| Sample search results for: aada teedume toivo |
| 1 | Working Group I.2 Committee Members: 2002-2006 Andreas Junge | ||
|
Summary: Ferguson T. Harinarayana George Jiracek Toivo Korja Juanjo Ledo Nick Palshin Art Raiche Claudia Sainato... @ksvo.titech.ac.jp dhbai@mail.igcas.ac.cn ij_ferguson@umanitoba.ca tharinarayana@hotmail.com jiracek@moho.sdsu.edu toivo |
|||
|
Source: Harinarayana, T. - Magnetotelluric Division, National Geophysical Research Institute, India |
|||
|
Collection: Geosciences |
|||
| 2 | Original Article High prevalence of trimethoprim-resistance cassettes in class 1 and 2 | ||
|
Summary: strains. The class 1 integrons detected contained dfr and aadA cassettes, alone or in combination (dfrA5... /dfrA15, or dfrA15-aadA1, dfrA1-aadA2), and an atypical cassette array with an insertion sequence (oxa... 30-aadA1-IS1). For class 2 integrons, we detected either the same cassettes as those found in Tn7 |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 3 | The EMBO Journal vol.15 no.14 pp.3498-3506, 1996 The chloroplast ycf7 (petL) open reading frame of | ||
|
Summary: with a single transmembrane a helix. We have disrupted 0RF58 andycf 7 with the aadA expression cassette... by particle- gun mediated chloroplast transformation. While the ORF58::aadA transformants... are indistinguishable from wild type, photoautotrophic growth of the ycf7::aadA transformants is considerably impaired |
|||
|
Source: Institut de Biologie Physico-Chimique CNRS, Physico-Chimie Moléculaire des Membranes Biologiques |
|||
|
Collection: Chemistry ; Biology and Medicine |
|||
| 4 | Stable transformation of petunia plastids Mikhajlo K. Zubkoy | ||
|
Summary: cultivar of P. hybrida (var. Pink Wave). Plastid targeting regions from tobacco were used to integrate aadA... cassettes containing the aadA and gusA genes were cloned into the ApaI site of pTB27-link in inverted... element can be excised with NotI and PstI as a 247 bp fragment. An aadA expression cassette |
|||
|
Source: Meyer, Peter - Centre for Plant Sciences & Faculty of Biological Sciences, University of Leeds |
|||
|
Collection: Biology and Medicine |
|||
| 5 | ELECTRICAL CONDUCTIVITY OF THE SCANDINAVIAN CALEDONIDES AND THE UNDERLYING PRECAMBRIANBASEMENT | ||
|
Summary: Toivo Korja (1) Maxim Smirnov (2), and Laust B. Pedersen (2) (1) Institute of Geosciences, University |
|||
|
Source: Smirnov, Maxim - Institutionen för geovetenskaper, Uppsala Universitet |
|||
|
Collection: Geosciences |
|||
| 6 | Book Title Encyclopedia of Machine Learning Book CopyRight -Year 2010 | ||
|
Summary: , University of Helsinki, Helsinki, Finland Definition Apriori algorithm (Agrawal, Mannila, Srikant, Toivo- nen |
|||
|
Source: Toivonen, Hannu - Department of Computer Science, University of Helsinki |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 7 | 1st Reading August 3, 2011 18:57 WSPC/1793-5369 244-AADA 00081 | ||
|
Summary: 1st Reading August 3, 2011 18:57 WSPC/1793-5369 244-AADA 00081 Advances in Adaptive Data Analysis1... iteration41 1 #12;1st Reading August 3, 2011 18:57 WSPC/1793-5369 244-AADA 00081 2 R. H. Chan, H.-X. Liang... -AADA 00081 Positively Constrained Total Variation Penalized Image Restoration 3 The first term of Eq |
|||
|
Source: Chan, Raymond - Department of Mathematics, Chinese University of Hong Kong |
|||
|
Collection: Mathematics |
|||
| 8 | 1st Reading June 16, 2011 20:26 WSPC/1793-5369 244-AADA 00064 | ||
|
Summary: 1st Reading June 16, 2011 20:26 WSPC/1793-5369 244-AADA 00064 Advances in Adaptive Data Analysis1... of 1 #12;1st Reading June 16, 2011 20:26 WSPC/1793-5369 244-AADA 00064 2 T. Y. Hou & Z. Shi wavelet... in this same special issue of AADA as our paper.38 This is a very interesting line of work. For the examples |
|||
|
Source: Hou, Thomas Yizhao - Applied and Computational Mathematics Department, California Institute of Technology |
|||
|
Collection: Mathematics |
|||
| 9 | ON THE EQUATION a(a + d)(a + 2d)(a + 3d) = x2 Tamas Erdelyi | ||
|
Summary: the following outline: If y2 = a(a+d)(a+2d)(a+3d), then dividing both sides by a4 and setting y = y/a2 and x = d... is to present a totally elementary proof of the fact that the equation a(a+d)(a+2d)(a+3d) = x2 cannot be solved... -trivial applications of infinite descent; the current proof is one. Theorem. The equation ... |
|||
|
Source: Erdélyi, Tamás - Department of Mathematics, Texas A&M University |
|||
|
Collection: Mathematics |
|||
| 10 | JOURNAL OF BACTERIOLOGY, Nov. 2002, p. 60566059 Vol. 184, No. 21 0021-9193/02/$04.00 0 DOI: 10.1128/JB.184.21.60566059.2002 | ||
|
Summary: C-PBAD-T7pol genes, flanked by aadA sequences, in a pSB890 backbone (8). The new Salmonella construct, SB300... -1 to SB300. Key components of pSBaadABADT7-1 include tet, oriR6K (7, 11), sacB (7), aadA (7, 9), ara... C-PBAD (6), and the T7 RNA polymerase gene (12). The aadA gene, encoding a streptomycin adenylyltransferase |
|||
|
Source: Galan, Jorge E - Boyer Center for Molecular Medicine & Department of Cell Biology, Yale University |
|||
|
Collection: Biology and Medicine |
|||
| 11 | Proc. Natl. Acad. Sci. USA Vol. 95, pp. 43804385, April 1998 | ||
|
Summary: -attachment-defective cytochrome f sequence, a deletion of the petD gene, and the aadA cassette (conferring spectinomycin... of the aadA cassette in plasmid pAF52L-55V (21) with the 3 UTR of the petD gene, using the strategy... plasmid pAFRF. This substituted the aadA coding region from plasmid pdFBE with the petA coding region |
|||
|
Source: Wollman, Francis-André - nstitut de Biologie Physico-Chimique & Université Pierre-et-Marie-Curie, Paris 6 |
|||
|
Collection: Biology and Medicine ; Renewable Energy |
|||
| 12 | 1st Reading July 24, 2008 13:6 WSPC/244-AADA 00004 | ||
|
Summary: 1st Reading July 24, 2008 13:6 WSPC/244-AADA 00004 Advances in Adaptive Data Analysis1 Vol. 1, No... Reading July 24, 2008 13:6 WSPC/244-AADA 00004 2 Z. Wu & N. E. Huang As discussed by Huang et al.,1... , 200 to 480 Hz, etc. #12;1st Reading July 24, 2008 13:6 WSPC/244-AADA 00004 Ensemble Empirical Mode |
