Home

About

Advanced Search

Browse by Discipline

Scientific Societies

E-print Alerts

Add E-prints

E-print Network
FAQHELPSITE MAPCONTACT US


  Topic List  Advanced Search  
Sample search results for: ab initto determination

Page:   2  3  4  5 
 
1 Reachability-based orthogonal persistence for C, C++ and other intransigents
 

Summary:  these persistently-named objects must themselves persist. Thus, persistence is determined by reachability closure... pointers to those objects can accurately be determined, and updated to reflect the relocation of the object... 22 to-space := fg; 23 foreach r 2AR do promotepager; from-space; to-space; end; 24 copyStack:initto

  

Source: Hosking, Antony - Department of Computer Sciences, Purdue University

 

Collection: Computer Technologies and Information Sciences

 
2 Proc. HPCNEurope'99, Amsterdam, April 12--14, 1999, Springer LNCS, pp. 525--534. c fl Springer--Verlag
 

Summary:  (non­ determinism) when accessing shared memory locations or shared resources (screen, shared files... determined that all 4 #12; threads are going to take the same branch of control flow. Otherwise, control... is set to i. Evaluating expression e 2 (which is typically unstable), each thread determines the index i

  

Source: Kessler, Christoph - Institutionen för datavetenskap, Linköpings Universitet

 

Collection: Computer Technologies and Information Sciences

 
3 13498 J. Phys. Chem. 1994,98, 13498-13505 Rule-Based Trial Wave Functions for Generalized Valence Bond Theory
 

Summary:  -Fock (HF) method in which a product of orbitals and spins is antisymmetrized (using a Slater determinant... , as in HF),the wave function is generalized from a Slater determinant to a form that ensures that both... ,Including the Number of Iterationsto Convergence from GVB-INITto an Energy Criterionof 5 x hartrees no.GVBof no

  

Source: Goddard III, William A. - Materials and Process Simulation Center & Department of Chemistry, California Institute of Technology

 

Collection: Materials Science

 
4 1 Types of reasonings Deduction, Abduction, Learning
 

Summary:  . a set of observations How to: 1. determine the failures of the system 2. repair the system #12;Diagnosis... predicates: · Add additioner · Mult multiplier · In1 input 1 · In2 input 2 · Out output · Ab abnormal · Sum... are universally quantified. Behavior of an additioner · Add(x) ¬Ab(x) In1(x, u) In2(x, v) Sum(u, ...

  

Source: Pencolé, Yannick - Laboratoire d'Analyse et d'Architecture des Systèmes du CNRS

 

Collection: Computer Technologies and Information Sciences

 
5 KRR7: Diagnosis Yannick Pencole
 

Summary:  a system 2 a set of observations How to: 1 determine the failures of the system 2 repair the system #12... multiplier In1 input 1 In2 input 2 Out output Ab abnormal Sum sum Prod product #12;Knowledge representation... (x) ¬Ab(x) In1(x, u) In2(x, v) Sum(u, v, w) Out(x, w) Add(x) ¬Ab(x) In1(x, u) ...

  

Source: Pencolé, Yannick - Laboratoire d'Analyse et d'Architecture des Systèmes du CNRS

 

Collection: Computer Technologies and Information Sciences

 
6 Stability of small periodic waves for the nonlinear Schrodinger equation
 

Summary:  . This determines uniquely the expansion of P, k, # in powers of a and b. Setting W a,b (x) = e i# a,b x P a,b (k a,b... . In fact, for small (a, b) we can determine the spectrum of H a,b by a perturbation argument similar... )|, the translation ...

  

Source: Gallay, Thierry - Institut Fourier, Université Joseph Fourier Grenoble-I

 

Collection: Mathematics

 
7 Supplemental materials to "Reduced Rank Mixed Effects Models for
 

Summary:  standard results for multivari- ate normal distributions. The covariances between ab, ab and Y ab are cov(ab... , Y ab) = D,aT BT ab and cov(ab, Y ab) = VabT ,abBT ab. Since ...

  

Source: Huang, Jianhua - Department of Statistics, Texas A&M University; Zhou, Lan - Department of Statistics, Texas A&M University

 

Collection: Mathematics

 
8 Characterizing Diagnoses' Johan de Kleer
 

Summary:  task is to determine why a correctly designed system is not functioning as it was intended... in some way with its design. One of the main subtasks of diagnosis is to determine what could be wrong... that AB(c) is a literal which holds when component c ECOMPS is behaving abnormally. (Some of the model

  

Source: Mackworth, Alan K. - Department of Computer Science, University of British Columbia; de Kleer, Johan - Palo Alto Research Center (PARC)

 

Collection: Computer Technologies and Information Sciences

 
9 Biology 2250 Principles of Genetics
 

Summary:  Mendelian Inheritance Determining mode of inheritance: - single gene or more complicated - recessive... with expected #12;2 Mendelian Genetics in Humans Determining mode of inheritance Problems: 1. long generation... ambiguous · determine probability Mendel's Second Law Independent assortment: during gamete formation

  

Source: Innes, David J. - Department of Biology, Memorial University of Newfoundland

 

Collection: Environmental Sciences and Ecology

 
10 ANSWER KEY TO MATLAB 4.1 and 4.2 -Define your A and B matrices
 

Summary:  using the "det()" command. determinant of A+B = det(A+B) determinant of A-B = det(A-B) ...same procedure... with A*B, inv(A), and B' 4.1b you should notice that one of the calculations above yields a determinant... of A and B are. Which of the following matrices' ...

  

Source: Wenzl, Hans - Department of Mathematics, University of California at San Diego

 

Collection: Mathematics

 
11 A&A 446, 733738 (2006) DOI: 10.1051/0004-6361:20053757
 

Summary:  report: (i) a determination of the orbit of AB Dor C, the very low mass companion to AB Dor A, which... the details of an im- proved method to determine the mass of AB Dor C, which con- firms the value of 0.090 M... . 3. Astrometric analysis 3.1. AB Dor A ...

  

Source: Steward Observatory, Center for Astronomical Adaptive Optics

 

Collection: Physics

 
12 Polynomial-based optical true-time delay devices with microelectromechanical mirror arrays
 

Summary:  , and the locations of the spots for a given light beam are determined by the alignment of the other two mirrors... . The position of this spot is determined by the location of the center of the curvature of mirror B or more... as- sume the micromirror at that pixel is tipped to . Light is therefore reflected back into the AB

  

Source: Anderson, Betty Lise - Department of Electrical and Computer Engineering, Ohio State University

 

Collection: Engineering

 
13 Logic and Bayesian Networks Part 2: Logical Encoding of Bayesian Networks
 

Summary:  Encoding of Bayesian Networks 2/ 24 #12;Network Polynomial A B Pr(A, B) a b ab|a a b ab|a a b ab|a a b ab... |a a b abab|a a b abab|a a b abab|a f = abab|a + abab|a + abab|a + abab|a f (e = a) = (0)(1)ab|a + (0... )(1)ab|a + (1)(1)ab|a + ...

