Home

About

Advanced Search

Browse by Discipline

Scientific Societies

E-print Alerts

Add E-prints

E-print Network
FAQHELPSITE MAPCONTACT US


  Topic List  Advanced Search  
Sample search results for: abdominal al nacer

Page:   2  3  4  5 
 
1 REMOVAL OF ABDOMINAL WALL FOR 3D VISUALIZATION AND SEGMENTATION OF ORGANS IN CT VOLUME
 

Summary:  al. [4] proposed to use rib cage to approxi- mate the interface between the abdominal wall... REMOVAL OF ABDOMINAL WALL FOR 3D VISUALIZATION AND SEGMENTATION OF ORGANS IN CT VOLUME Feng DING... Medical Drive, Singapore 117597 ABSTRACT 3D visualization and segmentation of organs in abdominal volume

  

Source: Leow, Wee Kheng - Department of Computational Science, National University of Singapore

 

Collection: Computer Technologies and Information Sciences

 
2 Finite Element Modeling of Three-Dimensional Pulsatile Flow in the Abdominal Aorta: Relevance to Atherosclerosis
 

Summary:  the dia- phragm, the thoracic aorta. Roberts et al.34 noted that the abdominal aorta contained by far... of the abdominal aorta. Friedman et al.7 noted increased intimal thickness in regions of low wall shear stress... along the lateral walls of the abdominal aortic bifurca- tion. Moore ...

  

Source: Taylor, Charles A. - Department of Bioengineering, Stanford University

 

Collection: Biology and Medicine

 
3 Enfoque del NINR: La Salud de los Hispanos
 

Summary:  University, 2000. Escaso Beneficio de Intervenciones en Hogares Latinos con Infantes de Bajo Peso al Nacer... Peso al Nacer (en inglés, Low Birth Weight o LBW) de familias latinas de bajos ingresos. Aunque el... evaluar la incidencia de infantes de bajo peso al ...

  

Source: Baker, Chris I. - Laboratory of Brain and Cognition, National Institute of Mental Health

 

Collection: Biology and Medicine

 
4 The Terminal Abdominal Ganglion of the Wood Cricket Nemobius sylvestris
 

Summary:  .C. INSAUSTI ET AL. Journal of Morphology #12;Fig. 5. Nemobius sylvestris. The terminal abdominal ganglion... The Terminal Abdominal Ganglion of the Wood Cricket Nemobius sylvestris Teresita C. Insausti... ­ Universite´ Franc¸ois Rabelais, Tours, France ABSTRACT The abdominal cerci of the wood cricket, ...

  

Source: Giron, David - Institut de Recherche sur la Biologie de l'Insecte, Université François Rabelais - Tours

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
5 Informations Complmentaires Poste 2011 ATER MCF0238 Quotit du poste : 100%
 

Summary:  (GMC) Lieu(x) d'exercice : INSA de LYON Nom directeur département : Nacer HAMZAOUI Tel directeur dépt... . : 04 72 43 82 01 Email directeur dépt. : nacer.hamzaoui@insa-lyon.fr Recherche : Profil : Le profil

  

Source: Stouls, Nicolas - Centre of Innovation in Telecommunications and Integration of Services & Département Informatique, INSA Lyon

 

Collection: Computer Technologies and Information Sciences

 
6 Ultrasound in abdominal trauma John S. Rose, MD
 

Summary:  C, Militello P, Mirvis S, Badellino M, et al. Sonography in blunt abdominal trauma: a preliminary... , Shanmuganathan K, et al. Abdominal injuries without hemoperitoneum: a potential limitation of focused abdominal... , Gandhi R, Collazzo L, et al. Defining the ...

  

Source: Louisiana State University Health Sciences Center in New Orleans, Department of Biochemistry and Molecular Biology

 

Collection: Biology and Medicine

 
7 Korea-Australia Rheology Journal June 2004 Vol. 16, No. 2 75 Korea-Australia Rheology Journal
 

Summary:  branches (Taylor et al., 1998; Buchanan et al., 2003). The flow field in the abdominal aorta with the left... abdominal aortic branches Taedong Kim, Taewon Seo*1,2 and Abdul.I. Barakat2 Dept. of Environmental Eng... shear stresses are considerably higher along the anterior wall of the ...

  

Source: Barakat, Abdul - Department of Mechanical and Aeronautical Engineering, University of California, Davis

 

Collection: Biology and Medicine

 
8 Particle Image Velocimetry measurements in an abdominal aortic aneurysm model
 

Summary:  Particle Image Velocimetry measurements in an abdominal aortic aneurysm model Ch. Stamatopoulos1... School, Univ. of Crete, Greece Abdominal aortic aneurysm (AAA) is an abnormal dilatation of the aortic... by a rapid prototyping machine (3D printer). The manufactured transparent model includes the abdominal aorta

  

Source: Papaharilaou, Yannis - Institute of Applied and Computational Mathematics, Foundation of Research and Technology, Hellas

 

Collection: Computer Technologies and Information Sciences ; Biology and Medicine

 
9 Movement of oxygen from the atmosphere to the mitochondria occurs via several convective and diffusive steps
 

Summary:  inspiration due to descent of the diaphragm and displacement of the abdominal viscera (Decramer et al., 1984... et al., 1999; Takata et al., 1990). When right atrial pressure exceeds PIA the abdominal compartment... and diffusive steps (Weibel et al., 1981). In ...

  

Source: Bennett, Albert F. - Ecology and Evolutionary Biology Department, University of California, Irvine

 

Collection: Environmental Sciences and Ecology

 
10 Biological Journal of the Linnean Society, 2007, 90, 97116. With 9 figures 2007 The Linnean Society of London, Biological Journal of the Linnean Society, 2007, 90, 97116 97
 

Summary:  & Bolker, 2003). Polly et al. (2001) proposed that the abdominal and caudal vertebral regions of snakes... anatomically distinct regions (i.e. abdominal and caudal), an increase in the number and relative length... in the abdominal and caudal regions of the vertebral column, but changes in aspect ratio ...

  

Source: Brainerd, Elizabeth - Department of Ecology and Evolutionary Biology, Brown University

 

Collection: Environmental Sciences and Ecology

 
11 Creation of a Standardized Data Collection Form: Aiding in Acute Abdominal Pain Examination and Diagnosis
 

Summary:  , and often resulted in diagnoses of undifferentiated abdominal pain (Lukens, et al, 696). F. T. de Dombal... Creation of a Standardized Data Collection Form: Aiding in Acute Abdominal Pain Examination... collection form specifically designed for those patients complaining of acute abdominal pain (AAP). We

  

Source: Virginia, University of - Department of Systems and Information Engineering, Human Computer Interaction Group

 

Collection: Engineering ; Computer Technologies and Information Sciences

 
12 Preoperative Surgical Planning Using Virtual Laparoscopic Camera
 

Summary:  on abdominal CT scan- ning and physically based modeling of organ dis- placement after abdominal insufflation... . This will al- low surgeons to combine anatomic data with visual cues of a 2D laparoscopic environment... in preopera- tive surgical planning. 2 Method 2.1 Data Thin cut stack of abdominal CT ...