|||
|
Source: Huang, Norden E.- Research Center for Adaptive Data Analysis, National Central University |
|||
|
Collection: Engineering ; Materials Science |
|||
| 13 | Autoluminescent Plants Alexander Krichevsky1 | ||
|
Summary: marker aadA, resulting in pCAS3-aadA-LUX vector. Homologous recombination sites for integration into rps... ) plastid genome in tobacco is present in thousands of copies per cell [24]. Integration of aadA and the lux... fragments. Shown are also: the rps12 and trnV plastid genes; aadA, the spectinomycin resistance gene |
|||
|
Source: Citovsky, Vitaly - Department of Biochemistry and Cell Biology, SUNY at Stony Brook |
|||
|
Collection: Biology and Medicine ; Biotechnology |
|||
| 14 | University Graduate School Academic Bulletin | ||
|
Summary: Studies) Associate Director Professor Toivo Raun* (Central Eurasian Studies) Center E-mail iaunrc... * (Public and Environmental Affairs), Christine L. Ogan* (Emerita, Journalism), Toivo Raun* (Central |
|||
|
Source: Indiana University - Center for Research on Concepts and Cognition |
|||
|
Collection: Multidisciplinary Databases and Resources |
|||
| 15 | Advances in Adaptive Data Analysis Vol. 3, Nos. 1 & 2 (2011) vvi | ||
|
Summary: This special issue of AADA is devoted to the research topics presented in the highly stimulating international |
|||
|
Source: Huang, Norden E.- Research Center for Adaptive Data Analysis, National Central University |
|||
|
Collection: Engineering ; Materials Science |
|||
| 16 | ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Feb. 2010, p. 590596 Vol. 54, No. 2 0066-4804/10/$12.00 doi:10.1128/AAC.00055-09 | ||
|
Summary: Cf No. of copies of blaCMY-2 1 2 2 2 floR regiong Yes Yes Yes Yes aadA regiong Yes Yes No Yes kan... on sequence similarity with pAM04528. g The floR, aadA, kan, and merA regions are shown in Fig. 1. VOL. 54... (A), strA, strB, and sul2. The "aadA region" includes aadA, aacC, and two heat-shock chaperones ... |
|||
|
Source: Singer, Randall - College of Veterinary Medicine, University of Minnesota |
|||
|
Collection: Biology and Medicine |
|||
| 17 | The EMBO Journal vol. 1 3 no. 5 pp. 101 9 -1027, 1994 The assembly of cytochrome b6If complexes: an | ||
|
Summary: ; Goldschmidt-Clermont, 1991). One of them, the aadA expression cassette (Goldschmidt- Clermont, 1991... restriction fragment containing most or all of the corresponding pet ORF for the aadA4 cassette which confers... .9 kb, resulting from the fusion of the 5' untranslated region of atpA with the aadA gene from |
|||
|
Source: Wollman, Francis-André - nstitut de Biologie Physico-Chimique & Université Pierre-et-Marie-Curie, Paris 6 |
|||
|
Collection: Biology and Medicine ; Renewable Energy |
|||
| 18 | Ragam: Charukesi Version: Semmangudi | ||
|
Summary: Tyaagaraaje Paati Maata Meaning: O Ramayya! You seem to feel ("galade") too proud ("Aada"), too uppish ("modi |
|||
|
Source: Kalyanaraman, Shivkumar - IBM Research India |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 19 | Biogenesis of PSI involves a cascade of translational autoregulation in the chloroplast | ||
|
Summary: of regulation of translation initiation in the CES behaviour of PsaA, using the aadA reporter gene One... a chimeric gene bearing the psaA 50 UTR fused immediately upstream of the bacterial aadA gene coding sequence... to a specific downregulation of translation of the psaA 50 UTR-driven aadA gene when expressed in the absence |
|||
|
Source: Wollman, Francis-André - nstitut de Biologie Physico-Chimique & Université Pierre-et-Marie-Curie, Paris 6 |
|||
|
Collection: Biology and Medicine ; Renewable Energy |
|||
| 20 | EMTESZ-Pomerania International co-operative EM sounding research | ||
|
Summary: Observatory (FMI), Oulu/Helsinki: - Toivo Korja (PI), - Ilkka Lahti, - Kari Pajunpaa Germany - Frei Univ |
|||
|
Source: Smirnov, Maxim - Institutionen för geovetenskaper, Uppsala Universitet |
|||
|
Collection: Geosciences |
|||
| 21 | RELATEDNESS OF ESCHERICHIA COLI WITH DIFFERENT SUSCEPTIBILITY1 PHENOTYPES ISOLATED FROM SWINE FECES DURING AMPICILLIN2 | ||
|
Summary: -spectinomycin (strA-strB and167 aadA1), tetracycline (tet(A) and tet(B)) and the integrase genes intI1 and intI2 were... A-strB and intI1 (except for one isolate).263 Another combination: blaTEM, cmlA, sulI, sulIII, tet(A), aadA1... 678/ EF090911b aadA1 GAGAACATAGCGTTGCCTTGG TCGGCGCGATTTTGCCGGTTAC 46 198 53 Se 131/ AJ238350b tet |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 22 | 2002 Blackwell Science Ltd The ramC gene is required for morphogenesis in | ||
|
Summary: is a derivative of pIJ8660 (Sun et al., 1999) in which the aac(3) IV gene has been replaced by aadA (see Table 2... ) and inserted into the XbaI site. The aadA gene, conferring resist- ance to spectinomycin, was isolated from p... at positions 712 to generate ramRdown, aac(3)IV and aadA. pTO1 is unable to replicate in S. ... |
|||
|
Source: Nodwell, Justin - Department of Biochemistry and Biomedical Sciences, McMaster University |
|||
|
Collection: Biology and Medicine |
|||
| 23 | Diversity Strategic Update William T. Lewis -Vice President -Office for Diversity and Inclusion | ||
|
Summary: . · AnAchievableDreamAcademyPartnership (AADA) is designed to close the achievement gap for Access... Resources #12;first-generation, low-income and underrepresented students at AADA schools, thereby increasing |
|||
|
Source: Hopkins, William A. - Department of Fisheries and Wildlife Sciences, Virginia Tech |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 24 | Advantages of a Leveled Commitment Contracting Protocol | ||
|
Summary: constraint is based on the idea that E ;a] E max ;a;a ; ]]: Z 1 ;1 f(a) ;a]da Z ;a ;1 f(a) ;a;a]da+ Z 1 ;a f... 0). The contractor's IR constraint is satis ed: Z 1 ;1 f(a) ;a]da Z ;a ;1 f(a) ;a;a]da+ Z 1 ;a f... ;a ; ] , a . Thus the (ex ante) IR constraint is Z 1 ;1 f(a) ;a]da Z ;a ;1 f(a) ;a;a]da+ Z 1 ;a f(a) ; ]da Full |
