Home

About

Advanced Search

Browse by Discipline

Scientific Societies

E-print Alerts

Add E-prints

E-print Network
FAQHELPSITE MAPCONTACT US


  Topic List  Advanced Search  
Sample search results for: aada teedume tarmo

Page:   2  3  4  5 
 
1 Multiplier ideals and jumping numbers Preliminaries on simple complete ideals
 

Summary:  NUMBERS OF A SIMPLE COMPLETE IDEAL IN A TWO DIMENSIONAL REGULAR LOCAL RING Eero Hyry, Tarmo J¨arvilehto 19... th July 2006 Eero Hyry, Tarmo J¨arvilehto Jumping numbers of a simple complete ideal #12;Multiplier... ideals and jumping numbers 2 Preliminaries on simple complete ideals 3 Main results Eero Hyry, Tarmo J

  

Source: Faridi, Sara - Department of Mathematics and Statistics, Dalhousie University

 

Collection: Mathematics

 
2 Original Article High prevalence of trimethoprim-resistance cassettes in class 1 and 2
 

Summary:  strains. The class 1 integrons detected contained dfr and aadA cassettes, alone or in combination (dfrA5... /dfrA15, or dfrA15-aadA1, dfrA1-aadA2), and an atypical cassette array with an insertion sequence (oxa... 30-aadA1-IS1). For class 2 integrons, we detected either the same cassettes as those found in Tn7

  

Source: Ecole Polytechnique, Centre de mathématiques

 

Collection: Mathematics

 
3 The EMBO Journal vol.15 no.14 pp.3498-3506, 1996 The chloroplast ycf7 (petL) open reading frame of
 

Summary:  with a single transmembrane a helix. We have disrupted 0RF58 andycf 7 with the aadA expression cassette... by particle- gun mediated chloroplast transformation. While the ORF58::aadA transformants... are indistinguishable from wild type, photoautotrophic growth of the ycf7::aadA transformants is considerably impaired

  

Source: Institut de Biologie Physico-Chimique CNRS, Physico-Chimie Moléculaire des Membranes Biologiques

 

Collection: Chemistry ; Biology and Medicine

 
4 L. Brim and J. van de Pol (Eds.): 8th International Workshop on Parallel and Distributed Methods in verifiCation 2009 (PDMC'09)
 

Summary:  . Niemenmaa & K. Heljanko Tarmo: A Framework for Parallelized Bounded Model Checking Siert Wieringa Matti... Tarmo. Our framework can be used with any incremental SAT encoding for BMC but for the results... extensive experimental results obtained with multiple variants of our Tarmo imple- mentation. Our shared

  

Source: Heljanko, Keijo - Department of Information and Computer Science, Helsinki University of Technology

 

Collection: Computer Technologies and Information Sciences

 
5 Stable transformation of petunia plastids Mikhajlo K. Zubkoy
 

Summary:  cultivar of P. hybrida (var. Pink Wave). Plastid targeting regions from tobacco were used to integrate aadA... cassettes containing the aadA and gusA genes were cloned into the ApaI site of pTB27-link in inverted... element can be excised with NotI and PstI as a 247 bp fragment. An aadA expression cassette

  

Source: Meyer, Peter - Centre for Plant Sciences & Faculty of Biological Sciences, University of Leeds

 

Collection: Biology and Medicine

 
6 Vaughan Pratt (Invited Speaker) Comonoids in chu: a large cartesian closed sibling of topological spaces 1
 

Summary:  . . . . . . . . . . . . . . . 265 Ralph Matthes, Tarmo Uustalu Substitution in Non-wellfounded Syntax with Variable Binding

  

Source: Gumm, H. Peter - Fachbereich Mathematik und Informatik, Philipps-Universität Marburg

 

Collection: Mathematics

 
7 Theoretical Computer Science, Volume: 327, Issue: 1-2, October 25, 2004 Home Browse Search Settings Alerts My Articles Help
 

Summary:  ) Substitution in non-wellfounded syntax with variable binding Matthes, Ralph; Uustalu, Tarmo pp. 155

  

Source: Gumm, H. Peter - Fachbereich Mathematik und Informatik, Philipps-Universität Marburg

 

Collection: Mathematics

 
8 Barred Galaxias (Galaxias fuscus Mack, 1936). R.K. JOURNAL OF THE AUSTRALIA NEW GUINEA FISHES ASSOCIATIONincorporated Registration No. ACO27788J
 

Summary:  H Kuiter MOUNTAIN GALAXIAS ­ Tarmo Raadik Chilatherina axelrodi ­ Barry Crockford SACRED LOTUS... not a Mountain Galaxias? Tarmo Raadik* The Mountain Galaxias, Galaxias olidus Günther 1866, is a small (up to 14... Rylah Institute, 123 Brown St, Heidelberg VIC 3084, tarmo.raadik@nre.vic.gov.au) #12;

  

Source: Canberra, University of - Institute for Applied Ecology

 

Collection: Environmental Sciences and Ecology

 
9 1st Reading August 3, 2011 18:57 WSPC/1793-5369 244-AADA 00081
 

Summary:  1st Reading August 3, 2011 18:57 WSPC/1793-5369 244-AADA 00081 Advances in Adaptive Data Analysis1... iteration41 1 #12;1st Reading August 3, 2011 18:57 WSPC/1793-5369 244-AADA 00081 2 R. H. Chan, H.-X. Liang... -AADA 00081 Positively Constrained Total Variation Penalized Image Restoration 3 The first term of Eq

  

Source: Chan, Raymond - Department of Mathematics, Chinese University of Hong Kong

 

Collection: Mathematics

 
10 1st Reading June 16, 2011 20:26 WSPC/1793-5369 244-AADA 00064
 

Summary:  1st Reading June 16, 2011 20:26 WSPC/1793-5369 244-AADA 00064 Advances in Adaptive Data Analysis1... of 1 #12;1st Reading June 16, 2011 20:26 WSPC/1793-5369 244-AADA 00064 2 T. Y. Hou & Z. Shi wavelet... in this same special issue of AADA as our paper.38 This is a very interesting line of work. For the examples

  

Source: Hou, Thomas Yizhao - Applied and Computational Mathematics Department, California Institute of Technology

 

Collection: Mathematics

 
11 ON THE EQUATION a(a + d)(a + 2d)(a + 3d) = x2 Tamas Erdelyi
 

Summary:  the following outline: If y2 = a(a+d)(a+2d)(a+3d), then dividing both sides by a4 and setting y = y/a2 and x = d... is to present a totally elementary proof of the fact that the equation a(a+d)(a+2d)(a+3d) = x2 cannot be solved... -trivial applications of infinite descent; the current proof is one. Theorem. The equation ...

