| Sample search results for: a549 lung cancer |
| 1 | aallll IIrreell aanndd ccaanncceerr ssttaattiissttiiccss sseeccoonndd rreeppoorrtt 11999988--22000000 Lung cancer Lung cancer Lung cancer Lung c | ||
|
Summary: --22000000 34 Lung cancer Lung cancer Lung cancer Lung c ancer Lung cancer Lung cancer Lung cancer L ung ... |
|||
|
Source: Paxton, Anthony T. - Department of Pure and Applied Physics, Queen's University Belfast |
|||
|
Collection: Physics ; Materials Science |
|||
| 2 | [CANCER RESEARCH 63, 64886495, October 1, 2003] Human Epithelial Cancers Secrete Immunoglobulin G with Unidentified Specificity | ||
|
Summary: of Military Medical Science); cervical cancer cell line (HeLa S3), lung cancer cell line (A549), ovarian... cancer (HT-29, LOVO), liver cancer (BCL-7402), ovarian cancer (CaOV3), lung ... |
|||
|
Source: Ma, Dalong - Center for Human Disease Genomics, Peking University |
|||
|
Collection: Biology and Medicine |
|||
| 3 | The Heparan Sulfate Proteoglycan GPC3 Is a Potential Lung Tumor Suppressor | ||
|
Summary: function in lung carcinoma, we infected two lung cancer cell lines (NCI-H460-large cell and A549... (22, 23). Two lung carcinoma cell lines (A549 and NCI-H460) were incubated with viral supernatant... . Pharmacologic Unmasking ... |
|||
|
Source: Tian, Weidong - Institute of Biochemistry and Cell Biology, Shanghai Institute of Biological Sciences |
|||
|
Collection: Biology and Medicine |
|||
| 4 | A SNP in a let-7 microRNA Complementary Site in the KRAS 3 Untranslated Region Increases NonSmall Cell Lung Cancer Risk | ||
|
Summary: 549 cells, a lung cancer cell line, with known low let-7 levels (14), and compared luciferase expres... Small Cell Lung Cancer Risk Lena J. Chin, 1 Elena Ratner, 2 Shuguang Leng, 9 Rihong Zhai, 6 Sunitha Nallur, 2... Medicine, University of New Mexico and 9 Lung ... |
|||
|
Source: Kidd, Kenneth - Department of Genetics, Yale University |
|||
|
Collection: Biology and Medicine |
|||
| 5 | THE EFFECTS OF IN VIVO MECHANICAL FORCES ON MORPHOLOGY, PROLIFERATION AND PROTEIN EXPRESSION OF LUNG CANCER CELLS | ||
|
Summary: (NSCLC) cell lines. Methods: The epithelial lung carcinoma (A549 ) and a bronchioalveolar (NCI-H358... OF LUNG CANCER CELLS S. Schmitt, B.S. 1 , P.J. Morales, M.S. 2 , P. Hendricks, B.S. 2 , G .Vielhauer... forces on the morphology, proliferation and the epithelial- mesenchymal ... |
|||
|
Source: Peterson, Blake R. - Department of Medicinal Chemistry, University of Kansas |
|||
|
Collection: Chemistry |
|||
| 6 | Retinoids and Their Receptors in Cancer XIAO-KUN ZHANG, PH.D. | ||
|
Summary: that retinoids can promote apoptosis in breast cancer and lung cancer cells and that induction of apoptosis... and its mechanism of action in human lung cancer cell lines. Our results demonstrated that AHPN/CD437... effectively inhibited lung ... |
|||
|
Source: Oshima, Robert G. - Burnham Institute for Medical Research |
|||
|
Collection: Biology and Medicine |
|||
| 7 | WHERE TO FIND MORE INFORMATION ON LUNG CANCER | ||
|
Summary: WHERE TO FIND MORE INFORMATION ON LUNG CANCER The National Cancer Institute, International Cancer... Information Center Bldg. 82, Rm 123 Bethesda, MD 20892 The American Cancer Society The American Lung... Information Center for any information on ... |
|||
|
Source: National Center for Environmental Health- Publications and Products |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 8 | Classification : Original Article VOLTAGE-GATED SODIUM CHANNELS POTENTIATE THE INVASIVE | ||
|
Summary: ) and cancerous lung epithelial cell lines (H23, H460, Calu-1 and A549). A, Total currents recorded from... studied are from human origin, normal (NL-20 and BEAS-2B) and cancerous (H23, H460, A549 and Calu-1... , Calu-1 and ... |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 9 | Differential regulation of RANTES and IL-8 expression in lung adenocarcinoma cells | ||
|
Summary: (PKC)/ on the expression of RANTES and IL-8 in A549 lung adenocarcinoma cells. TNF- is a major mediator... Macromoléculaire, Montpellier, France) [24]. Cell maintenance The A549 human lung adenocarcinoma cell line... and IL-8 in ... |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 10 | QUESTIONS & ANSWERS ABOUT LUNG CANCER | ||
|
Summary: QUESTIONS & ANSWERS ABOUT LUNG CANCER Q: What are the early signs of lung cancer? How would I know... I have it? A: Some of the early warning signs of lung cancer are: · A cough that doesn't go away... what may be causing these symptoms. Q: How is ... |
|||
|
Source: National Center for Environmental Health- Publications and Products |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 11 | David J. Brenner, PhD, DSc Index terms | ||
|
Summary: Cancer1 PURPOSE: To estimate the radiation-related lung cancer risks associated with annual low... statusdependent excess relative risks of lung cancer were derived from cancer incidence data for atomic... bomb survivors and used to calculate the excess ... |
|||
|
Source: Brenner, David Jonathan - Center for Radiological Research & Department of Environmental Health Sciences, Columbia University |
|||
|
Collection: Biology and Medicine |
|||
| 12 | An NQO1-and PARP-1-mediated cell death pathway induced in non-small-cell lung cancer cells | ||
|
Summary: An NQO1- and PARP-1-mediated cell death pathway induced in non-small-cell lung cancer cells... Institute, Boston, MA, and approved May 21, 2007 (received for review March 12, 2007) Lung cancer... for non-small- cell lung cancers (NSCLCs) have a survival rate of 15% ... |
|||
|
Source: Gao, Jinming - Department of Oncology and Pharmacology, University of Texas Southwestern Medical Center at Dallas |
|||
|
Collection: Biology and Medicine |
|||
| 13 | LUNG CANCER 6. LUNG CANCER | ||
|
Summary: LUNG CANCER 47 6. LUNG CANCER 6.1. SUMMARY Lung cancer was the third most common cancer in Ireland... (Table 6.1). The average number of new lung cancer cases diagnosed each year was 1,000 in women and 1... ... |
|||
|
Source: Paxton, Anthony T. - Department of Pure and Applied Physics, Queen's University Belfast |
|||
|
Collection: Physics ; Materials Science |
|||
| 14 | aallll IIrreell aanndd ccaanncceerr ssttaattiissttiiccss sseeccoonndd rreeppoorrtt 11999988--22000000 SSSuuummmmmmaaarrryyy | ||
|
