Home

About

Advanced Search

Browse by Discipline

Scientific Societies

E-print Alerts

Add E-prints

E-print Network
FAQHELPSITE MAPCONTACT US


  Topic List  Advanced Search  
Sample search results for: ismas triennial international

Page:   2  3  4  5 
 
1 A COMPARISON OF ISMA AND DECT-DCS CHANNEL ACCESS POLICIES FOR INDOOR WIRELESS
 

Summary:  A COMPARISON OF ISMA AND DECT-DCS CHANNEL ACCESS POLICIES FOR INDOOR WIRELESS COMMUNICATIONS... ), and basestation-controlled inhibit sense multiple access (ISMA). It is shown that the mobile-controlled scheme... may not be satisfactory when supporting packet voice transmission. Inhibit Sense Multiple Access (ISMA

  

Source: Atkinson, Robert C - Department of Electronic and Electrical Engineering, University of Strathclyde

 

Collection: Engineering

 
2 MILLIMETER MULTIPLICITY IN NGC 6334 I AND I(N) T. R. Hunter,1
 

Summary:  I, we find four compact sources: the two brightest (I-SMA1 and I-SMA2) are associated... with previously known ammonia cores; I-SMA3 coincides with the peak of the compact H ii region (NGC 6334 F), and I-SMA... 4 is a newly discovered object. While I-SMA3 exhibits a mixture of free-free ...

  

Source: Beuther, Henrik - Max-Planck-Institut für Astronomie; Thorwirth, Sven - Physikalisches Institut, Universität zu Köln

 

Collection: Physics

 
3 ISMA 2007 Striking outwards reed OSCILLATION THRESHOLDS FOR "STRIKING OUTWARDS" REEDS
 

Summary:  Author manuscript, published in "Proceedings of the International Symposium on Musical Acoustics (ISMA... ISMA 2007 Striking outwards reed OSCILLATION THRESHOLDS FOR "STRIKING OUTWARDS" REEDS COUPLED... ), Barcelona : Spain (2007)" #12;ISMA 2007 Striking outwards reed MODELLING A STRIKING OUTWARDS REED Figure ...

  

Source: Ecole Polytechnique, Centre de mathématiques

 

Collection: Mathematics

 
4 The Introductory Subject Matter Authorization (ISMA) in Mathematics
 

Summary:  The Introductory Subject Matter Authorization (ISMA) in Mathematics What is the ISMA... in Math and what does it allow you to do? The ISMA in Math authorizes the holder to teach Mathematics... holders of the ISMA in Mathematics teach middle school Mathematics. Is the ISMA ...

  

Source: Sze, Lawrence - Department of Mathematics, California Polytechnic State University

 

Collection: Mathematics

 
5 Proceedings of the International Symposium on Music Acoustics (Associated Meeting of the International Congress on Acoustics)
 

Summary:  of the International Congress on Acoustics) 25-31 August 2010, Sydney and Katoomba, Australia ISMA 2010, associated... and Katoomba, Australia Proceedings of the International Symposium on Music Acoustics, ISMA 2010 2 ISMA 2010... , Sydney and Katoomba, Australia Proceedings of the ...

  

Source: New South Wales, University of - School of Physics, Music Acoustics Group

 

Collection: Physics

 
6 Proceedings of the International Symposium on Music Acoustics (Associated Meeting of the International Congress on Acoustics)
 

Summary:  of the International Congress on Acoustics) 25-31 August 2010, Sydney and Katoomba, Australia ISMA 2010, associated... , Australia Proceedings of 20th International Congress on Acoustics, ICA 2010 ISMA 2010, associated meeting... and Katoomba, Australia Proceedings of the International ...

  

Source: New South Wales, University of - School of Physics, Music Acoustics Group

 

Collection: Physics

 
7 SANJEEV KUMAR Environmental Science Research Centre (ESRC)
 

Summary:  for Mass Spectrometry (ISMAS) workshop on mass spectrometry (2004), Shimla, India. * European Association... courses and workshops * International training course on ocean colour remote sensing organized by ISRO... spectrometry: some recent studies, "Proceedings of 11th ISMAS workshop on mass spectrometry", 7-12 October 2004

  

Source: St. Francis Xavier University, Environmental Sciences Research Centre

 

Collection: Environmental Sciences and Ecology ; Geosciences

 
8 106 | Triennial Scientific Report EC-EARTH: goals, developments
 

Summary:  106 | Triennial Scientific Report EC-EARTH: goals, developments and scientific perspectives Richard... betweenthedominantvariabilitypatterns(e.g.theNorth Figure 1. The EC-Earth logo. #12;Triennial Scientific Report | 107 Atlantic... the CY33 deep convection scheme. Units are cm per 3 months. #12;108 | Triennial Scientific Report

  

Source: Selten, Frank - Koninklijk Nederlands Meteorologisch Instituut

 

Collection: Geosciences ; Environmental Sciences and Ecology

 
9 Intelligent Cyberphysical Systems (ICS) Center (Former CAIP) Seminar
 

Summary:  and is an international leader in these fields. She received the Pettinos Award (a triennial international research award

  

Source: Chung, Deborah D.L. - Department of Mechanical and Aerospace Engineering, State University of New York at Buffalo

 

Collection: Materials Science ; Engineering

 
10 Proceedings of the International Symposium on Music Acoustics (Associated Meeting of the International Congress on Acoustics)
 

Summary:  of the International Congress on Acoustics) 25-31 August 2010, Sydney and Katoomba, Australia ISMA 2010, associated... International Congress on Acoustics, ICA 2010 ISMA 2010, associated meeting of ICA 2010 3 60 50 40 30 20 10 0 x... and Katoomba, Australia Proceedings of the ...

  

Source: New South Wales, University of - School of Physics, Music Acoustics Group

 

Collection: Physics

 
11 Proceedings of the International Symposium on Music Acoustics (Associated Meeting of the International Congress on Acoustics)
 

Summary:  of the International Congress on Acoustics) 25-31 August 2010, Sydney and Katoomba, Australia ISMA 2010, associated... Proceedings of the International Symposium on Music Acoustics, ISMA 2010 2 ISMA 2010, associated meeting... and Katoomba, Australia Proceedings of the ...

  

Source: New South Wales, University of - School of Physics, Music Acoustics Group

 

Collection: Physics

 
12 Status of the Pacific coast groundfish fishery through 2008,
 

Summary:  in the model was the triennial shelf trawl survey (1980-2004), although the NWFSC shelf/slope trawl survey... -deviations · Due to differences in start dates of the triennial survey and serially correlated residuals in model... and length compositions favoring high h and the triennial survey favoring low h. The Panel and STAT ...

  

Source: Southwest Fisheries Science Center, NOAA

 

Collection: Environmental Sciences and Ecology

 
13 Journal of Computer and Systems Sciences International, Vol. 43, No. 2, 2004, pp. 278287. Translated from Izvestiya Akademii Nauk. Teoriya i Sistemy Upravleniya, No. 2, 2004, pp. 126136.
 

