| Sample search results for: abdominal muscles |
| 1 | Objectives: The Muscular System Learn major groupings of Skeletal | ||
|
Summary: external abdominal oblique internal abdominal oblique transverse abdominal rectus abdominis Muscles... Posterior #12;4 11-19 Muscles of Abdominal Wall · 4 layers of muscle in the abdominal wall ·Inguinal canal... ... |
|||
|
Source: Morrell, Thomas E. - Department of Biology, Ball State University |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 2 | Objectives: The Muscular System Learn major groupings of Skeletal | ||
|
Summary: , laterally flexes the neck and rotates face in opposite direction Digastric 11-17 Muscles of Abdominal Wall... oriented external & internal obliques and transverses abdominis Rectus sheath 11-18 Muscles of Abdominal... Wall · 4 layers of muscle in the ... |
|||
|
Source: Morrell, Thomas E. - Department of Biology, Ball State University |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 3 | REMOVAL OF ABDOMINAL WALL FOR 3D VISUALIZATION AND SEGMENTATION OF ORGANS IN CT VOLUME | ||
|
Summary: , the existence of the abdominal wall which consists of skin, fat, muscle and bones prevents the viewer from... REMOVAL OF ABDOMINAL WALL FOR 3D VISUALIZATION AND SEGMENTATION OF ORGANS IN CT VOLUME Feng DING... Medical Drive, Singapore 117597 ABSTRACT 3D visualization and segmentation of organs in abdominal ... |
|||
|
Source: Leow, Wee Kheng - Department of Computational Science, National University of Singapore |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 4 | Pilates and Pregnancy To exercise safely in pregnancy, you should be able to perform an effective pelvic floor and deep | ||
|
Summary: . If you cannot contract your pelvic floor or deep abdominal muscles effectively, more advanced exercises... muscle groups. Avoid abdominal crunches and curls Avoid abdominal crunches and curls throughout pregnancy... quality deep abdominal contractions will be ... |
|||
|
Source: Williamson, Jane - Department of Biological Sciences, Macquarie University |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 5 | Human Anatomy Biol 253 4 basic types | ||
|
Summary: connective - extracellular matrix muscle - contractile nervous - conductive Epithelial simple squamous... dense connective tissue regular irregular elastic cartilage hyaline elastic fibrous bone blood Muscle... Cavities dorsal (craniovertebral) thoracic abdominal pelvic Surface regions cranial = head: nasal, orbital |
|||
|
Source: Houde, Peter - Department of Biology, New Mexico State University |
|||
|
Collection: Biology and Medicine |
|||
| 6 | The effect of abdominal wall morphology on ultrasonic pulse distortion. Part I. Measurements | ||
|
Summary: abdominal wall.3,6,7 In the study reported in Ref. 6, pork fat and a combination of pork fat and muscle were... of the muscle and fat layers of the abdominal wall on ultrasonic pulses. The purpose of this study... in the abdominal wall includes extensive sheets known as fasciae that ... |
|||
|
Source: Mast, T. Douglas - Department of Biomedical Engineering, University of Cincinnati |
|||
|
Collection: Biology and Medicine ; Engineering |
|||
| 7 | Abdominal Muscle Function in Ventilation and Locomotion in New World Opossums and Basal | ||
|
Summary: Abdominal Muscle Function in Ventilation and Locomotion in New World Opossums and Basal Eutherians... understand- ing of the evolution of mammalian abdominal muscle function and loco-ventilatory integration we... and insectivore. These new data reveal 1) that continuous abdominal ... |
|||
|
Source: Reilly, Stephen M. - Department of Biological Sciences, Ohio University |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 8 | Development 113, 103-118(1991) Printed in Great Britain The Company of Biologists Limited 1991 | ||
|
Summary: in Drosophila 105 Results Pattern of adult abdominal muscles The adult abdominal muscles of Drosophila consist... stages causes specific ablations of elements of the adult abdominal muscle pattern Treatment... 1, we present a summary of these findings. Deletions in ... |
|||
|
Source: Broadie, Kendal S. - Department of Biological Sciences, Vanderbilt University |
|||
|
Collection: Biology and Medicine |
|||
| 9 | Time to Failure: A Stochastic Model of the Formation and Development of Abdominal Aortic Aneurysms | ||
|
Summary: Time to Failure: A Stochastic Model of the Formation and Development of Abdominal Aortic Aneurysms... : A Stochastic Model of the Formation and Development of Abdominal AorOctober 24 2009 1 / 34 #12;The Aorta Four... and Development of Abdominal AorOctober 24 2009 2 / 34 #12;Aortic Function · Pump blood into peripherial vessels |
|||
|
Source: Karsai, Istvan - Department of Biological Sciences, East Tennessee State University |
|||
|
Collection: Biology and Medicine |
|||
| 10 | 36 W.A. LAFRAMBOISE ET AL.JOURNAL OF EXPERIMENTAL ZOOLOGY 286:3648 (2000) 2000 WILEY-LISS, INC. | ||
|
Summary: - cial abdominal extensor muscles are innervated by tonic excitatory motoneurons. High resolution SDS... -PAGE revealed that these two muscles express the same MyHC profile. In contrast, the deep abdominal extensor... ., '98). The walking leg opener and superficial abdominal ... |
|||
|
Source: Cooper, Robin L. - Department of Biology, University of Kentucky |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 11 | A Physiological Torso Model for Realistic Breathing Simulation | ||
|
Summary: of 40 frames per second, a full breath takes 200 frames. Some muscles, such as the abdominals... , a deformable belly, and muscles. This results in a model with two independent breathing systems, namely ab... been done on the simulation of muscles, al- though more on the deformation than on the way they ... |
|||
|
Source: Veltkamp, Remco - Department of Information and Computing Sciences, Universiteit Utrecht |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 12 | Effects of Abdominal Wall Morphology on Ultrasonic Pulse Distortion Laura M. Hinkelman', T. Douglas Mast', Michael J. O d , and RobertC. Waag13 | ||
|
Summary: of the individualdistortions combined. simulated using whole abdominal wall specimens, muscle Representative arrival time... Effects of Abdominal Wall Morphology on Ultrasonic Pulse Distortion Laura M. Hinkelman', T. Douglas... and m w k m e r , and the taotpl dlstortian pm- duced by the abdominal wall h uot ... |
|||
|
Source: Mast, T. Douglas - Department of Biomedical Engineering, University of Cincinnati |
|||
|
Collection: Biology and Medicine ; Engineering |
|||
| 13 | Eyestalk Ablation Has Little Effect on Actin and Myosin Heavy Chain Gene Expression in Adult | ||
|
Summary: with a 26-gauge needle. Muscles from the dimorphic cutter and crusher claws, and from the deep-abdominal... since eyestalk ablation, only actin message expressed in the deep- abdominal flexor muscles changed... - expression was more prominent for the cutter and crusher claw muscles, but ... |
|||
|