  

Source: Guskov, Igor - Department of Electrical Engineering and Computer Science, University of Michigan

 

Collection: Computer Technologies and Information Sciences

 
13 Preoperative Surgical Planning Using Virtual Laparoscopic Camera
 

Summary:  on abdominal CT scan- ning and physically based modeling of organ dis- placement after abdominal insufflation... . This will al- low surgeons to combine anatomic data with visual cues of a 2D laparoscopic environment... in preopera- tive surgical planning. 2 Method 2.1 Data Thin cut stack of abdominal CT ...

  

Source: Zhukov, Leonid - University Higher School of Economics, Moscow

 

Collection: Computer Technologies and Information Sciences

 
14 Track 14. Cardiovascular Mechanics 14.1. Aneurysms -Abdominal Aortic Aneurysms and Stent-Grafts $273 AAA have considered the tissue as isotropic. However, recent biaxial tensile
 

Summary:  Track 14. Cardiovascular Mechanics 14.1. Aneurysms -Abdominal Aortic Aneurysms and Stent... on AAA tissue samples demonstrate the anisotropic nature of this tissue (VandeGeest et al., 2006... density function has been used to model the anisotropic behaviour of the AAA tissue (Holzapfel et al. 2000

  

Source: Papaharilaou, Yannis - Institute of Applied and Computational Mathematics, Foundation of Research and Technology, Hellas

 

Collection: Computer Technologies and Information Sciences ; Biology and Medicine

 
15 Examen de BIOESTADSTICA 3 de febrero de 2004 1) En la Sierra Morena se pueden encontrar arbustos de jara de dos tipos: jara de ldano (cistus ladanifer,
 

Summary:  distribución del peso de su hijo al nacer, se tomaron dos muestras (una de hijos de fumadoras y otra de hijos... se sabe que del (1-p) restante 1/3 son grandes y 2/3 son pequeños. a) De 100 huevos elegidos al azar... polimorfismo en la encina, realizada en el monte de El Pardo, se recogieron al azar hojas ...

  

Source: Quirós, Fernando - Departamento de Matemáticas, Universidad Autonoma de Madrid

 

Collection: Mathematics

 
16 Computational Evaluation of Aortic Aneurysm Rupture Risk: What have we learned So Far?
 

Summary:  al. Peak wall stress measurement in elective and acute abdominal aortic aneurysms. J Vasc Surg 2008... ML, et al. Prediction of rupture risk in abdominal aortic aneurysm during observation: wall stress... , et al. The role of geometric parameters in the prediction of ...

  

Source: Papaharilaou, Yannis - Institute of Applied and Computational Mathematics, Foundation of Research and Technology, Hellas

 

Collection: Computer Technologies and Information Sciences ; Biology and Medicine

 
17 downwards: snout truncate, mouth almost vertical. Dorsal and anal fins with nine rays. ^
 

Summary:  with 14 rays, reaching almost ^he abdominals, which areoboval and white. Tail forked as usu- al with 24... 'nsparent, the pectoral with 14 rays and not reaching the abdominal, tail with 32 rays. 48th Species. Roundnose Fallfish... the abdominal fins. Dorsal and anal fins with 10 rays. Length one or two ...

  

Source: Hulsey, C. Darrin - Department of Ecology and Evolutionary Biology, University of Tennessee

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
18 PROCEEDINGS of the HUMAN FACTORS AND ERGONOMICS SOCIETY 45th ANNUAL MEETING-2001 THE EFFECT OF A STANDARDIZED DATA COLLECTION FORM ON THE
 

Summary:  of [abdominal pain] in the emergency department." that the use of a computer-based aid improved (Powers, et al... OF A STANDARDIZED DATA COLLECTION FORM ON THE EXAMINATION AND DIAGNOSIS OF PATIENTS WITH ABDOMINAL PAIN Stephanie... Calland University of Virginia, Charlottesville, Virginia Abdominal pain (AP) ...

  

Source: Virginia, University of - Department of Systems and Information Engineering, Human Computer Interaction Group

 

Collection: Engineering ; Computer Technologies and Information Sciences

 
19 ARTHROPOD BIOLOGY Relationships Between Adult Abdominal Color and Reproductive
 

Summary:  typically yielded May 2009 WENNINGER ET AL.: ABDOMINAL COLOR AND REPRODUCTION IN D. citri 477 #12... were collected at nine 2- to 3-d intervals after mating. May 2009 WENNINGER ET AL.: ABDOMINAL COLOR... focus on mated females (see Wenninger et al. 2008) and/or females of blue/ green ...

  

Source: Florida, University of - College of Engineering. Software and Analysis of Advanced Materials Processing Center

 

Collection: Computer Technologies and Information Sciences ; Materials Science

 
20 Drosophila bristles and the nature of quantitative genetic variation
 

Summary:  for abdominal bristle number (Long et al. 1995), whereas two QTLs on the X chromosome and six on chromosome 3... , and full sib corre- lations (Clayton et al. 1957). Further, mean abdominal bristle number did not change... show that there is naturally segregating genetic variance for environmental plasticity ...

  

Source: Mackay, Trudy F.C. - Department of Genetics, North Carolina State University

 

Collection: Biology and Medicine


Page:   2  3  4  5 
Page:   1  2  3  4  5 
 
21 Instituto Nacional de Salud Pblica http://www.insp.mx/Portal/Centros/ciss/ciss_seminario.html 1 of 2 2/4/06 2:06 AM
 

Summary:  Consejo Nacional de Investigación sobre la caracterización de riesgo, el bajo peso al nacer, las emisiones... desarrollado una vacuna contra el SIDA? El Centro de Investigación en Sistemas de Salud (CISS) invita al... público en general al seminario especial "¿Por qué no hemos encontrado una vacuna ...

  

Source: Seager, Sara - Departments of Earth, Atmospheric, and Planetary Sciences & Physics, Massachusetts Institute of Technology

 

Collection: Geosciences ; Physics

 
22 Marina Aerial by Macduff Everton Sponsored by the
 

Summary:  Department of Radiology Presents AbDominAl imAging AnD musculoskeleTAl uPDATe 2011 January 15-18, 2011... of the Department of Radiology, Duke University Medical Center, Durham, North Carolina abdominal musculoskeletal... for the practicing radiolo- gist performing Abdominal & Musculoskeletal MRI. Two days of this course

  

Source: Duke University, Center for In Vivo Microscopy

 

Collection: Biology and Medicine

 
23 Las Conjeturas de Bolo -Hola, Eiffel, cunto tiempo!
 

Summary:  impulsivo, además de fuerte. - Sí, es cierto, al menos desde que se fue Ados. Vaya, lo siento. - Continua... a nacer, y que esto se seguirá repitiendo para toda la eternidad. Incluso decía tener vagos recuerdos de... ;3 - Yo empiezo a dudar de ella. - ¡Oh, vamos, admite al menos que eres un fatalista! - ¿Pero no ves lo

  

Source: Johnson, Samuel - Instituto Carlos I de Física Teórica y Computacional, Universidad de Granada

 

Collection: Physics

 
24 BASIC RESEARCH PAPERS Exercise has numerous overall health benefits.
 

Summary:  -to-side anastomosis, there have been few numeric studies of flow in the abdominal aorta. Taylor et al25 described... conditions. Taylor et al26,27 described, qualitatively, the pulsatile flow in a model of an abdominal aorta... -33 The anatomic dimensions of the idealized abdominal aorta ...

