Summary:  perineural vascular plexus. Localized ectopic expression of heparin-binding VEGF165 or VEGF189 from... differential affinity for the extracellular matrix. VEGF165 and VEGF189 interact moderately or strongly... vectors The human VEGF121, VEGF165 and VEGF189 cDNAs ...

Source: Bautch, Victoria L. - Department of Biology, University of North Carolina at Chapel Hill

Collection: Biology and Medicine

Summary:  VEGF producing cells appear to preferentially express VEGF 121, VEGF 165 and VEGF 189. These three... already been described (28). The addition of VEGF 189, 165, 121 cDNAs sequence at the 30 extremity... SP VEGF 121 E5/8 +1 CUG AUG mSP VEGF 189 E5/6/7/8 +1 CUG AUG mSP ...

Source: Ecole Polytechnique, Centre de mathématiques

Collection: Mathematics

Summary:  . Idea · take exon structures for known genes (e.g. RefSeq, Ensembl) · use Protein domain families (Pfam... ) and annotate the known protein · consider putative splice forms that arise from exon skipping and/or intron... exons Pfam score: 100 intron retention: Pfam score > 100exon skipping: Pfam score ...

Source: Bejerano, Gill - Departments of Computer Science & Developmental Biology, Stanford University

Collection: Computer Technologies and Information Sciences ; Biology and Medicine

Summary:  NEWS AND COMMENTARY Human specific exons... ............................................................... When new exons are born R Sorek... to the common belief before the genomic era, we now know that new exons are frequently `born' in the genomes

Source: Sorek, Rotem - Department of Molecular Genetics, Weizmann Institute of Science

Collection: Biology and Medicine

Summary:  Origin and evolution of new exons in rodents Wen Wang,1,9,10 Hongkun Zheng,2,9 Shuang Yang,1... that new gene origination is a fundamental biological process in evolution. Exon shuffling has been... universally observed in the formation of new genes. Yet to be learned are the ways new exons originate

Source: Samudrala, Ram - Department of Microbiology, University of Washington at Seattle

Collection: Biotechnology ; Biology and Medicine

Summary:  bioinformatic analyses have shown that con- served alternative exons possess several features that distinguish... them from alternative exons that are species-specific. One of the most striking differ- ences between... conserved and species-specific alternative exons is the high percentage of exons that ...

Source: Ast, Gil - Department of Molecular Genetics and Biochemistry, Tel Aviv University

Collection: Biology and Medicine

Summary:  .D. January, 2001 #12;FlexJetTMExon Arrays can validate Exon Predictions and assemble Gene Structures... Predicted exon Predicted exon One or more Probes per Predicted Exon Verify predicted exons on a genome... -wide scale. Group exons into genes via co-regulation. ...

Source: Boguski, Mark S. - Center for Biomedical Informatics, Harvard University

Collection: Mathematics ; Biology and Medicine

Summary:  splicing (or `noise'). To address this question, we compared alternatively spliced cassette exons... that are conserved between human and mouse with EST-predicted cas- sette exons that are not conserved in the mouse... gen- ome. Presumably, conserved exon-skipping events represent functional alternative splicing. We

Source: Ast, Gil - Department of Molecular Genetics and Biochemistry, Tel Aviv University; Lycan, Deborah E. - Department of Biology, Lewis and Clark College; Sorek, Rotem - Department of Molecular Genetics, Weizmann Institute of Science

Collection: Biology and Medicine

Summary:  Research article Assessing the number of ancestral alternatively spliced exons in the human genome Rotem Sorek*1... have between one and dozens of alternative exons, the number of alternatively spliced genes by itself... exons that undergo alternative splicing. We have previously described an accurate machine

Source: Shamir, Ron - School of Computer Science, Tel Aviv University; Sorek, Rotem - Department of Molecular Genetics, Weizmann Institute of Science

Collection: Biology and Medicine ; Computer Technologies and Information Sciences

Summary:  that distin- guish exons subject to evolutionarily conserved AS, which we call alternative conserved exons... (ACEs), from other orthologous human mouse exons and integrate these features into an exon... classification algorithm, ACESCAN. Genome-wide analysis of annotated orthologous human­mouse ...

Source: Poggio, Tomaso - Center for Biological and Computational Learning, Massachusetts Institute of Technology (MIT)

Collection: Biology and Medicine

Summary:  #12;Table des illustrations 9 FIGURE 29: ACTIVATION D'EPISSAGE PAR LES PROTEINES SR D'UNE MANIERE EXON... extracellulaire EGF: Epidermal Growth Factor EJC: Exon Junction Complex ELISA: Enzyme-linked immunosorbent assay... ESE: Exonic Splicing Enhancer ESS: Exonic Splicing Silencer FADD: Fas Associated Death ...