|||
|
Source: Massachusetts at Amherst, University of - Department of Computer Science, Multi-Agent Systems Lab |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 25 | The Plant Cell, Vol. 13, 13471367, June 2001, www.plantcell.org 2001 American Society of Plant Physiologists The Chloroplast Gene ycf9 Encodes a Photosystem II (PSII) | ||
|
Summary: reading frame with an aadA cassette in the antisense orientation (Figure 2A); aadA confers resistance... D and psbC upstream and trnG down- stream. A terminatorless aadA cassette was inserted into the MunI site... reinitiation of transcripts con- taining the C-terminal gene segment. Correct insertion of the ... |
|||
|
Source: Wollman, Francis-André - nstitut de Biologie Physico-Chimique & Université Pierre-et-Marie-Curie, Paris 6 |
|||
|
Collection: Biology and Medicine ; Renewable Energy |
|||
| 26 | Pivotal Roles for the Receiver Domain in the Mechanism of Action of the Response Regulator RamR of | ||
|
Summary: reading frame with an aadA cassette in the antisense orientation (Figure 2A); aadA confers resistance... D and psbC upstream and trnG down- stream. A terminatorless aadA cassette was inserted into the MunI site... reinitiation of transcripts con- taining the C-terminal gene segment. Correct insertion of the ... |
|||
|
Source: Nodwell, Justin - Department of Biochemistry and Biomedical Sciences, McMaster University |
|||
|
Collection: Biology and Medicine |
|||
| 27 | ANRV329-GE41-08 ARI 21 June 2007 22:19 The Origin and | ||
|
Summary: -resistant and driven by a mosaic virus promoter that would be active in the nucleus) and aadA (controlled by a plastid... -resistant plants (i.e., that contain the nptII gene trans- ferred from the plastid) both the active nptII and aadA... genes were detected in the same genomic vicinity (ca. 1 Kb). Given that ARGs nptII and ... |
|||
|
Source: Bhattacharya, Debashish - Department of Ecology, Evolution, and Natural Resources, Rutgers University |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 28 | TO: 2009-2010 Faculty Senate FROM: Rod Hill, Faculty Secretary | ||
|
Summary: /17/09 Appr. 4/13/09 FSH UP-09-022 AA&DA FC-09-022: FSH 3200 Policy of Nondiscrimination 12/9/08 #14 appr... . GFM 4/21/09 Pres. Appr. 6/18/09 n/a FSH UP-09-023 AA&DA FC-09-023: FSH 3860 Grievance for Classified... Staff 12/9/08 #14 appr. GFM 4/21/09 Pres. Appr. 6/18/09 n/a FSH UP-09-020 AA&DA FC-09-024: FSH 3215 |
|||
|
Source: Idaho, University of - Department of Electrical and Computer Engineering, Center for Advanced Microeclectronics and Biomolecular Research |
|||
|
Collection: Engineering |
|||
| 29 | A ticking clock: Performance analysis of a Circadian rhythm with stochastic process | ||
|
Summary: as we do in the stochastic -calculus model. DA def = (bindADA , A).ADA + (mkMA, A).DA ADA def = (unbind... = (decayMR , MR).M R + (mkR, R).MR A def = (mkA, ).A A def = (bindADA , A).ADA + (bindADR , R).ADR + (bind... dt [A] = A[MA] + A[ADA] + R[ADR] - A[DA][A] - R[DR][A] - C[A][R] - A[A] d dt [ADA ] = ... |
|||
|
Source: Imperial College, London - Department of Computing, Analysis, Engineering, Simulation & Optimization of Performance Group |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 30 | The Plant Cell, Vol. 12, 137149, January 2000, www.plantcell.org 2000 American Society of Plant Physiologists Evidence for a Role of ClpP in the Degradation of the | ||
|
Summary: ) by a silent TC change at the last position of the third codon. For selection of transformants, the aadA... the aadA cassette and the PvuI restriction site. In one of these strains, the PCR product amplified using... -acetate [TAP] and spectinomycin), the transformants became homoplasmic for the aadA cassette. However, the Pvu |
|||
|
Source: Wollman, Francis-André - nstitut de Biologie Physico-Chimique & Université Pierre-et-Marie-Curie, Paris 6 |
|||
|
Collection: Biology and Medicine ; Renewable Energy |
|||
| 31 | Message from the Department Head When you tell your friends and family that your degree is in | ||
|
Summary: and Technology 2011 14 DigestFood College of Agriculture and Life Sciences An Achievable Dream Academy (AADA... relationships with caring adults. Approximately 80 percent of AADA graduates go on to college and 20 percent... participated in a Living Career Fair at AADA. The purpose of the career fair was to inspire ... |
|||
|
Source: Virginia Tech, Virginia Bioinformatics Institute, Influenze Outbreak Project |
|||
|
Collection: Biology and Medicine ; Computer Technologies and Information Sciences |
|||
| 32 | Functional Insensitivity of the Cytochrome b6 f Complex to Structure Changes in the Hinge Region of the | ||
|
Summary: . The aadA cassette (34), which encodes an aminoglycoside 3 -adenyltransferase and confers spectino- mycin... contains an aadA cassette located 500 bp upstream of petC1. A 3.8-kb fragment including the 5 -part of pet... C1 and the 5 -flanking sequence with the aadA cassette was excised from plasmid V by restriction |
|||
|
Source: Cramer, William A. - Department of Biological Sciences, Purdue University |
|||
|
Collection: Biology and Medicine |
|||
| 33 | Expanding C1 with R3(x0, x2) we find two implied atoms: R4(x2) and R1(x2, x1) respectively. After normal-form | ||
|
Summary: , Toivo- nen. 2000) and Jimi (Maloberti, Suzuki. 2003). We define a Closure() operator by empolying |
|||
|
Source: Khardon, Roni - Department of Computer Science, Tufts University |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 34 | bio-math-vol1-inaba_final : 2009/11/26(21:58) , 1920 1930 | ||
|
Summary: ) = Z 0 (a)(a)da (1.4) (1.4) , (a) := exp(- R a 0 µ(x)dx) , (a) = (0)e-a (a) , , EulerLotka Z 0 e... (A) D(A) = { X : A X, (0) = R 0 (a)(a)da} 1.3.1 A C0 T(t), t 0 , T(t)(X+) X+ p(t) = T(t)p0 , p0 D |
|||
|
Source: Inaba, Hisashi - Graduate School of Mathematical Sciences, University of Tokyo |
|||
|
Collection: Mathematics |
|||
