Home

About

Advanced Search

Browse by Discipline

Scientific Societies

E-print Alerts

Add E-prints

E-print Network
FAQHELPSITE MAPCONTACT US


  Topic List  Advanced Search  
Sample search results for: a1555g 12s rrna

Page:   2  3  4  5 
 
1 Something Old, Something New, Something Borrowed .
 

Summary:  1555G mutation in the 12S rRNA, as a polymor- phism that maps near the TF1BM gene is associated... in the 12s rRNA, a decrease in the steady-state level of small subunit ribosomal proteins, and impaired... the ...

  

Source: Shoubridge, Eric - Montreal Neurological Institute, McGill University

 

Collection: Biology and Medicine

 
2 Nonbridging phosphate oxygens in 16S rRNA important for 30S subunit assembly and association with the 50S
 

Summary:  proteins S5, S6, S11, S12, S18 and S21 with 16 S rRNA. J. Mol. Biol. 201: 683­695. Svensson, P., Changchien... (helix 1­18) (Fig. 5). Small subunit proteins S4, S5, S12, S16, S17, and S20 bind to this region... , S11, S12, S16, and S18), and ...

  

Source: Joseph, Simpson - Department of Chemistry and Biochemistry, University of California at San Diego

 

Collection: Biology and Medicine ; Chemistry

 
3 10.1261/rna.2246710Access the most recent version at doi: 2010 16: 1990-2001 originally published online August 24, 2010RNA
 

Summary:  binding proteins (S4, S7, S8, S15, S17, and S20) and mid-binding proteins (S5, S6, S9, S11, S12, S13, S16... Effector Observed rates of RNA backbone protection (secÀ1 )a 301G Stage II 296 U/S12/S17 #0.02 302G Stage... II 295C/S12/S13 N/A 529G Both S12 0.73 530G ...

  

Source: Bedwell, David M. - Department of Microbiology, University of Alabama at Birmingham

 

Collection: Biology and Medicine

 
4 Insect Molecular Biology (2002) 11(4), 361369 2002 The Royal Entomological Society 361
 

Summary:  Science, Ltd Louse (Insecta: Phthiraptera) mitochondrial 12S rRNA secondary structure is highly variable R... hosted by birds and mammals. Mitochondrial 12S rRNA sequences obtained from lice show considerable length... variation and are very difficult to align. We ...

  

Source: Johnson, Kevin P. - Illinois Natural History Survey; Page, Roderic - Division of Environmental and Evolutionary Biology, Institute of Biomedical and Life Sciences, University of Glasgow

 

Collection: Environmental Sciences and Ecology

 
5 Molecular Microbiology (2001) 40(3), 509519 MicroReview
 

Summary:  RNA gene pairsa Orientation Pho Pfu Pab sR2/sR9 Opposite strand 109 bp 130 bp 116 bp sR12/sR34 Opposite... -ribose methylation to specific nucleotide positions within rRNA during the early stages of ribosome biogenesis... al., 2000). The nucleolar machinery systematically integrates the transcription of rRNA ...

  

Source: Lowe, Todd M. - Department of Biomolecular Engineering, University of California at Santa Cruz

 

Collection: Biology and Medicine ; Biotechnology

 
6 Crystal Structure of the Ribosome at 5.5 Resolution
 

Summary:  , S12, S13, S19, S20, L3, L5, L6, L7, L11, L13, L14, L19, L22, L25, and L30, as well as the positions... and transfer RNAs (tRNAs) at 5.5 angstrom resolution. All of the 16S, 23S, and 5S ribosomal RNA (rRNA) chains... with ribosomal function being based on rRNA. In each of the three tRNA binding sites, the ...

  

Source: Economou, Tassos - Institute of Molecular Biology and Biotechnology, Foundation of Research and Technology, Hellas

 

Collection: Biology and Medicine

 
7 Syst. Biol. 52(3):283295, 2003 Copyright c Society of Systematic Biologists
 

Summary:  for the third domain of animal 12S rRNA. Mol. Biol. Evol. 13:150­169. HICKSON, R. E., C. SIMON, AND S. W. PERREY... :314­330. KJER, K. M. 1997. Conserved primary and secondary structural motifs of amphibian 12S rRNA, domain III... analyses of tetrapod 18S ribosomal ...

  

Source: Xia, Xuhua - Department of Biology, University of Ottawa

 

Collection: Biology and Medicine

 
8 Genomic analysis of Hyphomonas neptunium contradicts 16S rRNA gene-based phylogenetic
 

Summary:  7, S8, S10, S11, S12, S13, S14, S15, S16, S17 and S19) (b), HSP70 proteins (c) and EF-Tu proteins (d... Genomic analysis of Hyphomonas neptunium contradicts 16S rRNA gene-based phylogenetic analysis... this classification is supported by 16S rRNA gene sequence phylogeny, 23S rRNA gene ...

  

Source: Badger, Jonathan - Institute for Genomic Research, Rockville

 

Collection: Biotechnology ; Biology and Medicine

 
9 Phylogenetic investigations of Antarctic notothenioid fishes (Perciformes: Notothenioidei) using complete gene sequences
 

Summary:  DNA 12S and 16S rRNA sequence data have resulted in limited phylogenetic resolution and relatively low... (Fig. 1A; Balushkin, 1992, 2000). Phylogenetic analyses of nuclear (rhodopsin, 28S rRNA) and mtDNA (12S... adequate phylogenetic resolution (Ritchie et al., ...

  

Source: Cheng, Chi-Hing Christina - Department of Animal Biology, University of Illinois at Urbana-Champaign

 

Collection: Environmental Sciences and Ecology

 
10 Phylogenetic investigations of Antarctic notothenioid fishes (Perciformes: Notothenioidei) using complete gene
 

Summary:  using partial mtDNA 12S and 16S rRNA sequence data have resulted in limited phylogenetic resolution... of nuclear (rhodopsin, 28S rRNA) and mtDNA (12S and 16S rRNA) gene se- quences have resulted in hypotheses... of the partial ...

  

Source: Near, Thomas J. - Department of Ecology and Evolutionary Biology, Yale University

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
11 Proc. Natl. Acad. Sci. USA Vol. 93, pp. 54495454, May 1996
 

Summary:  that is at the limit of resolution of fast-evolving mitochondrial genes such as 12S and 16S rRNA genes (unpublished... -mail: rzardoya@ life.bio.sunysb.edu. 5449 #12;Nuclear rRNA genes are found in multiple copies that are organized... consists of three rRNA genes (18S, 5.8S, and 28S) and ...

  

Source: Zardoya, Rafael - Biodiversidad y Biologia Evolutiva, Museo Nacional de Ciencias Naturales

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
12 Structure of a mitochondrial ribosome with minimal RNA
 

Summary:  subunit (LSU) of the Lmr contains a 1,173-nt-long 12S rRNA. Overall, the Leishmania mitochondrial r... the bacterial LSU rRNA secondary structure (14) as the template to describe the 12S Lm-rRNA secondary structure... -rRNAs ( 66% of the 9S and 34% of the ...