  

Source: 

 

Collection: Computer Technologies and Information Sciences

 
14 HEURISTIC SEARCH FOR HAMILTON CYCLES
 

Summary:  the conven- tions mentioned above are used (labels of graphs are from 1]): 1. 108] (abc)3 = (ab)2c(ba)2c = e... , ((ab)2ac)2(ba)2bc(ba)5bc(ac)2(ba)5bc(ba)2bc(ab)2ac(ab)4ac(ab)5ac(ba)2bc (ba)2bc(ab)5ac(ab)2 2. 120B... ] (ab)5 = ...

  

Source: Mohar, Bojan - Department of Mathematics, University of Ljubljana & Simon Fraser University

 

Collection: Mathematics

 
15 Journal of Pharmacological Sciences 2003 The Japanese Pharmacological Society
 

Summary:  January 8, 2003; Accepted February 3, 2003 Abstract. In Alzheimer's disease, fibrillar amyloid-b (Ab... ) peptides form senile plaques associated with microglia. However, the relationship between Ab peptides... and microglia is not fully understood. In this study, the incubation of Ab1-40 (Ab40) produced ...

  

Source: Durstewitz, Daniel - Research Group Computational Neuroscience, Central Institute of Mental Health,

 

Collection: Computer Technologies and Information Sciences ; Biology and Medicine

 
16 THE IMPACT OF INTERREGIONAL AND INTRAREGIONAL TRANSPORTATION COSTS
 

Summary:  ) and between regions (AB, BA). The intraregional transportation costs are given by AA and BB , whereas... interregional ones are given by AB BA . We suppose that the intraregional transportation costs are more... then have the following inequality: .BA AB BB AA 2.3. Equilibrium The objective of this model

  

Source: Ecole Polytechnique, Centre de mathématiques

 

Collection: Mathematics

 
17 M7: Exercise sheet 1 1. Prove directly from axioms (A1)(A9) that, for all a, b, c R,
 

Summary:  M7: Exercise sheet 1 1. Prove directly from axioms (A1)­(A9) that, for all a, b, c R, (a) If ab... = 0 then either a = 0 or b = 0; (b) -(ab) = (-a)b = a(-b); (c) If a + c = b + c then a = b. (d) -(-a... R, a < 0 and b < 0 a + b < 0. (vi) a, b R, a < 0 and 0 < b ab ...

  

Source: Burstall, Fran E. - Department of Mathematical Sciences, University of Bath

 

Collection: Mathematics

 
18 Re nements of the Peano kernel theorem Shayne Waldron
 

Summary:  that each 2 X is uniquely determined by its restriction to Ck+1 a;b], which is an element of (Ck+1 a;b... de ned on a;b] f = kX j=0 Djf(a)( ?a)j j! + Z b a Dk+1f(t) ( ?t)k + k! dt; (1:1) where ( )k... +1 a;b]) . The rest of the paper is set out as follows. In Section 2, the general Peano ...

  

Source: Waldron, Shayne - Department of Mathematics, University of Auckland

 

Collection: Mathematics

 
19 Answers HMW 2 MATH 330, Instructor: Catalin Turc
 

Summary:  the properties of the determinant, namely det(AB) = det(A)det(B) and the fact that A is singular iff det(A) = 0... , we get that after two steps the last row of the extended matrix [A|b] is zero, which means... possibility to solve this involves using the determinant, which can be defined for any square ...

  

Source: Turc, Catalin - Department of Mathematics, Case Western Reserve University

 

Collection: Mathematics

 
20 7N -glycansitesperSC 7N -glycan sites per SIgA
 

Summary:  ES/MS/MS Pool Glycans Release Glycans Hydrazinolysis PNGase F N or O links N links 2AB label Mass... Hydrazinolysis PNGase F N or O links N links 2AB label MassGU HPLC AU NP RP Mass Spec Fragmentation N- and O... -glycansitesperSIgA Predominantly small glycans with free GlcNAcs 2AB2AB ...

  

Source: Oxford Glycobiology Institute

 

Collection: Chemistry ; Biology and Medicine


Page:   2  3  4  5 
Page:   1  2  3  4  5 
 
21 Moment sums associated with binary linear forms A transparent argument is used to study the structure of the set of numbers
 

Summary:  which determines its value. Thus, for 0 m < ab, the value of N(m; a, b) acts as a characteristic... integers exceeding 1, and denote by S the set of non- negative integers m < ab for which the linear... .1) is not soluble is known to be the odd number M = ab - a - b; (1.2) see, for example, [1, Theorem ...

  

Source: Loughborough University, Department of Mathematical Sciences

 

Collection: Mathematics

 
22 ORIGINAL ARTICLE Xudong Huang Craig S. Atwood Robert D. Moir
 

Summary:  , and oligomerization of Alzheimer's Ab peptides Received: 3 August 2004 / Accepted: 17 September 2004 / Published... interaction is an in vitro model thought to propagate b-amyloid (Ab) deposition, accumulation, and incur... - rodegenerative diseases. However, Ab is a high-affinity metalloprotein that aggregates in the presence ...

  

Source: Wisconsin at Madison, University of - Laboratory of Endocrinology, Aging and Disease

 

Collection: Biology and Medicine

 
23 Pre-class worksheet due Wednesday, October 19. (Solutions) 1.For each of the following statement determine whether it is true or false
 

Summary:  determine whether it is true or false: (1) If A M3,3(R) and rank(A) = 2 then det(A) = 0. (2) If A M3,3(R... det(AB) = 0. (4) If sin (det(A)) = 0 then A is not invertible. (5) For every A M2,1(R) and every B M... 1,2(R) we have det(AB) = 0. [Note that if A M2,1(R) and B M1,2(R) then AB is a 2 × 2 ...

  

Source: Kapovich, Ilya - Department of Mathematics, University of Illinois at Urbana-Champaign

 

Collection: Mathematics

 
24 Math 475 Some Definitions from Chapter 2 Put Your Name In Here For this assignment, you should copy this document as closely as possible. Put your name in the
 

Summary:  Chapter 2 that you should already know. 1. Definition - A segment AB consists of points A and B and all... those points C on the line through A and B such that C is between A and B. 2. Definition - A ray -- AB... consists of the segment AB together with those points C on the line through A and B such that B is between

  

Source: Arnold, Elizabeth A. - Department of Mathematics and Statistics, James Madison University

 

Collection: Mathematics

 
25 CSC 258 midterm 4 November 2008, 6:10
 

Summary:  . 4. [10 marks] Write assembly-language code (VELMA or similar) to determine which is greater... -or definition: ab = ab + ab commutative: ab = ba a + b = b + a ab = ba associative: (ab)c = a(bc) (a + b) + c... = a + (b + c) ...

  

Source: Toronto, University of - Department of Computer Science, Dynamic Graphics Project

 

Collection: Computer Technologies and Information Sciences

 
26 Encoding phylogenetic trees in terms of weighted Stefan Grunewald
 

Summary:  of quartets A|B(T ) {ab|cd : a, b A and c, d B} uniquely determines the topology of T ([1, Proposition 2... , b}, {c, d}}, with a, b, c, d X distinct, which we also denote by ab|cd. A weighted quartet... of µ(ab|cd), µ(ac|bd), and µ(ad|bc) are equal to 0. (T2) For all x X - {a, b, c, d}, if ...