| 35 | Visualization of Pathogenicity Regions in Bacteria Carsten Friis, Lars Juhl Jensen and David W. Ussery | ||
|
Summary: ) aadA2 > CmlA > tetA > b-lac > sulI > < int < tetR < IntB D) C) B) A) int aadA 2 qacD E qacD E C m l |
|||
|
Source: Ussery, David W. - Center for Biological Sequence Analysis, Institute of Biotechnology, Danmarks Tekniske Universitet |
|||
|
Collection: Biotechnology |
|||
| 36 | ON INTEGRAL REPRESENTATIONS OF THE DRAZIN INVERSE IN BANACH ALGEBRAS | ||
|
Summary: by ay = (a*a)Da* = a*(aa*)D. (3.2) Since the nonzero spectrum of a*a always |
|||
|
Source: Koliha, Jerry J. - Department of Mathematics and Statistics, University of Melbourne |
|||
|
Collection: Mathematics |
|||
| 37 | Moufang Quasigroups Kenneth Kunen 1 | ||
|
Summary: ), and the definition of d: (a(aa))d = (((aa) d) (aa)) d = (aa) (d ((aa) d)) = (aa)(da) = (aa)b (i) By (ffl) and (i), we |
|||
|
Source: Kunen, Ken - Department of Mathematics, University of Wisconsin at Madison |
|||
|
Collection: Mathematics |
|||
| 38 | Homogeneous Epidemic Systems in the Stable Hisashi Inaba | ||
|
Summary: .3) 6 #12;where (a) := e-r0a f(a) (a), is the state space of w given by := L1 +(0, ) : 0 (a)(a)da... given by D(A0) = AC[0, ] : (0) = 0 (a)(a)da . and the nonlinear term G is given by G() := (r0 - h... of the perturbation is := L1 +(0, ) : 0 (a)(a)da = 0 . Then it is easy to see that is positively invariant |
|||
|
Source: Inaba, Hisashi - Graduate School of Mathematical Sciences, University of Tokyo |
|||
|
Collection: Mathematics |
|||
| 39 | *Research Assistant, Member AIAA Professor, Fellow, AIAA | ||
|
Summary: for this study is based on the Ground Accuracy Designator B (GADB) and Airborne Accuracy Designator A (AADA... , integrity, continuity, and availability of the GADB/AADA model are likely to be slightly worse than... Airborne Model (m) (m) (deg) AADA (worst) 0.15 0.43 6.9 AADB (best) 0.11 0.13 4.0 n ( ) a0 a1e c/ += mp |
|||
|
Source: Stanford University - Global Positioning System (GPS) Lab. |
|||
|
Collection: Engineering |
|||
| 40 | ElectroMagnetic Mini Arrays (EMMAs) in Fennoscandia. Theoretical and practical advances in long period simultaneous magnetotelluric investigations. | ||
|
Summary: period simultaneous magnetotelluric investigations. A research plan Toivo Korja Department of Geosciences... - final publications 4. Research team and resources 4.1 Research team Oulu: Toivo Korja, docent, Senior |
|||
|
Source: Smirnov, Maxim - Institutionen för geovetenskaper, Uppsala Universitet |
|||
|
Collection: Geosciences |
|||
| 41 | Dartmouth College Computer Science Technical Report TR2008-624 Making RBAC Work in Dynamic, Fast-Changing | ||
|
Summary: period simultaneous magnetotelluric investigations. A research plan Toivo Korja Department of Geosciences... - final publications 4. Research team and resources 4.1 Research team Oulu: Toivo Korja, docent, Senior |
|||
|
Source: Dartmouth College, Department of Computer Science |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 42 | ORIGINAL PAPER Effects of selective inactivation of individual genes | ||
|
Summary: chimeric aadA gene fused to the homologous psbA promoter (Koop et al. 1996) into internal restriction sites... L) and 5¢-GGGGTAAATGG- CCGATACTGCAGGAAGGATTCCTC-3¢ (psbJ). The aadA cassette with a heterologous... -less chimeric aadA cassette which confers spectinomycin resistance on chloroplasts was inserted in sense |
|||
|
Source: Pakrasi, Himadri - Department of Biology, Washington University in St. Louis |
|||
|
Collection: Biology and Medicine |
|||
| 43 | Chloroplast Biogenesis of Photosystem II Cores Involves a Series of Assembly-Controlled Steps | ||
|
Summary: constructed a 59psbA-aadA cassette, in which the bac- terial aadA reporter gene was translated under... the 59psbA-driven aadA gene to the same level as the control that expresses D2. Since the 59psbA-aadA m... . The psbA 59UTR Confers a D2-Dependent Expression to the Reporter Gene aadA. (A) Schematic map of the pet |
|||
|
Source: Wollman, Francis-André - nstitut de Biologie Physico-Chimique & Université Pierre-et-Marie-Curie, Paris 6 |
|||
|
Collection: Biology and Medicine ; Renewable Energy |
|||
| 44 | Environ. Biosafety Res. 6 (2007) 7183 Available online at: c ISBR, EDP Sciences, 2007 www.ebr-journal.org | ||
|
Summary: Acinetobacter baylyi strain BD143 and transplastomic tobacco plants harboring the aadA gene (streptomycin... tobacco plants harboring the aadA gene (streptomycin and specti- nomycin resistance), our objective... , of the rbcL and accD genes flanking the transgene aadA (1.35 kb in size) and schematic representation |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 45 | Chimeric Fusions of Subunit IV and PetL in the b6 f Complex of Chlamydomonas reinhardtii | ||
|
Summary: for biolistic transformation by plasmid pycf7::aadA (a kind gift of Y. Takahashi, Okayama University), which... carries an aadA cassette conferring resistance to spectinomycin inserted at the SnaBI site within the pet... , the chloroplast genomes of strains DLL and DLS were transformed with plasmid pycf7::aadA. This plasmid ... |
|||
|
Source: Institut de Biologie Physico-Chimique CNRS, Physico-Chimie Moléculaire des Membranes Biologiques |
|||
|
Collection: Chemistry ; Biology and Medicine |
|||
| 46 | Subunit IV-PetL chimeras in cytochrome b6f complex Chimeric fusions of subunit IV and PetL in the b6 f complex of | ||
|
Summary: and DLS, were in turn used as recipient strains for biolistic transformation by plasmid pycf7::aadA (a... kind gift of Y. Takahashi, Okayama University), which carries an aadA cassette conferring resistance... DLL and DLS were transformed with plasmid pycf7::aadA. This plasmid carries a petL coding sequence dis |
|||
|
Source: Wollman, Francis-André - nstitut de Biologie Physico-Chimique & Université Pierre-et-Marie-Curie, Paris 6 |
|||
|
Collection: Biology and Medicine ; Renewable Energy |
|||
| 47 | A hyperelastic deformable template for cardiac segmentation in MRI | ||
