| Sample search results for: abdominal al nacer |
| 1 | REMOVAL OF ABDOMINAL WALL FOR 3D VISUALIZATION AND SEGMENTATION OF ORGANS IN CT VOLUME | ||
|
Summary: al. [4] proposed to use rib cage to approxi- mate the interface between the abdominal wall... REMOVAL OF ABDOMINAL WALL FOR 3D VISUALIZATION AND SEGMENTATION OF ORGANS IN CT VOLUME Feng DING... Medical Drive, Singapore 117597 ABSTRACT 3D visualization and segmentation of organs in abdominal volume |
|||
|
Source: Leow, Wee Kheng - Department of Computational Science, National University of Singapore |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 2 | Finite Element Modeling of Three-Dimensional Pulsatile Flow in the Abdominal Aorta: Relevance to Atherosclerosis | ||
|
Summary: the dia- phragm, the thoracic aorta. Roberts et al.34 noted that the abdominal aorta contained by far... of the abdominal aorta. Friedman et al.7 noted increased intimal thickness in regions of low wall shear stress... along the lateral walls of the abdominal aortic bifurca- tion. Moore ... |
|||
|
Source: Taylor, Charles A. - Department of Bioengineering, Stanford University |
|||
|
Collection: Biology and Medicine |
|||
| 3 | Enfoque del NINR: La Salud de los Hispanos | ||
|
Summary: University, 2000. Escaso Beneficio de Intervenciones en Hogares Latinos con Infantes de Bajo Peso al Nacer... Peso al Nacer (en inglés, Low Birth Weight o LBW) de familias latinas de bajos ingresos. Aunque el... evaluar la incidencia de infantes de bajo peso al ... |
|||
|
Source: Baker, Chris I. - Laboratory of Brain and Cognition, National Institute of Mental Health |
|||
|
Collection: Biology and Medicine |
|||
| 4 | The Terminal Abdominal Ganglion of the Wood Cricket Nemobius sylvestris | ||
|
Summary: .C. INSAUSTI ET AL. Journal of Morphology #12;Fig. 5. Nemobius sylvestris. The terminal abdominal ganglion... The Terminal Abdominal Ganglion of the Wood Cricket Nemobius sylvestris Teresita C. Insausti... Universite´ Franc¸ois Rabelais, Tours, France ABSTRACT The abdominal cerci of the wood cricket, ... |
|||
|
Source: Giron, David - Institut de Recherche sur la Biologie de l'Insecte, Université François Rabelais - Tours |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 5 | Informations Complmentaires Poste 2011 ATER MCF0238 Quotit du poste : 100% | ||
|
Summary: (GMC) Lieu(x) d'exercice : INSA de LYON Nom directeur département : Nacer HAMZAOUI Tel directeur dépt... . : 04 72 43 82 01 Email directeur dépt. : nacer.hamzaoui@insa-lyon.fr Recherche : Profil : Le profil |
|||
|
Source: Stouls, Nicolas - Centre of Innovation in Telecommunications and Integration of Services & Département Informatique, INSA Lyon |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 6 | Ultrasound in abdominal trauma John S. Rose, MD | ||
|
Summary: C, Militello P, Mirvis S, Badellino M, et al. Sonography in blunt abdominal trauma: a preliminary... , Shanmuganathan K, et al. Abdominal injuries without hemoperitoneum: a potential limitation of focused abdominal... , Gandhi R, Collazzo L, et al. Defining the ... |
|||
|
Source: Louisiana State University Health Sciences Center in New Orleans, Department of Biochemistry and Molecular Biology |
|||
|
Collection: Biology and Medicine |
|||
| 7 | Korea-Australia Rheology Journal June 2004 Vol. 16, No. 2 75 Korea-Australia Rheology Journal | ||
|
Summary: branches (Taylor et al., 1998; Buchanan et al., 2003). The flow field in the abdominal aorta with the left... abdominal aortic branches Taedong Kim, Taewon Seo*1,2 and Abdul.I. Barakat2 Dept. of Environmental Eng... shear stresses are considerably higher along the anterior wall of the ... |
|||
|
Source: Barakat, Abdul - Department of Mechanical and Aeronautical Engineering, University of California, Davis |
|||
|
Collection: Biology and Medicine |
|||
| 8 | Particle Image Velocimetry measurements in an abdominal aortic aneurysm model | ||
|
Summary: Particle Image Velocimetry measurements in an abdominal aortic aneurysm model Ch. Stamatopoulos1... School, Univ. of Crete, Greece Abdominal aortic aneurysm (AAA) is an abnormal dilatation of the aortic... by a rapid prototyping machine (3D printer). The manufactured transparent model includes the abdominal aorta |
|||
|
Source: Papaharilaou, Yannis - Institute of Applied and Computational Mathematics, Foundation of Research and Technology, Hellas |
|||
|
Collection: Computer Technologies and Information Sciences ; Biology and Medicine |
|||
| 9 | Movement of oxygen from the atmosphere to the mitochondria occurs via several convective and diffusive steps | ||
|
Summary: inspiration due to descent of the diaphragm and displacement of the abdominal viscera (Decramer et al., 1984... et al., 1999; Takata et al., 1990). When right atrial pressure exceeds PIA the abdominal compartment... and diffusive steps (Weibel et al., 1981). In ... |
|||
|
Source: Bennett, Albert F. - Ecology and Evolutionary Biology Department, University of California, Irvine |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 10 | Biological Journal of the Linnean Society, 2007, 90, 97116. With 9 figures 2007 The Linnean Society of London, Biological Journal of the Linnean Society, 2007, 90, 97116 97 | ||
|
Summary: & Bolker, 2003). Polly et al. (2001) proposed that the abdominal and caudal vertebral regions of snakes... anatomically distinct regions (i.e. abdominal and caudal), an increase in the number and relative length... in the abdominal and caudal regions of the vertebral column, but changes in aspect ratio ... |
|||
|
Source: Brainerd, Elizabeth - Department of Ecology and Evolutionary Biology, Brown University |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 11 | Creation of a Standardized Data Collection Form: Aiding in Acute Abdominal Pain Examination and Diagnosis | ||
|
Summary: , and often resulted in diagnoses of undifferentiated abdominal pain (Lukens, et al, 696). F. T. de Dombal... Creation of a Standardized Data Collection Form: Aiding in Acute Abdominal Pain Examination... collection form specifically designed for those patients complaining of acute abdominal pain (AAP). We |
|||
|
Source: Virginia, University of - Department of Systems and Information Engineering, Human Computer Interaction Group |
|||
|
Collection: Engineering ; Computer Technologies and Information Sciences |
|||
| 12 | Preoperative Surgical Planning Using Virtual Laparoscopic Camera | ||
|
Summary: on abdominal CT scan- ning and physically based modeling of organ dis- placement after abdominal insufflation... . This will al- low surgeons to combine anatomic data with visual cues of a 2D laparoscopic environment... in preopera- tive surgical planning. 2 Method 2.1 Data Thin cut stack of abdominal CT ... |
|||
|
Source: Guskov, Igor - Department of Electrical Engineering and Computer Science, University of Michigan |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 13 | Preoperative Surgical Planning Using Virtual Laparoscopic Camera | ||
|