Source: Ecole Polytechnique, Centre de mathématiques

Collection: Mathematics

Summary:  MINI-REVIEW The birth of new exons: Mechanisms and evolutionary consequences ROTEM SOREK Genomics... to hypotheses concerning the origin of ancient introns and exons, but accumulating evidence indicates that new... exons are also constantly being added to evolving genomes. Several mechanisms contribute to the creation

Source: Sorek, Rotem - Department of Molecular Genetics, Weizmann Institute of Science

Collection: Biology and Medicine

Summary:  Non-EST based prediction of exon skipping and intron retention events using Pfam information... -wide manner to all human RefSeq transcripts and pre- dicted a total of 321 exon skipping and intron retention... preference of alternative exon junctions to be loc- ated at the protein surface and to avoid secondary

Source: Will, Sebastian - Lehrstuhl für Bioinformatik, Institut für Informatik, Albert-Ludwigs-Universität Freiburg

Collection: Computer Technologies and Information Sciences ; Biology and Medicine

Summary:  Selection for Modularity in the Genome: Reading Frame Evidence for Exon Shuffling ? Lee Altenberg... : exon shuffling, modularity, reading frame, evolution Abstract. During the addition of new, adaptive... genes. When applied to the evolution of exons, this idea predicts that there should be a predominance

Source: Altenberg, Lee - Department of Information and Computer Science, University of Hawai'i at Manoa

Collection: Computer Technologies and Information Sciences

Summary:  and Inducible Splicing-regulatory Elements in Each of the Variable Exons*S Received for publication,July 25... of alternative splicing of exons 4­6. Expression of the CD45 isoforms is tightly regulated in peripheral T cells... variable exons. In con- trast, activated T cells express CD45 isoforms encoded by mRNAs lacking most ...

Source: Lynch, Kristen W. - Department of Biochemistry and Biophysics, University of Pennsylvania

Collection: Biology and Medicine

Summary:  A Non-EST-Based Method for Exon-Skipping Prediction Rotem Sorek,1,2,4 Ronen Shemesh,2 Yuval Cohen,2... predict that an internal exon is skipped (namely whether it is a cassette-exon) merely based on its naked... underrepresentation of splice variants involving exons that are in the middle of long transcripts ...

Source: Sorek, Rotem - Department of Molecular Genetics, Weizmann Institute of Science

Collection: Biology and Medicine

Summary:  A Non-EST-Based Method for Exon-Skipping Prediction Rotem Sorek,1,2,4 Ronen Shemesh,2 Yuval Cohen,2... predict that an internal exon is skipped (namely whether it is a cassette-exon) merely based on its naked... underrepresentation of splice variants involving exons that are in the middle of long transcripts ...

Source: Ast, Gil - Department of Molecular Genetics and Biochemistry, Tel Aviv University

Collection: Biology and Medicine

Summary:  Selection for Modularity in the Genome: Reading Frame Evidence for Exon Shuffling Lee Altenberg... : exon shuffling, modularity, reading frame, evolution Abstract. During the addition of new, adaptive... genes. When applied to the evolution of exons, this idea predicts that there should be a predominance

Source: Altenberg, Lee - Department of Information and Computer Science, University of Hawai'i at Manoa; Brutlag, Doug - Department of Biochemistry, Stanford University

Collection: Biology and Medicine ; Computer Technologies and Information Sciences

Summary:  The ``Alternative'' Choice of Constitutive Exons throughout Evolution Galit Lev-Maor1[ , Amir Goren... of Neurobiochemistry, Tel Aviv University, Tel Aviv, Israel Alternative cassette exons are known to originate from two... processes--exonization of intronic sequences and exon shuffling. Herein, we suggest ...

Source: Pupko, Tal - Department of Cell Research and Immunology, Tel Aviv University

Collection: Biology and Medicine

Summary:  The ``Alternative'' Choice of Constitutive Exons throughout Evolution Galit Lev-Maor1[ , Amir Goren... of Neurobiochemistry, Tel Aviv University, Tel Aviv, Israel Alternative cassette exons are known to originate from two... processes--exonization of intronic sequences and exon shuffling. Herein, we suggest ...

Source: Ast, Gil - Department of Molecular Genetics and Biochemistry, Tel Aviv University

Collection: Biology and Medicine

Summary:  for skipped exons using exon-exon junction microarray data. We compare these exons with known literature... -verified EST skipped exons and exons predicted to be skipped in both human and mouse. After deriving tissue... -specific skipped exon sets for brain, heart, ...

Source: Poggio, Tomaso - Center for Biological and Computational Learning, Massachusetts Institute of Technology (MIT)

Collection: Biology and Medicine

Summary:  Alu Exonization Events Reveal Features Required for Precise Recognition of Exons by the Splicing... short exonic islands within the vast intronic oceans remains to a large extent obscure. In this study... , we analyzed Alu exonization events, aiming to understand the requirements for correct selection

Source: Ast, Gil - Department of Molecular Genetics and Biochemistry, Tel Aviv University

Collection: Biology and Medicine

Summary:  ExonHunter: A Comprehensive Approach Tom´as Vinar, Brona Brejov´a, Ming Li, Dan Brown tvinar... @cs.uwaterloo.ca (To appear in ISMB 2005) 1 #12;ExonHunter architecture superadvisor HMM-based genefinder Drosophila... mouse genome result advisors 2 #12;Evidence combination for single position in ExonHunter DNA sequence

Source: Foissac, Sylvain - Centre de Regulació Genòmica, Barcelona

Collection: Biotechnology

Summary:  Intronic Sequences Flanking Alternatively Spliced Exons Are Conserved Between Human and Mouse Rotem... and alternative splicing regulation, we developed a method to identify exons that are alternatively spliced... in both human and mouse. We compiled two exon sets: one of alternatively spliced conserved exons

Source: Ast, Gil - Department of Molecular Genetics and Biochemistry, Tel Aviv University; Sorek, Rotem - Department of Molecular Genetics, Weizmann Institute of Science

Collection: Biology and Medicine

Summary:  expression: introns are removed and exons are ligated to form mRNA. The inclusion of different exons in m... throughout the phylogenetic tree. However, we still have much to learn about how diverse intron­exon... extended our evolutionary understanding. The basis of splicing is the recognition of introns and ...