|
Summary: H¨anninen, Kirsi Lauerma, Juhani Knuuti, Toivo Katila, and Isabelle E. Magnin. A 3-D model |
|||
|
Source: Rouchdy, Youssef - Instrumentation, Control and Architecture of Advanced Robots, INRIA Sophia Antipolis |
|||
|
Collection: Mathematics |
|||
| 48 | On the Fixed-Parameter Tractability of the Equivalence Test of Monotone Normal Forms | ||
|
Summary: , Roni Khardon, Heikki Mannila, and Hannu Toivo- nen. Data mining, hypergraph transversals, and machine |
|||
|
Source: Friedrich-Schiller-Universität Jena, Fakultät für Mathematik und Informatik |
|||
|
Collection: Mathematics |
|||
| 49 | Conference Report Molecular Routes to Materials in New York | ||
|
Summary: in significantamounts in solution during sol-gel condensation. Toivo Kodas (University of New Mexico) detailed his |
|||
|
Source: Girolami, Gregory S. - Department of Chemistry, University of Illinois at Urbana-Champaign |
|||
|
Collection: Materials Science ; Chemistry |
|||
| 50 | Ant Colony Optimization A Aevaluating which of several alternative algorithms is | ||
|
Summary: , Helsinki, Finland Definition Apriori algorithm (Agrawal, Mannila, Srikant, Toivo- nen, & Verkamo |
|||
|
Source: Libre de Bruxelles, Université - Computer and Decision Engineering Department |
|||
|
Collection: Computer Technologies and Information Sciences ; Engineering |
|||
| 51 | A Fast Algorithm for Computing Hypergraph Transversals and its Application in Mining Emerging Patterns | ||
|
Summary: , and H. Toivo nen. Data Mining, Hypergraph Transversals, and Ma chine Learning. In Proceedings of PODS |
|||
|
Source: Bailey, James - Department of Computer Science and Software Engineering, University of Melbourne |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 52 | Recent Advances in Machine Learning and Game Playing | ||
|
Summary: [1] Rakesh Agrawal, Heikki Mannila, Ramakrishnan Srikant, Hannu Toivo- nen, and A. Inkeri Verkamo |
|||
|
Source: Fürnkranz, Johannes - Fachbereich Informatik, Technische Universität Darmstadt |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 53 | Donna Esposito1,2,3 , Julien P.Fey1,4,5 | ||
|
Summary: RNA. Transformants were selected by resistance to spectinomycin (conferred by the aadA marker; Goldschmidt... M-CAUUsspI or fM-CAUGsspI was inserted into the StuI site of the plasmid pQMAD, which contains the aadA gene... -particle bombardment (Kindle et al., 1991). Transformants expressing the aadA cassette were selected on TAP ... |
|||
|
Source: Wollman, Francis-André - nstitut de Biologie Physico-Chimique & Université Pierre-et-Marie-Curie, Paris 6 |
|||
|
Collection: Biology and Medicine ; Renewable Energy |
|||
| 54 | Finding frequent substructures in chemical compounds Luc Dehaspe | ||
|
Summary: from the Apriori al gorithm (Agrawal et al. 1996). In (Dehaspe & Toivo nen 1998) we show how Warmr... Bases (VLDB'95), 420 -- 431. Holsheimer, M.; Kersten, M.; Mannila, H.; and Toivo nen, H. 1995 |
|||
|
Source: Toivonen, Hannu - Department of Computer Science, University of Helsinki |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 55 | Mining Audit Data to Build Intrusion Detection Models # Wenke Lee and Salvatore J. Stolfo and Kui W. Mok | ||
|
Summary: here di#ers from (Mannila & Toivo nen 1996) in that we don't consider a separate window constraint... . available via anonymous ftp to ftp.ee.lbl.gov. Klemettinen, M.; Mannila, H.; Ronkainen, P.; Toivo nen, H |
|||
|
Source: Lee, Wenke - College of Computing, Georgia Institute of Technology |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 56 | An Object-Oriented Approach to Multi-Level Association Rule Scott IFortin | ||
|
Summary: . Holsheimer, M. Kersten, H. Mannila, andH. Toivo- nen. A perspective on databases and data mining. Technical... . Mannila, P.Ronkainen, H. Toivo- nen, and Al. Verkamo. Finding interesting rules from large setsof |
|||
|
Source: Liu, Ling - College of Computing, Georgia Institute of Technology |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 57 | INTEGRAL REPRESENTATIONS OF THE g-DRAZIN INVERSE IN C* -ALGEBRAS | ||
|
Summary: of a is then expressed by ay = (a*a)Da* = a*(aa*)D . (1 |
|||
|
Source: Koliha, Jerry J. - Department of Mathematics and Statistics, University of Melbourne |
|||
|
Collection: Mathematics |
|||
| 58 | 1970 (Andrei Rogers) (Herve Le Bras) (multistate demographic models) | ||
|
Summary: 0 |p0(a)|da vT 0 ^G(0) vT 0 1u0 (2.10) 1 = 0 a(a)da v0 K K Keyfitz 2.2 (birth state) K = ^(0 |
|||
|
Source: Inaba, Hisashi - Graduate School of Mathematical Sciences, University of Tokyo |
|||
|
Collection: Mathematics |
|||
| 59 | Abstract to be submitted to the 23nd IWWWFB, Jeju, Korea, 13 April 16 April 2007. Generalized Wagner model for 2D symmetric and elastic bodies. | ||
|
Summary: the differential time marching (a=a+da) computation of a new history of the wetting correction history |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 60 | MATHEMATIQUES Une introduction aux mod`eles | ||
|
Summary: A avec D A = W 1,1 (0, +) : (0) = + 0 (a)(a)da , SMF Gazette 125, juillet 2010 #12;BIFURCATION ET... (a)(a)da) + 0 (a)(a)da - + 0 (a)(a)da . La premi`ere composante de l'application F est `a rapprocher |
|||
|
Source: Ruan, Shigui - Department of Mathematics, University of Miami |
|||
|
Collection: Mathematics |
|||
| 61 | JOURNAL DE PHYSIQUE Colloque C6, suppliment au no 11-12, Tome 33, Novembre-Ddcembre 1972,page 231 SCANNING OPTICAL PATTERNS WITH ACOUSTIC SURFACE WAVES (*) | ||
|
Summary: , photoconductive (pc) and surface state discharge (ss) we see that where W is the depletion region width. Now, a aa/da |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 62 | Long-wavelength tilting of the Australian continent since the Late Cretaceous Lydia DiCaprio a,b, | ||
|
Summary: , the Australian Antarctic Depth Anomaly (AADA), may be caused by a mantle source (Gurnis et al., 1998). Sandiford... away from a dynamic topography low associated with the AADA. It should be noted that following... AADA correlates well with the reconstructed position of the proposed shorter wavelength anomalous |
