;21 301 Examensvertiefung im Zivilprozessrecht, P (ab ... |
|||
|
Source: Schubart, Christoph - Institut für Zoologie, Universität Regensburg |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 37 | Fax +41 61 306 12 34 E-Mail karger@karger.ch | ||
|
Summary: is that of a promontory (fig. 3c), wet wrin- 1ab 2abc 3abc 4ab 5ab 6ab 7a 8a 9ab 10ab 11abc 12abc 13ab Fig. 5. Channel... . The divides, on the other hand, are disconnected and diverge away from one 1ab 3abc2abc 6ab 7a5ab4ab ... |
|||
|
Source: Meyers, Ron - Department of Zoology, Weber State University |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 38 | Zweite Satzung zur nderung der Studien-und Prfungsordnung fr das Bachelorstudium der Biologie und das Masterstudium der Zell-und | ||
|
Summary: . August 2011 Aufgrund von Art. 13 Abs. 1 in Verbindung mit Art. 43 Abs. 5, Art. 58 Abs. 1 und Art. 61 Abs... werden." 2. In § 8 Abs. 6 Satz 2 wird das Wort ,,Rektorin" durch das Wort ,,Präsidentin" und das Wort... , elektronischer Fassung" eingefügt. b) In Abs. 5 ... |
|||
|
Source: Gugat, Martin - Mathematisches Institut, Friedrich-Alexander University Erlangen-Nürnberg |
|||
|
Collection: Mathematics |
|||
| 39 | Amtliche Bekanntmachung Jahrgang 2010 / Nr. 032 | ||
|
Summary: Ausführungen entsprechend." c) Die bisherigen Abs. 5 und 6 werden zu den Abs. 7 und 8. 8. § 15 Abs. 1 erhält... . 3 wird der Passus ,,(Anhänge 1 und 2)" durch den Passus ,,(Anhang)" ersetzt. b) In Abs. 6 wird die... ,,10 bis 21" durch den Passus ,,G1 bis G6" ... |
|||
|
Source: Ott, Albrecht - Physikalisches Institut, Universität Bayreuth |
|||
|
Collection: Physics ; Biology and Medicine |
|||
| 40 | Konsolidierte Fassung der Universitt Bayreuth: Der Text dieser Satzung ist nach dem aktuellen Stand sorgfltig erstellt; gleichwohl sind | ||
|
Summary: die Ab- wahl gilt abweichend von Art. 21 Abs. 3 und Art. 26 Abs. 5 Satz 1 Nr. 2 BayHSchG das in Abs. 7... ) ge- mäß Art. 19 Abs. 5 Satz 5 i. V. m. Abs. 6 Satz 1 BayHSchG eingerichtet, die für die Fakultät für... An der ... |
|||
|
Source: Schmidt, Matthias - Physikalisches Institut, Universität Bayreuth |
|||
|
Collection: Physics ; Materials Science |
|||
| 41 | SPORTINSTITUT UNIVERSITTS | ||
|
Summary: Abende ab 5. Oktober 76. Mi. 18.30 - 19.55, VH Ferd.Marklstr.: Grundkenntnisse Marion Danner 77. Mi. 20... .00 - 19.55, 6 Termine ab 4. Oktober Josef Horner 116. Di. 20.00 - 21.55, 6 Termine ab 4. Okt., ab 5b... Vorstieg Jo Horner 118. Do. 18.00 - 19.55, 6 Termine ab ... |
|||
|
Source: Jüttler, Bert - Institut für Angewandte Geometrie, Johannes Kepler Universität Linz |
|||
|
Collection: Mathematics |
|||
| 42 | AN INT~ATIONAL DELPHI POLL ON FUTURE TRENDS IN "INFORMATION LINGUISTICS" | ||
|
Summary: hal ha2 sol so3 so3 so4 il5 illI illI il5 in4 in5 in5 in4 ab2 ab6 ab6 ab5 trl tr5 tr6 trl re3 re3 re4... 7 il4 i16 i15 in6 in3 in3 in6 ab4 ab5 ab5 ... |
|||
|
Source: Association for Computational Linguistics (ACL) Anthology |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 43 | TdL-Durchfhrungshinweise vom 18. August 2006 | ||
|
Summary: .....................................................................................................22 5.3 Zu § 5 Abs. 5 TVÜ - Teilzeitbeschäftigte ..................................................23... 5.4 Zu § 5 Abs. 6 TVÜ - Berücksichtigung von Zeiten ohne Vergütung/ Lohn im Oktober 2006... .7.3 ... |
|||
|
Source: Pfeifer, Holger - Institut für Künstliche Intelligenz, Universität Ulm |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 44 | Range Burning and Fertilizing Related to Nutritive Value of Bluestem Grass | ||
|
Summary: Nitrogen free extract 5 1.24ab 5 3.28' 50.99b 5 1.68a Ash 7.60ab 7.66ab 7.34b 7.95a Cell wall constituents... . ' No nitrogen Nitrogen Not Not Constituent burned Burned burned Burned Crude protein 5.41bc 2 5.1 3ab 5.1gc 5... ... |
|||
|