Summary: on abdominal CT scan- ning and physically based modeling of organ dis- placement after abdominal insufflation... . This will al- low surgeons to combine anatomic data with visual cues of a 2D laparoscopic environment... in preopera- tive surgical planning. 2 Method 2.1 Data Thin cut stack of abdominal CT ... |
|||
|
Source: Zhukov, Leonid - University Higher School of Economics, Moscow |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 14 | Track 14. Cardiovascular Mechanics 14.1. Aneurysms -Abdominal Aortic Aneurysms and Stent-Grafts $273 AAA have considered the tissue as isotropic. However, recent biaxial tensile | ||
|
Summary: Track 14. Cardiovascular Mechanics 14.1. Aneurysms -Abdominal Aortic Aneurysms and Stent... on AAA tissue samples demonstrate the anisotropic nature of this tissue (VandeGeest et al., 2006... density function has been used to model the anisotropic behaviour of the AAA tissue (Holzapfel et al. 2000 |
|||
|
Source: Papaharilaou, Yannis - Institute of Applied and Computational Mathematics, Foundation of Research and Technology, Hellas |
|||
|
Collection: Computer Technologies and Information Sciences ; Biology and Medicine |
|||
| 15 | Examen de BIOESTADSTICA 3 de febrero de 2004 1) En la Sierra Morena se pueden encontrar arbustos de jara de dos tipos: jara de ldano (cistus ladanifer, | ||
|
Summary: distribución del peso de su hijo al nacer, se tomaron dos muestras (una de hijos de fumadoras y otra de hijos... se sabe que del (1-p) restante 1/3 son grandes y 2/3 son pequeños. a) De 100 huevos elegidos al azar... polimorfismo en la encina, realizada en el monte de El Pardo, se recogieron al azar hojas ... |
|||
|
Source: Quirós, Fernando - Departamento de Matemáticas, Universidad Autonoma de Madrid |
|||
|
Collection: Mathematics |
|||
| 16 | Computational Evaluation of Aortic Aneurysm Rupture Risk: What have we learned So Far? | ||
|
Summary: al. Peak wall stress measurement in elective and acute abdominal aortic aneurysms. J Vasc Surg 2008... ML, et al. Prediction of rupture risk in abdominal aortic aneurysm during observation: wall stress... , et al. The role of geometric parameters in the prediction of ... |
|||
|
Source: Papaharilaou, Yannis - Institute of Applied and Computational Mathematics, Foundation of Research and Technology, Hellas |
|||
|
Collection: Computer Technologies and Information Sciences ; Biology and Medicine |
|||
| 17 | downwards: snout truncate, mouth almost vertical. Dorsal and anal fins with nine rays. ^ | ||
|
Summary: with 14 rays, reaching almost ^he abdominals, which areoboval and white. Tail forked as usu- al with 24... 'nsparent, the pectoral with 14 rays and not reaching the abdominal, tail with 32 rays. 48th Species. Roundnose Fallfish... the abdominal fins. Dorsal and anal fins with 10 rays. Length one or two ... |
|||
|
Source: Hulsey, C. Darrin - Department of Ecology and Evolutionary Biology, University of Tennessee |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 18 | PROCEEDINGS of the HUMAN FACTORS AND ERGONOMICS SOCIETY 45th ANNUAL MEETING-2001 THE EFFECT OF A STANDARDIZED DATA COLLECTION FORM ON THE | ||
|
Summary: of [abdominal pain] in the emergency department." that the use of a computer-based aid improved (Powers, et al... OF A STANDARDIZED DATA COLLECTION FORM ON THE EXAMINATION AND DIAGNOSIS OF PATIENTS WITH ABDOMINAL PAIN Stephanie... Calland University of Virginia, Charlottesville, Virginia Abdominal pain (AP) ... |
|||
|
Source: Virginia, University of - Department of Systems and Information Engineering, Human Computer Interaction Group |
|||
|
Collection: Engineering ; Computer Technologies and Information Sciences |
|||
| 19 | ARTHROPOD BIOLOGY Relationships Between Adult Abdominal Color and Reproductive | ||
|
Summary: typically yielded May 2009 WENNINGER ET AL.: ABDOMINAL COLOR AND REPRODUCTION IN D. citri 477 #12... were collected at nine 2- to 3-d intervals after mating. May 2009 WENNINGER ET AL.: ABDOMINAL COLOR... focus on mated females (see Wenninger et al. 2008) and/or females of blue/ green ... |
|||
|
Source: Florida, University of - College of Engineering. Software and Analysis of Advanced Materials Processing Center |
|||
|
Collection: Computer Technologies and Information Sciences ; Materials Science |
|||
| 20 | Drosophila bristles and the nature of quantitative genetic variation | ||
|
Summary: for abdominal bristle number (Long et al. 1995), whereas two QTLs on the X chromosome and six on chromosome 3... , and full sib corre- lations (Clayton et al. 1957). Further, mean abdominal bristle number did not change... show that there is naturally segregating genetic variance for environmental plasticity ... |
|||
|
Source: Mackay, Trudy F.C. - Department of Genetics, North Carolina State University |
|||
|
Collection: Biology and Medicine |
|||
| 21 | Instituto Nacional de Salud Pblica http://www.insp.mx/Portal/Centros/ciss/ciss_seminario.html 1 of 2 2/4/06 2:06 AM | ||
|
Summary: Consejo Nacional de Investigación sobre la caracterización de riesgo, el bajo peso al nacer, las emisiones... desarrollado una vacuna contra el SIDA? El Centro de Investigación en Sistemas de Salud (CISS) invita al... público en general al seminario especial "¿Por qué no hemos encontrado una vacuna ... |
|||
|
Source: Seager, Sara - Departments of Earth, Atmospheric, and Planetary Sciences & Physics, Massachusetts Institute of Technology |
|||
|
Collection: Geosciences ; Physics |
|||
| 22 | Marina Aerial by Macduff Everton Sponsored by the | ||
|
Summary: Department of Radiology Presents AbDominAl imAging AnD musculoskeleTAl uPDATe 2011 January 15-18, 2011... of the Department of Radiology, Duke University Medical Center, Durham, North Carolina abdominal musculoskeletal... for the practicing radiolo- gist performing Abdominal & Musculoskeletal MRI. Two days of this course |
|||
|
Source: Duke University, Center for In Vivo Microscopy |
|||
|
Collection: Biology and Medicine |
|||
| 23 | Las Conjeturas de Bolo -Hola, Eiffel, cunto tiempo! | ||
|
Summary: impulsivo, además de fuerte. - Sí, es cierto, al menos desde que se fue Ados. Vaya, lo siento. - Continua... a nacer, y que esto se seguirá repitiendo para toda la eternidad. Incluso decía tener vagos recuerdos de... ;3 - Yo empiezo a dudar de ella. - ¡Oh, vamos, admite al menos que eres un fatalista! - ¿Pero no ves lo |
|||
|
Source: Johnson, Samuel - Instituto Carlos I de Física Teórica y Computacional, Universidad de Granada |
|||
|
Collection: Physics |
|||
| 24 | BASIC RESEARCH PAPERS Exercise has numerous overall health benefits. | ||
|
Summary: -to-side anastomosis, there have been few numeric studies of flow in the abdominal aorta. Taylor et al25 described... conditions. Taylor et al26,27 described, qualitatively, the pulsatile flow in a model of an abdominal aorta... -33 The anatomic dimensions of the idealized abdominal aorta ... |
|||
|
Source: Taylor, Charles A. - Department of Bioengineering, Stanford University |
|||
|
Collection: Biology and Medicine |
|||
| 25 | INTRODUCTION Failure to precisely regulate chromosome duplication and | ||
