Home

About

Advanced Search

Browse by Discipline

Scientific Societies

E-print Alerts

Add E-prints

E-print Network
FAQHELPSITE MAPCONTACT US


  Topic List  Advanced Search  
Sample search results for: a2 15-prostaglandin dehydrogenase

Page:   2  3  4  5 
 
1 A quantitative method for assessing co-localization in immunolabeled thin section electron micrographs
 

Summary:  experiments were sheep anti-CpA, 2 lg mlÀ1 , or chicken anti-CpB, 0.6 lg mlÀ1 . Details of the double Fig. 1... tissue. Whether the subunits form A4 and B4 tetramers that interact, or form a mixture of A4 and A2B2... of five isozymes (i.e., A4, A3B, A2B2, AB3, and ...

  

Source: Anderson, James B. - Department of Chemistry, Pennsylvania State University

 

Collection: Chemistry

 
2 The Central Enzymes of the Aspartate Family of Amino Acid
 

Summary:  bifunc- tional enzyme (Table 5). The remaining portion of the thrA gene, called thrA2, consists... , this region was removed from the monofunc- tional HDH. This gene fragment, called thrA2, encodes for only... that encodes for the monofunctional AK III with the thrA2 ...

  

Source: Viola, Ronald - Department of Chemistry, University of Toledo

 

Collection: Chemistry ; Biology and Medicine

 
3 Pyruvate dehydrogenase from Azotobacter vinelandii Properties of the N-terminally truncated enzyme
 

Summary:  exists both as a homodimer (a2) or a heterotetramer (a2b2) depending on the source and type of complex... Pyruvate dehydrogenase from Azotobacter vinelandii Properties of the N-terminally truncated enzyme... Sciences, Laboratory of Biochemistry, Wageningen University, the Netherlands The ...

  

Source: Kassen, Rees - Department of Biology, University of Ottawa

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
4 THEJOURNAL OF BIOLOGICALCHEMISTRY Vol. 258, No. 18,Issue of September25, pp. 10839-10845,1983
 

Summary:  = 1.994,exhibited nuclear hyperfine interactionwith two equivalent pro- tons (A, = 0.45, A2 = 0... /S signals from M. formicicum formatedehydrogenase EPR species g1 g2 g3 %Moa 'H" AI A2 A3 AI A2 A3 A', A'z A... 'B AI A2 A3 ...

  

Source: Ferry, James G. - Department of Biochemistry and Molecular Biology, Pennsylvania State University

 

Collection: Biology and Medicine

 
5 Production and Characterization of Bifunctional Enzymes. Domain Swapping To Produce New Bifunctional Enzymes in the Aspartate Pathway
 

Summary:  fragment encoding for the AK catalytic domain; thrA2, gene fragment encoding for the HDH catalytic domain... . Overexpression and purification of this domain, from this thrA2 + fragment, led to a highly active monofunctional... . The thrA2 + fragment encoding for HDH ...

  

Source: Viola, Ronald - Department of Chemistry, University of Toledo

 

Collection: Chemistry ; Biology and Medicine

 
6 Abiotic stress series: The ALDH gene superfamily of
 

Summary:  Ahy AAL33906 Sli P28237 ALDH10A2 Bvu P17202 ALDH10A7 Sol P42757 ALDH10A3 Aho AAM19157 Ace AAM08913 Apr... Aldehyde dehydrogenases (ALDHs) represent a protein superfamily of NAD(P)C -dependent enzymes that oxi... by the superfamily of NAD(P)C -dependent aldehyde dehydrogenases [aldehyde:NAD(P)C ...

  

Source: Schnable, Patrick S. - Center for Plant Genomics & Department of Genetics, Development and Cell Biology, Iowa State University

 

Collection: Biology and Medicine ; Biotechnology

 
7 JOURNAL OF BACTERIOLOGY, Jan. 2006, p. 450455 Vol. 188, No. 2 0021-9193/06/$08.00 0 doi:10.1128/JB.188.2.450455.2006
 

Summary:  (GAACTCGGT TACAACGTTG) and FrdA2 (GTCACCATGCTGCGGAATGC) and labeled with [ -32 P]dCTP (New England Nuclear... to the fumarate reductase of Wolinella succinogenes and the succinate dehydrogenase of Bacillus subtilis. Mutation... dehydrogenase activity and did not grow with acetate as the electron donor and ...

  

Source: Lovley, Derek - Department of Microbiology, University of Massachusetts at Amherst

 

Collection: Environmental Management and Restoration Technologies ; Biology and Medicine

 
8 electronic reprint Acta Crystallographica Section D
 

Summary:  No. of molecules in asymmetric unit 4 Wilson B factor (A° 2 ) 22.2 Rwork/Rfree (%) 20.7/22.6 No... . of atoms Protein 11365 Ligands 208 DTT 24 Waters 920 Average B factors (A° 2 ) Protein 20.4 Ligands 16... -4449 Editors: E. N. Baker and Z. Dauter Structural characterization of tartrate ...

  

Source: Viola, Ronald - Department of Chemistry, University of Toledo

 

Collection: Chemistry ; Biology and Medicine

 
9 The X-ray structure of the NAD-dependent 5,10-methylenetetrahydrofolate dehydrogenase
 

Summary:  -Helix Residues b-Strand Residues A1 9­15 a 6­8 A2 17­31 b 37­43 B 47­63 c 67­73 C 76­88 d 94­98 D 104­113 e 179... The X-ray structure of the NAD-dependent 5,10-methylenetetrahydrofolate dehydrogenase from... or more NADP-dependent methylene-THF dehydrogenases as part of multifunctional enzymes. In ...

  

Source: Robertus, Jon D.- Center for Structural Biology & Department of Chemistry and Biochemistry, University of Texas at Austin

 

Collection: Biology and Medicine

 
10 >90 75-90 50-75 <50 BLASTX IPR Annotation COG Description COG class
 

Summary:  4642 0 30154 X 21 160446 160964 morn repeat MORN motif Testis-specific gene A2 protein Uncharacterized... 265765 267897 chr_7 1949641 1951869 acyl-dehydrogenase Protein of unknown function DUF1974 Acyl... -coenzyme A dehydrogenase Acyl-CoA dehydrogenases Lipid metabolism 32143 COG1960 239 ...

  

Source: Lopez, Pascal Jean - Département de Biologie, École Normale Supérieure

 

Collection: Biology and Medicine

 
11 THE UNIVERSITY OF MANITOBA December 8, 2008 1:30 pm -3:30 pm Page 1 of 14
 

Summary:  pKa of formic acid is 3.75). The resulting mixture has a pH close to: A) 2 B) 3 C) 4 D) 5 E) 6 6... ) Glyceraldehyde A) 2 & 4 B) 3, 4 & 5 C) 3 & 4 D) 1 & 2 E) 1, 2, & 5 19. Identify the following compounds: i CH2OH... of pyruvate is catalyzed by: A) Glyceraldehyde-3-phosphate ...

  

Source: O'Neil, Joe - Department of Chemistry, University of Manitoba

 

Collection: Biology and Medicine ; Chemistry

 
12 Plant Molecular Biology 35: 355365, 1997. 355 c 1997 Kluwer Academic Publishers. Printed in Belgium.
 

Summary:  , a translation- al fusion of eIF-4A2 in pET-3A was used. Aldehyde dehydrogenase activity was determined... disulfiram blocks the aldehyde dehydrogenase activity. E. coli overexpressing eIF-4A2 was used as a negative... with an antibody raised against ...