Source: Owensby, Clenton E. - Department of Agronomy, Kansas State University |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 45 | Veranstaltungen M.Sc Biologie (SoSe 11) 1. Drittel 2. Drittel 3. Drittel Vorlesungsfreie Zeit | ||
|
Summary: : 04.04.-03.05.11 09.05.-03.06.11 06.06.-08.07.11 und blockübergreifend MBIO-AB-6: Allgemeine... MBIO-AB-9: Ökophysiologie aquatischer Organismen (12 LP) Biotechnologie (9 LP) (12 LP) MBIO-AB-7 |
|||
|
Source: Hamburg,.Universität - Department Informatik, Cognitive Systems Laboratory |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 46 | ...... _, .............._.........., .............,' ............". r-t ot. UI.-lIly. IlUII. YY. otunn Erste nderung der Benutzungsordnung der Thringer Universitts-und Landesbibliothek Jena | ||
|
Summary: -Schiller-Universität Jena gelten für alle Benutzer der Thüringer Universitäts- und Landesbibliothek die §§ 3, 8 Abs. 7, 9... Angaben des Entleihers gemäß § 3 Abs. 5 als Benutzernummer für das elektronische Ausleihsystem zugeordnet |
|||
|
Source: Seyfarth, Andre - Institute of Sport Science, Friedrich-Schiller Universität Jena |
|||
|
Collection: Engineering ; Biology and Medicine |
|||
| 47 | Application of Sparse NMR Restraints to Large-Scale Protein Structure Prediction | ||
|
Summary: ab 6.48 4 10 0 5.37 2 17 2 4.52 2 1dcjA 81 ab 2.72 1 10 0 2.6 1 20 0 2.57 4 1ip9A 85 ab 5.3 3 11 0 5... 1mnl_ 91 ab 8.52 2 11 0 6.91 1 23 0 5.75 3 1jh3A 99 ab 7.03 1 12 0 4.49 2 25 0 4.13 4 1g10A 102 ab 5... .7 1 1ncs_ 47 ab ... |
|||
|
Source: Skolnick, Jeff - Center for the Study of Systems Biology, Georgia Institute of Technology |
|||
|
Collection: Chemistry ; Biology and Medicine |
|||
| 48 | Amtliche Bekanntmachung Jahrgang 2008 / Nr. 015 | ||
|
Summary: of African Studies (BIGSAS) gemäß Art. 19 Abs. 5 Satz 5 i. V. m. Abs. 6 Satz 1 BayHSchG eingerichtet, die für |
|||
|
Source: Ott, Albrecht - Physikalisches Institut, Universität Bayreuth |
|||
|
Collection: Physics ; Biology and Medicine |
|||
| 49 | (AB 1) Solve the differential equation y = (y + 4x)3 (AB 2) Suppose that we play laser tag in the dark. Two groups of people, the red team and the blue | ||
|
Summary: , u(x, 0) = sin(2x), 0 < x < , ut(x, 0) = 3 sin(5x), 0 < x < . (AB 5) Let u(x, t) be the function you... frequency of the string? (AB 6) A violin's A string is 32 cm long (according to measurements taken in class |
|||
|
Source: Barton, Ariel - Department of Mathematics, Purdue University |
|||
|
Collection: Mathematics |
|||
| 50 | February 3, 2010 18.01 Problem Set 1 | ||
|
Summary: , 5ab, 6a. 3. 1E-1abc, 3, 4a, 5bc, 1J-1e, 1J-2. 4. 1F-1ab, 1F-4, 1F-7bd, 1J-1ak, 1G-4. Part II: 15... ) of the Supplementary Notes (solved in section S). 0. 1A-2a, 3ad, 6b. 1. 1B-1abc, 1C-3bd, 1C-4bd, 1C-5. 2. 1D-1bfgj, 3ab |
|||
|
Source: Vogan, David - Department of Mathematics, Massachusetts Institute of Technology (MIT) |
|||
|
Collection: Mathematics |
|||
| 51 | Verkndungsblatt Nr. 6/2009 Satzung ber ein ergnzendes Hochschulauswahlverfahren | ||
|
Summary: § 6 Abs. 6 Thüringer Hochschulzulassungsgesetz (ThürHZG) vom 16. Dezember 2008 (GVBl. S. 535... Auswahlmaßstäbe gemäß § 6 Abs. 5 Satz 2 Nr. 1 bis 6 ThürHZG zugrunde gelegt wer- den. (2) Die Auswahl der |
|||
|
Source: Seyfarth, Andre - Institute of Sport Science, Friedrich-Schiller Universität Jena |
|||
|
Collection: Engineering ; Biology and Medicine |
|||
| 52 | Konsolidierte Fassung der Universitt Bayreuth: Der Text dieser Satzung ist nach dem aktuellen Stand sorgfltig erstellt; gleichwohl sind | ||
|
Summary: die Ab- wahl gilt abweichend von Art. 21 Abs. 3 und Art. 26 Abs. 5 Satz 1 Nr. 2 BayHSchG das in Abs. 7... International Graduate School of African Studies (BIGSAS) ge- mäß Art. 19 Abs. 5 Satz 5 i. V. m. Abs. 6 Satz 1... ... |
|||
|
Source: Ott, Albrecht - Physikalisches Institut, Universität Bayreuth |
|||
|
Collection: Physics ; Biology and Medicine |
|||
