| Sample search results for: a2 peroxidase expression |
| 1 | Published in Plant Physiol Biochem (2008) 46, 760-767 Partial purification and characterization of a copper-induced anionic | ||
|
Summary: peroxidases, named A1, A2, A3, A4, and A5. These peroxidases had differential behavior during the period... and characterize the other peroxidases (A2-A5). 4. Materials and methods 4.1. Plant material Sunflower (Helianthus... of treatment. A1, ... |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 2 | Eur. J. Biochem. 267, 17611769 (2000) q FEBS 2000 Effects of cadmium on manganese peroxidase | ||
|
Summary: ., Alic, M. & Gold, M.H. (1994) Homologous expression of recombinant manganese peroxidase in Phanerochaete... ., Cereghino, G.P.L. & Gold, M.H. (1999) Homologous expression of recombinant lignin peroxidase... of bee venom phos- pholipase A2. Biochemistry 24, ... |
|||
|
Source: Youngs, Heather - Department of Biological Sciences, Michigan Technological University |
|||
|
Collection: Biology and Medicine |
|||
| 3 | Plant Physiol. (1993) 103: 665-666 Plant Cene Register | ||
|
Summary: with conserved regions of known peroxidases. Expression Characteristics: Both clones were expressed in roots... Plant Physiol. (1993) 103: 665-666 Plant Cene Register Nucleotide Sequences of Two Peroxidase Genes... , Indiana 47907-1 165 (P.M.H.) Peroxidases (EC 1.11.1.7.) are heme enzymes ... |
|||
|
Source: Málaga, Universidad de - Departamento de Biología Molecular y Bioquímica, Laboratorio de Bioquímica y Biotecnología Vegetal |
|||
|
Collection: Biology and Medicine |
|||
| 4 | A Tomato Peroxidase Involved in the Synthesis of Lignin and Suberin1 | ||
|
Summary: a combination of transgenic expression and antibody recognition, we now show that the peroxidase pI 9... ; Christensen et al., 1998). Other studies have used the expression of specific peroxidase genes in lignifying... information from kinetics, structural, and gene expression studies for ... |
|||
|
Source: Málaga, Universidad de - Departamento de Biología Molecular y Bioquímica, Laboratorio de Bioquímica y Biotecnología Vegetal |
|||
|
Collection: Biology and Medicine |
|||
| 5 | Enhanced Expression and Hydrogen Peroxide Dependence of Lignin Peroxidase from Streptomyces viridosporus T7A | ||
|
Summary: peroxidases and acid-precipitable polymeric lignin production by Streptomyces chromofuscus A2 and S... Enhanced Expression and Hydrogen Peroxide Dependence of Lignin Peroxidase from Streptomyces... Streptomyces species for lignin peroxidase activity. By enhancing ALiP ... |
|||
|
Source: Wood, Thomas K. - Department of Chemical Engineering, Texas A&M University |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 6 | Peroxidase activity and inducibility in the sea fan coral exposed to a fungal pathogen | ||
|
Summary: Peroxidase activity and inducibility in the sea fan coral exposed to a fungal pathogen Laura D... . In this study, we examined the role of the superfamily of peroxidase enzymes in the coral response... to a naturally occurring pathogen. We examined the inducibility of peroxidases by experimentally exposing corals |
|||
|
Source: Harvell, Catherine Drew - Department of Ecology and Evolutionary Biology, Cornell University |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 7 | A Symbiotic Plant Peroxidase Involved in Bacterial Invasion of the Tropical Legume Sesbania rostrata1[C][W][OA] | ||
|
Summary: class III plant peroxidase. The expression strictly depended on bacterial nodulation factors (NFs... stages of adventitious root nodule development are shown at 1 (A), 2 (B), 3 (C), 4 (G), and 6 (J) dpi... and to modulate Srprx1 expression. A putative substrate of the ... |
|||
|
Source: Gent, Universiteit - Department of Plant Systems Biology, Bioinformatics and Evolutionary Genomics Division |
|||
|
Collection: Biology and Medicine |
|||
| 8 | Journal of Chemical Ecology, Vol. 30, No. 7, July 2004 (C 2004) DIFFERENTIAL ACTIVITY OF PEROXIDASE ISOZYMES IN | ||
|
Summary: Greenhouse C1 9.87 C2 9.37 9.4 C3 8.89 C4 8.21 A1 5.84 A2 5.06 A3 4.82 A4 4.71 A5 4.56 A6 4.37 4.4 A6 4.20 4... .961 26.8 C3 9 -5.92 (5.60) -1.056 7.1 C4 7 1.23 (0.28) 4.406 1.2 A1 6 0.40 (0.19) 2.080 0.3 A2 5 0.49 (0... ) expressing tobacco anionic peroxidase. Cell. ... |
|||
|
Source: Allison, Steven D. - Departments of Ecology and Evolutionary Biology & Earth System Science, University of California, Irvine |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 9 | The Structure of Reduced Tryparedoxin Peroxidase Reveals a Decamer and Insight into Reactivity of | ||
|
Summary: -a1-b4-a2-b5). Figure 1. The trypanothione per- oxidase pathway. NADPH inputs reducing equivalents... of the protein, is distorted near Ser61. A second segment of 310-helix (y2) occurs between a2 and b5. A b... is close to subunit J of an adjacent dimer, i.e. less than 11 AÊ from Tyr82 J of ... |
|||
|
Source: Fairlamb, Alan - Division of Biological Chemistry and Molecular Microbiology, University of Dundee |
|||
|
Collection: Biology and Medicine |
|||
| 10 | Molecular Evolution and Diversity of Lignin Degrading Heme Peroxidases in the Agaricomycetes | ||
|
Summary: Molecular Evolution and Diversity of Lignin Degrading Heme Peroxidases in the Agaricomycetes Ingo... The plant and microbial peroxidase superfam- ily encompasses three classes of related protein families... . Class I includes intracellular peroxidases of prokaryotic origin, class II includes secretory fungal |
|||
|
Source: Hibbett, David S. - Department of Biology, Clark University |
|||
|
Collection: Biology and Medicine |
|||
| 11 | Halide Peroxidase in Tissues That Interact With Bacteria in the Host Squid Euprymna scolopes | ||
|
Summary: -dependent peroxidase is consistently expressed in high concentration in tissues that interact bacteria. Elevated levels... with the presence of bacteria, we also have evidence for abundant peroxidase gene expression, protein production and... of the peroxidase in the light organ suggest ... |
|||
|
Source: Ruby, Edward G. - Department of Medical Microbiology and Immunology, University of Wisconsin at Madison |
|||
|
Collection: Biology and Medicine |
|||
| 12 | Molecular & Biochemical Parasitology 116 (2001) 171183 Molecular characterisation of mitochondrial and cytosolic | ||
|
Summary: was not clearly demonstrated. We report here the expression and characterisation of two tryparedoxin peroxidase... as tryparedoxin peroxidases, T. brucei TRYX, TRYP1 and TRYP2 were cloned into an expression vector (pET-15b... the bloodstream (Fig. 5a1, a2, and b) and ... |
|||
|
Source: Fairlamb, Alan - Division of Biological Chemistry and Molecular Microbiology, University of Dundee |
|||
|
Collection: Biology and Medicine |
|||
| 13 | Reaction Mechanism of Compound I Formation in Heme Peroxidases: A Density Functional Theory Study | ||
|