|
Summary: and suppression of endoreduplication in pupal wing cells (Katzen et al., 1998). The abdominal phenotype in Dm myb... abdominal histoblasts (Hayashi et al., 1993) was used to identify these cells. Wandering third instar larvae... . Pupae were then treated for abdominal epidermal ... |
|||
|
Source: Katzen, Alisa L. - Department of Biochemistry and Molecular Genetics, University of Illinois at Chicago |
|||
|
Collection: Biology and Medicine |
|||
| 26 | Pulse Wave Imaging in Murine Abdominal Aortas A Feasibility Study | ||
|
Summary: Pulse Wave Imaging in Murine Abdominal Aortas A Feasibility Study Kana Fujikura,Jianwen Luo... , New York, USA kf2113@columbia.edu Abstract--One of the most crucial aspects of abdominal aortic... model. Twelve wild-type (WT) mice were anesthetized, and underwent laparotomy. The abdominal aortas |
|||
|
Source: Konofagou, Elisa E. - Department of Biomedical Engineering, Columbia University |
|||
|
Collection: Engineering ; Biology and Medicine |
|||
| 27 | Abdominal Muscle Function in Ventilation and Locomotion in New World Opossums and Basal | ||
|
Summary: 10 (0.150.25 m/s) 1018 S.M. REILLY ET AL. Journal of Morphology #12;Fig. 3. Abdominal hypaxial motor... (Goldman et al., 1987; Iscoe, 1998). What is novel in our data is that all of the abdominal muscles... Abdominal Muscle Function in Ventilation and Locomotion in New World Opossums ... |
|||
|
Source: Reilly, Stephen M. - Department of Biological Sciences, Ohio University |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 28 | A Physiological Torso Model for Realistic Breathing Simulation | ||
|
Summary: been done on the simulation of muscles, al- though more on the deformation than on the way they exhibit... force. Muscles are often modeled as mass-spring systems [10] or finite element systems [3]. Al... approach. Simulation of the abdominal breathing is done by [11]. It is done by constraint resolution |
|||
|
Source: Veltkamp, Remco - Department of Information and Computing Sciences, Universiteit Utrecht |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 29 | Current Biology, Vol. 14, 13191329, August 10, 2004, 2004 Elsevier Ltd. All rights reserved. DOI 10.1016/j.cub.2004.07.052 Roundabout 2 Regulates Migration | ||
|
Summary: - robo2 double mutants have more severe CNS pheno-gans. We used live imaging to show that abdominal Cho... shown to affect migra-neighboring visceral mesoderm) transforms abdominal tion of several neuronal types... expression in the Slit-Robo signaling can also affect migration and ad-abdominal visceral mesoderm. hesion |
|||
|
Source: Zinn, Kai - Division of Biology, California Institute of Technology |
|||
|
Collection: Biology and Medicine |
|||
| 30 | 2004. The Journal of Arachnology 32:336340 SHORT COMMUNICATION | ||
|
Summary: in males, females and juveniles. The abdominal pigment is located in the hypodermis. Keywords: Color... , s1, s2 abdominal spot 1 and 2 lengths. 2. Tibia, lateral view; tib 1,3 tibia 1 and tibia 3 lengths... site, see Sørensen et al. 2002), by an expedition of the Smithsonian Insti- tution in Washington, D |
|||
|
Source: Huber, Bernhard A. - Zoologische Forschungsmuseum Alexander Koenig |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 31 | Nipponentomon pembertonense, n. sp. (Protura: Acerentomidae) from Maryland | ||
|
Summary: of characters: 9 anterior setae on abdominal sternite VII, 15 posterior setae on abdominal tergite VIII, cover... , chaetotaxy of first abdominal tergite, right side; I, lateral chaetotaxy of second abdominal tergite, right... side; J, chaetotaxy of sixth abdominal tergite, right side; K, ... |
|||
|
Source: Bernard, Ernest - Department of Entomology and Plant Pathology, University of Tennessee |
|||
|
Collection: Biology and Medicine |
|||
| 32 | A GENERIC KEY TO THE PROTOZOEAN, MYSIS, AND POSTLARVAL STAGES OF THE LITTORAL PENAEIDAE OF THE NORTHWESTERN GULF OF | ||
|
Summary: .ory conditions, the nallplii were found to be so similar as to defy attempts to fit them int.o a key. Al- though... a given development.al stage (e.g., Nauplius II, Protozoea I, etc.), the size ranges of penaeid larvae... \ '----~~ ~\~l12 Dor'5al Protuberance ... 1"0 v ~,~\Q 13 Rudimenlary Carapace 11 \ f FIGURE l.-Penaeid ... |
|||
|
Source: National Oceanic and Atmospheric Administration (NOAA), Fishery Bulletin |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 33 | 5015RESEARCH ARTICLE INTRODUCTION | ||
|
Summary: -germ insects (Aranda et al., 2008; Pueyo et al., 2008), expression of Gb-Dl in abdominal segments precedes... , in contrast to reports on a cockroach (Pueyo et al., 2008), Gb-Dl expression in abdominal segments does... to abdominal segmentation (Mito et ... |
|||
|
Source: Extavour, Cassandra - Department of Organismic and Evolutionary Biology, Harvard University |
|||
|
Collection: Biology and Medicine |
|||
| 34 | REMOTE CONTROL OF A CYBORG MOTH USING CARBON NANOTUBE-ENHANCED FLEXIBLE NEUROPROSTHETIC PROBE | ||
|
Summary: to evoke multi-directional, graded abdominal motions in the moths thus altering their flight path. 1... ) to evoke the abdominal motions in the moths. Moreover, we have electroplated a CNT-Au nanocomposite film... to elicit graded and multi-direction abdominal movements in both the pupae and adult moths using FNP |
|||
|
Source: Voldman, Joel - Research Laboratory of Electronics & Department of Electrical Engineering and Computer Science, Massachusetts Institute of Technology (MIT) |
|||
|
Collection: Engineering |
|||
| 35 | Understanding and Treating Childhood Bellyaches Pediatric and Adolescent | ||
|
Summary: ):60-68. 2. Walker LS, Lipani TA, Greene JW, et al. Recurrent abdominal pain: symptom subtypes based on t 3... C, et al. Chronic abdominal pain in children: beliefs and expectations. Gastroenterology. 1998; 1 14... and cope with abdominal pain. Every child complains about a bellyache now ... |
|||
|
Source: Louisiana State University Health Sciences Center in New Orleans, Department of Biochemistry and Molecular Biology |
|||
|
Collection: Biology and Medicine |
|||
| 36 | Sponsored by the Duke University School of Medicine The Duke Department of Radiology Presents | ||
|
Summary: MUSCUlOSkeleTAl ABDOMInAl Clyde Helms, M.D. Tracy A. Jaffe, M.D. Professor Associate Professor Thomas... K. Paulson, M.D. 12:30 p.m.-12:45 p.m. Q&A MUSCUlOSkeleTAl MRI & ABDOMInAl IMAGInG #12;MUSCUl... OSkeleTAl MRI AnD ABDOMInAl IMAGInG UPDATe January 16-19, 2012 The Ritz Carlton, Grand Cayman Islands REGISTER |
|||
|
Source: Duke University, Center for In Vivo Microscopy |
|||
|
Collection: Biology and Medicine |
|||
| 37 | In Vivo Quantification of Blood Flow and Wall Shear Stress in the Human Abdominal Aorta During Lower Limb Exercise | ||
|
Summary: . Oshin- ski et al. used cine PCMRI to measure flow velocity in the abdominal aorta under resting... In Vivo Quantification of Blood Flow and Wall Shear Stress in the Human Abdominal Aorta During... bicycle were used to measure, in vivo, the effects of exercise on hemodynamic conditions in the abdominal |