| 53 | Konsolidierte Fassung der Universitt Bayreuth: Der Text dieser Satzung ist nach dem aktuellen Stand sorgfltig erstellt; gleichwohl sind | ||
|
Summary: die Ab- wahl gilt abweichend von Art. 21 Abs. 3 und Art. 26 Abs. 5 Satz 1 Nr. 2 BayHSchG das in Abs. 7... International Graduate School of African Studies (BIGSAS) ge- mäß Art. 19 Abs. 5 Satz 5 i. V. m. Abs. 6 Satz 1... ... |
|||
|
Source: Ott, Albrecht - Physikalisches Institut, Universität Bayreuth |
|||
|
Collection: Physics ; Biology and Medicine |
|||
| 54 | Chemie der Erde 67 (2007) 151174 Petrology, geochemistry and zircon age for redwitzite at Abertamy, | ||
|
Summary: AB 4 AB 5 AB 6 AB 7 PLE-1 PLE-2 PLE-3 PLE-4 PLE-5 wt% SiO2 51.84 70.12 72.77 72.06 52.24 47.74 49... AB 1 AB 2 AB 3 AB 4 AB 5 AB 6 AB 7 PLE-1 ... |
|||
|
Source: Siebel, Wolfgang - Institut für Geowissenschaften, Universität Tübingen |
|||
|
Collection: Geosciences |
|||
| 55 | Diplomprfungsordnung Physik Ordnung fr die | ||
|
Summary: von § 17 Abs. 7 ein Teil der Fachprüfungen abgelegt werden. Die anschließenden zwei Semester dienen... . § 22). Die Fachprüfungen können entsprechend der Regelung des § 17 Abs. 7 auf zwei Prüfungsabschnitte... nichtphysikalische Wahlpflichtfach gemäß Abs. 2 Ziffer 4 und Abs. ... |
|||
|
Source: Johann Wolfgang Goethe-Universität, Frankfurt am Main - Institut fur Theoretische Physik - Fachbereich Physik |
|||
|
Collection: Physics |
|||
| 56 | D I E N S T B L A T T DER HOCHSCHULEN DES SAARLANDES | ||
|
Summary: (§ 7, § 9, § 11, § 14 Abs. 6, § 17 Abs. 5 und § 18 Abs. 2) abhängt, ist diese Entscheidung spätestens... fachgebundene Studienberechtigung gemäß § 82 Abs. 5 UG besitzt. (2) Die Zulassung zu Prüfungen ist beim... verlangen, dass die Entscheidungen nach ... |
|||
|
Source: Huber, Patrick - Technische Physik, Universität des Saarlandes |
|||
|
Collection: Physics ; Materials Science |
|||
| 57 | Cardiac function is vital for transport of respiratory gases, nutrients and hormones and removal of waste products. The | ||
|
Summary: (§ 7, § 9, § 11, § 14 Abs. 6, § 17 Abs. 5 und § 18 Abs. 2) abhängt, ist diese Entscheidung spätestens... fachgebundene Studienberechtigung gemäß § 82 Abs. 5 UG besitzt. (2) Die Zulassung zu Prüfungen ist beim... verlangen, dass die Entscheidungen nach ... |
|||
|
Source: Farrell, Anthony P. - Faculty of Land and Food Systems, University of British Columbia |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 58 | Demandes de rectification ou d'information faire auprs de Pierre Brard avant le 7/01/2010 dernier dlai GRPE N tudiant CC CC2 | ||
|
Summary: 15 12 9 MAT 20915508 17,8 18 16,50 19,00 14 0,5 15,667 16 16 15 MAT 20700106 abs abs 5,00 abs abs 0... 7 MAT 20800731 abs 5,4 5,75 5,00 abs 0 10,667 12 8 12 MAT 20800394 10,8 10 10,75 10,00 15 0 11 14 9... 10 11 9 10 MIN 20702464 6,01 5,1 6,25 4,00 14 0 9,3333 10 9 9 MIN 20503385 abs ... |
|||
|
Source: Bérard, Pierre - Institut Fourier, Université Joseph Fourier Grenoble-I |
|||
|
Collection: Mathematics |
|||
| 59 | Diplomprfungsordnung fr den integrierten Studiengang Maschinenbau | ||
|
Summary: ausreichend. (5) Für die Prüfer und Beisitzer gilt § 5 Abs. 6 Sätze 2 und 3 entsprechend. § 7 Anrechnung von... in Absatz 3 genannten Voraussetzungen werden im Falle des § 7 Abs. 6 durch entsprechende Feststellungen im... in einem anderen Prü- fungsverfahren befindet. (8)Ist es dem Kandidaten nicht ... |
|||
|
Source: Hellebrand, Sybille - Fakultät für Elektrotechnik, Informatik und Mathematik, Universität Paderborn |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 60 | The KB1 Image Compression System Andy Fraser | ||
|
Summary: ^yb = ab,1 · xr,1 + ab,2 · xr,2 + ab,3 · xr,3+ ab,4 · xg,1 + ab,5 · xg,2 + ab,6 · xg,3+ ab,7 · xb,1 |
|||
|
Source: Fraser, Andrew M. - Department of Electrical and Computer Engineering, Portland State University |
|||
|
Collection: Engineering |
|||