Source: Ast, Gil - Department of Molecular Genetics and Biochemistry, Tel Aviv University

Collection: Biology and Medicine

Summary:  Efficient internal exon recognition depends on near equal contributions from the 30 and 50 splice... by the spliceo- some, which identifies exons and removes inter- vening introns. In vertebrates, most splice sites... are initially recognized by the spliceosome across the exon, because most exons are small ...

Source: Hertel, Klemens J. - Department of Microbiology and Molecular Genetics, University of California, Irvine

Collection: Biology and Medicine

Summary:  1 Origins of New Genes:Origins of New Genes: ExonExon ShufflingShuffling By Carl Hillstrom #12... ;2 · The talk is about how the shuffling of exons can give rise to new genes. #12;3 Merriam... Merriam--Webster OnlineWebster Online DictionaryDictionary Main Entry: ex·on Pronunciation: 'ek-"sän Function: noun

Source: Sargent, Robert Craig - Department of Biology, University of Kentucky

Collection: Environmental Sciences and Ecology

Summary:  CORRESPONDENCE Comparison of a proteomic approach with a microarray- based approach to detect exons... in the mouse genome TotheEditor: Recently, Frey and colleagues predicted more than 1.14 million putative exon... sequences from the mouse genome, among which are 155,839 sequences identified using exon microarrays andthe

Source: Tian, Weidong - Institute of Biochemistry and Cell Biology, Shanghai Institute of Biological Sciences

Collection: Biology and Medicine

Summary:  Distribution of SR protein exonic splicing enhancer motifs in human protein-coding genes Jinhua... August 16, 2005 ABSTRACT Exonic splicing enhancers (ESEs) are pre-mRNA cis- acting elements required... in consti- tutive internal protein-coding exons, compared with both their flanking intronic regions

Source: Zhang, Michael Q.- Watson School of Biological Sciences, Cold Spring Harbor Laboratory

Collection: Biotechnology

Summary:  Cyp4PromExon1.F Forward 21 CTTGCTATCTATGGCAGGACC 34252 Cyp4PromExon1.R Reverse 21... 61071 Cyp4Ex13R2a Reverse 20 GTTCATTGCATCGAGACAGT 62380 Exon 13 + UTR Exon 13 + UTR Exons 7, 8, & 9 Exon... 10 Exons 11 & 12 Exons ...

Source: Di Rienzo, Anna - Department of Human Genetics, University of Chicago

Collection: Biology and Medicine

Summary:  or silencing. Here we use molecular approaches to identify a ternary combination of exonic UAGG and 59-splice... -site-proximal GGGG motifs that functions cooperatively to silence the brain-region-specific CI cassette exon (exon 19... the CI cassette into a constitutive exon, while predominant skipping was ...

Source: Poggio, Tomaso - Center for Biological and Computational Learning, Massachusetts Institute of Technology (MIT)

Collection: Biology and Medicine

Summary:  nucleotide transition in the duplicated copy of the gene (SMN2) leads to exon 7 skipping and expression... by the disruption of an exonic splicing enhancer. Here we show that the single nucleotide difference reduces... the intrinsic strength of the 3' splice site of exon 7 two-fold while the strength of the 5' splice site

Source: Hertel, Klemens J. - Department of Microbiology and Molecular Genetics, University of California, Irvine

Collection: Biology and Medicine

Summary:  (received for review March 30, 2005) The exon intron architecture of genes determines whether com- ponents... of the spliceosome recognize splice sites across the intron or across the exon. Using in vitro splicing assays, we... nucleotides. Beyond this threshold, splice sites are recognized across the exon. Splice-site ...

Source: Hertel, Klemens J. - Department of Microbiology and Molecular Genetics, University of California, Irvine

Collection: Biology and Medicine

Summary:  The Emergence of Alternative 39 and 59 Splice Site Exons from Constitutive Exons Eli Koren, Galit... cassette exons are known currently. In this study, we compared the characteristics of constitutive exons... , alternative cassette exons, and alternative 39ss and 59ss ...

Source: Ast, Gil - Department of Molecular Genetics and Biochemistry, Tel Aviv University

Collection: Biology and Medicine

Summary:  sequences provide new exons for host genes The generation of new exons and new genes is a major force... that advances genomic complexity. Three mecha- nisms are thought to be responsible for the origin of new exons... . Two of these yield new exons within existing genes. The first is known as ...

Source: Ast, Gil - Department of Molecular Genetics and Biochemistry, Tel Aviv University

Collection: Biology and Medicine

Summary:  Induce Alternative Exon Skipping through Their Activities on the Flanking Constitutive Exons Joonhee Han... exon inclusion in regulated splicing through exonic splicing enhancers. SR proteins have also been... reported to cause exon skipping, but little is known about the mechanism. We ...

Source: Hertel, Klemens J. - Department of Microbiology and Molecular Genetics, University of California, Irvine

Collection: Biology and Medicine

Summary:  Research article Exonization of the LTR transposable elements in human genome Jittima Piriyapongsa1, Nalini... into an intron or a gene flanking region, and subsequent incorporation into an exon. Results: We found that Long... retrotransposons were observed in protein-coding regions, while 50 distinct protein coding exons in 45 ...