Summary: performed by Kuramochi et al. the 4A2u and the 2A2u states were found to be (23) Frisch, M. J.; Trucks, G. W... . Also, the spin distribution obtained for the 4A2u state was found to be close to that for the 2A2u... Reaction ... |
|||
|
Source: Siegbahn, Per E.M. - Department of Physics, Stockholms Universitet |
|||
|
Collection: Chemistry |
|||
| 14 | Structure 14, 107117, January 2006 2006 Elsevier Ltd All rights reserved DOI 10.1016/j.str.2005.09.011 Activation and Catalysis | ||
|
Summary: lines indicate hydrogen bonds. Cytochrome c Peroxidase from P. pantotrophus 111 #12;1407 to 1723 A° 2... exposed (1 A° 2 ) than in the oxidized form (19 A° 2 ). The ethoxyformylation of this histidine... in the structure (1 ... |
|||
|
Source: Fülöp, Vilmos - Department of Biological Sciences, University of Warwick |
|||
|
Collection: Biology and Medicine |
|||
| 15 | Biochem. J. (2008) 414, 375381 (Printed in Great Britain) doi:10.1042/BJ20080889 375 Structural and mechanistic insights into type II trypanosomatid | ||
|
Summary: , GPX5 and GPX7 (2F8A, 2HE3, 2R37, 2OBI [28], 2I3Y and 2P31), and the two PtGPX5 structures (2P5Q and 2P... .9 X Resolution (A°) 58.0-2.1 Observed reflections 37396 Unique reflections 9469 Wilson B (A°2 ) 27... (A°2 ) Overall 27.7 Main chain 27.2 Side chain 28.1 ... |
|||
|
Source: Fairlamb, Alan - Division of Biological Chemistry and Molecular Microbiology, University of Dundee |
|||
|
Collection: Biology and Medicine |
|||
| 16 | Proc. Natl. Acad. Sci. USA Vol. 93, pp. 1368313688, November 1996 | ||
|
Summary: in the establishment and maintenance of this association, it may serve to modulate expression of the squid peroxidase... Proc. Natl. Acad. Sci. USA Vol. 93, pp. 1368313688, November 1996 Biochemistry A peroxidase... -specific or -enhanced gene expression in one or both partners, but a clear example of this ... |
|||
|
Source: Ruby, Edward G. - Department of Medical Microbiology and Immunology, University of Wisconsin at Madison |
|||
|
Collection: Biology and Medicine |
|||
| 17 | Mycologia, 95(2), 2003, pp. 209221. 2003 by The Mycological Society of America, Lawrence, KS 66044-8897 | ||
|
Summary: Isolate Isolate No.a mnpb Location Host Heterobasidion abietinum B1089*c B1090* B1162* B1165* B1166* 1a, 2... , 3 1a, 2, 3 1a, 2, 3 3 la, 2, 3 Italy Italy Greece Bulgaria Bulgaria Abies alba Abies alba A... lambertiana Picea abies H. annosum-European B298* B299* ... |
|||
|
Source: Harrington, Thomas C. - Departments of Natural Resource Ecology and Management & Plant Pathology, Iowa State University |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 18 | Expression of a highly basic peroxidase gene in NaCl-adapted tomato cell suspensions | ||
|
Summary: Expression of a highly basic peroxidase gene in NaCl-adapted tomato cell suspensions Mar|èa I... 12 March 1997 Abstract A tomato peroxidase gene, TPX2, that is only weakly expressed in the roots... the transcript level of the tomato peroxidase gene tap1 [11]. TPX2 ... |
|||
|
Source: Málaga, Universidad de - Departamento de Biología Molecular y Bioquímica, Laboratorio de Bioquímica y Biotecnología Vegetal |
|||
|
Collection: Biology and Medicine |
|||
| 19 | Molecular and Biochemical Parasitology 96 (1998) 111123 Cloning, expression and reconstitution of the | ||
|
Summary: X) and tryparedoxin peroxidase (TryP) genes from C. fasciculata, their expression in Escherichia coli... Package. 2.7. Expression of tryparedoxin and tryparedoxin peroxidase in E. coli E. coli strain BL21(DE3... ... |
|||
|
Source: Fairlamb, Alan - Division of Biological Chemistry and Molecular Microbiology, University of Dundee |
|||
|
Collection: Biology and Medicine |
|||
| 20 | Peroxidase-dependent apoplastic oxidative burst in Arabidopsis required for pathogen resistance | ||
|
Summary: the peroxidase(s) that are down- regulated in the transgenic FBP-1 anti-sense lines, RNA- expression profiles... play a role in the Arabidopsis oxidative burst, we expressed a cDNA encoding the French bean peroxidase... an inducible system for targeted reduction of At3g49110 and At3g49120 ... |
|||
|
Source: Ausubel, Frederick M. - Department of Genetics, Harvard University |
|||
|
Collection: Biology and Medicine |
|||
| 21 | Accessibility of Oxygen With Respect to the Heme Pocket in Horseradish Peroxidase | ||
|
Summary: kcal/mol/A2 to ensure the overall stability of the protein structure during the course... Accessibility of Oxygen With Respect to the Heme Pocket in Horseradish Peroxidase Mazdak Khajehpour... system studied in this case is horseradish peroxidase (HRP). We have converted the native HRP |
|||
|
Source: Sharp, Kim - Department of Biochemistry and Biophysics, University of Pennsylvania |
|||
|
Collection: Biology and Medicine ; Chemistry |
|||
| 22 | Differential compartmentation of o-diphenols and peroxidase activity in the inner sapwood of the Juglans nigra tree | ||
|
Summary: - Verlag, Berlin, 1987. [12] Lagrimini L.M., Plant Peroxidases: under- and over- expression in transgenic... Differential compartmentation of o-diphenols and peroxidase activity in the inner sapwood... , phenolic compounds and peroxidases (PODs, EC 1.11.1.7) are most likely involved in the generation |
|||
|
Source: Mondolot, Laurence - Centre dEcologie Fonctionnelle et Evolutive, Université Montpellier I |
|||
|
Collection: Biology and Medicine |
|||
| 23 | Calcium-Dependent Heme Structure in the Reduced Forms of the Bacterial Cytochrome c Peroxidase from Paracoccus pantotrophus | ||
|
Summary: A2g mode [19 red , near 1581 cm-1 (Figure S1)]. This line is apparently activated by heme reduction... Calcium-Dependent Heme Structure in the Reduced Forms of the Bacterial Cytochrome c Peroxidase from... of Paracoccus pantotrophus bacterial cytochrome c peroxidase. The spectra of the active mixed-valence ... |
|||
|
Source: Shelnutt, John A. - Advanced Materials Laboratory, Sandia National Laboratories |
|||
|
Collection: Chemistry ; Materials Science |
|||
| 24 | Biochemistry 1983,22, 4769-4774 4769 activity of human erythrocyte membrane protein extract. The | ||
|
Summary: absorption differences are due to the formation of an A2,,and an Alu a cation radical species, respectively... A D I C A L I N H R P I V O L . 2 2 , N O . 2 0 , 1 9 8 3 4773 tell whether an AI, or A2,,orbital... compound I, in contrast, is placed in the A2, radical ... |
|||
|
Source: Hendrich, Mike - Department of Chemistry, Carnegie Mellon University |
|||
|
Collection: Chemistry ; Biology and Medicine |
|||
| 25 | Technical Note Human IL-6 chemiluminescent ELISA using SwordTM Peroxidase | ||
|
Summary: Technical Note 1 Human IL-6 chemiluminescent ELISA using SwordTM Peroxidase Reagents Sensitive... ELISA Reagents QuantiGlo® Human IL-6 Immunoassay (R&D Systems, MN) Sword Peroxidase Reagents (Sword... insert1 up until the addition of chromogen, when Sword Peroxidase Reagents were substituted |
|||
|
Source: Koehler, Carla - Department of Chemistry and Biochemistry, University of California at Los Angeles |
|||