| 61 | Az.: 20/1-2/0-1 RS 525/2 Prfungsordnung | ||
|
Summary: bestanden, wenn nach dem in § 13 Abs. 5 angegebenen Berech- nungsschlüssel alle Fachprüfungen jeweils mit... wissenschaftlichen Hausarbeit dreifach. § 13 Abs. 5 gilt entsprechend. (3) Die Prüfungskommission setzt die... Abs. 7) erfolgen; ist dies nicht möglich, ... |
|||
|
Source: Gugat, Martin - Mathematisches Institut, Friedrich-Alexander University Erlangen-Nürnberg |
|||
|
Collection: Mathematics |
|||
| 62 | CHANGES IN FIRE REGIMES AND THE SUCCESSIONAL STATUS OF TABLE MOUNTAIN PINE (Pinus pungens Lamb.) | ||
|
Summary: bestanden, wenn nach dem in § 13 Abs. 5 angegebenen Berech- nungsschlüssel alle Fachprüfungen jeweils mit... wissenschaftlichen Hausarbeit dreifach. § 13 Abs. 5 gilt entsprechend. (3) Die Prüfungskommission setzt die... Abs. 7) erfolgen; ist dies nicht möglich, ... |
|||
|
Source: Grissino-Mayer, Henri D. - Department of Geography, University of Tennessee |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 63 | Title: Links between phytoplankton and bacterial community dynamics in a coastal1 marine environment2 | ||
|
Summary: -5, AB-6, AB-7, AB-8, and AB-9). These results20 confirm previous reports of the importance... LimeKi SeptPassBa SeptBrandy Fig. 4 AFB-1/ AFB-2 AB-1 AB-2 AB-6 AB-7 AB3 AB-8 AFB-1/ AFB-2 AB-4 ... |
|||
|
Source: Rooney-Varga, Juliette N. - Department of Biological Sciences, University of Massachusetts at Lowell |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 64 | From Deduction Graphs to Proof Nets: Boxes and Sharing in the Graphical Presentation of | ||
|
Summary: , AB) (7, (AB)A) (8, A) (9, B) g g g g g g g g g g g g g g g... £ £ £ £ £ £ £ £ £ £ £ £ £ £ £ ¥ ¥ ¥ ¥ ¥ ¥ e e e DDD t t t t t $$$$$ l l l ¨¨¨¨¨¨¨¨¨¨¨ $$$$$ hhhh (3, AAB) (6, AB) (7, (AB)A) (8, A) (5, B... ) (1, A) (4, AB) (2, A) (9, B) (0, A) (6a, AB) ... |
|||
|
Source: Loeb, Iris - Department of Mathematics and Statistics, University of Canterbury |
|||
|
Collection: Mathematics |
|||
| 65 | From Deduction Graphs to Proof Nets: Boxes and Sharing in the Graphical Presentation of | ||
|
Summary: e ¨¨¨¨¨ $$$$$$$$$$$ t t t t t 22222222222222 (4, AB) (2, A)(1, A) (5, B) (3, AAB) (6, AB) (7... DDD t t t t t $$$$$ l l l ¨¨¨¨¨¨¨¨¨¨¨ $$$$$ hhhh (3, AAB) (6, AB) (7, (AB)A) (8, A) (5, B) (1, A... ) (4, AB) (2, A) (9, B) (0, A) (6a, AB) (6b, AB) ... |
|||
|
Source: Geuvers, Herman - Institute for Computing and Information Sciences, Radboud Universiteit Nijmegen |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 66 | A DESINGULARIZATION OF V6 SANDRA DARBY, MONICA HALL, AND DANIEL JACKSON | ||
|
Summary: +778a6 b2 c+2061a5 b3 c+3271a4 b4 c+3182a3 b5 c+1849a2 b6 c+ 584ab7 c + 76b8 c + 77a7 c2 + 710a6 bc2... + 2688a5 b2 c2 + 5419a4 b3 c2 + 6288a3 b4 c2 + 4197a2 b5 c2 +1487ab6 c2 +214b7 c2 +215a6 c3 +1548a5 bc3... +4456a4 b2 c3 +6586a3 b3 c3 + 5275a2 b4 c3 +2166ab5 c3 ... |
|||
|
Source: Jackson, Daniel R. - Department of Mathematics, University of Maine at Farmington |
|||
|
Collection: Mathematics |
|||
| 67 | On the efficiency of the simple groups with order less than a million and their covers | ||
|
Summary: , aabaaB6A3bAb 44 279893 aba3babAAb, BaabbaaBBA3B, Ba3b3a3BBA7B 44 6335191 ab5aaB3a, a3Ba3BA4B, Ab6a3b4... (aB)2 43 699938 J2 a2b3, (ab)2(aB)2ab(AB)4(Ab)3(AB)4ab(aB)2 43 1469303 L2(121) a3 = b11, (ab4ab7)2, aB2... BBaB, abAbaaBaBa3BBAAbAAbaB 43 173182 ... |
|||
|
Source: St Andrews, University of - School of Mathematics and Statistics, Centre for Interdisciplinary Research in Computational Algebra |
|||
|
Collection: Mathematics |
|||
| 68 | Ordnung fr die Bachelorprfung in Mathematik an der Technischen Universitt Kaiserslautern | ||
|
Summary: . Abs. 5 Satz 3 und 4 gilt entsprechend. (7) Leistungen gemäß Abs. 4 kann nur erbringen, wer zum... obliegen unter Wahrung der Vorschriften von § 25 Abs. 5 HochSchG die Organisation der Prüfungen und die ihm... (1) Die Modulprüfungen in den mathematischen Blöcken (§ 2 Abs. ... |