  

Source: Kuhlemeier, Cris - Institut für Pflanzenwissenschaften, Universität Bern

 

Collection: Biology and Medicine

 
13 Activity, Stability and Structural Studies of Lactate Dehydrogenases Adapted to
 

Summary:  within the loop J- 1G (Fig. 6a). (2) In the apo form of SaLDH (Fig. 6b), residues K220, D224, K226 and K... Activity, Stability and Structural Studies of Lactate Dehydrogenases Adapted to Extreme Thermal... ; accepted 18 September 2007 Available online 22 September 2007 Lactate dehydrogenase (LDH) catalyzes

  

Source: Glover, Mark - Department of Biochemistry, University of Alberta

 

Collection: Biology and Medicine

 
14 BioMed Central Page 1 of 10
 

Summary:  ) or by phospholipase A2-generated lysophospholip- ids, the purification procedures were based on combined... -hydroxybutyrate dehydrogenase from Jaculus orientalis Driss Mountassif1,2, Pierre Andreoletti1, Zakaria El Kebbaj2... major ketone bodies), is catalyzed by D-3-hydroxybutyrate dehydrogenase (BDH1: EC ...

  

Source: Ecole Polytechnique, Centre de mathématiques

 

Collection: Mathematics

 
15 Biochem. J. (2004) 381, 131136 (Printed in Great Britain) 131 Biosynthesis of UDP-GlcA, a key metabolite for capsular polysaccharide
 

Summary:  .1 0.1 + - 0.01 C278A ­ ­ ­ R43A 5.5 + - 0.2 × 10-3 0.4 + - 0.03 0.8 + - 0.2 R348A 2.8 + - 0.1 × 10-2 0... -glucose dehydrogenase catalyses the conversion of UDP- glucose into UDP-GlcA, a critical precursor for glycan synthesis... . Key words: capsule, Cryptococcus neoformans, pathogenic fungi, UDP-GlcA, UDP-glucose ...

  

Source: Doering, Tamara - Department of Molecular Microbiology, Washington University in St. Louis

 

Collection: Biology and Medicine

 
16 Nature Macmillan Publishers Ltd 1998 letters to nature
 

Summary:  NOVEMBER 1997 367 3 amt nhe2 Na+ H+ hemUV NH4+ 3 feoB trkAH Fe3+ Fe2+ K+ Na+ H+ napA 2 Mg2+ corA Cu2... -CoA fadE (acd) [12] fad [5] hbd [10] Acyl-CoA(-2)* -oxidationcycle Dihdroxyacetone-P glpK Glycerol glpA 3... novo Purine Biosynthesis Ribose-5-P PRPP Histidine prsA ...

  

Source: Badger, Jonathan - Institute for Genomic Research, Rockville

 

Collection: Biotechnology ; Biology and Medicine

 
17 Appl Microbiol Biotechnol (1995) 44:27--36 Springer-Verlag 1995 ORIGINAL PAPER
 

Summary:  : x"(A2P\A)\A2P\r. For strictly intracellular metabolites the pseudo-steady-state assumption... on the intracellular concentrations of the gluta- mate dehydrogenase reactants, as well as the redox state... on nitrogen metabolism and the flux through glutamate ...

  

Source: Sinskey, Anthony J. - Department of Biology, Massachusetts Institute of Technology (MIT)

 

Collection: Biology and Medicine

 
18 Title: Structural Features That Stabilize Halophilic Malate Dehydrogenase from an Archaebacterium
 

Summary:  Title: Structural Features That Stabilize Halophilic Malate Dehydrogenase from an Archaebacterium... -resolution structure of halophilic malate dehydrogenase (hMDH) from the archaebacterium Haloarcula marismortui... that contribute to the stabilization of thermophilic lactate dehydrogenase and thermophilic MDH-the incorporation

  

Source: Sussman, Joel L. - Department of Structural Biology, Weizmann Institute of Science

 

Collection: Biology and Medicine

 
19 Energy metabolism in the tropical abalone, Haliotis asinina Linn: Comparisons with temperate abalone species
 

Summary:  Crawling Righting Control Crawling Righting Arginine phosphate 7.95±3.08 1.17±1.62a 2.91±1.79a 3.61±1.96 0... -lactate dehydrogenase as the predominant pyruvate reductases, and low intracellular pH buffering capacities... Cl2, 2 mmol l- 1 KCL, 1 mmol l-1 dithio- threitol, excess glucose 6-phosphate ...

  

Source: Donovan, Deborah - Department of Biology, Western Washington University

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
20 Structure Determination of the Glutamate Dehydrogenase from the Hyperthermophile
 

Summary:  . (1975). Stereochemical basis of heat stability in bacterial ferredoxins and in haemo- globin A2. Nature... Structure Determination of the Glutamate Dehydrogenase from the Hyperthermophile Thermococcus... dehydrogenase catalyses the oxidative deamination of gluta- mate to 2-oxoglutarate with concomitant ...

  

Source: Vetriani, Costantino - Institute of Marine and Coastal Sciences and Department of Biochemistry and Microbiology, Rutgers University

 

Collection: Environmental Sciences and Ecology


Page:   2  3  4  5 
Page:   1  2  3  4  5 
 
21 Functional Neighbors: Inferring Relationships between Non-Homologous Protein Families Using Family-Specific Packing Motifs
 

Summary:  RNA-binding domain (54768) Thiolase-related (53902) -12 EGF/Laminin Vertebrate phospholipase A2 (48623) -7 (57196... : S Phospholipase A2, PLA2; 46626: S Cytochrome c; 54292: S 2Fe-2S ferredoxin-like; 50494: S Trypsin-like serine... relationship between alcohol dehydrogenases (EC family in ...

  

Source: Huan, Jun "Luke" - Information and Telecommunication Technology Center & Department of Electrical Engineering and Computer Science, University of Kansas; Prins, Jan - Department of Computer Science, University of North Carolina at Chapel Hill; Wang, Wei - Department of Computer Science, University of North Carolina at Chapel Hill

 

Collection: Biology and Medicine ; Computer Technologies and Information Sciences

 
22 Chemico-Biological Interactions 130132 (2001) 499525 The aldo-keto reductase (AKR) superfamily: an
 

Summary:  .1.1.188)5A2 Pseudomonas putidaMorphine dehydrogenase (EC 1.1.1.218) Q021985B 2,5-diketo-D-gluconic acid... SchizosaccharomycesPyridoxal reductase T409238A2 pombe 9A1 Emericella nidulans Q00727Sterogmatocystin dehydrogenase... -- StcV ...

  

Source: Jez, Joseph - Department of Biology, Washington University in St. Louis

 

Collection: Biology and Medicine

 
23 Molecular Microbiology (2005) 55(1), 2738 doi:10.1111/j.1365-2958.2004.04398.x 2004 Blackwell Publishing Ltd
 

Summary:  the sequence specific oligonucle- otides A1 and A2 containing HindIII and BamHI restriction sites and a plasmid... GCGCAAGCTTATGTCCATAGAAACCATTAAAGTACC Anti-sense CGCGGGATCCTTAACAATCAATTAACATTAGATTAGG A1 Sense GCGCAAGCTTATGGTCATAAGGCAAAATATTAAAC A2... with the sequence specific oligonucleotides A_exp and ...

  

Source: McFadden, Geoff - School of Botany, University of Melbourne

 

Collection: Environmental Sciences and Ecology

 
24 THE UNIVERSITY OF MANITOBA DATE: Dec. 17, 2001 Final EXAMINATION
 

Summary:  lactic acid. (The pK of lactic acid is 4.1). The resulting mixture has a pH close to: A) 2 B) 3 C) 4 D) 5... molecule of glucose are formed by substrate level phosphorylation? A) 2 B) 4 C) 6 D) 30 E) 32 42... H of the solution? A) 2.3 B) 4.3 C) 7.0 D) 8.8 E) 10.8 ...

  

Source: O'Neil, Joe - Department of Chemistry, University of Manitoba

 

Collection: Biology and Medicine ; Chemistry

 
25 Eur. J. Biochem. 255, 336 346 (1998) FEBS 1998
 

Summary:  guide. mately 2100 A° 2 . Cluster 1 is the most extensive ion-pair network in Pf Glu... in bacterial ferredoxins and in haemoglobin A2, Nature 255, P. J., Sedelnikova, S. E., Engel, P. C., Pasquo, A... stability from the analysis of ion-pair networks in the Glutamate Dehydrogenase ...