  

Source: Taylor, Charles A. - Department of Bioengineering, Stanford University

 

Collection: Biology and Medicine

 
25 INTRODUCTION Failure to precisely regulate chromosome duplication and
 

Summary:  and suppression of endoreduplication in pupal wing cells (Katzen et al., 1998). The abdominal phenotype in Dm myb... abdominal histoblasts (Hayashi et al., 1993) was used to identify these cells. Wandering third instar larvae... . Pupae were then treated for abdominal epidermal ...

  

Source: Katzen, Alisa L. - Department of Biochemistry and Molecular Genetics, University of Illinois at Chicago

 

Collection: Biology and Medicine

 
26 Pulse Wave Imaging in Murine Abdominal Aortas A Feasibility Study
 

Summary:  Pulse Wave Imaging in Murine Abdominal Aortas A Feasibility Study Kana Fujikura,Jianwen Luo... , New York, USA kf2113@columbia.edu Abstract--One of the most crucial aspects of abdominal aortic... model. Twelve wild-type (WT) mice were anesthetized, and underwent laparotomy. The abdominal aortas

  

Source: Konofagou, Elisa E. - Department of Biomedical Engineering, Columbia University

 

Collection: Engineering ; Biology and Medicine

 
27 Abdominal Muscle Function in Ventilation and Locomotion in New World Opossums and Basal
 

Summary:  ­10 (0.15­0.25 m/s) 1018 S.M. REILLY ET AL. Journal of Morphology #12;Fig. 3. Abdominal hypaxial motor... (Goldman et al., 1987; Iscoe, 1998). What is novel in our data is that all of the abdominal muscles... Abdominal Muscle Function in Ventilation and Locomotion in New World Opossums ...

  

Source: Reilly, Stephen M. - Department of Biological Sciences, Ohio University

 

Collection: Environmental Sciences and Ecology

 
28 A Physiological Torso Model for Realistic Breathing Simulation
 

Summary:  been done on the simulation of muscles, al- though more on the deformation than on the way they exhibit... force. Muscles are often modeled as mass-spring systems [10] or finite element systems [3]. Al... approach. Simulation of the abdominal breathing is done by [11]. It is done by constraint resolution

  

Source: Veltkamp, Remco - Department of Information and Computing Sciences, Universiteit Utrecht

 

Collection: Computer Technologies and Information Sciences

 
29 Current Biology, Vol. 14, 13191329, August 10, 2004, 2004 Elsevier Ltd. All rights reserved. DOI 10.1016/j.cub.2004.07.052 Roundabout 2 Regulates Migration
 

Summary:  - robo2 double mutants have more severe CNS pheno-gans. We used live imaging to show that abdominal Cho... shown to affect migra-neighboring visceral mesoderm) transforms abdominal tion of several neuronal types... expression in the Slit-Robo signaling can also affect migration and ad-abdominal visceral mesoderm. hesion

  

Source: Zinn, Kai - Division of Biology, California Institute of Technology

 

Collection: Biology and Medicine

 
30 2004. The Journal of Arachnology 32:336340 SHORT COMMUNICATION
 

Summary:  in males, females and juveniles. The abdominal pigment is located in the hypodermis. Keywords: Color... , s1, s2 abdominal spot 1 and 2 lengths. 2. Tibia, lateral view; tib 1,3 tibia 1 and tibia 3 lengths... site, see Sørensen et al. 2002), by an expedition of the Smithsonian Insti- tution in Washington, D

  

Source: Huber, Bernhard A. - Zoologische Forschungsmuseum Alexander Koenig

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
31 Nipponentomon pembertonense, n. sp. (Protura: Acerentomidae) from Maryland
 

Summary:  of characters: 9 anterior setae on abdominal sternite VII, 15 posterior setae on abdominal tergite VIII, cover... , chaetotaxy of first abdominal tergite, right side; I, lateral chaetotaxy of second abdominal tergite, right... side; J, chaetotaxy of sixth abdominal tergite, right side; K, ...

  

Source: Bernard, Ernest - Department of Entomology and Plant Pathology, University of Tennessee

 

Collection: Biology and Medicine

 
32 A GENERIC KEY TO THE PROTOZOEAN, MYSIS, AND POSTLARVAL STAGES OF THE LITTORAL PENAEIDAE OF THE NORTHWESTERN GULF OF
 

Summary:  .ory conditions, the nallplii were found to be so similar as to defy attempts to fit them int.o a key. Al- though... a given development.al stage (e.g., Nauplius II, Protozoea I, etc.), the size ranges of penaeid larvae... \ '----~~ ~\~l12 Dor'5al Protuberance ... 1"0 v ~,~\Q 13 Rudimenlary Carapace 11 \ f FIGURE l.-Penaeid ...

  

Source: National Oceanic and Atmospheric Administration (NOAA), Fishery Bulletin

 

Collection: Environmental Sciences and Ecology

 
33 5015RESEARCH ARTICLE INTRODUCTION
 

Summary:  -germ insects (Aranda et al., 2008; Pueyo et al., 2008), expression of Gb-Dl in abdominal segments precedes... , in contrast to reports on a cockroach (Pueyo et al., 2008), Gb-Dl expression in abdominal segments does... to abdominal segmentation (Mito et ...

  

Source: Extavour, Cassandra - Department of Organismic and Evolutionary Biology, Harvard University

 

Collection: Biology and Medicine

 
34 REMOTE CONTROL OF A CYBORG MOTH USING CARBON NANOTUBE-ENHANCED FLEXIBLE NEUROPROSTHETIC PROBE
 

Summary:  to evoke multi-directional, graded abdominal motions in the moths thus altering their flight path. 1... ) to evoke the abdominal motions in the moths. Moreover, we have electroplated a CNT-Au nanocomposite film... to elicit graded and multi-direction abdominal movements in both the pupae and adult moths using FNP

  

Source: Voldman, Joel - Research Laboratory of Electronics & Department of Electrical Engineering and Computer Science, Massachusetts Institute of Technology (MIT)

 

Collection: Engineering

 
35 Understanding and Treating Childhood Bellyaches Pediatric and Adolescent
 

Summary:  ):60-68. 2. Walker LS, Lipani TA, Greene JW, et al. Recurrent abdominal pain: symptom subtypes based on t 3... C, et al. Chronic abdominal pain in children: beliefs and expectations. Gastroenterology. 1998; 1 14... and cope with abdominal pain. Every child complains about a bellyache now ...

