Home

About

Advanced Search

Browse by Discipline

Scientific Societies

E-print Alerts

Add E-prints

E-print Network
FAQHELPSITE MAPCONTACT US


  Topic List  Advanced Search  
Sample search results for: a-amino acid derivatives

Page:   2  3  4  5 
 
1 Amino Acids DOI: 10.1002/anie.200602801
 

Summary:  : A Remarkably Enantioselective Route to a-Amino Acid Derivatives from o-Benzoquinone Imides** Jamison Wolfer... enantiomeri- cally enriched a-amino acids and related derivatives.[4] Herein, we present the first catalytic... ,4-benzoxazines and a- ...

  

Source: Lectka, Thomas - Department of Chemistry, Johns Hopkins University

 

Collection: Chemistry

 
2 8488 J. Am. Chem. SOC.1995,117, 8488-8489 A Practical Method for the Synthesis of D-or
 

Summary:  of pseudoephedrine amide enolates: (R,R)-(-)- 1produces L-a-amino acid derivatives,and (S,S)-(+)-lproduces D-a-amino... 8488 J. Am. Chem. SOC.1995,117, 8488-8489 A Practical Method for the Synthesis of D- or L-a-AminoAcids... of Technology, Pasadena, California 91125 Received May 9, I995 ...

  

Source: Myers, Andrew G.- Department of Chemistry and Chemical Biology, Harvard University

 

Collection: Chemistry

 
3 LETTER 2591 Synthesis of New 2,2,5,5-Tetramethyl-2,5-dihydro-1H-pyrrol-1-yloxyl
 

Summary:  -Substituted-2,5,5-trimethylpyrrolidin-1-yloxyl Radicals Based a-Amino Acids SynthesisofNew2,2,5,5-Tetramethyl... Stuttgart · New York Abstract: Unnatural paramagnetic a-amino acids with 2,2,5,5-tet- ramethyl-2,5-dihydro-1... of paramagnetic a-amino acids,3­5,8 ...

  

Source: Steinhoff, Heinz-Jürgen - Fachbereich Physik, Universität Osnabrück

 

Collection: Biology and Medicine ; Physics

 
4 GTQ, Chemistry 212, Dr. Glaser, FS96 --1 --GTQ on Amino Acids. (40 points, nomenclature, acid/base properties, synthesis)
 

Summary:  of aminoacids. (a) Amino acids contain both a proton donor, the carboxylic acid, and a proton acceptor... GTQ, Chemistry 212, Dr. Glaser, FS96 -- 1 -- GTQ on Amino Acids. (40 points, nomenclature, acid... /base properties, synthesis) To be precise, amino ...

  

Source: Glaser, Rainer - Department of Chemistry, University of Missouri-Columbia

 

Collection: Chemistry

 
5 GTQ, Chemistry 212, Dr. Glaser, FS96 --1 --GTQ on Amino Acids. (40 points, nomenclature, acid/base properties, synthesis)
 

Summary:  of aminoacids. (a) Amino acids contain both a proton donor, the carboxylic acid, and a proton acceptor... GTQ, Chemistry 212, Dr. Glaser, FS96 -- 1 -- GTQ on Amino Acids. (40 points, nomenclature, acid... /base properties, synthesis) To be precise, amino ...

  

Source: Glaser, Rainer - Department of Chemistry, University of Missouri-Columbia

 

Collection: Chemistry

 
6 Database guided conformation selection in crystal structure prediction of Timothy G. Cooper,a
 

Summary:  structure prediction calculations have been performed for the a-amino acid alanine with the intention... packing of the more flexible amino acids. For the a-amino acids, the density functional theory geometry... acids. The a-amino ...

  

Source: de Gispert, Adrià - Machine Intelligence Laboratory, Department of Engineering, University of Cambridge

 

Collection: Computer Technologies and Information Sciences

 
7 IN THIS ISSUE 1060 Crystal structure of the Leishmania major MIX protein: A scaffold
 

Summary:  alternating a- and b-amino acid residues were examined for this pyramidalization. The a-amino acid residues... . We found that the a-amino acid residues, which adopt the main chain dihedral angles of an a... Crystallographic Data Centre (CCDC). In these structures, the ...

  

Source: Raines, Ronald T. - Departments of Biochemistry & Chemistry, University of Wisconsin at Madison

 

Collection: Chemistry ; Biology and Medicine

 
8 Monatshefte fur Chemie 131, 667672 (2000) Beauveria bassiana ATCC 7159 Contains
 

Summary:  Monatshefte fuÈr Chemie 131, 667±672 (2000) Beauveria bassiana ATCC 7159 Contains an L-Speci®c a-Amino... of carboxylic acid ester [2] or amino amide [3] derivatives; either D- or L-speci®c hydrolysis can occur... derivatives of -amino acids by aminoacylase enzymes include inter alia ...

  

Source: Andreana, Peter R. - Department of Chemistry, Wayne State University

 

Collection: Chemistry

 
9 Highly efficient synthesis of a-amino amidines from ynamides by the Cu-catalyzed three-component coupling reactions
 

Summary:  and 12, respectively). The produced a-amino amidine compounds can be regarded as a-amino acid isosteres... Table 3 a-Methylation of chiral a-amino amidine derivatives N O O R N N(i Pr)2 Ts ii) MeI (8 equiv), 12... Highly efficient synthesis of a-amino amidines from ...

  

Source: Chang, Sukbok - Department of Chemistry, Korea Advanced Institute of Science and Technology

 

Collection: Chemistry

 
10 Icarus 145, 272281 (2000) doi:10.1006/icar.1999.6328, available online at http://www.idealibrary.com on
 

Summary:  as a function of pH. J. Am. Chem. Soc. 94, 1371­1373. Bada, J. L. 1985a. Amino acid racemization dating... OF METEORITIC AMINO ACIDS 275 TABLE II Amino Acid Racemization Rate Constants Derived from Fig. 2 Amino acid... . The racemization rates ...

  

Source: Cohen, Barbara Anne - Institute of Meteoritics & Department of Earth and Planetary Sciences, University of New Mexico

 

Collection: Geosciences

 
11 Proc. Nati. Acad. Sci. USA Vol. 82, pp. 5732-5736, September 1985
 

Summary:  at 275 nm and its amino acid composition (Table 1). Acid treatment ofT1C2 deblocked the a-amino group... . Deacylation by acid treatment of T1C2, probably causing a N -O 0 shift of the blocking group from the a-amino... . It is assumed that the reaction proceeds through the N -3 0 ...

  

Source: Scott, John D. - Department of Pharmacology, University of Washington at Seattle

 

Collection: Biology and Medicine

 
12 short communications 414 nature structural biology volume 6 number 5 may 1999
 

Summary:  a nucleophile with a free a- amino group. Since PVA is an Ntn hydro- lase, we can deduce that the N... pair of the unprotonated N-terminal a-amino group. In spite of these common features, the pH profiles... indicates that their mechanisms may be subtly different. It is notable that in PGA the a-amino ...