Summary: colorectal, breast, lung, prostate, stomach, and oesophageal cancers, as well as melanoma of the skin... life-threatening. The four commonest cancers-- breast, colorectal, lung and prostate --are... ccaanncceerr ssttaattiissttiiccss sseeccoonndd rreeppoorrtt 11999988--22000000 3 Lung ... |
|||
|
Source: Paxton, Anthony T. - Department of Pure and Applied Physics, Queen's University Belfast |
|||
|
Collection: Physics ; Materials Science |
|||
| 15 | 2011;71:473-483. Published OnlineFirst January 11, 2011.Cancer Res Jia-Yang Chen, Yen-An Tang, Sin-Ming Huang, et al. | ||
|
Summary: lung cancer cell lines, H1299 and A549, were obtained from the American Type Culture Collection... -O-Asp on cancer cell motilities, human lung cancer cell line, A549, H1299, and murine breast ... |
|||
|
Source: Gleeson, Joseph G. - Department of Neurosciences, University of California at San Diego |
|||
|
Collection: Biology and Medicine |
|||
| 16 | Caliper Life Sciences offers a wide variety of bioluminescent and fluorescent reagents that are optimized for use with IVIS systems. With over a 1000 publications and millions of mice imaged, our | ||
|
Summary: 119265 A549-luc-C8 Human Lung Cancer 119266 Product Name Description Catalog Number LL/2-luc-M38 Murine... /Angiogenesis reporter cell line 119273 p53-RE-luc/A549 Cancer/Apoptosis/ Toxicology reporter cell line 119274 #12;IVIS... that offers ... |
|||
|
Source: Roth, David B. - Langone Medical Center, New York University; Wang, Da-Neng - Skirball Institute of Biomolecular Medicine & Department of Cell Biology, New York University |
|||
|
Collection: Biology and Medicine |
|||
| 17 | Noninvasive Imaging for Evaluation of the Systemic Delivery of Capsid-Modified Adenoviruses in an | ||
|
Summary: in an Orthotopic Model of Advanced Lung Cancer Merja Sarkioja, MD 1,2 Anna Kanerva, MD, PhD 13 Jarmo Salo, MD 4... ' knowledge, targeting approaches for nonsmall cell lung cancer (NSCLC) have not been comprehensively... of advanced lung cancer was developed. Because ... |
|||
|
Source: Hemminki, Akseli - Department of Biosciences, University of Helsinki |
|||
|
Collection: Biology and Medicine |
|||
| 18 | The Math Colloquium Department of Mathematics | ||
|
Summary: University Estimating the Likelihood of Cure from Lung Cancer February 3, 2010, MH320 Abstract: Lung cancer... is the leading cause of death from cancer in the United States, yet screening for lung cancer is not recommended... even for current ... |
|||
|
Source: Hsu, Tim - Department of Mathematics, San José State University |
|||
|
Collection: Mathematics |
|||
| 19 | Integrated Systems and Technologies -Lapachone Micellar Nanotherapeutics for NonSmall Cell | ||
|
Summary: . Pharmacokinetic analyses in mice bearing subcutaneous A549 lung tumors showed prolonged blood circulation (t1... A549 lung tumors and orthotopic Lewis lung carcinoma models showed significant tumor growth delay... ). Treatment of subcutaneous ... |
|||
|
Source: Gao, Jinming - Department of Oncology and Pharmacology, University of Texas Southwestern Medical Center at Dallas |
|||
|
Collection: Biology and Medicine |
|||
| 20 | 978-1-61284-852-5/11/$26.00 2011 IEEE 233 Poster: A Lung Cancer Mortality Risk Calculator Based on SEER Data | ||
|
Summary: 978-1-61284-852-5/11/$26.00 ©2011 IEEE 233 Poster: A Lung Cancer Mortality Risk Calculator Based... ,choudhar}@eecs.northwestern.edu, lpolepeddi@u.northwestern.edu Abstract-- We analyze the lung cancer data... .eecs.northwestern.edu:8080/CancerMortalityRiskCalculator Keywords- data mining; ... |
|||
|
Source: Kuzmanovic, Aleksandar - Department of Electrical and Computer Engineering, Northwestern University; Northwestern University, Electrical Engineering and Computer Science Department, Center for Ultra-scale Computing and Information Security |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 21 | ForPeerReview High Kallikrein-Related Peptidase 6 in Non-Small Cell Lung | ||
|
Summary: ForPeerReview High Kallikrein-Related Peptidase 6 in Non-Small Cell Lung Cancer Cells: an indicator... in the development and dissemination of lung cancer, the leading cause of cancer mortality worldwide. We have... KLK6 in order to investigate the role of KLK6 in ... |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 22 | Integrated Systems and Technologies Optical Detection of Buccal Epithelial Nanoarchitectural | ||
|
Summary: Alterations in Patients Harboring Lung Cancer: Implications for Screening Hemant K. Roy1 , Hariharan... /epigenetic alterations of field carcinogenesis. Our approach was to screen for lung cancer by assessing the cheek cells... from smokers with and without lung ... |
|||
|
Source: MacIver, Malcolm A. - Departments of Biomedical Engineering & Mechanical Engineering, Northwestern University; Pradhan, Prabhakar - Department of Electrical and Computer Engineering, Northeastern University |
|||
|
Collection: Biology and Medicine ; Engineering ; Materials Science ; Physics |
|||
| 23 | Cytotoxic Effects of Bilberry Extract on MCF7-GFP-Tubulin Breast Cancer Cells | ||
|
Summary: adenocarcinoma AGS cells and human nonsmall cell lung cancer A549 cells, respectively. Because consumption... =G1 phase in human gastric adenocarcinoma AGS cells and human nonsmall cell lung cancer A549 cells... ... |
|||
|
Source: Lelkes, Peter I. - School of Biomedical Engineering, Drexel University |
|||
|
Collection: Materials Science ; Biology and Medicine |
|||
| 24 | Chemistry & Biology, Vol. 10, 881892, September, 2003, 2003 Elsevier Science Ltd. All rights reserved. DOI 10.1016/j.chembiol.2003.08.009 Biological Mechanism Profiling Using an Annotated | ||
|
Summary: -related mechanisms, as well as several mechanisms with no obvious or pre- A549 lung cancer cells. These and others... on incorporating additional biological mechanism termsliferation and viability. We treated A549 lung carcinoma... but Not Normal ... |
|||
|
Source: Stockwell, Brent R. - Department of Biological Sciences, Columbia University |
|||
|
Collection: Biology and Medicine |
|||
| 25 | lung cancer smoke-free 6 One man's | ||
|
Summary: Fighting lung cancer Living smoke-free 6 One man's mission85 #12;Cure is the newsletter... , UF Shands Cancer Center Lindy Brounley From the Director's Desk Advancing lung cancer care, research... Research Proton therapy effective in treating lung ... |
|||
|