|||
|
Source: Taylor, Charles A. - Department of Bioengineering, Stanford University |
|||
|
Collection: Biology and Medicine |
|||
| 38 | Atherosclerosis 214 (2011) 5864 Contents lists available at ScienceDirect | ||
|
Summary: .3 ± 8.6%) expansion of abdominal aortas after 10-day infusions. #12;62 M. Zack et al. / Atherosclerosis... Bockxmeer FM, et al. Angiotensin II type 1 receptor 1166C polymorphism is associated with abdominal aortic... G, Sofi F, et al. ACE DD genotype: a predisposing factor for ... |
|||
|
Source: Gelb, Michael - Departments of Chemistry & Biochemistry, University of Washington at Seattle |
|||
|
Collection: Chemistry ; Biology and Medicine |
|||
| 39 | REDESCRIPTION OF SOME SPECIES OF CHONE KROYER AND EUCHONE MALMGREN, AND THREE NEW SPECIES | ||
|
Summary: primitive charac- ters in Sabellidae by Banse (1970), especially in regard to the abdominal uncini... abdominal setigers is stressed in the following descriptions. The ac- cessory teeth above the main fang... or subspatulate. Tho- racic neuropodial uncini long-handled, acicular. Abdominal notopodial uncini avicular |
|||
|
Source: National Oceanic and Atmospheric Administration (NOAA), Fishery Bulletin |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 40 | Genetica 102/103: 199215, 1998. 199 c 1998 Kluwer Academic Publishers. Printed in the Netherlands. | ||
|
Summary: abdominal or sternopleural bristle number for 12 `selected' sublines (with 3 replicate selection lines... variance was due to temperature line interaction. For abdominal bristle number, the mutational interaction... , Daphnia, Tri- bolium, Mus, Hordeum, Oryza and Zea (reviewed by Houle et al., 1996). Most estimates cluster |
|||
|
Source: Mackay, Trudy F.C. - Department of Genetics, North Carolina State University |
|||
|
Collection: Biology and Medicine |
|||
| 41 | Copyright 1998 by the Genetics Society of America Candidate Quantitative Trait Loci and Naturally Occurring Phenotypic Variation | ||
|
Summary: chromosome affected re- sponse to artificial selection for abdominal (Long et al. 1995) and sternopleural (M... of naturally occurring alleles in the Dl-H gene region to complement the abdominal bristlelero et al. 1997... assessed quantitative genetic variation in abdominal and ... |
|||
|
Source: Mackay, Trudy F.C. - Department of Genetics, North Carolina State University |
|||
|
Collection: Biology and Medicine |
|||
| 42 | Ultrasound in Med. & Biol. Vol. 18, No. 8, pp. 681-689, 1992 0301-5629/92 $5.00 + .00 Printed in the U.S.A. @ 1992 Pergamon Press Ltd. | ||
|
Summary: and the mean thickness of the maternal abdominal and uterine walls. Ongoing studies will al- low us to improve... INSERTION LOSS DURING PASSAGE THROUGH ABDOMINAL WALL AND MYOMETRIUM TARIQ A. SIDDIQI, t WILLIAM D. O... . In the full bladder condition, the sound beam traversed the anterior abdominal wall and ... |
|||
|
Source: Illinois at Urbana-Champaign, University of - Bioacoustics Research Laboratory |
|||
|
Collection: Engineering ; Biology and Medicine |
|||
| 43 | Rapid Proton Density Weighted Abdominal MRI at 3 Tesla With RF Non-Uniformity Correction , and K. S. Nayak1 | ||
|
Summary: Rapid Proton Density Weighted Abdominal MRI at 3 Tesla With RF Non-Uniformity Correction H. H. Hu1... , CA, United States Introduction In high-field abdominal imaging, RF non-uniformities due to the use... , and then discuss the applicability of the method for fat quantification in abdominal MRI. Methods - For low |
|||
|
Source: Southern California, University of - Department of Electrical Engineering, Magnetic Resonance Engineering Laboratory |
|||
|
Collection: Biology and Medicine ; Engineering |
|||
| 44 | University of Southampton Research Repository ePrints Soton | ||
|
Summary: AND THE ENVIRONMENT Institute of Sound and Vibration Research Antenatal foetal monitoring through abdominal phonogram... FOETAL MONITORING THROUGH ABDOMINAL PHONOGRAM RECORDINGS: A SINGLE-CHANNEL INDEPENDENT COMPONENT ANALYSIS... to a signal referred to as the abdominal phonogram. Such a signal, recorded in a single-channel ... |
|||
|
Source: Quartly, Graham - National Oceanography Centre Southampton |
|||
|
Collection: Environmental Sciences and Ecology ; Geosciences |
|||
| 45 | Sex pheromone gland of the female tiger moth Holomelina lamae (Lepidoptera: Arctiidae) | ||
|
Summary: , University of Massachusetts, Amherst. #12;YIN ET AL 1917 For ultrastructural studies the abdominal tips were... glands located dorsally at the female's abdominal tip, above the ovipositor. Each gland opens externally... to a dorsal pore, with both pores being situated near the junction of abdominal segments ... |
|||
|
Source: |
|||
|
Collection: Biology and Medicine |
|||
| 46 | Ulster MedJ2005; 74 (2) 113-121 Periods of low atmospheric pressure are associated with | ||
|
Summary: R, Zamboni P et al. Seasonal variations in the rupture of abdominal aortic aneurysms. Jpn Heart J... abdominal aortic aneurysm rupture rates in Northern Ireland DW Harkin, M O'Donnell, J Butler, PH Blair, JM... of ruptured abdominal aortic aneurysm (RAAA) has been reported. We explored the role ofatmospheric ... |
|||
|
Source: Armagh Observatory Meteorology Databank |
|||
|
Collection: Geosciences |
|||
| 47 | Amyloid Treatment and Research Program key clinical research accomplishments: Description of the natural history of amyloid diseases, which varies with each clinical type | ||
|
Summary: , the abdominal fat aspirate, for the diagnosis of systemic amyloidosis, offering a less-invasive, highly... for patients with AL amyloidosis. This treatment has become the standard first line therapy for AL amyloidosis... . Investigation of the use of novel agents for treatment of AL amyloidosis, including ... |
|||
|
Source: Finzi, Adrien - Department of Biology, Boston University |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 48 | Presented by the Department of Radiology AbdominAl imAging | ||
|
Summary: Presented by the Department of Radiology AbdominAl imAging & musculoskeletAl mRi updAte 2010... CRiption -- This course has been designed for the radiologist performing abdominal and musculoskeletal imaging... and procedures. The first two days of the course will focus on abdominal imaging, the other two ... |
|||
|
Source: Duke University, Center for In Vivo Microscopy |
|||
|
Collection: Biology and Medicine |
|||
| 49 | Ann Surg Oncol . Author manuscript Closed hyperthermic intraperitoneal chemotherapy with open abdomen: a | ||
|
Summary: and aerosols, and allows permanent access to the whole abdominal cavity. Its principle is to extend... the abdominal surgical wound upwards with a sort of glove-box . The cutaneous edges of the laparotomy are... and vapours. Intra-abdominal temperature was maintained between 42 and 43 C during most of the procedure |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 50 | The effect of abdominal wall morphology on ultrasonic pulse distortion. Part I. Measurements | ||
|