  

Source: Vetriani, Costantino - Institute of Marine and Coastal Sciences and Department of Biochemistry and Microbiology, Rutgers University

 

Collection: Environmental Sciences and Ecology

 
26 SAGE-Hindawi Access to Research Journal of Amino Acids
 

Summary:  by a conserved hydrophobic -sheet and complemented by the helical subdomain to create over 3400 °A 2 of buried... of the dimer interface with about 2600 °A 2 of total buried surface area. A 48-amino acid deletion in mj... has a much smaller dimer interface of about 2000 °A ...

  

Source: Viola, Ronald - Department of Chemistry, University of Toledo

 

Collection: Chemistry ; Biology and Medicine

 
27 8150 Biochemistry 1986, 25, 8150-8 155 Inactivation of Formate Dehydrogenase from Methanobacterium formicicum by
 

Summary:  .45, A2 = 0.55, and A3 = 0.5 mT), identified by 2Hsubstitution. Incubation of oxidized formate... .05, A2 = 0.85, and A3 = 0.88 mT, respectively. In addition, cyanide treatment altered the behavior... 8150 Biochemistry 1986, 25, 8150-8 155 Inactivation of Formate Dehydrogenase from ...

  

Source: Ferry, James G. - Department of Biochemistry and Molecular Biology, Pennsylvania State University

 

Collection: Biology and Medicine

 
28 Proteome of Methanosarcina acetivorans Part I: An Expanded View of the Biology of the Cell
 

Summary:  for the identification of paralogs of the R subunit (CdhA) of CO dehydrogenase/acetyl-CoA synthase that were contained... predicted to encode the five subunits of CO dehydrogenase/acetyl-CoA synthase, for which the products of MA... -dehydrogenase Q 27,815 5.99 430 34 MA0110 proliferating cell nuclear antigen L 26,659 4.55 375 ND ...

  

Source: Ferry, James G. - Department of Biochemistry and Molecular Biology, Pennsylvania State University

 

Collection: Biology and Medicine

 
29 Structure, Vol. 12, 559567, April, 2004, 2004 Elsevier Science Ltd. All rights reserved. DOI 10.1016/j.str.2004.03.007 Crystal Structure of Phosphotransacetylase
 

Summary:  .2, and 47.8 A° 2 , respectively. In contrast, the D monomer shows a con-to an R factor of 0... factor of 67.0 A° 2 and is not as well defined. Each monomer contains one cis-peptidethe asymmetric unit... ,2/1,3-bonded main chain atoms (A° 2 ) 0.86/1.64 ...

  

Source: Ferry, James G. - Department of Biochemistry and Molecular Biology, Pennsylvania State University

 

Collection: Biology and Medicine

 
30 RESEARCH ARTICLE Functional analysis of the nuclear proteome of human
 

Summary:  .22 21396489 Lon protease-like 1.50E-09 14 6 107 631472 Translation initiation eIF-4A2 homolog 9.30E-07 28 6... .25 4757756 Annexin A2 5.80E-05 30 7.7 38.81 7706485 Heat shock protein 75 2.20E-04 17 8.2 80.28 18645167... Annexin A2 4.40E-04 28 7.7 38.79 18089095 ...

  

Source: Wood, James B. - Bermuda Biological Station for Research

 

Collection: Environmental Sciences and Ecology

 
31 Steroid recognition and regulation of hormone action: crystal structure of testosterone and NADP+ bound to 3 -hydroxysteroid/
 

Summary:  liver aldehyde reductase AKR1A1 41 65 Aldehyde reductase Porcine aldehyde reductase AKR1A2 41 65... + bound to 3 -hydroxysteroid/ dihydrodiol dehydrogenase Melanie J Bennett1, Ross H Albert1, Joseph M Jez1... , Haiching Ma2, Trevor M Penning2 and Mitchell Lewis1* Background: Mammalian 3 -hydroxysteroid ...

  

Source: Jez, Joseph - Department of Biology, Washington University in St. Louis

 

Collection: Biology and Medicine

 
32 GENOMICS 6.89-93 (1990) The Locus for the Medium-Chain Acyl-CoA Dehydrogenase Gene
 

Summary:  .91 10 6 11 16 01 32 x: = 2.82 10 16 11 19 01 4 X: = 0.23 10 25 11 12 01 6 x: = 2.48 Symbol Al: A2: Bl: B... .8 a.2 5.1 0.120 9.85 0.07-0.18 DlS2-DlS17 -00 -0.6 3.2 4.3 4.1 2.8 0.144 4.56 0.07-0.25 Maximum 0 lod... GENOMICS 6.89-93 (1990) The Locus for the Medium-Chain Acyl-CoA ...

  

Source: Kidd, Kenneth - Department of Genetics, Yale University

 

Collection: Biology and Medicine

 
33 Rate-promoting vibrations and coupled hydrogenelectron transfer reactions in the condensed phase: A model for enzymatic catalysis
 

Summary:  to a symmetric double well: Vs s as4 bs2 b2 /4a. 2.3 That potential is broken into two pieces, left and right... dehydrogenases and soybean lipoxygenase. Consistent with earlier results, turning off the promoting vibration... the PPV model. Antoniou and Schwartz calculated KIEs and tunneling indicators13 in alcohol ...

  

Source: Schwartz, Steven D. - Department of Physiology and Biophysics, Albert Einstein College of Medicine, Yeshiva University

 

Collection: Biology and Medicine

 
34 Effects of anoxia exposure and aerobic recovery on metabolic enzyme activities in the freshwater
 

Summary:  Center, Boston, MA 02115, U.S.A. 2 Present address: Surgical Research Laboratory, Department of Surgery... dehydrogenase and glutamate-oxaloacetate transaminase in heart, glutamate dehydrogenase and serine dehydratase... in brain, and 3-hydroxyacyl-CoA dehydrogenase in red mus- cle. ...

  

Source: Storey, Kenneth B. - Departments of Biology & Chemistry, Carleton University

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
35 Divergence time estimates for the early history of animal phyla and the origin of plants,
 

Summary:  , animals and fungi divergence time (Ma)a gamma correction (aX) gamma correction (a2) number of genes... times using gene-speci¢c shape parameters (aX) and a ¢xed shape parameter (a2) are shown. 0 2 4 6 8 10... ¢dence value for this relationship was 499% in a neighbour-joining analysis (gamma distance; ...

  

Source: Hedges, S. Blair - Department of Biology, Pennsylvania State University; Kumar, Sudhir - Department of Biology, Arizona State University; Nei, Masatoshi - Department of Biology, Pennsylvania State University

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
36 Hidden Markov Model Analysis of Motifs in Steroid Dehydrogenases and their Homologs
 

Summary:  Hidden Markov Model Analysis of Motifs in Steroid Dehydrogenases and their Homologs William N... ­MEME on a family of dehydrogenases that includes mammalian 11fi­ hydroxysteroid and 17fi... ­hydroxysteroid dehydrogenase and their homologs in the short chain alcohol dehydrogenase family. We chose this dataset ...

  

Source: Bailey, Timothy L. - Institute for Molecular Bioscience, University of Queensland

 

Collection: Biotechnology

 
37 THE UNIVERSITY OF MANITOBA DATE: Dec. 19, 2000 Final EXAMINATION
 

Summary:  K of lactic acid is 4.1). The resulting mixture has a pH close to: A) 2 B) 3 C) 4 D) 5 #12;THE UNIVERSITY... of the substrate. 4) Lineweaver-Burk modification of the data to give a double reciprocal plot. A) 2 and 3 B) 1, 2... , and FADH together, all at 1 M concentrations and in the presence of succinate ...