  

Source: Wlodawer, Alexander - Macromolecular Crystallography Laboratory, National Cancer Institute

 

Collection: Chemistry ; Biology and Medicine

 
13 ASTROCHEMISTRY Radiolysis and radioracemization of 20 amino acids
 

Summary:  to the fact that not only common a-amino acids used in the bio- chemistry of living organisms have been found... (Draganic et al. 1993). It should be considered that the a-amino acid racemisation is negligible in a dry... of the radiation dose administered. For the purpose of the present work, we have ...

  

Source: Canarias, Instituto de Astrofisica de (IAC)

 

Collection: Physics

 
14 Meteoritics & Planetary Science 39, Nr 11, 18491858 (2004) Abstract available online at http://meteoritics.org
 

Summary:  Research 3:5­18. Cronin J., Pizzarello S., and Gandy W. 1979a. Amino acid analysis with o... that the protein amino acids detected in our samples (A, B, C, R1, and R2) derived not from our extraction... ://meteoritics.org 1849 © Meteoritical Society, 2004. Printed in USA. Concentration ...

  

Source: Matrajt, Graciela - Department of Astronomy, University of Washington at Seattle

 

Collection: Physics

 
15 An empirical model of amino acid transformations in an alpine soil D.A. Lipson*, T.K. Raab, S.K. Schmidt, R.K. Monson
 

Summary:  acids under natural conditions (Lipson and Monson, 1998; Lipson et al., 1999a). Amino acid-N (but very... three data sets simultaneously is derived to produce a well- constrained estimate of seasonal amino acid... An empirical model of amino acid ...

  

Source: Colorado at Boulder, University of - Alpine Microbial Observatory

 

Collection: Environmental Sciences and Ecology

 
16 Re-examination of amino acids in Antarctic micrometeorites D.P. Glavin a,*, G. Matrajt b,c
 

Summary:  processes for standard a-amino acids and some of their dipeptides in the solid state. Thermochim. Acta 200... Re-examination of amino acids in Antarctic micrometeorites D.P. Glavin a,*, G. Matrajt b,c , J... February 2003 Abstract The delivery of amino acids by micrometeorites to the early Earth during the ...

  

Source: Matrajt, Graciela - Department of Astronomy, University of Washington at Seattle

 

Collection: Physics

 
17 The Astrophysical Journal, 550:L95L99, 2001 March 20 2001. The American Astronomical Society. All rights reserved. Printed in U.S.A.
 

Summary:  94043. alanine (NH2CH2CH2COOH) are extremely rare on Earth. In a-amino acids, the amino group (iNH2... . All rights reserved. Printed in U.S.A. THE PHOTOSTABILITY OF AMINO ACIDS IN SPACE P. Ehrenfreund,1 M... led to life's origin. Among these compounds, amino acids may have played a crucial role since

  

Source: NASA Ames Research Center, Astrochemistry Laboratory

 

Collection: Physics

 
18 BioMed Central Page 1 of 11
 

Summary:  ): a) Amino acids whose relative abundance is characteristic of each one of the three groups (with... 1A). Amino acids (one letter) are in green. The three pools for polar (POL), charged (CHAR... analysis, we derive the dis- tribution of species ...

  

Source: Ecole Polytechnique, Centre de mathématiques

 

Collection: Mathematics

 
19 J. Am. Chem. SOC.1986, 108,4879-4881 4879 On the Deprotonation of Trialkylamine Cation Radicals by
 

Summary:  be extremely acidic? Maybe not, because deprotonation leads to an a-amino radical. a-Amino radicals do have... impossible to devise conditions under which R3N'+ and the a-amino radical derived from it by deprotonation... -azabicyclo[3.3.1]nonane(7) and the related ...

  

Source: 

 

Collection: Chemistry

 
20 Conformational properties of hybrid peptides containing
 

Summary:  Munksgaard, 2004 The conformational properties of peptides derived from a-amino acid residues are well... in a- amino acids restricts the range of sterically allowed con- formations about the torsional angles... containing the higher homologs of ...

  

Source: Balaram , P. - Molecular Biophysics Unit, Indian Institute of Science, Bangalore

 

Collection: Biology and Medicine


Page:   2  3  4  5 
Page:   1  2  3  4  5 
 
21 TETRAHEDRON Tetrahedron Letters 44 (2003) 92139217Pergamon
 

Summary:  based cyclic tetrasubstituted a-amino acid and paramagnetic homoproline and their derivatives... conformationally rigid paramagnetic a-amino acids Ma´ria Balog,a Tama´s Ka´lai,a Jo´zsef Jeko3 ,b Zolta´n Berente... in unnatural amino acids.5 For ESR studies of ...

  

Source: Steinhoff, Heinz-Jürgen - Fachbereich Physik, Universität Osnabrück

 

Collection: Biology and Medicine ; Physics

 
22 Fat and Protein Metabolism Break down of large
 

Summary:  .e., lots of fat is broken down very quick) - blood conc. of fatty acids increases - acetyl CoA derived from... Fats and Proteins as Energy Sources Fats can be hydrolyzed to glycerol and fatty acids These can... be modified to run through Kreb's! Proteins can be broken down to amino acids Which can be ...

  

Source: Morrell, Thomas E. - Department of Biology, Ball State University

 

Collection: Environmental Sciences and Ecology

 
23 Expanding the polypeptide backbone: hydrogen-bonded conformations in hybrid
 

Summary:  containing the higher homologues of a-amino acids Sunanda Chatterjee, Rituparna Sinha Roy and P. Balaram... of a-amino acid residues. More recently, the discovery of well-folded structures in oligopeptides... of peptides constructed from higher homologues (u) of a-amino ...

  

Source: Balaram , P. - Molecular Biophysics Unit, Indian Institute of Science, Bangalore

 

Collection: Biology and Medicine

 
24 722 The American Journal of Clinical Nutrition 39: MAY 1984, pp 722-729. Printed in USA 1984 American Society for Clinical Nutrition
 

Summary:  -positive compounds Plasma concentrations of citrulline and a- amino butyric acid in the fasted state were lowest... . However, the rela- a-Amino butyrate 0 11.4 7.0 tionship between the glutamate concentra- ±4.6 ±1.7 75 3 1... and 2. Wurtman RJ, Rose CM, Chou C, Lam FF. Daily a-amino ...

  

Source: Wurtman, Richard - Department of Brain and Cognitive Science, Massachusetts Institute of Technology (MIT)

 

Collection: Biology and Medicine

 
25 Rapid Cycling of Organic Nitrogen in Taiga Forest Ecosystems
 

Summary:  Farland J, Olson K. 2006a. Amino acid uptake in deciduous and coniferous taiga ecosystems. Plant Soil 288... successional soil as the product of the soil amino acid concentration and the individual rate constants derived... of 13 C-enriched CO2 efflux from soils amended in the field with ...