  

Source: Semple, Charles - Department of Mathematics and Statistics, University of Canterbury

 

Collection: Mathematics ; Environmental Sciences and Ecology

 
27 Math 516 Fall 2006 Radford Written Homework # 2 Solution
 

Summary:  : The relations a2 = e = b3 and ab = b2 a completely determine the group table in Exercise 5. In light of Exercise... that a2 = e for all a G. Show that G is abelian. Solution: Let a, b G. Then e = (ab)2 = (ab)(ab) shows... that e = abab. Multiplying both sides of this equation on the left by a and on the ...

  

Source: Radford, David E. - Department of Mathematics, Statistics, and Computer Science, University of Illinois at Chicago

 

Collection: Mathematics

 
28 Dynamic Subunit Exchange and the Regulation of Microtubule Assembly by the Stress Response Protein
 

Summary:  ) The interaction between non-polymerized tubulin and human aB crystallin was determined using a Biosep SEC-S4000... at approximately 8.78 ml and tubulin 9.77 ml. SDS-PAGE analysis determined that the peak at 8.78ml consisted of aB... Human aB Crystallin Scott A. Houck3 , John I. Clark1,2 ...

  

Source: Washington at Seattle, University of - Structural Informatics Group (SIG)

 

Collection: Computer Technologies and Information Sciences ; Biology and Medicine

 
29 FacultyofArtsandHumanities 10 For up to date module, program and course offerings please see www.westerncalendar.uwo.ca 2011 First Year Calendar
 

Summary:  -year courses: Applied Mathematics 1411A/B, Chemistry 1024A/B, Eng Sci 1021A/B, Eng Sci 1036A/B, Physics 1401A/B... , Physics 1402A/B. (Three of the half courses are to be taken in each term as scheduled.) #12;Facultyof... Sciences 1001A/B, Health ...

  

Source: Sinnamon, Gordon J. - Department of Mathematics, University of Western Ontario

 

Collection: Mathematics

 
30 Staging Static Analyses for Program Generation (Extended Version)
 

Summary:  the fixed parts. In approximate analysis [18], the meta-program is analyzed to determine as much as possible... representation of a dataflow problem if there is a function abs : R DFFun such that it is a homomorphism from (R... abs( R) = DF F un = d. Data abs(idR) = id abs(asgnR(x, e)) ...

  

Source: Kamin, Sam - Department of Computer Science, University of Illinois at Urbana-Champaign

 

Collection: Computer Technologies and Information Sciences

 
31 Amyloid-b Fibrillogenesis Seeded by Interface-Induced Peptide Misfolding and Self-Assembly
 

Summary:  . Mica pucks with transferred and/or adsorbed Ab were imaged by AFM. To determine the thickness of the Ab... ,5,31). To determine the CMC of Ab, p-values attained from different Ab subphase concentrations were measured for water... isotherms of Ab ...

  

Source: Lee, Ka Yee C. - Department of Chemistry, University of Chicago

 

Collection: Materials Science ; Chemistry ; Biology and Medicine

 
32 Problem 10560 (American Mathematical Monthly, Vol.103, December 1996)
 

Summary:  P, Q, R and S on sides AB, BC, CD, and DA, respectively, with |PA| |PB| = |RD| |RC| and |QB| |QC... , QCR, and RDS, respectively. Show that K4 212 KAKBKCKD and determine a necessary and sufficient... , 56100 Pisa, Italy. By hypothesis, there are , µ [0, 1] such that |PA| = |AB|, |RD| = |CD|, |QB| = µ

  

Source: Tauraso, Roberto - Dipartimento di Matematica, Università di Roma Tor Vergata

 

Collection: Mathematics

 
33 Problem Set 4 The following problem is meant to illustrate the idea in the proof of Hilbert's
 

Summary:  's Nullstellensatz. Problem 1. Let k be an algebraically closed eld. Let I = (A2 , B2 ) k[A, B]. It is clear that AB... I(V (I)) but that AB / I. By Hilbert's Nullstellensatz, some power of AB is in I (it is clear... , in fact, that (AB)2 I but let's approach this in the spirit of the proof of the ...

  

Source: Abo, Hirotachi - Department of Mathematics, University of Idaho

 

Collection: Mathematics

 
34 MATH 4/51021 Illustration of Proof of Cayley-Hamilton Theorem
 

Summary:  is the determinant of the matrix times I, so we have (tI - A)B(t) = |tI - A|I = (t3 - 3t - 42)I. (Exercise: Multiply... the matrices to verify this!) We also have (tI - A)B(t) = (tI - A)(B2t2 + B1t + B0) = B2t3 + (B1 - AB2)t2 + (B0... - AB1)t - AB0, hence B2t3 + (B1 - ...

  

Source: White, Donald L. - Department of Mathematics, Kent State University

 

Collection: Mathematics

 
35 Staging Static Analyses for Program Generation (Extended Version)
 

Summary:  . 2003], the meta-program is analyzed to determine as much as possible about what the generated program... abs : R DFFun #12;Staging Static Analyses for Program Generation · 7 R skip = idR R x = e = asgn... , ; , ). Specif- ically, this requires abs( R) = DF F un = d. Data abs(idR) = id ...

  

Source: Kamin, Sam - Department of Computer Science, University of Illinois at Urbana-Champaign

 

Collection: Computer Technologies and Information Sciences

 
36 DEVELOPING GENETIC MAPS We can determine s for pairs of genes or loci. Next question is how to place them in
 

Summary:  DEVELOPING GENETIC MAPS We can determine s for pairs of genes or loci. Next question is how... . 1. Grouping loci into linkage groups The question beyond determining linkage of any two loci... is the ordering of the loci into a reasonable genetic map. Ordering can be done using the MLE of , determined via

  

Source: Bhattacharyya, Madan Kumar - Department of Agronomy, Iowa State University

 

Collection: Biology and Medicine

 
37 JOURNAL OF BACTERIOLOGY, Jan. 2005, p. 687696 Vol. 187, No. 2 0021-9193/05/$08.00 0 doi:10.1128/JB.187.2.687696.2005
 

Summary:  the phosphorylation state of AbsA2 is determined by the balance of the kinase and phosphatase activities of AbsA1... 253A) into an in-frame absA1 deletion mutant con- structed in the Champness laboratory to determine... (lane 2). To determine whether ...

  

Source: Nodwell, Justin - Department of Biochemistry and Biomedical Sciences, McMaster University

 

Collection: Biology and Medicine

 
38 Reciprocal Collision Avoidance with Acceleration-Velocity Obstacles Jur van den Berg Jamie Snape Stephen J. Guy Dinesh Manocha
 

Summary:  use this rule to determine V A and V B if V AB were convex. However, in general it is not (see Fig... . Determining Sets of Reciprocal Collision Avoidance Given the convex set ^V AB of safe new relative velocities... = -(1 - AB)( ^V AB ...