  

Source: Louisiana State University Health Sciences Center in New Orleans, Department of Biochemistry and Molecular Biology

 

Collection: Biology and Medicine

 
36 Sponsored by the Duke University School of Medicine The Duke Department of Radiology Presents
 

Summary:  MUSCUlOSkeleTAl ABDOMInAl Clyde Helms, M.D. Tracy A. Jaffe, M.D. Professor Associate Professor Thomas... K. Paulson, M.D. 12:30 p.m.-12:45 p.m. Q&A MUSCUlOSkeleTAl MRI & ABDOMInAl IMAGInG #12;MUSCUl... OSkeleTAl MRI AnD ABDOMInAl IMAGInG UPDATe January 16-19, 2012 The Ritz Carlton, Grand Cayman Islands REGISTER

  

Source: Duke University, Center for In Vivo Microscopy

 

Collection: Biology and Medicine

 
37 In Vivo Quantification of Blood Flow and Wall Shear Stress in the Human Abdominal Aorta During Lower Limb Exercise
 

Summary:  . Oshin- ski et al. used cine PC­MRI to measure flow velocity in the abdominal aorta under resting... In Vivo Quantification of Blood Flow and Wall Shear Stress in the Human Abdominal Aorta During... bicycle were used to measure, in vivo, the effects of exercise on hemodynamic conditions in the abdominal

  

Source: Taylor, Charles A. - Department of Bioengineering, Stanford University

 

Collection: Biology and Medicine

 
38 Atherosclerosis 214 (2011) 5864 Contents lists available at ScienceDirect
 

Summary:  .3 ± 8.6%) expansion of abdominal aortas after 10-day infusions. #12;62 M. Zack et al. / Atherosclerosis... Bockxmeer FM, et al. Angiotensin II type 1 receptor 1166C polymorphism is associated with abdominal aortic... G, Sofi F, et al. ACE DD genotype: a predisposing factor for ...

  

Source: Gelb, Michael - Departments of Chemistry & Biochemistry, University of Washington at Seattle

 

Collection: Chemistry ; Biology and Medicine

 
39 REDESCRIPTION OF SOME SPECIES OF CHONE KROYER AND EUCHONE MALMGREN, AND THREE NEW SPECIES
 

Summary:  primitive charac- ters in Sabellidae by Banse (1970), especially in regard to the abdominal uncini... abdominal setigers is stressed in the following descriptions. The ac- cessory teeth above the main fang... or subspatulate. Tho- racic neuropodial uncini long-handled, acicular. Abdominal notopodial uncini avicular

  

Source: National Oceanic and Atmospheric Administration (NOAA), Fishery Bulletin

 

Collection: Environmental Sciences and Ecology

 
40 Genetica 102/103: 199215, 1998. 199 c 1998 Kluwer Academic Publishers. Printed in the Netherlands.
 

Summary:  abdominal or sternopleural bristle number for 12 `selected' sublines (with 3 replicate selection lines... variance was due to temperature line interaction. For abdominal bristle number, the mutational interaction... , Daphnia, Tri- bolium, Mus, Hordeum, Oryza and Zea (reviewed by Houle et al., 1996). Most estimates cluster

  

Source: Mackay, Trudy F.C. - Department of Genetics, North Carolina State University

 

Collection: Biology and Medicine


Page:   1  2  3  4  5 
Page:   1  2  3  4  5 
 
41 Copyright 1998 by the Genetics Society of America Candidate Quantitative Trait Loci and Naturally Occurring Phenotypic Variation
 

Summary:  chromosome affected re- sponse to artificial selection for abdominal (Long et al. 1995) and sternopleural (M... of naturally occurring alleles in the Dl-H gene region to complement the abdominal bristlelero et al. 1997... assessed quantitative genetic variation in abdominal and ...

  

Source: Mackay, Trudy F.C. - Department of Genetics, North Carolina State University

 

Collection: Biology and Medicine

 
42 Ultrasound in Med. & Biol. Vol. 18, No. 8, pp. 681-689, 1992 0301-5629/92 $5.00 + .00 Printed in the U.S.A. @ 1992 Pergamon Press Ltd.
 

Summary:  and the mean thickness of the maternal abdominal and uterine walls. Ongoing studies will al- low us to improve... INSERTION LOSS DURING PASSAGE THROUGH ABDOMINAL WALL AND MYOMETRIUM TARIQ A. SIDDIQI, t WILLIAM D. O... . In the full bladder condition, the sound beam traversed the anterior abdominal wall and ...

  

Source: Illinois at Urbana-Champaign, University of - Bioacoustics Research Laboratory

 

Collection: Engineering ; Biology and Medicine

 
43 Rapid Proton Density Weighted Abdominal MRI at 3 Tesla With RF Non-Uniformity Correction , and K. S. Nayak1
 

Summary:  Rapid Proton Density Weighted Abdominal MRI at 3 Tesla With RF Non-Uniformity Correction H. H. Hu1... , CA, United States Introduction ­ In high-field abdominal imaging, RF non-uniformities due to the use... , and then discuss the applicability of the method for fat quantification in abdominal MRI. Methods - For low

  

Source: Southern California, University of - Department of Electrical Engineering, Magnetic Resonance Engineering Laboratory

 

Collection: Biology and Medicine ; Engineering

 
44 University of Southampton Research Repository ePrints Soton
 

Summary:  AND THE ENVIRONMENT Institute of Sound and Vibration Research Antenatal foetal monitoring through abdominal phonogram... FOETAL MONITORING THROUGH ABDOMINAL PHONOGRAM RECORDINGS: A SINGLE-CHANNEL INDEPENDENT COMPONENT ANALYSIS... to a signal referred to as the abdominal phonogram. Such a signal, recorded in a single-channel ...

  

Source: Quartly, Graham - National Oceanography Centre Southampton

 

Collection: Environmental Sciences and Ecology ; Geosciences

 
45 Sex pheromone gland of the female tiger moth Holomelina lamae (Lepidoptera: Arctiidae)
 

Summary:  , University of Massachusetts, Amherst. #12;YIN ET AL 1917 For ultrastructural studies the abdominal tips were... glands located dorsally at the female's abdominal tip, above the ovipositor. Each gland opens externally... to a dorsal pore, with both pores being situated near the junction of abdominal segments ...

  

Source: 

 

Collection: Biology and Medicine

 
46 Ulster MedJ2005; 74 (2) 113-121 Periods of low atmospheric pressure are associated with
 

Summary:  R, Zamboni P et al. Seasonal variations in the rupture of abdominal aortic aneurysms. Jpn Heart J... abdominal aortic aneurysm rupture rates in Northern Ireland DW Harkin, M O'Donnell, J Butler, PH Blair, JM... of ruptured abdominal aortic aneurysm (RAAA) has been reported. We explored the role ofatmospheric ...

  

Source: Armagh Observatory Meteorology Databank

 

Collection: Geosciences

 
47 Amyloid Treatment and Research Program key clinical research accomplishments: Description of the natural history of amyloid diseases, which varies with each clinical type
 

Summary:  , the abdominal fat aspirate, for the diagnosis of systemic amyloidosis, offering a less-invasive, highly... for patients with AL amyloidosis. This treatment has become the standard first line therapy for AL amyloidosis... . Investigation of the use of novel agents for treatment of AL amyloidosis, including ...

  

Source: Finzi, Adrien - Department of Biology, Boston University

 

Collection: Environmental Sciences and Ecology

 
48 Presented by the Department of Radiology AbdominAl imAging
 

Summary:  Presented by the Department of Radiology AbdominAl imAging & musculoskeletAl mRi updAte 2010... CRiption -- This course has been designed for the radiologist performing abdominal and musculoskeletal imaging... and procedures. The first two days of the course will focus on abdominal imaging, the other two ...