Source: Roy, Subrata - Department of Mechanical and Aerospace Engineering, University of Florida |
|||
|
Collection: Plasma Physics and Fusion ; Physics |
|||
| 26 | Supplementary Information A novel sialyltransferase inhibitor suppresses FAK/paxillin and | ||
|
Summary: 3x104 of the CL1-0, CL1-5, A549, and H1299 lung cancer cells were seeded on 12-well culture dishes... treatment with Lith-O-Asp, the survival of CL1-0, CL1-5, A549 and H1299 lung cancer cell lines was evaluated... knockdown ... |
|||
|
Source: Gleeson, Joseph G. - Department of Neurosciences, University of California at San Diego |
|||
|
Collection: Biology and Medicine |
|||
| 27 | SUMMARY OF RESULTS A Summary of the Fernald Risk Assessment Report, Centers for Disease Control and | ||
|
Summary: FEED MATERIALS PRODUCTION CENTER (FMPC) ON LUNG CANCER MORTALITY IN THE SURROUNDING COMMUNITY Draft... the results of the first phase of the Fernald Risk Assessment Project. Lung cancer is the most likely health... of the number of lung cancer deaths occurring from ... |
|||
|
Source: National Center for Environmental Health- Publications and Products |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 28 | 11/4/10 3:07 PMNCI stops large lung cancer trial early; CT tops x-ray screening Page 1 of 2http://www.healthimaging.com/index.php?view=article&id=24939:nci-stops-large-l...early-ct-tops-x-ray-screening&tmpl=component&print=1&page=&option=com_articles | ||
|
Summary: 11/4/10 3:07 PMNCI stops large lung cancer trial early; CT tops x-ray screening Page 1 of 2http... : American Journal of Roentgenology NCI stops large lung cancer trial early; CT tops x-ray screening... The National Cancer Institute has stopped the multi-million dollar National ... |
|||
|
Source: Duke University, Center for In Vivo Microscopy |
|||
|
Collection: Biology and Medicine |
|||
| 29 | b-Tubulin Isotype Classes II and V Expression Patterns in Nonsmall Cell | ||
|
Summary: of b-tubulin classes I and V mRNA were measured in two NSCLC lung cancer cell lines (A549 and HOP 18... -tubulin isotype protein levels could be useful as indicators of nonsmall cell lung cancer (NSCLC) aggressiveness... 685, 2008. ' 2008 Wiley-Liss, Inc. Key words: ... |
|||
|
Source: Correia, John J. - Department of Biochemistry, University of Mississippi |
|||
|
Collection: Biology and Medicine |
|||
| 30 | WHAT'S NEXT? Members and | ||
|
Summary: and Government Public Health Officials Individuals with Concern about their Lung Cancer Risks NCEH will work... of lung cancer or other health outcomes that could be related to FMPC; or · relevant public health... screening for lung cancer in persons without ... |
|||
|
Source: National Center for Environmental Health- Publications and Products |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 31 | Nucleic Acids Research doi:10.1093/nar/gki514 | ||
|
Summary: A549 lung carcinoma cell line was obtained from the American Type Culture Collection (Rockville, MD... of 12459. (b) Effect of 12459 (10 mM) on the growth of human A549 lung carcinoma parental cells... and apoptosis in the human ... |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 32 | Increased lung cancer risks are similar whether arsenic is ingested ALLAN H. SMITHa | ||
|
Summary: Increased lung cancer risks are similar whether arsenic is ingested or inhaled ALLAN H. SMITHa... . In 2004, IARC listed arsenic in drinking water as a cause of lung cancer, making arsenic the first... seem counterintuitive that arsenic in drinking water would cause human lung ... |
|||
|
Source: California at Berkeley, University of - School of Public Health, Arsenic Health Effects Research Program |
|||
|
Collection: Biology and Medicine |
|||
| 33 | has yet to be ascertained. However, the significant correlation between MT-SP1 and uPAR transcript lev- | ||
|
Summary: lines). The remaining cell lines are SKOV3 (ovarian cancer), A549 (lung carcinoma), A431 (epidermal... cancer cell line A549 (0%, 0%), the fibrosarcoma cell line HT1080 (0%, 0%), the fibroblast line 847 (0... 549 ... |
|||
|
Source: Craik, Charles S. - Departments of Pharmaceutical Chemistry, Cellular and Molecular Pharmacology & Biochemistry and Biophysics,University of California at San Francisco |
|||
|
Collection: Biology and Medicine |
|||
| 34 | Original Article Efficient Derivation of Alveolar Type II Cells | ||
|
Summary: as a precursor to lung epithelial cells. When con- ditioned medium from A549 cells was used to derive endoderm... a two-step differentiation of ESCs into definitive endoderm by activin or A549-conditioned medium... of the secreted factors produced by ... |
|||
|
Source: Lelkes, Peter I. - School of Biomedical Engineering, Drexel University |
|||
|
Collection: Materials Science ; Biology and Medicine |
|||
| 35 | FutureOncology 10.2217/FON.10.176 2011 Future Medicine Ltd Future Oncol. (2011) 7(1), 13 ISSN 1479-6694 | ||
|
Summary: . Lung cancer should be eminently screenable since the at- risk population is well defined (~90% of lung... tomography (LDCT). The landmark results came from a randomized trial of 55,000 smokers (National Lung Cancer... Screening Trial) that dem- onstrated that LDCT screening resulted in ... |
|||
|
Source: MacIver, Malcolm A. - Departments of Biomedical Engineering & Mechanical Engineering, Northwestern University |
|||
|
Collection: Engineering ; Biology and Medicine |
|||
| 36 | 11/4/10 3:06 PMhttp://www.usatoday.com/news/health/2010-11-04-ct-scan-lung-cancer_N.ht...A+usatoday-NewsTopStories+%28News+-+Top+Stories%29&utm_content=My+Yahoo Page 1 of 2http://www.usatoday.com/cleanprint/?1288897557720 | ||
|
Summary: 11/4/10 3:06 PMhttp://www.usatoday.com/news/health/2010-11-04-ct-scan-lung-cancer... ://www.usatoday.com/cleanprint/?1288897557720 Study: CT scans can reduce lung cancer deaths by 20% Updated 2h 13m ago By Liz Szabo, USA TODAY... For the first time, a large study shows that using CT scans to screen smokers and ex-smokers for ... |
|||
|
Source: Duke University, Center for In Vivo Microscopy |
|||
|
Collection: Biology and Medicine |
|||
| 37 | NF-kappaB signaling and glucose metabolism during lung cancer development Laboratory of Etienne Meylan, ISREC | ||
|
Summary: NF-kappaB signaling and glucose metabolism during lung cancer development... Laboratory of Etienne Meylan, ISREC Lung cancer is the leading cause of cancer deaths... laboratory focuses on two important yet under-investigated aspects ... |