Source: Borodovsky, Mark - School of Biology, Georgia Institute of Technology

Collection: Biotechnology ; Environmental Sciences and Ecology

Summary:  the primary determinant to signal-induced synchronized changes in transcriptionof CD45 variable exon exclusion... - As a model for dissecting signal-regulated alternativeinduced skipping of a heterologous exon. Additionally... variable exons that occurs in response to antigen-to sequences in other signal-regulated genes, sug

Source: Lynch, Kristen W. - Department of Biochemistry and Biophysics, University of Pennsylvania

Collection: Biology and Medicine

Summary:  for the identification of protein-coding exons using human/mouse sequence comparisons. The test takes advantage... ) most of the human and mouse exons are sufficiently long and have a suitable degree of sequence... divergence for the test to perform reliably; (2) the test is suited for the identification of long exons

Source: Gu, Xun - Department of Genetics, Development and Cell Biology, Iowa State University

Collection: Environmental Sciences and Ecology ; Biotechnology

Summary:  Alu-Containing Exons are Alternatively Spliced Rotem Sorek,1,2,4 Gil Ast,3 and Dan Graur1 1... in the human genome, comprising more than one-tenth of it. Numerous studies describe exonizations of Alu... the connection between the exonization of Alu elements and alternative splicing, we used a database of ESTs and c

Source: Ast, Gil - Department of Molecular Genetics and Biochemistry, Tel Aviv University; Graur, Dan - Department of Biology and Biochemistry, University of Houston

Collection: Biology and Medicine ; Environmental Sciences and Ecology

Summary:  Alu-Containing Exons are Alternatively Spliced Rotem Sorek,1,2,4 Gil Ast,3 and Dan Graur1 1... in the human genome, comprising more than one-tenth of it. Numerous studies describe exonizations of Alu... the connection between the exonization of Alu elements and alternative splicing, we used a database of ESTs and c

Source: Sorek, Rotem - Department of Molecular Genetics, Weizmann Institute of Science

Collection: Biology and Medicine

Summary:  evolutionary forces apply to alternatively and constitu- tively splice exons? Do similar forces act on all... is ``improper'' rec- ognition of exons and introns allowed by the splicing machinery? In this review, we... from an mRNA precursor (pre-mRNA) and exons are ligated to form a mature mRNA.(1) Most types

Source: Ast, Gil - Department of Molecular Genetics and Biochemistry, Tel Aviv University

Collection: Biology and Medicine

Summary:  are usually completely ignored by the cellular splicing machinery. Even at the level of exon definition... , pseudo exons defined by such false splices sites outnumber real exons by an order of magnitude. We used... a support vector machine to discover sequence information that could be used to distinguish real ...

Source: Heller, Katherine - Department of Brain and Cognitive Science, Massachusetts Institute of Technology (MIT)

Collection: Computer Technologies and Information Sciences

Summary:  Characteristics of Transposable Element Exonization within Human and Mouse Noa Sela1¤ , Britta... of transposed elements into introns can lead to their activation as alternatively spliced cassette exons... , an event called exonization. Elucidation of the evolutionary constraints that have shaped fixation

Source: Ast, Gil - Department of Molecular Genetics and Biochemistry, Tel Aviv University

Collection: Biology and Medicine

Summary:  levelof exonization of Alu elements than other elements.

Source: Ast, Gil - Department of Molecular Genetics and Biochemistry, Tel Aviv University

Collection: Biology and Medicine

Summary:  Combinatorial Control of Exon Recognition* Published, JBC Papers in Press, November 16, 2007, DOI... of noncoding intronic sequences to assemble exons into mature mRNAs prior to export and translation. Given... of the spliceosome to identify and process exons within a given pre-mRNA. To reach this flexibil- ity, splice site

Source: Hertel, Klemens J. - Department of Microbiology and Molecular Genetics, University of California, Irvine

Collection: Biology and Medicine

Summary:  than frame-shifting AS events; selection for smaller exon size is stronger in frame-pre- serving exons... genomes. Introduction Alternative splicing (AS), the process of removing introns and joining exons... that AS accelerates exon creation and loss by relaxing the negative selection pres- sure against the ...

Source: Zhang, Michael Q.- Watson School of Biological Sciences, Cold Spring Harbor Laboratory

Collection: Biotechnology

Summary:  not generate nonsense errors. We observe that single-exon genes have evolved to become robust... compared to multi-exon genes. A similar depletion is evident in last exons of multi-exon genes. Histone... . Finally, the protein products of single-exon genes show a strong tendency to avoid ...

Source: Arndt, Peter - Max-Planck-Institut für molekulare Genetik

Collection: Physics ; Biotechnology

Summary:  commentreviewsreportsdepositedresearchrefereedresearchinteractionsinformation Open Access2007Lev-Maoret al.Volume 8, Issue 2, Article R29Research RNA-editing-mediated exon... the original work is properly cited. RNA-editing-mediated exon evolution

A primate-specific exon is found... to be dependent on RNA editing for its ...

Source: Ast, Gil - Department of Molecular Genetics and Biochemistry, Tel Aviv University; Sorek, Rotem - Department of Molecular Genetics, Weizmann Institute of Science

Collection: Biology and Medicine

Summary:  VEGF188 (human VEGF189) isoform is insufficient for these functions, due to restricted diffusion... mode strain shifts expression to the AUG start codon, leading to the production of vegf 189. This might... '- GGCCCCCATCCCTGTGGGCC -3' reverse 5'- CTCCTGCCCGGCTCACCGCC -3' 72 72 173 NM_003376 ...