  

Source: North Carolina at Chapel Hill, University of - Department of Computer Science, Geometric Algorithms for Modeling, Motion and Animation Group

 

Collection: Computer Technologies and Information Sciences

 
39 Reciprocal Collision Avoidance with Acceleration-Velocity Obstacles Jur van den Berg Jamie Snape Stephen J. Guy Dinesh Manocha
 

Summary:  use this rule to determine V A and V B if V AB were convex. However, in general it is not (see Fig... . Determining Sets of Reciprocal Collision Avoidance Given the convex set ^V AB of safe new relative velocities... = -(1 - AB)( ^V AB ...

  

Source: North Carolina at Chapel Hill, University of - Department of Computer Science, Geometric Algorithms for Modeling, Motion and Animation Group

 

Collection: Computer Technologies and Information Sciences

 
40 Transistor-level NCL Design As explained in the Intro to NCL module, NCL threshold gates are designed with hysteresis state-holding
 

Summary:  the set equation determines when the gate will become asserted and the hold equation determines when... the gate will remain asserted once it has been asserted. The set equation determines the gate... 23 gate for example. The set equation is AB + AC + BC, as given in Table 1, and the hold equation

  

Source: Smith, Scott C. - Department of Electrical Engineering, University of Arkansas

 

Collection: Engineering


Page:   1  2  3  4  5 
Page:   1  2  3  4  5 
 
41 Math 302, Section B1; February 5, 2003 Quiz 2 (with Solutions)
 

Summary:  distinct points A, B write a definition of a line segment AB with endpoints A, B. Solution. If A and B... are two distinct points then the segment AB consists of the points A and B and of all the points C... -space determined by A and P. Solution 1. The half-space determined by A and P consists of the point ...

  

Source: Kapovich, Ilya - Department of Mathematics, University of Illinois at Urbana-Champaign

 

Collection: Mathematics

 
42 Ch 7: Design of Experiments Controllable variables: temperature, pressure, feed
 

Summary:  time... · Determine a subset of variables that have the most influence on process performance... )/2 = 20. · Factor effect with interaction: A = 0 and B = -10. · Interactions: Table 1: AB = (20 + 50... )/2 - (30 + 40)/2 = 0 (No interac- tion). Table 2: AB = (40+30)/2-(10+20)/2 = 20 (Interaction). 3 #12

  

Source: Li, Haijun - Department of Mathematics, Washington State University

 

Collection: Mathematics

 
43 Tuesday 4/28 Agenda: 1. Student Evaluations of Instruction (SEIs)
 

Summary:  to determine whether: a) 84 | 3960 b) 13860 = (22 x 32 x 5 x 7 x 11) is a multiple of 3,960. Julia found... Divisibility Properties of Integers: 1. If a|b and b|a, then either a = b or a = b. 2. If a|b, then a... |bx for any integer x. 3. If a|b and a|c, then a|(bx + cy) for any integers x and y). 4. If ...

  

Source: Hasenbank, Jon - Mathematics Department, University of Wisconsin-La Crosse

 

Collection: Mathematics ; Multidisciplinary Databases and Resources

 
44 An equivalent definition of the histogram of forces: Theoretical and algorithmic implications
 

Summary:  ). The behavior of Fr AB towards any invertible affine transformation was not, however, determined... , the equivalent definition is better adapted to the solving of theoretical issues. We use it here to determine... definition allows us to determine the behavior of the force histogram towards any invertible ...

  

Source: Matsakis, Pascal - Department of Computing and Information Science, University of Guelph

 

Collection: Computer Technologies and Information Sciences

 
45 Efficient elimination of response parameters in molecular property calculations for variational and nonvariational energies
 

Summary:  are symmetric with respect to index permutations ab = ba . To determine a given response parameter ab... to order n in the ab...k indices determine energy derivatives to order 2n+1 within these indices. We use... such as ab...p and ¯ab...p may ...

  

Source: Helgaker, Trygve - Department of Chemistry, Universitetet i Oslo

 

Collection: Physics ; Chemistry

 
46 ORIGINAL PAPER Cation identity dependence of crown ether photonic crystal
 

Summary:  plate (1-D swelling), or with the PCCA film free (3-D swelling). Results and discussion Determination... .47. These values of are close to those previously determined for similar PCCAs (where was 0.503 for the affine... it calculates a value closer to the value of previously determined compared to the phantom model. Modeling

  

Source: Asher, Sanford A. - Department of Chemistry, University of Pittsburgh

 

Collection: Chemistry ; Materials Science

 
47 Molecular Ecology Notes (2002), 2, 316319 doi:10.1046/j.1471-8278 .2002.00227.x 2002 Blackwell Science Ltd
 

Summary:  no Ab1 F: CCAAATCCGTTAGTGGAACG R: CATTTTCCCAAGAGAAGTTTGG 55 (GA)27 270 10 AJ427924 Ab2 F... : GTAACAATGACCACACCCGTTACA R: CTTGACCCCCGTCCGATTAATATC 65 (GT)13 211 > 1 AJ427925 Ab3 F: TTTCTTGACAGAATGATATCCTGAAC R... : GGCAACGATTGTTGATCCTTTC 54 (GT)10 152 10 AJ427926 Ab4 F: CCCGTTATTACCAAAACTGATT R: ...

  

Source: Halligan, Daniel - Institute of Evolutionary Biology, University of Edinburgh

 

Collection: Environmental Sciences and Ecology

 
48 1.For the load shown in the figure, determine the force acting on the pin E of the lifting tongs. Where OA= OC =AE = CE, BE = DE = 2AE. In the position shown OAEC forms a square, and angle BED is
 

Summary:  .75. Determine the angular velocity of AB and the linear velocity of Gjust after impact. (15%) #12;5. A cord... 1.For the load shown in the figure, determine the force acting on the pin E of the lifting tongs... , weight is W. (20%) 2. A rigid bar AB of negligible weight is supported in a vertical plane by two ...

  

Source: Huang, Haimei - Department of Life Science, National Tsing Hua University

 

Collection: Biology and Medicine

 
49 EXAMPLE OF A CONTINUOUS MAPPING S2 WHOSE SET OF FOLD POINTS IS DENSE IN S2
 

Summary:  of Int Ab onto Ar = { z : r < |z| < 1} such that 1(pb ) [r, 1] (r is uniquely determined by Ab ) and 2... the annulus { z D | F(|z|) Ib} by Ab. Let U = {U1, U2, . . .} be some countable base of the standard... topology in D. For any b = (b1, . . ., bm) B, we define an annulus ...