Summary:  278 Journal of Computer and Systems Sciences International, Vol. 43, No. 2, 2004, pp. 278... , in such a situa- tion, the preparations of surveys of papers and papers submitted at large international... effect on the competitive- ness of new development works. The World Congresses of the International

  

Source: Russian Academy of Sciences, Institute for Problems in Mechanical Engineering, Laboratory "Control of Complex Systems"

 

Collection: Engineering

 
14 Proceedings of the International Symposium on Music Acoustics (Associated Meeting of the International Congress on Acoustics)
 

Summary:  of the International Congress on Acoustics) 25-31 August 2010, Sydney and Katoomba, Australia ISMA 2010, associated... Proceedings of the International Symposium on Music Acoustics, ISMA 2010 2 ISMA 2010, associated meeting... of 20th International Congress on ...

  

Source: Ecole Polytechnique, Centre de mathématiques; New South Wales, University of - School of Physics, Music Acoustics Group

 

Collection: Mathematics ; Physics

 
15 Proceedings of the International Symposium on Music Acoustics (Associated Meeting of the International Congress on Acoustics)
 

Summary:  of the International Congress on Acoustics) 25-31 August 2010, Sydney and Katoomba, Australia ISMA 2010, associated... ;23-27 August 2010, Sydney, Australia Proceedings of 20th International Congress on Acoustics, ICA 2010 ISMA... and Katoomba, Australia Proceedings of the International ...

  

Source: New South Wales, University of - School of Physics, Music Acoustics Group

 

Collection: Physics

 
16 Proceedings of the International Symposium on Music Acoustics (Associated Meeting of the International Congress on Acoustics)
 

Summary:  of the International Congress on Acoustics) 25-31 August 2010, Sydney and Katoomba, Australia ISMA 2010, associated... of the International Symposium on Music Acoustics, ISMA 2010 2 ISMA 2010, associated meeting of ICA 2010 suggest... and Katoomba, Australia Proceedings of the ...

  

Source: Ecole Polytechnique, Centre de mathématiques; New South Wales, University of - School of Physics, Music Acoustics Group

 

Collection: Mathematics ; Physics

 
17 TRB Traffic Flow Theory Committee Triennial Strategic Plan Page 1 of 11 Transportation Research Board
 

Summary:  TRB Traffic Flow Theory Committee Triennial Strategic Plan Page 1 of 11 Transportation Research... Board Committee on Traffic Flow Theory and Characteristics (AHB45) TRIENNIAL STRATEGIC PLAN March 2008... activities over the years, specifically include: #12;TRB Traffic Flow Theory Committee Triennial Strategic

  

Source: Bertini, Robert L. - Department of Civil Engineering and Environmental Sciences, Portland State University

 

Collection: Energy Storage, Conversion and Utilization

 
18 224 IEEE TRANSACTIONS ON PLASMA SCIENCE, VOL. 33, NO. 2, APRIL 2005 Fourth Triennial Special Issue on
 

Summary:  224 IEEE TRANSACTIONS ON PLASMA SCIENCE, VOL. 33, NO. 2, APRIL 2005 Fourth Triennial Special Issue... the presentation to tell the story that we want to tell. It is our pleasure to present to you the "Fourth Triennial... , and International Union of Pure and Applied Chemistry. He has chaired the Gaseous Electronics Con- ference, ...

  

Source: Kushner, Mark - Department of Electrical Engineering and Computer Science, University of Michigan

 

Collection: Engineering

 
19 Modelling the relationship between human perception and Sound Quality parameters using LS-SVMs
 

Summary:  becomes difficult. 3750 PROCEEDINGS OF ISMA2004 #12;Figure 1: Normalized absolute mutual correlation... confirms the lack of a good parameter. All parameters are equally (un)important. 3752 PROCEEDINGS OF ISMA... parameters 3754 PROCEEDINGS OF ISMA2004 #12;· comfortability scores: the normalized scores on comfortability

  

Source: Leuven, Katholieke Universiteit, Department of Electrical Engineering, SCD Division

 

Collection: Engineering

 
20 Pisma stareho Orientu a moderni informacni technologie
 

Summary:  P´isma star´eho Orientu a modern´i informacn´i technologie Otakar Smrz ´Ustav form... ´apadocesk´a univerzita v Plzni Ù ÆÚ P´isma star´eho Orientu (O. Smrz) Orientalia Antiqua Nova 10. ´unora 2006 1 / 17 #12... ;Prehled 1 Reprezentace 2 Arabstina 3 Hebrejstina 4 Hieroglyfy 5 Kl´inopisy 6 Dals´i p´isma 7 Appendix ...

  

Source: Cerveny, Vlastislav - Department of Geophysics, Charles University in Prague

 

Collection: Geosciences


Page:   2  3  4  5 
Page:   1  2  3  4  5 
 
21 GLOBAL PARTNERSHIPS AND THE NEW INTERNATIONAL SOCIETY FOR RIVER SCIENCE (ISRS)
 

Summary:  EDITORIAL GLOBAL PARTNERSHIPS AND THE NEW INTERNATIONAL SOCIETY FOR RIVER SCIENCE (ISRS... and among nations. Consequently, international collaborations, communication, partnerships and societies... . This critical need led to the 2006 formation of the International Society for River Science (ISRS). Here we

  

Source: Thorp, James H. - Department of Ecology and Evolutionary Biology, University of Kansas

 

Collection: Environmental Sciences and Ecology

 
22 c 2004 . .. , .. 11.07.03 ., 4.11.03
 

Summary:  ÷åñêîìó óïðàâëåíèþ (International Federation on Automatic Control, Ðàáîòà ÷àñòè÷íî ôèíàíñèðîâàíà Ðîññèéñêèì Ôîíäîì... experiment // Proc. 15th Triennial World Congr. of IFAC (b'02). Barcelona, 2002. 2. Nebylov A.V. Controlled... igth close to rough sea: strategies and means // Proc. 15th ...

  

Source: Russian Academy of Sciences, Institute for Problems in Mechanical Engineering, Laboratory "Control of Complex Systems"

 

Collection: Engineering

 
23 ~~,. OF ('0 + ~.:.q. ,~
 

Summary:  triennialWestCoastgroundfishsurvey.Stratahavebeengroupedaccordingto International... West Coast triennial bottom trawl survey was conducted to assess stocks of groundf ish inhabiting... Fisheries science Center (AFSC). These bottom trawl surveys, initiated in 1977 and repeated triennially

  

Source: NOAA Marine Fisheries Review

 

Collection: Environmental Sciences and Ecology

 
24 IUPAP International Conference on Women in Physics Stellenbosch, South Africa
 

Summary:  ICWIP 2011 4th IUPAP International Conference on Women in Physics Stellenbosch, South Africa April... 5-8, 2011 Organised by The International Union of Pure and Applied Physics, IUPAP, Working Group... in South Africa The 4th IUPAP International Conference on Women in Physics (ICWIP 2011) will be held

  

Source: 

 

Collection: Physics ; Materials Science

 
25 204 SHORT COMMUNICATIONS Acta Cryst. (1986). A42, 204
 

Summary:  once every three years during the triennial International Congresses of Crystallography. The first... .k)k[- All relevant information is given in the Abstract. International Union of Crystallography Acta Cryst... . (1986). A42, 204 International Union of Crystallography announces the Ewald Prize The ...

