| Sample search results for: aada teedume heldur |
| 1 | Steno maurinn og jarfringurinn Margrt Th. Jnsdttir | ||
|
Summary: sinna heldur þurfti að verja öllum sínum stundum meðal foreldra sinna og gesta þeirra. Hann náði sér... Kaupmanna- hafnarháskóla heldur hélt hann til Hollands og hélt þar námi sínu áfram. Hann eyddi fyrstu þremur... og fólk tileinkaði sér hin ýmsu trúarbrögð. Þessi menningarsúpa var heldur ólík því ... |
|||
|
Source: Ingólfsson, Ólafur - Institute of Earth Sciences & Department of Geology and Geography, University of Iceland |
|||
|
Collection: Geosciences |
|||
| 2 | Original Article High prevalence of trimethoprim-resistance cassettes in class 1 and 2 | ||
|
Summary: strains. The class 1 integrons detected contained dfr and aadA cassettes, alone or in combination (dfrA5... /dfrA15, or dfrA15-aadA1, dfrA1-aadA2), and an atypical cassette array with an insertion sequence (oxa... 30-aadA1-IS1). For class 2 integrons, we detected either the same cassettes as those found in Tn7 |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 3 | The EMBO Journal vol.15 no.14 pp.3498-3506, 1996 The chloroplast ycf7 (petL) open reading frame of | ||
|
Summary: with a single transmembrane a helix. We have disrupted 0RF58 andycf 7 with the aadA expression cassette... by particle- gun mediated chloroplast transformation. While the ORF58::aadA transformants... are indistinguishable from wild type, photoautotrophic growth of the ycf7::aadA transformants is considerably impaired |
|||
|
Source: Institut de Biologie Physico-Chimique CNRS, Physico-Chimie Moléculaire des Membranes Biologiques |
|||
|
Collection: Chemistry ; Biology and Medicine |
|||
| 4 | Hringrs kolefnis Freyr Plsson | ||
|
Summary: planta eða dýr nýtir sér til efnaskipta. Plantan brennir ekki öllum sykrinum heldur notar hann líka sem... plantan meira CO2 úr andrúmsloftinu heldur en hún skilar. Í þessu hvarfi er súrefni afgangsefni sem... (99%). Hlutfall þeirra er yfirleitt stöðugt. Plöntur nota frekar C-12 heldur en C- 13, ef mikil greftrun ... |
|||
|
Source: Ingólfsson, Ólafur - Institute of Earth Sciences & Department of Geology and Geography, University of Iceland |
|||
|
Collection: Geosciences |
|||
| 5 | Stable transformation of petunia plastids Mikhajlo K. Zubkoy | ||
|
Summary: cultivar of P. hybrida (var. Pink Wave). Plastid targeting regions from tobacco were used to integrate aadA... cassettes containing the aadA and gusA genes were cloned into the ApaI site of pTB27-link in inverted... element can be excised with NotI and PstI as a 247 bp fragment. An aadA expression cassette |
|||
|
Source: Meyer, Peter - Centre for Plant Sciences & Faculty of Biological Sciences, University of Leeds |
|||
|
Collection: Biology and Medicine |
|||
| 6 | run grasa og blmplantna Nlfsld Harpa Bel Sigurgeirsdttir | ||
|
Summary: suðurhveli jarðarinnar heldur hafði áhrif á loftslag jarðarinnar í heild. Jökullinn á Antarctíku dró til sín... talið að útbreiðsla graslendis hafi leitt til útdauða þessara tegunda heldur tegund graslendisins. C3... en var áður. Þessi þróun verður ekki á sama tíma allstaðar heldur er mismunandi eftir ... |
|||
|
Source: Ingólfsson, Ólafur - Institute of Earth Sciences & Department of Geology and Geography, University of Iceland |
|||
|
Collection: Geosciences |
|||
| 7 | Calednska fellingafjallamyndunin, hrif run lfs BYLGJA GUMUNDSDTTIR | ||
|
Summary: ekki aðeins miklir tektóniskir atburðir sem eiga sér stað á þessum tíma heldur er einnig mikil þróun í... verið viðfangsefni marga fræðimanna. Sú þróun verður ekki rakin hér til hlítar heldur er í þessu... land og síðan fylgdi dýralífið á eftir. Ekki er hægt að benda á einhvern einn ákveðinn atburð ... |
|||
|
Source: Ingólfsson, Ólafur - Institute of Earth Sciences & Department of Geology and Geography, University of Iceland |
|||
|
Collection: Geosciences |
|||
| 8 | Neanderdalsmaurinn Sigurur H. Marksson, , jar og landafriskor Hskla slands. | ||
|
Summary: Neanderdalsmenn hafi ekki dáið út heldur hreinlega blandast Cro Magnon manninum og séu þeir sameiginlegir forfeður... það í ljós að ekki séu nein áhrif frá Neanderdalsmönnum í genum okkar heldur hafi þessar tvær tegundir... þetta til þess að hér hafi ekki verið um tvær aðskildar tegundir að ræða ... |
|||
|
Source: Ingólfsson, Ólafur - Institute of Earth Sciences & Department of Geology and Geography, University of Iceland |
|||
|
Collection: Geosciences |
|||
| 9 | Suurskautslandi og klnun jarar mrkum Esen og ligsen fyrir um 34 milljn rum. | ||
|
Summary: breiður og aðeins -1 til 5°C. Straumurinn heldur heitum sjávarstraumum frá Suðurskautslandinu og einangrar... hafstraumurinn í kringum Suðurskautslandið. Hann einangrar kaldan sjó við Suðurskautslandið og heldur heitum frá |
|||
|
Source: Ingólfsson, Ólafur - Institute of Earth Sciences & Department of Geology and Geography, University of Iceland |
|||
|
Collection: Geosciences |
|||
| 10 | -Hafstraumar Sjkultma og Ntma-Hita-og seltuhringrsin | ||
|
Summary: neinn kraft að ræða heldur virðist sem svo sé. Orsakir þessa sýndarkrafts má rekja til snúnings jarðar... seltuhringrásarinnar heldur einnig vegna hlýrra vinda sem leika um svæðið. Með líkönum hafa menn gert ráð fyrir því að... til þess að hringrásin stöðvist ekki heldur myndist önnur og minni ... |
|||
|
Source: Ingólfsson, Ólafur - Institute of Earth Sciences & Department of Geology and Geography, University of Iceland |
|||
|
Collection: Geosciences |
|||
| 11 | Eyrn Anta Gylfadttir Myndun Himalaya og hslttu Tbets Myndun Himalaya og hslttu Tbets | ||
|
Summary: Superterranes rekur frá Gondvana, en Tíbet var þá hluti af Cimmerian Superterranes. Frá þeim tíma heldur... yfirborð jarðar heldur Indland áfram á siglingu sinni í norður um 19 mm á ári. Vegna þessa heldur Himalaya... eðlisþungir getur annar ekki sokkið undir hinn heldur þrýsta þeir á ... |
|||
|
Source: Ingólfsson, Ólafur - Institute of Earth Sciences & Department of Geology and Geography, University of Iceland |
|||
|
Collection: Geosciences |
|||
| 12 | 1st Reading August 3, 2011 18:57 WSPC/1793-5369 244-AADA 00081 | ||
|