|||
|
Source: Pinnau, René - Fachbereich Mathematik, Technische Universität Kaiserslautern |
|||
|
Collection: Mathematics |
|||
| 69 | Veranstaltungsverzeichnis Sommersemester 2011 | ||
|
Summary: Unterrichtsqualität Pädagogische Schulentwicklung nach Dr. H. Klippert 3.1186 S ab 5. Sem. Do 14:0016:00 15/133 WPK... Pädagogische Schulentwicklung nach Dr. H. Klippert 3.1186 S ab 5. Sem. Do 14:0016:00 15/133 Beer, K... Schulentwicklung nach Dr. H. Klippert 3.1186 S ab ... |
|||
|
Source: Steinhoff, Heinz-Jürgen - Fachbereich Physik, Universität Osnabrück |
|||
|
Collection: Biology and Medicine ; Physics |
|||
| 70 | RC 20125 (07/07/95) Computer Science | ||
|
Summary: (0ab6, 0ab5) :ab7 oe moreexpert(L, Q, F iscal) N2(0ab7) ^ R2(0ab7, 0ab6... 4) ^ ... |
|||
|
Source: Gabrieli, John - Department of Brain and Cognitive Science, Massachusetts Institute of Technology (MIT); MIT Center for Coordination Science |
|||
|
Collection: Biology and Medicine ; Multidisciplinary Databases and Resources |
|||
| 71 | RC 20125 (07/07/95) Computer Science | ||
|
Summary: (x; y; z) oe :moreexpert(x; y; z) N2( 0 ab6) R2( 0 ab6; 0 ab4) R2( 0 ab6; 0 ab5) :ab7 oe... ( 0 ab2; 0 ab3)] :ab5 oe [moreexpert(Q; L; F ... |
|||
|
Source: Gabrieli, John - Department of Brain and Cognitive Science, Massachusetts Institute of Technology (MIT); MIT Center for Coordination Science |
|||
|
Collection: Biology and Medicine ; Multidisciplinary Databases and Resources |
|||
| 72 | PEANUT VARIETY AND QUALITY EVALUATION RESULTS | ||
|
Summary: .7 b 0.0 b VT 024077 3.7 ab 5.0 a-c 1.7 c-f 5.0 b-d 5.7 a-d 1.7 b-e 4.0 ab 0.0 b VT 004152 2.3 ab 3.3 a... .0 b 0.0 b VT 003069 4.7 ab 5.7 ab 4.0 a-d 5.0 b-d 4.3 a-d 5.3 a 0.0 b 0.3 b VT 003191 5.0 ab 4.0 a-e 4... .3 a-e 0.0 b 0.0 b N05024J 4.0 ab 6.3 a 0.7 ef 2.3 cd ... |
|||
|
Source: Liskiewicz, Maciej - Institut für Theoretische Informatik, Universität zu Lübeck |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 73 | P 2100 A 03.00 -105 Aktualisierung der | ||
|
Summary: .....................................................................................................22 5.3 Zu § 5 Abs. 5 TVÜ - Teilzeitbeschäftigte ..................................................23... 5.4 Zu § 5 Abs. 6 TVÜ - Berücksichtigung von Zeiten ohne Vergütung/ Lohn im Oktober 2006... - ... |
|||
|
Source: Seyfarth, Andre - Institute of Sport Science, Friedrich-Schiller Universität Jena |
|||
|
Collection: Engineering ; Biology and Medicine |
|||
| 74 | An den Vorsitzenden Regensburg, den ............................ der Promotionskommission | ||
|
Summary: Vereinbarungen nach § 6 Abs. 6: Nachweise nach §5 Abs. 7 bis 9 oder § 6 Abs. 6 #12;Terminvereinbarung unter Tel |
|||
|
Source: Schubart, Christoph - Institut für Zoologie, Universität Regensburg |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 75 | Nichtamtliche Lesefassung der Prfungsordnung Prfungsordnung der Universitt Mannheim | ||
|
Summary: Bereichsnote geht zusätzlich zu den nach § 6 Abs. 5 errechneten Noten in die Gesamtnote ein. § 6 Abs. 6 gilt... in Papierform ein. Zum Plagi- atsabgleich ist die Arbeit in anonymisierter Form gem. § 3 Abs. 7... . (6) Die Gesamtnote der Master-Prüfung wird aus den ... |
|||
|
Source: Mannheim, Universität - Institut für Informatik, Forschungsgruppe Datenbanken |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 76 | zur nderung der Prfungsordnung fr den Modellstudiengang Bachelor in Informatik | ||
|
Summary: ,,§ 66 Abs. 6 HG" durch die Worte ,,§ 49 Abs. 10 HG" ersetzt. b) In Abs. 7 werden die Worte ,,des... folgt geändert: a) Abs. 5 Satz 4 wird gestrichen. #12;14 b) Nach Abs. 7 wird folgender Absatz 8 angefügt... Kandidatin ... |
|||
|
Source: Güting, Ralf Hartmut - Fakultät für Mathematik und Informatik, FernUniversität in Hagen |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 77 | CMC 2003/04 School of Mathematics and Statistics | ||