  

Source: Wagner, Diane - Institute of Arctic Biology, Department of Biology and Wildlife, University of Alaska Fairbanks

 

Collection: Environmental Sciences and Ecology

 
26 Functional significance of Glu-77 and Tyr-137 within the active site of isoaspartyl dipeptidase
 

Summary:  the proton from the bridging hydroxide to the a-amino group of the departing amino acid during cleavage... by the deprotonation of the a-amino group of the aspartate moiety of the substrate [4]. Amino acid sequence alignments... -chain carboxylate of Glu-77 is consistent with the formation of an ion pair ...

  

Source: Holden, Hazel - Department of Biochemistry, University of Wisconsin at Madison

 

Collection: Biology and Medicine

 
27 The synthesis of peptides and proteins containing non-natural amino acids
 

Summary:  nucleophilic attack by the a-amino group of the amino acid bound to the T domain of the next module... can be employed in order to form hydrazone and oxime derivatives in the case of the keto amino acid10... or triazole derivatives in the case of the azido functionalised amino ...

  

Source: Dholakia, Kishan - School of Physics and Astronomy, University of St Andrews

 

Collection: Physics

 
28 Cloning and characterization of an aromatic amino acid and leucine permease of Penicillium chrysogenum
 

Summary:  average values and standard deviations are shown (Fig. 1A). Amino acid transport assays in S. cerevisiae... moiety is replaced by a phenylacetic acid group involving a CoA derivative of this aromatic acid... 43 Chapter 2 Cloning and characterization of an aromatic ...

  

Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution,

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
29 International Journal of Biological Macromolecules 24 (1999) 109118
 

Summary:  the central metabolic path- ways. The starting metabolites of amino acids are derived from the central... . Amino Acid Metabolism. New York: Wiley, 1985. . #12;... that are highly expressed and composed of amino acids that are costly to synthesize are likely to place a greater

  

Source: Pierce, Naomi E. - Museum of Comparative Zoology & Department of Organismic and Evolutionary Biology, Harvard University

 

Collection: Environmental Sciences and Ecology

 
30 Detecting Remote Homologues Using Scoring Matrices Calculated from the Estimation of Amino Acid Substitution Rates of Beta-Barrel
 

Summary:  . III. RESULTS A. Amino acid substitution rates in bbTM, PHAT and SLIM matrices We calculated amino acid... derived residue similarity scoring matrices from the estimated amino acid substitution rates in each... Detecting Remote Homologues Using Scoring Matrices ...

  

Source: Liang, Jie - Department of Bioengineering, University of Illinois at Chicago

 

Collection: Engineering ; Biotechnology

 
31 The Discovery of Anthranilic Acid-Based MMP Inhibitors. Part 1: SAR of the 3-Position
 

Summary:  of these compounds have been derived from a-amino acids, with a single carbon linking the sulfona- mide nitrogen... , the anthranilic acid derivative 1 had IC50s below 1 mM versus MMP-1, MMP-9, and MMP-13 (Table 1). In contrast... , the 3- and 4-aminobenzoic acid ...

  

Source: Powers, Robert - Department of Chemistry, University of Nebraska-Lincoln

 

Collection: Chemistry

 
32 Uptake of the -lactam precursor -aminoadipic acid in Penicillium chrysogenum is mediated by the acidic and the general amino acid
 

Summary:  average values and standard deviations are shown (Fig. 1A). Amino acid transport assays in S. cerevisiae... moiety is replaced by a phenylacetic acid group involving a CoA derivative of this aromatic acid... 57 Chapter 3 Uptake of the -lactam precursor -aminoadipic ...

  

Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution,

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
33 Standard Operating Procedures Standard Operating Procedures
 

Summary:  concentrations of aqueous acid solutions. A mineral acid is defined as a water-soluble acid derived from... and inorganic acids working with organic and inorganic acids Dr. Ragauskas Group Fall 2009 #12;Process... and Hazardous Chemicals Proper handling (carrying, ...

  

Source: 

 

Collection: Chemistry

 
34 MECHANISMS OF AMINO ACID FORMATION IN INTERSTELLAR ICE ANALOGS Jamie E. Elsila,1,2
 

Summary:  resistance to ultraviolet (UV) photolysis (Ehrenfreund et al. 2001a); amino acid precursors such as nitriles... of OPA/NAC deriv- atized acid-hydrolyzed extracts of (a) residue from an ice with composition H2O : CH3OH... atoms from CH3OH and one or two C atoms from HCN. The ...

  

Source: NASA Ames Research Center, Astrochemistry Laboratory

 

Collection: Physics

 
35 STANDARD OPERATING PROCEDURE: MINERAL ACIDS PI: _______________________________ Room & Building: ___________________________
 

Summary:  -soluble acid derived from inorganic minerals by chemical reaction as opposed to organic acids (e.g. acetic acid... STANDARD OPERATING PROCEDURE: MINERAL ACIDS PI: _______________________________ Room & Building... : _____________________________ Pertains to Lab Protocol: ...

  

Source: Prentiss, Mara - Department of Physics, Harvard University

 

Collection: Physics

 
36 Helix Packing Moments Reveal Diversity and Conservation in Membrane Protein Structure
 

Summary:  (Figure 2B). As in glycophorin A, amino acids with small side- chains and separated by one helical turn... as in rhodopsin (Figure 4A). Amino acids with sequence identities greater than ,75% across the GPCR family... those found in helical soluble proteins. Based on ...

  

Source: Smith, Steven O.- Department of Biochemistry and Cell Biology, SUNY at Stony Brook

 

Collection: Biology and Medicine

 
37 Molecular Cell Nascent Peptide in the Ribosome Exit Tunnel
 

Summary:  the reaction substrates for an efficient nucleophilic attack of the a-amino group of the aminoacyl residue onto... to be a fairly inefficient nascent peptide acceptor because of its constrained structure and alkylation of the a-amino... amino acids in the A-site. Only binding of Phe-tRNA or puromycin ...

  

Source: Bedwell, David M. - Department of Microbiology, University of Alabama at Birmingham

 

Collection: Biology and Medicine

 
38 Exam 2, Chemistry 212, Dr. Glaser, FS96 --1 --C h e m i s t r y 2 1 2 --F a l l S e m e s t e r 1 9 9 6C h e m i s t r y 2 1 2 --F a l l S e m e s t e r 1 9 9 6
 

Summary:  :30 featuring Carboxylic Acids and Carboxylic Acid Derivatives. Preparations, Properties & Reactions. Your Name... with another alcohol. The ester formed with the phosphatidic acid are the phosphatidyl derivatives. We learned... derived from the fatty ...