|
Collection: Chemistry ; Biology and Medicine |
|||
| 26 | APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Oct. 2010, p. 64316440 Vol. 76, No. 19 0099-2240/10/$12.00 doi:10.1128/AEM.00547-10 | ||
|
Summary: peroxidase used in the comparison. Comparison of relative expression levels. Quantitative RT- PCR experiments... . 1990. Manganese regulates expression of manganese peroxidase by Phanerochaete chrysosporium. J. Bac... . Hsieh. 2009. Cloning and heterologous expression of a novel ... |
|||
|
Source: Hibbett, David S. - Department of Biology, Clark University |
|||
|
Collection: Biology and Medicine |
|||
| 27 | Journal of Experimental Botany, Vol. 61, No. 2, pp. 491502, 2010 doi:10.1093/jxb/erp318 Advance Access publication 30 October, 2009 | ||
|
Summary: nd nd Tissue-specific peroxidase expression in cress seeds | 495 by on 9 January 2010http... expression Quantitative PCR was used to quantify the expression of the three peroxidases found in our... -specific peroxidase expression in cress seeds | ... |
|||
|
Source: Leubner, Gerhard - Institut für Biologie II, Albert-Ludwigs-Universität Freiburg |
|||
|
Collection: Biology and Medicine |
|||
| 28 | Linking microbial community composition to function in a tropical soil M.P. Waldrop*, T.C. Balser, M.K. Firestone | ||
|
Summary: .6y P (mg 100 g 1 ) 4.8ax 8.8a 3.8b 4.3x 9.7x S (mg 100 g 1 ) 1.3ax 1.8a 2.3a 1.7x 2.6y Zn (mg 10 kg 1... .56y 6.13z a17:0 2.57ax 2.15b 2.20b 2.02y 2.28z Gram 16:1c7/15:0 2OH 2.40abx 2.65a 2.04b 2.57x 2.25x i... .90b 1.45a 2.04y 1.48x Actinomycete 18:0 10Me 0.90ax ... |
|||
|
Source: Balser, Teri C. - Department of Soil Science, University of Wisconsin at Madison |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 29 | Living organisms when growing aerobically produce reactive oxygen species (ROS) including superoxide | ||
|
Summary: (wild type K12, F thr 1 leuB6 proA2 his 4 thi 1 argE2 lacY1 galK2 rpsL supE44 ara 14 xyl 15 mtl 1 tsx... .98* 0.184 ± 0.061 1.94 ± 0.23a 0.163 ± 0.025a 2.27 ± 0.23a oxygenation 0.129 ± 0.047 2.57 ± 0.032 0... ), catalases, and peroxidases [7, 9 11]. Most enzymes involved in the ... |
|||
|
Source: Storey, Kenneth B. - Departments of Biology & Chemistry, Carleton University |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 30 | Plant Cell Physiol. 45(3): 290299 (2004) JSPP 2004 | ||
|
Summary: (nirA) 2.92±0.54 slr0364 : hypothetical protein 2.85±0.07 sll0681 : phosphate transport system permease... : 30S ribosomal protein S3 (rps3) 2.75±0.02 sll1397 : putative transposase (ISY100_a) 2.69±0.98 sll1071... 2.57±1.39 sll1771 : protein serin-threonin phosphatase (pphA) ... |
|||
|
Source: Pakrasi, Himadri - Department of Biology, Washington University in St. Louis |
|||
|
Collection: Biology and Medicine |
|||
| 31 | Biochemistry 1984, 23, 6809-68 16 6809 Chloroperoxidase Compound I: Electron Paramagnetic Resonance and | ||
|
Summary: with kA,2 A = 79.5 K as found by fitting the spin relaxationdata, we find D / k = 52 K, which... data are consistentwith the model of an exchange-coupled T e peroxidase family of enzymes is dominated... than the resting enzyme by one (11) and two (I) electrons, re- spectively. Oxidized peroxidases can |
|||
|
Source: Hendrich, Mike - Department of Chemistry, Carnegie Mellon University |
|||
|
Collection: Chemistry ; Biology and Medicine |
|||
| 32 | Developmental Cell, Vol. 7, 801814, December, 2004, Copyright 2004 by Cell Press The Oxidative Burst at Fertilization Is Dependent | ||
|
Summary: _0004_A2_F05_SP6E; http://sugp.caltech.edu), and the am- for surface area and volume were made using... in fertilized eggs is theand Jaffe, 2001). Such a chemiluminescent reporter ac- tivity is peroxidase dependent... measurements were made relying on endogenousabsence of exogenous horseradish peroxidase ... |
|||
|
Source: Wessel, Gary M. - Department of Molecular Biology, Cell Biology and Biochemistry, Brown University |
|||
|
Collection: Biology and Medicine |
|||
| 33 | A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major | ||
|
Summary: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major Janine Ko... -dependent glutathione peroxidases (GPXs), glutathione-dependent 1-Cys peroxiredoxins, Keywords glutathione peroxidase... ; Leishmania; peroxiredoxin; trypanothione; tryparedoxin peroxidase Correspondence A. H. ... |
|||
|
Source: Fairlamb, Alan - Division of Biological Chemistry and Molecular Microbiology, University of Dundee |
|||
|
Collection: Biology and Medicine |
|||
| 34 | Communication Vol. 264, No. 3 Issue of January 25, pp. 1345-1348,1989 THEJOURNALOF BIOLOGICALCHEMISTRY | ||
|
Summary: in dysgenic muscle. Also present in dys- genic muscleis the 175/15O-kDa glycoprotein subunit (a2... recognizedby various antibodies. The a2 subunit of the dihydropyridine receptorwas also recognized bya... polyclonal antibody against rabbit a2, but antibodies to the ... |
|||
|
Source: Campbell, Kevin P. - Department of Physiology and Biophysics, University of Iowa |
|||
|
Collection: Biology and Medicine |
|||
| 35 | Sea urchin ovoperoxidase: oocyte-specific member of a heme-dependent peroxidase superfamily that functions in the block to polyspermy | ||
|
Summary: Sea urchin ovoperoxidase: oocyte-specific member of a heme-dependent peroxidase superfamily... - dependent animal peroxidase family, including the mammalian myelo-, lacto-, eosinophil, and thyroid... peroxidases. Using in situ RNA hybridizations, we showed that the mRNA of S. purpuratus ovoperoxidase (4 kb |
|||
|
Source: Wessel, Gary M. - Department of Molecular Biology, Cell Biology and Biochemistry, Brown University |
|||
|
Collection: Biology and Medicine |
|||
| 36 | Peroxidase Activity in Heme Proteins Derived from a Designed Combinatorial Library | ||
|
Summary: + AH2 98 k3 E + AH· (3) Figure 1. Screen for peroxidase activity. Proteins were expressed... Peroxidase Activity in Heme Proteins Derived from a Designed Combinatorial Library David A. Moffet... heme proteins function as peroxidases. Natural peroxidases such as horseradish ... |
|||
|
Source: Hecht, Michael H. - Departments of Chemistry & Molecular Biology, Princeton University |
|||
|
Collection: Chemistry ; Biotechnology |
|||
| 37 | A Catalysis-Based Selection for Peroxidase Antibodies with Increased Jun Yin, Jeremy H. Mills, and Peter G. Schultz* | ||
|
Summary: determined. In general, higher levels of peroxidase activity resulted from three factors: higher expression... A Catalysis-Based Selection for Peroxidase Antibodies with Increased Activity Jun Yin, Jeremy H... -mail: schultz@scripps.edu Affinity-based selections involving libraries of peptides or proteins ... |
|||
|
Source: Yin, Jun - Department of Chemistry, University of Chicago |
|||
|
Collection: Chemistry |
|||
| 38 | Development of cyclic Voltammetry Assays and Instrumentaion for detection and Quantification of Analyte Concentration | ||
|