  

Source: Duke University, Center for In Vivo Microscopy

 

Collection: Biology and Medicine

 
49 Ann Surg Oncol . Author manuscript Closed hyperthermic intraperitoneal chemotherapy with open abdomen: a
 

Summary:  and aerosols, and allows permanent access to the whole abdominal cavity. Its principle is to extend... the abdominal surgical wound upwards with a sort of glove-box . The cutaneous edges of the laparotomy are... and vapours. Intra-abdominal temperature was maintained between 42 and 43 C during most of the procedure

  

Source: Ecole Polytechnique, Centre de mathématiques

 

Collection: Mathematics

 
50 The effect of abdominal wall morphology on ultrasonic pulse distortion. Part I. Measurements
 

Summary:  ., Vol. 104, No. 6, December 1998 Hinkelman et al.: Abdominal wall pulse distortion: Measurements #12... , No. 6, December 1998 Hinkelman et al.: Abdominal wall pulse distortion: Measurements #12;appear... , December 1998 Hinkelman et al.: Abdominal wall pulse ...

  

Source: Mast, T. Douglas - Department of Biomedical Engineering, University of Cincinnati

 

Collection: Biology and Medicine ; Engineering

 
51 Tissue and Cell 43 (2011) 5265 Contents lists available at ScienceDirect
 

Summary:  interneurons Terminal abdominal ganglion a b s t r a c... a pair of abdominal appendages, the cerci, involved in the detection of air-movements. They mediate... , representing a classical model-system for neuroethologists (e.g., Edwards and Palka, 1974; Palka et al., 1977

  

Source: Giron, David - Institut de Recherche sur la Biologie de l'Insecte, Université François Rabelais - Tours

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
52 Biol. Lett. (2005) 1, 276279 doi:10.1098/rsbl.2005.0318
 

Summary:  describe a novel male trait--an abdominal constriction that appears during courtship--that allows males... of damage inflicted by females during the first copulation. Thus, the abdominal constriction allows males... .g. Ramos et al. 2004)--sexual selection favours males that facilitate cannibalism at the first copulation

  

Source: Andrade, Maydianne C.B. - Department of Biological Sciences, University of Toronto at Scarborough

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
53 Copyright 0 1985 by the Genetics Society of America TRANSPOSABLE ELEMENT-INDUCED RESPONSE TO
 

Summary:  for number of bristles on the last abdominal tergite was carried out for 16 generations among the progeny... -strain females (Harwich). Each cross was replicated four times. Average realized heritability of abdominal... .163 k 0.010). Phenotypic variance of abdominal bristle score increased by a factor of four in lines

  

Source: Mackay, Trudy F.C. - Department of Genetics, North Carolina State University

 

Collection: Biology and Medicine

 
54 Zoologica Scripta, Vol. 21, N o 3, pp 247-250, 1002 Printed in Great Britain
 

Summary:  by the terrestrial freshwater inputs reachingthe bay during the spring-summer period (Pala- cin et al. 1991). Several... ;Palacin et al. 1991; Capaccioni-Azzati 1987;Capaccioni & San Martin 1989-1990; Martin 1990, 1991; Martin... , together with the prcscncc o f an abdominal branchiatc region, allow us to separate these ...

  

Source: Martin, Daniel - Centre d'Estudis Avançats de Blanes

 

Collection: Environmental Sciences and Ecology

 
55 IEEE TRANSACTIONS ON BIOMEDICAL ENGINEERING, VOL. 57, NO. 7, JULY 2010 1757 Flexible Split-Ring Electrode for Insect Flight
 

Summary:  the multisite electrode to deliver electrical stimuli that evoke multidirectional, graded abdominal motions... and consistently produced neural probes for small neural systems. 3-D shape-memory al- loy microelectrodes [11... demonstrated that stimulation with the FSE can elicit multidirectional graded abdominal motions in both ...

  

Source: Voldman, Joel - Research Laboratory of Electronics & Department of Electrical Engineering and Computer Science, Massachusetts Institute of Technology (MIT)

 

Collection: Engineering

 
56 Abstract--We hereby propose a new method to determine the regionally passive, elastic, stress-strain relationship of the
 

Summary:  -strain relationship of the normal murine abdominal aorta in vivo. The circumferential stress-strain relationship... and diameter variation. The regional diameter variation of the murine abdominal aortas was obtained using... diagnosis. Luo et al. (2009) proposed the Pulse Wave Imaging (PWI) technique to visualize the pulse wave ...

  

Source: Konofagou, Elisa E. - Department of Biomedical Engineering, Columbia University

 

Collection: Engineering ; Biology and Medicine

 
57 Neuromodulators play a key role in timing and coordinating complex behaviours in animals (Marder, 2000). Such control
 

Summary:  -containing cells are not detected in the first or second abdominal ganglia (Chen et al., 1994... rapidly in the descending processes compared with the abdominal neurons (Ewer et al., 1994). The rise... by a decline in steroid titres (Hewes and Truman, 1991; Kingan et al., 1997), the ...

  

Source: Fuse, Megumi - Department of Biology, San Francisco State University

 

Collection: Biology and Medicine

 
58 OBSERVATIONS OF MOLTING FEMALE KING CRABS, PARALITHODES CAMTSCHATICA (TILESIUS)
 

Summary:  ~ emergethrough an opening between the posterior margin of the cacapaceand anterior margin of the abdominal... molting. Carapace leGgth measurements, taken from the hind margin of the ort·:!al socket to the median... along the anterior margin of the first abdominal seg- #12;2 BULLETIN 5 - NORTH PACIFIC COMMISSION FIGURE

  

Source: Alaska Fisheries Science Center

 

Collection: Environmental Sciences and Ecology

 
59 ARTICLE IN PRESS Computer-Aided Design ( )
 

Summary:  cite this article in press as: Shim M-B, et al. Three-dimensional shape reconstruction of abdominal... this article in press as: Shim M-B, et al. Three-dimensional shape reconstruction of abdominal aortic aneurysm... al. Three-dimensional shape reconstruction of ...

  

Source: Shimada, Kenji - Department of Mechanical Engineering, Carnegie Mellon University

 

Collection: Engineering

 
60 International Conference on Experiments/Process/System Modelling/Simulation/Optimization Athens, 6-9 July, 2005
 

Summary:  IN ABDOMINAL AORTIC ANEURYSMS Yannis Papaharilaou *, , John A. Ekaterinaris* , Eirini Manousaki , Asterios N... , computational hemodynamics, structural stress analysis. Abstract. Abdominal aortic aneurysm (AAA) is a localized... to the more complete but computationally intensive FSI study. 1 INTRODUCTION Abdominal aortic ...