|||
|
Source: |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 38 | The landscape of somatic copy-number alteration across human cancers | ||
|
Summary: H1792 16 4.9 3.4 9.2 H520 3.9 H2228 3.8 LCLC-97TM1 H2110 PC9 H3122 1.6 1.3 2.1 1.9 A549 2.0 H1437 1... (FISH) of the MCL1 region in lung and breast cancers showed much higher rates of focal amplification... previously noted in lung cancer36 , giant-cell tumour of ... |
|||
|
Source: Raychaudhuri, Soumya - Division of Genetics, Brigham and Women's Hospital, Harvard University |
|||
|
Collection: Biology and Medicine |
|||
| 39 | Priority Report Metformin Decreases the Dose of Chemotherapy for | ||
|
Summary: cancer cells or (B), A549 lung cancer cells that were untreated (NT), treated by intratumoral injections... adenocarcinoma cells, and A549 cells are human lung epithelial carcinoma cells. Cell culture BT-474, MDA-MB-231... ... |
|||
|
Source: |
|||
|
Collection: Biology and Medicine |
|||
| 40 | A Strategy for Bounding Attributable Risk: a Lung Cancer Example Minh Ha-Duong1,2 | ||
|
Summary: 3 A Strategy for Bounding Attributable Risk: a Lung Cancer Example Minh Ha-Duong1,2 , Elizabeth A... . In this study we outline a method to bound the fraction of lung cancer fatalities not attributed to specific... of the minor risk factors, and, as such, complements the traditional risk analysis. With ... |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 41 | SCIENCES DE LA TECHNOLOGIE ET DE LA SANT GRENOBLE I Ecole Doctorale Chimie et Sciences du Vivant | ||
|
Summary: A. Amphiregulin promotes BAX inhibition and resistance to gefitinib in Non-Small Cell Lung Cancers... in Non-Small Cell Lung Cancer cells by regulating Ku70 acetylation. Molecular Therapy, 2009. Epub ahead... in non-small cell lung cancer. Pathologie Biologie, ... |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 42 | Highly parallel identification of essential genes in cancer cells | ||
|
Summary: representing diverse cancer types, including small-cell lung cancer (H82, H187), non-small-cell lung cancer (A... , and MYB were in the top 1% of essential genes in at least 1 cancer cell line (KRAS in LN229, ... |
|||
|
Source: Sabatini, David M. - Whitehead Institute for Biomedical Research & Department of Biology, Massachusetts Institute of Technology (MIT) |
|||
|
Collection: Biology and Medicine |
|||
| 43 | research>>research>> Engineered Distal Lung Constructs (EDLC) for High Throughput | ||
|
Summary: , bronchopulmonary dysplasia), and acquired (e.g. emphysema, chronic obstructive lung disease (COPD) and lung cancer... can also mimic various acquired pulmonary disease states, such as COPD, emphysema, lung cancer... research>>research>> Engineered Distal ... |
|||
|
Source: Lelkes, Peter I. - School of Biomedical Engineering, Drexel University |
|||
|
Collection: Materials Science ; Biology and Medicine |
|||
| 44 | 10/12/2005 12:15 PMEngelhardt Receives Extended NIH Funding For Lung Stem Cell Study Page 1 of 2http://www.uiowa.edu/~ournews/2005/october/101205engelhardt.html | ||
|
Summary: and chronic bronchitis, and knowledge of lung stem cells may also be relevant and applicable to cancer... 10/12/2005 12:15 PMEngelhardt Receives Extended NIH Funding For Lung Stem Cell Study Page 1 of 2... . 12, 2005 Engelhardt Receives Extended NIH Funding For Lung Stem Cell Study Efforts to understand |
|||
|
Source: Engelhardt, John F. - Department of Anatomy and Cell Biology, University of Iowa |
|||
|
Collection: Biology and Medicine |
|||
| 45 | UNIVERSITE JOSEPH FOURIER GRENOBLE 1 Discipline : BIOLOGIE | ||
|
Summary: ..........................................I. Lung Cancer and Gene Therapy 15... ...............................................................................I.1. Lung Cancer 15... of Lung Cancer 21 .............................................I.2a. Oncogenes and ... |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 46 | Lung Cancer Discovery Award (LCD) Program Description Page 1 of 7 5/25/2011 | ||
|
Summary: Lung Cancer Discovery Award (LCD) Program Description Page 1 of 7 5/25/2011 IMPORTANT NOTES... REFERENCE. The Lung Cancer Discovery Award supports the development of novel medical treatments, advancing... current treatment options and/or finding a cure for lung cancer ... |
|||
|
Source: Gleeson, Joseph G. - Department of Neurosciences, University of California at San Diego |
|||
|
Collection: Biology and Medicine |
|||
| 47 | Magnetic Resonance in Medicine 000:000000 (2011) Quantitative Analysis of Tumor Burden in Mouse Lung | ||
|
Summary: Nehorai1 Lung cancer is the leading cause of cancer death in the United States. Despite recent advances... cancer. Respiratory-gated MRI is a key tool for quantitatively measuring lung-tumor burden and monitoring... the time-course progression of individual tumors in mouse models of ... |
|||
|
Source: Nehorai, Arye - Department of Electrical Engineering, Washington University in St. Louis |
|||
|
Collection: Engineering |
|||
| 48 | R documentation of `GSCA/man/GSCA-package.Rd' etc. | ||
|
Summary: -package . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 LungCancer3 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2 meta... |
|||
|
Source: Kendziorski, Christina - Department of Biostatistics and Medical Informatics, University of Wisconsin at Madison |
|||
|
Collection: Biology and Medicine |
|||
| 49 | What is the report? This is the first collaborative report of the two cancer | ||
|
Summary: rates of cancer: 10% higher for females, 15% for males. · Lung cancer accounted for 1/4 of cancer deaths... 24 8787 5108 all excluding NMS 9077 5839 12233 5118 all cancers 12967 5869 non-melanoma skin lung... was for lip, lung and bladder ... |
|||
|
Source: Paxton, Anthony T. - Department of Pure and Applied Physics, Queen's University Belfast |
|||
|
Collection: Physics ; Materials Science |
|||
| 50 | Acetylcholine Is an Autocrine or Paracrine Hormone Synthesized and Secreted by Airway Bronchial | ||
|
Summary: - nisms by which smoking affects lung cancer growth and development. (Endocrinology 145: 24982506, 2004... of cholinergic signaling have also been reported in lung cancers, and nicotinic acti- vation appears to stimulate... lung cancer cell growth (1517). As well ... |