  

Source: Glaser, Rainer - Department of Chemistry, University of Missouri-Columbia

 

Collection: Chemistry

 
39 Unnatural amino acid mutagenesis in mapping ion channel function
 

Summary:  ­18]. A well studied and useful back- bone mutation arises from the replacement of an a-amino acid with an a... Unnatural amino acid mutagenesis in mapping ion channel function Darren L Beeneà , Dennis... A Doughertyà and Henry A Lestery Unnatural amino acid mutagenesis makes possible the site

  

Source: Lester, Henry - Division of Biology, California Institute of Technology

 

Collection: Biology and Medicine

 
40 Reprinted from the Journal of the American Chemical Society, 1989, /ll-, 635'1. Copyright @ 198^9by the American Chemical Society and reprinted by permission of the copyright owner.
 

Summary:  describethe useof theseenzymesas catalystsfor the kinetic resolutionof a-amino acids. We report the rangeof... , underambientatmosphere(O) and undernitrogen(O). Chart III. Analoguesof a-Amino Acids Testedfor Substrate Activin r... Chart IV. Glycine Enolate Equivalents N , C O O E T 54 N _ COOET 55 HNAc I ...

  

Source: Prentiss, Mara - Department of Physics, Harvard University

 

Collection: Physics


Page:   1  2  3  4  5 
Page:   1  2  3  4  5 
 
41 Models of Natural Mutations Including Site Heterogeneity
 

Summary:  , M.O., Delacroix, H., Henaut, A. Amino acid substitutions in structurally related proteins. J. Mol... . ACKNOWLEDGMENTS We would like to thank Darin Taverna for his work in deriving the models of amino acid... physical-chemical properties of the amino acids. This ...

  

Source: Goldstein, Richard - Department of Chemistry, University of Michigan

 

Collection: Chemistry ; Biotechnology

 
42 Conformations of b-Amino Acid Residues in Peptides: X-Ray Diffraction Studies of Peptides Containing the Achiral Residue
 

Summary:  peptides and also in hybrid sequences containing a-amino acid and their backbone homologated counterparts.5... - ties of a-amino acids containing sequences has become possi- ble only as a result of the enormous body... be noted that the free a- amino ...

  

Source: Balaram , P. - Molecular Biophysics Unit, Indian Institute of Science, Bangalore

 

Collection: Biology and Medicine

 
43 THE JOURNAL OF B!OLOGICAL CHEMISTRY Vol. 265, No. 26, Issue of Se&?mber 15, PP. 15667-15873,199O Printed in U.S.A.
 

Summary:  Printed in U.S.A. Amino Acid and cDNA Sequence of Bovine Phosducin, a Soluble Phosphoprotein from... - ulate the phosphorylation of phosducin by protein ki- nase A. The complete amino acid sequence... , phosducin contains 245 amino acids with a calculated molecular weight of 28,186 and ...

  

Source: Southern California, University of - Mary D. Allen Laboratories for Vision Research

 

Collection: Biology and Medicine

 
44 An Expanded Set of Amino Acid Analogs for the Ribosomal Translation of Unnatural Peptides
 

Summary:  ] or by chemical tRNA acylation [15,37,57]. Since the a-hydroxy acids lack an a-amino group, their potential... , a few a,a disubstituted, N-methyl and a-hydroxy derivatives, but no b-amino acids. We show that over 50... An Expanded Set of Amino Acid Analogs for the Ribosomal Translation of ...

  

Source: Szostak, Jack W. - Department of Genetics, Harvard University

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
45 Cyanation Reaction Recent Developments in the Catalytic Asymmetric
 

Summary:  have recently culminated in efficient catalysts for the cyanation of aldimines affording a-amino acids... . Williams in Synthesis of Optically Active a-Amino Acids, (Eds.: J. E. Bald- win, P. D. Magnus), Pergamon... . They rea- soned that a bulkier group on the left- hand side (the fragment ...

  

Source: Spino, Claude - Département de chimie, Université de Sherbrooke

 

Collection: Chemistry

 
46 Folding Protein-Like Structures with Open Gemma B. Danks, Susan Stepney, and Leo S. D. Caves
 

Summary:  -system to create an -helix from 10 alanine (A) amino acids with initial torsion angles (, ) = (-57 , -47 ) defined... the initial torsion angles in each amino acid repeatedly over a number of derivation steps. Altering... , Ramachandran plots show the , angles for each amino ...

  

Source: Stepney, Susan - Department of Computer Science, University of York (UK)

 

Collection: Computer Technologies and Information Sciences

 
47 MALDI-TOF mass spectrometry methods for evaluation of in vitro aminoacyl tRNA production
 

Summary:  a-amino-protected dCA amino acids to 74mer tRNA. Previously, there has been no facile method... of chemical and biological steps+ The amino acid to be delivered is made as an a-amino-protected cyanom- ethyl... of Biology, California Institute of Technology, Pasadena, California 91125, USA ABSTRACT Unnatural ...

  

Source: Lester, Henry - Division of Biology, California Institute of Technology

 

Collection: Biology and Medicine

 
48 1056 Anal. Chem. 1987, 59. 1056-1059 be done selectively, and any ions that are not completely
 

Summary:  -, (3) iso- propyl-, and (5) n-hexylphosphonic acid derivatives using a linear gradient of 60 to 100... -L-methionine (Met),dansyl-L-isoleucine(Ile), and dan- syl-L-a-amino-n-butyricacid (Abu) as the cyclohexylaminesalt... November 7, 1986. Fluorescence Detection of Alkylphosphonic Acids Using p ...

  

Source: Zare, Richard N. - Department of Chemistry, Stanford University

 

Collection: Chemistry

 
49 Carboxylic Acid Unknowns and Titration 45 CARBOXYLIC ACID UNKNOWN
 

Summary:  · Molecular weight of acid = ! 0.2015g 0.001457mol =138.3 g/mol D. Anilide Derivative R Cl H2N + -HCl N H R... Carboxylic Acid Candidates bp of mw of mp of Anilide Liquid Acid Unknowns Acid Acid (g/mol) Derivative... Acid ...

  

Source: Jasperse, Craig P. - Department of Chemistry, Minnesota State University Moorhead

 

Collection: Chemistry

 
50 Communication www.rsc.org/chemcomm
 

Summary:  acids phenylalanine 1a, aspartic acid 2a and glutamic acid 3a. Amino acid derivatives (Scheme 1) were... conjugates that modulate fibroblast and melanoma growth,10 are themselves a-amino esters of carbohydrates... ­amino ...

  

Source: Davis, Ben G. - Department of Chemistry, University of Oxford

 

Collection: Chemistry

 
51 AcceleratedArticles Anal. Chem. 1995, 67, 3093-3100
 

Summary:  +), and one derivative that was acetylated at both a-amino groups (oo+). A co-injection experi- ment verified... has only three primary amino groups (Figure 1):an a-amino groupfrom the N-terminalglycine residue... ). Reactivity of Amino Groups. The a-amino groups of a protein are less basic than the E-amino ...