  

Source: Papaharilaou, Yannis - Institute of Applied and Computational Mathematics, Foundation of Research and Technology, Hellas

 

Collection: Computer Technologies and Information Sciences ; Biology and Medicine


Page:   1  2  3  4  5 
Page:   1  2  3  4  5 
 
61 GRACM International Congress on Computational Mechanics Limassol, 29 June 1 July, 2005
 

Summary:  ANALYSIS IN ABDOMINAL AORTIC ANEURYSMS APPLYING FLOW INDUCED WALL PRESSURE Yannis Papaharilaou *, , John A... . Abdominal aortic aneurysm (AAA) is a localized dilatation of the aortic wall. The lack of an accurate AAA... study. 1 INTRODUCTION Abdominal aortic aneurysm is a localized dilatation of the aortic wall

  

Source: Papaharilaou, Yannis - Institute of Applied and Computational Mathematics, Foundation of Research and Technology, Hellas

 

Collection: Computer Technologies and Information Sciences ; Biology and Medicine

 
62 A Screening Aid for the Identification of the Banded Elm Bark Beetle*, Scolytus schevyrewi Semenov
 

Summary:  . With rare exceptions, a spine or tubercule is present on the second abdominal sternite. Recognizing... the elytra. - Many species of Scolytus possess a more or less distinct spine on the 2nd abdominal sternite... abdominal apex and/or elytral apex strongly declivous

  

Source: Ginzel, Matthew - Department of Entomology, Purdue University

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
63 Creating the FMA-RadLex in Ontology Viewer Manual operation
 

Summary:  Viewer #12;Ontology Viewer #12;Application view required 1. Add class/node `Abdominal organ' to class... /node `Organ' 2. Reassign existing and appropriate organs to `Abdominal organ' 3. Reassign all other organs... ;Create new class `Abdominal organ' #12;Organs reassigned to new class `Abdominal organ' ...

  

Source: Washington at Seattle, University of - Structural Informatics Group (SIG)

 

Collection: Computer Technologies and Information Sciences ; Biology and Medicine

 
64 Copyright 8 1995 by the Genetics Society of America Polygenic Mutation in Drosophila melanogaster
 

Summary:  of -15 abdominal and 16sternopleural bristles (MACKAY et al. 1994),it is clear that in no case didthe... generations 93 to 103 averaged over allthree replicate high abdominal bristle lines was 0.005 (MACKAY et al... mutations affecting abdominal and sternopleural bristle number. ...

  

Source: Mackay, Trudy F.C. - Department of Genetics, North Carolina State University

 

Collection: Biology and Medicine

 
65 Neuron, Vol. 37, 185192, January 23, 2003, Copyright 2003 by Cell Press posterior position in the animal: abdominal neuroblastsRegion-Specific Apoptosis Limits
 

Summary:  the abdominal lineages, Bello et al. ptosis is induced by the Hox gene abdA, which is differ- observed... be the fate of the abdominal development (Prokop and Technau, 1991; Truman et al., pNBs if they did not die... NB survives and abdominal clones are expanded, a result similar to that ...

  

Source: Brand, Andrea - Department of Genetics, University of Cambridge

 

Collection: Biology and Medicine

 
66 INTRODUCTION Developmental neurobiologists working on insect model
 

Summary:  of Schmidt et al. (1997). It is medium- sized (6.4 µm; n=4), dorsal, and migrates medially in abdominal... forms only in abdominal segments. Cash et al. (1992) and Landgraf et al. (1997) both describe muscles 5... by positional cues shortly after they are formed in the neuroectoderm ...

  

Source: Doe, Chris - Institute of Neuroscience & Department of Biology, University of Oregon

 

Collection: Biology and Medicine

 
67 Closed hyperthermic intraperitoneal chemotherapy with open abdomen: A novel technique to reduce exposure of
 

Summary:  and aerosols, and allows permanent access to the whole abdominal cavity. Its principle is to extend... the abdominal surgical wound upwards with a sort of "glove-box". The cutaneous edges of the laparotomy... and vapours. Intra-abdominal temperature was maintained between 42 and 43°C during most of the procedure

  

Source: Ecole Polytechnique, Centre de mathématiques

 

Collection: Mathematics

 
68 Crustacean Hyperglycemic Hormone, a possible endocrine regulator of ecdysis in the tobacco hornworm, Manduca sexta
 

Summary:  Specificity Fig. 4: paired abdominal cells and transverse nerves of the 4th abdominal ganglia Fourth abdominal... ganglia Terminal abdominal Ganglia Fig.5: Paired cells of the therminal ganglia Neuroendocrine regulation... in vertebrates as well as invertebrates (Siviter et al, 2000). ...

  

Source: Fuse, Megumi - Department of Biology, San Francisco State University

 

Collection: Biology and Medicine

 
69 Diversity and Evolution of the Insect Ventral
 

Summary:  - ciated with each pair of legs. Ancestrally there are 11 abdominal segments, but in almost all extant... , and the thoracic and abdominal ganglia of the VNC, which to- gether form most of the CNS (22, 109, 114). Each... , 59, 140), all possess three thoracic (T1­ T3) and eight abdominal ganglia (A1­A8), ranged across

  

Source: Foster, William A. - University Museum of Zoology, University of Cambridge

 

Collection: Environmental Sciences and Ecology

 
70 Drosophila Primers for Quantitative RT-PCR Veronika Sander 2009
 

Summary:  TCTCCTTGCGCTTCTTGGA LaLonde et al., 2006 CV2 Crossveinless 2 GTATGAGAGTGGCTCGGAGTG CGTGGTGGCTGTAACTGGTTG 131 Tsg... Brinker GCCAGGAAATACAACATTCAC CCGATTGCTGTGGGAGTAG 163 Abda Abdominal a CAGACCTACACTCGCTTCCAG... CGGCTCGTAACTCCTTCTTC 172 AbdB Abdominal B GCCTACAACGACGAGGGATTC CTGCGTTTCTGGGTAAGGATAG ~90 Dfd Deformed

  

Source: De Robertis, Eddy M. - Department of Biological Chemistry, University of California at Los Angeles

 

Collection: Biology and Medicine

 
71 Austral Ecology (2002) 27, 565572 Distribution of energy reserves in a viviparous skink
 

Summary:  , the frequency and position of naturally occurring tail breaks were determined. Both abdominal and caudal lipid... ­78%) of these fat reserves. Temporal variation in fat body mass, both abdominal and caudal, was evident... by a variety of invertebrates (e.g. crusta- ceans, cnidarians, spiders, insects; Robinson et al. 1970; ...

  

Source: Chapple, David - School of Biological Sciences, Monash University

 

Collection: Biology and Medicine

 
72 46 Accepted by J. Longino: 17 Feb. 2009; published: 6 Apr. 2009 ISSN 1175-5326 (print edition)
 

Summary:  peculiar features of the wing venation and abdominal morphology that introduced some uncertainty about its... copy (EF1F1), elongation factor 1-alpha F2 copy (EF1F2), wingless (wg), and abdominal-A (abd... al. (2006). The Amyrmex sequences (GenBank accession numbers FJ588487-FJ588493) were added to the 162

  

Source: Brady, Seán - Curator of Hymenoptera, Department of Entomology, National Museum of Natural History, Smithsonian Institution

 

Collection: Biology and Medicine

 
73 PERITONEAL MEMBRANES, OVARIES, AND OVIDUCTS OF SALMONOID FISHES AND THEIR SIGNIFICANCE
 

Summary:  . Page. Introduction.. , " ' " ., . . . . . . . . . . . I8S Abdominal viscera... ... .. .. . .. .. .. .. . . . . . . . . . . . . .. . . . . . . .. .. .. . . . . . . . . .. . . . . .. . .. . .. . . .. . 206 184 #12;ABDOMINAL VISCERA. PERITONEAL MEMBRANES, OVARIES, AND OVIDUCTS OF SALMONOID FISHES... , definitions of the principal ...