Source: Ecole Polytechnique, Centre de mathématiques

Collection: Mathematics

Summary:  .1093/nar/gkm187 Non-EST-based prediction of novel alternatively spliced cassette exons with cell signaling... . Therefore, we developed PASE (Prediction of Alternative Signaling Exons), a computational tool to identify... novel alternative cassette exons that code for kinase phosphorylation or signaling protein-binding sites

Source: Mitra, Rob - Department of Genetics, Washington University in St. Louis

Collection: Biotechnology ; Biology and Medicine

Summary:  165, (both expressing exons 7 and 8, differing only by VEGF189's additional partial expression of exon... Ratio in VEGF-Secretion Rate VEGF121, VEGF165 and VEGF189 are considered the predominant pro... RNA expression levels of VEGF121, VEGF165, and ...

Source: Popel, Aleksander S. - Department of Biomedical Engineering, Johns Hopkins University

Collection: Engineering ; Biology and Medicine

Summary:  with the number of exons. To this end, we have developed an e#30;cient polynomial- time algorithm, called ASFPred... (Alternative Splice Form Prediction). This algorithm needs only a set of exons as input. Keywords: alternative... and introns/exons using sequence signals and compo- sition di#27;erences 14,15 . These methods are ...

Source: Will, Sebastian - Lehrstuhl für Bioinformatik, Institut für Informatik, Albert-Ludwigs-Universität Freiburg

Collection: Computer Technologies and Information Sciences ; Biology and Medicine

Summary:  such as exonization and intronization (the birth of new exons/introns from previously intronic/exonic sequences... , respectively), and insertion into first and last exons. However, no extensive analysis has compared the effects... into introns, significantly lower numbers of exonizations ...

Source: Ast, Gil - Department of Molecular Genetics and Biochemistry, Tel Aviv University

Collection: Biology and Medicine

Summary:  two non-consecutive exonsand destroys a feature by inserting an exon in its body. Evidence... and function. It is mainly carried out in two ways: by skipping exons that encode a certain protein feature... -consecutive exons or destroys a feature by inserting an exon in its body. In contrast to other ...

Source: Will, Sebastian - Lehrstuhl für Bioinformatik, Institut für Informatik, Albert-Ludwigs-Universität Freiburg

Collection: Computer Technologies and Information Sciences ; Biology and Medicine

Summary:  regulated and the BDNF gene can generate multiple transcript isoforms by alternate splicing of four 5V exons... (exons I­IV) to one 3V exon (exon V). To gain insight into the regulation of different BDNF transcripts... in specific hippocampal subfields during postnatal development, ...

Source: Vaidya, Vidita - Department of Biological Sciences, Tata Institute of Fundamental Research

Collection: Biology and Medicine

Summary:  Lead to Skipping of Exon 7 in Neurofibromatosis Type I Patients Katharina Wimmer1 , Markus Eckart1... novel (W336X and Q315X), and one recurrent (R304X) mutation located in exon 7 and show that all three... premature termination codons lead to skipping of exon 7 in a proportion of the transcripts derived from

Source: Stadler, Peter F. - Institut für Informatik, Universität Leipzig

Collection: Biology and Medicine

Summary:  A CD45 Polymorphism Associated with Multiple Sclerosis Disrupts an Exonic Splicing Silencer... increases the splicing of variable exon 4 in transcripts of the human protein- tyrosine phosphatase CD45... splicing of CD45 exon 4. We found that at least four distinct splicing regulatory elements exist within

Source: Lynch, Kristen W. - Department of Biochemistry and Biophysics, University of Pennsylvania

Collection: Biology and Medicine

Summary:  often have distinct activ- ities when bound to exons versus introns. However, less clear is whether... exons 4 and 5 to affect their coordinate repression. Here, we show that, in contrast to its direct... repression of exon 4, hnRNP L represses exon 5 by countering the activity of a neighboring splicing ...

Source: Lynch, Kristen W. - Department of Biochemistry and Biophysics, University of Pennsylvania

Collection: Biology and Medicine

Summary:  of hybridizations to short oligonucleotide probes to determine in parallel which exons of Gi are present in every... or deletion of one or more complete exons from a transcript. A gene is treated as an ordered list of exons G... = {E1 . . . En}, with each splice variant containing a subset of these exons. We ...

Source: Mitra, Rob - Department of Genetics, Washington University in St. Louis

Collection: Biotechnology ; Biology and Medicine

Summary:  , as a result of alternative and optional exon usage, were seen. A novel alternative exon 8d was found in one... Tcas6 transcript. Tcas5 transcripts did not contain previously reported exons 8­10. Six subunits had... editing, nicotinic acetylcholine receptor alleles, red flour beetle, alternative exon usage. ...

Source: Scott, Jeffrey G. - Department of Entomology, Cornell University

Collection: Environmental Sciences and Ecology

Summary:  alternative splicing, the total length of all the exons is much shorter than in a cell that encodes the same... set of proteins without alternative splicing. This economical use of exons makes genes more stable... during reproduction and development because a genome with a shorter exon length is more resistant

Source: Cahill, Kevin - Department of Physics and Astronomy, University of New Mexico

Collection: Physics

Summary:  .05.008 Comparative Analysis Identifies Exonic Splicing Regulatory Sequences-- The Complex Definition of Enhancers... Aviv 69978 Israel Summary Exonic splicing regulatory sequences (ESRs) are cis- acting factor binding... orthologous exons was de- veloped, identifying 285 putative ESRs. Alternatively spliced ...