Source: Medler, Scott - Department of Biological Sciences, State University of New York at Buffalo |
|||
|
Collection: Biology and Medicine |
|||
| 14 | 321J. exp. Biol. 174, 321342 (1993) Printed in Great Britain The Company of Biologists Limited 1993 | ||
|
Summary: opener muscle and the associated abdominal ganglia containing the central pattern generator that drives... . It maintained the ventral opener muscle innervation from the terminal abdominal ganglion and the normal... abdominal ganglion which project to the ventral opener ... |
|||
|
Source: Belanger, Jim H. - Department of Biology, West Virginia University |
|||
|
Collection: Biology and Medicine |
|||
| 15 | 1) Which of the following muscles is most involved in typing? A) flexor digitorum longus | ||
|
Summary: described as which of the following? A) components of the quadriceps group B) muscles of the abdominal wall... 1) Which of the following muscles is most involved in typing? A) flexor digitorum longus B) flexor... digitorum brevis C) flexor digitorum superficialis D) flexor digitorum profundus E) all of the above ... |
|||
|
Source: Houde, Peter - Department of Biology, New Mexico State University |
|||
|
Collection: Biology and Medicine |
|||
| 16 | The effect of abdominal wall morphology on ultrasonic pulse distortion. Part II. Simulations | ||
|
Summary: of ultrasonic pulses through the fat and muscle layers of the abdominal wall was simulated in two dimensions... muscle from the same abdominal wall specimen. An aponeurosis, which does not extend through the entire... -difference method for whole abdominal wall cross sections, ... |
|||
|
Source: Mast, T. Douglas - Department of Biomedical Engineering, University of Cincinnati |
|||
|
Collection: Biology and Medicine ; Engineering |
|||
| 17 | The hypaxial muscles of terrestrial vertebrates are known to function in both lung ventilation and locomotion. A costal | ||
|
Summary: movements, but the abdominal oblique muscles appear to adopt solely a postural function during arm movements... ) that the internal and external abdominal oblique muscles performed primarily locomotor functions during running yet... in the thoracic and abdominal external oblique, internal ... |
|||
|
Source: Deban, Stephen M. - Department of Integrative Biology, University of South Florida |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 18 | Bilaterally Symmetrical Respiratory Activity during Lateralized Birdsong | ||
|
Summary: abdominal muscles and vocal output. Activity of expiratory muscles was always present on both sides... of the abdominal muscles. The bipartite nature of the songbird syrinx, with its ipsilateral innervation... of the air sacs through contraction of the abdominal and ... |
|||
|
Source: Suthers, Roderick A. - Medical Sciences Program & Department of Biology, Indiana University |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 19 | Introduction The mid-18th Century saw the beginning of 40years of | ||
|
Summary: muscles (M. gracilis minor, M. abdominal crenator, M. sphincter ani cloacalis, M. cutaneous dorsi) may... rhythmically, driven by spinal motor center stimulation of the muscle fibers (Flindt, 1966) via cholinergic... synapses (Greber and Schipp, 1986). The fibers seem to be modified skeletal muscle fibers, ... |
|||
|
Source: Hedrick, Michael S. - Department of Biological Sciences, California State University, East Bay |
|||
|
Collection: Biology and Medicine |
|||
| 20 | ABSTRACT: We present a model preparation, the crayfish, to investigate chronic stimulation effects in muscle fiber type and neuronal conversion | ||
|
Summary: inner- vate distinctly different muscles in crayfish, the claw closer and the abdominal extensor muscles... ) Myographic recordings of the crayfish abdominal muscles during voluntary movement without stimulation. (C... . Atwood HL, Parnas I: Recording from the crayfish ... |
|||
|
Source: Cooper, Robin L. - Department of Biology, University of Kentucky |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 21 | CIP ... Colonic Manometry Pediatric and Adolescent | ||
|
Summary: occurs when the movement of food is coordinated by the nerves and muscles that are part of the digestive... tract. What are some of the problems that may occur in gastrointestinal motility? · Nerves and muscles... . · Vomiting occurs when stomach and intestine muscle contractions are uncoordinated. · Constipation results |
|||
|
Source: Louisiana State University Health Sciences Center in New Orleans, Department of Biochemistry and Molecular Biology |
|||
|
Collection: Biology and Medicine |
|||
| 22 | CIP ... Colonic Manometry Pediatric and Adolescent | ||
|
Summary: occurs when the movement of food is coordinated by the nerves and muscles that are part of the digestive... tract. What are some of the problems that may occur in gastrointestinal motility? · Nerves and muscles... . · Vomiting occurs when stomach and intestine muscle contractions are uncoordinated. · Constipation results |
|||
|
Source: Louisiana State University Health Sciences Center in New Orleans, Department of Biochemistry and Molecular Biology |
|||
|
Collection: Biology and Medicine |
|||
| 23 | Zoology 112 (2009) 161168 Breathing with your belly: Abdominal exhalation, loco-ventilatory | ||
|
Summary: , the contribution of abdominal hypaxial muscles to resting and locomotor ventilation is little understood in mammals... that all of the abdominal hypaxial muscles actively contribute to both resting and locomotory ventilation... exhale by firing the abdominal hypaxial ... |
|||
|
Source: Reilly, Stephen M. - Department of Biological Sciences, Ohio University |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 24 | UNITED STATES DEPARTMENT OF THE INTERIOR, Fred A. Seaton,.Secretary FISH AND WILDLIFE SERVICE, Arnie J. Suomela, Commissioner | ||
|
Summary: ~' of the cnll1mercifill~' important white shrimp of the Gulf of ",lexico the muscle, nen-ous, circulatory... decapod crustllceans, The major porthill nf the cOlUpllrative work deals with the muscles. since... the muscle s~'stelUs of a few Decallnc1a have been reported in much greater detail than othel'systellls. 1 |
|||
|
Source: National Oceanic and Atmospheric Administration (NOAA), Fishery Bulletin |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 25 | Muscles of Head (and Neck, in part) muscles of facial expression | ||
|
Summary: intercostal innermost intercostal (deepest) muscles of abdominal wall rectus abdominus (most superficial... Muscles of Head (and Neck, in part) muscles of facial expression occipitofrontalis, galea... oris,zygomaticus major and minor, nasalis, auricularis, buccinator muscles of orbit 4 ... |
|||
|
Source: Houde, Peter - Department of Biology, New Mexico State University |
|||
|
Collection: Biology and Medicine |
|||
| 26 | J Comp Physiol A (2007) 193:11011113 DOI 10.1007/s00359-007-0261-7 | ||
|