  

Source: Erdélyi, Tamás - Department of Mathematics, Texas A&M University

 

Collection: Mathematics

 
12 JOURNAL OF BACTERIOLOGY, Nov. 2002, p. 60566059 Vol. 184, No. 21 0021-9193/02/$04.00 0 DOI: 10.1128/JB.184.21.60566059.2002
 

Summary:  C-PBAD-T7pol genes, flanked by aadA sequences, in a pSB890 backbone (8). The new Salmonella construct, SB300... -1 to SB300. Key components of pSBaadABADT7-1 include tet, oriR6K (7, 11), sacB (7), aadA (7, 9), ara... C-PBAD (6), and the T7 RNA polymerase gene (12). The aadA gene, encoding a streptomycin adenylyltransferase

  

Source: Galan, Jorge E - Boyer Center for Molecular Medicine & Department of Cell Biology, Yale University

 

Collection: Biology and Medicine

 
13 Proc. Natl. Acad. Sci. USA Vol. 95, pp. 43804385, April 1998
 

Summary:  -attachment-defective cytochrome f sequence, a deletion of the petD gene, and the aadA cassette (conferring spectinomycin... of the aadA cassette in plasmid pAF52L-55V (21) with the 3 UTR of the petD gene, using the strategy... plasmid pAFRF. This substituted the aadA coding region from plasmid pdFBE with the petA coding region

  

Source: Wollman, Francis-André - nstitut de Biologie Physico-Chimique & Université Pierre-et-Marie-Curie, Paris 6

 

Collection: Biology and Medicine ; Renewable Energy

 
14 1st Reading July 24, 2008 13:6 WSPC/244-AADA 00004
 

Summary:  1st Reading July 24, 2008 13:6 WSPC/244-AADA 00004 Advances in Adaptive Data Analysis1 Vol. 1, No... Reading July 24, 2008 13:6 WSPC/244-AADA 00004 2 Z. Wu & N. E. Huang As discussed by Huang et al.,1... , 200 to 480 Hz, etc. #12;1st Reading July 24, 2008 13:6 WSPC/244-AADA 00004 Ensemble Empirical Mode

  

Source: Huang, Norden E.- Research Center for Adaptive Data Analysis, National Central University

 

Collection: Engineering ; Materials Science

 
15 Autoluminescent Plants Alexander Krichevsky1
 

Summary:  marker aadA, resulting in pCAS3-aadA-LUX vector. Homologous recombination sites for integration into rps... ) plastid genome in tobacco is present in thousands of copies per cell [24]. Integration of aadA and the lux... fragments. Shown are also: the rps12 and trnV plastid genes; aadA, the spectinomycin resistance gene

  

Source: Citovsky, Vitaly - Department of Biochemistry and Cell Biology, SUNY at Stony Brook

 

Collection: Biology and Medicine ; Biotechnology

 
16 (Co)Monads for DummiesGrad Students Math's answer to `It Depends'
 

Summary:  of Dataflow Programming, Tarmo Uustalu and Varmo Vene, APLAS 2005, LNCS 3780 (2005) link 4. Comonadic... functional attribute evaluation, Tarmo Uustalu and Varmo Vene, in 6th Sym- posium on Trends in Functional... Programming (September 2005) link 5. Comonad Dataflow Programming, Tarmo Uustalu (November 2005) link 6

  

Source: Carette, Jacques - Department of Computing and Software, McMaster University

 

Collection: Computer Technologies and Information Sciences ; Mathematics

 
17 Proceedings Workshop on
 

Summary:  : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : 69 Tarmo Uustalu and Varmo Vene Language Independent Traversals for Program Transformation

  

Source: Utrecht, Universiteit - Department of Information and Computing Sciences

 

Collection: Computer Technologies and Information Sciences

 
18 Explicit Substitutions and Higher-Order Syntax School of Computer Science and IT, University of Nottingham,
 

Summary:  , University of Nottingham, Jubilee Campus, Wollaton Rd, Nottingham NG8 1BB, UK, nxg@cs.nott.ac.uk Tarmo... , Estonia, tarmo@cs.ioc.ee Makoto Hamana Department of Computer Science, Gunma University, 1-5-1 Tenjin... :33; p.1 #12;2 Neil Ghani, Tarmo Uustalu, Makoto Hamana the constructors of the datatype while initiality

  

Source: Uustalu, Tarmo - Institute of Cybernetics, Tallinn Technical University

 

Collection: Computer Technologies and Information Sciences

 
19 Advances in Adaptive Data Analysis Vol. 3, Nos. 1 & 2 (2011) vvi
 

Summary:  This special issue of AADA is devoted to the research topics presented in the highly stimulating international

  

Source: Huang, Norden E.- Research Center for Adaptive Data Analysis, National Central University

 

Collection: Engineering ; Materials Science

 
20 THE RATIONAL UNIFIED PROCESS WITH THE "4+1" VIEW MODEL OF SOFTWARE
 

Summary:  FOR MODELING WEB APPLICATIONS Tarmo Robal, Vladimir Viies, Margus Kruus Department of Computer Engineering... software development processes, but also creative mind and short reaction time to changes. Web #12;2 Tarmo... at the inception phase, for a new lifecycle. #12;4 Tarmo Robal, Vladimir Viies, Margus Kruus Figure 1. ...

  

Source: Kruus, Margus - Faculty of Information Technology, Tallinn University of Technology

 

Collection: Computer Technologies and Information Sciences


Page:   2  3  4  5 
Page:   1  2  3  4  5 
 
21 ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Feb. 2010, p. 590596 Vol. 54, No. 2 0066-4804/10/$12.00 doi:10.1128/AAC.00055-09
 

Summary:  Cf No. of copies of blaCMY-2 1 2 2 2 floR regiong Yes Yes Yes Yes aadA regiong Yes Yes No Yes kan... on sequence similarity with pAM04528. g The floR, aadA, kan, and merA regions are shown in Fig. 1. VOL. 54... (A), strA, strB, and sul2. The "aadA region" includes aadA, aacC, and two heat-shock chaperones ...

  

Source: Singer, Randall - College of Veterinary Medicine, University of Minnesota

 

Collection: Biology and Medicine

 
22 Monad Translating Inductive and Coinductive Types
 

Summary:  Monad Translating Inductive and Coinductive Types Tarmo Uustalu Inst. of Cybernetics, Tallinn... Technical University Akadeemia tee 21, EE-12618 Tallinn, Estonia tarmo@cs.ioc.ee Abstract. We show... -Verlag Berlin Heidelberg 2003 #12;300 Tarmo Uustalu The project grew out of earlier work of Gilles Barthe

  

Source: Uustalu, Tarmo - Institute of Cybernetics, Tallinn Technical University

 

Collection: Computer Technologies and Information Sciences

 
23 Normalization by Evaluation for 2 Thorsten Altenkirch1
 

Summary:  Normalization by Evaluation for 2 Thorsten Altenkirch1 and Tarmo Uustalu2 1 School of Computer... of Cybernetics, Tallinn Technical University Akadeemia tee 21, EE-12618 Tallinn, Estonia tarmo@cs.ioc.ee Abstract... are using are only approximations of their type-theoretic #12;262 Thorsten Altenkirch and Tarmo Uustalu