  

Source: Ecole Polytechnique, Centre de mathématiques

 

Collection: Mathematics

 
26 In its 22nd year, UKSMA, the United Kingdom Software Metrics Association COSMIC, the Common Software Measurement International Consortium
 

Summary:  , the Common Software Measurement International Consortium with the support of Unicom Seminars Ltd to announce... an International Conference on Software Metrics and Estimating to be held in London, 27th /28th October 2011 CALL... Chair, MAIN (Metrics Associations' International Network), Germany Carol Buttle Director / CTO, BBS

  

Source: Québec, Université du - École de technologie supérieure, Département de génie logiciel et des technologies de l'information, Software Engineering Research Laboratory

 

Collection: Computer Technologies and Information Sciences

 
27 FPE Alumni Lunch at the 10th International IAFSS Symposium
 

Summary:  FPE Alumni Lunch at the 10th International IAFSS Symposium University of Maryland June 19 ­ 24... , 2011 The 10th Symposium of the International Association of Fire Safety Science (IAFSS) will be held... science meeting in the world and has been organized triennially since 1985 by the IAFSS. We expect more

  

Source: Milchberg, Howard - Institute for Physical Science and Technology & Department of Physics, University of Maryland at College Park

 

Collection: Plasma Physics and Fusion ; Physics

 
28 Cole Museum/AMS New Agriculture Building
 

Summary:  Agriculture, Policy & Development 49 International and Study Abroad Office D4 Geography 71 ISMA Centre C4 4... International Conference on Boundary Integral Methods #12;Updated April 2004. Copyright The University... & Social Sciences 35 Insurance Office D4 Blandford East 59 International and Rural ...

  

Source: Chandler-Wilde, Simon N. - Department of Mathematics, University of Reading

 

Collection: Mathematics

 
29 Contesting Shi`ism: Isna `Ashari and Isma`ili Shi`ism in Modern South Asia
 

Summary:  Contesting Shi`ism: Isna `Ashari and Isma`ili Shi`ism in Modern South Asia University of London... Contesting Shi`ism: Isna `Ashari and Isma`ili Shi`ism in Modern South Asia September 9th -10th 2011 Royal... Holloway University of London Contesting Shi`ism: Isna `Ashari and Isma`ili Shi`ism in Modern South Asia

  

Source: 

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
30 Michelle Mary Kuttel Department of Computer Science
 

Summary:  Lundborg, Pro- ceedings of the 7th IEEE International Conference on e-Science, paper accepted. 11... Animations, A. Reid, J. Gain and M. Kuttel, Proceedings of Afrigraph2010: the 7th International Confer- ence... , Michelle Kuttel, Sena Allen and Robert Koletka Proceedings of IEEE International Communica- tions

  

Source: Kuttel, Michelle - Department of Computer Science, University of Cape Town

 

Collection: Computer Technologies and Information Sciences

 
31 U MIXI G SPARSE HYPERSPECTRAL MIXTURES Marian-Daniel Iordache1
 

Summary:  , Orthogonal Matching Pursuit (OMP) [1], Iterative Spectral Mixture Analysis (ISMA) [2] and 12 ll - sparse... is orthogonalized to the members already selected. 3.3. Iterative Spectral Mixture Analysis (ISMA) ISMA... by examining the change in the root-mean-squared (RMS) error along the iterations. ISMA ...

  

Source: Plaza, Antonio J. - Remote Sensing Signal and Image Processing Laboratory, University of Maryland, Baltimore County

 

Collection: Computer Technologies and Information Sciences

 
32 Phylogenetics and biogeography of the broad-nosed bats, genus Platyrrhinus (Chiroptera: Phyllostomidae)
 

Summary:  rank as species under a phylogenetic species concept (P. albericoi, P. ismaeli, P. masu, and P... ­P. chocoensis­P. dorsalis­P. ismaeli­P. infus- cus­P. masu­P. nigellus­P. vittatus on one hand and a lowland... . chocoensis, P. dorsalis, P. ismaeli, P. masu, and P. nigellus (left map) and P. albericoi, P. aurarius, P

  

Source: Westneat, Mark W. - Curator of Zoology, Biodiversity Synthesis Center, Field Museum of Natural History

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
33 ADVANCED COURSE ON MOLECULAR MODELING AND PROTEIN-LIGAND INTERACTIONS December 14-18, 2007 Scientific Coordinator: R Sowdhamini NCBS
 

Summary:  ). · Top-down approach of sequencing proteins using Qtof. 10th ISMAS Triennial Symposium on Mass... the past two years with the addition of several international scholars to almost all our academic programs... CBS/harvard-MIT student exchange program in place we have begun hosting undergraduates from these ...

  

Source: Bhalla, Upinder S. - National Centre for Biological Sciences, Tata Institute of Fundamental Research

 

Collection: Computer Technologies and Information Sciences ; Biology and Medicine

 
34 NEW SERIES, NO. 105 Morphological Phylogeny of the Bat Genus
 

Summary:  of Platyrrhinus in- fuscus and P. lineatus ........................ 29 21. Frontal view of Platyrrhinus ismaeli sp... of Platyrrhinus ismaeli sp. nov. and P. dorsalis ........................................... 33 24. Frontal view... of the type series of Pla- tyrrhinus ismaeli sp. nov. ..................... 30 5. Measurements ...

  

Source: Westneat, Mark W. - Curator of Zoology, Biodiversity Synthesis Center, Field Museum of Natural History

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
35 International Journal on Artificial Intelligence Tools c World Scientific Publishing Company
 

Summary:  International Journal on Artificial Intelligence Tools c World Scientific Publishing Company... APPLICATIVE AND COMBINATORY CATEGORIAL GRAMMAR AND SUBORDINATE CONSTRUCTIONS IN FRENCH ISMA¨iL BISKRI D... system used as a formal metalanguage 1 #12;2 Isma¨il Biskri for describing natural languages

  

Source: Biskri, Ismail - Département de Mathématiques et d'Informatique, Université du Québec à Trois Rivières

 

Collection: Computer Technologies and Information Sciences

 
36 Proceedings of the International Symposium on Music Acoustics (Associated Meeting of the International Congress on Acoustics)
 

Summary:  of the International Congress on Acoustics) 25-31 August 2010, Sydney and Katoomba, Australia ISMA 2010, associated... , Sydney and Katoomba, Australia Proceedings of the International Symposium on Music Acoustics, ISMA 2010 2... Proceedings of the International Symposium on Music ...