Summary: structural study of the abdominal muscle recep- tor organs of the crayWsh (Procambarus clarkii). Fast... :227240 Parnas I, Atwood HL (1966) Phasic and tonic neuromuscular systems in the abdominal extensor muscles... J Comp Physiol A (2007) 193:11011113 DOI 10.1007/s00359-007-0261-7 123 ORIGINAL PAPER ... |
|||
|
Source: Hooper, Scott - Department of Biological Sciences, Ohio University |
|||
|
Collection: Biology and Medicine |
|||
| 27 | Z .Comparative Biochemistry and Physiology Part B 128 2001 377 378 Erratum to ``The effects of 5-HT on sensory, central and | ||
|
Summary: of 5-HT on sensory, central and motor neurons driving the abdominal superficial flexor muscles... contained within the second root of the 2nd abdominal segment. Extracellular recording illustrates |
|||
|
Source: Cooper, Robin L. - Department of Biology, University of Kentucky |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 28 | Movement of oxygen from the atmosphere to the mitochondria occurs via several convective and diffusive steps | ||
|
Summary: muscles, and costal ventilation requires bilateral recruitment of the same hypaxial muscles. This conflict... for hemodynamics. Locomotion may elevate intra-abdominal pressure as a result of the activity of the hypaxial... muscles that are recruited both during locomotion and ventilation (Carrier, 1990; ... |
|||
|
Source: Bennett, Albert F. - Ecology and Evolutionary Biology Department, University of California, Irvine |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 29 | Forces generated by both skeletal and cardiac muscle depend strongly upon muscle length. The in vivo range of lengths is | ||
|
Summary: 2455 Forces generated by both skeletal and cardiac muscle depend strongly upon muscle length... . The in vivo range of lengths is therefore a critical determinant of muscle performance. On the classic... complete overlap of the thick and thin filaments. In locomotor muscles, length changes could straddle |
|||
|
Source: Daniel, Tom - Department of Biology, University of Washington at Seattle |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 30 | ABSTRACTABSTRACT The role of DNA in cells is to carry a code that can beThe role of DNA in cells is to carry a code that can be | ||
|
Summary: to function properly.them that enables tissues and organs to function properly. Muscle cellsMuscle cells'' DNA... tailshakertailshaker muscles suggest the presence ofmuscles suggest the presence of ``superfastsuperfast'' myosin... of ``superfastsuperfast'' myosin in the songbird syringeal muscles ... |
|||
|
Source: Trask, Barbara Crippes - Department of Zoology, Weber State University |
|||
|
Collection: Biology and Medicine |
|||
| 31 | Acta Zoologica (Stockholm) 81: 285292 (October 2000) 2000The Royal swedish Academy of Sciences 285 | ||
|
Summary: skeletal muscle (M68). In Odonata and Plecoptera, the dorsal vessel ends in the 9th abdominal segment... 285 Abstract Gereben-Krenn, B.-A. and G. Pass 2000. Circulatory organs of abdominal appendages... : 285292 The abdominal circulatory organs and the haemolymph supply of the terminal filament |
|||
|
Source: Pass, Günther - Department für Evolutionsbiologie, Fakultät für Lebenswissenschaften, Universität Wien |
|||
|
Collection: Biology and Medicine |
|||
| 32 | Hypaxial Motor Patterns and the Function of Epipubic Bones in | ||
|
Summary: of the associated abdominal muscles of monotremes and marsupial mammals have remained unresolved. We show that each... have four abdominal hypax- ial muscle layers (Fig. 1): two obliquely crossing layers (internal... , presum- ably by the epaxial muscles with a possible contribution from ... |
|||
|
Source: Reilly, Stephen M. - Department of Biological Sciences, Ohio University |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 33 | Functional model of the diaphragm for computer assisted medical interventions | ||
|
Summary: model of the diaphragm muscle based on a discrete biomechanical model. In this model soft tissues... or interaction forces. Muscles are elastic bodies where explicit directions are used by an activation function... D diaphragm model was built according to anatomical references (shape, muscle attachments, fiber |
|||
|
Source: Promayon, Emmanuel - TIMC-IMAG Laboratory, Université Joseph Fourier |
|||
|
Collection: Biology and Medicine |
|||
| 34 | OFFICE USE ONLY Department of Campus Recreation | ||
|
Summary: and endurance, flexibility and muscle imbalances, cardiovascular endurance, blood pressure, height, weight... is the capacity of a muscle to repeatedly exert force over an extended period of time. This will be assessed... by how many push-ups are performed in one minute. In addition, abdominal muscular endurance |
|||
|
Source: Saidak, Filip - Department of Mathematical Sciences, University of North Carolina, Greensboro |
|||
|
Collection: Mathematics |
|||
| 35 | Core Stability and Its Relationship to Lower | ||
|
Summary: ), and hip and trunk muscle stiff- ness. The contribution of intra- abdominal pressure to core stability... is generally considered to be a con- sequence of abdominal muscle ac- tivity. Although this assumption... without abdominal muscle activity. Specifically, ... |
|||
|
Source: Davis, Irene McClay - Department of Physical Therapy, University of Delaware |
|||
|
Collection: Biology and Medicine |
|||
| 36 | Trunk muscle recruitment patterns in specific chronic low back pain populations | ||
|
Summary: higher acti- vation levels of the external oblique and rectus abdominus muscles and lower abdominal... and extensor muscle activity was completed using submaximal isometric con- tractions. Each abdominal group... resisted abdominal crunch or crunch with rotation. Extensor ... |
|||
|
Source: Karduna, Andrew - Department of Human Physiology, University of Oregon |
|||
|
Collection: Biology and Medicine |
|||
| 37 | International Journal of Industrial Ergonomics 37 (2007) 825831 Modification of an EMG-assisted biomechanical model for | ||
|
Summary: . These results suggest that the external oblique muscle should have the same moment arms as the abdominals... in the torso muscles expected during pushing and pulling compared to lifting tasks. The objective of this study... modifications were made. Based upon a literature review, changes in muscle ... |
|||
|
Source: Ohio State University, Department of Industrial, Welding, and Systems Engineering, Biodynamics Laboratories |
|||
|
Collection: Engineering ; Biology and Medicine |
|||
| 38 | Comparative Biochemistry and Physiology Part A 120 (1998) 289300 Differential effects of a molting hormone, 20-hydroxyecdysone, on the | ||
|
Summary: at the neuromuscular junction of the dactyl opener muscle and the abdominal phasic flexor muscle of intermolt lobsters... ) from the claw opener muscle and EJPs from the abdominal flexor muscle and now present evidence that 20... -HE enhances EJPs in the opener ... |
|||
|
Source: Cromarty, Stuart I. - Department of Natural Sciences, Assumption College |
|||
|
Collection: Biology and Medicine |
|||