  

Source: Uustalu, Tarmo - Institute of Cybernetics, Tallinn Technical University

 

Collection: Computer Technologies and Information Sciences

 
24 Generalized Iteration and Coiteration for Higher-Order Nested Datatypes
 

Summary:  Matthes2 , and Tarmo Uustalu3 1 Department of Computer Science, University of Munich abel... ) matthes@informatik.uni-muenchen.de 3 Inst. of Cybernetics, Tallinn Technical University tarmo... categories: #12;56 Andreas Abel, Ralph Matthes, and Tarmo Uustalu Kinds. Kinds are given by the following

  

Source: Hutton, Graham - School of Computer Science, University of Nottingham; Uustalu, Tarmo - Institute of Cybernetics, Tallinn Technical University

 

Collection: Computer Technologies and Information Sciences

 
25 The EMBO Journal vol. 1 3 no. 5 pp. 101 9 -1027, 1994 The assembly of cytochrome b6If complexes: an
 

Summary:  ; Goldschmidt-Clermont, 1991). One of them, the aadA expression cassette (Goldschmidt- Clermont, 1991... restriction fragment containing most or all of the corresponding pet ORF for the aadA4 cassette which confers... .9 kb, resulting from the fusion of the 5' untranslated region of atpA with the aadA gene from

  

Source: Wollman, Francis-André - nstitut de Biologie Physico-Chimique & Université Pierre-et-Marie-Curie, Paris 6

 

Collection: Biology and Medicine ; Renewable Energy

 
26 A N N U A L R E P O R T 2 0 0 6 CMA in brief 2
 

Summary:  ; Goldschmidt-Clermont, 1991). One of them, the aadA expression cassette (Goldschmidt- Clermont, 1991... restriction fragment containing most or all of the corresponding pet ORF for the aadA4 cassette which confers... .9 kb, resulting from the fusion of the 5' untranslated region of atpA with the aadA gene from

  

Source: Løw, Erik - Matematisk institutt, Universitetet i Oslo

 

Collection: Mathematics

 
27 Corruption of journal Impact Factors Anurag A. Agrawal
 

Summary:  reserved. doi:10.1016/j.tree.2005.02.002 Genetic compatibility and sexual selection Mikael Puurtinen, Tarmo

  

Source: Agrawal, Anurag - Department of Ecology and Evolutionary Biology & Entomollogy, Cornell University

 

Collection: Environmental Sciences and Ecology

 
28 NOUVEAUTS DU 10 DCEMBRE 2011 Affine algebraic geometry : the Russell festschrift / Daniel Daigle, Richard
 

Summary:  (295) Jumping numbers of a simple complete ideal in a two-dimensional regular local ring / Tarmo

  

Source: Gutkin, Boris - Group for Neural Theory, Collège de France

 

Collection: Computer Technologies and Information Sciences

 
29 SEMANTICS OF GRAMMARS AND ATTRIBUTES VIA INITIALITY BART JACOBS AND TARMO UUSTALU
 

Summary:  SEMANTICS OF GRAMMARS AND ATTRIBUTES VIA INITIALITY BART JACOBS AND TARMO UUSTALU Institute... , Akadeemia tee 21, EE-12618 Tallinn, Estonia e-mail address: tarmo@cs.ioc.ee Dedicated to Henk Barendregt... 2007 by Bart Jacobs and Tarmo Uustalu 181 #12;182 BART JACOBS AND TARMO UUSTALU 2. FROM CONTEXT FREE

  

Source: Jacobs, Bart - Institute for Computing and Information Sciences, Radboud Universiteit Nijmegen

 

Collection: Computer Technologies and Information Sciences

 
30 Ragam: Charukesi Version: Semmangudi
 

Summary:  Tyaagaraaje Paati Maata Meaning: O Ramayya! You seem to feel ("galade") too proud ("Aada"), too uppish ("modi

  

Source: Kalyanaraman, Shivkumar - IBM Research India

 

Collection: Computer Technologies and Information Sciences

 
31 Biogenesis of PSI involves a cascade of translational autoregulation in the chloroplast
 

Summary:  of regulation of translation initiation in the CES behaviour of PsaA, using the aadA reporter gene One... a chimeric gene bearing the psaA 50 UTR fused immediately upstream of the bacterial aadA gene coding sequence... to a specific downregulation of translation of the psaA 50 UTR-driven aadA gene when expressed in the absence

  

Source: Wollman, Francis-André - nstitut de Biologie Physico-Chimique & Université Pierre-et-Marie-Curie, Paris 6

 

Collection: Biology and Medicine ; Renewable Energy

 
32 VOLUME NINETEEN JANUARYMARCH 2005
 

Summary:  .K. DORRIGO PLATEAU GALAXIIDS Tarmo Raadik RAJA AMPAT RAINBOWFISHES Heiko Bleher CONGOLLI'S PAST AND FUTURE... ;98 DORRIGO PLATEAU ­ A BIODIVERSITY "HOT-SPOT" FOR GALAXIIDS Tarmo A. Raadik* During the course of my... , Heidelberg VIC 3084 tarmo.raadik@dse.vic.gov.au #12;Fifty-two sites were sampled on the plateau, with 42

  

Source: Canberra, University of - Institute for Applied Ecology

 

Collection: Environmental Sciences and Ecology

 
33 Curriculum Vitae Full name: Andreas Martin Abel
 

Summary:  colleague Ralph Matthes and with Tarmo Uustalu from the Instiute of Cybernetics in Estonia, I have been... , Ralph Matthes, and Tarmo Uustalu. Generalized iteration and coiteration for higher-order nested... * *003. Springer. [12] Andreas Abel, Ralph Matthes, and Tarmo Uustalu. Iteration schemes for high

  

Source: Abel, Andreas - Theoretische Informatik, Ludwig-Maximilians-Universität München

 

Collection: Computer Technologies and Information Sciences

 
34 VOLUME SIXTEEN MAY-JUNE 2002
 

Summary:  ;830 Kosciuszko Galaxias: a story of confusion and imminent peril. Tarmo A. Raadik* & Rudie H. Kuiter** Confusion... , Arthur Rylah Institute, 123 Brown Street, Heidelberg VIC 3084. tarmo.raadik@nre.vic.gov.au. **Aquatic

  

Source: Canberra, University of - Institute for Applied Ecology

 

Collection: Environmental Sciences and Ecology

 
35 Generalizing Substitution (Extended Abstract)
 

Summary:  Generalizing Substitution (Extended Abstract) Tarmo Uustalu Inst. of Cybernetics, Tallinn Techn... . Univ. Akadeemia tee 21, EE-12618 Tallinn, Estonia tarmo@cs.ioc.ee It is well known that, given

  

Source: Uustalu, Tarmo - Institute of Cybernetics, Tallinn Technical University

 