Summary: 1st Reading August 3, 2011 18:57 WSPC/1793-5369 244-AADA 00081 Advances in Adaptive Data Analysis1... iteration41 1 #12;1st Reading August 3, 2011 18:57 WSPC/1793-5369 244-AADA 00081 2 R. H. Chan, H.-X. Liang... -AADA 00081 Positively Constrained Total Variation Penalized Image Restoration 3 The first term of Eq |
|||
|
Source: Chan, Raymond - Department of Mathematics, Chinese University of Hong Kong |
|||
|
Collection: Mathematics |
|||
| 13 | 1st Reading June 16, 2011 20:26 WSPC/1793-5369 244-AADA 00064 | ||
|
Summary: 1st Reading June 16, 2011 20:26 WSPC/1793-5369 244-AADA 00064 Advances in Adaptive Data Analysis1... of 1 #12;1st Reading June 16, 2011 20:26 WSPC/1793-5369 244-AADA 00064 2 T. Y. Hou & Z. Shi wavelet... in this same special issue of AADA as our paper.38 This is a very interesting line of work. For the examples |
|||
|
Source: Hou, Thomas Yizhao - Applied and Computational Mathematics Department, California Institute of Technology |
|||
|
Collection: Mathematics |
|||
| 14 | ON THE EQUATION a(a + d)(a + 2d)(a + 3d) = x2 Tamas Erdelyi | ||
|
Summary: the following outline: If y2 = a(a+d)(a+2d)(a+3d), then dividing both sides by a4 and setting y = y/a2 and x = d... is to present a totally elementary proof of the fact that the equation a(a+d)(a+2d)(a+3d) = x2 cannot be solved... -trivial applications of infinite descent; the current proof is one. Theorem. The equation ... |
|||
|
Source: Erdélyi, Tamás - Department of Mathematics, Texas A&M University |
|||
|
Collection: Mathematics |
|||
| 15 | JOURNAL OF BACTERIOLOGY, Nov. 2002, p. 60566059 Vol. 184, No. 21 0021-9193/02/$04.00 0 DOI: 10.1128/JB.184.21.60566059.2002 | ||
|
Summary: C-PBAD-T7pol genes, flanked by aadA sequences, in a pSB890 backbone (8). The new Salmonella construct, SB300... -1 to SB300. Key components of pSBaadABADT7-1 include tet, oriR6K (7, 11), sacB (7), aadA (7, 9), ara... C-PBAD (6), and the T7 RNA polymerase gene (12). The aadA gene, encoding a streptomycin adenylyltransferase |
|||
|
Source: Galan, Jorge E - Boyer Center for Molecular Medicine & Department of Cell Biology, Yale University |
|||
|
Collection: Biology and Medicine |
|||
| 16 | Proc. Natl. Acad. Sci. USA Vol. 95, pp. 43804385, April 1998 | ||
|
Summary: -attachment-defective cytochrome f sequence, a deletion of the petD gene, and the aadA cassette (conferring spectinomycin... of the aadA cassette in plasmid pAF52L-55V (21) with the 3 UTR of the petD gene, using the strategy... plasmid pAFRF. This substituted the aadA coding region from plasmid pdFBE with the petA coding region |
|||
|
Source: Wollman, Francis-André - nstitut de Biologie Physico-Chimique & Université Pierre-et-Marie-Curie, Paris 6 |
|||
|
Collection: Biology and Medicine ; Renewable Energy |
|||
| 17 | 1st Reading July 24, 2008 13:6 WSPC/244-AADA 00004 | ||
|
Summary: 1st Reading July 24, 2008 13:6 WSPC/244-AADA 00004 Advances in Adaptive Data Analysis1 Vol. 1, No... Reading July 24, 2008 13:6 WSPC/244-AADA 00004 2 Z. Wu & N. E. Huang As discussed by Huang et al.,1... , 200 to 480 Hz, etc. #12;1st Reading July 24, 2008 13:6 WSPC/244-AADA 00004 Ensemble Empirical Mode |
|||
|
Source: Huang, Norden E.- Research Center for Adaptive Data Analysis, National Central University |
|||
|
Collection: Engineering ; Materials Science |
|||
| 18 | Autoluminescent Plants Alexander Krichevsky1 | ||
|
Summary: marker aadA, resulting in pCAS3-aadA-LUX vector. Homologous recombination sites for integration into rps... ) plastid genome in tobacco is present in thousands of copies per cell [24]. Integration of aadA and the lux... fragments. Shown are also: the rps12 and trnV plastid genes; aadA, the spectinomycin resistance gene |
|||
|
Source: Citovsky, Vitaly - Department of Biochemistry and Cell Biology, SUNY at Stony Brook |
|||
|
Collection: Biology and Medicine ; Biotechnology |
|||
| 19 | Nmsfer til tlanda Auur Agla ladttir 21.-31. ma 2005 | ||
|
Summary: grænsand og kalk. Þetta svæði er jarðsögulega ofar heldur en þeir staðir sem heimsóttir voru daginn áður |
|||
|
Source: Ingólfsson, Ólafur - Institute of Earth Sciences & Department of Geology and Geography, University of Iceland |
|||
|
Collection: Geosciences |
|||
| 20 | Advances in Adaptive Data Analysis Vol. 3, Nos. 1 & 2 (2011) vvi | ||
|
Summary: This special issue of AADA is devoted to the research topics presented in the highly stimulating international |
|||
|
Source: Huang, Norden E.- Research Center for Adaptive Data Analysis, National Central University |
|||
|
Collection: Engineering ; Materials Science |
|||
| 21 | ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Feb. 2010, p. 590596 Vol. 54, No. 2 0066-4804/10/$12.00 doi:10.1128/AAC.00055-09 | ||
|
Summary: Cf No. of copies of blaCMY-2 1 2 2 2 floR regiong Yes Yes Yes Yes aadA regiong Yes Yes No Yes kan... on sequence similarity with pAM04528. g The floR, aadA, kan, and merA regions are shown in Fig. 1. VOL. 54... (A), strA, strB, and sul2. The "aadA region" includes aadA, aacC, and two heat-shock chaperones ... |
|||
|
Source: Singer, Randall - College of Veterinary Medicine, University of Minnesota |
|||
|
Collection: Biology and Medicine |
|||
| 22 | Hrfunarhrai Skaftafellsjkuls eftir Litlu sldina | ||
|
Summary: ísöldin ekki heildstætt kuldatímabil, heldur var loftslag mjög mismunandi og þar af leiðandi skriðu jöklar... aðeins fyrrum loftlagsbreytingar heldur einnig viðbragðsnæmni jöklanna, hversu vel jökulgarðarnir eru... gæti verið skemmd, standi fyrir aldri yfirborðsins heldur byggist hann á fleiri fléttum sem ... |
|||
|
Source: Ingólfsson, Ólafur - Institute of Earth Sciences & Department of Geology and Geography, University of Iceland |
|||
|
Collection: Geosciences |
|||
| 23 | The EMBO Journal vol. 1 3 no. 5 pp. 101 9 -1027, 1994 The assembly of cytochrome b6If complexes: an | ||
|
Summary: ; Goldschmidt-Clermont, 1991). One of them, the aadA expression cassette (Goldschmidt- Clermont, 1991... restriction fragment containing most or all of the corresponding pet ORF for the aadA4 cassette which confers... .9 kb, resulting from the fusion of the 5' untranslated region of atpA with the aadA gene from |
|||
|