  

Source: Orevkov, Stepan - Institut de Mathématiques de Toulouse, Université Paul Sabatier

 

Collection: Mathematics

 
50 Readings and Problems ***Note: Quiz #2: Thurs. Oct. 28
 

Summary:  Inheritance Determining mode of inheritance: - single gene or more complicated - recessive or dominant - sex... : P (6) or P (5) = 1/6 + 1/6 #12;2 Mendelian Genetics in Humans Determining mode of inheritance... Assortment F1 AaBb X AaBb F2 9 A-B- 3 A-bb 3 aaB- 1 aabb 4 phenotypes Independent Assortment Test Cross Aa

  

Source: Innes, David J. - Department of Biology, Memorial University of Newfoundland

 

Collection: Environmental Sciences and Ecology

 
51 Version 2.0 Electrodynamics of a compound system with relativistic corrections
 

Summary:  that the coupling of the total motion to internal degrees of freedom is uniquely determined by Lorentz covariance... that most of the terms are determined by Lorentz covariance and gauge symmetry, and we therefore expect... Hamiltonian is a sum of one­particle terms H a and two­particle interactions H ab including relativistic

  

Source: Pachucki, Krzysztof - Instytut Fizyki Teoretycznej, Uniwersytet Warszawski

 

Collection: Physics

 
52 MTH 310 Syllabus Fall 2000 CLASS TIME: MWF 10:00 { 10:50 in Addams Hall 220 from 08/21/2000 to 12/01/2000.
 

Summary:  changes : L-1 Mon Aug 21 1.1 linear systems and row operations { 1ab,5,6ad L-2 Wed Aug 23 1.2 echelon form... { 1,2a-d,3 L-3 Fri Aug 25 1.2 Gauss elimination, Gauss-Jordan { 5a-d,6ab (p.78:2b),12,16,18,19 L-4 Mon... Sep 6 2.1 determinants, de#12;nition, cofactors { 3,4,6 L-8 Fri Sep 8 2.2 properties of ...

  

Source: Verschelde, Jan - Department of Mathematics, Statistics, and Computer Science, University of Illinois at Chicago

 

Collection: Mathematics

 
53 CSI 3104: Introduction to Formal Languages Winter 2007
 

Summary:  are in PALINDROME Rule 2: Ok 1. b) 4 To determine if a string is PALINDROME: Step 1: If length (string) < 2... of length 2, and then make n-1 choices for the letters to the left which determine the letters to the right... letters. In each case n choices determine the word. Since there are two choices for letters

  

Source: Stojmenovic, Ivan - School of Information Technology and Engineering, University of Ottawa

 

Collection: Engineering

 
54 Reduction criterion for separability N. J. Cerf,1,2
 

Summary:  the inseparability of AB either. Accordingly, the determinant of AB is equal to 6a7 (1 a)(5a 3)/(1 8a)9 and thus... determinant Det(~ AB) 24a7 (1 a2 )/(1 8a)9 . This example emphasizes that does not result in a sufficient... .65.Bz, 89.70. c I. INTRODUCTION The state of a quantum ...

  

Source: Cerf, Nicolas - Quantum Information and Communication, Ecole Polytechnique, Université Libre de Bruxelles

 

Collection: Physics

 
55 Arthur B. Markman Curriculum Vitae
 

Summary:  , Chicago, IL. Markman, A.B. (1993). Structural alignment and the determination of commonalities... Books Markman, A.B. (1999). Knowledge representation. Mahwah, NJ: Lawrence Erlbaum Associates. Dietrich... , E., & Markman, A.B. (Eds.)(2000). Cognitive dynamics. Mahwah, NJ: Lawrence Erlbaum Associates. ...

  

Source: Pillow, Jonathan - Department of Psychology, University of Texas at Austin

 

Collection: Computer Technologies and Information Sciences ; Biology and Medicine

 
56 Onco-neural antibodies and tumour type determine survival and neurological symptoms in paraneoplastic neurological syndromes with Hu or CV2/CRMP5
 

Summary:  Onco-neural antibodies and tumour type determine survival and neurological symptoms... -Hu antibodies (Hu-Ab) and anti-CV2/CRMP5 antibodies (CV2/CRMP5-Ab) have been identified in association... this question, we compared 37 patients with CV2/CRMP5-Ab and 324 patients with Hu-Ab. Results ...

  

Source: Ecole Polytechnique, Centre de mathématiques

 

Collection: Mathematics

 
57 SHORT COMMUNICATION The phylogenetic position of an Armillaria species
 

Summary:  of the Armillaria sp. was determined using sequences of the elongation factor-1a (EF-1a) gene and the internal... : AB558990­AB559004 and AB36893, Table 1). The sequence data reported by Hasegawa et al. (2010... accession no. ITS accession no. Armillaria sp. 00-13 S841 Amami, Kagoshima, Japan Decayed wood ...

  

Source: US Forestry Service, Rocky Mountain Research Station

 

Collection: Environmental Sciences and Ecology

 
58 MATH 110: LINEAR ALGEBRA MIDTERM #2 REVIEW
 

Summary:  . If the statement is true, give a reason; if it is false, give a counterexample. (a) If A;B are row... -equivalent matrices, then det(A) = det(B). (b) Let A;B be n ¢n matrices such that AB = O. Then rk(A) + rk(B) n. (c... = b, then the n ¢n-matrix A = 0 BBBBBB@ a + b ab 0 ::: 0 0 1 a + b ...

  

Source: Voight, John - Department of Mathematics and Statistics, University of Vermont

 

Collection: Mathematics

 
59 Design, synthesis and evaluation of synthetic peptides with estrogen-like activity. Currently used anti-estrogenic drugs against hormone dependent-breast cancer, and
 

Summary:  , by evaluating their binding to mAb-E2 and to ERs. Initially, we determined the minimal binding sequence... -580, 2002) we used a monoclonal antibody to estradiol (mAb-E2) to screen a phage-display peptide library... , and identified a 15-mer peptide (peptide H5) that recognizes mAb-E2 (IC50 1 µM) and ...

  

Source: Kasher, Roni - Zuckerberg Institute for Water Research, Zuckerberg Institute for Water Research, Jacob Blaustein Institutes for Desert Research

 

Collection: Environmental Sciences and Ecology ; Environmental Management and Restoration Technologies

 
60 Rev. 10/7/2011 University of California
 

Summary:  Rev. 10/7/2011 University of California Frequently Asked Questions about AB 131 (California... Dream Act II) Context: AB 131, the "California Dream Act II" was signed by the Governor on October 7... , 2011. What will AB 131 do? AB 131 will allow all students who qualify for ...

  

Source: Wang, Deli - Department of Electrical and Computer Engineering, University of California at San Diego

 

Collection: Engineering ; Materials Science


Page:   1  2  3  4  5 
Page:   1  2  3  4  5 
 
61 Rev. 10/7/2011 Frequently Asked Questions about AB 131 (California Dream Act II)
 

Summary:  Rev. 10/7/2011 Frequently Asked Questions about AB 131 (California Dream Act II) Context: AB 131... , the "California Dream Act II" was signed by the Governor on October 7, 2011. What will AB 131 do? AB 131... will allow all students who qualify for AB 540 nonresident tuition exemptions, ...

  

Source: Hammock, Bruce D. - Department of Entomology, University of California, Davis

 

Collection: Biotechnology

 
62 Risk-Limiting Audits California AB 2023 Orange County, 2011 Audits: The After-Math of Elections
 

Summary:  Slates to determine sampling weights; about 2 hours work. #12;Risk-Limiting Audits California AB 2023 Orange County... Risk-Limiting Audits California AB 2023 Orange County, 2011 Audits: The After-Math of Elections... Verification Network Conference Chicago, IL #12;Risk-Limiting Audits California AB 2023 ...