Collection: Computer Technologies and Information Sciences

 
36 RELATEDNESS OF ESCHERICHIA COLI WITH DIFFERENT SUSCEPTIBILITY1 PHENOTYPES ISOLATED FROM SWINE FECES DURING AMPICILLIN2
 

Summary:  -spectinomycin (strA-strB and167 aadA1), tetracycline (tet(A) and tet(B)) and the integrase genes intI1 and intI2 were... A-strB and intI1 (except for one isolate).263 Another combination: blaTEM, cmlA, sulI, sulIII, tet(A), aadA1... 678/ EF090911b aadA1 GAGAACATAGCGTTGCCTTGG TCGGCGCGATTTTGCCGGTTAC 46 198 53 Se 131/ AJ238350b tet

  

Source: Ecole Polytechnique, Centre de mathématiques

 

Collection: Mathematics

 
37 2002 Blackwell Science Ltd The ramC gene is required for morphogenesis in
 

Summary:  is a derivative of pIJ8660 (Sun et al., 1999) in which the aac(3) IV gene has been replaced by aadA (see Table 2... ) and inserted into the XbaI site. The aadA gene, conferring resist- ance to spectinomycin, was isolated from p... at positions 7­12 to generate ramRdown, aac(3)IV and aadA. pTO1 is unable to replicate in S. ...

  

Source: Nodwell, Justin - Department of Biochemistry and Biomedical Sciences, McMaster University

 

Collection: Biology and Medicine

 
38 Diversity Strategic Update William T. Lewis -Vice President -Office for Diversity and Inclusion
 

Summary:  . · AnAchievableDreamAcademyPartnership (AADA) is designed to close the achievement gap for Access... Resources #12;first-generation, low-income and underrepresented students at AADA schools, thereby increasing

  

Source: Hopkins, William A. - Department of Fisheries and Wildlife Sciences, Virginia Tech

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
39 Advantages of a Leveled Commitment Contracting Protocol
 

Summary:  constraint is based on the idea that E ;a] E max ;a;a ; ]]: Z 1 ;1 f(a) ;a]da Z ;a ;1 f(a) ;a;a]da+ Z 1 ;a f... 0). The contractor's IR constraint is satis ed: Z 1 ;1 f(a) ;a]da Z ;a ;1 f(a) ;a;a]da+ Z 1 ;a f... ;a ; ] , a . Thus the (ex ante) IR constraint is Z 1 ;1 f(a) ;a]da Z ;a ;1 f(a) ;a;a]da+ Z 1 ;a f(a) ; ]da Full

  

Source: Massachusetts at Amherst, University of - Department of Computer Science, Multi-Agent Systems Lab

 

Collection: Computer Technologies and Information Sciences

 
40 The Plant Cell, Vol. 13, 13471367, June 2001, www.plantcell.org 2001 American Society of Plant Physiologists The Chloroplast Gene ycf9 Encodes a Photosystem II (PSII)
 

Summary:  reading frame with an aadA cassette in the antisense orientation (Figure 2A); aadA confers resistance... D and psbC upstream and trnG down- stream. A terminatorless aadA cassette was inserted into the MunI site... reinitiation of transcripts con- taining the C-terminal gene segment. Correct insertion of the ...

  

Source: Wollman, Francis-André - nstitut de Biologie Physico-Chimique & Université Pierre-et-Marie-Curie, Paris 6

 

Collection: Biology and Medicine ; Renewable Energy


Page:   1  2  3  4  5 
Page:   1  2  3  4  5 
 
41 Pivotal Roles for the Receiver Domain in the Mechanism of Action of the Response Regulator RamR of
 

Summary:  reading frame with an aadA cassette in the antisense orientation (Figure 2A); aadA confers resistance... D and psbC upstream and trnG down- stream. A terminatorless aadA cassette was inserted into the MunI site... reinitiation of transcripts con- taining the C-terminal gene segment. Correct insertion of the ...

  

Source: Nodwell, Justin - Department of Biochemistry and Biomedical Sciences, McMaster University

 

Collection: Biology and Medicine

 
42 PRIMEIRA PROVA -F589 1. A uma dada temperatura T1 um corpo negro tem emiss~ao maxima no comprimento
 

Summary:  ´axima no comprimento de onda 1. Qual ser´a o valor do comprimento de onda de m´axima emiss~ao se aumen- tarmos

  

Source: de Aguiar, Marcus A. M. - Instituto de Física "Gleb Wataghin", Universidade Estadual de Campinas

 

Collection: Materials Science ; Physics

 
43 Genetic compatibility and sexual selection Mikael Puurtinen, Tarmo Ketola and Janne S. Kotiaho
 

Summary:  Letters Genetic compatibility and sexual selection Mikael Puurtinen, Tarmo Ketola and Janne S

  

Source: Kotiaho, Janne S. - Department of Biological and Environmental Science, University of Jyväskylä

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
44 Termination of Functions that Are Passed to Their Arguments
 

Summary:  Martin Hofmann John Hughes Ralph Matthes Thomas Streicher Tarmo

  

Source: Abel, Andreas - Theoretische Informatik, Ludwig-Maximilians-Universität München

 

Collection: Computer Technologies and Information Sciences

 
45 Termination of Functions that Are Passed to Their Arguments
 

Summary:  Martin Hofmann John Hughes Ralph Matthes Thomas Streicher Tarmo Uustalu . Stipends GKLI Co

  

Source: Abel, Andreas - Theoretische Informatik, Ludwig-Maximilians-Universität München

 

Collection: Computer Technologies and Information Sciences

 
46 Generalized Iteration and Coiteration for HigherOrder Nested Datatypes
 

Summary:  ! Andreas Abel (joint work with Ralph Matthes and Tarmo Uustalu) FoSSaCS 2003 Warsaw, Poland April 8, 2003

  

Source: Abel, Andreas - Theoretische Informatik, Ludwig-Maximilians-Universität München

 

Collection: Computer Technologies and Information Sciences

 
47 Worlds Coalgebraically Olha Shkaravska 1,2
 

Summary:  satisfy 1 The author thanks John Power and Tarmo Uustalu for the discussions. 2 Email: shkarav

  

Source: Shkaravska, Olha - Institute for Computing and Information Sciences, Radboud Universiteit Nijmegen

 

Collection: Computer Technologies and Information Sciences

 
48 Generalized Iteration and Coiteration for Higher-Order Nested Datatypes
 

Summary:  ! Andreas Abel (joint work with Ralph Matthes and Tarmo Uustalu) FoSSaCS 2003 Warsaw, Poland April 8, 2003

  

Source: Abel, Andreas - Theoretische Informatik, Ludwig-Maximilians-Universität München

 

Collection: Computer Technologies and Information Sciences

 
49 Generalized Iteration and Coiteration for Higher-Order Nested Datatypes
 

Summary:  again! Andreas Abel (joint work with Ralph Matthes and Tarmo Uustalu) Workshop on Termination and Type