Source: Wollman, Francis-André - nstitut de Biologie Physico-Chimique & Université Pierre-et-Marie-Curie, Paris 6 |
|||
|
Collection: Biology and Medicine ; Renewable Energy |
|||
| 24 | Pangea myndun, run og uppbrot 1 Pangea myndun, run og uppbrot: me herslu kenningar sem fram | ||
|
Summary: . Landrekið heldur áfram Nýr sjávarbotn varð til samfara því því að Atlantshafið myndaðist. Í lok Krít urðu... er hinsvegar berg á meginlandi sem er eldra en 3000 milljón ára Í dag heldur landrekið áfram |
|||
|
Source: Ingólfsson, Ólafur - Institute of Earth Sciences & Department of Geology and Geography, University of Iceland |
|||
|
Collection: Geosciences |
|||
| 25 | Jkulhrfun og sjvarstubreytingar slandi vi lok sasta jkulskeis | ||
|
Summary: er ekki að fjalla ítarlega um einstaka staði heldur að reyna að birta einhvers konar heildarmynd af... eiginleg hlý- og kuldaskeið, einsog hin lotubundnu jökul- og hlýskeið Pleistocene heldur aðeins mun styttri |
|||
|
Source: Ingólfsson, Ólafur - Institute of Earth Sciences & Department of Geology and Geography, University of Iceland |
|||
|
Collection: Geosciences |
|||
| 26 | ndvegissetur umhverfissgu vi Hskla slands Hvers vegna ndvegissetur umhverfissgu? | ||
|
Summary: laggirnar nýja stofnun #12;innan Háskóla Íslands, heldur samstarfsvettvang fyrir vísindamenn úr ýmsum áttum... fylgir ekki nákvæm fjárhagsáætlun, heldur eru settar fram hér hugmyndir um stærðargráður kostnaðar |
|||
|
Source: Ingólfsson, Ólafur - Institute of Earth Sciences & Department of Geology and Geography, University of Iceland |
|||
|
Collection: Geosciences |
|||
| 27 | 27. aprl 2007 Messel nman | ||
|
Summary: er með ólíkindum, heldur líka varðveisla þeirra. #12;Jarðsaga 2 Guðjón E. Ólafsson 3... og sjá þeim mun betur um það, heldur en að eignast mörg afkvæmi í þeirri von að eitt kæmist af.10 10 |
|||
|
Source: Ingólfsson, Ólafur - Institute of Earth Sciences & Department of Geology and Geography, University of Iceland |
|||
|
Collection: Geosciences |
|||
| 28 | Society report Vttur: Sker Skeiarrjkli | ||
|
Summary: minnkun Grænalóns í þessum greinarstúf, heldur segja stuttlega frá jökulskeri sem komið hef- ur upp í |
|||
|
Source: Guðmundsson, Magnús Tumi - Geophysics Division, Science Institute, University of Iceland |
|||
|
Collection: Geosciences |
|||
| 29 | Klettafjllin og Grand Canyon 1 Klettafjllin, Grand Canyon og Laramide byltingin | ||
|
Summary: ekki setberg, eins og við væri að búast í fellingafjöllum, heldur eru fjöllin í raun byggð upp af... , heldur að hún hafi líklega átt stóran þátt í myndun þeirra. Hit and Run Jarðfræðingarnir Julie Maxson og... nefndur Kula flekinn, en hann fer að færast norður á bóginn á meðan syðri hluti flekans ... |
|||
|
Source: Ingólfsson, Ólafur - Institute of Earth Sciences & Department of Geology and Geography, University of Iceland |
|||
|
Collection: Geosciences |
|||
| 30 | Saga Eystrasaltsins Sjkultma og Ntma Bra Drfn Kristinsdttir | ||
|
Summary: er að stórum hluta lagskipt þar sem saltvatn er eðlisþyngra en ferskvatn og heldur sig því í... Norðurheimsskautasvæðinu. Í Eystrasaltinu heldur hann aðallega til í Bothniaflóa og kæpir þar á ísnum sem myndast á veturna... umhverfinu og þetta fínkorna efni helst ekki lengur í upplausn heldur fellur til ... |
|||
|
Source: Ingólfsson, Ólafur - Institute of Earth Sciences & Department of Geology and Geography, University of Iceland |
|||
|
Collection: Geosciences |
|||
| 31 | Tungli myndun; fjarlg, hrif snning jarar, lengd dags og sjvarfll gegnum jarsguna | ||
|
Summary: heldur möndulhalla jarðar stöðugum en án tunglsins myndi hallinn flökta á milli 0° og 85°2 . Slíkar... fjara einskorðast sem sagt ekki við flóðkrafta tunglsins heldur skipta ýmsir þættir máli eins og... eilítið flóknari. Jörðin snýst nefnilega hraðar um möndul sinn heldur en tunglið snýst um ... |
|||
|
Source: Ingólfsson, Ólafur - Institute of Earth Sciences & Department of Geology and Geography, University of Iceland |
|||
|
Collection: Geosciences |
|||
| 32 | Ragam: Charukesi Version: Semmangudi | ||
|
Summary: Tyaagaraaje Paati Maata Meaning: O Ramayya! You seem to feel ("galade") too proud ("Aada"), too uppish ("modi |
|||
|
Source: Kalyanaraman, Shivkumar - IBM Research India |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 33 | Biogenesis of PSI involves a cascade of translational autoregulation in the chloroplast | ||
|
Summary: of regulation of translation initiation in the CES behaviour of PsaA, using the aadA reporter gene One... a chimeric gene bearing the psaA 50 UTR fused immediately upstream of the bacterial aadA gene coding sequence... to a specific downregulation of translation of the psaA 50 UTR-driven aadA gene when expressed in the absence |
|||
|
Source: Wollman, Francis-André - nstitut de Biologie Physico-Chimique & Université Pierre-et-Marie-Curie, Paris 6 |
|||
|
Collection: Biology and Medicine ; Renewable Energy |
|||
| 34 | Society report Vorfer Jklarannsknaflags slands, 2.11. jn 2007 | ||
|
Summary: ekki færi á að bera viðarvörn á húsin á Grímsfjalli. Ekki var heldur ekki hægt að sinna neinu þeirra |
|||
|
Source: Guðmundsson, Magnús Tumi - Geophysics Division, Science Institute, University of Iceland |
|||
|
Collection: Geosciences |
|||
| 35 | Landnm plantna. Hskli slands, skrsla nmskeiinu Jarsaga 1, haust 2004. | ||
|
Summary: verkum að Cooksonia er ekki þróunarhópur heldur blanda af plöntum sem líkjast hvor annarri en eru ekki |
|||
|
Source: Ingólfsson, Ólafur - Institute of Earth Sciences & Department of Geology and Geography, University of Iceland |
|||
|
Collection: Geosciences |
|||
| 36 | Society report Vorfer Jklarannsknaflags slands, 30. ma 7. jn 2008 | ||
|
Summary: Kverkfjöllum og á Goðahnjúkum mestan hluta tímans. Fyrir vikið var ferðaáætlunin heldur flóknari en oftast og |
|||
|
Source: Guðmundsson, Magnús Tumi - Geophysics Division, Science Institute, University of Iceland |
|||
|
Collection: Geosciences |
|||
| 37 | Bara h file:///Z:/.public_html/publicat/98/sfelGreinThroun98.html 1 of 3 13.7.2010 15:16 | ||
|
Summary: útbreyðslu heldur áfram að þróast af þeirri ástæðu að þegar búið er að útfæra verulegt kerfi í tilteknu |