|
Summary: of the groups with presentations D a; bja 2 = b 4 = (ab) 5 = (ab 2 ) 5 = 1 E D a; bja 2 = b 4 = (ab) 7 = [a; b |
|||
|
Source: St Andrews, University of - School of Mathematics and Statistics, Centre for Interdisciplinary Research in Computational Algebra |
|||
|
Collection: Mathematics |
|||
| 78 | CMC 2003/04 School of Mathematics and Statistics | ||
|
Summary: of the groups with presentations a, b|a2 = b4 = (ab)5 = (ab2 )5 = 1 a, b|a2 = b4 = (ab)7 = [a, b]5 = (abab2 ab-1 |
|||
|
Source: St Andrews, University of - School of Mathematics and Statistics, Centre for Interdisciplinary Research in Computational Algebra |
|||
|
Collection: Mathematics |
|||
| 79 | *Corresponding Author: Leslie B. Vosshall--Laboratory of Neurogenetics and Behavior, The Rockefeller University, 1230 York Avenue, Box 63, New York, New York 10021, USA. | ||
|
Summary: ab7 VC3m 8 (9) ethyl lactate Or67d at1 DA1 Or69aA ab9 D Or69aB ab9 D Or82a ab5A VA6 1 (5) geranyl... ab7A VM5v 21 (8) ethyl benzoate Or98b ab6B* VM5d* *tentative; ^from Hallem and Carlson 2006... at2 DA3 0 (22) no strong ... |
|||
|
Source: Vosshall, Leslie - L:aboratory of Neurogenetics and Behavior, Rockefeller University |
|||
|
Collection: Biology and Medicine |
|||
| 80 | Amtliche Bekanntmachung Jahrgang 2008 / Nr. 003 | ||
|
Summary: Art. 13 Abs. 1 Satz 2 Halbsatz 2 in Verbindung mit Art. 71 Abs. 6 des Bayerischen Hochschulgesetzes... , in dem das Studium abgeschlossen wird, zu stellen." b) Die bisherigen Abs. 4, 5 und 6 werden die Abs. 5 |
|||
|
Source: Ott, Albrecht - Physikalisches Institut, Universität Bayreuth |
|||
|
Collection: Physics ; Biology and Medicine |
|||
| 81 | Vierte Satzung zur nderung der Fachstudien-und Prfungsordnung fr das Fach Nordische Philologie im Zwei-Fach-Bachelorstudiengang an der | ||
|
Summary: Satzung vom 5. November 2010, wird wie folgt geändert: In § 5 wird nach Abs. 5 folgender neuer Abs. 6 |
|||
|
Source: Gugat, Martin - Mathematisches Institut, Friedrich-Alexander University Erlangen-Nürnberg |
|||
|
Collection: Mathematics |
|||
| 82 | Satzung zur nderung von Fachstudien-und Prfungsordnungen in EinFach-und Zwei-Fach-Bachelorstudien-und Masterstudiengngen | ||
|
Summary: Erlangen-Nürnberg Vom 5. November 2010 Aufgrund von Art. 13 Abs. 1, Art. 43 Abs. 5, Art. 58 Abs. 1 und Art... und Pädagogik der Paragraph ,,28 Abs. 5" durch den Paragraphen ,,30 Abs. 5" ersetzt. 3. In § 6 der FPO... Paragraphen ,,7" und in Abs. 3 die Zahlen und ... |
|||
|
Source: Gugat, Martin - Mathematisches Institut, Friedrich-Alexander University Erlangen-Nürnberg |
|||
|
Collection: Mathematics |
|||
| 83 | M.Sc./Ph.D. Molecular Biology Program -Prfungsordnung Georg-August-Universitt Gttingen, Germany | ||
|
Summary: Prüfenden und die Beisitzerinnen und Beisitzer gilt § 6 Abs. 7 entsprechend. #12;M.Sc./Ph.D. Molecular... Promotionsausschuss gemäß § 5 Abs. 5 gehören zusätzlich zu der Anleiterin oder dem Anleiter der Arbeit mindestens zwei... die §§ 6 Abs. 6 und Abs. 10 ... |
|||
|
Source: Wardetzky, Max - Institut für Numerische und Angewandte Mathematik, Georg-August-Universität Göttingen |
|||
|
Collection: Mathematics |
|||
| 84 | Neunte Satzung zur nderung der Prfungsordnung fr die Diplomprfung der Tech-nischen Fakultt der Universitt Erlangen-Nrnberg | ||
|
Summary: für die zweite Wiederholung § 3 Abs. 7 Satz 5." 8. § 14 wird wie folgt geändert: a) In Absatz 3 wird... ." 9. § 17 Abs. 6 wird wie folgt geändert: a) Satz 1 erhält folgende Fassung: ,,1 Die Diplomarbeit wird... (Art. 81 Abs. 4 Satz 2 BayHSchG). Gleiches gilt für die Wiederholungsfrist (Art. 81 ... |
|||
|
Source: Gugat, Martin - Mathematisches Institut, Friedrich-Alexander University Erlangen-Nürnberg |
|||
|
Collection: Mathematics |
|||
| 85 | Universitt Bremen Fachbereich 1 (Physik / Elektrotechnik) | ||
|