  

Source: Mrksich, Milan - Department of Chemistry, University of Chicago; Prentiss, Mara - Department of Physics, Harvard University

 

Collection: Chemistry ; Physics

 
52 In: D-Amino Acids: ISBN 1-60021-075-9 A New Frontier in Amino Acid and Protein Research 2006 Nova Science Publishers, Inc.
 

Summary:  containing D-amino acids incorporated in the right handed helical scaffold. (A) -amino acid in the right... In: D-Amino Acids: ISBN 1-60021-075-9 A New Frontier in Amino Acid and Protein Research © 2006 Nova... Science Publishers, Inc. Chapter 5.9 THE USE OF D-AMINO ...

  

Source: Balaram , P. - Molecular Biophysics Unit, Indian Institute of Science, Bangalore

 

Collection: Biology and Medicine

 
53 Top Curr Chem (2011) DOI: 10.1007/128_2011_173
 

Summary:  of Polypeptides by Ring-Opening Polymerization of a-Amino Acid N-Carboxyanhydrides Jianjun Cheng and Timothy J... -opening polymerization. Traditional and recently improved methods used to polymerize a-amino acid N... Mass spectroscopy NACE Non-aqueous capillary electrophoresis NCA ...

  

Source: Cheng, Jianjun - Department of Materials Science and Engineering, University of Illinois at Urbana-Champaign

 

Collection: Materials Science

 
54 Brain Research, 599 (1992) 57-63 57 ~'~ 1992 Elsevier Science Publishers B.V. All rights reserved 0006-8993/92/$05.00
 

Summary:  ; Cholinergic; Neurotoxicity; Nucleus basalis Picolinic acid, a pyridine monocarboxylic acid derived from... acid and kynurenic acid are derived from the tryptophan metabolic pathway that yields QUIN... 0006-8993/92/$05.00 BRES 18363 Action of picolinic ...

  

Source: Beninger, Richard J. - Department of Psychology, Queen's University (Kingston)

 

Collection: Biology and Medicine

 
55 0026-895X/951030582.06$3.00/0 Copyright t by The American Society for Pharmacology and Experimental Therapeutics
 

Summary:  . Differential Antagonism of a-Amino-3-hydroxy-5-methyl-4- isoxazolepropionic Acid-Preferring and Kainate... differentially modulates desensitization of a-amino-3-hydroxy-5-methyl-4-isoxazolepro- pionic acid receptor... ; Accepted January 2, 1995 SUMMARY Whole-cell recordings were used to study the antagonism ...

  

Source: Huettner, James E. - Department of Cell Biology and Physiology, Washington University in St. Louis

 

Collection: Biology and Medicine

 
56 Protection of 3,4-dihydroxyphenylalanine (DOPA) for Fmoc solid-phase peptide synthesis
 

Summary:  protects the a-amino group of amino acids during coupling reactions.7 The cyclic ethyl orthoformate (Ceof... ; amino acids and derivatives; solid-phase synthesis; peptides and polypeptides. 3... ,4-Dihydroxyphenylalanine (DOPA) 1 is a naturally occurring, unusual amino acid ...

  

Source: Messersmith, Phillip B.- Department of Materials Science and Engineering, Northwestern University

 

Collection: Biology and Medicine ; Materials Science

 
57 Glutathione-like Tripeptides as Inhibitors of Glutathionylspermidine Synthetase. Part 2: Substitution of the
 

Summary:  -nitrophenylsulphonylchloride. After a-amino protec- tion with a Fmoc-group, l-a-Fmoc-e-(o-nitrophenylsul- phonyl)lysine was linked... the glycine moiety has been substituted for other amino acids. These peptides were evaluated as substrates... and inhibitors of GspS. Compounds with basic side chains such as diaminopropionic acid ...

  

Source: Fairlamb, Alan - Division of Biological Chemistry and Molecular Microbiology, University of Dundee

 

Collection: Biology and Medicine

 
58 Efficient Enantioselective Synthesis of a-Hydroxy-b-amino Acids Using the Claisen and Curtius Rearrangements
 

Summary:  As one can see in Figure 1, a-hydroxy-b-amino acids or their derivatives reside in key structural... the corresponding a-amino ketone. This compound was treated with tetrabutylammonium borohydride as reported... LETTER86 Efficient Enantioselective Synthesis of a-Hydroxy-b-amino Acids Using the Claisen

  

Source: Chang, Sukbok - Department of Chemistry, Korea Advanced Institute of Science and Technology

 

Collection: Chemistry

 
59 Amidohydrolase Superfamily
 

Summary:  is a-amino-b-carboxymuconate-e-semialdehyde decarboxy- lase (ACMSD, EC 4.1.1.45), which converts a-amino... members of the amidohydrolase superfamily Enzyme Abbreviation E.C. number PDB code a-Amino... , Iwaki H, Fu R et al. (2006) a-Amino-b-carboxymu- conic-e-semialdehyde decarboxylase (ACMSD) is a new mem

  

Source: Correia, John J. - Department of Biochemistry, University of Mississippi

 

Collection: Biology and Medicine

 
60 Silke S. Hings1, Eben S. Cross1, William C. Wrobel1, Douglas R. Worsnop2, Paul Davidovits1, Timothy B. Onasch1,2
 

Summary:  of the particles and consequently alter their CCN activity. Slighlty soluble organics, like adipic acid... of such components on CCN activity. Here we report on the effect of adipic acid coatings on soluble and insoluble... Experiments ammonium sulfate coated with adipic acid - approaches predicted critical supersaturations

  

Source: Brookhaven National Laboratory, Environmental Chemistry Division, Department of Applied Science

 

Collection: Environmental Sciences and Ecology


Page:   1  2  3  4  5 
Page:   1  2  3  4  5 
 
61 BIOL 220 Human Anatomy & Physiology I Practice Questions for Exam 1 These include all the questions I showed during lecture
 

Summary:  . The major building blocks of carbohydrates are __________. A. amino acids B. fats C. nucleotides D... . amino acids B. monosaccharides C. triglycerides D. nucleotides 18. The four DNA nucleotides... . monosaccharides 16. The three subclasses of lipids include phospholipids, steroids, and ...

  

Source: Beachy, Christopher K. - Department of Biology, Minot State University

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
62 Journal of Biomolecular NMR 29: 19, 2004. 2004 Kluwer Academic Publishers. Printed in the Netherlands.
 

Summary:  residue Amino # Data %a Amino # Data %a acid points occurrence acid points occurrence ala 1521 7.5 leu... in (13C), , and space for each amino acid residue. Extracting and combining probabilities for particular... amino acid residues in a short proposed sequence ...

  

Source: Prestegard, James H. - Complex Carbohydrate Research Center & Department of Chemistry, University of Georgia

 

Collection: Chemistry ; Biology and Medicine

 
63 Journal of Neurochemislry Raven Press, Ltd., New York
 

Summary:  for Neurochemistry Evidence that High- and Low-Affinity ~~-a-Amino-3- Hydroxy-5-Methylisoxazole-4-PropionicAcid (AMPA... brain tissue using DL-[3H]-a-amino-3-hydroxy-5-methylisoxazole-4-prop~onic acid (AMPA) and a filtration... :comparison with ...