|||
|
Source: Gurnis, Michael - Division of Geological and Planetary Sciences, California Institute of Technology; Müller, Dietmar - School of Geosciences, University of Sydney |
|||
|
Collection: Geosciences |
|||
| 63 | PUBLICATION Journal paper | ||
|
Summary: : Probing the Complex Fluctuations by #12;Hilbert-Huang Transform", Advances in Adaptive Data Analysis (AADA |
|||
|
Source: Huang, Norden E.- Research Center for Adaptive Data Analysis, National Central University |
|||
|
Collection: Engineering ; Materials Science |
|||
| 64 | Multistep Processing of an Insertion Sequence in an Essential Subunit of the Chloroplast ClpP Complex*S | ||
|
Summary: pair aadA cassette conferring resistance to specti- nomycin and streptomycin (17) was inserted... in the unique EcoRV site so that aadA and clpP1 read in the same direction. Site-directed mutagenesis... 387A muta- tion into the clpP1 gene, linked to the aadA cassette conferring antibiotic resistance |
|||
|
Source: Wollman, Francis-André - nstitut de Biologie Physico-Chimique & Université Pierre-et-Marie-Curie, Paris 6 |
|||
|
Collection: Biology and Medicine ; Renewable Energy |
|||
| 65 | Serine Hydrolase KIAA1363: Toxicological and Structural Features with Emphasis on Organophosphate Interactions | ||
|
Summary: Abbreviations: AADA, arylacetamide deacetylase; AChE, acetylcho- linesterase; AFEST, Archaeoglobus fulgidus... of KIAA1363 and Homologous Serine Hydrolases with AChE KIAA1363 and homologuesa property KIAA1363 AADA... from the following references: KIAA1363, 13; AADA, 39; AFEST, 5; and AChE, 40. b Homology relative |
|||
|
Source: Cravatt, Benjamin - Department of Cell Biology, Scripps Research Institute |
|||
|
Collection: Biology and Medicine |
|||
| 66 | Demonstrations of Multi-Constellation Advanced RAIM for Vertical Guidance using | ||
|
Summary: Data (TEXT) Error Model (AAD-A) Computing Position Solution & Fault Detection Exclusion & Vertical... data through a ground receiver. We call that nominal error model Airborne Accuracy Designators (AAD-A |
|||
|
Source: Stanford University - Global Positioning System (GPS) Lab. |
|||
|
Collection: Engineering |
|||
| 67 | Set theoretical proofs as type theoretical programs | ||
|
Summary: 2 b.OE(x, y* *, "an)] (Ad.1) 8a.Ad(a) ! trans(a). (Ad.2) 8a, b.((Ad(a) ^ Ad... (b)) ! (a 2 b _ a = b _ b 2 a)). (Ad.3) 8a.(Ad(a) ! OEa), where OE is an axiom (P air), (Union |
|||
|
Source: Setzer, Anton - Department of Computer Science, University of Wales Swansea |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 68 | Set theoretical proofs as type theoretical Anton Setzer | ||
|
Summary: , # an)] (Ad.1) #a.Ad(a) # trans(a). (Ad.2) #a, b.((Ad(a) # Ad(b)) # (a # b # a = b # b # a)). (Ad.3) #a.(Ad(a |
|||
|
Source: Setzer, Anton - Department of Computer Science, University of Wales Swansea |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 69 | Set theoretical proofs as type theoretical Anton Setzer | ||
|
Summary: .[x a.y b.(x, y, an)] (Ad.1) a.Ad(a) trans(a). (Ad.2) a, b.((Ad(a) Ad(b)) (a b a = b b a)). (Ad... .3) a.(Ad(a) a ), where is an axiom (Pair), (Union) (0 - Sep), (0 - Coll). (+)n0 a, a1, . . . , an0 |
|||
|
Source: Setzer, Anton - Department of Computer Science, University of Wales Swansea |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 70 | Approximate Simulations for Probabilistic I/O Automata | ||
|
Summary: p(1-p) p2 (1-p) p3 aada 1-p p(1-p) p2 (1-p) p3 a 1-p p aa 1-p p(1-p) p2 d 1 ad 0 p 1-p aad 1-p p(1-p... -p) p3 aada 1-p p(1-p) p2 (1-p) p3 a 1-p p aa 1-p p(1-p) p2 d 1 ad 0 p 1-p aad 1-p p(1-p) p2 p1(a |
|||
|
Source: Lynch, Nancy - Computer Science and Artificial Intelligence Laboratory & Department of Electrical Engineering and Computer Science, Massachusetts Institute of Technology (MIT) |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 71 | Analysis of Signature Change Patterns Sunghun Kim, E. James Whitehead, Jr., Jennifer Bevan | ||
|
Summary: Overall projects Common Sequence # % Common Sequence # % ACDA 186 13% AADA 198 9% AADA 183 12% ACDA 186 9 |
|||
|
Source: Whitehead, James - Department of Computer Science, University of California at Santa Cruz |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 72 | An AraC-like transcriptional activator is required for induction of genes needed for K-galactoside utilization in Sinorhizobium meliloti | ||
|
Summary: ) with the aadA gene from Tn21. AadA conferred resistance to spectinomycin and allowed for selection |
|||
|
Source: Gage, Daniel J. - Department of Molecular and Cell Biology, University of Connecticut |
|||
|
Collection: Biology and Medicine |
|||
| 73 | Sequence elements within an HSP70 promoter counteract transcriptional transgene silencing in Chlamydomonas | ||
|
Summary: . In Chlamydomonas, TGS was found to be involved in the epigenetic silencing of the aadA transgene (Cerutti et al... ., 1997a, 1997b; Jeong et al., 2002). Two mutants, mut9 and mut11, exhibit impaired TGS of the aadA gene... ®cantly increasing the activities of promoters RBCS2, b2TUB and HSP70B driving the HSP70B and the aadA ... |
|||
|
Source: Wollman, Francis-André - nstitut de Biologie Physico-Chimique & Université Pierre-et-Marie-Curie, Paris 6 |
|||
|
Collection: Biology and Medicine ; Renewable Energy |
|||
| 74 | The Plant Cell, Vol. 15, 14431454, June 2003, www.plantcell.org 2003 American Society of Plant Biologists Cytochrome f Translation in Chlamydomonas Chloroplast Is | ||
|
Summary: with the aadA cassette that confers spectinomycin resistance (Goldschmidt-Clermont, 1991) in- serted at either... with the heterologous AadA reporter pro- tein (Choquet et al., 1998). However, we also had observed an opposite effect... region and of the petD gene, re- placed by the aadA cassette (see supplemental data online), ... |
|||
|