|||
|
Source: Blakely, Randy - Department of Pharmacology, Vanderbilt University |
|||
|
Collection: Biology and Medicine |
|||
| 51 | Systemic efficacy of oncolytic adenoviruses in imagable orthotopic models of hormone refractory metastatic breast cancer | ||
|
Summary: words: hormone refractory breast cancer; lung metastasis; oncolytic adenovirus; noninvasive imaging... and nonreplicating viruses (Table I) were propa- gated on A549 and 293 cells, respectively. All viruses were puri... been given a value of 1. Systemic treatment model of breast cancer ... |
|||
|
Source: Hemminki, Akseli - Department of Biosciences, University of Helsinki |
|||
|
Collection: Biology and Medicine |
|||
| 52 | CChhaannggeess YYoouurr BBooddyy GGooeess TThhrroouugghh WWhheenn YYoouu QQuuiitt SSmmookkiinngg | ||
|
Summary: : Bronchial tubes relax, making breathing easier Lung capacity starts increasing 2 weeks to 2 months... : Circulation improves Walking becomes easier Lung function increases up to 30% 1 to 9 months: Body's overall... in bronchial tubes regrow, increasing the ability to handle mucus, clean lungs, and reduce infection 3 to 5 |
|||
|
Source: Eustice, Ryan - Departments of Naval Architecture and Marine Engineering & Electrical Engineering and Computer Science, University of Michigan |
|||
|
Collection: Engineering |
|||
| 53 | 136 IEEE REVIEWS IN BIOMEDICAL ENGINEERING, VOL. 2, 2009 Potential of Computer-Aided Diagnosis to | ||
|
Summary: to Improve CT Lung Cancer Screening Noah Lee, Student Member, IEEE, Andrew F. Laine, Senior Member, IEEE... computed tomog- raphy (CT) has rekindled hope that effective lung cancer screening might yet be found... the benefitcost calculus of CT sensitivity and specificity in lung ... |
|||
|
Source: Laine, Andrew F, - Department of Biomedical Engineering, Columbia University |
|||
|
Collection: Biology and Medicine ; Engineering |
|||
| 54 | Pathol Biol (Paris) . Author manuscript The increasing role of amphiregulin in non-small cell lung cancer | ||
|
Summary: -small cell lung cancer Beno t Busserî , Jean-Luc Coll , Amandine Hurbin * Institut d oncologie/d veloppement... .Hurbin@ujf-grenoble.fr > Abstract Non-small cell lung cancers present a 5-year survival rate below 12 . Such a poor prognosis may... be explained by non small cell lung% ... |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 55 | Cancer Therapy: Clinical Oncolytic Adenovirus ICOVIR-7 in Patients with Advanced | ||
|
Summary: was produced on A549 cells by Oncos Therapeu- tics, Inc. (Helsinki, Finland) to avoid the risk of recombina... ,096 Head and neck, N127 10 Bone, lungs 256 Nokisalmi et al. Clin Cancer Res; 16(11) June 1, 2010 Clinical... of cytokines and lung cancer survival in ... |
|||
|
Source: Hemminki, Akseli - Department of Biosciences, University of Helsinki |
|||
|
Collection: Biology and Medicine |
|||
| 56 | Genetic Unmasking of an Epigenetically Silenced microRNA in Human Cancer Cells | ||
|
Summary: . Das, 5 Carlos Caldas, 4 Eric Miska, 5 and Manel Esteller 1 1 Cancer Epigenetics Laboratory and 2 Lung... -937 KG1a REH RS4;11 KOPN8 Hs 819.T A673 H358 CALU3 A549 A427 H2126 H209 miR-124a1 miR-124a2 miR-124a3... analyses of CDK6 expression in lung cancer patients (n = ... |
|||
|
Source: Miska, Eric - Wellcome Trust/Cancer Research UK Gurdon Institute, University of Cambridge |
|||
|
Collection: Biology and Medicine |
|||
| 57 | P2 receptors and cancer Nicholas White and Geoffrey Burnstock | ||
|
Summary: cancer cell line, A549, the expression of functional P2Y2 and P2Y6 receptors has been established [23]. m... groups of patients with advanced cancer, mainly inoperable non-small-cell lung cancer [3840]. The first... -small-cell lung ... |
|||
|
Source: Burnstock, Geoffrey - Autonomic Neuroscience Centre, University College London |
|||
|
Collection: Biology and Medicine |
|||
| 58 | ORIGINAL ARTICLE Oncolytic adenovirus based on serotype 3 | ||
|
Summary: . PC-3MM2 (prostate cancer) (a), A549 (lung cancer) (b), HCT116 (colon cancer) (c) and SKOV3.ip1... in mice with A549 (lung cancer) tumors, although the PBS group had to be terminated ... |
|||
|
Source: Hemminki, Akseli - Department of Biosciences, University of Helsinki |
|||
|
Collection: Biology and Medicine |
|||
| 59 | Oncolytic adenovirus Ad5/3-24 and chemotherapy for treatment of orthotopic ovarian cancer | ||
|
Summary: Microbix (Toronto, Canada) while human lung adenocarcinoma kidney cell line A549 was purchased from... -deficient control [13]. Viruses were amplified on A549 or 293 cells, respectively, and purified on double caesium... (pfu) were determined by standard plaque assay on both ... |
|||
|
Source: Hemminki, Akseli - Department of Biosciences, University of Helsinki |
|||
|
Collection: Biology and Medicine |
|||
| 60 | AHSC in the News Tuesday, September 27, 2011 | ||
|
Summary: AHSC in the News Tuesday, September 27, 2011 EMCOR employees don pink hard hats for breast cancer... Construction View Clip View Clip New $109 million cancer center opens in Gilbert (Arizona Cancer Center... $109 million Banner MD Anderson Cancer Center opens in Gilbert with more than 50 physicians (Arizona |
|||
|
Source: Arizona, University of - Center for Gamma-Ray Imaging |
|||
|
Collection: Engineering ; Biology and Medicine |
|||
| 61 | Int J Cancer . Author manuscript Occupational exposures contribute to educational inequalities in lung | ||
|
Summary: inequalities in lung cancer incidence among men: Evidence from the EPIC prospective cohort study Gwenn... socioeconomic inequalities in lung cancer incidence after adjusting for smoking and dietary factors. Analyses... study), a prospective cohort. Analyses included 703 incident lung ... |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 62 | J Natl Cancer Inst . Author manuscript The role of smoking and diet in explaining educational inequalities in lung | ||
|
Summary: educational inequalities in lung cancer incidence Gwenn Menvielle 1 2 3 * , Hendriek Boshuizen 3 , Anton E... Background Studies in many countries have reported higher lung cancer incidence and mortality in individuals... at study entry and gathered data on lung ... |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 63 | ORIGINAL ARTICLE Changing the adenovirus fiber for retaining gene | ||