Summary: ., Vol. 104, No. 6, December 1998 Hinkelman et al.: Abdominal wall pulse distortion: Measurements #12... , No. 6, December 1998 Hinkelman et al.: Abdominal wall pulse distortion: Measurements #12;appear... , December 1998 Hinkelman et al.: Abdominal wall pulse ... |
|||
|
Source: Mast, T. Douglas - Department of Biomedical Engineering, University of Cincinnati |
|||
|
Collection: Biology and Medicine ; Engineering |
|||
| 51 | Tissue and Cell 43 (2011) 5265 Contents lists available at ScienceDirect | ||
|
Summary: interneurons Terminal abdominal ganglion a b s t r a c... a pair of abdominal appendages, the cerci, involved in the detection of air-movements. They mediate... , representing a classical model-system for neuroethologists (e.g., Edwards and Palka, 1974; Palka et al., 1977 |
|||
|
Source: Giron, David - Institut de Recherche sur la Biologie de l'Insecte, Université François Rabelais - Tours |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 52 | Biol. Lett. (2005) 1, 276279 doi:10.1098/rsbl.2005.0318 | ||
|
Summary: describe a novel male trait--an abdominal constriction that appears during courtship--that allows males... of damage inflicted by females during the first copulation. Thus, the abdominal constriction allows males... .g. Ramos et al. 2004)--sexual selection favours males that facilitate cannibalism at the first copulation |
|||
|
Source: Andrade, Maydianne C.B. - Department of Biological Sciences, University of Toronto at Scarborough |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 53 | Copyright 0 1985 by the Genetics Society of America TRANSPOSABLE ELEMENT-INDUCED RESPONSE TO | ||
|
Summary: for number of bristles on the last abdominal tergite was carried out for 16 generations among the progeny... -strain females (Harwich). Each cross was replicated four times. Average realized heritability of abdominal... .163 k 0.010). Phenotypic variance of abdominal bristle score increased by a factor of four in lines |
|||
|
Source: Mackay, Trudy F.C. - Department of Genetics, North Carolina State University |
|||
|
Collection: Biology and Medicine |
|||
| 54 | Zoologica Scripta, Vol. 21, N o 3, pp 247-250, 1002 Printed in Great Britain | ||
|
Summary: by the terrestrial freshwater inputs reachingthe bay during the spring-summer period (Pala- cin et al. 1991). Several... ;Palacin et al. 1991; Capaccioni-Azzati 1987;Capaccioni & San Martin 1989-1990; Martin 1990, 1991; Martin... , together with the prcscncc o f an abdominal branchiatc region, allow us to separate these ... |
|||
|
Source: Martin, Daniel - Centre d'Estudis Avançats de Blanes |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 55 | IEEE TRANSACTIONS ON BIOMEDICAL ENGINEERING, VOL. 57, NO. 7, JULY 2010 1757 Flexible Split-Ring Electrode for Insect Flight | ||
|
Summary: the multisite electrode to deliver electrical stimuli that evoke multidirectional, graded abdominal motions... and consistently produced neural probes for small neural systems. 3-D shape-memory al- loy microelectrodes [11... demonstrated that stimulation with the FSE can elicit multidirectional graded abdominal motions in both ... |
|||
|
Source: Voldman, Joel - Research Laboratory of Electronics & Department of Electrical Engineering and Computer Science, Massachusetts Institute of Technology (MIT) |
|||
|
Collection: Engineering |
|||
| 56 | Abstract--We hereby propose a new method to determine the regionally passive, elastic, stress-strain relationship of the | ||
|
Summary: -strain relationship of the normal murine abdominal aorta in vivo. The circumferential stress-strain relationship... and diameter variation. The regional diameter variation of the murine abdominal aortas was obtained using... diagnosis. Luo et al. (2009) proposed the Pulse Wave Imaging (PWI) technique to visualize the pulse wave ... |
|||
|
Source: Konofagou, Elisa E. - Department of Biomedical Engineering, Columbia University |
|||
|
Collection: Engineering ; Biology and Medicine |
|||
| 57 | Neuromodulators play a key role in timing and coordinating complex behaviours in animals (Marder, 2000). Such control | ||
|
Summary: -containing cells are not detected in the first or second abdominal ganglia (Chen et al., 1994... rapidly in the descending processes compared with the abdominal neurons (Ewer et al., 1994). The rise... by a decline in steroid titres (Hewes and Truman, 1991; Kingan et al., 1997), the ... |
|||
|
Source: Fuse, Megumi - Department of Biology, San Francisco State University |
|||
|
Collection: Biology and Medicine |
|||
| 58 | OBSERVATIONS OF MOLTING FEMALE KING CRABS, PARALITHODES CAMTSCHATICA (TILESIUS) | ||
|
Summary: ~ emergethrough an opening between the posterior margin of the cacapaceand anterior margin of the abdominal... molting. Carapace leGgth measurements, taken from the hind margin of the ort·:!al socket to the median... along the anterior margin of the first abdominal seg- #12;2 BULLETIN 5 - NORTH PACIFIC COMMISSION FIGURE |
|||
|
Source: Alaska Fisheries Science Center |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 59 | ARTICLE IN PRESS Computer-Aided Design ( ) | ||
|
Summary: cite this article in press as: Shim M-B, et al. Three-dimensional shape reconstruction of abdominal... this article in press as: Shim M-B, et al. Three-dimensional shape reconstruction of abdominal aortic aneurysm... al. Three-dimensional shape reconstruction of ... |
|||
|
Source: Shimada, Kenji - Department of Mechanical Engineering, Carnegie Mellon University |
|||
|
Collection: Engineering |
|||
| 60 | International Conference on Experiments/Process/System Modelling/Simulation/Optimization Athens, 6-9 July, 2005 | ||
|
Summary: IN ABDOMINAL AORTIC ANEURYSMS Yannis Papaharilaou *, , John A. Ekaterinaris* , Eirini Manousaki , Asterios N... , computational hemodynamics, structural stress analysis. Abstract. Abdominal aortic aneurysm (AAA) is a localized... to the more complete but computationally intensive FSI study. 1 INTRODUCTION Abdominal aortic ... |
|||
|
Source: Papaharilaou, Yannis - Institute of Applied and Computational Mathematics, Foundation of Research and Technology, Hellas |
|||
|
Collection: Computer Technologies and Information Sciences ; Biology and Medicine |
|||
| 61 | GRACM International Congress on Computational Mechanics Limassol, 29 June 1 July, 2005 | ||
|
Summary: ANALYSIS IN ABDOMINAL AORTIC ANEURYSMS APPLYING FLOW INDUCED WALL PRESSURE Yannis Papaharilaou *, , John A... . Abdominal aortic aneurysm (AAA) is a localized dilatation of the aortic wall. The lack of an accurate AAA... study. 1 INTRODUCTION Abdominal aortic aneurysm is a localized dilatation of the aortic wall |
|||
|
Source: Papaharilaou, Yannis - Institute of Applied and Computational Mathematics, Foundation of Research and Technology, Hellas |
|||
|
Collection: Computer Technologies and Information Sciences ; Biology and Medicine |
|||
| 62 | A Screening Aid for the Identification of the Banded Elm Bark Beetle*, Scolytus schevyrewi Semenov | ||
|