  

Source: O'Neil, Joe - Department of Chemistry, University of Manitoba

 

Collection: Biology and Medicine ; Chemistry

 
38 Molecular, biochemical and functional characterization of a Nudix hydrolase protein that stimulates activity of a nicotinoprotein alcohol
 

Summary:  (T/C)GA(A/G)GA(A/G)AA (A/G)AC-3', and A2: 5'-GGCTGATCATC (C/T/A)AC(T/C)TG(T/C)AA(T/C)TT(C/T/A)AC (C/T/A)AC-3', were based... of primers A1/A2, with B. methanolicus chromosomal DNA as template, in pBlueScriptIIKS (Stratagene, Westburg... BlueScriptIIKS and transformed to E. coli MC1061. This partial gene ...

  

Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution,

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
39 Fish Physiology and Biochemistry 28: 197198, 2003. 2004 Kluwer Academic Publishers. Printed in the Netherlands.
 

Summary:  in the Netherlands. 197 Enzymatic activity of 11-hydroxysteroid dehydrogenase in rainbow trout (Oncorhynchus mykiss... -hydroxysteroid dehydrogenase (11-HSD) from rainbow trout testis and head kidney. Homology search suggested... . The results demonstrated that rt11-HSD is predominantly a 11-dehydrogenase, a homologue of mammalian ...

  

Source: Young, Graham - School of Aquatic and Fishery Sciences, University of Washington at Seattle

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
40 Hidden Markov Model Analysis of Motifs in Steroid Dehydrogenases and their Homologs
 

Summary:  Hidden Markov Model Analysis of Motifs in Steroid Dehydrogenases and their Homologs William N... datasets. We demonstrate Meta-MEME on a family of dehydrogenases that includes mammalian 11... - hydroxysteroid and 17 -hydroxysteroid dehydrogenase and their homologs in the short chain alcohol dehydrogenase

  

Source: Noble, William Stafford - Department of Genome Sciences, University of Washington at Seattle

 

Collection: Biology and Medicine ; Biotechnology


Page:   1  2  3  4  5 
Page:   1  2  3  4  5 
 
41 Author's personal copy Key enzymes of the retinoid (visual) cycle in vertebrate retina
 

Summary:  of A2E, a product of all-trans- retinal conjugation with phosphatidylethanolamine, no significant... 22 March 2011 Available online 5 April 2011 Keywords: RPE65 Retinol dehydrogenase Visual cycle... , short-chain dehydrogenases/reductases and carotenoid/retinoid isomerases/oxygenases. This article

  

Source: Palczewski, Krzysztof - Department of Pharmacology, Case Western Reserve University

 

Collection: Biology and Medicine

 
42 Experimental Biology Online (EBO) 2000 5 : 1 Springer-Verlag 2000 Kyra J. Cowan1
 

Summary:  percentage of membrane-bound active PKC during estivation.Activities of protein phosphatase types 1, 2A, 2B... ]phosphorylase a per minute at 22°C. Protein phosphatase types-2A,-2B,and -2C Tissues were homogenized 1:10 w... Control 18.4±1.14 16.7±3.54 48.5±6.05 46.6±5.7 Estivated ...

  

Source: Storey, Kenneth B. - Departments of Biology & Chemistry, Carleton University

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
43 http://jbx.sagepub.com/ Journal of Biomolecular Screening
 

Summary:  SFL (a 2.6% hit rate) and 8 from the DMSO-soluble OFL (a 2.1% hit rate). In most cases, the observed... semialdehyde dehydrogenases (ASADHs) catalyzes the same reaction and each shares identical active site... semialdehyde dehydrogenase, antibiotic development, ...

  

Source: Viola, Ronald - Department of Chemistry, University of Toledo

 

Collection: Chemistry ; Biology and Medicine

 
44 Computational and Experimental Analysis of Redundancy in the Central Metabolism
 

Summary:  /À/À þ/þ/þ þ/þ/þ MDH1 [2/1/2a ] À/À/À þ/þ/þ þ/þ/þ [2/1/2d ] [2/1/2d ] þ/þ/þ þ/þ/þ [2/1/2a ] [2/1/2d ] þ... chloride, 0.01 mM calcium chloride, 0.3 mM thiamine pyrophosphate, 0.12 mM coenzyme A, 2.0 mM NAD, and 5 m... for the activity of the malate dehydrogenase ...

  

Source: Lovley, Derek - Department of Microbiology, University of Massachusetts at Amherst

 

Collection: Environmental Management and Restoration Technologies ; Biology and Medicine

 
45 Activation of dioxin response element (DRE)-associated genes by benzo(a)pyrene 3,6-quinone and benzo(a)pyrene 1,6-quinone in
 

Summary:  of BaP by cytochrome P450s (CYP1A1, CYP1A2, and CYP1B1) and epoxide hydrolase (EPHX1). BPDE binds to DNA... .6 5.3 7.9 205623_at ALDH3A1 Aldehyde dehydrogenase 3 family, memberA1 6.2 5.7 6.7 201467_s_at NQO1 NAD... (P)H dehydrogenase, quinone 1 5.5 3.4 7.7 209921_at SLC7A11 Solute carrier family 7 (cationic ...

  

Source: Oprea,Tudor I. - Department of Biochemistry and Molecular Biology, University of New Mexico

 

Collection: Biology and Medicine

 
46 Chemico-Biological Interactions 130132 (2001) 659671 Engineering steroid hormone specificity into
 

Summary:  and b2 ­a2) in the (a/b)8 barrel motif. These five loops contribute ten residues that form points... CLoopa b1­a1 b2­a2 54 55 117 118 129 226 227 306 31024 Yb Lb T Hb Fb Rat liver F T Wb N Y 3a-HSD MFCYLFb... these chimeras the two small loops b1 ­a1 and b2 ­a2 ...

  

Source: Jez, Joseph - Department of Biology, Washington University in St. Louis

 

Collection: Biology and Medicine

 
47 Statistical approaches to protein matching in Bioinformatics
 

Summary:  A Computational Cost 174 A.1 Processor Times . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 174 A.2... pair into optimal superposition. iii. Find rotation A2 to superpose the third pair. iv. Thus got xjl... = A1A2µil + b, l = 1, . . . , 3. Matching ...

  

Source: Haase, Markus - Elektrotechniek, Wiskunde en Informatica, Technische Universiteit Delft

 

Collection: Mathematics

 
48 Bistability in the Isocitrate Dehydrogenase Reaction: An Experimentally Based Theoretical Study
 

Summary:  is given as Eq. A2 in Appendix 2. Plotted in Fig. 10 is the value of the critical time t* computed... according to Eqs. 7 and A2 as a function of the IDH concentration, for three distinct concentrations of di... * on the total concentration of substrate, Z. The theoretical curves are obtained by means of Eq. ...

  

Source: Goldbeter, Albert - Faculté des Sciences, Université Libre de Bruxelles

 

Collection: Biology and Medicine

 
49 A New Branch in the Family: Structure of Aspartate-b-semialdehyde Dehydrogenase from
 

Summary:  Most favored (%) 90.2 Allowed (%) 9.8 Disallowed (%) 0 Average B-factor (A° 2 ) 32.2 rmsd from ideal... containing two short helices (a2 and a3) that drapes over the coenzyme-binding site (Figure 1), in contrast... thermostability mjASADH vcASADH hiASADH ecASADH Resolution (A° ) ...

  

Source: Viola, Ronald - Department of Chemistry, University of Toledo

 

Collection: Chemistry ; Biology and Medicine

 
50 Hierarchically-Structured Biofuel Cell Anodes
 

Summary:  -porosity scaffolds to improve enzyme activity and mass transport of malate dehydrogenase bioelectrodes. Results... suggest that the hydrophobically-modified chitosan can alter catalytic activity of malate dehydrogenase

  

Source: Hawaii Natural Energy Institute

 

Collection: Renewable Energy

 
51 The Stereoselectivity and Catalytic Properties of Xanthobacter autotrophicus 2-[(R)-2-Hydroxypropylthio]ethanesulfonate Dehydrogenase Are Controlled by
 

Summary:  .058 ( 0.002 52 ( 4 0.027 0.52 R152A 2.9b 27b 1.4 52 0.059 ( 0.001 41 ( 3 0.028 0.68 R179A NDc ND ND ND R... -Hydroxypropylthio]ethanesulfonate Dehydrogenase Are Controlled by Interactions between C-Terminal Arginine Residues... Ved March 24, 2004 ABSTRACT: 2-[(R)-2-Hydroxypropylthio]ethanesulfonate (R-HPC) ...