  

Source: National Oceanic and Atmospheric Administration (NOAA), Fishery Bulletin

 

Collection: Environmental Sciences and Ecology

 
74 Biomechan Model Mechanobiol DOI 10.1007/s10237-007-0115-9
 

Summary:  model for the development of abdominal aortic aneurysm (AAA) of Watton et al. Biomech Model Mechanobiol... of the abdominal aorta and development of an aneurysm at physiological pressures. Watton et al. (2004) model... for the carotid artery of a rabbit (Holzapfel et al. 2000) are ...

  

Source: Hill, Nicholas A.- Department of Mathematics, University of Glasgow

 

Collection: Biology and Medicine ; Mathematics

 
75 Genet. Res., Camb. (2002), 79, pp. 211218. With 2 figures. # 2002 Cambridge University Press DOI: 10.1017\S0016672302005621 Printed in the United Kingdom
 

Summary:  and abdominal bristle number (Long et al., 1998). 2. Materials and methods (i) Construction of Drosophila stocks... the previous observation that this SNP had a female-specific effect on abdominal bristle number (Long et al... for two SNPs at Dl, one affecting sternopleural and the other ...

  

Source: Mackay, Trudy F.C. - Department of Genetics, North Carolina State University

 

Collection: Biology and Medicine

 
76 1994 Elsevier Science B. V. AIl ri8h1s reserved. A crilical appraisal offetal surveillance.
 

Summary:  It to obtain clear, abdominally recorded, feta! heart signals from which diagnostic parameters could be derived... scaled subtraction of a thoracic or near-thoracic MECG from an abdominally measured compos- ite... more signaIs; 3) The FECG-to-noise ratio in the result is never better than in the original abdominal

  

Source: Leuven, Katholieke Universiteit, Department of Electrical Engineering, SCD Division

 

Collection: Engineering

 
77 Local Factorial Analysis of Multivariate Time Series Douzal Chouakria, Ahlame
 

Summary:  .Douzal@imag.fr Hammami, Nacer TIMC-IMAG-CNRS (UMR 5525), Universit´e Joseph Fourier Grenoble 1, F-38706 LA TRONCHE Cedex... , France E-mail: Nacer.Hammami@imag.fr Garbay, Catherine CLIPS-IMAG, Universit´e Joseph Fourier Grenoble 1... in factorial analysis was proposed by Lebart (Lebart (1969) and Banet et al. (1984)) with the ...

  

Source: Ecole Polytechnique, Centre de mathématiques

 

Collection: Mathematics

 
78 Which method to deliver heated intraperitoneal chemotherapy with oxaliplatin? An experimental comparison of open and closed techniques
 

Summary:  , Magnin G et al. High intra-abdominal pressure enhances the penetration and antitumor effect... homogeneity was achieved with both techniques. The systemic absorption and the abdominal tissue uptake... of this study was to compare blood and abdominal tissue concentrations of oxaliplatin after open and closed

  

Source: Ecole Polytechnique, Centre de mathématiques

 

Collection: Mathematics

 
79 Genet. Res., Camb. (1999), 74, pp. 303311. With 2 figures. Printed in the United Kingdom # 1999 Cambridge University Press 303 Linkage disequilibrium mapping of molecular
 

Summary:  region (Lai et al., 1994) and SSCP 1836 ­ were significantly associated with abdominal bristle number... ' number 10 (Lai et al., 1994), which had on average 5n37 abdominal bristles fewer than the other seven... variation in bristle number. Variation in abdominal and sternopleural ...

  

Source: Mackay, Trudy F.C. - Department of Genetics, North Carolina State University

 

Collection: Biology and Medicine

 
80 Physiological relevance of the changes in hemodynamics for circulating blood cells in
 

Summary:  the AAA when compared to the flow in a healthy abdominal aorta (Bluestein et al. 1996; Peattie et al. 1996... in Abdominal Aortic Aneurysms A. Introduction It has been observed that 75% of AAAs with a maximum diameter... been studied in abdominal aortic aneurysms. As discussed in the ...

  

Source: Ecole Polytechnique, Centre de mathématiques

 

Collection: Mathematics


Page:   1  2  3  4  5 
Page:   1  2  3  4  5 
 
81 Copyright 2000 by the Genetics Society of America Both Naturally Occurring Insertions of Transposable Elements and Intermediate
 

Summary:  al. and Jan 1994). Quantitative trait locus (QTL) mapping deletion complemented both abdominal... of sternopleural and abdominal bristles (Mackay and Langley 1990). Earlier work is also extended throughet al. 1998... with a reduction in both sternopleural and abdominal bristle number, ...

  

Source: Long, Anthony D. - Department of Ecology and Evolutionary Biology, University of California, Irvine; Mackay, Trudy F.C. - Department of Genetics, North Carolina State University

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
82 Neuropeptides in Heteroptera: Identification of allatotropin-related peptide and tachykinin-related peptides using MALDI-TOF mass spectrometry
 

Summary:  1 List of neuropeptides which were identified in the antennal lobes (AL) and in the abdominal... published recently [16]. In that study, the peptidome of corpora cardiaca (CC) and abdominal perisympathetic... and abdominal perisympathetic organs of polyphagous stinkbugs (Pentatomidae) revealed the group

  

Source: Meagher, Mary - Department of Psychology, Texas A&M University

 

Collection: Biology and Medicine

 
83 Received 8 January 2002 Accepted 26 March 2002
 

Summary:  and abdominal markings that are intriguing candidates for signals of indi- vidual identity. Here, I describe... systems (Dale et al. 2001), also occurs in insects (Choe & Crespi 1997). These social systems could... ­1428 1423 Ó 2002 The Royal Society DOI 10.1098/rspb.2002.2031 nant female (Sledge et al. 2001). However

  

Source: 

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
84 INTRODUCTION The epidermis of the embryonic segments and imaginal discs
 

Summary:  embryogenesis as derivatives of the embryonic epidermis (Simcox et al., 1991). Each larval abdominal hemisegment... of adult abdominal segments is subdivided into anterior and posterior compart- ments (Hama et al., 1990... forceps, leaving the abdominal epidermis exposed. In situ ...

  

Source: Kopp, Artyom - Section of Evolution and Ecology, University of California, Davis

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
85 Copyright 1999 by the Genetics Society of America The Genetic Architecture of Selection Response: Inferences From Fine-Scale
 

Summary:  artificial selection for abdominal (Long et al. 1995) and sternopleural (Gurganus et al. 1999) bristle num... for abdominal and sternopleural bristle number have been mapped with high resolution to the X and third... by genetic complexity--segregating al- most likely to be achieved using ...