|
Summary: and viruses A549 lung adenocarcinoma cells were obtained from American Type Culture Collection (ATCC, Manassas... -modified viruses. Anti-Ad5(GL) NAb blocked intravenous Ad5(GL) gene transfer to orthotopic lung cancer xenografts... , whereas capsid-modified viruses were not affected. When ... |
|||
|
Source: Hemminki, Akseli - Department of Biosciences, University of Helsinki |
|||
|
Collection: Biology and Medicine |
|||
| 64 | WINTER 2011 Clinical Research | ||
|
Summary: for both early and advanced stage non-small cell lung cancer, as well as for other thoracic malignancies... WINTER 2011 Thoracic Oncology Group Novel Care for Non-small Cell Lung Cancer Patients: Individualized... treatments for both early and advanced stage non-small cell lung ... |
|||
|
Source: Bogyo, Matthew - Department of Microbiology and Immunology, Stanford University |
|||
|
Collection: Biology and Medicine |
|||
| 65 | Histology of Breast Cancer Metastasis Theresa Reno | ||
|
Summary: the stroma. #12;Common secondary sites of breast cancer metastasis: 1. Bone 2. Lungs 3. Liver 4. Brain... Histology of Breast Cancer Metastasis Theresa Reno 11/18/08 #12;Hanahan and Weinberg, Cell 2000... Cancer: 6 Hallmarks #12;Breast Anatomy and Histology Normal Breast Histology - H&E Stain Ross and ... |
|||
|
Source: Gleeson, Joseph G. - Department of Neurosciences, University of California at San Diego |
|||
|
Collection: Biology and Medicine |
|||
| 66 | VOLTAGE-GATED SODIUM CHANNELS: NEW TARGETS IN CANCER Sbastien ROGER, Marie POTIER, Christophe VANDIER, Pierre BESSON and Jean-Yves LE | ||
|
Summary: are summarised here. In this study, 4 cancer cell lines (H23, H460, A549, Calu-1) and 2 non-cancerous epithelial... and their biological roles in different cancers such as prostate, breast, lung (small cells and non-small cells... physiology can be the same as the ... |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 67 | PrtT-Regulated Proteins Secreted by Aspergillus fumigatus Activate MAPK Signaling in Exposed A549 | ||
|
Summary: Activate MAPK Signaling in Exposed A549 Lung Cells Leading to Necrotic Cell Death. PLoS ONE 6(3): e17509... that A. fumigatus conidia bind to A549 type-II-like lung epithelial cells and to PLoS ONE | www... of cultured A549 ... |
|||
|
Source: Shamir, Ron - School of Computer Science, Tel Aviv University |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 68 | A Distributed Biomarker Atlas for Lung Research aiding the Discovery and Early Detection of Cancer Biomarkers | ||
|
Summary: A Distributed Biomarker Atlas for Lung Research aiding the Discovery and Early Detection of Cancer... Atlas software system that allows a researcher to correlate lung cancer patients with similar... for lung cancer researchers to browse lung ... |
|||
|
Source: Mattmann, Chris - Jet Propulsion Laboratory & Department of Computer Science, University of Southern California |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 69 | Algorithmic guided screening of drug combinations of arbitrary size for activity against cancer cells | ||
|
Summary: 524 Mol Cancer Ther 2009;8(3). March 2009 #12;given the independent ability of DMSO to inhibit A549... and the number of drugs. Using a WST-1 assay on the A549 cell line, through MACS, we screened 72 combinations... in A549, the one cell line in ... |
|||
|
Source: Popova, Elmira - Department of Mechanical Engineering, University of Texas at Austin |
|||
|
Collection: Engineering |
|||
| 70 | THE JOURNAL OF GENE MEDICINE RESEARCH ARTICLE J Gene Med 2003; 5: 300310. | ||
|
Summary: carcinoma line, HepG2, and the lung carcinoma cell line, A549, were obtained from the American Type Culture... [19]. SLPI promoter activity in this cell line was 6.9% the activity of the CMV promoter. A549 cells... of luciferase. With the exception of ... |
|||
|
Source: Hemminki, Akseli - Department of Biosciences, University of Helsinki |
|||
|
Collection: Biology and Medicine |
|||
| 71 | The role of uPAR signaling in lung cancer Background and significance | ||
|
Summary: The role of uPAR signaling in lung cancer Background and significance Lung cancer is the leading... of lung cancer non-small-cell-lung cancer (about 85% of all lung cancer cases) and ... |
|||
|
Source: Gleeson, Joseph G. - Department of Neurosciences, University of California at San Diego |
|||
|
Collection: Biology and Medicine |
|||
| 72 | Clinical studies indicate that stress, chronic depression, social support and other psycho- | ||
|
Summary: in increased lung metastasis from injected breast cancer cells2124 . Swim stress, laparotomy (opening the abdo... factors might influence cancer onset and progression15 . Recent mechanistic stud- ies have identified... are described separately, there are numerous interactions between them, reflecting the complexity of ... |
|||
|
Source: Meagher, Mary - Department of Psychology, Texas A&M University |
|||
|
Collection: Biology and Medicine |
|||
| 73 | An integrated clinical, CT, PFT database to better define an at risk population to screen for lung cancer | ||
|
Summary: 01@med.nyu.edu BACKGROUND Routine CT screening for lung cancer is currently not recommended... for developing lung cancer. METHODS The NYU Lung Cancer Biomarker Center has enrolled 1358 smokers and followed... them prospectively for up to 6 years for the development ... |
|||
|
Source: Mattmann, Chris - Jet Propulsion Laboratory & Department of Computer Science, University of Southern California |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 74 | Infectivity-Enhanced Adenoviruses Deliver Efficacy in Clinical Samples and Orthotopic Models of Disseminated Gastric Cancer | ||
|
Summary: of peritoneally disseminated gastric cancer. Materials and Methods Cells and tissues. A549 human lung... ) were propagated on A549 and 293 cells, respectively, and purified on cesium chloride gradients... of Disseminated Gastric Cancer Lotta ... |
|||
|
Source: Hemminki, Akseli - Department of Biosciences, University of Helsinki |
|||
|
Collection: Biology and Medicine |
|||
| 75 | Elsevier Editorial System(tm) for Pathologie Biologie Manuscript Draft | ||
|