  

Source: Ensign, Scott - Department of Chemistry and Biochemistry, Utah State University

 

Collection: Chemistry

 
52 Multiple Protein Sequence Alignment From Tertiary Structure Comparison: Assignment of Global and
 

Summary:  -treptomycesgriseustrypsin lsGT 228 l.z0 0.16 bB S.griseusproteinaseA 2SGA 1g1 l.b0 0.13 54 S.griseasproteinaseB 3SGB(E) 18b 1... agteement with published structural accounts within the dehydrogenase fold do. mains, globins, and serine... refined (e.g., see Dehydrogenase Fold Do- mains below). A threshold ...

  

Source: Barton, Geoffrey J. - Division of Biological Chemistry and Molecular Microbiology, University of Dundee

 

Collection: Biotechnology

 
53 A Structural Perspective on Enzymes Activated by
 

Summary:  (5-0-1) 32 Na -activated Type II Factor Xa 1P0S, 2BOK 6 (4-2-0) 41 Thrombin 1A2C, 1A46, 1A4W, 1A5G, 1... and is assisted by Mg2 , which anchors all three P groups of ATP. Branched chain -ketoacid dehydrogenase kinase... (13) and pyruvate dehydrogenase kinase (14) use a similar K -Mg2 tandem, whereas the ...

  

Source: Di Cera, Enrico - Department of Biochemistry and Molecular Biology, Saint Louis University School of Medicine

 

Collection: Biology and Medicine

 
54 Biochem. J. (1997) 326, 625636 (Printed in Great Britain) 625 REVIEW ARTICLE
 

Summary:  (liver) ALR (AKR1A1) 42 Por-ALR Sus scrofa ALR (AKR1A2) 43 Rat-ALR Rattus norvegicus (liver) ALR (AKR1A3... reductase (AKR4A2) 12 Gly-PKR Glycyrrhiza echinata Polyketide reductase (AKR4A3) 51 Lei-putRed Leishmania... reductases, aldehyde reductases, hydroxysteroid dehydro- genases and dihydrodiol ...

  

Source: Jez, Joseph - Department of Biology, Washington University in St. Louis

 

Collection: Biology and Medicine

 
55 WASHINGTON UNIVERSITY Division of Biology and Biomedical Sciences
 

Summary:  to domain shuffling, see below). An example of a gene arisen by internal duplications is the a2 type I... ? ...............................................................119 4.5.2.2.2 RIO analysis of lactate/malate dehydrogenase family members... ). ...

  

Source: Eddy, Sean - Janelia Farm Research Campus, Howard Hughes Medical Institute

 

Collection: Biology and Medicine

 
56 RReeffeerreenncceess References
 

Summary:  in alcohol dehydrogenase activity in vitro in flies from natural populations of Drosophila melanogaster... . Genetica 67: 13-19. ASHBURNER, M., 1998 Speculations on the subject of alcohol dehydrogenase and its... and alcohol dehydrogenase (ADH) activity in Drosophila melanogaster: Selection, genotype and sex effects

  

Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution,

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
57 ELECTROPHORETIC INVESTIGATION OF THE FAMILY SCORPAENIDAE ALLYN G. JOHNSON, FRED M. UTTER, AND HAROr..o O. HODGINS'
 

Summary:  are shown; 1, 4 Sebastolobus alascanus (A), 2, 5 Sebastes helvomac- ulatus (B), and 3, 6 Sebastes alutu... species are shown: 1, 4 Sebastolobu8 alascanus (A'), 2, 5 Sebastes catwiuus (A), and 4, 6 Sebastes reedi... ), 2 Sebastolobus alascanus (A-5, 7), Sebastes marinus ...

  

Source: National Oceanic and Atmospheric Administration (NOAA), Fishery Bulletin

 

Collection: Environmental Sciences and Ecology

 
58 Abbreviations LIST OF ABBREVIATIONS (in alphabetical order)
 

Summary:  dehydrogenase Glc, glucose HAD, haloacid dehalogenase HPr, histidine protein HPr-His-P, HPr phosphorylated... Bacteria LDH, lactate dehydrogenase NAD+ , nicotinamide adenine nucleotide NADH, dihydronicotinamide... adenine dinucleotide NMR, Nuclear Magnetic Resonance #12;Abbreviations 152 PDH, pyruvate dehydrogenase PEP

  

Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution,

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
59 /LVWRISXEOLFDWLRQV List of publications
 

Summary:  of the kstD JHQH HQFRGLQJ D NHWRVWHURLG û1 - dehydrogenase isoenzyme of Rhodococcus erythropolis strain SQ1... -dehydrogenase, in Rhodococcus erythropolis SQ1 using sacB as counter-selectable marker. FEMS Microbiol. Lett... -dehydrogenase isoenzyme. Microbiology 148:3285-3292. 5. Van der Geize R., G.I. Hessels, L. Dijkhuizen. ...

  

Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution,

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
60 Lactate Dehydrogenase Undergoes a Substantial Structural Change to Bind its Substrate
 

Summary:  ¼ 4500 (6500) A° 2 for the measured heat capacity in aqueous solution (Fig. 3 B) determined above, DCp... and TMAO solutions yields a DASA of 9700 (61500) A° 2 (0.25 urea), 4500 (6500) A° 2 (buffer alone... ), and 2800 (6400) A° ...

  

Source: Callender, Robert - Department of Biochemistry, Albert Einstein College of Medicine, Yeshiva University

 

Collection: Biology and Medicine


Page:   1  2  3  4  5 
Page:   1  2  3  4  5 
 
61 THE UNIVERSITY OF MANITOBA December 12, 2005 1:30pm -3:30pm Page 1 of 14
 

Summary:  monosaccharides are not aldoses? 1) ribose 2) galactose 3) fructose 4) dihydroxyacetone 5) erythrose A) 2 & 4 B) 3... (s) 4. Ethanolamine 5. Sphingosine A) 2, 3, 4 and 5 B) 1 & 5 only C) 4 and 5 only D) 2 and 3. E) 1, 2... in the complementary strand. A) 2 ...

  

Source: O'Neil, Joe - Department of Chemistry, University of Manitoba

 

Collection: Biology and Medicine ; Chemistry

 
62 Molecular Microbiology (2005) 55(1), 3953 doi:10.1111/j.1365-2958.2004.04407.x 2004 Blackwell Publishing Ltd
 

Summary:  .2.4.1) and decarboxylates pyruvate (see Fig. 1). It usually occurs as a heterotet- ramer (a2b2) of distinct E1a and E1b... falciparum has only one pyruvate dehydrogenase complex, which is located in the apicoplast Bernardo J. Foth,1... synthesizes fatty acids and is a promising drug target. In plant plastids, a pyruvate ...

  

Source: McFadden, Geoff - School of Botany, University of Melbourne

 

Collection: Environmental Sciences and Ecology

 
63 Sol-Gel-Encapsulated Alcohol Dehydrogenase as a Versatile, Environmentally Stabilized Sensor for Alcohols and Aldehydes
 

Summary:  . 1994, 66 (22), 1120A-1126A. (2) Brinker, C. J.; Scherer, G. W. Sol-Gel Science; Academic Press: New... Sol-Gel-Encapsulated Alcohol Dehydrogenase as a Versatile, Environmentally Stabilized Sensor... alcohol dehydrogenase (ADH) can be employed as a sensor for short- chained alcohols in standard aqueous

  

Source: Hupp, Joseph T.- Materials Research Center & Department of Chemistry, Northwestern University

 

Collection: Materials Science ; Renewable Energy

 
64 Renewable Dehydrogenase-Based Interfaces for Bioelectronic Applications
 

Summary:  ° ADH-modified interface before the removalwere12µA,2.5µAmM-1 cm-2,and20s-1,respectively, compared to 11... µA, 2.1 µA mM-1 cm-2, and 19 s-1, respectively, for the reconstituted bioelectronic interface... Renewable Dehydrogenase-Based Interfaces for Bioelectronic Applications Brian L. ...