| 39 | Somatosensory feedback modulates the respiratory motor program of crystallized birdsong | ||
|
Summary: a compensatory reduction in the electrical activity of the abdominal expiratory muscles, both in hearing... for birdsong includes activation of the abdominal expiratory muscles, which power the airflow, necessary... .025 mm diameter, insulated except at the tip) were implanted in the ... |
|||
|
Source: Suthers, Roderick A. - Medical Sciences Program & Department of Biology, Indiana University |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 40 | Practice Exam III -SPSS Experimental Methods | ||
|
Summary: injuries according to the strength of various muscle groups. An injury index is based on the number... and severity of injuries. Muscle groups include "quads", "gluts", "abs", and "arms". Use SPSS, the Lesson 33... . Running a multiple regression with all predictors shows that abdominals have the lowest semi |
|||
|
Source: Brady, Mark - Department of Psychology, North Dakota State University |
|||
|
Collection: Biology and Medicine ; Engineering |
|||
| 41 | Biology 253 Human Anatomy Exam II Fall 2010 page 1 of 8 IMPORTANT INSTRUCTIONS: ANSWER ONLY 50 QUESTIONS. Do not answer more than 50 questions. If | ||
|
Summary: ) pectoralis minor E) external abdominal oblique 30) Which of the following muscles has the most distal origin... ; don't just leave it blank 1) Identify the INCORRECT statement regarding the triceps muscle. A) its... long head separates the teres major and minor muscles B) it inserts on the olecranon process ... |
|||
|
Source: Houde, Peter - Department of Biology, New Mexico State University |
|||
|
Collection: Biology and Medicine |
|||
| 42 | Peptides 23 (2002) 17511757 Differential effects of neuropeptides on circular and | ||
|
Summary: muscles of the crayfish hindgut A.J. Mercier, J. Lee Department of Biological Sciences, Brock University... the peptides affect both longitudinal and circular muscles, hindguts were cut into longitudinal strips... that neuropeptides have different effects on circular and longitudinal muscles of hindgut. © 2002 Elsevier Science |
|||
|
Source: Cooper, Robin L. - Department of Biology, University of Kentucky |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 43 | Postural reactions of the trunk muscles to multi-directional perturbations in sitting Kei Masani a,b,*, Vivian W. Sin a | ||
|
Summary: above resting levels by at about 13% of the MVC for the abdominal muscles, and 46% for the back... roughly explicable by differences be- tween the abdominal muscles (13% MVC) and those of the back (4... .358, and no significant interaction be- tween muscle and side: P = 0.393) (Fig. ... |
|||
|
Source: Popovic, Milos R. - Institute of Biomaterials and Biomedical Engineering, University of Toronto |
|||
|
Collection: Engineering ; Biology and Medicine |
|||
| 44 | Myosin heavy chain isoform expression in rat smooth muscle development | ||
|
Summary: visceral smooth muscle tissue taken from abdominal cavity. A: RNase protection analysis of total RNA from... of fetal development in RNA isolated from smooth muscle obtained from whole abdominal viscera (Fig. 2A... Myosin heavy chain isoform expression in rat smooth muscle development ... |
|||
|
Source: White, Sheryl - Department of Anatomy and Neurobiology, University of Vermont |
|||
|
Collection: Biology and Medicine |
|||
| 45 | Autonomic Nervous System and Visceral Reflexes | ||
|
Summary: , cardiac muscle, and smooth muscle · Maintains homeostasis · Primary organs of the ANS · viscera... of thoracic and abdominal cavities · some structures of the body wall cutaneous blood vessels sweat glands... piloerector muscles · carries out actions involuntarily no intent/awareness · ... |
|||
|
Source: Morrell, Thomas E. - Department of Biology, Ball State University |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 46 | Turbo Kick TM: Awesome music paired with movement patterns, combinations and techniques specific to the ancient sport of Muay Thai Boxing. The ultimate cardiovascular challenge complete with a sport specific warm-up, easy to follow combos, kickboxing spec | ||
|
Summary: and tone the core muscles. All major muscles of the abdominals and lower back working to develop a hard... the major muscle groups for a full body workout. Let us guide you in your goal to create strong, toned... muscles.... Just Lift! (All levels) CARDIO & STRENGTH MIX Flexible ... |
|||
|
Source: Peterson, Blake R. - Department of Medicinal Chemistry, University of Kansas |
|||
|
Collection: Chemistry |
|||
| 47 | INTRODUCTION Developmental neurobiologists working on insect model | ||
|
Summary: muscle contacts for every thoracic and abdominal motoneuron at stage 17. We define the parental... , they either die or acquire functions independent of leg muscle innervation in abdominal segments. (B... on muscle 5. The NB 3-3-derived motoneuron forms only in ... |
|||
|
Source: Doe, Chris - Institute of Neuroscience & Department of Biology, University of Oregon |
|||
|
Collection: Biology and Medicine |
|||
| 48 | SUPPLEMENTARY MATERIAL Integration of Insulin Receptor/FOXO signaling and dMyc activity during | ||
|
Summary: , C,C'), and body wall muscles VI1 of the first abdominal segment and of thoracic segments (M, C... muscle growth regulates body size in Drosophila. Fabio Demontis and Norbert Perrimon #12;2 SUPPLEMENTARY... signaling and dMyc function are required for muscle growth. Body wall muscles ... |
|||
|
Source: Higgins, Darren - Department of Microbiology and Molecular Genetics, Harvard University |
|||
|
Collection: Biology and Medicine |
|||
| 49 | Inspiratory Muscle Activity during Bird Song J. M. Wild,* F. Goller, R. A. Suthers | ||
|
Summary: inspiratory muscle activity The expiratory muscles monitored were the abdominal might be assumed to accompany... ) Sonagram of song; Exp Å EMG activity in abdominal expiratory muscles; other abbreviations as in Figure 1... in these muscles is coincident with the end ... |
|||
|
Source: Suthers, Roderick A. - Medical Sciences Program & Department of Biology, Indiana University |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 50 | J Physiol 580.3 (2007) pp 961975 961 Pharmacological dissection of the human gastro- | ||
|
Summary: sphincter of circular smooth-muscle fibres within the abdominal oesophagus. Our aims were to separate... muscle fibres of the abdominal oesophagus (Christensen, 1975, 1987). Liebermann-Meffert et al. (1979... -oesophageal sphincter. One argument places the intrinsic component within the circular ... |
|||
|
Source: Brasseur, James G. - Department of Mechanical and Nuclear Engineering, Pennsylvania State University |
|||
|
Collection: Engineering |
|||
| 51 | JOURNAL OF MORPHOLOGY 191:l-15(1987) Distributionand Innervationof Short, lnterdigitated Muscle Fibers | ||
|
Summary: a history of occa- sional reports that long, parallel muscles in such varied sites as the abdominal muscula... JOURNAL OF MORPHOLOGY 191:l-15(1987) Distributionand Innervationof Short, lnterdigitated Muscle... ,biarticular strap mus- cles composed of parallel muscle fascicles that attach to short tendons. ... |