  

Source: Abel, Andreas - Theoretische Informatik, Ludwig-Maximilians-Universität München

 

Collection: Computer Technologies and Information Sciences

 
50 Termination of Functions that Are Passed to Their Arguments
 

Summary:  Martin Hofmann John Hughes Ralph Matthes Thomas Streicher Tarmo Uustalu · Stipends GKLI Co

  

Source: Abel, Andreas - Theoretische Informatik, Ludwig-Maximilians-Universität München

 

Collection: Computer Technologies and Information Sciences

 
51 An Introduction to Corecursive Algebras Venanzio Capretta
 

Summary:  An Introduction to Corecursive Algebras Venanzio Capretta in collaboration with Tarmo Uustalu

  

Source: Capretta, Venanzio - Institute for Computing and Information Sciences, Radboud Universiteit Nijmegen

 

Collection: Computer Technologies and Information Sciences

 
52 Learning the structure of an in vivo gene regulatory network using Gaussian processes
 

Summary:  Learning the structure of an in vivo gene regulatory network using Gaussian processes {tarmo

  

Source: Yli-Harja, Olli - Institute of Signal Processing, Tampere University of Technology

 

Collection: Computer Technologies and Information Sciences

 
53 ANRV329-GE41-08 ARI 21 June 2007 22:19 The Origin and
 

Summary:  -resistant and driven by a mosaic virus promoter that would be active in the nucleus) and aadA (controlled by a plastid... -resistant plants (i.e., that contain the nptII gene trans- ferred from the plastid) both the active nptII and aadA... genes were detected in the same genomic vicinity (ca. 1 Kb). Given that ARGs nptII and ...

  

Source: Bhattacharya, Debashish - Department of Ecology, Evolution, and Natural Resources, Rutgers University

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
54 Research in the spatial sciences: how are Canadian geographers contributing?
 

Summary:  Research in the spatial sciences: how are Canadian geographers contributing? TARMO K. REMMEL... ´eographe canadien 54, no 1 (2010) #12;6 Tarmo K. Remmel and Marie-Jos´ee Fortin Application areas include spatial... ) #12;8 Tarmo K. Remmel and Marie-Jos´ee Fortin international recognition for Canadian contri- butions

  

Source: Fortin, Marie Josee - Department of Ecology and Evolutionary Biology, University of Toronto

 

Collection: Environmental Sciences and Ecology

 
55 Cube and Conquer: Guiding CDCL SAT Solvers by Lookaheads
 

Summary:  called Tarmo. That work was focused on Bounded Model Checking (BMC) but it can be seen as a general... sitting idle waiting for a small number of nodes with hard jobs to finish. In Tarmo we experimented also... to beneficial for performance of the cube-and-conquer solving phase. Another feature of Tarmo is its ability

  

Source: Kullmann, Oliver - Department of Computer Science, University of Wales Swansea; Langendoen, Koen - Elektrotechniek, Wiskunde en Informatica, Technische Universiteit Delft

 

Collection: Computer Technologies and Information Sciences ; Engineering

 
56 TO: 2009-2010 Faculty Senate FROM: Rod Hill, Faculty Secretary
 

Summary:  /17/09 Appr. 4/13/09 FSH UP-09-022 AA&DA FC-09-022: FSH 3200 ­ Policy of Nondiscrimination 12/9/08 #14 appr... . GFM 4/21/09 Pres. Appr. 6/18/09 n/a FSH UP-09-023 AA&DA FC-09-023: FSH 3860 ­ Grievance for Classified... Staff 12/9/08 #14 appr. GFM 4/21/09 Pres. Appr. 6/18/09 n/a FSH UP-09-020 AA&DA FC-09-024: FSH 3215

  

Source: Idaho, University of - Department of Electrical and Computer Engineering, Center for Advanced Microeclectronics and Biomolecular Research

 

Collection: Engineering

 
57 A ticking clock: Performance analysis of a Circadian rhythm with stochastic process
 

Summary:  as we do in the stochastic -calculus model. DA def = (bindADA , A).ADA + (mkMA, A).DA ADA def = (unbind... = (decayMR , MR).M R + (mkR, R).MR A def = (mkA, ).A A def = (bindADA , A).ADA + (bindADR , R).ADR + (bind... dt [A] = A[MA] + A[ADA] + R[ADR] - A[DA][A] - R[DR][A] - C[A][R] - A[A] d dt [ADA ] = ...

  

Source: Imperial College, London - Department of Computing, Analysis, Engineering, Simulation & Optimization of Performance Group

 

Collection: Computer Technologies and Information Sciences

 
58 The Plant Cell, Vol. 12, 137149, January 2000, www.plantcell.org 2000 American Society of Plant Physiologists Evidence for a Role of ClpP in the Degradation of the
 

Summary:  ) by a silent TC change at the last position of the third codon. For selection of transformants, the aadA... the aadA cassette and the PvuI restriction site. In one of these strains, the PCR product amplified using... -acetate [TAP] and spectinomycin), the transformants became homoplasmic for the aadA cassette. However, the Pvu

  

Source: Wollman, Francis-André - nstitut de Biologie Physico-Chimique & Université Pierre-et-Marie-Curie, Paris 6

 

Collection: Biology and Medicine ; Renewable Energy

 
59 A note on strong dinaturality, initial algebras and uniform parameterized fixpoint operators
 

Summary:  A note on strong dinaturality, initial algebras and uniform parameterized fixpoint operators Tarmo... , Estonia tarmo@cs.ioc.ee Abstract I show a basic Yoneda-like lemma relating strongly dinatural

  

Source: Uustalu, Tarmo - Institute of Cybernetics, Tallinn Technical University

 

Collection: Computer Technologies and Information Sciences

 
60 1. Introduction The latest developments in the electronic industry, namely
 

Summary:  Graphs for Fast Architecture Exploration Peeter Ellervee, Tarmo Klaar* , Margus Kruus, Kalle Tammemäe... Link Computer Ltd., Estonia e-mail: lrv@cc.ttu.ee, tarmo@microlink.ee, {kruus nalle}@cc.ttu.ee Abstract

  

Source: Kruus, Margus - Faculty of Information Technology, Tallinn University of Technology

 

Collection: Computer Technologies and Information Sciences


Page:   1  2  3  4  5 
Page:   1  2  3  4  5 
 
61 Proceedings of the 16th Nordic Workshop on
 

Summary:  Owe Univ. of Oslo, Norway Kaisa Sere Abo Akademi University, Finland Tarmo Uustalu Inst... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5 Signals and Comonads Tarmo Uustalu and Varmo Vene . . . . . . . . . . . . . . . . . . . . . 9

  

Source: Olderog, Ernst-Rüdiger - Department für Informatik, Carl von Ossietzky Universität Oldenburg

 

Collection: Computer Technologies and Information Sciences

 
62 Message from the Department Head When you tell your friends and family that your degree is in
 

Summary:  and Technology 2011 14 DigestFood College of Agriculture and Life Sciences An Achievable Dream Academy (AADA... relationships with caring adults. Approximately 80 percent of AADA graduates go on to college and 20 percent... participated in a Living Career Fair at AADA. The purpose of the career fair was to inspire ...