  

Source: Stark, Philip B. - Department of Statistics, University of California at Berkeley

 

Collection: Mathematics

 
63 *Department of Neurology, David Geffen School of Medicine, University of California, Los Angeles, California, USA Materials Processing Center, Massachusetts Institute of Technology, Cambridge, Massachusetts, USA
 

Summary:  , and biochemical data indicate that self-assembly of amyloid b-protein (Ab) initiates the disruption... initially Ab fibrils, the pre-dominant component of amyloid plaques, were thought to be the culprit, now... soluble Ab oligomers are believed to be the major neurotoxic species in AD (Dahlgren et al. 2002; White et

  

Source: Benedek, George B. - Department of Physics, Massachusetts Institute of Technology (MIT)

 

Collection: Physics

 
64 Week 50 (8/25/03) Equal segments
 

Summary:  are equal distances from AB. Let the line determined by the Qi intersect PM and PN at Q0 and Q4... to arbitrary N will be clear. In the figure below, let the segment AB be divided into three equal segments by D... 1 and D2. From an arbitrary point P (assume that P is on the side of AB opposite to the infinite

  

Source: Prentiss, Mara - Department of Physics, Harvard University

 

Collection: Physics

 
65 Stat 597D: Topics in bioinformatics Spring 2001 Assignment 1 Due February 1
 

Summary:  , someone asked a question about the frequencies of the female genotypes A/A, A/B, and B/B at generation n... + or Rh{) is determined by an autosomal locus that we may assume to be diallelic. Denote the alleles as R... , AB/ab animals are crossed to measure the recombi- nation fraction #18; between two loci with alleles

  

Source: Hunter, David - Department of Statistics, Pennsylvania State University

 

Collection: Mathematics

 
66 Spectroscopic Studies of Dehydrogenation of Ammonia Borane in Carbon Cryogel Saghar Sepehri, Aaron Feaver, Wendy J. Shaw, Christopher J. Howard, Qifeng Zhang,
 

Summary:  , 2007; In Final Form: October 11, 2007 Ammonia borane (AB) is of great interest for storing hydrogen... decomposition of solid-state AB incorporated in carbon cryogels (CC) have been studied by spectroscopic methods... ) and showed a significant increase in hydrogen release kinetics for AB in CC compared to neat ...

  

Source: Cao, Guozhong - Materials Science and Engineering Department, University of Washington at Seattle

 

Collection: Materials Science

 
67 Geometry I, 2010 : Week-12 test First name
 

Summary:  , but this will not be looked at. 1. Let A = 2 3 2 -1 and B = -2 -1 3 4 . Determine the matrix 2A-B. 2. Let A = 2 3 2 -1 and B... = 3 -2 -2 4 . Determine the matrix AB. c QMUL2010 1 #12;3. Write down the inverse of the 2×2 matrix... A = 2 5 2 4 . [Simplify your matrix entries as much as possible.] 4. ...

  

Source: Bullett, Shaun - School of Mathematical Sciences, Queen Mary, University of London

 

Collection: Mathematics

 
68 Mathematisches Institut WS 2001/02 der Universitat Munchen Set 9
 

Summary:  (B; Map(A; C)). Determine the associated unit and counit. (34) Show that the underlying functor U : Ab... functor F : comMon ! Ab. Determine the as- sociated unit and counit. (Hint: Consider the construction... ! Gr, that forgets the commutativity of Abelian groups, has a left adjoint functor F : Gr ! ...

  

Source: Pareigis, Bodo - Mathematisches Institut, Ludwig-Maximilians-Universität München

 

Collection: Mathematics

 
69 Deuteron NMR investigation of a photomechanical effect in a smectic-A liquid crystal Bostjan Zalar
 

Summary:  :7AB mixture, on the other hand, was investigated to determine possible changes in the 8CB... in that state. The fraction c of cis-7AB molecules that are in cis form is determined from the relation FIG. 4... order Si of pure samples with zero cis-7AB population. The DNMR study allows us ...

  

Source: Selinger, Robin L. Blumberg - Liquid Crystal Institute and Chemical Physics Program, Kent State University

 

Collection: Materials Science

 
70 Defining Classes of Influences for the Acquisition of Probability Constraints for Bayesian Networks
 

Summary:  of the basic causal mechanism, the four conditional probabilities Pr(c | ab), Pr(c | ¯ab), Pr(c | a¯b) and Pr... (c | ¯a¯b) are required. For these probabilities, there are 24 possible orderings, each of which gives... in the two situations where both causes are either present or absent: {Pr(c | ...

  

Source: Utrecht, Universiteit - Department of Information and Computing Sciences, Decision Support Systems Group

 

Collection: Computer Technologies and Information Sciences

 
71 LOOKING FOR A COURSE TO FULFILL YOURLOOKING FOR A COURSE TO FULFILL YOURLOOKING FOR A COURSE TO FULFILL YOURLOOKING FOR A COURSE TO FULFILL YOUR SCIENCE REQUIREMENT?SCIENCE REQUIREMENT?SCIENCE REQUIREMENT?SCIENCE REQUIREMENT?
 

Summary:  no previous Science background. Actuarial Science 1021A/B* Astronomy 1021* Biology 1201A, 1202B, 1225* (Online... ), 1229F/G*, 1290B Calculus 1000A/B, 1100A/B, 1301A/B Chemistry 1027A/B*, 1100A/B Computer Science 1011A/B... *, ...

  

Source: Ma, Bin - Departments of Computer Science & Biochemistry, University of Western Ontario

 

Collection: Biotechnology ; Computer Technologies and Information Sciences

 
72 SIS Change Request Overview and Process Requests for SIS Enhancement, Customization, or Exception1
 

Summary:  not to use delivered functionality. Requests will be reviewed by the SIS Advisory Board (SIS AB) for possible... standards related to the student system and will, as determined by the appropriate governing group, bear all... and in accordance with the process outlined below. Request forms should be submitted to the SIS AB as ...

  

Source: Whittle, Mark - Department of Astronomy, University of Virginia

 

Collection: Physics

 
73 MATH 205B NOTES 2010 COMMUTATIVE ALGEBRA 29 5. Integral dependence and valuation
 

Summary:  element of A[b] can be written as an A-linear combination of these n elements. Lemma 5.2. A[b] is finitely... over A. (2) A[b] is a finitely generated A-modules. (3) A[b] is contained in a subring M of B which... is a f.g A-module. (4) There is a f.g. A-module M on which A[b] acts ...

  

Source: Igusa, Kiyoshi - Department of Mathematics, Brandeis University

 

Collection: Mathematics

 
74 Mixtures of Wild-type and a Pathogenic (E22G) Form of Ab40 in Vitro Accumulate Protofibrils, Including
 

Summary:  a Superdex 75 SEC column, producing a single peak corresponding to an unstructured Ab monomer (as determined... it changes with age have not been determined. To determine whether changes in Ab40ARC/Ab40WT ratio have... . Quantitative analysis of the molecular mass ...