Source: Ast, Gil - Department of Molecular Genetics and Biochemistry, Tel Aviv University; Pupko, Tal - Department of Cell Research and Immunology, Tel Aviv University

Collection: Biology and Medicine

Summary:  1 In Silico Biology 6, 0022 (2006); ©2006, Bioinformation Systems e.V. First exons and introns... role in transcriptional control and splicing. The length and GC-content of first exons and introns... in large genomes. Hence, in this paper we perform a systematic comparison of exon-intron structure and GC

Source: Comeron, Josep M. - Department of Biological Sciences, University of Iowa

Collection: Environmental Sciences and Ecology ; Biology and Medicine

Summary:  The characteristics, regulation and evolution of human alternatively spliced exons THESIS SUBMITTED TO THE SENATE... alternatively spliced exons are conserved between human and mouse. Genome Research 13(7):1631-1637. 2. Sorek R... based method for exon-skipping prediction. Genome Research 14(8): 1617-1623. 4. Dror G., Sorek R

Source: Shamir, Ron - School of Computer Science, Tel Aviv University

Collection: Computer Technologies and Information Sciences

Summary:  exon (exon I­IV) and a common 3 coding exon. Using in situ hybridization with exon-specific riboprobes... ECS were the most prominent on exon I and II containing BDNF mRNAs in hippocampal and cortical... subfields. Chronic ECS enhanced the acute induction of exon I, ...

Source: Vaidya, Vidita - Department of Biological Sciences, Tata Institute of Fundamental Research

Collection: Biology and Medicine

Summary:  on a probability of error analysis, where errors are mutations which occur in the exon sequences. We derive... the optimal exon length distribution, which minimizes the probability of error in the genome. Furthermore... for exon generation throughout evolution. This model results in an alpha stable exon ...

Source: Bouaynaya, Nidhal - Department of Systems Engineering, University of Arkansas at Little Rock

Collection: Computer Technologies and Information Sciences ; Engineering

Summary:  -specific isoforms generated through exonization of transposable elements BMC Genetics 2007, 8:78 doi:10... - or tumor-specific isoforms generated through exonization of transposed elements Britta Mersch1 , Noa Sela2... (TEs) are known to affect transcriptomes, because either new exons are generated from intronic

Source: Ast, Gil - Department of Molecular Genetics and Biochemistry, Tel Aviv University

Collection: Biology and Medicine

Summary:  . The Drosophila slow- poke gene includes 14 alternative exons distributed among five sites of alternative splicing... . These libraries were screened by colony hybridization using alternative exon-specific DNA probes to document... the frequency of individual alternative exons in different developmental stages and distinct tissue ...

Source: Atkinson, Nigel - Section of Neurobiology, Division of Biological Sciences, University of Texas at Austin

Collection: Biology and Medicine

Summary:  and computational work confirms that CpGs can be unmethylated inside coding exons, thereby showing that codons may... G islands (CCGIs) that are regions inside exons enriched for CpGs. The difficulty in identifying... such islands is that coding exons exhibit sequence biases determined by codon usage and constraint that must

Source: Sahinalp, S. Cenk - School of Computing Science, Simon Fraser University

Collection: Biology and Medicine ; Computer Technologies and Information Sciences

Summary:  and Analysis of Exonic Splicing Silencers these imposters implies that sequence features outside... , * Prime candidates for these features are exonic or in-1 Department of Biology tronic cis... Sciences exonic splicing enhancers (ESEs) and exonic splicingMassachusetts Institute of Technology

Source: Poggio, Tomaso - Center for Biological and Computational Learning, Massachusetts Institute of Technology (MIT)

Collection: Biology and Medicine

Summary:  Sequential Loss of Two Neighboring Exons of the Tropoelastin Gene During Primate Evolution Zolta... Abstract. Previous evidence has demonstrated the ab- sence of exons 34 and 35 within the 3 end of the human... tropoelastin (ELN) gene. These exons encode conserved polypeptide domains within tropoelastin and are found

Source: Batzer, Mark A. - Department of Biological Sciences, Louisiana State University

Collection: Biotechnology ; Biology and Medicine

Summary:  . In this work, we systematically explore different methods for the validation of cassette exons predicted... --poly-dT prim- ing, random priming and pooled exon-specific priming. We also examined two strategies for PCR... amplification--flanking PCR, which uses pri- mers that hybridize to the constitutive exons flanking

Source: Mitra, Rob - Department of Genetics, Washington University in St. Louis

Collection: Biotechnology ; Biology and Medicine

Summary:  of chromatin. The intertwined DNA harbors genes, most of which are made up of short stretches of exonic... of four signals at the exon-intron junctions and a vast array of splicing regulatory elements (SREs... ), directs the spliceosomal machinery to the exon- intron boundaries, allowing precise identification

Source: Ast, Gil - Department of Molecular Genetics and Biochemistry, Tel Aviv University

Collection: Biology and Medicine

Summary:  Nucleic Acids Research, 2008, 1­12 doi:10.1093/nar/gkn024 Alternative splicing of Alu exons... splice sites, a process called exonization. Most exonizations occur in right arms of antisense Alu... elements, and are alternatively spliced. Here we show that without the left arm, exonization of the right

Source: Ast, Gil - Department of Molecular Genetics and Biochemistry, Tel Aviv University

Collection: Biology and Medicine

Summary:  Mutations in Tau Gene Exon 10 Associated with FTDP-17 Alter the Activity of an Exonic Splicing... aberrant splicing were not understood. We character- ized two mutations in exon 10 of the tau gene, N279K... and Del280K. Our results revealed an exonic splicing en- hancer element located in ...