Source: Wollman, Francis-André - nstitut de Biologie Physico-Chimique & Université Pierre-et-Marie-Curie, Paris 6 |
|||
|
Collection: Biology and Medicine ; Renewable Energy |
|||
| 75 | Tracking and recognizing actions of multiple hockey players using the boosted particle filter | ||
|
Summary: with the aadA cassette that confers spectinomycin resistance (Goldschmidt-Clermont, 1991) in- serted at either... with the heterologous AadA reporter pro- tein (Choquet et al., 1998). However, we also had observed an opposite effect... region and of the petD gene, re- placed by the aadA cassette (see supplemental data online), ... |
|||
|
Source: Little, Jim - Department of Computer Science, University of British Columbia |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 76 | A dichotomy theorem for isomorphism Greg Hjorth | ||
|
Summary: with the aadA cassette that confers spectinomycin resistance (Goldschmidt-Clermont, 1991) in- serted at either... with the heterologous AadA reporter pro- tein (Choquet et al., 1998). However, we also had observed an opposite effect... region and of the petD gene, re- placed by the aadA cassette (see supplemental data online), ... |
|||
|
Source: Hjorth, Greg - Department of Mathematics, University of California at Los Angeles |
|||
|
Collection: Mathematics |
|||
| 77 | Fields Institute Communications Volume 00, 0000 | ||
|
Summary: that dimK [Torsion( \Omega 1 A=K )] = 1 2 c + dimK [ ~ AD ~ A=ADA]; where ADA is the image of oe, and ~ AD... ~ A = \Omega 1 ~ A=K . By the third isomorphism theorem, we have dimK [ ~ AD ~ A=ADA] = dimK [ ~ AD ~ A... (*) and (**) imply that dimK [ ~ AD ~ A=ADA] = 1 2 c \Gamma dimK [¯oe( \Omega 1 A=K =dA)]; and dimK ... |
|||
|
Source: Valuation Theory Archive |
|||
|
Collection: Mathematics |
|||
| 78 | Principal Component Analysis Over Continuous Subspaces and Intersection of Half-spaces? | ||
|
Summary: j a>u j2 da = u> Z a2W aa>da u (1) By substituting a1 + (1 ; )a2 for a in the integral R aa... matrix: Cov(W) = 1 V (W) Z a2W aa>da where V (W) denotes the volume of the polytop W, and the inverse... (W) = 1 V (W) Z a2W aa>da = 1 d(d + 1)A(I + ee>)A> (4) where e = (1 1 ::: 1) and \I" is the identity |
|||
|
Source: Shashua, Amnon - School of Computer Science and Engineering, Hebrew University of Jerusalem |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 79 | Journal of Artificial Intelligence Research 7 (1997) 6782 Submitted 5/97, published 9/97 1997 AI Access Foundation and Morgan Kaufmann Publishers. All rights reserved | ||
|
Summary: -terminal symbol. Sequence Grammar Sequence Grammar a S abcdbc S aAdA A bc b S abcdbcabcdbc S AA A aBdB B bc... a S a 2 ab S ab 3 abc S abc 4 abcd S abcd 5 abcdb S abcdb 6 abcdbc S abcdbc bc appears twice S aAdA... removed, aA, Ad added {bc, db, aA, Ad} substitute A for bc S aAdA A bc db removed, dA added {bc, dA, ... |
|||
|
Source: Mitzenmacher, Michael - School of Engineering and Applied Sciences, Harvard University |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 80 | INFECTION AND IMMUNITY, 0019-9567/99/$04.00 0 | ||
|
Summary: in characteristic clusters, the overlapping nature of the phylogeny was notable: in addition to the combined AA/DA... was hybridization with the she probe characteristic of strains located only in EAEC1, EAEC2, and AA/DA, but within... /I was found mainly in cluster EAEC1, whereas AAF/II predominated in the AA/DA cluster. Also, ... |
|||
|
Source: Whittam, Thomas S. - National Food Safety and Toxicology Center & Department of Zoology, Michigan State University |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 81 | The EMBO Journal Vol.18 No.11 pp.29612969, 1999 The Qo site of cytochrome b6f complexes controls | ||
|
Summary: , in addition to the PWYE mutation, a selectable marker, the aadA cassette, that confers resistance... UC-atpX-AAD containing the aadA cassette (Goldschmidt-Clermont et al., 1991) in the same orientation as the petD gene... DApwye to bombard the wild- type strain. Transformants were selected on TAP medium for the expression of the ... |
|||
|
Source: Institut de Biologie Physico-Chimique CNRS, Physico-Chimie Moléculaire des Membranes Biologiques; Wollman, Francis-André - nstitut de Biologie Physico-Chimique & Université Pierre-et-Marie-Curie, Paris 6 |
|||
|
Collection: Biology and Medicine ; Chemistry ; Renewable Energy |
|||
| 82 | A gelation analogy of crustal formation derived from fractal conductive structures | ||
|
Summary: structures that are certainly not random. [34] Acknowledgments. Toivo Korja first suggested a large sparse... Group, T. Korja, Geological Survey of Finland, Betonimiehenkuja 4, FI-02151 Espoo, Finland. (toivo |
|||
|
Source: Smirnov, Maxim - Institutionen för geovetenskaper, Uppsala Universitet |
|||
|
Collection: Geosciences |
|||
| 83 | Nonlocal electrodynamic modeling of frequency shifts for molecules at rough surfaces | ||
|
Summary: (n+112 6 (WI= i a"(a+d+a)2("+2)' n=l n(n+l) G&d= i ~(4~(~+~)2("+2) 3 n=l (6) where 1 and II denote |
|||
|
Source: Leung, Pui-Tak "Peter" - Department of Physics, Portland State University |
|||
|
Collection: Physics |
|||
| 84 | EIGHTH WORLD CONFERENCE ON NONDESTRUCTIVE TESTING | ||
|
Summary: and dlmeasioael afsaaraaaata ara aada in the sane system aad in one pass of tha tabe. If every transducer |
|||
|
Source: Risø National Laboratory |
|||
|
Collection: Multidisciplinary Databases and Resources |
|||
| 85 | Time Warp Edit Distance PIERRE-FRANOIS MARTEAU | ||
|
Summary: ,'a(d)'b,'a(d)'b'a( )'a,'a(d)'a( qqq qpqpqp ppp 1 11 1 where d is any distance on Rk+1 . In practice, we will choose )t |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 86 | Introduction to Population Dynamics 1 Population Dynamics | ||
|
Summary: ) = (a) (0) = 0 (a)(a)da (2.2) (2.2) (a) = (0)e-a (a) EulerLotka 0 e-a (a) (a)da = 1 (2.3) Euler |
|||
|
Source: Inaba, Hisashi - Graduate School of Mathematical Sciences, University of Tokyo |
|||
|
Collection: Mathematics |
|||