Summary: Nachweise gemäß § 4 Abs. 6 vorzulegen, 4. der Vorschlag zur Besetzung des Prüfungsausschusses nach § 9 Abs... Abs. 6 über die Eröffnung des Promotionsverfahrens und eröffnet im Fall der Zustimmung das Verfahren... Kandidaten (§ 8 Abs. 5) statt und wird durch ... |
|||
|
Source: Bormann, Ute - Fachbereich 3 - Mathematik und Informatik, Universität Bremen |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 86 | SOILS, SEC 3 REMEDIATION AND MANAGEMENT OF CONTAMINATED OR DEGRADED LANDS RESEARCH ARTICLE | ||
|
Summary: .9±0.0d 2 5.3±0.5b 155±67ab 7.8±1.4b 96.5±11.1e 30.5±4.1b 2.7±0.4c 1.5±0.5d 3 5.8±0.6b 142±78ab 5.3±1.1ab... .2±0.1b 5 5.1±0.1b 212±64ab 5.3±0.5a 48.8±11.0cd 26.3±3.0b 2.2±1.5c 0.4±0.2bc 6 7.3±0.7c 118±81ab ... |
|||
|
Source: Ma, Lena - Soil and Water Science Department, University of Florida |
|||
|
Collection: Environmental Sciences and Ecology ; Environmental Management and Restoration Technologies |
|||
| 87 | D I E N S T B L A T T DER HOCHSCHULEN DES SAARLANDES | ||
|
Summary: Studienzeiten auf die Regelstudienzeit zu entscheiden, 14. nach § 3 Abs. 6, § 8 Abs. 8, § 21 Abs. 7 sowie § 11... Studium erforder- lichen sonstigen Kenntnisse (§ 17 Abs. 6) erworben werden müssen. (5) Soweit im Ausland... , 5. nach § 12 ... |
|||
|
Source: Huber, Patrick - Technische Physik, Universität des Saarlandes |
|||
|
Collection: Physics ; Materials Science |
|||
| 88 | J. Great Lakes Res. 29(1):145156 Internat. Assoc. Great Lakes Res., 2003 | ||
|
Summary: 6.89 (0.48) c 7.87 (0.46) 12 Sept Frankfort, MI 6.09 (0.58) ab 7.11 (0.39) ac 8.35 (0.82) 13 Sept... July Grand Haven, MI 6.13 (0.35) c 6.82 (0.56) 7.80 (0.69) a 20 July Muskegon, MI 5.53 (0.75) ab 6... Bay, WI 5.22 (0.43) ab 6.34 (0.41) 8.30 ... |
|||
|
Source: Great Lakes Environmental Research Laboratory, NOAA |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 89 | RESOLUTION OF SINGULARITIES FOR 3-FOLDS IN POSITIVE CHARACTERISTIC | ||
|
Summary: in his book [Ab7] and the papers [Ab5], [Ab6], [Ab8] and [Ab9]. The entire proof is extremely long... .2 and 1.3 were first proven by Abhyankar in the book [Ab7], relying on material proven in ... |
|||
|
Source: Cutkosky, Dale - Department of Mathematics, University of Missouri-Columbia |
|||
|
Collection: Mathematics |
|||
| 90 | Amtliche Bekanntmachung Jahrgang 2006 / Nr. 6 | ||
|
Summary: . c) In Abs. 5 werden die Worte ,,über die Entwicklung der Sprache und" gestrichen. d) Abs. 6 Satz 2... Präsentation oder eines schriftlich vorgelegten Referats sowie einer schriftlichen Hausarbeit." e) Abs. 7 |
|||
|
Source: Ott, Albrecht - Physikalisches Institut, Universität Bayreuth |
|||
|
Collection: Physics ; Biology and Medicine |
|||
| 91 | Curriculum Vitae Sylvie Aude Demouchy | ||
|
Summary: -12/04/2001) EUG, Strasbourg, France: "Water Diffusion in Mantle Olivine". J. Conf. Abs. 6, 461. (Poster). Demouchy... . Abs. 7,1, 27. Demouchy S., and Mackwell S. (23/09/02) 2nd " Hydrospec" European Meeting, Vienna... in Olivine Crystal from Garnet-Peridotite Xenoliths in Basalts". Geophys. Res. ... |
|||
|
Source: Demouchy, Sylvie - Department of Geosciences, Université Montpellier II |
|||
|
Collection: Materials Science |
|||
| 92 | Hjemmesider . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4 Instituttets hjemmeside . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4 | ||
|
Summary: STITUT for InformATIonS- og medIevIdenSkAB 5 Foto:AU-Foto derfor læse mere om den forskning der foregår på... praktik- og jobopslag annonceres . #12;InSTITUT for InformATIonS- og medIevIdenSkAB6 fra Studieportalen er... ATIonS- og medIevIdenSkAB 7 Foto:AU-Foto det ... |
|||
|
Source: Aarhus Universitet, Department of Computer Science |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 93 | GE Healthcare Instructions 28-9331-02 AB | ||
|