  

Source: Walz, Thomas - Department of Cell Biology, Harvard University

 

Collection: Biology and Medicine

 
75 RIMS-1585, IHES/M/07/10 AN A1-STRUCTURE FOR LINES IN A PLANE
 

Summary:  -vertex, h ab to each internal edge, where a; b 2 fa 1 ; : : : ; a n+1 g is uniquely determined by the graph... ;#3; . We determine those multilinear maps on ~ V ab separately in each case ](#) := ]f1 #20; i #20; kjw i 2... two lines L a , L b which intersect with each other at one point v ...

  

Source: Kyoto University, Research Institute for Mathematical Sciences

 

Collection: Mathematics

 
76 HBA/Economics Combined Degree Program The combined degree programs are administered on behalf of the Richard Ivey School of Business and
 

Summary:  of Business. Entrance to the program may be limited. #12;Year 1 5.0 courses including: Economics 1021A/B... and Economics 1022A/B (or Economics 1020) Calculus 1000A/B or 1100A/B Students who plan to enroll... 60% in Economics 1021A/B, Economics 1022A/B, Calculus ...

  

Source: Sinnamon, Gordon J. - Department of Mathematics, University of Western Ontario

 

Collection: Mathematics

 
77 BOSEMESNER ALGEBRAS ATTACHED TO INVERTIBLE JONES PAIRS
 

Summary:  as a special case. As a result we were able to show that each four­weight spin model determines a pair... are type­II matrices and they determine W 3 and W 2 , respectively. Furthermore, it is straightforward... this section by defining the Nomura algebras N A,B and N # A,B of a pair of n × n matrices. ...

  

Source: Chan, Ada Sze Sze - School of Analytic Studies and Information Technology, York University (Toronto)

 

Collection: Mathematics

 
78 Performance Tuning of Gigabit Network Robert Geist
 

Summary:  IntDelay would determine packets per interrupt TxIntDelay 1400 TxAbsIntDelay 65000 RxDescriptors 256 Tx... during the testing MTU (NPDU size) {1500,3000,4500,6000} RxAbsIntDelay {10... ;Operational parameters Two parameters were varied during the testing MTU (NPDU size) {1500,3000,4500,6000} RxAbs

  

Source: Westall, James M. - Department of Computer Science, Clemson University

 

Collection: Computer Technologies and Information Sciences

 
79 Tuning dehydrogenation temperature of carbonammonia borane nanocomposites
 

Summary:  the hydrogen storage properties. For example, the dehydrogenation temperature of ammonia borane (AB... the pore size of the porus scaffold in coherent carbon­AB nanocomposites and our work has demonstrated... ­formaldehyde hydrogels through controlled pyrolysis.14,15 CC­AB nanocomposites were made by loading monolithic CCs

  

Source: Cao, Guozhong - Materials Science and Engineering Department, University of Washington at Seattle

 

Collection: Materials Science

 
80 R E S E A R C H A R T I C L E Alzheimer's Abfused to green uorescent protein induces
 

Summary:  42 peptide: an unbiased search for the sequence determinants of Ab amyloidogenesis. J Mol Biol 319... Dawes Keywords Alzheimer's disease; protein misfolding; heat shock response; Ab; b amyloid; reactive... oxygen species. Abstract The 42 amino acid Alzheimer's Ab peptide is involved in the progression

  

Source: Melbourne, University of - School of Physics, ARC Centre of Excellence for Coherent X-ray Science

 

Collection: Biology and Medicine ; Physics


Page:   1  2  3  4  5 
Page:   1  2  3  4  5 
 
81 Create Date: Create Time
 

Summary:  Author Subject Notes AB 0006 Ch. 501 Assembly Member Fuentes CalWORKs and CalFresh. AB 0009 Ch. 723... contain other operative provisions. AB 0012 Ch. 75 Assembly Member Swanson Abolition of Child Commerce... , Exploitation, and Sexual Slavery Act of 2011. AB 0022 Ch. 724 Assembly Member Mendoza Employment: ...

  

Source: California Energy Commission

 

Collection: Energy Storage, Conversion and Utilization

 
82 Empirical Study of the Impact of Sampling Timescales and Strategies on Measurement of Available Bandwidth
 

Summary:  probe streams determines the timescale at which the AB process is observed; arrows depict the times... tools have been designed for measuring end-to-end available bandwidth (AB) of a path by injecting probe... traffic on the path and inferring AB based on the end-to-end delays observed. While the algorithmic

  

Source: Kaur, Jasleen - Department of Computer Science, University of North Carolina at Chapel Hill

 

Collection: Computer Technologies and Information Sciences

 
83 Astron. Nachr. / AN 326, No. 10, 10331039 (2005) / DOI 10.1002/asna.200510442 AB Doradus C: age, spectral type, orbit, and comparison to
 

Summary:  of the JHKs fluxes, spectral type, and dynamically determined mass of AB Dor C. Upon comparing these results... in this plot were determined in the same manner used for AB Dor C, and these Pleiades points mostly fall along... Astron. Nachr. / AN 326, No. 10, 1033­1039 (2005) / DOI 10.1002/asna.200510442 ...

  

Source: Steward Observatory, Center for Astronomical Adaptive Optics

 

Collection: Physics

 
84 Geometry I, 2009 : Week-12 test First name
 

Summary:  . Determine the matrix AB. 1 #12;3. Suppose A is an m × n matrix and B is a p × q matrix. State the only... condition(s) on m, n, p, q required to be able to form the product AB. 4. Calculate the determinant... (A), for all 3 × 3 matrices A. (e) A(BC) = (AB)C for all n × n matrices A, ...

  

Source: Bullett, Shaun - School of Mathematical Sciences, Queen Mary, University of London; St Andrews, University of - School of Mathematics and Statistics, Centre for Interdisciplinary Research in Computational Algebra

 

Collection: Mathematics

 
85 Development of photocrosslinked sialic acid containing polymers for use in Ab toxicity attenuation
 

Summary:  (1) 2.10. Radiochemical binding assay Binding of Ab to sialic acid polymers was determined using... Ab was determined by precipitation of the peptide with 20 wt% tri- chloroacetic acid in the presence... to the unmodified gel. Free and bound Ab activity was ...

  

Source: Cote, Gerard L - Department of Biomedical Engineering, Texas A&M University

 

Collection: Biology and Medicine ; Engineering

 
86 On the Reverse Problem of Fechnerian Scaling Ehtibar N. Dzhafarov
 

Summary:  formulation does not exclude the possibility that ab for a given pair of stimuli (a, b) is determined... , G2ab, G1ba, G2ba, a, b) quantities determinable from other quantities. Knowing G1ab, G1ba, b a one... the canonical discrimination space (S, ) is not uniquely ...

  

Source: Dzhafarov, Ehtibar - Department of Psychological Sciences, Purdue University

 

Collection: Biology and Medicine ; Mathematics

 
87 Compiler Construction Lecture 26: Code Optimization
 

Summary:  is to determine, for each program point, which (complex) expressions must have been computed, and not later... of the Analysis Available Expressions Analysis The goal of Available Expressions Analysis is to determine... of the Analysis Available Expressions Analysis The goal of Available Expressions Analysis is to determine

  

Source: Ábrahám, Erika - Fachgruppe Informatik, Rheinisch Westfälische Technische Hochschule Aachen (RWTH)

 

Collection: Computer Technologies and Information Sciences

 
88 Convolution Surfaces based on Polygonal Curve Skeletons
 

Summary:  , the distance of the points determined by (r, h) on the convolution surface to the line segment [AB... of a line segment [AB]. The straight line through A and B is noted (AB). Then - AP represent the vector from... vn. The distance between two points A and B is noted |AB| = (b1 - a1)2 + ...