| 87 | Nucleic Acids Research, 2007, 115 doi:10.1093/nar/gkm709 | ||
|
Summary: CaadA7, catT4 and VCR2) was assembled in pUC19 (Table 2). The primers aada7-3 and aada7-4 (Table 3) were... Plasmids construction aada7-3 AATTCGGTTATAACAATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGCTT AATTCAAGCGTTAGATGG aada7 |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 88 | Theoretical studies of parallel current in the presence of uctuations | ||
|
Summary: )] ; (18) where da = aaDa=2 ?, e = (Z + ee=c)=(2de) and i = (ii=c)=(2di) with aa = (3 p 3=4aa) and the ion |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 89 | This new Dover edition, first published in 1956, is an unabridged | ||
|
Summary: !x and x +ax. We get f(x, t +7)dx = dx. J f ( x +A)#(A)dA. A==+ m A = - m Now, since T is very small, we |
|||
|
Source: Raschke, Markus B. - Department of Chemistry, University of Washington at Seattle |
|||
|
Collection: Materials Science ; Physics |
|||
| 90 | Dr. S. Cruz-Pol, INEL 4151-Electromagnetics I | ||
|
Summary: of the box. == S s SdDQdS rr +== bottomtop sS dSdSDQA z S aD ^ 2 = r [ ]AADA sS += sheet |
|||
|
Source: Cruz-Pol, Sandra L. - Department of Electrical and Computer Engineering, Universidad de Puerto Rico, Mayagüez |
|||
|
Collection: Geosciences ; Engineering |
|||
| 91 | N t V E R S I T Y COLLlEGE a H O S P I T A 5 C H A M B E R M U S I C CtUB W H I Y P R S ~ T YC O E L B G E L O N D ~ N ,G ~ W I R5raea.r wcr -susrow 7 o ~ a | ||
|
Summary: i n C ~ 5 4 83,' : $":&,g~,3.3<~,.3x4 -8.- .a*2:*7:;-$tg;t@2p7- , , l 0 Aada-nte Allegro ." . The Cw |
|||
|
Source: Saunders, Mark - Benfield Hazard Research Centre, Department of Space and Climate Physics, University College London |
|||
|
Collection: Geosciences |
|||
| 92 | Position-Domain Geometry Screening to Maximize LAAS Availability in the Presence of Ionosphere | ||
|
Summary: Index VerticalErrorsandVPL VALH2,I MIEV, AAD-A Iono Error VPLH0 , AAD-MP Figure 12: MIEV simulation... models is constrained by the RTCA LAAS MOPS to only two choices, Airborne Accuracy Designator (AAD)-A... error models when computing VPLH0 and MIEV. For this reason, MIEV was calculated based on AAD-MP and AAD-A |
|||
|
Source: Stanford University - Global Positioning System (GPS) Lab. |
|||
|
Collection: Engineering |
|||
| 93 | Layout & Language: Preliminary experiments in assigning logical structure to table cells | ||
|
Summary: cent Concrete aada vith portland cement, Portland blastfurnaca cessna or coabination$ of GGB$ or PFA |
|||
|
Source: Association for Computational Linguistics (ACL) Anthology |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 94 | AVA/BMVA Meeting on Biological and Computer Vision | ||
|
Summary: >!)*(>)+O"!/+6>"->"(),!>9-@#D"(3>X/8/-+2$ N+(+)$I%##$ $ a' L+>)*)")3>.-3>)AA>#-#DA)"/-+8$>NO+)@/,>.),/)A>@/@/,3O |
|||
|
Source: Martin, Ralph R. - School of Computer Science, University of Wales, Cardiff |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 95 | The Rockefeller University Press, 0021-9525/2002/06/953/10 $5.00 The Journal of Cell Biology, Volume 157, Number 6, June 10, 2002 953962 | ||
|
Summary: of the aadA reporter gene driven from the psbC 5 UTR in the chimeric gene psbC(WT)-aadA (Zerges and Rochaix... , these differences are due to the differ- ent coding sequences and 3 UTRs. In contrast, the aadA protein... (Fig. 1 D). The wild-type (photosynthetic) progeny ex- pressed aadA; all were resistant to the drug |
|||
|
Source: Wollman, Francis-André - nstitut de Biologie Physico-Chimique & Université Pierre-et-Marie-Curie, Paris 6 |
|||
|
Collection: Biology and Medicine ; Renewable Energy |
|||
| 96 | Essential Histidine and Tryptophan Residues in CcsA, a System II Polytopic Cytochrome c Biogenesis Protein*S | ||
|
Summary: RI-SmaI fragment containing the aadA gene expression cassette from the plasmid pUC-atpX-aad (65) was cloned... A physically linked to the aadA gene or by co- transforming the mutated ccsA together with the SpecR 16 S r... RNA gene. Both aadA and SpecR 16 S rRNA genes confer resistance to spectinomycin. Determination |
|||
|
Source: Hamel, Patrice - Department of Plant Cellular and Molecular Biology, Ohio State University; Meier, Iris - Department of Plant Cellular and Molecular Biology, Ohio State University; Sayre, Richard - Department of Plant Cellular and Molecular Biology, Ohio State University |
|||
|
Collection: Biology and Medicine ; Renewable Energy |
|||
| 97 | JOURNAL OF BACTERIOLOGY, Sept. 2002, p. 49204924 Vol. 184, No. 17 0021-9193/02/$04.00 0 DOI: 10.1128/JB.184.17.49204924.2002 | ||
|
Summary: ) pET21a This study S. coelicolor pSET aac(3)IV aadA (Spcr ) pSET152 7 pTO8 ramC (Spcr ) pSET 7 pTO8-K |
|||
|
Source: Nodwell, Justin - Department of Biochemistry and Biomedical Sciences, McMaster University |
|||
|
Collection: Biology and Medicine |
|||
| 98 | Protein and Peptide Letters 6, 429-436 (2001) AN EFFICIENT, FLEXIBLE-MODEL PROGRAM FOR THE | ||
|
Summary: CCDC BBDB AADA -= -= -= (6) Given that the entropy function, S(T), is formally: ( ) + = T TD p d |
|||
|
Source: Blaber, Michael - Department of Biomedical Sciences, Florida State University |
|||
|
Collection: Biology and Medicine |
|||
| 99 | ELEMENTS OF RINGS WITH EQUAL SPECTRAL IDEMPOTENTS | ||
|
Summary: -Drazin invertible and one of the following equivalent conditions holds: (a) aa = 0; (b) aa = 0; (c) a = aaDa; (d... ) and (c) follows from the equation a - aaDa = a(1 - aDa) = aa. Applying (a) to a in place of a and taking |
|||
|
Source: Koliha, Jerry J. - Department of Mathematics and Statistics, University of Melbourne |
|||
|
Collection: Mathematics |
|||
| 100 | Estimation of Lag Time Between Onset of and Death from an Occult Hongshik Ahn1 | ||
|
Summary: Tb and then jTo as jjjjj AadaTb +++= 21 and .1--= jjj ATbTo For the first interval, obtain 1211111 Aada |
|||
|
Source: Ahn, Hongshik - Department of Applied Mathematics and Statistics, SUNY at Stony Brook |
|||
|
Collection: Materials Science |
|||