|||
|
Source: Loeb, Gerald E. - Department of Biomedical Engineering, University of Southern California |
|||
|
Collection: Biology and Medicine ; Engineering |
|||
| 52 | Skeletal muscles exhibit considerable variability in their physiological properties, with muscle fiber type being coupled | ||
|
Summary: study, we focused on S1 and S2 fibers from the superficial abdominal muscles of the lobster as a model... abdominal flexor muscles. S1 fibers are the exclusive fiber type in the crusher claw closer and are present... studies have demonstrated that the superficial abdominal ... |
|||
|
Source: Medler, Scott - Department of Biological Sciences, State University of New York at Buffalo |
|||
|
Collection: Biology and Medicine |
|||
| 53 | for peristalsis without the longitudinal muscle layer, a tremendous benefit that may explain the existence of | ||
|
Summary: for peristalsis without the longitudinal muscle layer, a tremendous benefit that may explain... the existence of longitudinal muscle fiber in the gut. We also review what is understood of the role... of longitudinal muscle in esophageal emptying, reflux and pathology. © 2007 The WJG Press. All rights reserved |
|||
|
Source: Brasseur, James G. - Department of Mechanical and Nuclear Engineering, Pennsylvania State University |
|||
|
Collection: Engineering |
|||
| 54 | PARASITES OF BENTHIC AMPHIPODS: MICROSPORIDANS OF AMPELISCA AGASSIZI aVDD) AND SOME orHER GAMMARIDEANS | ||
|
Summary: of amphipod. A microsporidan confined to the abdominal muscles was common in most populations of A. agll8sizi... the adult male has strongly developed transverse pleosomal muscles (muscles of the first three abdominal... in abdominal muscle. ... |
|||
|
Source: National Oceanic and Atmospheric Administration (NOAA), Fishery Bulletin |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 55 | Role of local contractile activity and muscle fiber type on LPL regulation during exercise | ||
|
Summary: Role of local contractile activity and muscle fiber type on LPL regulation during exercise MARC T... of local contractile activity and muscle fiber type on LPL regula- tion during exercise. Am. J. Physiol... the influence of local contractile activity on lipopro- tein lipase (LPL) regulation in skeletal muscle. Short |
|||
|
Source: Holloway, Alisha - Center for Population Biology, University of California, Davis |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 56 | Skeletal muscles differ significantly in their contractile properties, largely because of differences in myofibrillar | ||
|
Summary: levels of the alternate MHC. By contrast, fast fibers from the deep abdominal muscle expressed fast MHC... nerves (Atwood, 1976). For example, many of the deep abdominal muscles receive only phasic motor axons... , while the more superficial abdominal muscles receive ... |
|||
|
Source: Medler, Scott - Department of Biological Sciences, State University of New York at Buffalo |
|||
|
Collection: Biology and Medicine |
|||
| 57 | Video Article Membrane Potentials, Synaptic Responses, Neuronal Circuitry, Neuromodulation | ||
|
Summary: of the membrane to specific ions. The crayfish abdominal extensor muscles are in groupings with some being tonic... characteristics. We use these muscles as well as the superficial, tonic abdominal flexor muscle to demonstrate... abdominal extensor ... |
|||
|
Source: Cooper, Robin L. - Department of Biology, University of Kentucky |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 58 | A Biomechanical Model of the Female Reproductive System and the Fetus for the realization of a Childbirth Virtual Simulator | ||
|
Summary: to provoke the delivery. Indeed, we also have to consider the action of the abdominal muscles of the mother... ) that will appear at regular intervals. The second one is the simplification of the effect of the abdominal muscles... contraction forces help the movement of the fetus, the forces generated by ... |
|||
|
Source: Zara, Florence - Laboratoire d'InfoRmatique en Image et Systèmes d'information, Université Claude Bernard (Lyon I) |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 59 | Aerobics & Yoga Class Descriptions | ||
|
Summary: abdominals, obliques, back, and hip flexors. Modifications for beginners will be provided MUSCLE ENDURANCE... strong lean muscle, and create a hard core. Cardio, strength and abdominals training for all fitness... cardio and weight training class that torches calories and builds lean ... |
|||
|
Source: Bordenstein, Seth - Department of Biological Sciences, Vanderbilt University |
|||
|
Collection: Biology and Medicine |
|||
| 60 | Autonomic Nervous System and Visceral Reflexes | ||
|
Summary: , Smooth Muscle, and Glands · viscera of thoracic and abdominal cavities · some structures of the body wall... , cardiac muscle, and smooth muscle · Maintains homeostasis · Primary organs of the ANS: Cardiac muscle... cutaneous blood vessels sweat glands piloerector ... |
|||
|
Source: Morrell, Thomas E. - Department of Biology, Ball State University |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 61 | Journal of Electromyography and Kinesiology 8 (1998) 247256 Trunk muscle activities during asymmetric twisting motions | ||
|
Summary: . The muscles most affected by the changes in posture were the erector spinae and abdominal muscles. When... internal oblique, left external oblique, and the right abdominal muscles exhibited statistically... activity. Both of the abdominal ... |
|||
|
Source: Ohio State University, Department of Industrial, Welding, and Systems Engineering, Biodynamics Laboratories |
|||
|
Collection: Engineering ; Biology and Medicine |
|||
| 62 | Comparative Biochemistry and Physiology Part A 133 (2002) 967978 1095-6433/02/$ -see front matter 2002 Elsevier Science Inc. All rights reserved. | ||
|
Summary: -dimensional shape of myomeres in teleost fishes, the lateral hypaxial muscles of salamanders are nearly planar... the importance of the mechanics of myosepta in determining the shortening characteristics of a muscle segment. We... that is greater than that produced by muscle fiber angle alone (10% muscle ... |
|||
|
Source: Brainerd, Elizabeth - Department of Ecology and Evolutionary Biology, Brown University |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 63 | INTRODUCTION Observations of neuromuscular development in Drosophila | ||
|
Summary: ., 1991). Each abdominal hemisegment (A2-A7) of the Drosophila embryo has 30 syncytial muscle fibers... regions of a segment (data not shown). Muscle defects occur primarily in abdominal segments A4/A5... is not involved in the early embryonic stages of muscle patterning of either the ... |
|||
|
Source: Broadie, Kendal S. - Department of Biological Sciences, Vanderbilt University |
|||
|
Collection: Biology and Medicine |
|||