|||
|
Source: Benediktsson, Oddur - Applied Mathematics and Computer Science Division, University of Iceland |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 38 | RELATEDNESS OF ESCHERICHIA COLI WITH DIFFERENT SUSCEPTIBILITY1 PHENOTYPES ISOLATED FROM SWINE FECES DURING AMPICILLIN2 | ||
|
Summary: -spectinomycin (strA-strB and167 aadA1), tetracycline (tet(A) and tet(B)) and the integrase genes intI1 and intI2 were... A-strB and intI1 (except for one isolate).263 Another combination: blaTEM, cmlA, sulI, sulIII, tet(A), aadA1... 678/ EF090911b aadA1 GAGAACATAGCGTTGCCTTGG TCGGCGCGATTTTGCCGGTTAC 46 198 53 Se 131/ AJ238350b tet |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 39 | 2002 Blackwell Science Ltd The ramC gene is required for morphogenesis in | ||
|
Summary: is a derivative of pIJ8660 (Sun et al., 1999) in which the aac(3) IV gene has been replaced by aadA (see Table 2... ) and inserted into the XbaI site. The aadA gene, conferring resist- ance to spectinomycin, was isolated from p... at positions 712 to generate ramRdown, aac(3)IV and aadA. pTO1 is unable to replicate in S. ... |
|||
|
Source: Nodwell, Justin - Department of Biochemistry and Biomedical Sciences, McMaster University |
|||
|
Collection: Biology and Medicine |
|||
| 40 | Hugleiingar um eli diffurjafna Ekki er ofsagt a diffurjoefnur sfiu sffl staerfraei sem mest er notu til lsingar ff | ||
|
Summary: sfirhverju augnabliki, ffkvarØar ekki hreyfingu hans fl framtflØ og fortflØ, heldur øurfa baeØi sta... tffs til aØ flmynda okkur lausnir, en øff eru øaer heldur settar fram sem groef (fallrit) en stika |
|||
|
Source: Magnus, Robert - Mathematics Division, Science Institute, University of Iceland |
|||
|
Collection: Mathematics |
|||
| 41 | Jklun og flotjafnvgi jarskorpunnar slandi Jn Einar Jnsson | ||
|
Summary: Íslands. Hörfun jökla á þessu tímabili var þó ekki samfelld, heldur var hún trufluð með frekari jöklun á... ekki á fullkomlega sveigjanlegan máta, heldur má líkja svörun jarðarinnar við auðmótanlegt hálfrúm sem |
|||
|
Source: Ingólfsson, Ólafur - Institute of Earth Sciences & Department of Geology and Geography, University of Iceland |
|||
|
Collection: Geosciences |
|||
| 42 | run Primata og homo sapiens Gunnar Sverrir Ragnars | ||
|
Summary: steinverkfæri, heldur eru leifar að viðarkolum, brenndum beinum og öskulag, sem benda til þess að reismaðurinn... versnandi veðurfar er á ísöldina leið. Stuttur og digur líkami heldur betur hita en langur og mjór |
|||
|
Source: Ingólfsson, Ólafur - Institute of Earth Sciences & Department of Geology and Geography, University of Iceland |
|||
|
Collection: Geosciences |
|||
| 43 | Diversity Strategic Update William T. Lewis -Vice President -Office for Diversity and Inclusion | ||
|
Summary: . · AnAchievableDreamAcademyPartnership (AADA) is designed to close the achievement gap for Access... Resources #12;first-generation, low-income and underrepresented students at AADA schools, thereby increasing |
|||
|
Source: Hopkins, William A. - Department of Fisheries and Wildlife Sciences, Virginia Tech |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 44 | Advantages of a Leveled Commitment Contracting Protocol | ||
|
Summary: constraint is based on the idea that E ;a] E max ;a;a ; ]]: Z 1 ;1 f(a) ;a]da Z ;a ;1 f(a) ;a;a]da+ Z 1 ;a f... 0). The contractor's IR constraint is satis ed: Z 1 ;1 f(a) ;a]da Z ;a ;1 f(a) ;a;a]da+ Z 1 ;a f... ;a ; ] , a . Thus the (ex ante) IR constraint is Z 1 ;1 f(a) ;a]da Z ;a ;1 f(a) ;a;a]da+ Z 1 ;a f(a) ; ]da Full |
|||
|
Source: Massachusetts at Amherst, University of - Department of Computer Science, Multi-Agent Systems Lab |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 45 | The Plant Cell, Vol. 13, 13471367, June 2001, www.plantcell.org 2001 American Society of Plant Physiologists The Chloroplast Gene ycf9 Encodes a Photosystem II (PSII) | ||
|
Summary: reading frame with an aadA cassette in the antisense orientation (Figure 2A); aadA confers resistance... D and psbC upstream and trnG down- stream. A terminatorless aadA cassette was inserted into the MunI site... reinitiation of transcripts con- taining the C-terminal gene segment. Correct insertion of the ... |
|||
|
Source: Wollman, Francis-André - nstitut de Biologie Physico-Chimique & Université Pierre-et-Marie-Curie, Paris 6 |
|||
|
Collection: Biology and Medicine ; Renewable Energy |
|||
| 46 | Pivotal Roles for the Receiver Domain in the Mechanism of Action of the Response Regulator RamR of | ||
|
Summary: reading frame with an aadA cassette in the antisense orientation (Figure 2A); aadA confers resistance... D and psbC upstream and trnG down- stream. A terminatorless aadA cassette was inserted into the MunI site... reinitiation of transcripts con- taining the C-terminal gene segment. Correct insertion of the ... |
|||
|
Source: Nodwell, Justin - Department of Biochemistry and Biomedical Sciences, McMaster University |
|||
|
Collection: Biology and Medicine |
|||
| 47 | ANRV329-GE41-08 ARI 21 June 2007 22:19 The Origin and | ||
|
Summary: -resistant and driven by a mosaic virus promoter that would be active in the nucleus) and aadA (controlled by a plastid... -resistant plants (i.e., that contain the nptII gene trans- ferred from the plastid) both the active nptII and aadA... genes were detected in the same genomic vicinity (ca. 1 Kb). Given that ARGs nptII and ... |
|||
|
Source: Bhattacharya, Debashish - Department of Ecology, Evolution, and Natural Resources, Rutgers University |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 48 | TO: 2009-2010 Faculty Senate FROM: Rod Hill, Faculty Secretary | ||
|
Summary: /17/09 Appr. 4/13/09 FSH UP-09-022 AA&DA FC-09-022: FSH 3200 Policy of Nondiscrimination 12/9/08 #14 appr... . GFM 4/21/09 Pres. Appr. 6/18/09 n/a FSH UP-09-023 AA&DA FC-09-023: FSH 3860 Grievance for Classified... Staff 12/9/08 #14 appr. GFM 4/21/09 Pres. Appr. 6/18/09 n/a FSH UP-09-020 AA&DA FC-09-024: FSH 3215 |
|||
|
Source: Idaho, University of - Department of Electrical and Computer Engineering, Center for Advanced Microeclectronics and Biomolecular Research |
|||
|