Source: Wu, Jane Y. - Center for Genetic Medicine & Department of Neurology, Northwestern University

Collection: Biology and Medicine

Summary:  . The primers for quantitative RT-PCR analysis were designed to detect the specific junctions and exons... total mRNA levels for each SR gene, a constitutive exon was selected. For reference mRNA levels... in the same gene. Also, the c cassette exon probes could detect nuclear pre-mRNA that is not subject to NMD

Source: Herr, Amy E. - Department of Bioengineering, University of California at Berkeley

Collection: Biology and Medicine ; Chemistry

Summary:  Interplay Controls the Splicing Profile of Alu-Derived Exons Oren Ram, Schraga Schwartz, and Gil Ast... February 2008 Exonization of Alu elements creates primate-specific genomic diversity. Here we combine... bioinformatic and experimental methodologies to reconstruct the molecular changes leading to exon selection. Our

Source: Ast, Gil - Department of Molecular Genetics and Biochemistry, Tel Aviv University

Collection: Biology and Medicine

Summary:  ://dna.phys.unm.edu/ Abstract In a cell that uses alternative splicing, the total length of all the exons is far less than... exon length is more stable. For a broad class of alternatively spliced genes, a formula is given... and often many of its exons. The eucaryote then exports the mRNA out of its nucleus into its cytosol, ...

Source: Cahill, Kevin - Department of Physics and Astronomy, University of New Mexico

Collection: Physics

Summary:  they are transfected with the exon-4 splice-site mutant, the lymphocytes must contain all the processing factors... in the expression of calcitonin mRNA in the lymphocyte cell line, then the mutant that was missing the exon-4... polyadenylation site would be expected to produce CGRP mRNA. If the splicing on exon 3 to ...

Source: Lycan, Deborah E. - Department of Biology, Lewis and Clark College

Collection: Biology and Medicine

Summary:  in the homogeneity of the initial coding exons. This potential use of markovian models to help in data exploration... Markov Models (HMMs) ([22], [18], [23]). To each type of genomic region (exons, introns, etc.), one... regions and introns are concerned, the empirical distributions of the lengths of exons are clearly bell

Source: Piau, Didier - Institut Fourier, Université Joseph Fourier Grenoble-I

Collection: Mathematics ; Biology and Medicine

Summary:  in the homogeneity of the initial coding exons. This potential use of markovian models to help in data exploration... Markov Models (HMMs) ([22], [18], [23]). To each type of genomic region (exons, introns, etc.), one... regions and introns are concerned, the empirical distributions of the lengths of exons are clearly bell

Source: Piau, Didier - Institut Fourier, Université Joseph Fourier Grenoble-I

Collection: Mathematics ; Biology and Medicine

Summary:  Serine arginine-rich protein-dependent suppression of exon skipping by exonic splicing enhancers El... within any other intron during pre-mRNA splicing. How- ever, exons are joined in a strict 5 to 3 linear... joining of exons. Here we report that insertion of exon sequences into an ...

Source: Hertel, Klemens J. - Department of Microbiology and Molecular Genetics, University of California, Irvine

Collection: Biology and Medicine

Summary:  Cancer not listed in dbSNP CYP2A6 rs5031016 Nicotine addiction exonic, missense, 0.01 heterozygosity... 's exonic, missense, 0.37 heterozygosity GnRH novel Alzheimer's flanking sequence in .txt IL1A rs17561... Alzheimer's exonic, missense, > 0.30 heterozygosity LHB rs6521 Alzheimer's exonic, synonymous, 20

Source: Wisconsin at Madison, University of - Laboratory of Endocrinology, Aging and Disease

Collection: Biology and Medicine

Summary:  letter nature genetics · volume 27 · january 2001 55 A mechanism for exon skipping caused... -frame nonsense codons located at a minimum dis- tance upstream of the last exon-exon junction are recognized... skipping of one or more exons, presumably during pre-mRNA splicing in the nucleus; this phenomenon

Source: Zhang, Michael Q.- Watson School of Biological Sciences, Cold Spring Harbor Laboratory

Collection: Biotechnology

Summary:  containing a unique noncoding 5 -exon and a common 3 -coding exon. This study describes novel evidence... for the differential usage of alternative BDNF promoters and 5 -exons during the consolidation of learning. We found... a selective increase in BDNF transcripts containing exons I and III in the amygdala ...

Source: Duong, Timothy Q. - Yerkes National Primate Research Center, Emory University

Collection: Biology and Medicine

Summary:  Research Focus SR proteins: a foot on the exon before the transition from intron to exon definition... are found in all eukaryotic organisms. However, the number and size of introns and exons and their modes... a greater number of exons per gene and larger intronic sequences in primates and other mammals com- ...

Source: Ast, Gil - Department of Molecular Genetics and Biochemistry, Tel Aviv University

Collection: Biology and Medicine

Summary:  . Whereas the previously defined human EPHX1 exon 1 sequence, E1, is derived from a gene promoter... immediately proximal to exon 2 of the EPHX1 coding region. Remarkably, the E1 promoter directs expression only... in the liver. We have identified an alternative EPHX1 promoter that is localized ~18.5 kb upstream of exon 2

Source: Omiecinski, Curtis - Department of Veterinary and Biomedical Sciences, Pennsylvania State University

Collection: Biology and Medicine

Summary:  splicing-sensitive microarrays. We found a striking class of highly conserved stop codon-containing exons... identified >50 such exons in genes with a variety of functions. These exons are unusually frequent in genes... to the activity of the splicing machinery. The spliceosome leaves a protein mark called the ...