| 64 | A Musical Instrument Based on a Bioacoustic Model of a Cicada Tamara Smyth, Julius O. Smith | ||
|
Summary: for the abdominal air sac. There is also an object in the model that implements the rather unique excitation... 's characteristic loud tone by con verting the energy of an extremely fast contracting muscle to sound energy... figure 2) under the force of a contracting muscle (Fletcher 1992). Once the first rib buckles, the ... |
|||
|
Source: Smyth, Tamara - School of Computing Science, Simon Fraser University |
|||
|
Collection: Engineering |
|||
| 65 | A Musical Instrument Based on a Bioacoustic Model of a Cicada Tamara Smyth, Julius O. Smith | ||
|
Summary: for the abdominal air sac. There is also an object in the model that implements the rather unique excitation... 's characteristic loud tone by con- verting the energy of an extremely fast contracting muscle to sound energy... figure 2) under the force of a contracting muscle (Fletcher 1992). Once the first rib buckles, the tymbal |
|||
|
Source: Smyth, Tamara - School of Computing Science, Simon Fraser University |
|||
|
Collection: Engineering |
|||
| 66 | Elec 331 -Minimally Invasive Surgery Minimally Invasive Surgery | ||
|
Summary: intestine No known function Inflamed · Surgery Removal Hernia · Hernia Weakened abdominal wall... (muscle) Intestine protrudes through abdomen Visible bulge · Surgery Retract intestine Sew... abdominal wall #12;Elec 331 - Minimally Invasive Surgery 8 Gallbladder Pre-Operative Post-Operative Stores |
|||
|
Source: Pulfrey, David L. - Department of Electrical and Computer Engineering, University of British Columbia |
|||
|
Collection: Energy Storage, Conversion and Utilization ; Engineering |
|||
| 67 | 200 ENTOMOLOGICAL NEWS A UNIQUE COLLECTION OF TWO | ||
|
Summary: . alaskanus specimens were taken alive to the lab, killed in 70% ethanol and then the abdominal cavity... collected in early June, we discovered two specimens of Rhantus wallisi (Hatch) in the abdominal cavity... of the female D. alaskanus. The internal organs of the D. alaskanus female were gone except for a few muscle |
|||
|
Source: Aiken, Ron - Biology Department, Mount Allison University |
|||
|
Collection: Biology and Medicine |
|||
| 68 | Drosophila Primers for Quantitative RT-PCR Veronika Sander 2009 | ||
|
Summary: Twisted gastrulation GATTGGAGACATTGAAGGAGTG CATAGATCACGGTGCATAGGG 198 Msh Muscle segment homeobox... Brinker GCCAGGAAATACAACATTCAC CCGATTGCTGTGGGAGTAG 163 Abda Abdominal a CAGACCTACACTCGCTTCCAG... CGGCTCGTAACTCCTTCTTC 172 AbdB Abdominal B GCCTACAACGACGAGGGATTC CTGCGTTTCTGGGTAAGGATAG ~90 Dfd Deformed |
|||
|
Source: De Robertis, Eddy M. - Department of Biological Chemistry, University of California at Los Angeles |
|||
|
Collection: Biology and Medicine |
|||
| 69 | The cytoplasm is a complex and crowded medium consisting of soluble and bound macromolecules, fibrous | ||
|
Summary: mobility in an orientation- dependent manner in skeletal muscle. The abdominal muscles in P. argus are used... abdominal muscle. The fibers are characterized by their extreme size, which can exceed 500 µm in diameter... 3 giant fibers were isolated from the deep extensor ... |
|||
|
Source: Kinsey, Stephen - Department of Biology and Marine Biology, University of North Carolina at Wilmington |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 70 | -11-1I. exp. Bioi. 140, 313-324 (1988) Printed in Great Britain @ The Company of Biologists Limited 1988 | ||
|
Summary: 1988 ACTIVATION OF MULTIPLY INNERVATED FAST AND SLOW MYOTOMAL MUSCLE FIBRES OF THE TELEOST MYOXOCEPHALU... and Preclinical Medicine, St Andrews Universitv. St Andrews. Fife KY16 8LB Accepted 4 May 1988 Summary A nerve-muscle... muscle fibres to stimulation of the spinal nerves. There was no significant difference between resting |
|||
|
Source: Johnston, Ian A. - Gatty Marine Laboratory, School of Biology, University of St Andrews |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 71 | JOURNAL OF EXPERIMENTAL ZOOLOGY 287:353377 (2000) 2000 WILEY-LISS, INC. | ||
|
Summary: and Wiersma (1963. J Morph 113:453587). The arrangement of these muscles varies de- pending on the abdominal... muscle (DMA) and the superficial extensor muscle accessory head (SEAcc) for each abdominal segment... the ventral surface of the deep abdominal extensor ... |
|||
|
Source: Cooper, Robin L. - Department of Biology, University of Kentucky |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 72 | Determinants of intrabolus pressure during esophageal peristaltic bolus transport | ||
|
Summary: - cordingsin supinenormal volunteersusingdifferent bolusvol- umesand viscositiesand abdominal compression... that results from the aborad sequence of esophageal muscle contraction and relaxation. Quanti- fiable... strawberry syrup (13)]. Bolusvolumesof 2,5, 10, or 20ml were usedin a randomsequence.During someswallows,abdominal |
|||
|
Source: Brasseur, James G. - Department of Mechanical and Nuclear Engineering, Pennsylvania State University |
|||
|
Collection: Engineering |
|||
| 73 | Pediatric and Adolescent Gastrointestinal Motility & Pain Program | ||
|
Summary: cramp, functional abdominal pain is a symptom that falls within the expected range of behaviors... or inflammation. There are several pediatric functional gastrointestinal disorders associated with abdominal pain... old enough to give accurate pain histories may have the same functional abdominal pain disorders |
|||
|
Source: Louisiana State University Health Sciences Center in New Orleans, Department of Biochemistry and Molecular Biology |
|||
|
Collection: Biology and Medicine |
|||
| 74 | INSECT FLIGHT CONTROL BY NEURAL STIMULATION OF PUPAE-IMPLANTED FLEXIBLE | ||
|
Summary: into the muscle of pupae, to control the wing motion of the moth Manduca sexta, leading to rudimentary turning... into the muscle of adult beetles to enable flight control [2]. In this work, we have developed a flexible... and directly interface with the CNS of the moth (rather than muscle). CNS- based flight control is likely |
|||
|
Source: Voldman, Joel - Research Laboratory of Electronics & Department of Electrical Engineering and Computer Science, Massachusetts Institute of Technology (MIT) |
|||
|
Collection: Engineering |
|||
| 75 | 10 B. GRIFFIS ET AL.JOURNAL OF EXPERIMENTAL ZOOLOGY 289:1022 (2001) 2001 WILEY-LISS, INC. | ||
|
Summary: of the abdominal flexor muscles of the Norway lobster Ne- phrops norvegicus. J Exp Biol 183:185201. Nose A... 10 B. GRIFFIS ET AL.JOURNAL OF EXPERIMENTAL ZOOLOGY 289:1022 (2001) © 2001 WILEY-LISS, INC. Muscle... Loss of chelipeds in crustaceans results in severe atrophy of the major muscle responsible ... |
|||
|
Source: Cooper, Robin L. - Department of Biology, University of Kentucky |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 76 | APPLICATIONS OF BIOACOUSTICS IN PHYSICAL MODELING AND THE CREATION OF NEW MUSICAL | ||
|