  

Source: Lee, Ilsoon - Department of Chemical Engineering and Materials Science, Michigan State University

 

Collection: Materials Science

 
65 GENIC AND CHROMOSOMAL DIFFERENTIATION I N POCKET GOPHERS OF THE GEOMYS BURSARIUS GROUP
 

Summary:  dehydrogenase-2 -a (2) -a (2) -a -a Isocitrate dehydrogenase-1 b (7) b c a c Isocitrate dehydrogenase-2 a (5... ) a a Alcohol dehydrogenase -b (2) -a (2) -a -a Sorbitol ...

  

Source: Baker, Robert J. - Museum of Texas Tech University

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
66 THE UNIVERSITY OF MANITOBA DATE: December 13, 2004 Final EXAMINATION
 

Summary:  .1). The resulting mixture has a pH close to: A) 2 B) 3 C) 4 D) 5 E) 6 3. The isoelectric point (pI) of glutamic acid... of a polypeptide chain, approximately how many turns are there? A) 2 B) 4 C) 6 D) 8 E) 10 11. Give the correct name... C. The value of the equilibrium constant is ? A) ...

  

Source: O'Neil, Joe - Department of Chemistry, University of Manitoba

 

Collection: Biology and Medicine ; Chemistry

 
67 CHEMICALS LIST August 2009 STOREY LAB (see Peptide list on last page)
 

Summary:  phosphatases Protein Phospatase I substrate Queen's U 424fre(#2) [KRY(P)VA] mw:771.56 Protein Phospatase 2A,2C... alcohol dehydrogenase sigma 424f, 431f aldolase pharmacia 431f allose beta-D- sigma 424s alumina sigma 424... ,6 diphosphate (G1,6P2) sigma 424fre(#1) glucose-6-P dehydrogenase sigma 431f ...

  

Source: Storey, Kenneth B. - Departments of Biology & Chemistry, Carleton University

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
68 Active Site Analysis of the Potential Antimicrobial Target Aspartate Semialdehyde Dehydrogenase
 

Summary:  . At the N-terminus, residues A1-A2 packs against residues B1-B2 of a symmetry related molecule and vice... Active Site Analysis of the Potential Antimicrobial Target Aspartate Semialdehyde Dehydrogenase... : Aspartate- -semialdehyde dehydrogenase (ASADH) lies at the first branch point in the biosynthetic ...

  

Source: Viola, Ronald - Department of Chemistry, University of Toledo

 

Collection: Chemistry ; Biology and Medicine

 
69 Evolution of the Aldose Reductase-Related Gecko Eye Lens Protein B-Crystallin: A Sheep in Wolf's Clothing
 

Summary:  Comm 217:452­458 Ro¨ll B, Amons R, de Jong WW (1996) Vitamin A2 bound to cellular retinol... dehydrogenases (Jez et al. 1997; Seery et al. 1998). The finding that these three lineages do not form a separate... NAD(P)H-dependent xylose reductase; aldx_pig (P50578), alcohol dehydrogenase (NADP+) (aldehyde ...

  

Source: van Aalten, Daan - Division of Biological Chemistry and Molecular Microbiology, University of Dundee

 

Collection: Biology and Medicine

 
70 is why K4C60 and a host of otherAnC60 com-pounds are not metallic, despite having a
 

Summary:  isopropylmalate dehydrogenase. In turn, this enzyme uses the coenzyme nicotinamide adenine dinu- cleotide (NAD... dehydrogenase found in all three domains of life, but NAD+ is the only cofactor so far found to be used... isopropylmalate dehydrogenase use only NAD+? Although there are appar- ently no extant natural enzymes that ...

  

Source: Dean, Antony Michael - BioTechnology Institute & Department of Ecology, Evolution, and Behavior, University of Minnesota

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
71 ACCELERATED PUBLICATION Combined Transcriptome and Proteome
 

Summary:  2-oxoglutarate dehydrogenase E1 component gatZ putative tagatose 6-phosphate kinase GatZ ptsG PTS... (HCDC). The expression of genes of TCA cycle enzymes, NADH dehydrogenase and ATPase, was up... . It is notable that the level of isoci- trate dehydrogenase (Idh), one of the most abundant pro- teins

  

Source: Korea Advanced Institute of Science and Technology, Department of Chemical and Biomolecular Engineering, Metabolic & Biomolecular Engineering National Research Laboratory

 

Collection: Engineering ; Biotechnology

 
72 Protease Assay Kit TB252 11/99 Novagen 1
 

Summary:  absorbance at 340 nm (A1 ) after about 1 min. After exactly another 2 min measure absorbance A2 . Calculate A... of samples 1 to 4 at 150, 150½, 151, 151½ min Measuring of A1 and A2 of sample 1 at 152 and 154 min Measuring... of A1 and A2 of ...

  

Source: Lebendiker, Mario - Wolfson Centre for Applied Structural Biology, Hebrew University of Jerusalem

 

Collection: Biotechnology ; Biology and Medicine

 
73 Table SI. Proteomic analysis of lipid droplet Fraction 1. Shown are proteins associated with lipid bodies purified by sucrose gradient centrifugation from bovine RPE (Fraction 1). These were identified by MS/MS analysis of peptides resulting from in gel t
 

Summary:  Dehydrogenase Malate dehydrogenase 35 118572778 MDH2 407 30 9 (34,81) Dehydrogenase Lactate dehydrogenase B 36... 154425698 LDHB 744 34 9 (81) Dehydrogenase Lactate dehydrogenase A 36 217592 LDHA 422 20 5 (81... shock 70 kDa protein 4 95 166795319 HSPA4 677 23 13 ...

  

Source: Palczewski, Krzysztof - Department of Pharmacology, Case Western Reserve University

 

Collection: Biology and Medicine

 
74 RIO: Analyzing proteomes by automated phylogenomics using resampled inference of
 

Summary:  + -dependent isocitrate dehydrogenase and NADP+ -dependent isocitrate dehydrogenase we can suppose... that the query is likely to be a isocitrate dehydrogenase, but it is not possible to determine whether... a match to a Pfam domain family. #12;RIO analysis of lactate/malate dehydrogenase family members In ...

  

Source: Eddy, Sean - Janelia Farm Research Campus, Howard Hughes Medical Institute

 

Collection: Biology and Medicine

 
75 Supporting Information Files in this Data Supplement
 

Summary:  pyrD dihydro-orotate dehydrogenase 0.13 leuB 3-isopropylmalate dehydrogenase 0.14 leuA 2... synthetase B 3.02 adhE CoA-linked acetaldehyde dehydrogenase and iron-dependent alcohol dehydrogenase 2... dehydrogenase 2.25 feoA ferrous iron transport ...

  

Source: Korea Advanced Institute of Science and Technology, Department of Chemical and Biomolecular Engineering, Metabolic & Biomolecular Engineering National Research Laboratory

 

Collection: Engineering ; Biotechnology

 
76 Reprintedfrom The Journalof OrganicChemist-ry,L982,47.,2816 Copyright @ 1982by the AmericanChemicalSocietyand reprintedby permissionof the copyrightowner.
 

Summary:  Using Ethanol/Alcohol Dehydrogenase/Aldehyde Dehydrogenaeeand Methanol/Alcohol Dehydrogenase... /Aldehyde Dehydrogenase/Formate Dehydrogenasel Summary: An enzyme-catalyzedsystem potentially ap- plicable to large... .1.1.1)and aldehyde dehydrogenase(AIdDH, EC 1.2.1.5)-and convertsethanol to acetate. This ...