Summary: , Electrical and Computer Engineering Department Abstract Peroxidases catalyze the oxidation of a wide variety... of substrates including benzidine. Mammalian tissue contain peroxidases and the peroxidatic activity of blood... ,3'5,5' Tetramethylbenzidine (TMB) and Horse Radish Peroxidase (HRP) is widely used for detection of ... |
|||
|
Source: Mountziaris, T. J. - Department of Chemical Engineering, University of Massachusetts at Amherst |
|||
|
Collection: Materials Science |
|||
| 39 | JOURNAL OF BACTERIOLOGY, June 2004, p. 40424045 Vol. 186, No. 12 0021-9193/04/$08.00 0 DOI: 10.1128/JB.186.12.40424045.2004 | ||
|
Summary: electron donors to cytochrome c peroxidases of other bacteria (14). To further evaluate the expression... ), macA2 (GATTAAGTGCGAAG CCGAAAGC), macA3 (GTTCTTCGATCCGCGGCTTTCAT GAATGTCAGCTACTGG), macA4... , designated MacA, was more highly expressed during growth with Fe(III) as the electron ... |
|||
|
Source: Lovley, Derek - Department of Microbiology, University of Massachusetts at Amherst |
|||
|
Collection: Environmental Management and Restoration Technologies ; Biology and Medicine |
|||
| 40 | ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Apr. 2008, p. 13591365 Vol. 52, No. 4 0066-4804/08/$08.00 0 doi:10.1128/AAC.01563-07 | ||
|
Summary: peroxidase of Leishmania donovani: molecular cloning, heterologous expression, specific- ity, and catalytic... . Roles of Trypanothione S-Transferase and Tryparedoxin Peroxidase in Resistance to Antimonials Susan... such as chlorodinitrobenzene as well as peroxidase activity with alkyl and aryl hydroperoxides ... |
|||
|
Source: Fairlamb, Alan - Division of Biological Chemistry and Molecular Microbiology, University of Dundee |
|||
|
Collection: Biology and Medicine |
|||
| 41 | 431RESEARCH ARTICLE INTRODUCTION | ||
|
Summary: with the major structural proteins (Wong and Wessel, 2006a). (2) Environmental alkalination auto... ; Oppen-Berntsen et al., 1990) and sea urchins (Battaglia and Shapiro, 1988). Peroxidase, however, forms... a peroxidase-dependent mechanism, with dynamics that parallel requisite production of hydrogen ... |
|||
|
Source: Wessel, Gary M. - Department of Molecular Biology, Cell Biology and Biochemistry, Brown University |
|||
|
Collection: Biology and Medicine |
|||
| 42 | 2,4-Dichlorophenol Degradation Using Streptomyces viridosporus T7A Lignin Peroxidase | ||
|
Summary: 2,4-Dichlorophenol Degradation Using Streptomyces viridosporus T7A Lignin Peroxidase Dennis C. Yee... peroxidase ALiP-P3. The ALiP-P3-catalyzed oxidation of 2,4-dichlorophenol (DCP) was examined to understand... peroxidase assay, and the kinetics were best modeled with a random-binding bireactant system, which differs |
|||
|
Source: Wood, Thomas K. - Department of Chemical Engineering, Texas A&M University |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 43 | BioMed Central Open Access | ||
|
Summary: performed following a modified hot borate procedure optimized for Gossypium [43]. From each pair of A2 and D... . For each gene, dif- ferences were calculated using pair-wise contrasts between A2 vs D5, wild G. hirsutum... for cytosolic ascorbate peroxidase1 ... |
|||
|
Source: Wendel, Jonathan F. - Department of Ecology, Evolution, and Organismal Biology, Iowa State University |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 44 | Role of arginine 177 in the MnII binding site of manganese peroxidase | ||
|
Summary: of manganese peroxidase gene expression. Appl. Environ. Microbiol. 60, 1353±1358. 45. Mayfield, M.B., Kishi, K... ., Alic, M. & Gold, M.H. (1994) Homologous expression of recombinant manganese peroxidase in Phanerochaete... Role of arginine 177 in the MnII binding site of manganese ... |
|||
|
Source: Youngs, Heather - Department of Biological Sciences, Michigan Technological University |
|||
|
Collection: Biology and Medicine |
|||
| 45 | Structure, mechanism and regulation of peroxiredoxins | ||
|
Summary: of dimers [an (a2)5 decamer], consistent with observations that 2-Cys Prx dimers can form discrete higher... -order oligomers. AhpC from Amphi- bacillus xylanus, another 2-Cys Prx, also crystallizes as an (a2)5 decamer [37... proteins, also termed the thio- redoxin peroxidases and ... |
|||
|
Source: Wood, Matthew J. - Department of Environmental Toxicology, University of California, Davis |
|||
|
Collection: Biology and Medicine |
|||
| 46 | Amphitrite ornata dehaloperoxidase: enhanced activity for the catalytically active globin using MCPBA | ||
|
Summary: . To ascertain that this enzymatic activity is intrinsic to DHP, we have cloned and expressed the enzyme... donor. Parallel studies have been carried out using horseradish peroxidase and myoglobin to calibrate... the activity of DHP versus typical peroxidase and globin proteins, respectively. Ó 2004 Elsevier Inc. All |
|||
|
Source: Ely, Bert - Department of Biological Sciences, University of South Carolina |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 47 | Improved germination under osmotic stress of tobacco plants overexpressing a cell wall peroxidase | ||
|
Summary: or enhanced expression under di¡erent biotic and/or abiotic stresses [10,11]. Peroxidases have been shown... ¡ect of increased TPX2 peroxidase activity in cell wall and adaptation to osmotic stress. Over- expression... TPX2 lines (Fig. 1B). Total peroxidase activity generally correlated ... |
|||
|
Source: Málaga, Universidad de - Departamento de Biología Molecular y Bioquímica, Laboratorio de Bioquímica y Biotecnología Vegetal |
|||
|
Collection: Biology and Medicine |
|||
| 48 | The Quantum Mixed-Spin Heme State of Barley Peroxidase: A Paradigm for Class III Peroxidases | ||
|
Summary: isoenzyme A2 (HRPA2), soy- bean peroxidase (SBP), and BP 1, using electronic absorp- tion and resonance... , and A2 (deRopp et al., 1997). It Received for publication 5 February 1999 and in final form 15 April... The Quantum Mixed-Spin Heme State of Barley Peroxidase: ... |
|||
|
Source: Shelnutt, John A. - Advanced Materials Laboratory, Sandia National Laboratories |
|||
|
Collection: Chemistry ; Materials Science |
|||
| 49 | CRYSTALLIZATION NOTE Crystallization of Recombinant Crithidia fasciculata Tryparedoxin | ||
|
Summary: purified from an Escherichia coli expression system and used in crystallization trials. Orthorhombic... and a variety of peroxidases, including glutathione peroxidase. Glutathione peroxi- dase works with glutathione... ). However, trypanosomatids do not contain glutathione reduc- tase or glutathione ... |
|||
|
Source: Fairlamb, Alan - Division of Biological Chemistry and Molecular Microbiology, University of Dundee |
|||
|
Collection: Biology and Medicine |
|||
| 50 | Adenosine A2A receptor in the monkey basal ganglia: ultrastructural localization and co-localization with the metabotropic glutamate receptor 5 in the striatum | ||
|