  

Source: Virginia Tech, Virginia Bioinformatics Institute, Influenze Outbreak Project

 

Collection: Biology and Medicine ; Computer Technologies and Information Sciences

 
63 Functional Insensitivity of the Cytochrome b6 f Complex to Structure Changes in the Hinge Region of the
 

Summary:  . The aadA cassette (34), which encodes an aminoglycoside 3 -adenyltransferase and confers spectino- mycin... contains an aadA cassette located 500 bp upstream of petC1. A 3.8-kb fragment including the 5 -part of pet... C1 and the 5 -flanking sequence with the aadA cassette was excised from plasmid V by restriction

  

Source: Cramer, William A. - Department of Biological Sciences, Purdue University

 

Collection: Biology and Medicine

 
64 Generalized Iteration and Coiteration for Higher-Order Nested Datatypes
 

Summary:  again! Andreas Abel (joint work with Ralph Matthes and Tarmo Uustalu) Workshop on Termination and Type

  

Source: Abel, Andreas - Theoretische Informatik, Ludwig-Maximilians-Universität München

 

Collection: Computer Technologies and Information Sciences

 
65 Semi-continuous Sized Types and Termination Termination Checking via Type Systems
 

Summary:  Aehlig Thorsten Altenkirch Ikegami Daisuke Martin Hofmann John Hughes Ralph Matthes Tarmo Uustalu

  

Source: Abel, Andreas - Theoretische Informatik, Ludwig-Maximilians-Universität München

 

Collection: Computer Technologies and Information Sciences

 
66 Monads Need Not Be Endofunctors Thorsten Altenkirch, University of Nottingham
 

Summary:  , Institute of Cybernetics, Tallinn Tarmo Uustalu, Institute of Cybernetics, Tallinn ScotCats, Edinburgh, 21

  

Source: Ghani, Neil - Department of Computer and Information Sciences, University of Strathclyde

 

Collection: Computer Technologies and Information Sciences

 
67 Endurance in exercise is associated with courtship call rate in decorated crickets, Gryllodes sigillatus
 

Summary:  sigillatus Tarmo Ketola 1 , Raine Kortet 2 and Janne S. Kotiaho 1,3 1 Centre of Excellence in Evolutionary... of Jyväskylä, PO Box 35, 40014 Jyväskylä, Finland. e-mail: tarmo.t.ketola@jyu.fi Consult the copyright... , 11: 1131­1139 © 2009 Tarmo Ketola #12;sexual signals (Lawniczak et al., 2006). Theoretically

  

Source: Kotiaho, Janne S. - Department of Biological and Environmental Science, University of Jyväskylä

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
68 Proc. Estonian Acad. Sci. Phys. Math., 1998, 47, 3, 147--16 1 FUNCTIONAL PROGRAMMING WITH
 

Summary:  WITH APOMORPHISMS (CORECURSION) Varmo VENE and Tarmo UUSTALUb a Institute of Computer Science, University of Tartu... Institute of Technology, Electrum 204, SE-164 40 Kista, Sweden; e-mail: tarmo@it.kth.se Received 19 January... VENEja Tarmo UUSTALU On käsitletud kategooriate teoreetilist Iahenemist tuUpidega funktsionaal

  

Source: Uustalu, Tarmo - Institute of Cybernetics, Tallinn Technical University

 

Collection: Computer Technologies and Information Sciences

 
69 bio-math-vol1-inaba_final : 2009/11/26(21:58) , 1920 1930
 

Summary:  ) = Z 0 (a)(a)da (1.4) (1.4) , (a) := exp(- R a 0 µ(x)dx) , (a) = (0)e-a (a) , , Euler­Lotka Z 0 e... (A) D(A) = { X : A X, (0) = R 0 (a)(a)da} 1.3.1 A C0 T(t), t 0 , T(t)(X+) X+ p(t) = T(t)p0 , p0 D

  

Source: Inaba, Hisashi - Graduate School of Mathematical Sciences, University of Tokyo

 

Collection: Mathematics

 
70 Visualization of Pathogenicity Regions in Bacteria Carsten Friis, Lars Juhl Jensen and David W. Ussery
 

Summary:  ) aadA2 > CmlA > tetA > b-lac > sulI > < int < tetR < IntB D) C) B) A) int aadA 2 qacD E qacD E C m l

  

Source: Ussery, David W. - Center for Biological Sequence Analysis, Institute of Biotechnology, Danmarks Tekniske Universitet

 

Collection: Biotechnology

 
71 ON INTEGRAL REPRESENTATIONS OF THE DRAZIN INVERSE IN BANACH ALGEBRAS
 

Summary:  by ay = (a*a)Da* = a*(aa*)D. (3.2) Since the nonzero spectrum of a*a always

  

Source: Koliha, Jerry J. - Department of Mathematics and Statistics, University of Melbourne

 

Collection: Mathematics

 
72 Moufang Quasigroups Kenneth Kunen 1
 

Summary:  ), and the definition of d: (a(aa))d = (((aa) d) (aa)) d = (aa) (d ((aa) d)) = (aa)(da) = (aa)b (i) By (ffl) and (i), we

  

Source: Kunen, Ken - Department of Mathematics, University of Wisconsin at Madison

 

Collection: Mathematics

 
73 Homogeneous Epidemic Systems in the Stable Hisashi Inaba
 

Summary:  .3) 6 #12;where (a) := e-r0a f(a) (a), is the state space of w given by := L1 +(0, ) : 0 (a)(a)da... given by D(A0) = AC[0, ] : (0) = 0 (a)(a)da . and the nonlinear term G is given by G() := (r0 - h... of the perturbation is := L1 +(0, ) : 0 (a)(a)da = 0 . Then it is easy to see that is positively invariant

  

Source: Inaba, Hisashi - Graduate School of Mathematical Sciences, University of Tokyo

 

Collection: Mathematics

 
74 *Research Assistant, Member AIAA Professor, Fellow, AIAA
 

Summary:  for this study is based on the Ground Accuracy Designator B (GADB) and Airborne Accuracy Designator A (AADA... , integrity, continuity, and availability of the GADB/AADA model are likely to be slightly worse than... Airborne Model (m) (m) (deg) AADA (worst) 0.15 0.43 6.9 AADB (best) 0.11 0.13 4.0 n ( ) a0 a1e c/­ += mp

  

Source: Stanford University - Global Positioning System (GPS) Lab.