  

Source: Prentiss, Mara - Department of Physics, Harvard University

 

Collection: Physics

 
77 electronic reprint Acta Crystallographica Section D
 

Summary:  . Resolution range (A° ) 79­2.2 (2.3­2.2) Wilson B factor (A° 2 ) 42.4 No. of reflections 32667 Rwork... 2 No. of atoms Protein 5350 Ligands 48 Waters 147 B factors (A° 2 ) Protein 48 Ligands 82 Waters 49... enzymes it has the lowest subunit surface area ($1800 A° ...

  

Source: Viola, Ronald - Department of Chemistry, University of Toledo

 

Collection: Chemistry ; Biology and Medicine

 
78 Gene Expression in Bacillus subtilis Surface Biofilms With and Without
 

Summary:  to sporulation genes, genes for transport, biosynthesis, and unknown functions were also induced (Table A2 and A3... were also up-regulated, e.g., oppA (2.4-fold), oppC (2.9-fold), comS (1.6-fold), and srfAC (1.9-fold... -methyltransferase), lctE (en- coding L-lactate dehydrogenase), lctP ...

  

Source: Wood, Thomas K. - Department of Chemical Engineering, Texas A&M University

 

Collection: Environmental Sciences and Ecology

 
79 Jean-Paul Lasserre1 Emmanuelle Beyne2
 

Summary:  family 23 36 364 38 ybbN C 7 P77395 SIMILARITY: to H. influenzae HI1159 12 31 791 39 yeeN C 6 P0A8A2... 2, 3 P25714 Inner membrane protein oxaA 2.6 2.1 5, 7, 10 61 526 289 pdxK M 2 P40191 Pyridoxine... -oxoglutarate dehydrogenases complexes 20 50 557 [48­50] 3 aceF C 6 P06959 ...

  

Source: Economou, Tassos - Institute of Molecular Biology and Biotechnology, Foundation of Research and Technology, Hellas

 

Collection: Biology and Medicine

 
80 1,4-Butanediol Production in E. coli Yim, H. et al. Supplementary Information
 

Summary:  ,4-butanediol 4.1.1.- 1.2.1.- Alpha-ketoglutaryl-CoA 1.1.1.- 1.2.1.- FIGURE2 1.2.1.- 4-hydroxybutyryl-CoA 2... 1,4-butanediol 4.1.1.- FIGURE2 1.2.1.- 4-hydroxybutyryl-CoA 2.7.2.- 2.8.3.- 6.2.1.- 1.2.1.- 1... . Succinate semialdehyde dehydrogenase (CoA-dependent) (SucD): The enzyme ...

  

Source: Korea Advanced Institute of Science and Technology, Department of Chemical and Biomolecular Engineering, Metabolic & Biomolecular Engineering National Research Laboratory

 

Collection: Engineering ; Biotechnology


Page:   1  2  3  4  5 
Page:   1  2  3  4  5 
 
81 Guidelines for Protein Name Tagging Version 2.0
 

Summary:  heterogeneous nuclear ribonucleaoprotein (hnRNP) A1/A2; o... ", "E2", "E1 alpha" or "E1 beta" refer to the subunits of "pyruvate dehydrogenase complex", which should... " is the post-modifier. In the NP, "alpha and beta chains of the pyruvate ...

  

Source: Georgetown University Medical Center, Protein Information Resource (PIR)

 

Collection: Biology and Medicine

 
82 RESEARCH ARTICLE Open Access Molecular characterization of glucose-6-
 

Summary:  RESEARCH ARTICLE Open Access Molecular characterization of glucose-6- phosphate dehydrogenase... ) enzyme deficiencies. We carried out a study on glucose-6-phosphate dehydrogenase (G6PD) deficient... of nucleotide1311 and IVS-XI-93 polymorphisms in the glucose-6- phosphate dehydrogenase gene. Results: A total

  

Source: Paris-Sud XI, Université de - Institut d'Optique, Laboratoire Charles-Fabry, Groupe d'Optique Atomique

 

Collection: Physics

 
83 Ligand Binding and Protein Dynamics in Lactate Dehydrogenase J. R. Exequiel T. Pineda,* Robert Callender,y
 

Summary:  constant of 100 kcal/mol/A° 2 . This was followed by 500 steps of Adopted Basis Newton-Raphson (ABNR... ) minimization. The force con- stant was reduced to 50 kcal/mol/A° 2 during the second ABNR minimization of 500... atoms were also calculated. ASA are reported in units of A° ...

  

Source: Callender, Robert - Department of Biochemistry, Albert Einstein College of Medicine, Yeshiva University; Schwartz, Steven D. - Department of Physiology and Biophysics, Albert Einstein College of Medicine, Yeshiva University

 

Collection: Biology and Medicine

 
84 Reprintedfrom The Journalof OrganicChemistry,1981,46,4100. CopyrightO 1981by the AmericanChemicalSocietyandreprintedby permissionof the copyrightowner
 

Summary:  summarized in SchemeI with the synthesisof l-lactate from pymvate. A2-L, three-necked,round-bottomed flask... in a reaction catalyzedby lipoamide dehydrogenase. Sir; Here we describea method for regenerationof NADH from... Dehydrogenase, t -LDH = r,-Lactate Dehydrogenase,DTT = ...

  

Source: Prentiss, Mara - Department of Physics, Harvard University

 

Collection: Physics

 
85 Abstract. -Three species of basses of the genus Pamlab'rax are
 

Summary:  .3.1.9) Gpi-A 2,3 m,1 Gpi-B 2,3 m Glutamate dehydrogenase (1.4.1.2) Gdh 1 I Glyceraldehyde... (2.7.3.2) Ck-A 2 m Ck-B 2 e Esterase (3.1.1.-); a-naphthyl acetate Est-1,2,3 3 m Fumarte hydratase (4... dehydrogenase (1.1.1.1) Adh-1 2 I Adh-2 2 I Aspartate ...

  

Source: National Oceanic and Atmospheric Administration (NOAA), Fishery Bulletin

 

Collection: Environmental Sciences and Ecology

 
86 JOURNAL OF MAGNETIC RESONANCE 48,402-417 (1982) Theory and Applications of the Transferred Nuclear Overhauser
 

Summary:  ligand (.&) to total protein (Er) concentration, as a function of k-,. LT/Er = (a) 2, (b) 4, (c) 8, (d... to a line broadening of 2 Hz. The pulse sequence used in the TRNOE experiments was (tl-tz-a/2-AT),, where... -monophosphate bound to horse liver al- cohol dehydrogenase, yeast ...

  

Source: Clore, G. Marius - Laboratory of Chemical Physics. National Institutes of Health

 

Collection: Biology and Medicine

 
87 APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Nov. 2007, p. 69306938 Vol. 73, No. 21 0099-2240/07/$08.00 0 doi:10.1128/AEM.01697-07
 

Summary:  B alphII 30 p prmA 2.2-kb fusion PCR fragment flanking prmA cloned into pK18mobsacB; used to make strain... hypothetical protein ro00446 14 Conserved hypothetical protein ro00447 29 prmE/alcohol dehydrogenase ro00448 13... monoxide dehydrogenase small subunit (ferredoxin) ro03894 7 pcal2/3-oxoacid coenzyme ...