  

Source: New South Wales, University of - School of Physics, Music Acoustics Group

 

Collection: Physics

 
37 SPARSE HYPERSPECTRAL U MIXI G Marian-Daniel Iordache1,*
 

Summary:  -Penrose pseudoinverse; 2) Orthogonal Matching Pursuit algorithm (Y. Pati, et al. ,1993); 3) ISMA ­ Iterative Spectral... not be selected more than once). 3.3 Iterative Spectral Mixture Analysis (ISMA) ISMA (Rogge et al., 2006... , the predicted fractional abundances are similar to the actual ones and they should sum to one. This ...

  

Source: Plaza, Antonio J. - Remote Sensing Signal and Image Processing Laboratory, University of Maryland, Baltimore County

 

Collection: Computer Technologies and Information Sciences

 
38 Jeff Gibson Jennifer Plourde
 

Summary:  , a use requiring the most lenient bacterial standards.5 Discussion I. Triennial Review Because the CWA... the review during which the public can voice concerns over different water bodies.8 The next triennial review... , and the party's reasons for requesting the change at the triennial review. While she admitted a letter to EPD

  

Source: Gittleman, John - School of Ecology, University of Georgia

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
39 Recursive subspace identification for in-flight modal analy-sis of airplanes
 

Summary:  , in Proceedings of the International Conference on Noise and Vibration Engineering (ISMA 2002), Leuven, Belgium... of the International Conference on Noise and Vibration Engineering (ISMA2002), Leuven, Belgium (2002). [21] M... are the basic starting blocks for subspace identification 1564 PROCEEDINGS OF ...

  

Source: Ecole Polytechnique, Centre de mathématiques

 

Collection: Mathematics

 
40 Bibliography: Physical Modeling of Musical Instruments Julius O. Smith III
 

Summary:  instrument," in Proceedings of the International Symposium on Musical Acoustics (ISMA-95), Dourdan, France... of the International Symposium on Musical Acoustics (ISMA-95), Dourdan, France, (France), pp. 42­46, Soci´et´e Fran... of the International Symposium on Musical Acoustics ...

  

Source: Smith III, Julius Orion - Center for Computer Research in Music and Acoustics, Stanford University

 

Collection: Computer Technologies and Information Sciences


Page:   1  2  3  4  5 
Page:   1  2  3  4  5 
 
41 MEHMETHADIGUNES Assistant Professor, Computer Science and Engineering
 

Summary:  /2001 ­ 7/2001 Intern IBMTurk, Istanbul, Turkey 7/2000 ­ 8/2000 Intern Information... Naruchitparames and MehmetH.Gunes "EnhancingDataPrivacyandIntegrityinthe Cloud", International Workshop... the Usage of Anonymity Services", 3rd COST TMA International Workshop on Traffic Monitoring and Analysis

  

Source: Gunes, Mehmet Hadi - Department of Computer Science and Engineering, University of Nevada, Reno

 

Collection: Computer Technologies and Information Sciences ; Engineering

 
42 862 IEEE TRANSACTIONS ON PLASMA SCIENCE, VOL. 36, NO. 4, AUGUST 2008 Guest Editorial
 

Summary:  Triennial Special Issue on Images in Plasma Science IT IS our pleasure to present the Fifth Triennial... Society of America, the American Vacuum Society, the International Union of Pure and Applied Chemistry

  

Source: Kushner, Mark - Department of Electrical Engineering and Computer Science, University of Michigan

 

Collection: Engineering

 
43 2014 IEEE TRANSACTIONS ON GEOSCIENCE AND REMOTE SENSING, VOL. 49, NO. 6, JUNE 2011 Sparse Unmixing of Hyperspectral Data
 

Summary:  . ISMA In this paper, we also use the iterative spectral mixture analysis (ISMA) algorithm [44] to solve... the considered prob- lems. The pseudocode of the ISMA is shown in Algorithm 2. The ISMA is an iterative technique... parts. In the first one, the ISMA initially computes an ...

  

Source: Plaza, Antonio J. - Remote Sensing Signal and Image Processing Laboratory, University of Maryland, Baltimore County

 

Collection: Computer Technologies and Information Sciences

 
44 U.S. DEPARTMENT OF COMMERCE National Oceanic and Atmospheric Administration
 

Summary:  -swept biomass estimates from the triennial survey (these data are discussed later), we note that these estimates... that the 1977 Triennial Survey biomass estimate would be on the order of 150,000 tons, and the average biomass... was limited to a triennial survey. S. jordani were identified for the northern areas only for the ...

  

Source: Southwest Fisheries Science Center, NOAA

 

Collection: Environmental Sciences and Ecology

 
45 The 2nd Workshop on Active Internet Measurements (AIMS-2) Report
 

Summary:  (ISMA) workshops. The goals of this workshop were to further our understanding of the potential... -10, 2010, focused on continuing inter- action among international researchers involved in active mea... . http://www.caida.org/utilities/netgeo/. [8] CAIDA. ISMA 2009 AIMS - Workshop on Active Internet

  

Source: California at San Diego, University of - San Diego Supercomputer Center, Cooperative Association for Internet Data Analysis (CAIDA Group

 

Collection: Computer Technologies and Information Sciences

 
46 AbstractThe rockfishes of the se bastid genus Sebastes are a very impor
 

Summary:  -occurrences were determined by using data from the Alaska Fisher ies Science Center triennial continental shelf... Cen ter (AFSC) westcoast triennial continental shelf bot tom-trawl survey, which enters... , including names of important coastal features and International North Pacific Fisheries Commission

  

Source: NOAA Marine Fisheries Review

 

Collection: Environmental Sciences and Ecology

 
47 AbstractTriennial bottom trawl sur vey data from 1984 to 1996 were used to
 

Summary:  307 Abstract­Triennial bottom trawl sur vey data from 1984 to 1996 were used to evaluate changes... surveys. Methods Data source Data were collected from triennial bottom trawl surveys in the GOA conducted... ment (A), biomass estimates from stock assessment analysis (B), and biomass estimates from triennial

  

Source: NOAA Marine Fisheries Review

 

Collection: Environmental Sciences and Ecology

 
48 TRAVEL GRANT APPLICATION (TRAVEL) DISTINGUISHED FACULTY TRAVEL APPLICATION (DFTA)
 

Summary:  ,000 (Canada & Continental USA) Maximum: $2,000 (International) Deadlines: January 15, March 15, June 15... of Meeting From to 3. Is the meeting Regional National International 4. Is the meeting Annual Biennial... Triennial Other NB: Travel arrangement must comply with the University's Travel Policy and an "Application

  

Source: Martin, Jeff - Kellogg Radiation Laboratory, California Institute of Technology

 

Collection: Physics

 
49 Particles, Aerosols, and Their Transport in Built Environment Particles, aerosols, or collectively called particulate matters (PM) are ubiquitous indoor
 

Summary:  , the triennial series of International Conferences on Indoor Air Quality and Climate (Indoor Air) provide... their papers for publication in special issues of several well-known international journals. This special issue

  

Source: Chen, Qingyan "Yan" - School of Mechanical Engineering, Purdue University

 

Collection: Engineering

 
50 Historically, the population of Gorno Badakhshan has felt indebted to socialism,
 

Summary:  and information network consists of the KGB, the Directorate of Internal Affairs, the Ministry of Internal Affairs... NGOs and international organisations in the GBAO are not available, it can be stated that the state... liber- al Ismaeli religion and communist principles of gender equality resulted in a ...