Summary: . With rare exceptions, a spine or tubercule is present on the second abdominal sternite. Recognizing... the elytra. - Many species of Scolytus possess a more or less distinct spine on the 2nd abdominal sternite... abdominal apex and/or elytral apex strongly declivous |
|||
|
Source: Ginzel, Matthew - Department of Entomology, Purdue University |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 63 | Creating the FMA-RadLex in Ontology Viewer Manual operation | ||
|
Summary: Viewer #12;Ontology Viewer #12;Application view required 1. Add class/node `Abdominal organ' to class... /node `Organ' 2. Reassign existing and appropriate organs to `Abdominal organ' 3. Reassign all other organs... ;Create new class `Abdominal organ' #12;Organs reassigned to new class `Abdominal organ' ... |
|||
|
Source: Washington at Seattle, University of - Structural Informatics Group (SIG) |
|||
|
Collection: Computer Technologies and Information Sciences ; Biology and Medicine |
|||
| 64 | Copyright 8 1995 by the Genetics Society of America Polygenic Mutation in Drosophila melanogaster | ||
|
Summary: of -15 abdominal and 16sternopleural bristles (MACKAY et al. 1994),it is clear that in no case didthe... generations 93 to 103 averaged over allthree replicate high abdominal bristle lines was 0.005 (MACKAY et al... mutations affecting abdominal and sternopleural bristle number. ... |
|||
|
Source: Mackay, Trudy F.C. - Department of Genetics, North Carolina State University |
|||
|
Collection: Biology and Medicine |
|||
| 65 | Neuron, Vol. 37, 185192, January 23, 2003, Copyright 2003 by Cell Press posterior position in the animal: abdominal neuroblastsRegion-Specific Apoptosis Limits | ||
|
Summary: the abdominal lineages, Bello et al. ptosis is induced by the Hox gene abdA, which is differ- observed... be the fate of the abdominal development (Prokop and Technau, 1991; Truman et al., pNBs if they did not die... NB survives and abdominal clones are expanded, a result similar to that ... |
|||
|
Source: Brand, Andrea - Department of Genetics, University of Cambridge |
|||
|
Collection: Biology and Medicine |
|||
| 66 | INTRODUCTION Developmental neurobiologists working on insect model | ||
|
Summary: of Schmidt et al. (1997). It is medium- sized (6.4 µm; n=4), dorsal, and migrates medially in abdominal... forms only in abdominal segments. Cash et al. (1992) and Landgraf et al. (1997) both describe muscles 5... by positional cues shortly after they are formed in the neuroectoderm ... |
|||
|
Source: Doe, Chris - Institute of Neuroscience & Department of Biology, University of Oregon |
|||
|
Collection: Biology and Medicine |
|||
| 67 | Closed hyperthermic intraperitoneal chemotherapy with open abdomen: A novel technique to reduce exposure of | ||
|
Summary: and aerosols, and allows permanent access to the whole abdominal cavity. Its principle is to extend... the abdominal surgical wound upwards with a sort of "glove-box". The cutaneous edges of the laparotomy... and vapours. Intra-abdominal temperature was maintained between 42 and 43°C during most of the procedure |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 68 | Crustacean Hyperglycemic Hormone, a possible endocrine regulator of ecdysis in the tobacco hornworm, Manduca sexta | ||
|
Summary: Specificity Fig. 4: paired abdominal cells and transverse nerves of the 4th abdominal ganglia Fourth abdominal... ganglia Terminal abdominal Ganglia Fig.5: Paired cells of the therminal ganglia Neuroendocrine regulation... in vertebrates as well as invertebrates (Siviter et al, 2000). ... |
|||
|
Source: Fuse, Megumi - Department of Biology, San Francisco State University |
|||
|
Collection: Biology and Medicine |
|||
| 69 | Diversity and Evolution of the Insect Ventral | ||
|
Summary: - ciated with each pair of legs. Ancestrally there are 11 abdominal segments, but in almost all extant... , and the thoracic and abdominal ganglia of the VNC, which to- gether form most of the CNS (22, 109, 114). Each... , 59, 140), all possess three thoracic (T1 T3) and eight abdominal ganglia (A1A8), ranged across |
|||
|
Source: Foster, William A. - University Museum of Zoology, University of Cambridge |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 70 | Drosophila Primers for Quantitative RT-PCR Veronika Sander 2009 | ||
|
Summary: TCTCCTTGCGCTTCTTGGA LaLonde et al., 2006 CV2 Crossveinless 2 GTATGAGAGTGGCTCGGAGTG CGTGGTGGCTGTAACTGGTTG 131 Tsg... Brinker GCCAGGAAATACAACATTCAC CCGATTGCTGTGGGAGTAG 163 Abda Abdominal a CAGACCTACACTCGCTTCCAG... CGGCTCGTAACTCCTTCTTC 172 AbdB Abdominal B GCCTACAACGACGAGGGATTC CTGCGTTTCTGGGTAAGGATAG ~90 Dfd Deformed |
|||
|
Source: De Robertis, Eddy M. - Department of Biological Chemistry, University of California at Los Angeles |
|||
|
Collection: Biology and Medicine |
|||
| 71 | Austral Ecology (2002) 27, 565572 Distribution of energy reserves in a viviparous skink | ||
|
Summary: , the frequency and position of naturally occurring tail breaks were determined. Both abdominal and caudal lipid... 78%) of these fat reserves. Temporal variation in fat body mass, both abdominal and caudal, was evident... by a variety of invertebrates (e.g. crusta- ceans, cnidarians, spiders, insects; Robinson et al. 1970; ... |
|||
|
Source: Chapple, David - School of Biological Sciences, Monash University |
|||
|
Collection: Biology and Medicine |
|||
| 72 | 46 Accepted by J. Longino: 17 Feb. 2009; published: 6 Apr. 2009 ISSN 1175-5326 (print edition) | ||
|
Summary: peculiar features of the wing venation and abdominal morphology that introduced some uncertainty about its... copy (EF1F1), elongation factor 1-alpha F2 copy (EF1F2), wingless (wg), and abdominal-A (abd... al. (2006). The Amyrmex sequences (GenBank accession numbers FJ588487-FJ588493) were added to the 162 |
|||
|
Source: Brady, Seán - Curator of Hymenoptera, Department of Entomology, National Museum of Natural History, Smithsonian Institution |
|||
|
Collection: Biology and Medicine |
|||
| 73 | PERITONEAL MEMBRANES, OVARIES, AND OVIDUCTS OF SALMONOID FISHES AND THEIR SIGNIFICANCE | ||
|
Summary: . Page. Introduction.. , " ' " ., . . . . . . . . . . . I8S Abdominal viscera... ... .. .. . .. .. .. .. . . . . . . . . . . . . .. . . . . . . .. .. .. . . . . . . . . .. . . . . .. . .. . .. . . .. . 206 184 #12;ABDOMINAL VISCERA. PERITONEAL MEMBRANES, OVARIES, AND OVIDUCTS OF SALMONOID FISHES... , definitions of the principal ... |
|||
|
Source: National Oceanic and Atmospheric Administration (NOAA), Fishery Bulletin |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 74 | Biomechan Model Mechanobiol DOI 10.1007/s10237-007-0115-9 | ||
|
Summary: model for the development of abdominal aortic aneurysm (AAA) of Watton et al. Biomech Model Mechanobiol... of the abdominal aorta and development of an aneurysm at physiological pressures. Watton et al. (2004) model... for the carotid artery of a rabbit (Holzapfel et al. 2000) are ... |
|||
|
Source: Hill, Nicholas A.- Department of Mathematics, University of Glasgow |
|||
|
Collection: Biology and Medicine ; Mathematics |
|||