Summary: The transduction from muscle energy to sound energy, in the cicada, is a 2 stage process, involving both a primary... and secondary resonator [1]: the tymbal, and the abdominal air sac, respectively. #12; The Buckling Tymbal... Muscle power drives a small mechanical resonator, the tymbal, which acts as a frequency |
|||
|
Source: Smyth, Tamara - School of Computing Science, Simon Fraser University |
|||
|
Collection: Engineering |
|||
| 77 | APPLICATIONS OF BIOACOUSTICS IN PHYSICAL MODELING AND THE CREATION OF NEW MUSICAL | ||
|
Summary: and secondary resonator [1]: the tymbal, and the abdominal air sac, respectively. #12;The Buckling Tymbal Muscle... The transduction from muscle energy to sound energy, in the cicada, is a 2 stage process, involving both a primary... -multiplier by converting relatively slow movements of contracting muscles ... |
|||
|
Source: Smyth, Tamara - School of Computing Science, Simon Fraser University |
|||
|
Collection: Engineering |
|||
| 78 | Journal of Fish Biology (1998) 53, 485501 Article No. jb980722 | ||
|
Summary: as watts kg 1 wet muscle mass. MEASUREMENT OF PROTEIN AND WATER CONTENT The anterior abdominal myotomes... content. Between 200 and 500 mg of anterior abdominal muscle were placed in an oven at 60 C and re... for anterior abdominal muscle preparations isolated from ... |
|||
|
Source: Johnston, Ian A. - Gatty Marine Laboratory, School of Biology, University of St Andrews |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 79 | Is Visfatin an Adipokine or Myokine? Evidence for Greater Visfatin Expression in Skeletal Muscle than | ||
|
Summary: by EIA. Chickens were euthanized by decapitation. Skeletal muscle (pectoralis), liver, and abdominal fat... microgram of total RNA from abdominal fat pad, liver, or skel- etal muscle was reverse transcribed using... was observed in protein extracts from chicken abdominal fat pad, liver, ... |
|||
|
Source: Ramachandran, Ramesh - Department of Veterinary and Biomedical Sciences, Pennsylvania State University |
|||
|
Collection: Biology and Medicine |
|||
| 80 | Employee Assistance Report Lifestyle Tips Insert April 2010 By Tim Lencki | ||
|
Summary: : continued on Page 2 A trainer works on his abdominal muscles. UConn Health Center Employee Assistance... can do to strengthen your "core" (abdominal and back muscles) using resistance tubing. The abdominal... calories while you're working out, but kettlebell training burns ... |
|||
|
Source: Oliver, Douglas L. - Department of Neuroscience, University of Connecticut Health Center |
|||
|
Collection: Biology and Medicine |
|||
| 81 | INTRODUCTION The mouthparts of insects lend themselves well to evo- | ||
|
Summary: sensilla and one small stipes-galea muscle (Hannemann, 1956; Chauvin & Faucheux, 1981; Krenn & Kristensen... , the complexly textured galeal wall, the numerous internal muscles, the modifications of the pro- boscis tip... muscles (Kristensen, 1968; Nielsen & Kristensen, 1996). The intrinsic galeal musculature was ... |
|||
|
Source: Krenn, Harald W. - Department für Evolutionsbiologie, Fakultät für Lebenswissenschaften, Universität Wien |
|||
|
Collection: Biology and Medicine |
|||
| 82 | Paper_WC09_v6.doc Forward Modeling of Uterine EMG and MMG Contractions | ||
|
Summary: at the abdominal sur- face. We introduce a simplified geometry for the problem and solve our model in this domain... of a single myometrial smooth muscle contraction, which is initiated by depolariza- tion. The model is based... - netic field B at the abdominal surface. II. MATERIALS AND METHODS In this section we discuss |
|||
|
Source: Nehorai, Arye - Department of Electrical Engineering, Washington University in St. Louis |
|||
|
Collection: Engineering |
|||
| 83 | UNIVERSITY OF CALIFORNIA Breathing, Laughing, Sneezing, Coughing: Model and Control of an Anatomically | ||
|
Summary: .2 Muscles of the Abdominal Wall . . . . . . . . . . . . . . . . . . . . . . . 29 5.1 Control parameters... Torso Simulation Diaphragm. . . . . . . . . 25 3.8 Muscles of the Abdominal Wall... Muscles versus Torso Simulation Shoulder Muscles. 3.2 ... |
|||
|
Source: Zordan, Victor - Department of Computer Science and Engineering, University of California at Riverside |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 84 | Biol. Cell (2007) 99, 615626 (Printed in Great Britain) doi:10.1042/BC20070019 Research article | ||
|
Summary: to the UAS promoter only in the presence of RU486 (purple). (B) A third instar larvae abdominal muscle... -hand panel shows the architecture of the specific subset of muscles of the ventral internal abdominal... ) Representative images of ventral abdominal muscle ... |
|||
|
Source: Broadie, Kendal S. - Department of Biological Sciences, Vanderbilt University |
|||
|
Collection: Biology and Medicine |
|||
| 85 | Chronic Intestinal Pseudo-obstruction Pediatric and Adolescent | ||
|
Summary: intestine, and ending in the colon. The movement of food is coordinated by the nerves and muscles... that are part of the digestive tract. When food enters the gastrointestinal tract, the nerves tell the muscles... to the muscle contractions within the walls of the digestive tract and the movement of the food within |
|||
|
Source: Louisiana State University Health Sciences Center in New Orleans, Department of Biochemistry and Molecular Biology |
|||
|
Collection: Biology and Medicine |
|||
| 86 | Video Article Muscle Receptor Organs in the Crayfish Abdomen: A Student Laboratory Exercise in | ||
|
Summary: medial fibers lying parallel to the helix muscle (Figure 11). Figure 11: The schematic of an abdominal... . Fields, H.L. Crustacean abdominal and thoracic muscle receptor organs. In: Mill PJ, editor. Structure... Video Article Muscle Receptor Organs in the Crayfish Abdomen: A Student ... |
|||
|
Source: Cooper, Robin L. - Department of Biology, University of Kentucky |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 87 | Aerobic muscle function during steady swimming in fish David J Coughlin | ||
|
Summary: the red muscle. Also shown in cross-section are the abdominal cavityand the vertebral centrum. Aerobic... Aerobic muscle function during steady swimming in fish David J Coughlin Department of Biology... produc- tion, red muscle, sonomicrometry FISH and FISH E RIE S, 2002, 3, 63^78 # 2002 Blackwell Science |
|||
|
Source: Coughlin, David J. - Science Division, Widener University |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 88 | Understanding and Treating Childhood Bellyaches Pediatric and Adolescent | ||
|
Summary: defecat by purposefully contracting the pelvic floor and gluteal muscles and sq the buttocks to abdominal... and cope with abdominal pain. Every child complains about a bellyache now and then. It is not always easy... in the setting of a child with recurrent abdominal p Review the diagnostic criteria for ... |
|||
|
Source: Louisiana State University Health Sciences Center in New Orleans, Department of Biochemistry and Molecular Biology |
|||
|
Collection: Biology and Medicine |
|||