Summary: microscopic (LM) immunohistochemical data (Rosin et al., 1998) have described high levels of A2AR expression... , and terminals express A2AR immunoreactivity in the rat striatum (Hettinger et al., 2001). Furthermore, double... , or somatostatin, indicating a ... |
|||
|
Source: Hall, Randy A - Department of Pharmacology, Emory University |
|||
|
Collection: Biology and Medicine |
|||
| 51 | Redox-Linked Structural Changes Associated with the Formation of a Catalytically Competent Form of the Diheme Cytochrome c Peroxidase from Pseudomonas | ||
|
Summary: of the Diheme Cytochrome c Peroxidase from Pseudomonas aeruginosa, Aude Echalier,§,| Thomas Brittain, Joshua... form of the prototypic diheme bacterial cytochrome c peroxidase (BCCP) from Pseudomonas aeruginosa (Psa... CCP) has been expressed in Escherichia coli and purified to homogeneity. This material was used to carry |
|||
|
Source: Fülöp, Vilmos - Department of Biological Sciences, University of Warwick |
|||
|
Collection: Biology and Medicine |
|||
| 52 | 47 00' 46 45' | ||
|
Summary: 2A 2C 3A 3B #12;... Ify the gene copies of heme- peroxidase, Auran&monas SSU rRNA and total bacterial... .7% of heme- peroxidase genes quanIfied suggesIng that peroxidase driven manganese |
|||
|
Source: Center for Coastal Margin Observation and Prediction (CMOP) |
|||
|
Collection: Environmental Sciences and Ecology ; Geosciences |
|||
| 53 | -gal immunohistochemistry (Black Lab 2005) -The primary antibody we use is from ICN (now MP). It is | ||
|
Summary: serum in 1x PBS. - For transgenic lines that express high levels of - galactosidase we embed the embryo... longer. - For lines that express lower levels of -gal, including the GT- Rosa line (ROSA26R), we have... mins. - If you are planning to use a peroxidase conjugated secondary antibody, incubate the sections |
|||
|
Source: Black, Brian - Cardiovascular Research Institute, University of California at San Francisco |
|||
|
Collection: Biology and Medicine |
|||
| 54 | 1. Lignocellulosic materials Lignocellulose is a renewable organic material | ||
|
Summary: lignocellulolytic en- zymes, lignin peroxidase and alcohol oxidase (H2O2-generating enzyme) are highly expressed... . These enzymes include phenol oxidase (laccase) and heme peroxidases [lignin peroxidase (LiP), manganese... peroxidase (MnP) and versatile peroxidase ... |
|||
|
Source: Qin, Wensheng - Department of Biology, Lakehead University |
|||
|
Collection: Biology and Medicine ; Renewable Energy |
|||
| 55 | Archives of Insect Biochemistry and Physiology 51:151169 (2002) Published 2002 Wiley-Liss, Inc. | ||
|
Summary: .16a Leafminer 0.58 ± 0.27a 8.51 ± 8.36a 65.6 ± 42.83a 2.70 ± 1.03b 1.06 ± 0.47b Split plot ANOVA (F... ,3-glucanases, peroxidases, chitosanases, etc.). Induction of the PR proteins by SLW feeding occurs in various... chitinase and peroxidase. Evaluation of pathogen growth 3 weeks after inoculation showed ... |
|||
|
Source: Inbar, Moshe - Department of Evolutionary and Environmental Biology, University of Haifa |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 56 | Published in: Electrophoresis 24:3421-3432 (2003) Proteomics of loosely bound cell wall proteins of Arabidopsis | ||
|
Summary: F6 F7 F8 F9 F10 F13 F11 F12 F14 F15 F16 ni 100 A3 A4 A5 A6 A7 A8 A9 A10 A11 A12A13 A1 A2 A17 A16 A15... F6 F7 F8 F9 F10 F13 F11 F12 F14 F15 F16 ni 100 A3 A4 A5 A6 A7 A8 A9 A10 A11 A12A13 A1 A2 A17 A16 A15... A3 A4 A5 A6 A7 A8 A9 A10 A11 A12A13 A1 A2 A17 A16 A15 A14 ... |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 57 | Nonlinear Dynamics of the Peroxidase-Oxidase Reaction. II. Compatibility of an Extended Model with Previously Reported Model-Data Correspondences | ||
|
Summary: c 6.4 × 104 5.1 [35] R1d 2.15 × 103 5.1 [35] Reactions Involving NAD2 R3a 2.7 × 105 5.1 [35] R4a 1... Nonlinear Dynamics of the Peroxidase-Oxidase Reaction. II. Compatibility of an Extended Model... to account for other results. Here, we consider a recently proposed model of the peroxidase-oxidase reaction |
|||
|
Source: Schaffer, William M. - Department of Ecology and Evolutionary Biology, University of Arizona |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 58 | Crystal structure of the di-haem cytochrome c peroxidase from Pseudomonas aeruginosa | ||
|
Summary: between the monomers is 1277 A2 (8.3% of the surface area of the monomer). The subunit interactions... is 1326 A2 (8.7% of the surface area of the monomer), similar to the buried area between the two monomers... a hexa- coordinated calcium with somewhat similar ligation in human phospholipase ... |
|||
|
Source: Fülöp, Vilmos - Department of Biological Sciences, University of Warwick |
|||
|
Collection: Biology and Medicine |
|||
| 59 | 0022-1 554I82Il0098308S02. 5 The Journal of Histochemistry and Cytochemistry | ||
|
Summary: .W.L.; C.P.L.. McGill University. Montreal. Quebec. Canada H3A 2B2 and National institute of Dental... polypeptide chains, a,(IV) and a2(IV) (9,14,25,27). By anal- ogy with other collagen types, it is generally... yolk sac with peroxidase-labeled Fab' from antibodies to the matrix of a ... |
|||
|
Source: Laurie, Gordon W.- Department of Cell Biology, University of Virginia |
|||
|
Collection: Biology and Medicine |
|||
| 60 | BioMed Central Page 1 of 16 | ||
|
Summary: ], a cation exchange chro- matography was performed using an FPLC device (Figures 1A, 2A). Fractions were... , pectin methylesterases and peroxidases, new proteins were identified such as proteases, proteins related... to Roudier et al. [26], Baumberger et al. [27], and Fowler et al. [28]. Peroxidases were ... |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 61 | The Role of Glu39 in MnII Binding and Oxidation by Manganese Peroxidase from | ||
|
Summary: ), DDE (E39D-E39D-D179E) (0), and E39A (2). The wild type (O) and E39D (b) are shown in the inset... The Role of Glu39 in MnII Binding and Oxidation by Manganese Peroxidase from Phanerochaete... Ved December 21, 2000 ABSTRACT: Manganese peroxidase (MnP) is a heme-containing enzyme produced by white |
|||
|
Source: Youngs, Heather - Department of Biological Sciences, Michigan Technological University |
|||
|
Collection: Biology and Medicine |
|||
| 62 | Stress response, cell death and signalling: the many faces of reactive oxygen species | ||
|
Summary: . 2001). There is also some evidence that phospholipases A1 and A2, which hydrolyse phospholipids... enzyme with glutathione peroxi- dase and phospholipase A2 activities. J Biol Chem 275: 2842128427 Chen Z... , Allan and Fluhr 1997, Pellinen et al. 1999, Bolwell et al. 2002). Major ROS sources are ... |
|||
|
Source: Fedoroff, Nina V.- Huck Institutes of the Life Sciences & Department of Biology, Pennsylvania State University |
|||
|
Collection: Biology and Medicine |
|||
| 63 | Plant Molecular Biology 49: 515532, 2002. 2002 Kluwer Academic Publishers. Printed in the Netherlands. | ||
|