| 75 | Genet. Res., Camb. (2002), 79, pp. 211218. With 2 figures. # 2002 Cambridge University Press DOI: 10.1017\S0016672302005621 Printed in the United Kingdom | ||
|
Summary: and abdominal bristle number (Long et al., 1998). 2. Materials and methods (i) Construction of Drosophila stocks... the previous observation that this SNP had a female-specific effect on abdominal bristle number (Long et al... for two SNPs at Dl, one affecting sternopleural and the other ... |
|||
|
Source: Mackay, Trudy F.C. - Department of Genetics, North Carolina State University |
|||
|
Collection: Biology and Medicine |
|||
| 76 | 1994 Elsevier Science B. V. AIl ri8h1s reserved. A crilical appraisal offetal surveillance. | ||
|
Summary: It to obtain clear, abdominally recorded, feta! heart signals from which diagnostic parameters could be derived... scaled subtraction of a thoracic or near-thoracic MECG from an abdominally measured compos- ite... more signaIs; 3) The FECG-to-noise ratio in the result is never better than in the original abdominal |
|||
|
Source: Leuven, Katholieke Universiteit, Department of Electrical Engineering, SCD Division |
|||
|
Collection: Engineering |
|||
| 77 | Local Factorial Analysis of Multivariate Time Series Douzal Chouakria, Ahlame | ||
|
Summary: .Douzal@imag.fr Hammami, Nacer TIMC-IMAG-CNRS (UMR 5525), Universit´e Joseph Fourier Grenoble 1, F-38706 LA TRONCHE Cedex... , France E-mail: Nacer.Hammami@imag.fr Garbay, Catherine CLIPS-IMAG, Universit´e Joseph Fourier Grenoble 1... in factorial analysis was proposed by Lebart (Lebart (1969) and Banet et al. (1984)) with the ... |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 78 | Which method to deliver heated intraperitoneal chemotherapy with oxaliplatin? An experimental comparison of open and closed techniques | ||
|
Summary: , Magnin G et al. High intra-abdominal pressure enhances the penetration and antitumor effect... homogeneity was achieved with both techniques. The systemic absorption and the abdominal tissue uptake... of this study was to compare blood and abdominal tissue concentrations of oxaliplatin after open and closed |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 79 | Genet. Res., Camb. (1999), 74, pp. 303311. With 2 figures. Printed in the United Kingdom # 1999 Cambridge University Press 303 Linkage disequilibrium mapping of molecular | ||
|
Summary: region (Lai et al., 1994) and SSCP 1836 were significantly associated with abdominal bristle number... ' number 10 (Lai et al., 1994), which had on average 5n37 abdominal bristles fewer than the other seven... variation in bristle number. Variation in abdominal and sternopleural ... |
|||
|
Source: Mackay, Trudy F.C. - Department of Genetics, North Carolina State University |
|||
|
Collection: Biology and Medicine |
|||
| 80 | Physiological relevance of the changes in hemodynamics for circulating blood cells in | ||
|
Summary: the AAA when compared to the flow in a healthy abdominal aorta (Bluestein et al. 1996; Peattie et al. 1996... in Abdominal Aortic Aneurysms A. Introduction It has been observed that 75% of AAAs with a maximum diameter... been studied in abdominal aortic aneurysms. As discussed in the ... |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 81 | Copyright 2000 by the Genetics Society of America Both Naturally Occurring Insertions of Transposable Elements and Intermediate | ||
|
Summary: al. and Jan 1994). Quantitative trait locus (QTL) mapping deletion complemented both abdominal... of sternopleural and abdominal bristles (Mackay and Langley 1990). Earlier work is also extended throughet al. 1998... with a reduction in both sternopleural and abdominal bristle number, ... |
|||
|
Source: Long, Anthony D. - Department of Ecology and Evolutionary Biology, University of California, Irvine; Mackay, Trudy F.C. - Department of Genetics, North Carolina State University |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 82 | Neuropeptides in Heteroptera: Identification of allatotropin-related peptide and tachykinin-related peptides using MALDI-TOF mass spectrometry | ||
|
Summary: 1 List of neuropeptides which were identified in the antennal lobes (AL) and in the abdominal... published recently [16]. In that study, the peptidome of corpora cardiaca (CC) and abdominal perisympathetic... and abdominal perisympathetic organs of polyphagous stinkbugs (Pentatomidae) revealed the group |
|||
|
Source: Meagher, Mary - Department of Psychology, Texas A&M University |
|||
|
Collection: Biology and Medicine |
|||
| 83 | Received 8 January 2002 Accepted 26 March 2002 | ||
|
Summary: and abdominal markings that are intriguing candidates for signals of indi- vidual identity. Here, I describe... systems (Dale et al. 2001), also occurs in insects (Choe & Crespi 1997). These social systems could... 1428 1423 Ó 2002 The Royal Society DOI 10.1098/rspb.2002.2031 nant female (Sledge et al. 2001). However |
|||
|
Source: |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 84 | INTRODUCTION The epidermis of the embryonic segments and imaginal discs | ||
|
Summary: embryogenesis as derivatives of the embryonic epidermis (Simcox et al., 1991). Each larval abdominal hemisegment... of adult abdominal segments is subdivided into anterior and posterior compart- ments (Hama et al., 1990... forceps, leaving the abdominal epidermis exposed. In situ ... |
|||
|
Source: Kopp, Artyom - Section of Evolution and Ecology, University of California, Davis |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 85 | Copyright 1999 by the Genetics Society of America The Genetic Architecture of Selection Response: Inferences From Fine-Scale | ||
|
Summary: artificial selection for abdominal (Long et al. 1995) and sternopleural (Gurganus et al. 1999) bristle num... for abdominal and sternopleural bristle number have been mapped with high resolution to the X and third... by genetic complexity--segregating al- most likely to be achieved using ... |
|||
|
Source: Mackay, Trudy F.C. - Department of Genetics, North Carolina State University |
|||
|
Collection: Biology and Medicine |
|||
| 86 | Header for SPIE use 3-D Deformable Model Segmentation of Abdominal Aortic Aneurysm | ||
|
Summary: Header for SPIE use 3-D Deformable Model Segmentation of Abdominal Aortic Aneurysm Marko Subasica... , A-8036, Austria ABSTRACT In this paper we propose a technique for 3-D segmentation of abdominal... been performed using real patient CTA images and have shown good results. Keywords: abdominal aortic |
|||
|
Source: Loncaric, Sven - Faculty of Electrical Engineering and Computing, University of Zagreb |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 87 | mirando a la valla El otro da me levant temprano. Me hice un buen desayuno con queso | ||
|
Summary: . Había pasado la noche con un Americano borracho que, al despertarse sobrio, quiso pagarle solo la mitad... de lo que había prometido y al protestar le pegó. Mientras que andaba me vio y paró un rato para... a dos mujeres en Guatemala que dejaban un pueblo pequeño con sus mercancías, yendo a venderlas al |