Collection: Engineering |
|||
| 49 | A ticking clock: Performance analysis of a Circadian rhythm with stochastic process | ||
|
Summary: as we do in the stochastic -calculus model. DA def = (bindADA , A).ADA + (mkMA, A).DA ADA def = (unbind... = (decayMR , MR).M R + (mkR, R).MR A def = (mkA, ).A A def = (bindADA , A).ADA + (bindADR , R).ADR + (bind... dt [A] = A[MA] + A[ADA] + R[ADR] - A[DA][A] - R[DR][A] - C[A][R] - A[A] d dt [ADA ] = ... |
|||
|
Source: Imperial College, London - Department of Computing, Analysis, Engineering, Simulation & Optimization of Performance Group |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 50 | 1. Inngangur Gossaga Ktlu sgulegum tma er all- | ||
|
Summary: þykja benda til að þekktar gos- stöðvar innan Kötluöskjunnar gjósi ekki óháð hverri annarri heldur... ) og b). Ef a) er rétt, þá er meðaltímabil milli gosa stærðar- gráðu styttri fyrir svæði K heldur en... dreifingu. skipulögð á láglendinu vestan og sunnan Mýrdalsjökuls. Gosin eru ekki óháðir atburðir, ... |
|||
|
Source: Guðmundsson, Magnús Tumi - Geophysics Division, Science Institute, University of Iceland |
|||
|
Collection: Geosciences |
|||
| 51 | The Plant Cell, Vol. 12, 137149, January 2000, www.plantcell.org 2000 American Society of Plant Physiologists Evidence for a Role of ClpP in the Degradation of the | ||
|
Summary: ) by a silent TC change at the last position of the third codon. For selection of transformants, the aadA... the aadA cassette and the PvuI restriction site. In one of these strains, the PCR product amplified using... -acetate [TAP] and spectinomycin), the transformants became homoplasmic for the aadA cassette. However, the Pvu |
|||
|
Source: Wollman, Francis-André - nstitut de Biologie Physico-Chimique & Université Pierre-et-Marie-Curie, Paris 6 |
|||
|
Collection: Biology and Medicine ; Renewable Energy |
|||
| 52 | Message from the Department Head When you tell your friends and family that your degree is in | ||
|
Summary: and Technology 2011 14 DigestFood College of Agriculture and Life Sciences An Achievable Dream Academy (AADA... relationships with caring adults. Approximately 80 percent of AADA graduates go on to college and 20 percent... participated in a Living Career Fair at AADA. The purpose of the career fair was to inspire ... |
|||
|
Source: Virginia Tech, Virginia Bioinformatics Institute, Influenze Outbreak Project |
|||
|
Collection: Biology and Medicine ; Computer Technologies and Information Sciences |
|||
| 53 | Functional Insensitivity of the Cytochrome b6 f Complex to Structure Changes in the Hinge Region of the | ||
|
Summary: . The aadA cassette (34), which encodes an aminoglycoside 3 -adenyltransferase and confers spectino- mycin... contains an aadA cassette located 500 bp upstream of petC1. A 3.8-kb fragment including the 5 -part of pet... C1 and the 5 -flanking sequence with the aadA cassette was excised from plasmid V by restriction |
|||
|
Source: Cramer, William A. - Department of Biological Sciences, Purdue University |
|||
|
Collection: Biology and Medicine |
|||
| 54 | bio-math-vol1-inaba_final : 2009/11/26(21:58) , 1920 1930 | ||
|
Summary: ) = Z 0 (a)(a)da (1.4) (1.4) , (a) := exp(- R a 0 µ(x)dx) , (a) = (0)e-a (a) , , EulerLotka Z 0 e... (A) D(A) = { X : A X, (0) = R 0 (a)(a)da} 1.3.1 A C0 T(t), t 0 , T(t)(X+) X+ p(t) = T(t)p0 , p0 D |
|||
|
Source: Inaba, Hisashi - Graduate School of Mathematical Sciences, University of Tokyo |
|||
|
Collection: Mathematics |
|||
| 55 | Visualization of Pathogenicity Regions in Bacteria Carsten Friis, Lars Juhl Jensen and David W. Ussery | ||
|
Summary: ) aadA2 > CmlA > tetA > b-lac > sulI > < int < tetR < IntB D) C) B) A) int aadA 2 qacD E qacD E C m l |
|||
|
Source: Ussery, David W. - Center for Biological Sequence Analysis, Institute of Biotechnology, Danmarks Tekniske Universitet |
|||
|
Collection: Biotechnology |
|||
| 56 | ON INTEGRAL REPRESENTATIONS OF THE DRAZIN INVERSE IN BANACH ALGEBRAS | ||
|
Summary: by ay = (a*a)Da* = a*(aa*)D. (3.2) Since the nonzero spectrum of a*a always |
|||
|
Source: Koliha, Jerry J. - Department of Mathematics and Statistics, University of Melbourne |
|||
|
Collection: Mathematics |
|||
| 57 | Moufang Quasigroups Kenneth Kunen 1 | ||
|
Summary: ), and the definition of d: (a(aa))d = (((aa) d) (aa)) d = (aa) (d ((aa) d)) = (aa)(da) = (aa)b (i) By (ffl) and (i), we |
|||
|
Source: Kunen, Ken - Department of Mathematics, University of Wisconsin at Madison |
|||
|
Collection: Mathematics |
|||
| 58 | Homogeneous Epidemic Systems in the Stable Hisashi Inaba | ||
|
Summary: .3) 6 #12;where (a) := e-r0a f(a) (a), is the state space of w given by := L1 +(0, ) : 0 (a)(a)da... given by D(A0) = AC[0, ] : (0) = 0 (a)(a)da . and the nonlinear term G is given by G() := (r0 - h... of the perturbation is := L1 +(0, ) : 0 (a)(a)da = 0 . Then it is easy to see that is positively invariant |
|||
|
Source: Inaba, Hisashi - Graduate School of Mathematical Sciences, University of Tokyo |
|||
|
Collection: Mathematics |
|||
| 59 | *Research Assistant, Member AIAA Professor, Fellow, AIAA | ||
|
Summary: for this study is based on the Ground Accuracy Designator B (GADB) and Airborne Accuracy Designator A (AADA... , integrity, continuity, and availability of the GADB/AADA model are likely to be slightly worse than... Airborne Model (m) (m) (deg) AADA (worst) 0.15 0.43 6.9 AADB (best) 0.11 0.13 4.0 n ( ) a0 a1e c/ += mp |
|||
|
Source: Stanford University - Global Positioning System (GPS) Lab. |
|||
|
Collection: Engineering |
|||
| 60 | Dartmouth College Computer Science Technical Report TR2008-624 Making RBAC Work in Dynamic, Fast-Changing | ||
|
Summary: for this study is based on the Ground Accuracy Designator B (GADB) and Airborne Accuracy Designator A (AADA... , integrity, continuity, and availability of the GADB/AADA model are likely to be slightly worse than... Airborne Model (m) (m) (deg) AADA (worst) 0.15 0.43 6.9 AADB (best) 0.11 0.13 4.0 n ( ) a0 a1e c/ += mp |
|||
|
Source: Dartmouth College, Department of Computer Science |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 61 | ORIGINAL PAPER Effects of selective inactivation of individual genes | ||