Summary: : The increasing role of amphiregulin in non-small cell lung cancer Le rôle grandissant de l'amphiréguline dans le... lung cancer; gefitinib; growth factor; apoptosis; drug resistance; EGFR, targeted therapy; tyrosine... ) Titre/Auteurs/Coordonnées inserm-00333661,version1-23Oct2008 #12;Abstract Non-small ... |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 76 | doi:10.1016/j.ijrobp.2003.12.010 BIOLOGY CONTRIBUTION | ||
|
Summary: . REFERENCES 1. Abratt RP, Morgan GW. Lung toxicity following chest irra- diation in patients with lung cancer... . Lung Cancer 2002;35: 103109. 2. Lingos TI, Recht A, Vicini F. Radiation pneumonitis in breast cancer... DR, You HS, et al. Radiation pneumonitis ... |
|||
|
Source: Duke University, Center for In Vivo Microscopy |
|||
|
Collection: Biology and Medicine |
|||
| 77 | Treatment of prostate cancer with Ad5/3#24hCG allows non-invasive detection of the magnitude | ||
|
Summary: lung adenocarcinoma cell line A549 from the American Type Culture Collection. 911 cells are courtesy... the survival of mice with hormone refractory prostate cancer metastatic to the lung. Detection of hCGB in serum... was released by PacI digestion and transfection into 911 cells. The ... |
|||
|
Source: Hemminki, Akseli - Department of Biosciences, University of Helsinki |
|||
|
Collection: Biology and Medicine |
|||
| 78 | Targeted Diseases The LSU Health Science Center Gene Therapy Program has embraced the mission to | ||
|
Summary: of brain cells. The result is the progressive destruction of the nervous system. #12;· Lung cancer affects... . Lung cancer may be spread to the lymph nodes, or to other organs or tissues of the body... from lung cancer. · Prostate cancer is the ... |
|||
|
Source: Louisiana State University Health Sciences Center in New Orleans, Department of Biochemistry and Molecular Biology |
|||
|
Collection: Biology and Medicine |
|||
| 79 | ORIGINAL ARTICLE The neuronal repellent SLIT2 is a target for repression by EZH2 | ||
|
Summary: cells with 5-aza-20 -deoxycytidine and monitored the SLIT2 level. We used the A549 lung cancer cell line... TTTAGTTGTTTCGTGCGTTTTGTTATGGGTTTGTTGGGTTTTCGTGTTTTTTAGTTTTCGGAGTTTATTTTGATTG Input IgG3mC LNCaP A549PC3 Figure 4 DNA methylation of SLIT2 promoter in prostate ... |
|||
|
Source: Wu, Jane Y. - Center for Genetic Medicine & Department of Neurology, Northwestern University |
|||
|
Collection: Biology and Medicine |
|||
| 80 | WHAT'S NEXT? Members and | ||
|
Summary: , female breast cancer, bone cancer and leukemia, as well as the lung cancer mortality estimates from our... and Government Public Health Officials Individuals with Concern about their Cancer Risks NCEH will work... residents about cancer or other health outcomes that ... |
|||
|
Source: National Center for Environmental Health- Publications and Products |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 81 | Systematic discovery of multicomponent therapeutics Alexis A. Borisy, Peter J. Elliott, Nicole W. Hurst, Margaret S. Lee, Joseph Lehar, E. Roydon Price, George Serbedzija, | ||
|
Summary: Xenograft Assay. A549 lung carci- noma cells were injected into severe combined immunodeficient (SCID) mice... fibroblasts, A549 lung carcinoma cells, or mouse skin fibroblasts (data not shown), indi- cating... as an anticancer drug (Fig. 4 AC). In combination, ... |
|||
|
Source: Stockwell, Brent R. - Department of Biological Sciences, Columbia University |
|||
|
Collection: Biology and Medicine |
|||
| 82 | Antinuclear Antibodies as Potential Markers of Lung Cancer1 Felix Fernandez-Madrid,2 | ||
|
Summary: Antinuclear Antibodies as Potential Markers of Lung Cancer1 Fe´lix Ferna´ndez-Madrid,2 Pamela J... of ANAs in lung cancer. We have previously reported that autoantibodies to collagen antigens resembling... those found in the connective tissue diseases are consistently detected in the sera from ... |
|||
|
Source: VandeVord, Pamela - Department of Biomedical Engineering, Wayne State University |
|||
|
Collection: Engineering ; Biology and Medicine |
|||
| 83 | THE JOURNAL OF GENE MEDICINE RESEARCH ARTICLE J Gene Med 2008; 10: 744753. | ||
|
Summary: . Induction of COX-2 protein expression by vanadate in A549 human lung carcinoma cell line through EGF... NSCLC cell line A549 (ATCC CCL-185) and human transformed embryonic kidney cell line 293 (ATCC CRL-1573... . 293 and A549 cells were used in ... |
|||
|
Source: Hemminki, Akseli - Department of Biosciences, University of Helsinki |
|||
|
Collection: Biology and Medicine |
|||
| 84 | BioMed Central Page 1 of 8 | ||
|
Summary: -). A549 cells (human lung epi- thelial carcinoma cell line, model of human alveolar epi- thelial type... -) stimulation of differentiated small airway epithelial cells (SAECs, generation 1012) and A549 cells (model... monolayers of SAECs and ... |
|||
|
Source: George, Steven C. - Department of Biomedical Engineering, University of California, Irvine |
|||
|
Collection: Biology and Medicine |
|||
| 85 | Current Cancer Therapy Reviews, 2009, 5, 281-287 281 1573-3947/09 $55.00+.00 2009 Bentham Science Publishers Ltd. | ||
|
Summary: -Small Cell Lung Cancer Joshua D. Lawson*, Ajay Sandhu, Steve Jiang and Arno J. Mundt University of California... , La Jolla, CA 92093-0943, USA Abstract: Patients with early stage non small cell lung cancer (NSCLC... - dence, SRT appears to be effective, convenient and well tolerated. Key Words: ... |
|||
|
Source: Bewley, Thomas - Department of Mechanical and Aerospace Engineering, University of California at San Diego |
|||
|
Collection: Engineering |
|||
| 86 | Molecular and Cellular Pathobiology Inhibition of miR-193a Expression by Max and RXRa | ||
|
Summary: of hepatocellular cancer cells (Hep3B), but it has little, if any, effect on prostate (PC3), lung (A549... cell types, mouse xenografts, and human cancer patients. A, soft agar colony formation in lung (A549... ... |
|||
|
Source: |
|||
|
Collection: Biology and Medicine |
|||
| 87 | Household coal use and lung cancer: systematic review and meta-analysis of casecontrol | ||
|
Summary: Household coal use and lung cancer: systematic review and meta-analysis of casecontrol studies... , there is still uncertainty about the level of risk for lung and other cancers. Methods We performed a meta... household coal use and lung cancer risk, and to explore ... |
|||
|
Source: |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 88 | Eur J Cancer. Author manuscript Social inequalities in cancer incidence and cancer survival: Lessons from | ||