  

Source: Richner, Heinz - Zoologischen Institut, Universität Bern

 

Collection: Environmental Sciences and Ecology

 
51 From SIAM News, Volume 39, Number 10, December 2006 New Ideas for SIAM Conferences
 

Summary:  . The triennial SIAM Conference on Applied Linear Algebra was held for the first time in Europe... , GAMM (Gesellschaft für Angewandte Mathematik und Mechanik), the International Association of Applied

  

Source: Grimm, Volker - Mathematisches Institut, Heinrich-Heine-Universität Düsseldorf

 

Collection: Mathematics

 
52 Daiwa Adrian Prizes 2010 WINNERS ANNOUNCED Winners of the seventh Daiwa Adrian Prizes, the prestigious awards for scientific excellence in the UK and
 

Summary:  Adrian Prizes are awarded by The Daiwa Anglo-Japanese Foundation on a triennial basis in recognition... strains follow particular routes when they disseminate internationally. University of Oxford National

  

Source: Ruzhansky, Michael - Department of Mathematics, Imperial College, London

 

Collection: Mathematics

 
53 NOAA Technical Memorandum NMFS-AFSC-128 U.S. DEPARTMENT OF COMMERCE
 

Summary:  format. #12;iii ABSTRACT The Alaska Fisheries Science Center's 2001 West Coast triennial bottom trawl... , initiated in 1977 and repeated triennially, have been designed to provide resource managers with fishery... over the first four iterations of the triennial survey, the large variances of the estimates remained

  

Source: NOAA Marine Fisheries Review

 

Collection: Environmental Sciences and Ecology

 
54 Name Anthony Joern Title Professor
 

Summary:  systematics: Intra-individual heterogeneity of both mitochondrial 12S-valine-16S and nuclear internal... IV Triennial Meeting Pan American Acridological Society. PAAS. Joern, A. and K.P. Pruess. 1986... Triennial Proceedings Pan Amer. Acridological Society. Edward Bros. Ann Arbor, Michigan Joern, A. 1985

  

Source: Kaufman, Glennis A. - Division of Biology, Kansas State University

 

Collection: Environmental Sciences and Ecology

 
55 Proceedings of the 5th Triennial ESCOM Conference 8-13 September 2003, Hanover University of Music and Drama, Germany
 

Summary:  Proceedings of the 5th Triennial ESCOM Conference 8-13 September 2003, Hanover University of Music... Triennial ESCOM Conference 8-13 September 2003, Hanover University of Music and Drama, Germany 468ISBN 3... of the 5th Triennial ESCOM Conference 8-13 September 2003, Hanover University of Music and Drama, Germany

  

Source: Volk, Anja Fleischer - Department of Information and Computing Sciences, Universiteit Utrecht

 

Collection: Computer Technologies and Information Sciences

 
56 Fuel Used for Off-Road Recreation: A Reassessment of the Fuel Use Model
 

Summary:  Industry Association ISMA International Snowmobile Manufacturers Association MIC Motorcycle Industry... equivalent ISTEA Intermodal Surface Transportation Efficiency Act of 1991 ISIA International Snowmobile... ­1998 . . . . . . . . . . . . . . . . . . . . 30 Table 5.2 Number of snowmobiles in States not reporting snowmobile ...

  

Source: Oak Ridge National Laboratory, Center for Transportation Analysis

 

Collection: Energy Storage, Conversion and Utilization

 
57 Triennial Conference Proceedings, June 15-19, 2009 Izmir-TURKEY T4 -008 -1
 

Summary:  ISTRO 18th Triennial Conference Proceedings, June 15-19, 2009 Izmir-TURKEY T4 - 008 - 1 Slumping... , climate and tillage conditions. Keywords: bulk density, capillary forces, internal force, recompaction... insu-00398908,version1-25Jun2009 Author manuscript, published in "International Soil Tillage Research

  

Source: Ecole Polytechnique, Centre de mathématiques

 

Collection: Mathematics

 
58 Physical Modeling Synthesis Update Julius O. Smith III
 

Summary:  in the brass instrument," in Proceedings of the International Symposium on Musical Acoustics (ISMA-95), Dourdan... in a trombone," in Proceedings of the International Symposium on Musical Acoustics (ISMA-95), Dourdan, France... ," in Proceed- ings of the 1995 International Computer Music ...

  

Source: Smith III, Julius Orion - Center for Computer Research in Music and Acoustics, Stanford University

 

Collection: Computer Technologies and Information Sciences

 
59 Physiological Insights Towards Improving Fish Culture L. CURRY WOODS III*
 

Summary:  Carolina, 28585, USA The Triennial Aquaculture Meeting ``Aquaculture 2007,'' one of the largest aquaculture... future Triennial Aquaculture Meetings, and we invite you to join us in San Diego in 2010. * Corresponding

  

Source: Hamza, Iqbal - Department of Animal and Avian Sciences, University of Maryland at College Park

 

Collection: Biology and Medicine

 
60 STAR Panel Report Alasakan Fisheries Science Center
 

Summary:  their contributions two retrospective analyses are requested. First, take out the triennial survey for 2004,and... and females and for north and south LCN Catch1956-2004 Abundance indices: 3 #12;Trawl CPUE 1976-1997 Triennial... survey 1977 ­ 2004 Length frequencies: Recreational 1981-1983 Commercial 1975-1978 Triennial survey ...