Summary: , incompatible interaction). The time points of the kinetics indicated at the bottom were: 0h, a; 2h, b; 4h, c; 8... GST expression in response to treatment with phytohormones, herbicides, oxidative stress and inoculation... expression in this super-family is controlled by multiple mechanisms. The respective ... |
|||
|
Source: Mauch, Felix - Department of Biology - Plant Biology, Université de Fribourg Suisse |
|||
|
Collection: Biology and Medicine |
|||
| 64 | electronic reprint Acta Crystallographica Section D | ||
|
Summary: -containing bifunc- tional enzymes capable of acting as both catalases and peroxidases. The C-terminal domain of HPI... % sequence identity with cytochrome c peroxidase (CCP) from Saccharomyces cerevisae, despite lacking... catalase±peroxidases are found in a wide variety of organisms including bacteria, archaebacteria and lower |
|||
|
Source: Guarne, Alba - Department of Biochemistry and Biomedical Sciences, McMaster University |
|||
|
Collection: Biology and Medicine |
|||
| 65 | ANTIOXIDANTS & REDOX SIGNALING Volume 3, Number 3, 2001 | ||
|
Summary: glutathione peroxidase-1 (GPx-1), modulates NFkB activation following UV irradiation, tumor necrosis factor... , glutathione peroxidase (GPx), and thioredoxin-dependent peroxidase. Among them, GPx is recognized as playing... in the nucleus (41), and is the only member of this family that is expressed in all ... |
|||
|
Source: Engelhardt, John F. - Department of Anatomy and Cell Biology, University of Iowa |
|||
|
Collection: Biology and Medicine |
|||
| 66 | J. Phys. Chem. 1993,97, 8431-8441 8431 Nonlinear Analyses of Periodic and Chaotic Time Series from the Peroxidase-Oxidase Reaction | ||
|
Summary: . Thevalues of k3 are (a) 2.5 X 1W2,(b) 3.3 X 1W2, and (c) 3.5 X l e 2 . Other rate constantsare kl = 0.35, k2... the Peroxidase-Oxidase Reaction Torben Geest,+* Lars F. Olsen,*l+*$Curtis G. Steinmetz,#Raima Larter,#and William... ,westudyperiodicandchaoticfluctuations in the peroxidase-oxidase reaction. The ... |
|||
|
Source: Schaffer, William M. - Department of Ecology and Evolutionary Biology, University of Arizona |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 67 | Thioredoxin-like domain of human k class glutathione transferase reveals sequence homology | ||
|
Summary: and a bba motif (b3b4a10) linked by an a-helix (a2) to form a four-stranded b-sheet surrounded by three a... identical. The dimer interface buries 1386 A° 2 solvent-accessible surface area of 2362 Protein Science, vol... is well ordered, with a mean B value of 25 A° ... |
|||
|
Source: Tian, Weidong - Institute of Biochemistry and Cell Biology, Shanghai Institute of Biological Sciences |
|||
|
Collection: Biology and Medicine |
|||
| 68 | Dev Genes Evol (2006) 216: 5768 DOI 10.1007/s00427-005-0032-9 | ||
|
Summary: for this highly specialized cell type is a locally expressed peroxidase (Hoffmeister et al. 1985). Based... The basal-disc-specific peroxidase activity, thought to be due to the gene expression of PPOD1 (Hoffmeister... the expression of PPOD1 (H.oli.) and the basal disc ... |
|||
|
Source: Bosch, Thomas C. G. - Zoologisches Institut Am Botanischen Garten, Christian-Albrechts-Universität zu Kiel |
|||
|
Collection: Biology and Medicine |
|||
| 69 | Published in: Phytochemistry 66, 453-461 (2005) Proteomic analysis of secreted proteins from Arabidopsis | ||
|
Summary: g64120 1-23 (0.820) 32.4 10.1 31.1- 29.1 9.8-6.5 26 (83) Peroxidase ATPA2 A2-B2 At5g06720 1-30 (0... esterases), and oxido-reductases (8 peroxidases). Such classes of proteins represent most of the identified... CWP in A. thaliana (Borderies et al., 2003; Boudart et al., 2005). ... |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 70 | Selenium Induces Manganese-dependent Peroxidase Production by the White-Rot Fungus Bjerkandera adusta | ||
|
Summary: Selenium Induces Manganese-dependent Peroxidase Production by the White-Rot Fungus Bjerkandera... , selenium (Se) induction of the ligninolytic enzyme manganese- dependent peroxidase (MnP) production... -rot fungi. Keywords Lipid peroxidation . Manganese peroxidase . Selenium . White-rot fungi Abbreviations Ag |
|||
|
Source: Tullos, Desiree - Department of Biological and Ecological Engineering, Oregon State University |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 71 | Molecular & Biochemical Parasitology 173 (2010) 162164 Contents lists available at ScienceDirect | ||
|
Summary: Direct Molecular & Biochemical Parasitology Short communication Elevated levels of tryparedoxin peroxidase... Leishmania donovani Tryparedoxin peroxidase a b s t r a c t Enhancement of the anti-oxidant metabolism... in antimony-resistant clinical isolates. Ele- vated levels of tryparedoxin and tryparedoxin peroxidase, key |
|||
|
Source: Fairlamb, Alan - Division of Biological Chemistry and Molecular Microbiology, University of Dundee |
|||
|
Collection: Biology and Medicine |
|||
| 72 | JOURNAL DE PHYSIQUE Colloque C6, suppliment au nc 12, Tome 35, Ddcembre 1974,page C6-33 ELECTRONIC STRUCTURE OF BIBMOLECULES | ||
|
Summary: involving the dimensionless parameters A/2, VIA and k yields a set of wave functions and energy levels which... kG, Az = -150 kG, A& = +2.42 mmls, q = 0.8 and r = 0.25 mm/s. The g-tensor and the A-tensor were... and horseradish peroxidase are used as examples. For ferric hemeproteins ... |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 73 | HIV1 encodes a sequence overlapping env gp41 with highly significant similarity to | ||
|
Summary: dependent glutathione peroxidases \Lambda Ethan Will Taylor y Ajita Bha y RamGopal Nadimpalli y Weiqing Zhang y John... ) and the antioxidant selenoprotein glutathione peroxidase in ARC and AIDS patients are ``significantly correlated... of glutathione peroxidase (GPx), the prototypical eukaryotic selenoprotein. The database ... |
|||
|
Source: Kececioglu, John - Department of Computer Science, University of Arizona |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 74 | Structural Characterization of Paracoccus denitrificans Cytochrome c Peroxidase and Assignment of the Low and High Potential Heme Sites | ||
|
Summary: Structural Characterization of Paracoccus denitrificans Cytochrome c Peroxidase and Assignment... of the diheme cytochrome c peroxidase from Paracoccus denitrificans has been determined as the result... shows 60% similarity to the cytochrome c peroxidase from Pseudomonas aeruginosa, 39% similarity |
|||
|
Source: Fülöp, Vilmos - Department of Biological Sciences, University of Warwick |
|||
|
Collection: Biology and Medicine |
|||
| 75 | Persistent c-fos expression and NADPH-d reactivity in the medulla and the lumbar spinal cord in rat with short-term | ||
|
Summary: -containing neurons located within Sol, CVL RVL (noradrenaline and adrenaline-containing cells of the groups A2, A1, A... Persistent c-fos expression and NADPH-d reactivity in the medulla and the lumbar spinal cord in rat... in male Wistar rats (n 4). Fos-like-immunoreactive cells revealed by avidin- ... |
|||
|