|
Summary: chimeric aadA gene fused to the homologous psbA promoter (Koop et al. 1996) into internal restriction sites... L) and 5¢-GGGGTAAATGG- CCGATACTGCAGGAAGGATTCCTC-3¢ (psbJ). The aadA cassette with a heterologous... -less chimeric aadA cassette which confers spectinomycin resistance on chloroplasts was inserted in sense |
|||
|
Source: Pakrasi, Himadri - Department of Biology, Washington University in St. Louis |
|||
|
Collection: Biology and Medicine |
|||
| 62 | Reviewed research article An Iceland hotspot saga | ||
|
Summary: .þ.b. helmingi þykkara undir Austfjörðum og landgrunni þeirra (120 km) heldur en undir Vestfjörðum og land... -Atlantshafi, og jarð- skorpu sem er 34 sinnum þykkari heldur en venju- legur úthafshryggur hefur. Þessa umfram |
|||
|
Source: Bjarnason, Ingi - Institute of Earth Sciences, University of Iceland |
|||
|
Collection: Geosciences |
|||
| 63 | Chloroplast Biogenesis of Photosystem II Cores Involves a Series of Assembly-Controlled Steps | ||
|
Summary: constructed a 59psbA-aadA cassette, in which the bac- terial aadA reporter gene was translated under... the 59psbA-driven aadA gene to the same level as the control that expresses D2. Since the 59psbA-aadA m... . The psbA 59UTR Confers a D2-Dependent Expression to the Reporter Gene aadA. (A) Schematic map of the pet |
|||
|
Source: Wollman, Francis-André - nstitut de Biologie Physico-Chimique & Université Pierre-et-Marie-Curie, Paris 6 |
|||
|
Collection: Biology and Medicine ; Renewable Energy |
|||
| 64 | Environ. Biosafety Res. 6 (2007) 7183 Available online at: c ISBR, EDP Sciences, 2007 www.ebr-journal.org | ||
|
Summary: Acinetobacter baylyi strain BD143 and transplastomic tobacco plants harboring the aadA gene (streptomycin... tobacco plants harboring the aadA gene (streptomycin and specti- nomycin resistance), our objective... , of the rbcL and accD genes flanking the transgene aadA (1.35 kb in size) and schematic representation |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 65 | Chimeric Fusions of Subunit IV and PetL in the b6 f Complex of Chlamydomonas reinhardtii | ||
|
Summary: for biolistic transformation by plasmid pycf7::aadA (a kind gift of Y. Takahashi, Okayama University), which... carries an aadA cassette conferring resistance to spectinomycin inserted at the SnaBI site within the pet... , the chloroplast genomes of strains DLL and DLS were transformed with plasmid pycf7::aadA. This plasmid ... |
|||
|
Source: Institut de Biologie Physico-Chimique CNRS, Physico-Chimie Moléculaire des Membranes Biologiques |
|||
|
Collection: Chemistry ; Biology and Medicine |
|||
| 66 | Subunit IV-PetL chimeras in cytochrome b6f complex Chimeric fusions of subunit IV and PetL in the b6 f complex of | ||
|
Summary: and DLS, were in turn used as recipient strains for biolistic transformation by plasmid pycf7::aadA (a... kind gift of Y. Takahashi, Okayama University), which carries an aadA cassette conferring resistance... DLL and DLS were transformed with plasmid pycf7::aadA. This plasmid carries a petL coding sequence dis |
|||
|
Source: Wollman, Francis-André - nstitut de Biologie Physico-Chimique & Université Pierre-et-Marie-Curie, Paris 6 |
|||
|
Collection: Biology and Medicine ; Renewable Energy |
|||
| 67 | Veurfar og umhverfi Msen slandi Gsli rn Bragaon | ||
|
Summary: jurtaleifum að þær ná ekki að rotna heldur kaffærast. Við fergingu jarðlagastaflans ummyndast jurtaleifarnar í |
|||
|
Source: Ingólfsson, Ólafur - Institute of Earth Sciences & Department of Geology and Geography, University of Iceland |
|||
|
Collection: Geosciences |
|||
| 68 | Lokun Panamasunds afleiingar veurfar og dralf THEDRA MATTHASDTTIR, JARSAGA 2 | ||
|
Summary: ræða heldur nýtti fána Norður-Ameríku sér auð svæði í suðri. Enn fremur er talið að fána Suður- Ameríku |
|||
|
Source: Ingólfsson, Ólafur - Institute of Earth Sciences & Department of Geology and Geography, University of Iceland |
|||
|
Collection: Geosciences |
|||
| 69 | Wegener og landreki, upphafi og run 1 Alfred Wegener og landreki, upphafi og run. | ||
|
Summary: ekki sagt okkur til um dreifingu heitra reita um jörðina, né heldur hvort eða hvernig plötumörk myndast |
|||
|
Source: Ingólfsson, Ólafur - Institute of Earth Sciences & Department of Geology and Geography, University of Iceland |
|||
|
Collection: Geosciences |
|||
| 70 | DR. ODDI-,'R BENEDIKTSSON. FORRITUNARMALI N ALGO!., FORTRAN | ||
|
Summary: forrrstuhlutverk i pessum efnum, ekki oinungis hvad kennslu snertir, heldur einnig til ad reyna nfjar Iei6ir. An ga |
|||
|
Source: Benediktsson, Oddur - Applied Mathematics and Computer Science Division, University of Iceland |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 71 | Donna Esposito1,2,3 , Julien P.Fey1,4,5 | ||
|
Summary: RNA. Transformants were selected by resistance to spectinomycin (conferred by the aadA marker; Goldschmidt... M-CAUUsspI or fM-CAUGsspI was inserted into the StuI site of the plasmid pQMAD, which contains the aadA gene... -particle bombardment (Kindle et al., 1991). Transformants expressing the aadA cassette were selected on TAP ... |
|||
|
Source: Wollman, Francis-André - nstitut de Biologie Physico-Chimique & Université Pierre-et-Marie-Curie, Paris 6 |
|||
|
Collection: Biology and Medicine ; Renewable Energy |
|||
| 72 | INTEGRAL REPRESENTATIONS OF THE g-DRAZIN INVERSE IN C* -ALGEBRAS | ||
|
Summary: of a is then expressed by ay = (a*a)Da* = a*(aa*)D . (1 |
|||
|
Source: Koliha, Jerry J. - Department of Mathematics and Statistics, University of Melbourne |
|||
|
Collection: Mathematics |
|||
| 73 | 1970 (Andrei Rogers) (Herve Le Bras) (multistate demographic models) | ||
|
Summary: 0 |p0(a)|da vT 0 ^G(0) vT 0 1u0 (2.10) 1 = 0 a(a)da v0 K K Keyfitz 2.2 (birth state) K = ^(0 |
|||
|
Source: Inaba, Hisashi - Graduate School of Mathematical Sciences, University of Tokyo |
|||
|
Collection: Mathematics |
|||
| 74 | Abstract to be submitted to the 23nd IWWWFB, Jeju, Korea, 13 April 16 April 2007. Generalized Wagner model for 2D symmetric and elastic bodies. | ||
|