  

Source: Simpson, Larry - Department of Microbiology, Immunology and Molecular Genetics, University of California at Los Angeles

 

Collection: Biology and Medicine

 
13 Phylogenetic Relationships of Amphibian Families Inferred from DNA Sequences of Mitochondrial 12s and 16s Ribosomal RNA Genes
 

Summary:  together with published data of the 12s rRNA gene for the same families and both genes for three more taxa... ( 1993) demonstrated that a region of the mitochondrial 12s ribosomal RNA (rRNA) gene is useful... those 12s ...

  

Source: Hedges, S. Blair - Department of Biology, Pennsylvania State University; Ruvinsky, Ilya - Department of Ecology and Evolution, University of Chicago

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
14 Chemico-Biological Interactions 171 (2008) 212235 Available online at www.sciencedirect.com
 

Summary:  . doi:10.1016/j.cbi.2007.09.002 #12;S.G. Bavykin et al. / Chemico-Biological Interactions 171 (2008) 212... size of 0.2 m #12;S.G. Bavykin et al. / Chemico-Biological Interactions 171 (2008) 212­235 215 Fig. 1... Cl, 50 mM sodium phosphate (pH 7.0), 6 mM EDTA, and 1% Tween 20). ...

  

Source: Kelly, John J. - Department of Biology, Loyola University Chicago

 

Collection: Environmental Sciences and Ecology ; Environmental Management and Restoration Technologies

 
15 Letters to the Editor Am. J. Hum. Genet. 64:290292, 1999
 

Summary:  of the mtDNA 12S rRNA Gene A1555G Mutation To the Editor: Human mitochondrial disorders comprise a heteroge... of the Journal, Es- tivill et al. (1998) reported that the A1555G mutation in the ...

  

Source: Zhao, Hongyu - School of Public Health, Yale University

 

Collection: Biology and Medicine

 
16 volume 13 Number 7 1985 Nucleic Acids Research Primary sequence and partial secondary structure of the 12S kinetoplast (mitochondria!)
 

Summary:  subunit mitochondrial rRNA of the kinetoplastid protozoa. In this paper we present the sequence of the 12S... contains the 12S rRNA gene, and DNA isolation procedures have been described elsewhere (13-15). Subcloning... with the cytoplasmic rRNA ...

  

Source: Simpson, Larry - Department of Microbiology, Immunology and Molecular Genetics, University of California at Los Angeles

 

Collection: Biology and Medicine

 
17 Molecular systematics of the South American caviomorph rodents: relationships among species and genera in the family Octodontidae
 

Summary:  Nucleotide sequences from mitochondrial (12S rRNA) and nuclear (growth hormone receptor) genes were used... phylogeny; 12S rRNA; Growth hormone; Molecular clocks 1. Introduction The evolutionary history of South... sequence data from both nuclear (growth hormone ...

  

Source: Rowe, Diane - School of Marine and Tropical Biology, James Cook University

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
18 Mol. Biol. Evol. 19(1):93100. 2002 2002 by the Society for Molecular Biology and Evolution. ISSN: 0737-4038
 

Summary:  mitochondrial rRNA genes from their nuclear paralogs. We explored this approach using the mitochondrial 12S rRNA... and the inferred secondary structure of primate 12S rRNA. Contrary to expectation, each of the three human numts... and ...

  

Source: Yoder, Anne - Department of Biology, Duke University

 

Collection: Environmental Sciences and Ecology

 
19 Changes in transcript abundance relating to colony collapse disorder in honey bees (Apis mellifera)
 

Summary:  S) and mitochondrial (12S and 16S) rRNA genes of Apis mellifera (Insecta: Hymenoptera): Structure... probes derived from expressed sequence tags (ESTs) specific for rRNA [supporting information (SI) Table S... was confirmed: CCD-associated up-regulation of the ESTs QW33 and jdeC15, corresponding to 28S and ...

  

Source: Zhong, Sheng - Department of Bioengineering, University of Illinois at Urbana-Champaign

 

Collection: Biology and Medicine ; Computer Technologies and Information Sciences

 
20 Scheinman et al., page 1 of 8 RECONSTITUTION OF A MINIMAL SMALL RIBOSOMAL SUBUNIT
 

Summary:  is the small kinetoplastid ribosomal subunit rRNA (de la Cruz et al., 198Sa) and the 12S RNA is the large... that a 9S- and 12S- containing kinetoplast-mitochondrial fraction contains ribosomes andribosomalsubunits... ). Additional experiments with both 9S and ...

  

Source: Simpson, Larry - Department of Microbiology, Immunology and Molecular Genetics, University of California at Los Angeles

 

Collection: Biology and Medicine


Page:   2  3  4  5 
Page:   1  2  3  4  5 
 
21 Short Communication Phylogenetic relationships of leopard frogs (Rana pipiens complex)
 

Summary:  Mitochondrial DNA 12S rRNA Molecular systematics a b s t r a c t Mitochondrial DNA sequence data from... the control region and 12S rRNA in leopard frogs from the Sierra El Aguaje of southern Sonora, Mexico... mitochondrial DNA (mtDNA) se- quence data from the ...

  

Source: Markow, Therese - Division of Biological Sciences, University of California at San Diego

 

Collection: Environmental Sciences and Ecology

 
22 Phylogenetics of Perissodactyla and Tests of the Molecular Clock Jane E. Norman, Mary V. Ashley
 

Summary:  , the protein- coding cytochrome c oxidase subunit II (COII) gene and a portion of the 12S rRNA gene, were used... -- Mitochondrial DNA -- 12S rRNA -- Cytochrome oxidase II -- Evo- lutionary rates -- Molecular clock Introduction... ...

  

Source: Ashley, Mary V. - Department of Biological Sciences, University of Illinois at Chicago

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
23 Abbreviations A adenine
 

Summary:  RNA ­ messenger RNA PIC ­ pre-initiation complex RNA ­ ribonucleic acid rRNA ­ ribosomal RNA RNAP ­ RNA polymerase... SSU rRNA or ss rRNA­ small subunit rRNA T ­ thymidine TATA-box ­ thymidine and adenine rich sequence

  

Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution,

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
24 Insect Molecular Biology (2000) 9(6), 565580 2000 Blackwell Science Ltd 565
 

Summary:  structure for the third domain of animal 12S rRNA. Mol Biol Evol 13: 150­169. Hickson, R.E., Simon, C... of the insect mitochondrial large subunit rRNA gene T. R. Buckley,1,2 C. Simon,1,3 P. K. Flook4 and B. Misof5 1... systematics, mitochondrial LSU rRNA, insect mitochondrial DNA. ...

  

Source: Simon, Chris - Department of Ecology and Evolutionary Biology, University of Connecticut

 

Collection: Environmental Sciences and Ecology

 
25 APPLIED AND ENVIRONMENTAL MICROBIOLOGY, 0099-2240/01/$04.00 0 DOI: 10.1128/AEM.67.6.27812789.2001
 

Summary:  cycles at 94°C for 40s, 60°C for 10 s, and 72°C for 75 s, followed by 40 cycles at 94°C for 12 s, 65o C... Reserved. Application of the 5 Fluorogenic Exonuclease Assay (TaqMan) for Quantitative Ribosomal DNA and rRNA... PCR and reverse transcriptase PCR assays for the 16S rRNA of Geobacter spp. and ...