  

Source: Southwest Fisheries Science Center, NOAA

 

Collection: Environmental Sciences and Ecology


Page:   1  2  3  4  5 
Page:   1  2  3  4  5 
 
61 Expression and purification of proteins using Strep-tag and/or 6xHistidine -tag A comprehensive manual 1 Expression and purification of proteins using
 

Summary:  of pASK-IBA plasmids pASK-IBA2 Eco31IPshAIPshAIEco31I XbaIRBSBsaINcoIBsmFIEcoRISstIKpnISma... TrpSerHisProGlnPheGluLysEnd OmpALinkStrep-tagII pASK-IBA3plus Eco31IPshAIPshAIEco31I XbaIRBSBsaISacIIBsmFIEcoRISstIKpnISma... RISstIKpnISmaIBamHIXhoISalIPstIBsmFINcoIBsaIEcoRVHindIII TCTAGATAACGAGGGCAAAAAATGAAA

  

Source: Lebendiker, Mario - Wolfson Centre for Applied Structural Biology, Hebrew University of Jerusalem

 

Collection: Biotechnology ; Biology and Medicine

 
62 ERRATA NOTICE This document is being made available in .PDF format for the convenience of users; however,
 

Summary:  ), in keeping with the triennial rotation of comprehensive surveys among three major geographic areas (Bering... Coast Surveys The year 1995 was a "triennial year" for focusing research survey efforts in the West... in a series of coastwide triennial groundfish surveyswas conducted during June through September to monitor

  

Source: Alaska Fisheries Science Center

 

Collection: Environmental Sciences and Ecology

 
63 The present account of the Tajik Pamirs and development trends in this remote
 

Summary:  : · Existing international population networks (transregional and transboundary relations between the Ismaeli... population groups (Ismaeli, Kyrgyz, and Tajik) · Traditional strong role of women in all spheres of life... and international family and ethnic networks suitable for exchange of goods, services, ...

  

Source: Richner, Heinz - Zoologischen Institut, Universität Bern

 

Collection: Environmental Sciences and Ecology

 
64 422 IEEE TRANSACTIONS ON VEHICULAR TECHNOLOGY, VOL. 46, NO. 2, MAY 1997 C-PRMA: A Centralized Packet Reservation
 

Summary:  - tegrated services (I-ISMA) [4], [5], derived from PRMA, combines a contention mechanism with a time... -reservation technique to provide the integration of voice and low-rate data applications on radio channels. In I-ISMA... ) will periodically poll the MS for the transmission of the whole talkspurt. However, I-ISMA uses a ...

  

Source: Borgonovo, Flaminio - Dipartimento di Elettronica e Informazione, Politecnico di Milano

 

Collection: Engineering

 
65 Photosynthesis. Energy from the Sun 14th International Congress on Photosynthesis
 

Summary:  succession of thirteen triennial international photosynthesis conferences, or congresses, stands behind... Photosynthesis. Energy from the Sun 14th International Congress on Photosynthesis Editorial... this process. The first truly international conference on pho- tosynthesis was held in Freudenstadt in ...

  

Source: Allen, John F. - School of Biological and Chemical Sciences, Queen Mary, University of London

 

Collection: Renewable Energy ; Biology and Medicine

 
66 Status of the Pacific coast groundfish fishery through 2009,
 

Summary:  and Washington using International Pacific Halibut Commission (IPHC) longline survey data. In addition, time... series of yelloweye rockfish abundance in the triennial and NWFSC combined trawl surveys were estimated... to areas based on internal parameter estimation; · Removal of stochasticity in recruitment; · Addition

  

Source: Southwest Fisheries Science Center, NOAA

 

Collection: Environmental Sciences and Ecology

 
67 Interannual signals in length of day and atmospheric angular momentum
 

Summary:  -31029 Toulouse Cedex 4-France E-mail: Rodrigo.Abarca-del-Rio@cisi.cnes.fr 2 International Earth Rotation Service... be separated natu- rally into three bands: a quasi-biennial, a triennial- quadrennial and one at six... in the troposphere of AAM observed in earlier studies for other variables. In the triennial- quadrennial (TQ) ...

  

Source: Ecole Polytechnique, Centre de mathématiques

 

Collection: Mathematics

 
68 Blind and semi-blind source Erkki Oja, Alexander Ilin, Zhirong Yang, Zhijian Yuan, Jaakko Luttinen
 

Summary:  considerably. This earlier work has been reported in the previous Triennial and Biennial reports of our... in the separate Chapter 2. References [1] Triennial and Biennial reports of CIS and AIRC. http... kmeans, spectral clustering and normalized cuts. In Proceedings of the tenth ACM SIGKDD international con

  

Source: Karhunen, Juha - Department of Information and Computer Science, Helsinki University of Technology

 

Collection: Computer Technologies and Information Sciences

 
69 ~"',. OF C"o .$"'.;qrES Of
 

Summary:  length based on the 1999 Gulf of Alaska triennial bottom trawl survey, by International North Pacific... on the 1999 Gulf of Alaska triennial bottom trawl survey, by International North Pacific Fisheries Commission... triennial (or first biennial) groundfish assessment survey of the Gulf ...

  

Source: NOAA Marine Fisheries Review

 

Collection: Environmental Sciences and Ecology

 
70 [7] Huhns, M. (ed.), Distributed Artifical Intelligence. Morgan Kaufman, 1987 [8] Jennings, N.R., Towards a cooperation knowledge level for collaborative problem
 

Summary:  t ) t £ N in IS(MAS). The set of all of them can be denoted by IS(MAS) N , or Traces(MAS). b) An element (M... is an internal semantic link of agent A (i.e., a semantic link between components C 1 and C 2 of A... ) then a transition function function for I is called an internal interaction transition ...

  

Source: Treur, Jan - Department of Artificial Intelligence, Vrije Universiteit Amsterdam

 

Collection: Computer Technologies and Information Sciences

 
71 Introduction -Preface The process of editing and publication of the proceedings for the 5th
 

Summary:  was planned in the framework of the N.T.U.A. institution involving among others triennial Interdisciplinary... changes. In the framework of this triennial tradition of conferences of memory, honor and live... members who are far from the theoretical values of the European Union and International Justice

  

Source: Papadopoulos, Evangelos - Department of Mechanical Engineering, National Technical University of Athens

 

Collection: Engineering

 
72 Standards to learning and
 

Summary:  /practice teacher qualifications Triennial review of mentors and practice teachers Roles to support learning... Circular 02/2008 and outlined at 3.2.6. b. Triennial review requirements for midwife sign-off mentors who... , are required to mentor at least one student in the three year period prior to triennial review, as outlined

  

Source: Davies, Christopher - School of Mathematics, University of Wales, Cardiff

 

Collection: Mathematics

 
73 Status of the Pacific coast groundfish fishery through 2008,
 

Summary:  : Evaluate anomalies from triennial surveys for multiple species. Reason: This issue spans all species... for which the triennial survey is used. The change in the timing of the survey to earlier in the year after... , the residual pattern of the fit to the triennial survey was reasonably good and the present application

  

Source: Southwest Fisheries Science Center, NOAA

 

Collection: Environmental Sciences and Ecology

 
74 Het is dan bijna zover, met het verdedigen van mijn proefschrift sluit ik een periode af van ruim tien jaar in Groningen. Het rest mij alleen nog een groot aantal
 

Summary:  meters bier, heb ik in deze jaren mee mogen maken, zoals het winnen van het interne toernooi, promotie... , Lidia, Iago e Isma. Graciñas de Corazón a Todos! Harold, Melanie, Britt en Lynn wil ik graag bedanken

  

Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution,

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
75 Cnrs Urbama Tours, France
 