Summary: the differential time marching (a=a+da) computation of a new history of the wetting correction history |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 75 | MATHEMATIQUES Une introduction aux mod`eles | ||
|
Summary: A avec D A = W 1,1 (0, +) : (0) = + 0 (a)(a)da , SMF Gazette 125, juillet 2010 #12;BIFURCATION ET... (a)(a)da) + 0 (a)(a)da - + 0 (a)(a)da . La premi`ere composante de l'application F est `a rapprocher |
|||
|
Source: Ruan, Shigui - Department of Mathematics, University of Miami |
|||
|
Collection: Mathematics |
|||
| 76 | JOURNAL DE PHYSIQUE Colloque C6, suppliment au no 11-12, Tome 33, Novembre-Ddcembre 1972,page 231 SCANNING OPTICAL PATTERNS WITH ACOUSTIC SURFACE WAVES (*) | ||
|
Summary: , photoconductive (pc) and surface state discharge (ss) we see that where W is the depletion region width. Now, a aa/da |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 77 | Long-wavelength tilting of the Australian continent since the Late Cretaceous Lydia DiCaprio a,b, | ||
|
Summary: , the Australian Antarctic Depth Anomaly (AADA), may be caused by a mantle source (Gurnis et al., 1998). Sandiford... away from a dynamic topography low associated with the AADA. It should be noted that following... AADA correlates well with the reconstructed position of the proposed shorter wavelength anomalous |
|||
|
Source: Gurnis, Michael - Division of Geological and Planetary Sciences, California Institute of Technology; Müller, Dietmar - School of Geosciences, University of Sydney |
|||
|
Collection: Geosciences |
|||
| 78 | PUBLICATION Journal paper | ||
|
Summary: : Probing the Complex Fluctuations by #12;Hilbert-Huang Transform", Advances in Adaptive Data Analysis (AADA |
|||
|
Source: Huang, Norden E.- Research Center for Adaptive Data Analysis, National Central University |
|||
|
Collection: Engineering ; Materials Science |
|||
| 79 | Multistep Processing of an Insertion Sequence in an Essential Subunit of the Chloroplast ClpP Complex*S | ||
|
Summary: pair aadA cassette conferring resistance to specti- nomycin and streptomycin (17) was inserted... in the unique EcoRV site so that aadA and clpP1 read in the same direction. Site-directed mutagenesis... 387A muta- tion into the clpP1 gene, linked to the aadA cassette conferring antibiotic resistance |
|||
|
Source: Wollman, Francis-André - nstitut de Biologie Physico-Chimique & Université Pierre-et-Marie-Curie, Paris 6 |
|||
|
Collection: Biology and Medicine ; Renewable Energy |
|||
| 80 | Serine Hydrolase KIAA1363: Toxicological and Structural Features with Emphasis on Organophosphate Interactions | ||
|
Summary: Abbreviations: AADA, arylacetamide deacetylase; AChE, acetylcho- linesterase; AFEST, Archaeoglobus fulgidus... of KIAA1363 and Homologous Serine Hydrolases with AChE KIAA1363 and homologuesa property KIAA1363 AADA... from the following references: KIAA1363, 13; AADA, 39; AFEST, 5; and AChE, 40. b Homology relative |
|||
|
Source: Cravatt, Benjamin - Department of Cell Biology, Scripps Research Institute |
|||
|
Collection: Biology and Medicine |
|||
| 81 | Demonstrations of Multi-Constellation Advanced RAIM for Vertical Guidance using | ||
|
Summary: Data (TEXT) Error Model (AAD-A) Computing Position Solution & Fault Detection Exclusion & Vertical... data through a ground receiver. We call that nominal error model Airborne Accuracy Designators (AAD-A |
|||
|
Source: Stanford University - Global Positioning System (GPS) Lab. |
|||
|
Collection: Engineering |
|||
| 82 | Set theoretical proofs as type theoretical programs | ||
|
Summary: 2 b.OE(x, y* *, "an)] (Ad.1) 8a.Ad(a) ! trans(a). (Ad.2) 8a, b.((Ad(a) ^ Ad... (b)) ! (a 2 b _ a = b _ b 2 a)). (Ad.3) 8a.(Ad(a) ! OEa), where OE is an axiom (P air), (Union |
|||
|
Source: Setzer, Anton - Department of Computer Science, University of Wales Swansea |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 83 | Set theoretical proofs as type theoretical Anton Setzer | ||
|
Summary: , # an)] (Ad.1) #a.Ad(a) # trans(a). (Ad.2) #a, b.((Ad(a) # Ad(b)) # (a # b # a = b # b # a)). (Ad.3) #a.(Ad(a |
|||
|
Source: Setzer, Anton - Department of Computer Science, University of Wales Swansea |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 84 | Set theoretical proofs as type theoretical Anton Setzer | ||
|
Summary: .[x a.y b.(x, y, an)] (Ad.1) a.Ad(a) trans(a). (Ad.2) a, b.((Ad(a) Ad(b)) (a b a = b b a)). (Ad... .3) a.(Ad(a) a ), where is an axiom (Pair), (Union) (0 - Sep), (0 - Coll). (+)n0 a, a1, . . . , an0 |
|||
|
Source: Setzer, Anton - Department of Computer Science, University of Wales Swansea |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 85 | Approximate Simulations for Probabilistic I/O Automata | ||
|
Summary: p(1-p) p2 (1-p) p3 aada 1-p p(1-p) p2 (1-p) p3 a 1-p p aa 1-p p(1-p) p2 d 1 ad 0 p 1-p aad 1-p p(1-p... -p) p3 aada 1-p p(1-p) p2 (1-p) p3 a 1-p p aa 1-p p(1-p) p2 d 1 ad 0 p 1-p aad 1-p p(1-p) p2 p1(a |
|||
|
Source: Lynch, Nancy - Computer Science and Artificial Intelligence Laboratory & Department of Electrical Engineering and Computer Science, Massachusetts Institute of Technology (MIT) |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 86 | Analysis of Signature Change Patterns Sunghun Kim, E. James Whitehead, Jr., Jennifer Bevan | ||
|
Summary: Overall projects Common Sequence # % Common Sequence # % ACDA 186 13% AADA 198 9% AADA 183 12% ACDA 186 9 |
|||
|
Source: Whitehead, James - Department of Computer Science, University of California at Santa Cruz |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 87 | An AraC-like transcriptional activator is required for induction of genes needed for K-galactoside utilization in Sinorhizobium meliloti | ||
|
Summary: ) with the aadA gene from Tn21. AadA conferred resistance to spectinomycin and allowed for selection |
|||
|
Source: Gage, Daniel J. - Department of Molecular and Cell Biology, University of Connecticut |
|||
|
Collection: Biology and Medicine |
|||
| 88 | Sequence elements within an HSP70 promoter counteract transcriptional transgene silencing in Chlamydomonas | ||
|