 

Collection: Engineering

 
75 Dartmouth College Computer Science Technical Report TR2008-624 Making RBAC Work in Dynamic, Fast-Changing
 

Summary:  for this study is based on the Ground Accuracy Designator B (GADB) and Airborne Accuracy Designator A (AADA... , integrity, continuity, and availability of the GADB/AADA model are likely to be slightly worse than... Airborne Model (m) (m) (deg) AADA (worst) 0.15 0.43 6.9 AADB (best) 0.11 0.13 4.0 n ( ) a0 a1e c/­ += mp

  

Source: Dartmouth College, Department of Computer Science

 

Collection: Computer Technologies and Information Sciences

 
76 ORIGINAL PAPER Effects of selective inactivation of individual genes
 

Summary:  chimeric aadA gene fused to the homologous psbA promoter (Koop et al. 1996) into internal restriction sites... L) and 5¢-GGGGTAAATGG- CCGATACTGCAGGAAGGATTCCTC-3¢ (psbJ). The aadA cassette with a heterologous... -less chimeric aadA cassette which confers spectinomycin resistance on chloroplasts was inserted in sense

  

Source: Pakrasi, Himadri - Department of Biology, Washington University in St. Louis

 

Collection: Biology and Medicine

 
77 Chloroplast Biogenesis of Photosystem II Cores Involves a Series of Assembly-Controlled Steps
 

Summary:  constructed a 59psbA-aadA cassette, in which the bac- terial aadA reporter gene was translated under... the 59psbA-driven aadA gene to the same level as the control that expresses D2. Since the 59psbA-aadA m... . The psbA 59UTR Confers a D2-Dependent Expression to the Reporter Gene aadA. (A) Schematic map of the pet

  

Source: Wollman, Francis-André - nstitut de Biologie Physico-Chimique & Université Pierre-et-Marie-Curie, Paris 6

 

Collection: Biology and Medicine ; Renewable Energy

 
78 Representing Cyclic Structures as Nested Datatypes Neil Ghani1, Makoto Hamana2, Tarmo Uustalu3, and Varmo Vene4
 

Summary:  Representing Cyclic Structures as Nested Datatypes Neil Ghani1, Makoto Hamana2, Tarmo Uustalu3... , Akadeemia tee 21, EE-12618 Tallinn, Estonia; tarmo@cs.ioc.ee 4 Dept. of Computer Science, Univ. of Tartu, J... Research No. 16700005. Tarmo Uustalu and Varmo Vene were partially supported by the Estonian Science

  

Source: Uustalu, Tarmo - Institute of Cybernetics, Tallinn Technical University

 

Collection: Computer Technologies and Information Sciences

 
79 INFORMATICA, 1999, Vol. 10, No. 1, 526 5 1999 Institute of Mathematics and Informatics, Vilnius
 

Summary:  Primitive (Co)Recursion and Course-of-Value (Co)Iteration, Categorically Tarmo UUSTALU Dept... . of Teleinformatics, Royal Inst. of Technology,Electrum 204, SE-164 40 Kista, Sweden e-mail: tarmo@it.kth.se Varmo... )iteracija kategoriju teorijos pozi¯uriu Tarmo UUSTALU, Varmo VENE Taikant kategoriju teorijos aparata tipizuotam

  

Source: Uustalu, Tarmo - Institute of Cybernetics, Tallinn Technical University

 

Collection: Computer Technologies and Information Sciences

 
80 Functional Programming with Apomorphisms / Corecursion
 

Summary:  , Estonia Tarmo Uustalu y Royal Institute of Technology, Stockholm, Sweden Abstract In the mainstream... ¨ogskolan, Electrum 204, SE­164 40 Kista, Sweden; tarmo@it.kth.se 1 #12; section 3, we introduce the scheme... ] Tarmo Uustalu and Varmo Vene. A cube of proof systems for the intuitionistic predi­ cate ¯,š­Logic. In M

  

Source: Uustalu, Tarmo - Institute of Cybernetics, Tallinn Technical University

 

Collection: Computer Technologies and Information Sciences


Page:   1  2  3  4  5 
Page:   1  2  3  4  5 
 
81 2005 12 14-18 Guillaume JacquesUniversit Paris V -Ren DescartesCRLAO
 

Summary:  sthuk uk t-pok *pk / *poq bug pa *b puk uk t-kh ta-k t-kt *k[h] *b xun un ? t-jmo ta-rmo t-lm *lma

  

Source: Ecole Polytechnique, Centre de mathématiques

 

Collection: Mathematics

 
82 Semi-conti==============================================================* *================================================================nuous Sized *
 

Summary:  sthuk uk t-pok *pk / *poq bug pa *b puk uk t-kh ta-k t-kt *k[h] *b xun un ? t-jmo ta-rmo t-lm *lma

  

Source: Abel, Andreas - Theoretische Informatik, Ludwig-Maximilians-Universität München

 

Collection: Computer Technologies and Information Sciences

 
83 Funktionale Programmierung Folds und Nested Datatypes
 

Summary:  Andreas Abel, Ralph Matthes, and Tarmo Uustalu. Iteration and coiteration schemes for higher

  

Source: Abel, Andreas - Theoretische Informatik, Ludwig-Maximilians-Universität München

 

Collection: Computer Technologies and Information Sciences

 
84 The Recursion Scheme from the Cofree Recursive Comonad
 

Summary:  MSFP 2008 The Recursion Scheme from the Cofree Recursive Comonad Tarmo Uustalu1 Institute... Mendler [19], this format is known as Mendler-style recursion, but has also been promoted under 1 tarmo... . The implementation is available at http://cs.ioc.ee/~tarmo/haskell/msfp08/. Some remarks are in order. First, we use

  

Source: Uustalu, Tarmo - Institute of Cybernetics, Tallinn Technical University

 

Collection: Computer Technologies and Information Sciences

 
85 TASE 2009 Advanced Program Day 1: 29 July 2009
 

Summary:  (University of Southampton), Ando Saabas (Tallinn University of Technology) and Tarmo Uustalu (Tallinn

  

Source: Qin, Shengchao - Department of Computer Science, University of Durham

 

Collection: Computer Technologies and Information Sciences

 
86 Normalization by Evaluation for System F Andreas Abel
 

Summary:  -Franz¨osisches Hochschulzentrum. Thanks to James and Tarmo for the invitation. Andreas Abel (LMU Munich) Normalization

  

Source: Abel, Andreas - Theoretische Informatik, Ludwig-Maximilians-Universität München

 

Collection: Computer Technologies and Information Sciences

 
87 Environ. Biosafety Res. 6 (2007) 7183 Available online at: c ISBR, EDP Sciences, 2007 www.ebr-journal.org
 

Summary:  Acinetobacter baylyi strain BD143 and transplastomic tobacco plants harboring the aadA gene (streptomycin... tobacco plants harboring the aadA gene (streptomycin and specti- nomycin resistance), our objective... , of the rbcL and accD genes flanking the transgene aadA (1.35 kb in size) and schematic representation

  

Source: Ecole Polytechnique, Centre de mathématiques

 

Collection: Mathematics

 
88 Chimeric Fusions of Subunit IV and PetL in the b6 f Complex of Chlamydomonas reinhardtii
 

Summary:  for biolistic transformation by plasmid pycf7::aadA (a kind gift of Y. Takahashi, Okayama University), which... carries an aadA cassette conferring resistance to spectinomycin inserted at the SnaBI site within the pet... , the chloroplast genomes of strains DLL and DLS were transformed with plasmid pycf7::aadA. This plasmid ...