  

Source: Lovley, Derek - Department of Microbiology, University of Massachusetts at Amherst

 

Collection: Environmental Management and Restoration Technologies ; Biology and Medicine

 
26 recruited from other Pediatric Oncology Group (POG) institutions before treatment began. Informed con-
 

Summary:  for S. solfataricus fall within the D box guide regions in the two sRNAs (Fig. 4A). 12. S. F. Altschul... methylations within rRNA, whereas most H/ACA box RNAs target specific con- versions of uridine to pseudouridine... within rRNA (2). The general mechanism of C/D box snoRNA-targeted ribose methylation has ...

  

Source: Eddy, Sean - Janelia Farm Research Campus, Howard Hughes Medical Institute; Lowe, Todd M. - Department of Biomolecular Engineering, University of California at Santa Cruz

 

Collection: Biology and Medicine ; Biotechnology

 
27 Human Disease-Associated Mitochondrial Mutations Fixed in Nonhuman Joa~ o Pedro de Magalha~ es
 

Summary:  enough for these pathologies to express themselves. For example, the base substitution A1555G in MTTRNR1... of mitochondrial 12S rRNA gene in type 2 diabetes]. Zhonghua Yi Xue Yi Chuan Xue Za Zhi 18:388­390 Zhao H, Li R... - induced and nonsyndromic deafness is ...

  

Source: de Magalhães, João Pedro - School of Biological Sciences, University of Liverpool

 

Collection: Biology and Medicine

 
28 Molecular & Biochemical Parasitology 148 (2006) 6978 Isolation and characterization of mitochondrial ribosomes and
 

Summary:  mitochondrial ribonucleoprotein (RNP) complexes using the 9S small subunit (SSU) rRNA and the 12S large subunit... tarentolae; Kinetoplast; Mitochondrial ribosome; Ribonucleoprotein complex; 9S SSU rRNA; 12S LSU rRNA 1... than 20% of the ...

  

Source: Simpson, Larry - Department of Microbiology, Immunology and Molecular Genetics, University of California at Los Angeles

 

Collection: Biology and Medicine

 
29 Evolution of Fragmented Mitochondrial Ribosomal RNA Genes in Chlamydomonas
 

Summary:  coding and tRNA genes. The mitochondrial rRNA genes of these two algae differ, however, in both... the distribution and organization of rRNA coding information within their respective ge- nomes. The objectives... of this study were (1) to examine the phylogenetic relationships between the mitochondrial rRNA gene sequences

  

Source: Sankoff, David - Laboratory for Innovation in Bioinformatics, University of Ottawa

 

Collection: Biology and Medicine ; Mathematics

 
30 Molecular Phylogenetics and Ecological Diversification of the Transisthmian Fish Genus Centropomus
 

Summary:  bp of the mitochondrial DNA 16S ribosomal RNA (rRNA) gene. Molecular phylogenetic trees were... data, and phylogenetic hypotheses for Centropomus based on 16S rRNA sequences were better supported... from the analyses of allozymes and mtDNA 16S ribosomal RNA (rRNA) for Centropomus. Using the molecular

  

Source: Bermingham, Eldredge - Smithsonian Tropical Research Institute, Balboa Panama

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
31 Fragmented and Scrambled Mitochondrial Ribosomal RNA Coding Regions Among Green Algae: A Model for Their Origin and Evolution
 

Summary:  of evolution of fragmented and scrambled mitochondrial ribosomal RNA (rRNA) genes within the green algal group... of fragmented and scrambled mitochon- drial LSU rRNA coding regions in a green algal taxon outside... the Chlumydomonas group. The present study (1) suggests that the scrambling of the mitochondrial rRNA coding ...

  

Source: Nedelcu, Aurora M. - Biology Department, University of New Brunswick

 

Collection: Biology and Medicine

 
32 Research Article for BMC Evolutionary Biology 11 March 2006
 

Summary:  transcript contains ITS1 (between the 12S and 5.8S) and ITS2 (between the 5.8S and 28S) whereas prokaryotes... , especially mRNA, tRNA and rRNA. A simple example is the RNase MRP processing of ribosomal RNA (rRNA... and previously discovered RNase MRP RNAs along with analysis of the primary substrate ...

  

Source: Stadler, Peter F. - Institut für Informatik, Universität Leipzig

 

Collection: Biology and Medicine

 
33 Letter to the Editor Phylogenetics of the Tenrecidae (Mammalia)
 

Summary:  ) come from two tenrecines, one African otter shrew, plus 12S rRNA from Oryzorictes, and because... not have intended this part of their 12S rRNA alignment to correspond with stem 7 of Springer and Douzery... ). In addition to an osteological dataset, I incorporated ...

  

Source: Wheeler, Ward - Division of Invertebrate Zoology, American Museum of Natural History

 

Collection: Environmental Sciences and Ecology

 
34 TaxI: a software tool for DNA barcoding using distance methods
 

Summary:  ) argued against the mitochondrial 12S and 16S rRNA genes as standard DNA barcoding markers because... . & Walsh, P. J. 2000 Molecular systematics of the order Anaspidea based on mitochondrial DNA sequence (12S... different models of sequence evolution. Sets of ribosomal 16S ...

  

Source: Vences, Miguel - Institute for Biodiversity and Ecosystem Dynamics, Zoological Museum, Universiteit van Amsterdam

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
35 Christopher R.Trotta1 , Elsebet Lund,
 

Summary:  processing in Xenopus (Savino and Gerbi, 1990), including the conver- sion of 12S rRNA to 6S rRNA... al. 2846 #12;contrast, the nuclear levels of 12S rRNA [a long-lived, earlier precursor of 5.8S rRNA... of the ...

  

Source: Johnson, Arlen - Section of Molecular Genetics and Microbiology, Division of Biological Sciences, University of Texas at Austin

 

Collection: Biology and Medicine

 
36 JOURNAL OF BACTERIOLOGY, Jan. 1995, p. 259263 Vol. 177, No. 1 0021-9193/95/$04.00 0
 

Summary:  -0835. Fax: (203) 486-2794. 259 #12;S85 supported nitrocellulose (Schleicher and Schuell, Inc., Keene, N... , University of North Carolina, Chapel Hill); plasmid pMC5 (1), containing a portion of the 16S rRNA genes... and the complete 23S and 5S rRNA genes of Mycoplasma capricolum; plasmid pMpP1 (14), ...

  

Source: Geary, Steven J. - Department of Pathobiology and Veterinary Science, University of Connecticut

 

Collection: Environmental Sciences and Ecology

 
37 Delsuc et al. Molecular systematics of armadillos MOLECULAR SYSTEMATICS OF ARMADILLOS (XENARTHRA, DASYPODIDAE): CONTRIBUTION OF
 

Summary:  ] and 12S ribosomal RNA [12S rRNA]) to the three protein- coding nuclear genes (2B Adrenergic receptor... and the ribosomal RNA-coding 12S rRNA. These two mitochondrial genes have been previously used for example... of the ...

  

Source: Ecole Polytechnique, Centre de mathématiques

 

Collection: Mathematics

 
38 Conserved Sequence Motifs, Alignment, and Secondary Structure for the Third Domain of Animal 12s rRNA
 

Summary:  Conserved Sequence Motifs, Alignment, and Secondary Structure for the Third Domain of Animal 12s rRNA... Zoo- logical Park. Key words: 12s rRNA, SSU rRNA, secondary structure model, sequence alignment... of animal mitochon- drial SSU ...