Summary: 20 features twin vertical membranes for unparalleled speed. #12;28-9331-02 AB 5 2 Required equipment... ;28-9331-02 AB 7 Chemical Compatibility Vivaspin concentrators are designed for use with biological fluids... % 50,000 MWCO 27 min 96% 22 min 95% 100,000 MWCO 25 min 91% 20 min 90% #12;12 28-9331-02 ... |
|||
|
Source: Lebendiker, Mario - Wolfson Centre for Applied Structural Biology, Hebrew University of Jerusalem |
|||
|
Collection: Biotechnology ; Biology and Medicine |
|||
| 94 | Promotionsordnung Fachbereichs Wirtschaftswissenschaften | ||
|
Summary: über die Erfüllung der Anforderungen gemäß § 5 Abs. 5 Satz 2, 3. ein tabellarischer Lebenslauf, 4... Promotionskommission vertretenen Gutachterinnen oder Gutachter hinaus kann im Falle des § 11 Abs. 7 Satz 2 eine weitere... Promotionskommission entscheidet gemäß § 11 Abs. ... |
|||
|
Source: Siegen, Universität - Fachbereich Physik, Theoretische Physik 1 (Elementarteilchenphysik) |
|||
|
Collection: Physics |
|||
| 95 | Das Mitteilungsblatt erscheint jeweils am 1. und 3. Mittwoch jeden Monats. Eigentmer, Herausgeber, Vervielfltigung und Vertrieb: Universittsdirektion der Universitt Innsbruck, Innrain 52, A-6020 | ||
|
Summary: 1993 Hiemit berufe ich gemäß § 14 Abs. 3 UOG 1993 sowie § 18 Abs. 6 und § 32 Abs. 7 WO für Donnerstag... Ausführung; 2. sonstige vom Habilitationswerber gemäß § 28 Abs. 5 UOG vorgelegte wissenschaftliche Arbeiten... , Herrn Univ.-Ass. Dr. Christian MARKL ... |
|||
|
Source: Breu, Ruth - Institut für Informatik, Universität Innsbruck |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 96 | Alumni House, D-5 Andersen Auditorium (Haas School of Business), C-2 | ||
|
Summary: 1993 Hiemit berufe ich gemäß § 14 Abs. 3 UOG 1993 sowie § 18 Abs. 6 und § 32 Abs. 7 WO für Donnerstag... Ausführung; 2. sonstige vom Habilitationswerber gemäß § 28 Abs. 5 UOG vorgelegte wissenschaftliche Arbeiten... , Herrn Univ.-Ass. Dr. Christian MARKL ... |
|||
|
Source: Boyer, Elizabeth W. - Department of Environmental Science Policy and Management, University of California at Berkeley |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 97 | Codiernummer letzte nderung | ||
|
Summary: Beisitzer und Beisitzerinnen gilt § 4 Abs. 7 entsprechend. § 6 Anerkennung von Studienzeiten, Studien- und... Durchschnitt über 4,0 = nicht ausreichend. Abs. 5 gilt entsprechend. (5) Bei der Berechnung der... . Das Thema muss so beschaffen sein, dass es innerhalb der in ... |
|||
|
Source: Rannacher, Rolf - Institut für Angewandte Mathematik, Universität Heidelberg |
|||
|
Collection: Mathematics |
|||
| 98 | RAMIFICATION THEORY FOR HIGHER DIMENSIONAL LOCAL FIELDS | ||
|
Summary: theory of higher dimensional local fields. It comes from I.Zhukov's approach [Zh], [Ab5] to such a theory... dimensional local fields. In particular, the paper [Ab5] contains an explicit description of the ramification... the original local field. Complete proofs of announced Theorems 1 and 2 are given in ... |
|||
|
Source: Abrashkin, Victor - Department of Mathematical Sciences, University of Durham |
|||
|
Collection: Mathematics |
|||
| 99 | 2008 Wisconsin Turfgrass Research Reports | ||
|
Summary: June 17 June 25 July 1 July 8 Chickity Doo Doo 6.38 B 6.88 B 7.25 AB 6.75 AB 7.00 B Chickity Doo Doo (1... Turf Builder 7.38 A 7.50 A 7.63 A 6.88 AB 7.75 A Milorganite 6.13 B 6.50 BC 7.25 AB 6.75 AB ... |
|||
|
Source: Bent, Andrew F. - Department of Plant Pathology, University of Wisconsin at Madison |
|||
|
Collection: Biology and Medicine |
|||
| 100 | Measuring method for determining the reasons of magnetically caused structure-borne sound on | ||
|
Summary: June 17 June 25 July 1 July 8 Chickity Doo Doo 6.38 B 6.88 B 7.25 AB 6.75 AB 7.00 B Chickity Doo Doo (1... Turf Builder 7.38 A 7.50 A 7.63 A 6.88 AB 7.75 A Milorganite 6.13 B 6.50 BC 7.25 AB 6.75 AB ... |
|||
|
Source: Kulig, Stefan - Fakultät für Elektrotechnik und Informationstechnik, Universität Dortmund |
|||
|
Collection: Engineering |
|||