| 89 | Identity and Phylogenetic Significance of the Metapostnotum in Nonaculeate Hymenoptera | ||
|
Summary: reductions in the metapostnotum and associated muscles have occurred in the Ichneumonoidea, Chalcidoidea... - teriorly and the first abdominal tergum posteriorly (propodeum in the Apocrita), but is not completely... metathoracic longitudinal flight muscles (2ph-3ph), which attach at their anterior ends to the second phragma |
|||
|
Source: Whitfield, James B. - Department of Entomology, University of Illinois at Urbana-Champaign |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 90 | Student Recreation Center Recreational Sports & Services | ||
|
Summary: endurance while creating flatter abdominal muscles. Helps develop core body strength for everyday activites... , and muscles. Expect to become more empowered with your own health with this practice. Hatha Yoga Hatha Yoga... with 15 minutes of guided meditation. Vinyasa Yoga Awaken your senses, challenge all ... |
|||
|
Source: Southern Illinois University, Fisheries and Illinois Aquaculture Center |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 91 | Haptic Simulation of the Liver with Respiratory Motion. | ||
|
Summary: such as respiration and needle insertion. While several research groups have used organs in the abdominal cavity (e... in the past. However, the abdominal cavity can be subjected to natural and procedure specific dynamics: all... the organs in the abdominal cavity are below the diaphragm and the rib cage and hence follow the ... |
|||
|
Source: Villard, Pierre-Frederic - Laboratoire Lorrain de Recherche en Informatique et ses Applications (LORIA), Université Henri Poincaré -Nancy-Université |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 92 | Current Biology, Vol. 14, 13191329, August 10, 2004, 2004 Elsevier Ltd. All rights reserved. DOI 10.1016/j.cub.2004.07.052 Roundabout 2 Regulates Migration | ||
|
Summary: - robo2 double mutants have more severe CNS pheno-gans. We used live imaging to show that abdominal Cho... shown to affect migra-neighboring visceral mesoderm) transforms abdominal tion of several neuronal types... expression in the Slit-Robo signaling can also affect migration and ad-abdominal visceral mesoderm. hesion |
|||
|
Source: Zinn, Kai - Division of Biology, California Institute of Technology |
|||
|
Collection: Biology and Medicine |
|||
| 93 | Architectural Gear Ratio and Muscle Fiber Strain Homogeneity in Segmented Musculature | ||
|
Summary: Architectural Gear Ratio and Muscle Fiber Strain Homogeneity in Segmented Musculature EMANUEL... musculature of fishes and amphibians, the patterns of muscle fiber shortening depend on both the orientation... of muscle fibers relative to the long axis of the body as well as the distance of fibers from the neutral |
|||
|
Source: Brainerd, Elizabeth - Department of Ecology and Evolutionary Biology, Brown University |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 94 | J. Electromyogr. Kinesiol. Vol. 7, No. 4, pp. 259268, 1997 1997 Elsevier Science Ltd. All rights reserved | ||
|
Summary: abdominus (RCA) muscles and intra-abdominal pressure (IAP). Numbers at each line represent the velocity... in that they were not able to explain how the trunk muscles work collectively (co-contraction) to support... in that they are not able to account for the variability in muscle recruit- ment and the ... |
|||
|
Source: Ohio State University, Department of Industrial, Welding, and Systems Engineering, Biodynamics Laboratories |
|||
|
Collection: Engineering ; Biology and Medicine |
|||
| 95 | Toward Anatomical Simulation for Breath Training in Mind/Body Medicine | ||
|
Summary: bodies and a de- formable body for the abdominal cavity, 1100 Hill muscle elements and 72 de- grees... & Febiger (1918). 4. Hoit J, Plassman B, Lansing R, Hixon T.: Abdominal muscle activity during speech produc... includes all of the key muscles, bones, and connective components ... |
|||
|
Source: Zordan, Victor - Department of Computer Science and Engineering, University of California at Riverside |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 96 | Abdominal Muscle and Epipubic Bone Function During Locomotion in Australian Possums: Insights to Basal | ||
|
Summary: Abdominal Muscle and Epipubic Bone Function During Locomotion in Australian Possums: Insights... , like all tetrapods, have the four basic abdominal hypaxial muscle layers that wrap around the abdomen... activity in abdominal muscles (Fig. 1A) that provides long-axis ... |
|||
|
Source: Reilly, Stephen M. - Department of Biological Sciences, Ohio University |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 97 | 2004. The Journal of Arachnology 32:336340 SHORT COMMUNICATION | ||
|
Summary: in males, females and juveniles. The abdominal pigment is located in the hypodermis. Keywords: Color... , s1, s2 abdominal spot 1 and 2 lengths. 2. Tibia, lateral view; tib 1,3 tibia 1 and tibia 3 lengths... 10.--Photographs of six adult Buitinga safura specimens showing some of the color variation described: abdominal |
|||
|
Source: Huber, Bernhard A. - Zoologische Forschungsmuseum Alexander Koenig |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 98 | IEEE TRANSACTIONS ON BIOMEDICAL ENGINEERING, VOL. 57, NO. 7, JULY 2010 1757 Flexible Split-Ring Electrode for Insect Flight | ||
|
Summary: the multisite electrode to deliver electrical stimuli that evoke multidirectional, graded abdominal motions... -MAV is the stimulation system. Various stimulation schemes, such as optical stimula- tion [5], muscle heating [6], drug... injection [7], and electrical stimulation of the muscle and nervous systems [5], [8] have been ... |
|||
|
Source: Voldman, Joel - Research Laboratory of Electronics & Department of Electrical Engineering and Computer Science, Massachusetts Institute of Technology (MIT) |
|||
|
Collection: Engineering |
|||
| 99 | INTRODUCTION Salamanders are often chosen for studies of the evolution of | ||
|
Summary: ). The abdominal wall muscles (the muscles ventral to the sulcus lateralis) comprise the rectus and the obliquus... to the sulcus lateralis and superficially to the other hypaxial abdominal wall muscles (Maurer, 1911). As the m... ) and subvertebralis lateralis (SL) compared with the ... |
|||
|
Source: Deban, Stephen M. - Department of Integrative Biology, University of South Florida |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 100 | Introduction Specialization of muscle fibres is an important and widespread | ||
|
Summary: ). Correlation of structure, speed of contraction, and total tension in fast and slow abdominal muscle fibers... 164 Introduction Specialization of muscle fibres is an important and widespread component... of the evolution of motor systems. The performance of muscle fibres, such as their maximum velocity, ... |
|||
|
Source: Kier, William M. - Department of Biology, University of North Carolina at Chapel Hill |
|||
|
Collection: Biology and Medicine |
|||