Source: Ares Jr., Manny - Department of Molecular, Cell, and Developmental Biology, University of California at Santa Cruz

Collection: Biology and Medicine

Summary:  (SFRS11), a Regulator for tau Exon 10 Alternative Splicing Identified by an Expression Cloning Strategy... associated with FTDP-17 often affect tau exon 10 alternative splicing. To investigate mechanisms regulating... tau exon 10 alternative splicing, we have developed a green fluorescent protein reporter for tau ...

Source: Wu, Jane Y. - Center for Genetic Medicine & Department of Neurology, Northwestern University

Collection: Biology and Medicine

Summary:  up to 13,000 different transcripts by the alternative splicing of variable exons. This extends... 's Dscam. In Daphnia, we detected exon usage variability in both the brain and hemocytes (the effector... and insects except in the alternative exons, which diverge greatly between these taxa. Our analysis shows

Source: Little, Tom - School of Biological Sciences, University of Edinburgh

Collection: Environmental Sciences and Ecology ; Biology and Medicine

Summary:  polymerase II can repress exon inclusion via a mechanism not explained by the prevailing models... exons from a final messenger RNA, occurs in upwards of 75% of humangenesandmaybeaprimarymechanism... for generating protein diversity and regulating protein expression. For an exon to be included in a final m

Source: Lynch, Kristen W. - Department of Biochemistry and Biophysics, University of Pennsylvania

Collection: Biology and Medicine

Summary:  in vertebrate whole genome alignments. We individually predict splice sites, assemble compatible sites into exon... candidates, and obtain multi-exon transcript predictions. Using a novel method to evaluate typical splice... , it can uncover both coding and non-coding exons. Applying our approach to an alignment of 44 vertebrate

Source: Stadler, Peter F. - Institut für Informatik, Universität Leipzig

Collection: Biology and Medicine

Summary:  Exon Intron Exon 3'UTR TAIL CAP 5'UTR Exon Exon 3'UTR TAIL MCNALCECLKCPGKVVCCCCSCACKMLLSIVFSALL... they are useful for protein coding or not: #15; exons #15; introns We have recently released a new version... of the program geneid. The original simple and hierarchical structure (signal ...

Source: Foissac, Sylvain - Centre de Regulació Genòmica, Barcelona

Collection: Biotechnology

Summary:  ) Schistosoma mansoni UbCRBP gene sequence extending into exon 3 of the downstream enolase gene (exon 1... between UbCRBP and enolase. Uppercase letters represent exon sequences (light shading, UbCRBP; darker... shading, enolase) and the predicted translation products of the encoded mRNAs are shown below the ...

Source: Davis, Richard E. - Department of Biochemistry and Molecular Genetics, University of Colorado Health Sciences Center

Collection: Biology and Medicine

Summary:  for transcribing D56 with a 6-nt 3-exon was prepared by PCR in a similar manner, with primer 2 changed to 5... -ACCATGCCGGCCCATAGTATCCCGATAGGTAGACCTT-3 (the six italicized nucleotides are the complement of the 3-exon sequence). When the 3-exon... the control (`C') branched RNA by ai5 catalysis, the ...

Source: Silverman, Scott K. - Department of Chemistry, University of Illinois at Urbana-Champaign

Collection: Chemistry ; Biology and Medicine

Summary:  An exonic splicing silencer represses spliceosome assembly after ATP-dependent exon recognition Amy... intermediates. Here we report that the exonic splicing silencer (ESS1) that represses splicing of PTPRC... (encoding CD45) exon 4 does not function by the typical mechanism of inhibiting binding of U1 or U2 ...

Source: Lynch, Kristen W. - Department of Biochemistry and Biophysics, University of Pennsylvania

Collection: Biology and Medicine

Summary:  Alus on splicing of the flanking exons is largely unknown. Here, we show that more Alus flank... alternatively spliced exons than constitutively spliced ones; this is especially notable for those exons... . This implies that Alu insertions may change the mode of splicing of the flanking exons. Indeed, we ...

Source: Ast, Gil - Department of Molecular Genetics and Biochemistry, Tel Aviv University

Collection: Biology and Medicine

Summary:  -complementarity enforces exon inclusion in a yeast pre-mRNA KENNETH JAMES HOWE AND MANUEL ARES, JR.* Center... for review July 18, 1997) ABSTRACT Skipping of internal exons during removal of introns from pre-mRNA must... of the mechanics of intron removal, mechanisms that ensure inclusion of internal exons in multi-intron pre

Source: Ares Jr., Manny - Department of Molecular, Cell, and Developmental Biology, University of California at Santa Cruz

Collection: Biology and Medicine

Summary:  with this sequence. Genes consist of introns and exons. Introns are portions that are spliced out prior... to translation to protein, and exons are the actual protein coding regions. It turns out the very feature... turns out that the exons--the ones that get translated into the actual phenotype--are highly conserved

Source: Batzoglou, Serafim - Department of Computer Science, Stanford University

Collection: Biotechnology ; Computer Technologies and Information Sciences