Source: Kalueff, Allan V. - Department of Pharmacology, Tulane University |
|||
|
Collection: Biology and Medicine |
|||
| 76 | Molecular and Biochemical Parasitology 111 (2000) 4149 Cloning, expression and functional characterisation of a | ||
|
Summary: . Molecular cloning, expression and enzymatic activity of a thiore- doxin peroxidase from Dirofilaria immitis... Molecular and Biochemical Parasitology 111 (2000) 4149 Cloning, expression and functional... form 15 June 2000; accepted 21 June 2000 Abstract We report the cloning, expression and functional |
|||
|
Source: Fairlamb, Alan - Division of Biological Chemistry and Molecular Microbiology, University of Dundee |
|||
|
Collection: Biology and Medicine |
|||
| 77 | BioMed Central Page 1 of 13 | ||
|
Summary: - - - catalase-peroxidase KatB 4 - - - - haem catalase 1 - - - - peroxidase/catalase (perA) 2 - - - - thr operon... and water [9-11]. Peroxidases reduce hydrogen or organic peroxides into water and alcohol moiety. This class... ,13], rubrerythrins [14,15], ... |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 78 | Product specification ECL Plus Western blotting reagent pack | ||
|
Summary: mouse IgG, peroxidase linked whole antibody (from sheep) 100µl Anti rabbit IgG, peroxidase linked whole... specific peroxidase linked second antibody These dilution factors are meant as a guide only... ECL membrane We have found in our laboratories that dilutions of 1:25000 of the peroxidase linked anti |
|||
|
Source: Kirschner, Marc W. - Department of Systems Biology, Harvard University |
|||
|
Collection: Biology and Medicine |
|||
| 79 | PLANTINSECT INTERACTIONS Friend or Foe?: A Plant's Induced Response to an Omnivore | ||
|
Summary: ET AL.: PLANT RESPONSE TO FEEDING 627 #12;ever, elevated peroxidase was expressed at the third leaf... on the identity of the damaging species. We Þrst compared changes in plant peroxidase activity, gossypol gland... of peroxidase, but when we controlled for the amount of damage, the ... |
|||
|
Source: Rosenheim, Jay A. - Department of Entomology, University of California, Davis |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 80 | Chemistry & Biology, Vol. 11, 309318, March, 2004, 2004 Elsevier Science Ltd. All rights reserved. DOI 10.1016/j.chembiol.2004.02.018 Functional Evolution and Structural Conservation | ||
|
Summary: . Properties of Designed CYP102A1-CYP102A2 Chimeric P450s E (Substrate E (Substrate- Peroxidase Proteina Bound... . to as cytochrome P450 BM-3) and CYP102A2, which are 460 amino acids in length and share 63% amino acid Introduction... ] and ... |
|||
|
Source: Arnold, Frances H. - Division of Chemistry and Chemical Engineering, California Institute of Technology |
|||
|
Collection: Chemistry ; Biology and Medicine |
|||
| 81 | Hydrogen peroxide increases the activities of soxRS regulon enzymes and the levels of oxidized proteins and lipids in Escherichia coli | ||
|
Summary: B6 proA2 his-4 thi-1 argE2 lacY1 galK2 rpsL supE44 ara-14 xyl- 15 mtl-1 tsx-33) were kindly provided... R regulon (catalase, peroxidase, and glutathione re- ductase) in both strains. In the AB1157 strain, H2O2... of selected antiox- idant enzymes were assessed in parallel. These included cata- lase, peroxidase |
|||
|
Source: Storey, Kenneth B. - Departments of Biology & Chemistry, Carleton University |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 82 | 2 0 0 3 B J U I N T E R N A T I O N A L | 9 2 , 7 9 3 8 0 2 | doi:10.1046/j.1464-410X.2003.04460.x 7 9 3 Original Article | ||
|
Summary: but there was no evidence of a2, a3 or g isoform expression in epithelial cells. The a3 isoform was not detected... , but there was a relatively low level of a2 isoform expression in the smooth muscle and stroma. CONCLUSION Rat prostate Na... . Comparison of the ... |
|||
|
Source: Brand, Paul H. - Department of Physiology and Pharmacology, University of Toledo |
|||
|
Collection: Biology and Medicine |
|||
| 83 | Functional Expression and Stabilization of Horseradish Peroxidase by Directed | ||
|
Summary: Functional Expression and Stabilization of Horseradish Peroxidase by Directed Evolution... . Expression of active horseradish peroxidase in Saccharomyces cerevisiae. Bio- chem Soc Trans 20:111S. Voigt... with a mutant that is functionally expressed in Saccharomyces cerevi- siae, we used ... |
|||
|
Source: Arnold, Frances H. - Division of Chemistry and Chemical Engineering, California Institute of Technology |
|||
|
Collection: Chemistry ; Biology and Medicine |
|||
| 84 | Laue diffraction study on the structure of cytochrome c peroxidase compound I | ||
|
Summary: .00A) on the bending magnet beam line BL6A2 at the Photon Factory, Japan, (I = 346-333 mA, positrons; E... Laue diffraction study on the structure of cytochrome c peroxidase compound I Vilmos Fiil6pl, 2*t... 6, 9000 Rockville Pike, Bethesda, MD 20892, USA Background: Cytochrome c peroxidase from yeast |
|||
|
Source: Fülöp, Vilmos - Department of Biological Sciences, University of Warwick |
|||
|
Collection: Biology and Medicine |
|||
| 85 | Journal of Chemical Ecology, Vol. 24, No. 1, 1998 ELICITORS OF PLANT DEFENSIVE SYSTEMS REDUCE | ||
|
Summary: pv. (Alternaria vestcatoria) 2.47a 2.54a 1.70c 2.12ab 2.42a 1.78b 1.31c solani) 2.24a 2.23a 1.61b 2... .62a 2.16a 1.53b l.50b Leaf mold (Fulvia fulva) 2.08a 1.59a 1.77a 1.99a 2.06a 1.99a 0.99b a Numbers... plants including ... |
|||
|
Source: Inbar, Moshe - Department of Evolutionary and Environmental Biology, University of Haifa |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 86 | INSTRUCTIONS Warranty: Pierce Biotechnology products are warranted to meet stated product specifications and to conform to label descriptions when stored and used properly. Unless | ||
|
Summary: Products 37070 SuperSignal® ELISA Pico Chemiluminescent Substrate, 100 ml, peroxidase substrate 15169... QuantaBluTM Fluorogenic Peroxidase Substrate Kit 34028 1-StepTM Ultra TMB-ELISA, 250 ml, colorimetric... peroxidase substrate 37621 1-StepTM PNPP, 100 ml, colorimetric phosphatase substrate 15075 Immuno |
|||
|
Source: Lebendiker, Mario - Wolfson Centre for Applied Structural Biology, Hebrew University of Jerusalem |
|||
|
Collection: Biotechnology ; Biology and Medicine |
|||
| 87 | Published in: Plant Proteomics: Technologies, Strategies, and Applications. (G.K. Agrawal & R Rakwal, eds.) John Wiley & Sons, | ||
|
Summary: ) or with the Yariv reagent (A2). Molecular masses of markers are indicated on the left. B. Identification... described. A four Arg residues-domain of a peroxidase was shown to have a high affinity for Ca2+ -pectate... .7%) include peroxidases, multicopper oxidases, berberine-bridge enzyme (S)-reticulin:oxygen ... |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 88 | RAPID COMMUNICATION Developmental Basis of Evolutionary Digit Loss | ||
|