  

Source: Spicer, Greg S. - Department of Biology, San Francisco State University

 

Collection: Biology and Medicine

 
39 Please cite this article in press as: Michel, C.J., Circular code motifs in transfer and 16S ribosomal RNAs: A possible translation code in genes. Comput. Biol. Chem. (2011), doi:10.1016/j.compbiolchem.2011.10.002
 

Summary:  , C(S2) = {C(A) : 8, C(C) : 2, C(G) : 2, C(T) : 8} = {T : 8, G : 2, C : 2, A : 8} = S2. Let S12 (S12... (S12) = card(S23) = 11 (among 16 dinucleotides). S12 /= S23 and S12 S23 = {AA, AC, AT, GC, GT, TA, TT... }. C(S12) = S23, ...

  

Source: Michel, Christian - Département Informatique, Université de Strasbourg

 

Collection: Computer Technologies and Information Sciences ; Biology and Medicine

 
40 Laing and Schlick 27 FIGURE LEGENDS
 

Summary:  to the 23S rRNA 1S72_2678 from Table 1. Figure 2. Network interaction diagrams for the nine families of 4... 23S rRNA 2AW4_267 and 23S rRNA 2J01_1832 of family , and 16S rRNA 2AVY_942 of family c... 23S rRNA H1H4 , H2H3 H HS3HS3HS3HS4 IV H64-65-66-67 2AW4 _1771 23S ...

  

Source: Schlick, Tamar - Department of Chemistry, New York University

 

Collection: Chemistry


Page:   1  2  3  4  5 
Page:   1  2  3  4  5 
 
41 The Norwegian Academy of Science and Letters Zoologica Scripta, 32, 5, September 2003, pp407414 407 Barker, S. C. Whiting, M., Johnson, K. P. & Murrell, A. (2003). Phylogeny of the lice (Insecta
 

Summary:  , L. J. & Gray, R. D. (2000). Seabird and louse coevolution: complex histories revealed by 12s rRNA... recognized; see Durden & Musser (1994) for a complete list. #12;S. C. Barker et al. · Phylogeny of lice... do not allow us to reject the hypothesis that each of the four ...

  

Source: Johnson, Kevin P. - Illinois Natural History Survey

 

Collection: Environmental Sciences and Ecology

 
42 2008 The Authors. Journal compilation 2008 The Norwegian Academy of Science and Letters Zoologica Scripta, 38, 2, March 2009, pp155170 155 Dell'Ampio, E., Szucsich, N. U., Carapelli, A., Frati, F., Steiner, G., Steinacher, A. & Pass, G.
 

Summary:  in analyses of 28S rRNA sequences. -- Zoologica Scripta, 38, 155­170. The present analyses employ the almost... complete sequence of the 28S rRNA gene to investi- gate phylogenetic relationships among Pancrustacea... to a minimum. This is the first time that a mixed DNA/ RNA model is applied to analyse 28S rRNA sequences

  

Source: Pass, Günther - Department für Evolutionsbiologie, Fakultät für Lebenswissenschaften, Universität Wien

 

Collection: Biology and Medicine

 
43 Last year, atomic structures of the 50S ribosomal subunit from Haloarcula marismortui and of the 30S ribosomal subunit from
 

Summary:  [21··]. S10 S13 S9 S12 S17 S19 S11 L4 L39e L15 L44e L37e L19 N C L21e L2 L3 (a) (b) Current Opinion... RNA roughly 1500 nucleotides in length, 16S rRNA, and single copies of each of about 20 different... proteins. The large subunit contains a 2900-nucleotide RNA, 23S rRNA, an RNA of about 120 nucleotides, ...

  

Source: Ramakrishnan, Venki - Laboratory of Molecular Biology, MRC

 

Collection: Biology and Medicine

 
44 This article was originally published in a journal published by Elsevier, and the attached copy is provided by Elsevier for the
 

Summary:  combined nucleotide sequences of mitochondrial 12S and 16S rRNA genes) data sets in order to further... , retention index; 16S rRNA and 12S rRNA, genes encoding for the large and small (12S) subunits of ...

  

Source: Zardoya, Rafael - Biodiversidad y Biologia Evolutiva, Museo Nacional de Ciencias Naturales

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
45 Proc. Natl. Acad. Sci. USA Vol. 92, pp. 11662-11665, December 1995
 

Summary:  sequence evidence from the 12S and 16S rRNA mitochondrial genes, and from the nuclear gene that codes... sequence data from two mitochondrial genes (12S and 16S rRNA) and a nuclear gene (aA-crystallin) relating... been deposited in the GenBank data base [accession ...

  

Source: Hedges, S. Blair - Department of Biology, Pennsylvania State University

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
46 ARTICLE IN PRESS Transcriptional and phylogenetic analysis of five complete
 

Summary:  -loop is comparable to levels of variation within the 12S and 16S rRNA genes. Overall, variation is lowest in regions... (12S rRNA, nd2, nd4, nd5, nd6), and seven tRNAs (-Leu(UUR) , -Trp, -Ala, -Asn, -Cys, -Tyr, -Ser... , including 11 complete genes ...

  

Source: Voss, S. Randal - Department of Biology, University of Kentucky

 

Collection: Biology and Medicine

 
47 BioMed Central Page 1 of 14
 

Summary:  ) and subunit 2 (ND2), in addition to a control region (CR1) adjacent to the 5'-end of the 12s rRNA... (CR1) present in all vertebrates adjacent to the 5' end of the 12s rRNA gene [7-9]. These genomes also... COX1 ND2 Control Region 2 ND1 R P T E L S1 H A N C Y ...

  

Source: Austin, Christopher C. - Museum of Natural Science, Louisiana State University; Burbrink, Frank - Department of Biology, College of Staten Island, City University of New York; McGuire, Jimmy A. - Museum of Vertebrate Zoology, University of California at Berkeley

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
48 Evolution / volution Higher-level relationships of caenophidian snakes
 

Summary:  of one nuclear gene (C-mos) and three mitochondrial genes (12S rRNA, 16S rRNA and ND4). Caenophidians... SAS Caenophidia / advanced snakes / Colubroidea / phylogeny / venom apparatus / C-mos / 12S rRNA / 16S... Caenophidia sont inférées par ...

  

Source: Hedges, S. Blair - Department of Biology, Pennsylvania State University

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
49 Molecular Phylogenetics and Evolution 34 (2005) 645654 www.elsevier.com/locate/ympev
 

Summary:  1 (COI)) for all taxa, while two additional loci (12S rRNA, cytochrome b) were used to investigate... the subspecies. Sequence data derived from four mitochondrial DNA gene loci (16S rRNA, 12S rRNA, cytochrome b... derived from two additional ...

  

Source: Crandall, Keith A. - Departments of Integrative Biology & Microbiology and Molecular Biology, Brigham Young University

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
50 Structural and Evolutionary Considerations for Multiple
 

Summary:  .1 shows an example of a fragment of a computer-generated alignment of the 12S rRNA from a variety... --CCCC-AGAAAAT-TACGATAACCCTTATGA GCTACATTTTCTA--CCCC-AGAAAAT-TACGATAACCCTTATGA Figure 7.1. A fragment of an alignment of complete 12S rRNA... above them. The top panel ...