Summary:  money in 1600. The life and times of Isma'il Isma'il Abu Taqiyya, egyptian merchant, Syracuse University... du gouvernement, sur le marché international du blé. - Il était chargé de la gestion des réserves de

  

Source: Ecole Polytechnique, Centre de mathématiques

 

Collection: Mathematics

 
76 April 5, 2005 Professor Richard D. Hazeltine, Chair
 

Summary:  and rate the program's progress toward achieving the long-term PART measures on a triennial basis. I would... Objective from DOE Strategic Plan o = Long Term Success Measure from PART INTL = with international... to ITER for this international collaboration to build the first fusion burning plasma experiment capable

  

Source: Fusiongnition Research Experiment (FIRE)

 

Collection: Plasma Physics and Fusion

 
77 Building Energy & Environments (BEE) Dept. of Civil, Architectural & Environmental Engineering
 

Summary:  is the preeminent international meeting on indoor air quality. It is expected that this triennial meeting (last held... in an integrated residential setting. The 1,300 ft2 UTest House includes a control room, a wide range of internal... , and international consulting firms. Examples of recent employers ...

  

Source: Texas at Austin, University of - Department of Biomedical Engineering, Ultrasound Imaging and Therapeutics Research Laboratory

 

Collection: Engineering ; Biology and Medicine

 
78 20110228 Reviewed: Spring 2011 MSU Departmental Assessment Plan
 

Summary:  members is: Mr. Stephen Burnham ON Semiconductor Pocatello, ID Mr. Lee Cannon International Game... corresponding to any problematic Outcomes. Triennial Objectives Assessment Figure 2 Objectives Assessment Every... of Objectives, which maintained the intent of the original Objectives, was the result. Triennial Curriculum

  

Source: Dratz, Edward A. - Department of Chemistry and Biochemistry, Montana State University; Dyer, Bill - Department of Plant Sciences and Plant Pathology, Montana State University

 

Collection: Biology and Medicine ; Chemistry ; Environmental Sciences and Ecology

 
79 Recently, many multiple-access (MAC) protocols have been or are being proposed for wireless networks. As most of these
 

Summary:  . Currently, we have implemented, Aloha and Slotted Aloha[3], ISMA[4], R-ISMA[5], TDMA[6], R-TDMA[7], MACA[8... -Access (ISMA) Scheme for Terrestrial Packet Radio Networks, Elec- tronics and Communications in Japan, Vol. 64... for Wireless Multimedia Networks, Proceedings 3rd International Workshop on Mobile ...

  

Source: Havinga, Paul J.M. - Department of Computer Science, Universiteit Twente

 

Collection: Computer Technologies and Information Sciences

 
80 Status of the Pacific coast groundfish fishery through 2009,
 

Summary:  other rockfishes, splitnose utilize internal fertilization and bear live young (Love et al. 2002... fishery (Fig. 9). Most of splitnose that year was landed in the Eureka and Monterey International North... ) for the Sebastes complex was estimated for each International North Pacific Fisheries Council (INPFC) area along

  

Source: Southwest Fisheries Science Center, NOAA

 

Collection: Environmental Sciences and Ecology


Page:   1  2  3  4  5 
Page:   1  2  3  4  5 
 
81 Nonlinear multichannel singular spectrum analysis of the tropical Pacific climate variability using a neural network approach
 

Summary:  in the individual SSA modes. A quasi­triennial wave of about 39­month period is found in the NLSSA mode 2... ­time loading patterns associated with this NLSSA mode 2 (Fig. 9) reveal oscillations at around the triennial... regularity strongly suggests that this quasi­triennial oscillation of the NLSSA mode 2 is a much more ...

  

Source: Hsieh, William - Departments of Earth and Ocean Science & Physics and Astronomy, University of British Columbia

 

Collection: Geosciences

 
82 Nonlinear multichannel singular spectrum analysis of the tropical Pacific climate variability using a neural network approach
 

Summary:  in the individual SSA modes. A quasi-triennial wave of about 39-month period is found in the NLSSA mode 2... with this NLSSA mode 2 (Fig. 9) reveal oscillations at around the triennial period. The corresponding NLPC... the fluctuations generated by the NLSSA mode 1 (Fig. 6). The great regularity strongly suggests that this ...

  

Source: Hsieh, William - Departments of Earth and Ocean Science & Physics and Astronomy, University of British Columbia

 

Collection: Geosciences

 
83 Purdue Animal Care and Use Committee PACUC Handbook
 

Summary:  by the PACUC 2. Projects using only cadavers, animal tissues, fluids, internal organs, eggs, embryos, fetuses... ;12 extensive triennial resubmission and review), the PI will be sent a form directing him or her to provide... be considered and voted on at a meeting of the full PACUC. b. Triennial resubmission and review of ...

  

Source: Fernández-Juricic, Esteban - Department of Biological Sciences, Purdue University

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
84 ISMA 2007 End conditions of piano strings END CONDITIONS OF PIANO STRINGS
 

Summary:  ISMA 2007 End conditions of piano strings END CONDITIONS OF PIANO STRINGS Kerem Ege1 , Antoine... velocity for a given string force) and tone duration (low soundboard velocity). #12;ISMA 2007 End... ) but need to be reconsidered especially in the upper frequency range. T v L f x TT vv LL ff xx #12;ISMA 2007

  

Source: Ecole Polytechnique, Centre de mathématiques

 

Collection: Mathematics

 
85 UNIVERSITA' DEGLI STUDI DI MILANO BICOCCA Piazza dell'Ateneo Nuovo, 1 20126 Milano
 

Summary:  of Milan it proceeded from in 1998 - UNIMIB has created an extensive international network and has been... and research process. International Dimension - Cooperation with over 200 partner universities in Europe... and 100 worldwide testifies UNIMIB's aim to enhance international cooperation through exchange programmes

  

Source: Milano-Bicocca, Università - Dipartimento di Informatica, Sistemistica e Comunicazione, Laboratory of Test and Analysis

 

Collection: Engineering ; Computer Technologies and Information Sciences

 
86 IEEE TRANSACTIONS ON PLASMA SCIENCE, VOL. 30, NO. 1, FEBRUARY 2002 5 Guest Editorial
 

Summary:  Triennial Special Issue on Images in Plasma Science AS THE PLASMA phenomena we investigate become more... in their own right. It is my pleasure to present to you the Third Triennial Special Issue on Images in Plasma

  

Source: Kushner, Mark - Department of Electrical Engineering and Computer Science, University of Michigan

 

Collection: Engineering

 
87 CURRICULUM VITAE Philip Lazarovici, Ph.D.
 

Summary:  Ministry of Health for Emmigrants Pharmacists, Jerusalem. 2006 Organizer of The Triennial Doris Cecelia... /Molecular Biology Societies;Israeli Association of Clinical Pharmacologists; International Society of Toxinology

  

Source: Lelkes, Peter I. - School of Biomedical Engineering, Drexel University

 