  

Source: Mackay, Trudy F.C. - Department of Genetics, North Carolina State University

 

Collection: Biology and Medicine

 
86 Header for SPIE use 3-D Deformable Model Segmentation of Abdominal Aortic Aneurysm
 

Summary:  Header for SPIE use 3-D Deformable Model Segmentation of Abdominal Aortic Aneurysm Marko Subasica... , A-8036, Austria ABSTRACT In this paper we propose a technique for 3-D segmentation of abdominal... been performed using real patient CTA images and have shown good results. Keywords: abdominal aortic

  

Source: Loncaric, Sven - Faculty of Electrical Engineering and Computing, University of Zagreb

 

Collection: Computer Technologies and Information Sciences

 
87 mirando a la valla El otro da me levant temprano. Me hice un buen desayuno con queso
 

Summary:  . Había pasado la noche con un Americano borracho que, al despertarse sobrio, quiso pagarle solo la mitad... de lo que había prometido y al protestar le pegó. Mientras que andaba me vio y paró un rato para... a dos mujeres en Guatemala que dejaban un pueblo pequeño con sus mercancías, yendo a venderlas al

  

Source: Santini, Simone - Escuela Politécnica Superior, Universidad Autonoma de Madrid

 

Collection: Computer Technologies and Information Sciences

 
88 Thse prsente pour obtenir le grade de DOCTEUR DE L'ECOLE POLYTECHNIQUE
 

Summary:  ; Fontaine et al. 2002; Wang et al. 2002). B. Pathogenesis of the abdominal aortic aneurysms Although... of abdominal aortic aneurysms ...........................................9 C. Influence of the hemodynamic... ...

  

Source: Ecole Polytechnique, Centre de mathématiques

 

Collection: Mathematics

 
89 inadequate in predicting cell type. Al-though all frankly pseudomonopolar cells
 

Summary:  inadequate in predicting cell type. Al- though all frankly pseudomonopolar cells did innervate OHC... involved in the generation ofmotor activityforflight in the locust werefound in thefirst three abdominal... in abdominal and thoracic ganglia supports theories that insect wings originated from movable appendages which

  

Source: Robertson, Meldrum - Department of Biology, Queen's University (Kingston)

 

Collection: Biology and Medicine

 
90 Zoology 112 (2009) 161168 Breathing with your belly: Abdominal exhalation, loco-ventilatory
 

Summary:  patterns during locomotion (Fife et al., 2001; Deban and Carrier, 2002). Thus, abdominal function... ZOOLOGY Zoology 112 (2009) 161­168 Breathing with your belly: Abdominal exhalation, loco... , the contribution of abdominal hypaxial muscles to resting and locomotor ventilation is little understood in mammals

  

Source: Reilly, Stephen M. - Department of Biological Sciences, Ohio University

 

Collection: Environmental Sciences and Ecology

 
91 Research Focus Tinker where the tinkering's good
 

Summary:  evolution in Drosophila santomea supports this notion. Multiple mutations that disrupt an abdominal enhancer... genes and mutations remains a massive challenge. Now Jeong et al. [8] have added an important piece... separate times (Figure 1). Pale abdomens lack tan Drosophila abdominal pigmentation patterns vary among

  

Source: Rockman, Matthew - Center for Genomics and Systems Biology & Department of Biology, New York University

 

Collection: Biotechnology ; Biology and Medicine

 
92 Source Edizioni Empira (Revista de Metodologa de Ciencias Sociales) n 13 Date juin 2007
 

Summary:  investigación de Halbwachs sobre la proporción de los sexos al nacer) ; por último, una sección dedicada a sus... al respecto. Ciertamente, Maurice Halbwachs es mucho más conocido por sus aportaciones a la... al cálculo de probabilidades. Su tesis complementaria de doctorado, (1912, en la Facultad de ...

  

Source: École Normale Supérieure, Département d'Etudes Cognitives, Group for Neural Theory

 

Collection: Biology and Medicine

 
93 Comparison of abdominal aortic hemodynamics between men and women at rest and during lower
 

Summary:  Comparison of abdominal aortic hemodynamics between men and women at rest and during lower limb... in the localization of atherosclerosis in the abdominal aorta. However, the hemodynamics of men and women have... stress at the supraceliac and infrarenal levels of the abdominal aorta of young healthy men and women

  

Source: Taylor, Charles A. - Department of Bioengineering, Stanford University

 

Collection: Biology and Medicine

 
94 Evolution in black and white: genetic control of pigment patterns in
 

Summary:  patterning in adult abdominal segments of Drosophila. Dev. Biol. 242, 15­30 12 Kopp, A. et al. (1997... . Drosophila Information Service 53, 166 59 Gibert, P. et al. (1999) Phenotypic plasticity of abdominal... ) of each abdominal segment (Fig. 1b; arrow). These bands, which give flies ...

  

Source: Kopp, Artyom - Section of Evolution and Ecology, University of California, Davis

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
95 Simulation of ultrasonic focus aberration and correction through human tissue
 

Summary:  of ultrasonic pulses through cross-sectional models of human abdominal wall and breast. Propagation calculations... indicate, consistent with measurements, that breast causes greater focus degradation than abdominal wall... has recently become feasible.1­3 Computations of wavefront distortion produced by human abdominal wall

  

Source: Mast, T. Douglas - Department of Biomedical Engineering, University of Cincinnati

 

Collection: Biology and Medicine ; Engineering

 
96 Naturwissenschaften (2003) 90:121126 DOI 10.1007/s00114-003-0402-y
 

Summary:  the abdominal sternites and tergites synthesize hydrocarbons (Gu et al. 1995). Hydrocarbons are then loaded... are produced by the abdominal integument of B. germanica (Gu et al. 1995), and we now demonstrate... by enzymatically dissociated oenocytes of the abdominal integument of the ...

  

Source: Schal, Coby - Department of Entomology, North Carolina State University

 

Collection: Biology and Medicine

 
97 Robot-based tele-echography: Clinical evaluation of the TER system in
 

Summary:  Robot-based tele-echography: Clinical evaluation of the TER system in abdominal aortic exploration... conditions, the feasibility and the reliability of TER in detecting abdominal aortic and iliac aneurysms... : The TER system is a reliable, acceptable, and effective robot-based system to perform remote abdominal

  

Source: Ecole Polytechnique, Centre de mathématiques

 

Collection: Mathematics

 
98 2004 The Society for the Study of Evolution. All rights reserved. Evolution, 58(3), 2004, pp. 587596
 

Summary:  , but these species do exhibit sexual dimorphism in abdominal pigmentation (Kopp et al. 2000). In marked contrast... , ebony, optomotor blind, Abdominal B, and Dopa decarbox- ylase--affect pigmentation (True et al. 1999... al. (2003) examined variation in abdominal ...

  

Source: Bi, Xin - Department of Biology, University of Rochester

 

Collection: Biology and Medicine

 
99 Anteroposterior Patterning in Adult Abdominal Segments of Drosophila
 

Summary:  in abdominal histoblasts (Kopp et al., 1997; Kopp and Duncan, 1997; and unpublished data). In some cases, we... expresses GAL4 uniformly in abdominal histoblasts (not shown); hs-FLP122 (Zecca et al., 1995), Tub 1 y hh... patterns (Kopp et al., 1999). Abdominal ...

  

Source: Kopp, Artyom - Section of Evolution and Ecology, University of California, Davis

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
100 Inferior vena caval hemodynamics quantified in vivo at rest and during cycling exercise using magnetic resonance imaging
 

Summary:  1167, 2003. First published December 5, 2002; 10.1152/ajpheart.00641.2002.--Compared with the abdominal... alter the hemodynamic environment in the abdominal aorta (15­17, 22, 27, 28); however, no similar... arteries, and abdominal aorta (2, 8, 14, 33). Ad- ditionally, it has been shown that lower limb exercise

  

Source: Taylor, Charles A. - Department of Bioengineering, Stanford University

 

Collection: Biology and Medicine


Page:   1  2  3  4  5