  

Source: Hall, Randy A - Department of Pharmacology, Emory University

 

Collection: Biology and Medicine

 
64 Plant Molecular Biology 41: 113, 1999. 1999 Kluwer Academic Publishers. Printed in the Netherlands.
 

Summary:  G-box and C-box binding by EmBP-1 mutants with TGA1a amino acid substitutions. Our results indicate... BP-1 and TGA1a. Amino acid differences between EmBP-1 and TGA1a are in bold type. The amino acid... -box (CCACGTGG) or C-box (TGACGTCA) binding ...

  

Source: Guiltinan, Mark - Department of Horticulture, Pennsylvania State University

 

Collection: Biotechnology

 
65 Start | Author Index 581-9 The Effect of Organic Acids from Rice (Oryza sativa L.) on Cadmium and Zinc Bioavailability
 

Summary:  Start | Author Index 581-9 The Effect of Organic Acids from Rice (Oryza sativa L.) on Cadmium... the solubility of heavy metals in the rhizosphere. However, the root secretion derived heavy metal speciation... -molecular-weight organic acids (LMWOA) from roots can operate by multiple mechanisms in response to various environmental

  

Source: Sparks, Donald L. - Department of Plant and Soil Sciences, University of Delaware

 

Collection: Environmental Management and Restoration Technologies

 
66 a g Hybrid Peptides that Contain the Conformationally Constrained Gabapentin Residue: Characterization of Mimetics of Chain Reversals
 

Summary:  conformations of TMthree linked peptide units.[3] Canonical b-turns in polypeptides, derived from a-amino acid... is similar to that observed for the i 1 position in type II b-turns in all a-amino acid structures... an entry to conformational families, hitherto inacces- sible for ...

  

Source: Balaram , P. - Molecular Biophysics Unit, Indian Institute of Science, Bangalore

 

Collection: Biology and Medicine

 
67 7, 53415364, 2007 Modelling the effect
 

Summary:  acid. These van't Hoff factors were derived from the dissociation constants and the actual... acid solutions was derived from osmolality as suggested earlier (Kiss and Hansson, 2004; Rosenorn et al... acids. Water activity can be derived from experiments with ...

  

Source: Ecole Polytechnique, Centre de mathématiques

 

Collection: Mathematics

 
68 Biochemistry 1987, 26, 7609-7614 7609 Serine Protease Mechanism: Structure of an Inhibitory Complex of a-Lytic
 

Summary:  that stabilize the transition state. Recently peptide analogues containing an a-amino boronic acid in the carboxy... of boronic acid inhibitors might be derived from the negatively charged boron in the tetrahedral adduct in... enzymogenes, and N-tert-butyloxycarbonylalanylprolylvalineboronic ...

  

Source: Agard, David - Department of Biochemistry and Biophysics, University of California at San Francisco

 

Collection: Biotechnology ; Biology and Medicine

 
69 A General Model of Codon Bias Due to GC Mutational Gareth A. Palidwor1
 

Summary:  GC) are green. (A) Amino acids whose codons are predicted to have a linear response to GC mutational... (B~0). The opposite holds for the G/C-ending codon. For a four-codon amino acid, the derivation... model of codon usage bias due to mutational bias has been lacking. Because most amino ...

  

Source: Xia, Xuhua - Department of Biology, University of Ottawa

 

Collection: Biology and Medicine

 
70 Amino acid transport in Penicillium chrysogenum in
 

Summary:  specific for amino acids and their derivatives, in plants and animals as well as vacuolar amino acid... Amino acid transport in Penicillium chrysogenum in relation to precursor supply for -lactam... by the European Community (grant no QLK3-CT-1999-00729). #12;RIJKSUNIVERSITEIT GRONINGEN Amino ...

  

Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution,

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
71 Identification and Characterization of Two Novel Clostridial Bacteriocins, Circularin A and Closticin 574.
 

Summary:  ), B (boldface) and B extended (boldface and italic) are indicated throughout the figure. (A) Amino... search with the derived circularin A amino acid sequence revealed that the protein has 60% similarity (30... GGTGTAGCAGGTATACAAGCAAATTGTTTTTAAATATTTATCTGAAATCGTTAAATAAGG G V A G I Q A N C F - Figure 4: ...

  

Source: Groningen, Rijksuniversiteit - Centre for Ecological and Evolutionary Studies, Department of Marine Benthic Ecology and Evolution,

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
72 Non-standard amino acids in peptide design and protein engineering
 

Summary:  -n-alkylglycines (n = 1, diethyl- glycine; n = 2, dipropylglycine; (4) l-aminocycloalkane-l-car- boxylic acids; (5)cr-methyl-a-amino... Non-standard amino acids in peptide design and protein engineering Padmanabhan Balaram Indian... Institute of Science, Bangalore, India The introduction of non-coded amino ...

  

Source: Balaram , P. - Molecular Biophysics Unit, Indian Institute of Science, Bangalore

 

Collection: Biology and Medicine

 
73 Prebiotic materials from on and off the early Earth
 

Summary:  that most of the amino acids found in meteorites are derived from reactions in liquid water on the parent... (amino acids, sugars, amphiphiles) that were directly related to the origin or early evolution of life... , but it was a logical choice since Strecker had shown in the 1850s that one could make amino ...

  

Source: NASA Ames Research Center, Astrochemistry Laboratory

 

Collection: Physics

 
74 Evaluating Evolutionary Constraint on the Rapidly Evolving Gene matK Using Protein Composition
 

Summary:  of the full-length MATK ORF (data set A). Amino acids were categorized as nonpolar, uncharged polar at pH 7... chloroplast matK gene has nucleotide and amino acid substitution rates suggestive of progression toward... . Conservative amino acid replacement may reconcile the fast ...

  

Source: Hilu, Khidir - Department of Biological Sciences, Virginia Tech

 

Collection: Biology and Medicine

 
75 Proc. Natd. Acad. Sci. USA Vol. 91, pp. 12027-12030, December 1994
 

Summary:  , acylation resulted in significantpreference forLys E-amino groups over N-terminal a-amino groups (12... - plicated. In a buffer with pH near the pKa of an a-amino group, covalent modification will contribute... in the values of pKa used (especially for the Zn-OH2 group and the a-amino group of the N-terminal Ser). Net

  

Source: Gao, Jinming - Department of Oncology and Pharmacology, University of Texas Southwestern Medical Center at Dallas

 

Collection: Biology and Medicine

 
76 A Decision Graph Explanation of Protein Secondary Structure Prediction.
 

Summary:  for each pair <a:amino­acid, s:state>, which are derived from the probability of `a' being in state `s... theory and now known as the GOR method[Garn78]. For each triple, <a:amino­acid, p:position, s... classifications of the amino acids. G1 and G2 fit most naturally with a hierarchy[Jimi84, p653, ...