Summary: mesenchymal expression is observed in the hind limbs of H. quadrilineata (A; 2/2), H. peronii (C; 3/3), and H... immunoreactivity in embryonic stages 3234 Hemiergis. (A, E, I, M) Stage 32 embryos of H. quadrilineata (A; 2/2), H... . quadrilineata (A; ... |
|||
|
Source: Shapiro, Mike - Department of Biology, University of Utah |
|||
|
Collection: Biology and Medicine |
|||
| 89 | Analysis of substructural variation in families of enzymatic proteins with applications to protein function | ||
|
Summary: -dependent peroxidase family (EC 1.11.1.7) and the xylose isomerases (EC 5.3.1.5), we show that the observed SCs can... families in detail below. Phylogenetic-based clusters (FASST) Heme-dependent peroxidases Heme... -dependent peroxidases (EC 1.11.1.7) are ubiq- uitous enzymes responsible for moderating reactions with reactive ... |
|||
|
Source: Kavraki, Lydia E. - Departments of Computer Science & Bioengineering, Rice University; Moll, Mark - Department of Computer Science, Rice University |
|||
|
Collection: Computer Technologies and Information Sciences ; Engineering |
|||
| 90 | Conservation of the Conformation of the Porphyrin Macrocycle in Hemoproteins | ||
|
Summary: deformations, which include saddling (B2u), ruffling (B1u), doming (A2u), waving (Eg), and propellering (A1u... ), doming (dom, A2u), waving [wav(x), wav(y); Eg], and pro- pellering (pro, A1u) deformation types required... of only the six (out-of-plane) normal deformations [sad (B2u), ruf (B1u), dom ... |
|||
|
Source: Shelnutt, John A. - Advanced Materials Laboratory, Sandia National Laboratories |
|||
|
Collection: Chemistry ; Materials Science |
|||
| 91 | ORIGINAL PAPER J. E. Grundy K. B. Storey | ||
|
Summary: 6 85.8 7.2 40.0 9.0a 2.15 Heart 3 91.8 9.67 58.8 4.4a 1.56 Kidney 4 85.2 3.1 67.8 1.7a 1... .26 Lung 4 86.4 12.6 30.6 5.4a 2.82 Gut 6 78.0 3.2 69.0 7.2 1.13 a Signi®cantly dierent from... Kidney 1.53 0.31 3.59 0.45a 5.66 0.48 6.61 0.31 Muscle 0.37 0.05 0.99 0.23a ... |
|||
|
Source: Storey, Kenneth B. - Departments of Biology & Chemistry, Carleton University |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 92 | Published in: Proteomics 5, 212-221 (2005) Cell wall proteins in apoplastic fluids of Arabidopsis thaliana | ||
|
Summary: 15 A1 A1 A2 A A A AA AA AA A1A1 A1 A1 A15 A17 A1 A19 A2 A2 A2A2 A2 ... |
|||
|
Source: Ecole Polytechnique, Centre de mathématiques |
|||
|
Collection: Mathematics |
|||
| 93 | electronic reprint Acta Crystallographica Section D | ||
|
Summary: cytochrome c peroxidase from Paracoccus denitrificans Aude Echalier, Celia F. Goodhew, Graham W. Pettigrew... from the IUCr. Acta Cryst. (2004). D60, 331333 Echalier et al. ¯ Dihaem cytochrome c peroxidase #12... -ray diffraction analysis of a dihaem cytochrome c peroxidase from Paracoccus denitrificans Aude Echalier,a Celia F |
|||
|
Source: Fülöp, Vilmos - Department of Biological Sciences, University of Warwick |
|||
|
Collection: Biology and Medicine |
|||
| 94 | Annu. Rev. Microbiol. 2000. 54:43961 Copyright c 2000 by Annual Reviews. All rights reserved | ||
|
Summary: . The expression of the ahpCF messenger RNA is regulated by OxyR (98). Two additional peroxidase activities, which... is expressed in yeast (102). In addition, Ahp1p was identified in an assay for other thiore- doxin peroxidase... @box-o.nih.gov; storz@helix.nih.gov Key Words glutaredoxin, reductase, ... |
|||
|
Source: Storz, Gisela - Cell Biology and Metabolism Branch, National Institute of Child Health and Human Development |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 95 | Calcium-Dependent Conformation of a Heme and Fingerprint Peptide of the Diheme Cytochrome c Peroxidase from Paracoccus pantotrophus | ||
|
Summary: ); polarized spectra of Pa-p CCP reveal none of the A2g modes that are sometimes observed in the high... 703 703 15 (B2u) 712 712 712 713 713 713 11(B1u), 5(A2u)d 726 726 726 727 727 727 16 (B1g) 742 742 741... ; for example, 5 is an A2u mode appearing at 729 cm-1 . ... |
|||
|
Source: Shelnutt, John A. - Advanced Materials Laboratory, Sandia National Laboratories |
|||
|
Collection: Chemistry ; Materials Science |
|||
| 96 | P u b l i s h i n g Volume 28, 2001 | ||
|
Summary: . Absorbance was measured at 470 nm and activity was expressed as OD (mg protein)1 min1. Cell wall peroxidase... in their total apoplastic concentration of cell wall proteins, in the activity of apoplastic peroxidases... protein, cell wall extensibility, creep assay, peroxidase, salinity, Zea mays L. ... |
|||
|
Source: Cramer, Grant R. - Department of Biochemistry, University of Nevada, Reno |
|||
|
Collection: Biology and Medicine |
|||
| 97 | Carbon Monoxide Binding by de Novo Heme Proteins Derived from Designed Combinatorial Libraries | ||
|
Summary: . Am. Chem. Soc. 1997b, 119, 5302-5306. (5) Roy, S.; Helmer, K. J.; Hecht, M. H. Folding Des. 1997a, 2... structure.1 The de novo proteins were expressed from a library of * Correspondence should be addressed to... of the novel heme proteins by demonstrating that several of them have significant peroxidase ... |
|||
|
Source: Hecht, Michael H. - Departments of Chemistry & Molecular Biology, Princeton University |
|||
|
Collection: Chemistry ; Biotechnology |
|||
| 98 | Antioxidant Defense System in Tadpoles of the American Bullfrog (Lithobates catesbeianus) Exposed to Paraquat | ||
|
Summary: peroxidase, and GR activities in the liver tissue, whereas the high constitutively expressed catalase... for catalase, superoxide dismutase (SOD), general peroxidase, and glutathione reductase (GR) activities... and the tail; however, peroxidase, SOD, and catalase activities ranged from two- to 20-fold ... |
|||
|
Source: McCallum, Malcolm - College of Science, Technology, Engineering, and Mathematics, Texas A&M University at Texarkana |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 99 | Detailed Model of the Peroxidase-Catalyzed Oxidation of Indole-3-Acetic Acid at Neutral Sergey N. Krylov* and H. Brian Dunford* | ||
|
Summary: Detailed Model of the Peroxidase-Catalyzed Oxidation of Indole-3-Acetic Acid at Neutral pH Sergey N... of peroxidase-catalyzed oxidation of indole-3-acetic acid (IAA) at neutral pH has been developed, characterized... in the presence of HRP by two pathways: (i) the standard peroxidase cycle, which is accompanied by (ii |
|||
|
Source: Krylov, Sergey - Department of Chemistry, York University (Toronto) |
|||
|
Collection: Biology and Medicine ; Chemistry |
|||
| 100 | Agonist-induced polarized trafficking and surface expression of the adenosine 2b receptor in intestinal epithelial cells: role of SNARE proteins | ||
|
Summary: was used because it only expresses the A2b-subtype adenosine recep- tor. Cell fractionation, biotinylation... ). Interestingly, the A2b receptor is the predom- inant adenosine receptor expressed in the cecum and colon as well... colonic epithelia T84 cells, the ... |
|||
|
Source: Hall, Randy A - Department of Pharmacology, Emory University |
|||
|
Collection: Biology and Medicine |
|||