|
Summary: inequalities in the incidence of many cancer sites, especially lung ( ), oesophagus, stomach ( ),17 18 mouth... and incidence of lung cancer and cervical cancer, no association for Hodgkin and non-Hodgkin s lymphoma... been found for instance for lung ( ) or alcohol ... |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 89 | Lung cancer...115 Chapter 11 | ||
|
Summary: NICR/NCRI Lung cancer...115 Chapter 11: Lung cancer (including trachea, bronchus and lung; C33-C34... of lung cancer diagnosed each year in Ireland during 2000-2004. o Male incidence rates decreased by 1... by 2.7%. o Higher levels of treatment ... |
|||
|
Source: Paxton, Anthony T. - Department of Pure and Applied Physics, Queen's University Belfast |
|||
|
Collection: Physics ; Materials Science |
|||
| 90 | 750 Morton Blvd. Hazard, KY 41701 (606) 439-3557 http://www.mc.uky.edu/ruralhealth/rcpc.asp | ||
|
Summary: skin cancer. It is also the second leading cause of cancer deaths among women behind lung cancer... ://www.mc.uky.edu/ruralhealth/rcpc.asp Important Facts You Should Know About Breast Cancer The Basic Facts: Breast cancer is abnormal cell growth... (glands that make ... |
|||
|
Source: Hayes, Jane E. - Department of Computer Science, University of Kentucky |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 91 | In The News Monday, January 03, 2011 | ||
|
Summary: In The News Monday, January 03, 2011 Lung-transplant recipient to walk in Fiesta Bowl Parade 12... Institute and the Arizona Cancer Center) 12/28/2010 Medical News Today View Clip Fans ask: Is it true Aretha... Franklin died today? (The University of Arizona's Arizona Cancer Center offers hope and compassion |
|||
|
Source: Arizona, University of - Center for Gamma-Ray Imaging |
|||
|
Collection: Engineering ; Biology and Medicine |
|||
| 92 | 10.1038/nrd2164 http://www.ncbi.nlm.nih.gov/ | ||
|
Summary: and lung cancer. In the renal model they implanted a slow-release pellet of PAC1, and in the lung model... of the drug. Finally, they injected lung cancer cells into the tail vein of mice and gave PAC1 orally on days... that can be exploited to induce death in ... |
|||
|
Source: Hergenrother, Paul J. - Department of Chemistry, University of Illinois at Urbana-Champaign |
|||
|
Collection: Chemistry |
|||
| 93 | TP53 gene mutations of lung cancer patients in upper northern Thailand and environmental risk factors | ||
|
Summary: TP53 gene mutations of lung cancer patients in upper northern Thailand and environmental risk... mutations are observed in about 40e70% of lung cancer tissues, and the hot spot codon mu- tations... factors that influence TP53 gene mutation in lung cancer patients ... |
|||
|
Source: |
|||
|
Collection: Biology and Medicine |
|||
| 94 | IN AUGUST 2007, KEVIN BRUMETT, AN athletic 29-year-old Massachusetts man, was | ||
|
Summary: why he was having severe back and stomach pain: He had advanced lung cancer. Brumett was young and had... in a small fraction of patients with his type of cancer, non-small cell lung cancer, the most common form... been diagnosed with non-small cell lung ... |
|||
|
Source: Mootha, Vamsi K. - Department of Systems Biology, Harvard University |
|||
|
Collection: Biology and Medicine |
|||
| 95 | Scientists find unusual lung cancer tumour-suppressor gene -Research Monday, January 23, 2006 | ||
|
Summary: Scientists find unusual lung cancer tumour-suppressor gene - Research Monday, January 23, 2006 Due... Scientists find unusual lung cancer tumour-suppressor gene Saturday, January 21, 2006 12:00 IST Columbus... in cancers of the lung and head and neck. The study shows ... |
|||
|
Source: Selvin, Paul R. - Department of Physics, University of Illinois at Urbana-Champaign |
|||
|
Collection: Physics ; Materials Science |
|||
| 96 | SCENARIOS OF FUTURE LUNG CANCER INCIDENCE BY EDUCATIONAL LEVEL: MODELLING STUDY IN DENMARK | ||
|
Summary: 1 SCENARIOS OF FUTURE LUNG CANCER INCIDENCE BY EDUCATIONAL LEVEL: MODELLING STUDY IN DENMARK Gwenn... : 10.1016/j.ejca.2010.07.027 #12;2 Abstract Objective: To model future trends in lung cancer incidence... in Denmark by education under different scenarios for cigarette smoking. Methods: ... |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 97 | Clinical Studies Oncolytic Adenovirus Coding for Granulocyte Macrophage | ||
|
Summary: I and transfected into A549 cells for amplification and rescue. All phases of the cloning were confirmed with PCR... the integrity of the fiber and GMCSF cDNA. All phases of the virus production were done on A549 cells to avoid... adenocarcinoma cell line A549 and TF1 ... |
|||
|
Source: Hemminki, Akseli - Department of Biosciences, University of Helsinki |
|||
|
Collection: Biology and Medicine |
|||
| 98 | Supplemental Data Prolonged Rapamycin Treatment | ||
|
Summary: human rh30 human Glioblastoma u87 null human 827 null human Lung Cancer A549 human H460 human Renal... treatment on Akt/PKB phosphorylation Tissue of Origin/Cancer Type Cell Line Name Strong Inhibition Partial... human U937 null human WEHI mouse K562 null human Breast ... |
|||
|
Source: Sabatini, David M. - Whitehead Institute for Biomedical Research & Department of Biology, Massachusetts Institute of Technology (MIT) |
|||
|
Collection: Biology and Medicine |
|||
| 99 | www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences, | ||
|
Summary: for humans, but this and other questions need continuing study to ensure a safe food supply. Lung Cancer... and Diet Smoking is clearly associated with high death rates from lung cancer. More women now die from lung... cancer than breast cancer, ... |
|||
|
Source: Liskiewicz, Maciej - Institut für Theoretische Informatik, Universität zu Lübeck |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 100 | Integrin targeted oncolytic adenoviruses Ad5-D24-RGD and Ad5-RGD-D24-GMCSF for treatment of patients with advanced chemotherapy refractory solid tumors | ||
|
Summary: in vitro Lung cancer (A549) and breast cancer (MDA-MB-436) cells were infected and cell viability... Lung adenocarcinoma A549 and breast carcinoma MDA-MB-436 cell lines were acquired from ATCC (American... was transfected ... |
|||
|
Source: Hemminki, Akseli - Department of Biosciences, University of Helsinki |
|||
|
Collection: Biology and Medicine |
|||