  

Source: Roshan, Usman - Department of Computer Science, New Jersey Institute of Technology

 

Collection: Computer Technologies and Information Sciences

 
51 Insect Biochemistry and Molecular Biology 32 (2002) 951960 www.elsevier.com/locate/ibmb
 

Summary:  rRNA (Kambhampati, 1996); (b) 16S and 12S rRNA (Kambhampati, 1995); (c) multiple gene sequences (Lo... . Phylogenetic relationship among cockroach families inferred from 12S rRNA gene sequence. Systematic Ento... ­960 Fig. 2. Alternative ...

  

Source: Schal, Coby - Department of Entomology, North Carolina State University

 

Collection: Biology and Medicine

 
52 2000 The Society for the Study of Evolution. All rights reserved. Evolution, 54(6), 2000, pp. 20142027
 

Summary:  ) and among divergent (14% in 12S rRNA) species of Daphnia (Colbourne and Hebert 1996). The pattern for E... compatibility. DNA sequences from two mitochondrial genes, large subunit (16S) rRNA (450 bp) and cytochrome... divergent clades with maximum sequence divergences of 10% in 16S rRNA ...

  

Source: Lee, Carol Eunmi - Department of Zoology, University of Wisconsin at Madison

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
53 Cell, Vol. 113, 789801, June 13, 2003, Copyright 2003 by Cell Press Study of the Structural Dynamics of the E. coli
 

Summary:  of which are near the solvent surface, conformations exhibited in the sample.except for S12, S13, and S19... models of proteins, rRNA and models shows that the ribosome changes from a com- t... of each RNA 16S rRNA (1542 nucleotides) and 21 proteins, and the structure and protein was taken from

  

Source: Sali, Andrej - Department of Biochemistry and Biophysics, University of California at San Francisco

 

Collection: Biology and Medicine ; Biotechnology

 
54 Syst. Biol. 53(3):506514, 2004 Copyright c Society of Systematic Biologists
 

Summary:  structure model for the third domain of animal 12S rRNA, with a comparison of alignment pro- grams. Mol... template for amphibian 12S rRNA, domain III: Conserved primary and secondary structural motifs. J. Herpetol... , New Brunswick, NJ 08901, USA; E-mail: ...

  

Source: Danforth, Bryan Nicholas - Department of Entomology, Cornell University

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
55 2001 by the American Society of Ichthyologists and Herpetologists Copeia, 2001(4), pp. 11511154
 

Summary:  , AND MICHAEL VEITH A total of 1981 bp of the mitochondrial 16S rRNA, 12S rRNA and cytochrome b genes were... . MATERIALS AND METHODS We sequenced fragments of the 16S rRNA (468 bp) and 12S rRNA genes (400 bp) in six... for the ...

  

Source: Vences, Miguel - Institute for Biodiversity and Ecosystem Dynamics, Zoological Museum, Universiteit van Amsterdam

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
56 Environmental Microbiology (2006) 8(9), 15641574 doi:10.1111/j.1462-2920.2006.01047.x 2006 The Authors
 

Summary:  .NEU-c12gNEU-g11cWagneretal.(1995) 12S-S-Nse-1472-a-A-18Nse1472ACCCCAGTCATGACCCCCNitrosomonaseuropaea... , polymerase chain reaction was used to selec- tively amplify the 16S rRNA genes of specific nitrifier groups... can be used to detect bacterial rRNA directly from environmen- tal samples (Koizumi et al., ...

  

Source: Kelly, John J. - Department of Biology, Loyola University Chicago

 

Collection: Environmental Sciences and Ecology ; Environmental Management and Restoration Technologies

 
57 Proc. Natl. Acad. Sci. USA Vol. 91, pp. 2621-2624, March 1994
 

Summary:  from four slow- evolving genes (mitochondrial 12S and 16S rRNA, tRNAVaI, and nuclear a-enolase) now... amniotes.* MATERIAL AND METHODS Complete sequences of three adjacent mitochondrial genes (12S rRNA, 16S rRNA... 0.05 FiG. 1. Amniote ...

  

Source: Doebley, John - Department of Medical Genetics, University of Wisconsin at Madison

 

Collection: Renewable Energy ; Biology and Medicine

 
58 APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Nov. 2007, p. 68986904 Vol. 73, No. 21 0099-2240/07/$08.00 0 doi:10.1128/AEM.01218-07
 

Summary:  . Appl. Environ. Microbiol. 62:316­322. 6904 AMOS ET AL. APPL. ENVIRON. MICROBIOL. #12;S-1 SUPPLEMENTAL... .loeffler@ce.gatech.edu #12;S-2 TABLE S1. Summary of the effect of Geobacter (formerly Trichlorobacter) thiogenes genomic DNA... with specific 16S rRNA gene-targeted primer pairs ...

  

Source: Löffler, Frank E. - School of Civil and Environmental Engineering, Georgia Institute of Technology

 

Collection: Environmental Management and Restoration Technologies

 
59 Accurate and efficient reconstruction of deep phylogenies from structured RNAs
 

Summary:  .53 0.70 0.99 1.00 0.10.1 Fig. 3. Bayesian tree inferred from the combined mammalian 12S rRNA and 16S rRNA... analyses of the mammalian 12S rRNA and 16S rRNA. Sequences are aligned with (A) RNAsalsa, (B) MAFFT, (C... in phylo- ...

  

Source: Stadler, Peter F. - Institut für Informatik, Universität Leipzig

 

Collection: Biology and Medicine

 
60 Two living species of coelacanths? Mark T. Holder*, Mark V. Erdmann, Thomas P. Wilcox*, Roy L. Caldwell, and David M. Hillis*
 

Summary:  and 12S rRNA genes. We have obtained the sequence of 4,823 bp of mitochondrial DNA from the same specimen... , including the entire genes for cytochrome b, 12S rRNA, 16S rRNA, four tRNAs, and the control region... to be 4.85% divergent from ...

  

Source: Hillis, David - Section for Integrative Biology, Division of Biological Sciences, University of Texas at Austin

 

Collection: Environmental Sciences and Ecology


Page:   1  2  3  4  5 
Page:   1  2  3  4  5 
 
61 Proc. Natl. Acad. Sci. USA Vol. 91, pp. 9861-9865, October 1994
 

Summary:  sequences of the 12S and 16S rRNA mitochon- drial genes, and they provide another example ofincongruence... ." In this paper we present the results of comparisons among the DNA sequences ofthe mitochondrial12S rRNA and 16S... ofportions oftwo mitochondrial genes ...

  

Source: Hedges, S. Blair - Department of Biology, Pennsylvania State University

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
62 Molecular Cell An Unexpected Type of Ribosomes
 

Summary:  precursor 21S. The 61S particles were deficient in r-proteins S1, S2, S6, S12, S18, and S21 and contained... , S6, S12, S18, and S21). Since the modern ribosome can be viewed as a protein-stabilized ribozyme... proteins S1 and S12. The lack of these proteins could be reconciled with structural changes in the ...