Summary: . In Chlamydomonas, TGS was found to be involved in the epigenetic silencing of the aadA transgene (Cerutti et al... ., 1997a, 1997b; Jeong et al., 2002). Two mutants, mut9 and mut11, exhibit impaired TGS of the aadA gene... ®cantly increasing the activities of promoters RBCS2, b2TUB and HSP70B driving the HSP70B and the aadA ... |
|||
|
Source: Wollman, Francis-André - nstitut de Biologie Physico-Chimique & Université Pierre-et-Marie-Curie, Paris 6 |
|||
|
Collection: Biology and Medicine ; Renewable Energy |
|||
| 89 | The Plant Cell, Vol. 15, 14431454, June 2003, www.plantcell.org 2003 American Society of Plant Biologists Cytochrome f Translation in Chlamydomonas Chloroplast Is | ||
|
Summary: with the aadA cassette that confers spectinomycin resistance (Goldschmidt-Clermont, 1991) in- serted at either... with the heterologous AadA reporter pro- tein (Choquet et al., 1998). However, we also had observed an opposite effect... region and of the petD gene, re- placed by the aadA cassette (see supplemental data online), ... |
|||
|
Source: Wollman, Francis-André - nstitut de Biologie Physico-Chimique & Université Pierre-et-Marie-Curie, Paris 6 |
|||
|
Collection: Biology and Medicine ; Renewable Energy |
|||
| 90 | Skrsla r nmsfer a Slheimajkli nmskeiinu ,,Rof, setmyndun og landmtun jkla" ma 2004 | ||
|
Summary: heldur áfram framan við garðinn og virðist lagið vera óhreyft og teljum við það auk |
|||
|
Source: Ingólfsson, Ólafur - Institute of Earth Sciences & Department of Geology and Geography, University of Iceland |
|||
|
Collection: Geosciences |
|||
| 91 | Flibasaltsvi Terter Ingi r Hallgrmsson Kld | ||
|
Summary: jarðar (mynd 5) og samanstendur af basöltum með víða samsetningu, ekki bara í samsætuhlutföllum heldur |
|||
|
Source: Ingólfsson, Ólafur - Institute of Earth Sciences & Department of Geology and Geography, University of Iceland |
|||
|
Collection: Geosciences |
|||
| 92 | Hskli slands Raunvsindadeild | ||
|
Summary: auðveldlega. #12;Þegar við skoðuðum sniðið við ána sáum við hvar garður- inn liggur ofan á jarðvegi sem heldur |
|||
|
Source: Ingólfsson, Ólafur - Institute of Earth Sciences & Department of Geology and Geography, University of Iceland |
|||
|
Collection: Geosciences |
|||
| 93 | Tracking and recognizing actions of multiple hockey players using the boosted particle filter | ||
|
Summary: auðveldlega. #12;Þegar við skoðuðum sniðið við ána sáum við hvar garður- inn liggur ofan á jarðvegi sem heldur |
|||
|
Source: Little, Jim - Department of Computer Science, University of British Columbia |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 94 | A dichotomy theorem for isomorphism Greg Hjorth | ||
|
Summary: auðveldlega. #12;Þegar við skoðuðum sniðið við ána sáum við hvar garður- inn liggur ofan á jarðvegi sem heldur |
|||
|
Source: Hjorth, Greg - Department of Mathematics, University of California at Los Angeles |
|||
|
Collection: Mathematics |
|||
| 95 | Fields Institute Communications Volume 00, 0000 | ||
|
Summary: that dimK [Torsion( \Omega 1 A=K )] = 1 2 c + dimK [ ~ AD ~ A=ADA]; where ADA is the image of oe, and ~ AD... ~ A = \Omega 1 ~ A=K . By the third isomorphism theorem, we have dimK [ ~ AD ~ A=ADA] = dimK [ ~ AD ~ A... (*) and (**) imply that dimK [ ~ AD ~ A=ADA] = 1 2 c \Gamma dimK [¯oe( \Omega 1 A=K =dA)]; and dimK ... |
|||
|
Source: Valuation Theory Archive |
|||
|
Collection: Mathematics |
|||
| 96 | Principal Component Analysis Over Continuous Subspaces and Intersection of Half-spaces? | ||
|
Summary: j a>u j2 da = u> Z a2W aa>da u (1) By substituting a1 + (1 ; )a2 for a in the integral R aa... matrix: Cov(W) = 1 V (W) Z a2W aa>da where V (W) denotes the volume of the polytop W, and the inverse... (W) = 1 V (W) Z a2W aa>da = 1 d(d + 1)A(I + ee>)A> (4) where e = (1 1 ::: 1) and \I" is the identity |
|||
|
Source: Shashua, Amnon - School of Computer Science and Engineering, Hebrew University of Jerusalem |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 97 | Journal of Artificial Intelligence Research 7 (1997) 6782 Submitted 5/97, published 9/97 1997 AI Access Foundation and Morgan Kaufmann Publishers. All rights reserved | ||
|
Summary: -terminal symbol. Sequence Grammar Sequence Grammar a S abcdbc S aAdA A bc b S abcdbcabcdbc S AA A aBdB B bc... a S a 2 ab S ab 3 abc S abc 4 abcd S abcd 5 abcdb S abcdb 6 abcdbc S abcdbc bc appears twice S aAdA... removed, aA, Ad added {bc, db, aA, Ad} substitute A for bc S aAdA A bc db removed, dA added {bc, dA, ... |
|||
|
Source: Mitzenmacher, Michael - School of Engineering and Applied Sciences, Harvard University |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 98 | INFECTION AND IMMUNITY, 0019-9567/99/$04.00 0 | ||
|
Summary: in characteristic clusters, the overlapping nature of the phylogeny was notable: in addition to the combined AA/DA... was hybridization with the she probe characteristic of strains located only in EAEC1, EAEC2, and AA/DA, but within... /I was found mainly in cluster EAEC1, whereas AAF/II predominated in the AA/DA cluster. Also, ... |
|||
|
Source: Whittam, Thomas S. - National Food Safety and Toxicology Center & Department of Zoology, Michigan State University |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 99 | The EMBO Journal Vol.18 No.11 pp.29612969, 1999 The Qo site of cytochrome b6f complexes controls | ||
|
Summary: , in addition to the PWYE mutation, a selectable marker, the aadA cassette, that confers resistance... UC-atpX-AAD containing the aadA cassette (Goldschmidt-Clermont et al., 1991) in the same orientation as the petD gene... DApwye to bombard the wild- type strain. Transformants were selected on TAP medium for the expression of the ... |
|||
|
Source: Institut de Biologie Physico-Chimique CNRS, Physico-Chimie Moléculaire des Membranes Biologiques; Wollman, Francis-André - nstitut de Biologie Physico-Chimique & Université Pierre-et-Marie-Curie, Paris 6 |
|||
|
Collection: Biology and Medicine ; Chemistry ; Renewable Energy |
|||
| 100 | Theoretical studies of parallel current in the presence of uctuations | ||
|
Summary: )] ; (18) where da = aaDa=2 ?, e = (Z + ee=c)=(2de) and i = (ii=c)=(2di) with aa = (3 p 3=4aa) and the ion |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||