  

Source: Allison, Lloyd - Caulfield School of Information Technology, Monash University

 

Collection: Computer Technologies and Information Sciences

 
77 Proc'.Natl.Acad.Scl. USA Vol. 91, pp. 12027-12030.December1994
 

Summary:  Lys e-aminogroupsover N-terminal a-amino groups (12). Procedures for CE. The sample for injection... or uncertaintiesin the values of pKa used (especially for the Zn-OHz group and the a-amino group of the N... 'er: impurities must not confuse interpretation of the charge ladder: modi- fication of the a-amino groups of Lys

  

Source: Prentiss, Mara - Department of Physics, Harvard University

 

Collection: Physics

 
78 Reference: Bid. Bull. 194: 132-142. (April, 1998) Role of Chemical Inducers in Larval Metamorphosis
 

Summary:  , and isoleucine are blocked by acetylsalicylic acid (Fig. 4). In other systems(Hara, 1977), alterations of the a-amino... ex- tract of L. poitei. The free amino acids valine and isoleu- tine mimic the effects of the natural... . Hydrogen peroxide, vanadate, and y-aminobutyric acid (GABA), as well as elevated ...

  

Source: Boettcher, Anne - Department of Biology, University of South Alabama

 

Collection: Environmental Sciences and Ecology ; Biology and Medicine

 
79 Proc. Natl. Acad. Sci. USA Vol. 88, pp. 11266-11270, December 1991
 

Summary:  the two fibronectin type III repeats of DPTP 99A (amino acids 171-270 and 271-370), the ninth repeat... (amino acids 497-747 and 783-1032) are compared with the first PITP domain of human PTPy (HPTP GAMMA... for a polypeptide of 1301 amino acids with a predicted ...

  

Source: Chuang, Pao-Tien - Cardiovascular Research Institute, University of California at San Francisco

 

Collection: Biology and Medicine

 
80 Cell. Vol. 52, 179-184, January 29, 1988, Copyright 0 1988 by Cell Press DNA-Bound Fos Proteins Activate
 

Summary:  made use of fusion genes containing the LexA amino terminus joined to avian vFos, mouse cFos, avian v... efficient operator binding when LexA's amino terminus is fused to proteins known to form dimers or tetramers... proteins are valid in CYC7 promoter derivatives (Brent and Ptashne, ...

  

Source: Brent, Roger - Fred Hutchinson Cancer Research Center

 

Collection: Biology and Medicine


Page:   1  2  3  4  5 
Page:   1  2  3  4  5 
 
81 Chemistry & Biology Recent Progress Toward the Templated Synthesis
 

Summary:  , or itself (Nielsen, 1995). Side-chain-containing PNA building blocks can be readily ac- cessed from a-amino... polymers such as nucleic acids and proteins are ubiquitous in living systems, but their ability to address... a means of translating amplifiable templates such as nucleic acids into the polymer being evolved

  

Source: Liu, David R. - Department of Chemistry and Chemical Biology, Harvard University

 

Collection: Chemistry ; Biology and Medicine

 
82 Biochemistry 1981,20,4325-4333 4325 Mechanistic Studies on Reactions of Bacterial Methionine y-Lyase with
 

Summary:  -lyase will catalyze the net oxidative deamination of a variety of four- and five-carbon a-amino acids (1... . These data were obtained by using a discontinuous assay which detected the hydrazone derivative of keto acid... between the model pyridoxal and the a-amino nitrogen of substrate ...

  

Source: Raines, Ronald T. - Departments of Biochemistry & Chemistry, University of Wisconsin at Madison

 

Collection: Chemistry ; Biology and Medicine

 
83 Invited Review Hybrid Polypeptides: Gabapentin as a Stereochemically Constrained
 

Summary:  he postulated the a-helix3 and b-sheet4 structures for polymeric chains composed of a-amino acids... structures in peptides containing the higher homologues of a-amino acid residues requires the restriction... of the range of local conformational choices. In a-amino ...

  

Source: Balaram , P. - Molecular Biophysics Unit, Indian Institute of Science, Bangalore

 

Collection: Biology and Medicine

 
84 '9 '*****f>*,->I position of these maps is accurate to 0.15 arc
 

Summary:  in Fig. 4. The deviation from the calculated value is given in parentheses; Aba, a-amino-n-butyric acid... to remove one amino acid at a time from the amino terminal. After release, each amino acid derivative... , sensitivity, and precision, than the amino acid ...

  

Source: Chait, Brian T. - Laboratory of Mass Spectrometry and Gaseous Ion Chemistry, Rockefeller University

 

Collection: Biology and Medicine

 
85 Transposing Sequences between Fetal and Adult Hemoglobins Indicates Which Subunits and Regulatory Molecule Interfaces Are Functionally Related
 

Summary:  , which contains the A helix of the -subunit (7) but all of the HbA amino acids at its allosteric... acids are present at the distant R1 2 interface, even if the HbA amino acids are present at the DPG... suggests that the central cavity may not ...

  

Source: Chait, Brian T. - Laboratory of Mass Spectrometry and Gaseous Ion Chemistry, Rockefeller University

 

Collection: Biology and Medicine

 
86 A FAAH-Regulated Class of N-Acyl Taurines That Activates TRP Ion Channels Alan Saghatelian, Michele K. McKinney, Michael Bandell, Ardem Patapoutian, and Benjamin F. Cravatt*
 

Summary:  are biosynthesized by the enzyme bile acid coenzyme A (CoA):amino acid N-acyltransferase (BAT) that conjugates cholyl... . (2005) Bile acid coenzyme A: amino acid N-acyltransferase in the amino acid conjugation of bile ...

  

Source: Cravatt, Benjamin - Department of Cell Biology, Scripps Research Institute

 

Collection: Biology and Medicine

 
87 Algorithms for Identifying Protein Cross-links via Tandem Mass Spectrometry
 

Summary:  ), amino acids p2 and qj are connected by a 10 #12;1p . . . +qq1 r-1 . . .p2 . . . . . .jq p2 . . . . . .jq... structures. We studied the problem of detecting the cross-linked peptides and cross-linked amino acids from... cross- linked amino acids in these two peptide sequences that are optimally correlated ...

  

Source: Church, George M. - Wyss Institute for Biologically Inspired Engineering & Department of Genetics, Harvard University

 

Collection: Biotechnology

 
88 TIBS -November 1977 Light-induced ion transport in
 

Summary:  or uptake of protons on binding oxygen to hemoglobin. It is due to specific a-amino and imidazole groups... H dependence is plotted as the points in Fig. 2. The structural reason for the Bohr effect is that certain a-amino... 'preparations derived from H. halobium, where processes affecting the pH cannot occur, less complicated pH ...