  

Source: Bedwell, David M. - Department of Microbiology, University of Alabama at Birmingham

 

Collection: Biology and Medicine

 
63 Mapping the Inside of the Ribosome with an RNA
 

Summary:  . Noller* The structure of ribosomal RNA (rRNA) in the ribosome was probed with hydroxyl radicals generated... ­dependent manner and directed cleavage to specific regions of the 16S, 23S, and 5S rRNA chains. The positions... , and on the lengths of their stems. These data predict the three-dimensional locations of the rRNA targets ...

  

Source: Joseph, Simpson - Department of Chemistry and Biochemistry, University of California at San Diego

 

Collection: Biology and Medicine ; Chemistry

 
64 Thermal Adaptation of the Small Subunit Ribosomal RNA Gene: A Comparative Study
 

Summary:  lineages in order to understand the general patterns of thermal adaptation in the rRNA genes. Within each... regions of the 16S rRNA genes and the optimal growth temperature, and we show that this correlation cannot... a significant, positive relationship between rRNA stem length and growth temperature. These correlations

  

Source: Xia, Xuhua - Department of Biology, University of Ottawa

 

Collection: Biology and Medicine

 
65 Horned lizard (Phrynosoma) phylogeny inferred from mitochondrial genes and morphological characters
 

Summary:  and external morphology; Reeder and Montanucci (2001) combined genetic data from mito- chondrial 12S and 16S rRNA... (2001) study were gi- ven precedence. We obtained the 12S and 16S rRNA gene sequences for all taxa... two fragments were translated and checked for ...

  

Source: Zamudio, Kelly R. - Department of Ecology and Evolutionary Biology, Cornell University

 

Collection: Environmental Sciences and Ecology

 
66 Molecular phylogenetic analyses indicate extensive morphological convergence between the ``yeti'' and primatesq
 

Summary:  successfully amplified and directly sequenced a fragment of the mitochondrial 12S ribosomal RNA gene (12S rRNA... ) from that sample. Surprisingly, comparison of the yeti sequence against all available 12S rRNA... therefore ...

  

Source: Jordan, Steve - Department of Biology, Bucknell University

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
67 Phylogeography of the false smooth snakes, Macroprotodon (Serpentes, Colubridae): mitochondrial
 

Summary:  ; 12S rRNA, 393 bp; and 16S rRNA, 382 bp) corroborates the monophyly of the genus Macroprotodon... Elsevier Inc. All rights reserved. Keywords: Mitochondrial DNA; Cytochrome b; 12S rRNA; 16S rRNA; Evolution... ) of ...

  

Source: Carranza, Salvador - Institut de Biologia Evolutiva, Universitat Pompeu Fabra

 

Collection: Biology and Medicine

 
68 Proc. Natl. Acad. Sci. USA Vol. 91, pp. 2621-2624, March 1994
 

Summary:  of three adjacent mitochondria1 genes (12s rRNA, 16s rRNA, tRNAVal)were obtained from a crocodilian... DNA sequences of the mitochondrial 12s rRNA, 16s rRNA, and tRNAVd genes (A) and the nuclear glycolytic... * Myoglobin ...

  

Source: Hedges, S. Blair - Department of Biology, Pennsylvania State University

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
69 Evolution / volution Higher-level relationships of snakes inferred from
 

Summary:  gene (C-mos) and three mitochondrial genes (12S rRNA, 16S rRNA and cytochrome b). Extant snakes belong... / phylogeny / macrostomatan / C-mos / 12S rRNA / 16S rRNA / cytochrome b Résumé ­ Grandes lignes de la... nucléaire ...

  

Source: Hedges, S. Blair - Department of Biology, Pennsylvania State University

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
70 Phylogeny of ``Philoceanus complex'' seabird lice (Phthiraptera: Ischnocera) inferred from mitochondrial DNA sequences
 

Summary:  , albatrosses, and their relatives). We obtained mitochondrial 12S rRNA and cytochrome oxidase I DNA sequences... Elsevier Inc. All rights reserved. Keywords: Phthiraptera; Lice; Seabirds; 12S rRNA; COI; Elongation factor... , based on ...

  

Source: Kennedy, Martyn - Department of Zoology, University of Otago

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
71 Multiple colonisations of the western Indian Ocean by Pteropus fruit bats (Megachiroptera: Pteropodidae): The furthest islands were colonised first
 

Summary:  Pteropus. We chose the 12S rRNA and cytochrome b loci to facilitate integration with available sequence... bp) and 12S rRNA (1002 bp) genes and a fragment of the control region (approximately 429 bp) using... and Maddison, 1992). We manually conducted the ...

  

Source: Russell, Amy L. - Department of Biology, Grand Valley State University, Michigan; Wagner, Diane - Institute of Arctic Biology, Department of Biology and Wildlife, University of Alaska Fairbanks; Yoder, Anne - Department of Biology, Duke University

 

Collection: Environmental Sciences and Ecology

 
72 NERC GR3/11075 Final Report 1 of 4 Final report on NERC grant GR3/11075
 

Summary:  small subunit rRNA gene (12S). The choice of this gene was based on Paterson's (6) use of it in his... incorrect alignments (8, 9). In the absence of a robust model for insect 12S rRNA, the PI developed... (11). This model is being used to aligning the louse ...

  

Source: Page, Roderic - Division of Environmental and Evolutionary Biology, Institute of Biomedical and Life Sciences, University of Glasgow

 

Collection: Environmental Sciences and Ecology

 
73 Proc. Nati. Acad. Sci. USA Vol. 86, pp. 2267-2271, April 1989
 

Summary:  (LSU) rRNA sequences. In the nuclear subtree, plants branch offlate, at a position reflecting a massive... rate of sequence divergence of non-plant mitochondrial rRNA sequences. In considering alternative... biological explanations for these results, we are led to propose that the rRNA genes in plant mitochondria

  

Source: Sankoff, David - Laboratory for Innovation in Bioinformatics, University of Ottawa

 

Collection: Biology and Medicine ; Mathematics

 
74 GAMETOPHYTIC SELF-INCOMPATIBILITY (Newbigin et al., 1993; Matton et al., 1994; Dodds et al., 1997)
 

Summary:  for allele-specificity a. A plant S12S14 was transformed with an S11 S-RNase­it rejected S11 pollen b. S11... 5 folds over extracellular matrix). 5. S11-S13 genotype was pollinated by pollens from a S12S12... (Figure 1 b and c). 6. No labeling was seen in the compatible S11S13 pollen tubes in ...

  

Source: Bhattacharyya, Madan Kumar - Department of Agronomy, Iowa State University

 

Collection: Biology and Medicine

 
75 This article was published in an Elsevier journal. The attached copy is furnished to the author for non-commercial research and
 

Summary:  of genes, and sequenced. Different combinations of four mitochon- drial genes (12S rRNA, tRNA Valine, 16S rRNA... project already pub- lished (Carranza and Arnold, 2006) and therefore we used the same genes (12S rRNA... used genes evolving more ...

  

Source: Hedges, S. Blair - Department of Biology, Pennsylvania State University

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
76 Systematics and Biodiversity 1 (2): 275282 Issued 14 August 2003 DOI: 10.1017/S1477200003001099 Printed in the United Kingdom C The Natural History Museum
 

Summary:  cytochrome b, 379 bp 12S rRNA and 388 bp 16S rRNA) is used to show that this genus invaded tropical America... ) for the cytochrome b gene, 12Sa and 12Sb for the 12S rRNA gene (Kocher et al., 1989) and 16SL1 (5 -CCG TGC AAA GGT... Museum number ...