Collection: Materials Science ; Biology and Medicine

 
88 Center for BioEnergy Sustainability (CBES) http://www.ornl.gov/cbes/ Bioenergy Sustainability and Land-Use Change Report
 

Summary:  reviewer for the USEPA report "Biofuels and the Environment: First Triennial Report to Congress." The peer... as an official US delegate for the International Organization for Standardization (ISO) Project Committee working

  

Source: Oak Ridge National Laboratory Fossil Energy Program; Pint, Bruce A. - Materials Science & Technology Division, Oak Ridge National Laboratory

 

Collection: Fossil Fuels ; Materials Science

 
89 MEXICAN AMERICAN STUDIES CONFERENCE
 

Summary:  , printmaking, and murals. She has participated in international exhibitions, and her work appears in The Road... of Yreina Cervántez © Yreina Flores The Mexican American Studies Conference is a triennial presentation

  

Source: Boise State University, Center for Environmental Sensing

 

Collection: Environmental Sciences and Ecology ; Engineering

 
90 SCI ( SCIENCE CITATION INDEX) VE SSCI (SOCIAL SCIENCE CITATION INDEX) KAPSAMINDAK DERGLERDE YAYINLANAN MAKALELER
 

Summary:  " Pediatrics International, 45(1):68-73, 2003 (SCI- Exp). 11. Aki, E. ve Y. Yakut, "Overuse Syndrome... "Effects of swimming training on physical fitness and water orientation in autism. Pediatrics International... in Neuromuscular Diseases", 11 th International Congress on Neuromuscular Disorders, 2-7 Temmuz 2006, stanbul

  

Source: Köprülü, Kahraman Güçlü - Department of Electrical and Electronics Engineering, TOBB Economics and Technology University

 

Collection: Engineering

 
91 Status of the California Current Ecosystem: Major EBM Components
 

Summary:  effects. The combined data from the AFSC triennial and NWFSC annual trawl surveys (see Table 7 through... Table 10 for trawl survey characteristics, net details, triennial survey effort, and annual survey... figure. The triennial and NWFSC data were not combined because of differences in survey design (see

  

Source: Southwest Fisheries Science Center, NOAA

 

Collection: Environmental Sciences and Ecology

 
92 National Marine Fisheries Service
 

Summary:  to lndustry: 1993 Triennial Bottom Trawl Survey of the Eastern Gulf of Alaska July-August 1993 RV Miller... may also affect the quality of the scanned document. #12;#12;Report to Industry: 1993 Triennial Bottom... APPENDD( B Fishing Log of the 1993 Triennial Bottom Trawl Survey of the Eastern Gulf of Alaska .....25

  

Source: Alaska Fisheries Science Center

 

Collection: Environmental Sciences and Ecology

 
93 THE MACHINE LEARNING AND INTELLIGENT MUSIC PROCESSING GROUP AT THE AUSTRIAN RESEARCH INSTITUTE FOR ARTIFICIAL
 

Summary:  of Intensity? Pro- ceedings of the 2004 International Symposion on Music Acoustics (ISMA'04), Nara, Japan, pp... Conference on Machine Learning (ECML 2004) [15]) and the International Conference on Music Information... Worm": An Interface for Real-Time Manipulation of Expressive Music Perfor- mance. ...

  

Source: Widmer, Gerhard - Department of Computational Perception, Johannes Kepler Universität Linz

 

Collection: Computer Technologies and Information Sciences

 
94 Aspects of distribution, transport and recruitment of Alaska plaice (Pleuronectes quadrituberculatus) in the Gulf of Alaska and
 

Summary:  from triennial surveys described below. Only fish less than 30 cm were included. The total number... above. For comparisons with the Bering Sea, triennial National Marine Fisheries Service summer... NMFS triennial bottom trawl surveys. (a) Gulf of Alaska, 1984 to 1999. Also shown are the 100 and 200 m

  

Source: National Oceanic and Atmospheric Administration, Pacific Marine Environmental Laboratory, Atmopsheric Chemistry and Global Change Program

 

Collection: Geosciences ; Environmental Sciences and Ecology

 
95 Page 1 of 18 Regional Monitoring Program for Water Quality
 

Summary:  ; and triennial bird egg monitoring (cormorant and tern) and sport fish monitoring. As the RMP evolves... required to manage finances and contracts, plan and coordinate internal activities and workgroups... .1 Internal Coordination This category provides SFEI staff time for coordination and liaison to program

  

Source: San Francisco Estuary Institute

 

Collection: Environmental Sciences and Ecology

 
96 triennial report 1 July 200630 June 2009
 

Summary:  triennial report 1 July 2006­30 June 2009 review 1 July 1995­30 June 2006 plans 1 July 2009­30 June... started. Professor Emeritus Bengt Åkesson has assisted with the compilation and editing of this Triennial... awards 80 International conferences 81 Partners in industry 82­83 Results and effects in industry 84

  

Source: Chalmers University of Technology, Department of Physical Resource Theory, Humanoid Project

 

Collection: Engineering

 
97 Status of the Pacific coast groundfish fishery through 2009,
 

Summary:  assessment and continued here include the CalCOFI larval abundance time series and the triennial trawl survey... optimistic view of stock status, and the trawl cpue and triennial survey index, which tend to reflect a more... selectivity is estimated for the triennial trawl survey continues to be problematic, as it has for past

  

Source: Southwest Fisheries Science Center, NOAA

 

Collection: Environmental Sciences and Ecology

 
98 NVH at MTUNVH at MTU Presented by
 

Summary:  Corporation US Navy International Snowmobile Manufacturer's Association Canadian Department of National... development Replace J192 w/ sound power type test Funded by ISMA to improve testing process Reduce... Vibration of a Real Wheel Sedan," International Journal of Vehicle Noise and Vibration, 1, 122-141. 2004

  

Source: Rao, Mohan - Department of Mechanical Engineering, Michigan Technological University

 

Collection: Engineering

 
99 Status of the Pacific coast groundfish fishery through 2008,
 

Summary:  a recreational observer program (1987-1998), an index of relative abundance based on the triennial trawl survey... research area for future assessments, and would benefit greatly from data from historical (triennial trawl... ), comparable parameter values estimated internally from an early draft of the model that included ...

  

Source: Southwest Fisheries Science Center, NOAA

 

Collection: Environmental Sciences and Ecology

 
100 Assistant Professor Technology and Information Management (TIM)
 

Summary:  Research Center July 2005 International Federation of Operational Research Societies Triennial Meeting June... of Canterbury 1994 ­ 1995 New Zealand International Mathematical Olympiad team member One of six competitors... Learning Effects, International Journal of Services and Operations Management. Vol 4. ...

  

Source: Ross, Kevin - Jack Baskin School of Engineering, University of California at Santa Cruz

 

Collection: Computer Technologies and Information Sciences


Page:   1  2  3  4  5