  

Source: Institut de Biologie Physico-Chimique CNRS, Physico-Chimie Moléculaire des Membranes Biologiques

 

Collection: Chemistry ; Biology and Medicine

 
89 Subunit IV-PetL chimeras in cytochrome b6f complex Chimeric fusions of subunit IV and PetL in the b6 f complex of
 

Summary:  and DLS, were in turn used as recipient strains for biolistic transformation by plasmid pycf7::aadA (a... kind gift of Y. Takahashi, Okayama University), which carries an aadA cassette conferring resistance... DLL and DLS were transformed with plasmid pycf7::aadA. This plasmid carries a petL coding sequence dis

  

Source: Wollman, Francis-André - nstitut de Biologie Physico-Chimique & Université Pierre-et-Marie-Curie, Paris 6

 

Collection: Biology and Medicine ; Renewable Energy

 
90 Donna Esposito1,2,3 , Julien P.Fey1,4,5
 

Summary:  RNA. Transformants were selected by resistance to spectinomycin (conferred by the aadA marker; Goldschmidt... M-CAUUsspI or fM-CAUGsspI was inserted into the StuI site of the plasmid pQMAD, which contains the aadA gene... -particle bombardment (Kindle et al., 1991). Transformants expressing the aadA cassette were selected on TAP ...

  

Source: Wollman, Francis-André - nstitut de Biologie Physico-Chimique & Université Pierre-et-Marie-Curie, Paris 6

 

Collection: Biology and Medicine ; Renewable Energy

 
91 INTEGRAL REPRESENTATIONS OF THE g-DRAZIN INVERSE IN C* -ALGEBRAS
 

Summary:  of a is then expressed by ay = (a*a)Da* = a*(aa*)D . (1

  

Source: Koliha, Jerry J. - Department of Mathematics and Statistics, University of Melbourne

 

Collection: Mathematics

 
92 1970 (Andrei Rogers) (Herve Le Bras) (multistate demographic models)
 

Summary:  0 |p0(a)|da vT 0 ^G(0) vT 0 1u0 (2.10) 1 = 0 a(a)da v0 K K Keyfitz 2.2 (birth state) K = ^(0

  

Source: Inaba, Hisashi - Graduate School of Mathematical Sciences, University of Tokyo

 

Collection: Mathematics

 
93 Abstract to be submitted to the 23nd IWWWFB, Jeju, Korea, 13 April 16 April 2007. Generalized Wagner model for 2D symmetric and elastic bodies.
 

Summary:  the differential time marching (a=a+da) computation of a new history of the wetting correction history

  

Source: Ecole Polytechnique, Centre de mathématiques

 

Collection: Mathematics

 
94 MATHEMATIQUES Une introduction aux mod`eles
 

Summary:  A avec D A = W 1,1 (0, +) : (0) = + 0 (a)(a)da , SMF ­ Gazette ­ 125, juillet 2010 #12;BIFURCATION ET... (a)(a)da) + 0 (a)(a)da - + 0 (a)(a)da . La premi`ere composante de l'application F est `a rapprocher

  

Source: Ruan, Shigui - Department of Mathematics, University of Miami

 

Collection: Mathematics

 
95 JOURNAL DE PHYSIQUE Colloque C6, suppliment au no 11-12, Tome 33, Novembre-Ddcembre 1972,page 231 SCANNING OPTICAL PATTERNS WITH ACOUSTIC SURFACE WAVES (*)
 

Summary:  , photoconductive (pc) and surface state discharge (ss) we see that where W is the depletion region width. Now, a aa/da

  

Source: Ecole Polytechnique, Centre de mathématiques

 

Collection: Mathematics

 
96 Long-wavelength tilting of the Australian continent since the Late Cretaceous Lydia DiCaprio a,b,
 

Summary:  , the Australian Antarctic Depth Anomaly (AADA), may be caused by a mantle source (Gurnis et al., 1998). Sandiford... away from a dynamic topography low associated with the AADA. It should be noted that following... AADA correlates well with the reconstructed position of the proposed shorter wavelength anomalous

  

Source: Gurnis, Michael - Division of Geological and Planetary Sciences, California Institute of Technology; Müller, Dietmar - School of Geosciences, University of Sydney

 

Collection: Geosciences

 
97 PUBLICATION Journal paper
 

Summary:  : Probing the Complex Fluctuations by #12;Hilbert-Huang Transform", Advances in Adaptive Data Analysis (AADA

  

Source: Huang, Norden E.- Research Center for Adaptive Data Analysis, National Central University

 

Collection: Engineering ; Materials Science

 
98 Multistep Processing of an Insertion Sequence in an Essential Subunit of the Chloroplast ClpP Complex*S
 

Summary:  pair aadA cassette conferring resistance to specti- nomycin and streptomycin (17) was inserted... in the unique EcoRV site so that aadA and clpP1 read in the same direction. Site-directed mutagenesis... 387A muta- tion into the clpP1 gene, linked to the aadA cassette conferring antibiotic resistance

  

Source: Wollman, Francis-André - nstitut de Biologie Physico-Chimique & Université Pierre-et-Marie-Curie, Paris 6

 

Collection: Biology and Medicine ; Renewable Energy

 
99 Serine Hydrolase KIAA1363: Toxicological and Structural Features with Emphasis on Organophosphate Interactions
 

Summary:  Abbreviations: AADA, arylacetamide deacetylase; AChE, acetylcho- linesterase; AFEST, Archaeoglobus fulgidus... of KIAA1363 and Homologous Serine Hydrolases with AChE KIAA1363 and homologuesa property KIAA1363 AADA... from the following references: KIAA1363, 13; AADA, 39; AFEST, 5; and AChE, 40. b Homology relative

  

Source: Cravatt, Benjamin - Department of Cell Biology, Scripps Research Institute

 

Collection: Biology and Medicine

 
100 Categorical Views on Computations on Trees (Extended Abstract)
 

Summary:  , and Tarmo Uustalu2 1 Institute of Computing and Information Sciences, Radboud University Nijmegen, Postbus... of Cybernetics at Tallinn University of Technology, Akadeemia tee 21, EE-12618 Tallinn, Estonia http://www.cs.ioc.ee/~tarmo

  

Source: Uustalu, Tarmo - Institute of Cybernetics, Tallinn Technical University

 

Collection: Computer Technologies and Information Sciences


Page:   1  2  3  4  5