|||
|
Source: Santini, Simone - Escuela Politécnica Superior, Universidad Autonoma de Madrid |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 88 | Thse prsente pour obtenir le grade de DOCTEUR DE L'ECOLE POLYTECHNIQUE | ||
|
Summary: ; Fontaine et al. 2002; Wang et al. 2002). B. Pathogenesis of the abdominal aortic aneurysms Although... of abdominal aortic aneurysms ...........................................9 C. Influence of the hemodynamic... ... |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 89 | inadequate in predicting cell type. Al-though all frankly pseudomonopolar cells | ||
|
Summary: inadequate in predicting cell type. Al- though all frankly pseudomonopolar cells did innervate OHC... involved in the generation ofmotor activityforflight in the locust werefound in thefirst three abdominal... in abdominal and thoracic ganglia supports theories that insect wings originated from movable appendages which |
|||
|
Source: Robertson, Meldrum - Department of Biology, Queen's University (Kingston) |
|||
|
Collection: Biology and Medicine |
|||
| 90 | Zoology 112 (2009) 161168 Breathing with your belly: Abdominal exhalation, loco-ventilatory | ||
|
Summary: patterns during locomotion (Fife et al., 2001; Deban and Carrier, 2002). Thus, abdominal function... ZOOLOGY Zoology 112 (2009) 161168 Breathing with your belly: Abdominal exhalation, loco... , the contribution of abdominal hypaxial muscles to resting and locomotor ventilation is little understood in mammals |
|||
|
Source: Reilly, Stephen M. - Department of Biological Sciences, Ohio University |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 91 | Research Focus Tinker where the tinkering's good | ||
|
Summary: evolution in Drosophila santomea supports this notion. Multiple mutations that disrupt an abdominal enhancer... genes and mutations remains a massive challenge. Now Jeong et al. [8] have added an important piece... separate times (Figure 1). Pale abdomens lack tan Drosophila abdominal pigmentation patterns vary among |
|||
|
Source: Rockman, Matthew - Center for Genomics and Systems Biology & Department of Biology, New York University |
|||
|
Collection: Biotechnology ; Biology and Medicine |
|||
| 92 | Source Edizioni Empira (Revista de Metodologa de Ciencias Sociales) n 13 Date juin 2007 | ||
|
Summary: investigación de Halbwachs sobre la proporción de los sexos al nacer) ; por último, una sección dedicada a sus... al respecto. Ciertamente, Maurice Halbwachs es mucho más conocido por sus aportaciones a la... al cálculo de probabilidades. Su tesis complementaria de doctorado, (1912, en la Facultad de ... |
|||
|
Source: École Normale Supérieure, Département d'Etudes Cognitives, Group for Neural Theory |
|||
|
Collection: Biology and Medicine |
|||
| 93 | Comparison of abdominal aortic hemodynamics between men and women at rest and during lower | ||
|
Summary: Comparison of abdominal aortic hemodynamics between men and women at rest and during lower limb... in the localization of atherosclerosis in the abdominal aorta. However, the hemodynamics of men and women have... stress at the supraceliac and infrarenal levels of the abdominal aorta of young healthy men and women |
|||
|
Source: Taylor, Charles A. - Department of Bioengineering, Stanford University |
|||
|
Collection: Biology and Medicine |
|||
| 94 | Evolution in black and white: genetic control of pigment patterns in | ||
|
Summary: patterning in adult abdominal segments of Drosophila. Dev. Biol. 242, 1530 12 Kopp, A. et al. (1997... . Drosophila Information Service 53, 166 59 Gibert, P. et al. (1999) Phenotypic plasticity of abdominal... ) of each abdominal segment (Fig. 1b; arrow). These bands, which give flies ... |
|||
|
Source: Kopp, Artyom - Section of Evolution and Ecology, University of California, Davis |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 95 | Simulation of ultrasonic focus aberration and correction through human tissue | ||
|
Summary: of ultrasonic pulses through cross-sectional models of human abdominal wall and breast. Propagation calculations... indicate, consistent with measurements, that breast causes greater focus degradation than abdominal wall... has recently become feasible.13 Computations of wavefront distortion produced by human abdominal wall |
|||
|
Source: Mast, T. Douglas - Department of Biomedical Engineering, University of Cincinnati |
|||
|
Collection: Biology and Medicine ; Engineering |
|||
| 96 | Naturwissenschaften (2003) 90:121126 DOI 10.1007/s00114-003-0402-y | ||
|
Summary: the abdominal sternites and tergites synthesize hydrocarbons (Gu et al. 1995). Hydrocarbons are then loaded... are produced by the abdominal integument of B. germanica (Gu et al. 1995), and we now demonstrate... by enzymatically dissociated oenocytes of the abdominal integument of the ... |
|||
|
Source: Schal, Coby - Department of Entomology, North Carolina State University |
|||
|
Collection: Biology and Medicine |
|||
| 97 | Robot-based tele-echography: Clinical evaluation of the TER system in | ||
|
Summary: Robot-based tele-echography: Clinical evaluation of the TER system in abdominal aortic exploration... conditions, the feasibility and the reliability of TER in detecting abdominal aortic and iliac aneurysms... : The TER system is a reliable, acceptable, and effective robot-based system to perform remote abdominal |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 98 | 2004 The Society for the Study of Evolution. All rights reserved. Evolution, 58(3), 2004, pp. 587596 | ||
|
Summary: , but these species do exhibit sexual dimorphism in abdominal pigmentation (Kopp et al. 2000). In marked contrast... , ebony, optomotor blind, Abdominal B, and Dopa decarbox- ylase--affect pigmentation (True et al. 1999... al. (2003) examined variation in abdominal ... |
|||
|
Source: Bi, Xin - Department of Biology, University of Rochester |
|||
|
Collection: Biology and Medicine |
|||
| 99 | Anteroposterior Patterning in Adult Abdominal Segments of Drosophila | ||
|
Summary: in abdominal histoblasts (Kopp et al., 1997; Kopp and Duncan, 1997; and unpublished data). In some cases, we... expresses GAL4 uniformly in abdominal histoblasts (not shown); hs-FLP122 (Zecca et al., 1995), Tub 1 y hh... patterns (Kopp et al., 1999). Abdominal ... |
|||
|
Source: Kopp, Artyom - Section of Evolution and Ecology, University of California, Davis |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 100 | Inferior vena caval hemodynamics quantified in vivo at rest and during cycling exercise using magnetic resonance imaging | ||
|
Summary: 1167, 2003. First published December 5, 2002; 10.1152/ajpheart.00641.2002.--Compared with the abdominal... alter the hemodynamic environment in the abdominal aorta (1517, 22, 27, 28); however, no similar... arteries, and abdominal aorta (2, 8, 14, 33). Ad- ditionally, it has been shown that lower limb exercise |
|||
|
Source: Taylor, Charles A. - Department of Bioengineering, Stanford University |
|||
|
Collection: Biology and Medicine |
|||