  

Source: Carranza, Salvador - Institut de Biologia Evolutiva, Universitat Pompeu Fabra

 

Collection: Biology and Medicine

 
77 Water Research 36 (2002) 46484654 Research note
 

Summary:  -D-Bact-0338-a-A-18 Virtually all Bacteria [12] S-D-Arch-0915-a-A-20 Virtually all Archaea [13] S-O-Mmic-1200-a... in the ASBR to approximately 3600 mg lÀ1 . The 16S ribosomal RNA (rRNA) levels of the acetate... S rRNA levels) during this period, while the 16S rRNA levels of Methanosaeta ...

  

Source: Angenent, Lars T. - Department of Biological and Environmental Engineering, Cornell University

 

Collection: Renewable Energy ; Engineering

 
78 Complete mitochondrial DNA sequence of the Australian freshwater crayfish, Cherax destructor (Crustacea: Decapoda: Parastacidae)
 

Summary:  0 ND1 (13,839 14,753) 915 ATG TAA 21 tRNALeu(UAG) (14,780 14,847) 68 26 12S (14,848 15,764) 917 0 t... for the gene inversions. In addition, the arrangement of rRNA genes is incompatible with current mitochondrial... genes (ATP6 and 8, CO1­3, Cyt b, ND1­6 and 4L), two rRNA genes (lrRNA and srRNA), and 22 ...

  

Source: Burridge, Chris - School of Zoology, University of Tasmania

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
79 Genome Update: rRNAs in sequenced microbial
 

Summary:  . The Methanococcus maripaludis genome contains few DNA repeats and has three rRNA operons. The genome of B. cereus... . cereus sensu lato group, and comparison of 16S rRNA gene sequences alone cannot distinguish between... members of this group. The genome of B. cereus ATCC 10987 encodes 12 rRNA operons and 98 tRNAs, as shown

  

Source: Ussery, David W. - Center for Biological Sequence Analysis, Institute of Biotechnology, Danmarks Tekniske Universitet

 

Collection: Biotechnology

 
80 Molecular Phylogenetics and Evolution 37 (2005) 661673 www.elsevier.com/locate/ympev
 

Summary:  . Four diVerent gene regions (12S rRNA, 16S rRNA, cytochrome c oxidase subunit I, 28S rRNA) and 45... to: approximately 1100 bp of D1­D3 regions of the 28S rRNA gene, app. 350 bp of 12S rRNA gene... Bank ...

  

Source: Huber, Bernhard A. - Zoologische Forschungsmuseum Alexander Koenig

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology


Page:   1  2  3  4  5 
Page:   1  2  3  4  5 
 
81 Distinct Domains in Ribosomal Protein L5 Mediate 5 S rRNA Binding and Nucleolar Localization*
 

Summary:  Distinct Domains in Ribosomal Protein L5 Mediate 5 S rRNA Binding and Nucleolar Localization... , a 34-kDa large ribosomal sub- unit protein, binds to 5 S rRNA and has been implicated... in the intracellular transport of 5 S rRNA. By immuno- fluorescence microscopy, L5 is detected mostly in the nucleolus

  

Source: Dreyfuss, Gideon - Department of Biochemistry and Biophysics, University of Pennsylvania

 

Collection: Biology and Medicine

 
82 Molecular Phylogenetics and Evolution 43 (2007) 936951 www.elsevier.com/locate/ympev
 

Summary:  of parasitiform mites (Acari) based on rRNA Hans Klompen a,¤ , Mariam Lekveishvili a , William C. Black IV b... and partial 28S nuclear rRNA sequence data. Most currently recognized lineages are recovered with good support... , suggesting that nuclear rRNA, and speciWcally 18S rRNA, is very well suited for ...

  

Source: Kubatko, Laura S. - Departments of Statistics & Evolution, Ecology and Organismal Biology, Ohio State University

 

Collection: Environmental Sciences and Ecology ; Mathematics

 
83 Ribosomal Proteins S5 and L6: High-resolution Crystal Structures and Roles in Protein Synthesis and
 

Summary:  , including S2, S3, S4, S8, S12, S15 and S16 (Lambert et al., 1983; Capel et al., 1987), but the only protein... . More recently, de®ned regions of 16 S rRNA have also come to be associated with the ribosome's accuracy... S subunit, ribosomal protein L6 and the 2660 loop region of 23 S rRNA. Mutations have ...

  

Source: Ramakrishnan, Venki - Laboratory of Molecular Biology, MRC

 

Collection: Biology and Medicine

 
84 R. D. M. Page et al. Philoceanus-complex 1 of 53 Phylogeny of "Philoceanus-complex" seabird lice
 

Summary:  hosts is an artefact of limited taxonomic sampling. Keywords: Phthiraptera; Lice; Seabirds; 12S rRNA... for slide mounting as vouchers. The third domain of the mitochondrial 12S rRNA gene was amplified... al. Philoceanus-complex 6 of 53 Previously published ...

  

Source: Page, Roderic - Division of Environmental and Evolutionary Biology, Institute of Biomedical and Life Sciences, University of Glasgow

 

Collection: Environmental Sciences and Ecology

 
85 Proc. Natl. Acad. Sci. USA Vol. 95, pp. 99679972, August 1998
 

Summary:  from complete sequences of the mitochondrial 12S rRNA, tRNA-Valine, and 16S rRNA genes (2.6 kb). A wide... the nuclear AQP2, vWF, and A2AB genes as well as the mitochondrial 12S­16S rRNA genes (8, 9). The fossil... of insectivores, using ...

  

Source: Hedges, S. Blair - Department of Biology, Pennsylvania State University

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
86 Evolution of Ruminant Sarcocystis (Sporozoa) Parasites Based on Small Subunit rDNA Sequences
 

Summary:  structure for the third domain of animal 12S rRNA. Mol. Biol. Evol. 13: 150­169. Holmdahl, O. J. M... -infecting species. Furthermore, the rDNA sequences that repre- sent the different structural regions of the rRNA mol... the evolutionary patterns of character-state changes in the different structural ...

  

Source: Morrison, David - Department of Biomedical Sciences and Veterinary Public Health, Sveriges Lantbruksuniversitet

 

Collection: Environmental Sciences and Ecology

 
87 Decapod Phylogenetics And Molecular Evolution ALICIA TOON, MAEGAN FINLEY, JEFFREY STAPLES & KEITH A. CRANDALL
 

Summary:  Primer Sequence (5' ­ 3') NR Position Reference Sequence Primer Reference Mitochondrial Genes 12S rRNA 12... Bank. Taxon Voucher ID 12S rRNA 16S rRNA 18S rRNA 28S rRNA H3 EF-2 EPRS TM9SF4 Decapoda ...

  

Source: Crandall, Keith A. - Departments of Integrative Biology & Microbiology and Molecular Biology, Brigham Young University

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
88 JOURNAL OF CLINICAL MICROBIOLOGY, Aug. 2004, p. 37113730 Vol. 42, No. 8 0095-1137/04/$08.00 0 DOI: 10.1128/JCM.42.8.37113730.2004
 

Summary:  Reserved. Use of 16S rRNA, 23S rRNA, and gyrB Gene Sequence Analysis To Determine Phylogenetic... if variations in rRNA sequence could be used for discrimination of the members of the Bacillus cereus group, we... analyzed 183 16S rRNA and 74 23S rRNA sequences for all species in the B. ...