  

Source: Ecole Polytechnique, Centre de mathématiques

 

Collection: Mathematics

 
89 Convolution Surfaces based on Polygonal Curve Skeletons
 

Summary:  , the distance of the points determined by (r, h) on the convolution surface to the line segment [AB... of a line segment [AB]. The straight line through A and B is noted (AB). Then - AP represent the vector from... vn. The distance between two points A and B is noted |AB| = (b1 - a1)2 + ...

  

Source: Ecole Polytechnique, Centre de mathématiques

 

Collection: Mathematics

 
90 Demandes de rectification ou d'information faire auprs de Pierre Brard avant le 7/01/2010 dernier dlai GRPE N tudiant CC CC2
 

Summary:  Colle 3 MAT 20800960 12 12 9,00 15,00 12 0 11,667 11 11 13 MAT 20503737 abs abs abs abs abs 0 ##### ABS... ABS ABS MAT 20804774 abs 8,1 7,25 9,00 abs 0 ##### 11 8 ...

  

Source: Bérard, Pierre - Institut Fourier, Université Joseph Fourier Grenoble-I

 

Collection: Mathematics

 
91 December 29, 2010 22:33 WSPC/Guidelines Y4Spanner International Journal of Computational Geometry & Applications
 

Summary:  the properties of Section 3 to prove that, for every edge ab in Y 4 , there exists a path between a and b in Y4... , the graph Y 4 contains a path between a and b whose length (in the L-metric) is at most 8|ab|. #12;December... definitions. We say that two edges ab and cd properly cross (or cross, for short) if they share a ...

  

Source: O'Rourke, Joseph - Department of Computer Science, Smith College; Smid, Michiel - School of Computer Science, Carleton University

 

Collection: Computer Technologies and Information Sciences

 
92 Vol. 29 (1998) ACTA PHYSICA POLONICA B No 3 BONDI MASS IN CLASSICAL FIELD THEORY
 

Summary:  us denote by AB a metric on a unit sphere ( ABdxAdxB := d2 + sin2 d2). We shall consider... + 230 1 + 2 + AB AB . We use the following convention for indices: Greek indices µ, , . . . run from 0... 30 + AB AB = L + 1 2 0 sin -3 1 + 2 2 - 1 2 3 sin -1 2 , (2.13) where we have ...

  

Source: Magiera, Andrzej - Instytut Fizyki, Uniwersytet Jagiellonski

 

Collection: Physics

 
93 Demo: Indoor Localization without Infrastructure using the Acoustic Background Spectrum
 

Summary:  as a full paper at this MobiSys conference [2]. In that paper, we introduce a new technique for determining... is based on a new ambient sound fingerprint called the Acoustic Back- ground Spectrum (ABS... ). This demonstration has two com- ponents. First, it shows attendees a live view of the ABS in the demonstration hall

  

Source: Dick, Robert - Department of Electrical Engineering and Computer Science, University of Michigan

 

Collection: Engineering ; Computer Technologies and Information Sciences

 
94 Linear algebra I Homework #7 solutions
 

Summary:  Linear algebra I Homework #7 solutions 1. Determine both the null space and the column space... the rank of A, namely the dimension of the column space of A. (a) Show that rk(AB) rk(A) for all n × n... ) Show that there are no matrices A, B such that A is 3 × 2, B is 2 × 3 and AB = I3. · The first part

  

Source: Karageorgis, Paschalis - School of Mathematics, Trinity College, Dublin

 

Collection: Mathematics

 
95 Salvianolic acid B inhibits Ab fibril formation and disaggregates preformed fibrils and protects against Ab-induced cytotoxicty
 

Summary:  in (Munoz-Ruiz et al., 2005). To determine amyloid fibril forma- tion, the solutions containing Ab1­40 with... Ab1­42 were added to the differentiated SH-SY5Y cells for 24 h. Cell viability was determined using... Salvianolic acid B inhibits Ab fibril formation and disaggregates ...

  

Source: Klein, William - Department of Neurobiology and Physiology, Northwestern University

 

Collection: Biology and Medicine

 
96 Handout D5 page 1 Tetrad Analysis
 

Summary:  's begin by showing how we can determine if two loci are located on the same or different chromosomes using... in question: A and B. A cross of a haploid yeast strain that is AB to one that is ab yields a transient... type has two spores like the one parent (AB) and two spores like the other parent ...

  

Source: Doebley, John - Department of Medical Genetics, University of Wisconsin at Madison

 

Collection: Renewable Energy ; Biology and Medicine

 
97 APPLIED PHYSICS 216 OPTICAL PHYSICS AND QUANTUM ELECTRONICS
 

Summary:  ( ) 2 = 1 for a runninng wave, Equation [ VI-21 in Semiclassical Laser Theory simplifies to P n ab ,n... , ab( ) = -i 2 h -1 En N D ab - n; ab( ) 1+ In L ab - n; ab( ) where N is the average population... inversion density and In = 2 En 2 h 2 1 2 1 a + 1 b 1 ...

  

Source: Jones, R. Victor - School of Engineering and Applied Sciences, Harvard University

 

Collection: Physics ; Materials Science

 
98 The DeCCo project papers V Compiler Correctness Proofs
 

Summary:  , as [A, B]AB [ac, bc]ab[C]C [ , t0|h, t1, . . . , t2 , t3, . . . , t4|, t5, ] where the subscripts show... , and the hi byte t5. If two bytes are store in AB, the lo byte is in B, the hi byte in A. An underscore... that the value of the the byte or word in the AB registers is stored at the memory location ...

  

Source: Stepney, Susan - Department of Computer Science, University of York (UK)

 

Collection: Computer Technologies and Information Sciences

 
99 Interactions of Ab(140) with Glycerophosphocholine and Intact Erythrocyte Membranes: Fluorescence and
 

Summary:  by fluorescence spectroscopy the interaction of Ab and GPC with the intact erythro- cyte membrane to determine... Interactions of Ab(1­40) with Glycerophosphocholine and Intact Erythrocyte Membranes: Fluorescence... , glycerophosphocholine (GPC), also increase in AD brain. The effect of GPC on amyloid b(1­40) peptide ...

  

Source: Mandal, Pravat K. - National Brain Research Centre (India)

 

Collection: Biology and Medicine

 
100 Encoding probabilistic causal models in probabilistic action language PAL Chitta Baral and Nam Tran
 

Summary:  and w. So s is also uniquely determined by u and w. Thus we have: P(s|init¬ab, initially D) = P... variables. If s is an initial state such that s |= init¬ab then (i) s is uniquely determined by its inertial... determine what state we are in. That is, conditioning on ...

  

Source: Baral, Chitta - Department of Computer Science and Engineering, Arizona State University

 

Collection: Computer Technologies and Information Sciences


Page:   1  2  3  4  5