  

Source: Alvarez-Cohen, Lisa - Department of Civil and Environmental Engineering, University of California at Berkeley; Wood, Thomas K. - Department of Chemical Engineering, Texas A&M University

 

Collection: Engineering ; Environmental Management and Restoration Technologies ; Environmental Sciences and Ecology

 
88 Science Highlight July 2010 Figure 1. Representative structures of CODH C-clusters (a) with
 

Summary:  -Fe-S active site metal cluster (C-cluster) of the enzyme carbon monoxide dehydrogenase (CODH). Acetogenic... bifunctional carbon monoxide dehydrogenase/acetyl-CoA synthase. Biochemistry. 48, 7432-7440. References 1... monoxide dehydrogenase reveals a [Ni-4Fe-5S] cluster. Science. 293, 1281­1285. 4. Dobbek, H., Svetlitchnyi

  

Source: Wechsler, Risa H. - Kavli Institute for Particle Astrophysics and Cosmology, Stanford Linear Accelerator Center

 

Collection: Physics

 
89 CMLS, Cell. Mol. Life Sci. 55 (1999) 450455 1420-682X/99/030450-06 $ 1.50+0.20/0
 

Summary:  -translocating NADH:ubiquinone oxidoreductase (complex I) and short-chain dehydrogenases/reductases M. E. Bakera, *, W... and hydroxys- teroid dehydrogenases while seeking distant homologs ofmembranes of mitochondria, where... in complex I is ho- mologous to short-chain dehydrogenases and reductases, from the solved three

  

Source: Wang, Deli - Department of Electrical and Computer Engineering, University of California at San Diego

 

Collection: Engineering ; Materials Science

 
90 doi:10.1152/physiolgenomics.00260.2005 25:346-353, 2006. First published Feb 7, 2006;Physiol. Genomics
 

Summary:  /acylcarnitine translocase Cact 1.74 0.001 2.05 0.009 Heat shock protein 9A Hspa9a 2.62 0.001 0.76 0.006 Superoxide dismutase... membrane component 1 (Pgrmc1, 3.39), and Dihydrolipoamide dehydrogenase (Dld, 3.27), where the numbers... ; succinate-CoA ligase (Sucla2, Suclg1), isocitrate dehydrogenase (Idh3a, ...

  

Source: Wagner, Diane - Institute of Arctic Biology, Department of Biology and Wildlife, University of Alaska Fairbanks

 

Collection: Environmental Sciences and Ecology

 
91 doi:10.1152/physiolgenomics.00260.2005 25:346-353, 2006. First published Feb 7, 2006;Physiol Genomics
 

Summary:  /acylcarnitine translocase Cact 1.74 0.001 2.05 0.009 Heat shock protein 9A Hspa9a 2.62 0.001 0.76 0.006 Superoxide dismutase... membrane component 1 (Pgrmc1, 3.39), and Dihydrolipoamide dehydrogenase (Dld, 3.27), where the numbers... ; succinate-CoA ligase (Sucla2, Suclg1), isocitrate dehydrogenase (Idh3a, ...

  

Source: Wagner, Diane - Institute of Arctic Biology, Department of Biology and Wildlife, University of Alaska Fairbanks

 

Collection: Environmental Sciences and Ecology

 
92 Identification of family-specific residue packing motifs and their use for structure-based protein function prediction
 

Summary:  ), 1d3cA(3) and 1fa2A(2). This is consistent with the fact that most members of the SCOP family are a... unweighted edge motifs. We chose the following families for this case study: 1. Alcohol dehydrogenase EC... (2009) 23:785­797 123 #12;1. Alcohol dehydrogenases catalyze the extraction of hydrogen from ...

  

Source: Prins, Jan - Department of Computer Science, University of North Carolina at Chapel Hill

 

Collection: Computer Technologies and Information Sciences

 
93 APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Jan. 1995, p. 7478 Vol. 61, No. 1 0099-2240/95/$04.00 0
 

Summary:  .2.1.16; ilvA) (2). The first two lead to produc- tion of glycine. Threonine dehydratase initiates a five... of the operon homdr -thrB encoding a feedback-insensitive homoserine dehydrogenase and a wild-type homoserine... was an unexplained increase in homoserine dehydrogenase activity. This resulted in a ...

  

Source: Sinskey, Anthony J. - Department of Biology, Massachusetts Institute of Technology (MIT)

 

Collection: Biology and Medicine

 
94 The ACT Domain: A Small Molecule Binding Domain and
 

Summary:  ; ThrD, threonine deaminase; LrpA and Lrp, Lrp transcription regulators; PHS023, PHS023 protein; LeuA-2... dehydrogenase (6), a tetrameric protein containing one ACT domain per subunit. This structure repre- sents... of the proteins, aspartate kinase-chorismate mutase-tyrA (prephenate dehydrogenase). In 2001, ...

  

Source: Kopan, Raphael - Department of Molecular Biology and Pharmacology, Washington University in St. Louis

 

Collection: Biology and Medicine

 
95 electronic reprint Acta Crystallographica Section D
 

Summary:  factor (A° 2 ) 36.8 31.8 No. of reflections 57268 73968 Rcryst/Rfree (%) 19.6/24.5 18.5/22.9 R... 7809 7404 Ligand 0 8 Water 406 767 B factors (A° 2 ) Protein 41.1 29.5 Ligand -- 25.6 Water 47.0 43... . Enzyme form Sequence identity to vcASADH2 (%) Buried dimer surface (A° ...

  

Source: Viola, Ronald - Department of Chemistry, University of Toledo

 

Collection: Chemistry ; Biology and Medicine

 
96 Plant Molecular Biology 48: 751764, 2002. 2002 Kluwer Academic Publishers. Printed in the Netherlands.
 

Summary:  217b.u, 5 -ACTCATATGGAGAA- CGGCAAATGCAA-3 ; A2ETL, 5 -TCAGGAATTC- CCGCTTCTTTTGAGAG-3 ; ALDH3-expr, 5... TJ311 using primers A217b.u #12;755 and A2ETL. This PCR product was then purified, di- gested with Nde... in the Netherlands. 751 Characterization of the aldehyde dehydrogenase gene ...

  

Source: Schnable, Patrick S. - Center for Plant Genomics & Department of Genetics, Development and Cell Biology, Iowa State University

 

Collection: Biology and Medicine ; Biotechnology

 
97 Genome Biology 2006, 7:R95 commentreviewsreportsdepositedresearchrefereedresearchinteractionsinformation
 

Summary:  enzymes, including those encoded by Cyp6a2 and Cyp6a13, and glutathione-S-transferase D5, are acutely up... in ethnically defined populations have implicated alcohol dehydrogenase [4], the GABAA receptor complex [5... - sumption in mice and humans [23]. In addition, Sorbitol dehydrogenase 2, CG1600 and ...

  

Source: Mackay, Trudy F.C. - Department of Genetics, North Carolina State University

 

Collection: Biology and Medicine

 
98 FUNCTIONAL CHARACTERIZATION OF THREE DIFFERENT GLUCOSE UPTAKE ROUTES IN LACTOCOCCUS LACTIS
 

Summary:  ,3-Butanediol dehydrogenase ackA1 1.5 1.6 s Acetate kinase ackA2 1.4 2.5 s Acetate kinase Regulation ptsH 0.9 1... dehydrogenase (LDH) and pyruvate kinase (PK) activities, which might be caused by a lower FBP pool, together... , dihydronicotinamide adenine dinucleotide; GLK, glucokinase; GAPDH, ...

  

Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution,

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
99 This Provisional PDF corresponds to the article as it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon.
 

Summary:  in G. bemidjiensis (Figure 7): the modB1C1 genes are located apart from the modA1 gene, while the modA2... two sets of genes encoding pyruvate dehydrogenase complexes (Gbem_2257 #12;7 and Gbem_2251-Gbem_2250... of subsurface Geobacter species possess a very-long-chain fatty acyl-CoA dehydrogenase (fadE ...

  

Source: Lovley, Derek - Department of Microbiology, University of Massachusetts at Amherst

 

Collection: Environmental Management and Restoration Technologies ; Biology and Medicine

 
100 Eur. J. Biochem. 251, 549 557 (1998) FEBS 1998
 

Summary:  Eur. J. Biochem. 251, 549 557 (1998) © FEBS 1998 Review Human aldehyde dehydrogenase gene family... 3 July/17 November 1997) EJB 97 0937/0 Twelve aldehyde dehydrogenase (ALDH) genes have been... Aldehyde dehydrogenases [aldehyde: NAD(P) oxidoreduc- tase] are a group of enzymes catalyzing the conversion of alde

  

Source: Nei, Masatoshi - Department of Biology, Pennsylvania State University

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine


Page:   1  2  3  4  5