  

Source: Kelly, John J. - Department of Biology, Loyola University Chicago

 

Collection: Environmental Sciences and Ecology ; Environmental Management and Restoration Technologies

 
89 Structural evidence for specific S8RNA and S8protein interactions within the 30S ribosomal subunit: ribosomal
 

Summary:  in the 30S subunit are S2, S4, S5, S12, S15 and S17. In Escherichia coli, the S8-binding site within 16S rRNA... , S9 and S19, and by proteins S8, S15 and 1102 Structure 1996, Vol 4 No 9 #12;S17. Nucleic Acids Res... with 16S rRNA and is crucial for the correct ...

  

Source: Ramakrishnan, Venki - Laboratory of Molecular Biology, MRC

 

Collection: Biology and Medicine

 
90 Whence the Red Panda? John J. Flynn,* Michael A. Nedbal,*,1
 

Summary:  three mitochondrial genes (cyto- chrome b, 12S rRNA, and 16S rRNA) and one nuclear intron (transthyretin... of 3450 bp (851 bp of nuclear transthyretin intron I, 1140 bp of mt cyto- chrome b, 964 bp of mt 12S rRNA... character weightings were ...

  

Source: Museum of Southwestern Biology, Division of Mammals

 

Collection: Environmental Sciences and Ecology

 
91 Phylogeography of the African common toad, Amietophrynus regularis, based on mitochondrial
 

Summary:  populations in the Cape Verde archipelago. Portions of the 12S and 16S rRNA mitochondrial regions of 30... misidentified. Key words: Amietophrynus regularis, `Bufo', mitochondrial DNA, 12S and 16S rRNA, Cape Verde... is present. By sequencing part of the ...

  

Source: Carranza, Salvador - Institut de Biologia Evolutiva, Universitat Pompeu Fabra

 

Collection: Biology and Medicine

 
92 2006 The Authors. Journal compilation 2006 The Norwegian Academy of Science and Letters Zoologica Scripta, 35, 4, July 2006, pp353362 353 Daniels, S. R., Heideman, N. J. L., Hendricks, M. G. J. & Crandall, K. A. (2006). Taxonomic
 

Summary:  from four mito- chondrial loci (16S rRNA, 12S rRNA, cytochrome oxidase I and cytochrome b), as well... . In the present study, we use sequence data from four mitochondrial loci [16S rRNA, 12S rRNA and two protein... data ...

  

Source: Crandall, Keith A. - Departments of Integrative Biology & Microbiology and Molecular Biology, Brigham Young University

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
93 Extensive Intraindividual Variation in Plastid rDNA Sequences from the Holoparasite Cynomorium coccineum (Cynomoriaceae)
 

Summary:  ­1592, and 2200­2223 were excluded from this analysis. 330 #12;found that in mammalian mitochondrial 12S rRNA... of the mitochondrial 12S rRNA gene in mammals. Mol Biol Evol 12:1138­1150 Sta¨ dler T, Delph LF (2002) Ancient... words: 23S rRNA ...

  

Source: Nickrent, Daniel L. - Department of Plant Biology, Southern Illinois University

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
94 Mol. Biol. Evol. 19(3):263277. 2002 2002 by the Society for Molecular Biology and Evolution. ISSN: 0737-4038
 

Summary:  gene) and one mitochondrial gene (12S rRNA). A combined analysis produced a highly derived and well... ATGGGTAATAAAAGTAGTCTGA GCCCTCTGAGAACAGTTG GACCAAATAATYTTTCCDGAGA 12S rRNA. . . . . . . F R R F R F L651c 12GHc H147c L109... gene ...

  

Source: Rowe, Diane - School of Marine and Tropical Biology, James Cook University

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
95 The Norwegian Academy of Science and Letters Zoologica Scripta, 31, 1, February 2002, pp8391 83 Kjer, K. M., Blahnik, R. J. & Holzenthal, R. W. (2002). Phylogeny of caddisflies (Insecta,
 

Summary:  12S rRNA, domain III: conserved primary and secondary structural motifs. Journal of Herpetology, 31... relationships within Trichoptera. We have recently presented an analysis of 89 taxa with rRNA data... of the large subunit nuclear rRNA (D1, 334 nucleotides (nts); D3, 233 nts), the ...

  

Source: Holzenthal, Ralph W. - Department of Entomology, University of Minnesota

 

Collection: Environmental Sciences and Ecology

 
96 Author's personal copy Biochemistry
 

Summary:  levels of COX subunit 1 (encoded on the mitochondrial genome), mitochondrial 12S rRNA levels... and 12S rRNA levels were unchanged over the winter months in E. scudderiana, as was COX 1 DNA content... -translational modification. However, both COX transcript and ...

  

Source: Storey, Kenneth B. - Departments of Biology & Chemistry, Carleton University

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
97 Thursday, 21 January 2010 Bioenergetics option,
 

Summary:  Thursday, 21 January 2010 #12;Thursday, 21 January 2010 #12;Mammalian mitochondrial DNA 12S rRNA 16S rRNA... ND1 ND2ND3 COX2 COX1 COX3 A8/A6 ND5 cyt b OH OL 16.6 kb Protein (L) rRNA tRNA (H) Non-coding I V Luur

  

Source: Schnaufer, Achim - Institute of Immunology and Infection Research, University of Edinburgh

 

Collection: Biology and Medicine

 
98 DOI: 10.1126/science.1194294 , 1203 (2010);330Science
 

Summary:  -ratcheting. BA ES6 ES3 ES41 ES6 S22 S9 SX4 L19 L19 h16 S13 SX4 h26 ES7 eB11 eB12 eB12 S13 ES3 ES6 ES9 ES12 ES7 ES... counterpart (70S). The large 60S subunit consists of three rRNA (rRNA) molecules (25S, 5.8S, and 5S) and 46... proteins, whereas the small 40S subunit includes only one ...

  

Source: Bedwell, David M. - Department of Microbiology, University of Alabama at Birmingham

 

Collection: Biology and Medicine

 
99 MOLECULAR PHYLOGENETICS AND EVOLUTION Vol. 2, No.1, March, pp. 76-87, 1993
 

Summary:  ofthe mitochondrial12S ribosomal RNA (rRNA) and cytochrome (cyt) b genes that supported a robust... - values (>95%) in both neighbor-joining and parsimony analyses for the 12S rRNA and combined data sets... and Presch (1993) have combined our DNA sequences from the ...

  

Source: Hedges, S. Blair - Department of Biology, Pennsylvania State University

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
100 Molecular evidence on the origin of and the phylogenetic relationships
 

Summary:  living relatives of tetrapods (Fig. 18.3a) was based on two fragments of the mito- chondrial 12S rRNA... the phylogenetic analysis of com- plete 12S and 16S rRNA mitochondrial genes (Hedges et al. 1993). However... of mitochondrial com- plete ...

  

Source: Zardoya, Rafael - Biodiversidad y Biologia Evolutiva, Museo Nacional de Ciencias Naturales

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine


Page:   1  2  3  4  5