  

Source: Eisenbach, Michael - Department of Biological Chemistry, Weizmann Institute of Science

 

Collection: Biology and Medicine

 
89 DOI: 10.1002/cssc.201000111 A Direct, Biomass-Based Synthesis of Benzoic Acid: Formic Acid-Mediated
 

Summary:  -Mediated Deoxygenation of the Glucose-Derived Materials Quinic Acid and Shikimic Acid Elena Arceo,[c] Jonathan A. Ellman... DOI: 10.1002/cssc.201000111 A Direct, Biomass-Based Synthesis of Benzoic Acid: Formic Acid... -based substances hazardous to human health and the environment. Benzoic ...

  

Source: Long, Jeffrey R.- Department of Chemistry, University of California at Berkeley

 

Collection: Materials Science ; Chemistry

 
90 Proc. Nati. Acad. Sci. USA Vol. 81, pp. 5021-5025, August 1984
 

Summary:  been introduced to optimize homology based on the results in Fig. 4A. Amino acids have been assigned... acids. Nine of the thirteen 22-amino acid re- peat units in the derived protein sequence begin... contains the polyadenylylation signal, A-A- T-A-A-A, beginning at ...

  

Source: Boguski, Mark S. - Center for Biomedical Informatics, Harvard University

 

Collection: Mathematics ; Biology and Medicine

 
91 Molecular Architecture of the DNA-Binding Region and Its Relationship to Classification of Basic HelixLoopHelix Proteins
 

Summary:  ), and residue abbre- viations are in italics (e.g., residue A; amino acids are coded by conventional single... . Alphabetic amino acid data are transformed to biologically meaningful quantitative values using a set of 5... multivariate ``indices.'' These multivariate indices summarize variation in a large ...

  

Source: Atchley, William R.- Department of Genetics, North Carolina State University

 

Collection: Biology and Medicine

 
92 Proc. Nati. Acad. Sci. USA Vol. 83, pp. 1613-1616, March 1986
 

Summary:  for serines and a-amino- butyrate was substituted for the threonine to give [Ala13'28'29 Abu'6]PKI-(7... of Washington, Seattle, WA 98195 Contributed by Edmond H. Fischer, November 4, 1985 ABSTRACT The amino acid... and by substitutions for specific amino acids. The results show that (i) deletion of residues 25-30 did not change

  

Source: Scott, John D. - Department of Pharmacology, University of Washington at Seattle

 

Collection: Biology and Medicine

 
93 Ragulator-Rag Complex Targets mTORC1 to the Lysosomal Surface and Is Necessary
 

Summary:  by Amino Acids Yasemin Sancak,1,2,3,6 Liron Bar-Peled,1,2,3,6 Roberto Zoncu,1,2,3 Andrew L. Markhard,1... , and amino acids, and its activity is often deregulated in disease. The Rag GTPases interact with mTORC1... and are pro- posed to activate it in response to amino acids by promoting mTORC1 translocation to a membrane

  

Source: Sabatini, David M. - Whitehead Institute for Biomedical Research & Department of Biology, Massachusetts Institute of Technology (MIT)

 

Collection: Biology and Medicine

 
94 Heterogeneous N-terminal acylation of retinal proteins J.C. DeMar Jra, b,
 

Summary:  bond to the a-amino group of the N-terminal amino acid, as depicted in the schematic diagram in Fig. 3... , an activated fatty acid in the form of acylated coenzyme A (acyl-CoA) and a peptide with a free N-terminal a-amino... as an acceptor for myristic acid during its transfer from CoA ...

  

Source: Wensel, Theodore G. - Department of Biochemistry and Molecular Biology, Baylor College of Medicine

 

Collection: Biology and Medicine

 
95 Author's personal copy Research Paper
 

Summary:  (e.g., McCoy, 1987; Oches et al., 1996; Kaufman, 2003a). Amino acids exist as mirror... signal for each amino acid derivative were integrated by HP Chemstation computer software. Analytical... Author's personal copy Research Paper Amino acid racemization in lacustrine ...

  

Source: Licciardi, Joseph M. - Department of Earth Sciences, University of New Hampshire

 

Collection: Environmental Sciences and Ecology ; Geosciences

 
96 Euolution,36(6),1982,pp. 1318-1322 SIMILARITY OF AMINO ACIDS IN NECTAR AND LARVAL SALIVA
 

Summary:  Univ. Press,N.Y. B.ela. Amino aqids in nectarand their evolutionary... Euolution,36(6),1982,pp. 1318-1322 SIMILARITY OF AMINO ACIDS IN NECTAR AND LARVAL SALIVA... samples were then analyzed for amino acid presence and con- centration using techniques described

  

Source: Hunt, James H. - Department of Biology, University of Missouri-St. Louis

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
97 Mutation Matrices and Physical-Chemical Properties: Correlations and Implications
 

Summary:  , J.L., Delorme, M.O., Delacroix, H., Henaut, A. Amino acid substitutions in structurally related... acids result in pro- teins with particular structures and functions, we have examined the correlations... between previously derived structure-dependent muta- tion rates and changes in ...

  

Source: Goldstein, Richard - Department of Chemistry, University of Michigan

 

Collection: Chemistry ; Biotechnology

 
98 APPLIED AND ENVIRONMENTAL MICROBIOLOGY, 0099-2240/01/$04.00 0 DOI: 10.1128/AEM.67.9.42724278.2001
 

Summary:  derived CumA amino acid se- quences (Fig. 1) revealed that certain regions of the protein were extremely... of the putative copper-binding regions (IHWHGI and HCHVIDH ME) of the deduced CumA amino acid sequence of GB-1... ...

  

Source: Tebo, Brad - Division of Environmental and Biomolecular Systems, Oregon Health and Science University

 

Collection: Biology and Medicine ; Environmental Sciences and Ecology

 
99 Structure and Characterization of AgfB from Salmonella enteritidis Thin Aggregative Fimbriae
 

Summary:  ) to overlapping peptides comprising the mature AgfB or AgfA amino acid sequences, respectively, plotted versus... serum Table 3. Patterns of amino acid conservation between AgfB and AgfA Amino acid characterc Agf... . Although uncharacterized, ...

  

Source: Paetzel, Mark - Department of Molecular Biology and Biochemistry, Simon Fraser University; Strynadka, Natalie - Department of Biochemistry and Molecular Biology, University of British Columbia

 

Collection: Biology and Medicine

 
100 10.1101/gr.101261.109Access the most recent version at doi: 2010 20: 745-754 originally published online March 24, 2010Genome Res.
 

Summary:  in human proteins Natural selection drives the accumulation of amino acid tandem Material Supplemental http... on single amino acid repeats service Email alerting click heretop right corner of the article or Receive... Natural selection drives the accumulation of amino acid tandem repeats in human proteins Loris Mularoni,1

  

Source: Mularoni, Loris - Sidney Kimmel Comprehensive Cancer Center, Johns Hopkins University

 

Collection: Biology and Medicine


Page:   1  2  3  4  5