| Sample search results for: 16s rrna coi |
Page:
1
2
3
4
5
Page: 1 2 3 4 5
| 1 | Fragmented and Scrambled Mitochondrial Ribosomal RNA Coding Regions Among Green Algae: A Model for Their Origin and Evolution | ||
|
Summary: :879-887. GUTELL, R. R. 1992. Evolutionary characteristics of 16s and 23s rRNA structures. Pp. 243-309 in H... of evolution of fragmented and scrambled mitochondrial ribosomal RNA (rRNA) genes within the green algal group... of fragmented and scrambled mitochon- drial LSU rRNA coding ... |
|||
|
Source: Nedelcu, Aurora M. - Biology Department, University of New Brunswick |
|||
|
Collection: Biology and Medicine |
|||
| 2 | Insect Molecular Biology (2002) 11(4), 361369 2002 The Royal Entomological Society 361 | ||
|
Summary: (16S rRNA) shows an increased structural variation. To date, the only published 16S rRNA sequence from... 369 completely consistent with Buckley et al.'s (2000) model for domains IV and V of insect 16S ... |
|||
|
Source: Johnson, Kevin P. - Illinois Natural History Survey; Page, Roderic - Division of Environmental and Evolutionary Biology, Institute of Biomedical and Life Sciences, University of Glasgow |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 3 | APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Jan. 2007, p. 303311 Vol. 73, No. 1 0099-2240/07/$08.00 0 doi:10.1128/AEM.00604-06 | ||
|
Summary: of 16S rRNA genes, specific fluorescence in situ hybridization, and phylogenetic analysis to determine... the California coast by amplifying their 16S rRNA genes by PCR from Watersipora larvae, directly sequencing... hybrid- ization (FISH), and conducting a ... |
|||
|
Source: Haygood, Margo G. - Division of Environmental and Biomolecular Systems, Oregon Health and Science University |
|||
|
Collection: Biotechnology ; Environmental Sciences and Ecology |
|||
| 4 | ORIGINAL RESEARCH Genetic diversity and connectivity remain high in Holothuria polii | ||
|
Summary: ). Data analysis We analyzed both COI and 16S rRNA gene fragments as independent genetic markers because... oxidase I (COI) and 16S rRNA (16S) mitochondrial genes. A total 484-bp of ... |
|||
|
Source: Alberto, Filipe - Centro de Ciencias do Mar, Universidade do Algarve |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 5 | 2000 The Society for the Study of Evolution. All rights reserved. Evolution, 54(6), 2000, pp. 20142027 | ||
|
Summary: divergent clades with maximum sequence divergences of 10% in 16S rRNA and 19% in COI. A power test... according to secondary structure for 16S rRNA and unambiguously by eye for COI. A consensus se- quence... as outgroups for ... |
|||
|
Source: Lee, Carol Eunmi - Department of Zoology, University of Wisconsin at Madison |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 6 | This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research | ||
|
Summary: (COI) Evolution Hololepta spp. Iliotona spp. 16S rRNA a b s t r a c t Nucleotide sequences from 16S rRNA... study was to utilize mitochondrial gene sequences [16S rRNA and cytochrome c ... |
|||
|
Source: Markow, Therese - Division of Biological Sciences, University of California at San Diego |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 7 | BioMed Central Page 1 of 12 | ||
|
Summary: the use of 16S rRNA as standard DNA barcoding marker for vertebrates to complement COI, especially... of priming sites in amphibians. Variability of priming sites for 16S rRNA and COI in amphibians. #12... . Variation in ... |
|||
|
Source: Vences, Miguel - Institute for Biodiversity and Ecosystem Dynamics, Zoological Museum, Universiteit van Amsterdam; Vieites, David R. - Museum of Vertebrate Zoology & Department of Integrative Biology, University of California at Berkeley |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 8 | Phenotypic plasticity in the Caribbean sponge Callyspongia vaginalis (Porifera: Haplosclerida) | ||
|
Summary: clave: esponja, espícula, 16S mtDNA, 18S rRNA, 28S rRNA, COI mtDNA, morfotipo, plasticidad fenotípica... of the mitochondrial genes COI and 16S and the nuclear genes 28S and 18S rRNA from sponge tissue ... |
|||
|
Source: Pawlik, Joseph - Center for Marine Science & Department of Biology and Marine Biology, University of North Carolina at Wilmington |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 9 | Phylogeny and Genetic Diversity of Palolo Worms (Palola, Eunicidae) from the Tropical North Pacific | ||
|
Summary: - somal RNA (16S rRNA) and for cytochrome c oxidase subunit I (COI) were amplified by polymerase chain... . Table 4 Number and percentages of singleton, private and shared haplotypes for COI and 16S rRNA... and Kocher, 1991]) ... |
|||
|
Source: Schulze, Anja - Department of Marine Biology, Texas A&M University at Galveston |
|||
|
Collection: Biology and Medicine |
|||
| 10 | Sugita and Shishikura, 1995), immunologi-cal comparisons of hemocyanins (Sugita, | ||
|
Summary: and codon sites of the two mitochondrial genes (16S rRNA and COI). Without such a study, an investi- gator... (16S rRNA and COI) and amino acid sequences of a nuclear gene (en- coding coagulogen) were used... for the ... |
|||
|
Source: Xia, Xuhua - Department of Biology, University of Ottawa |
|||
|
Collection: Biology and Medicine |
|||
| 11 | Nonbridging phosphate oxygens in 16S rRNA important for 30S subunit assembly and association with the 50S | ||
|
Summary: Nonbridging phosphate oxygens in 16S rRNA important for 30S subunit assembly and association... within 16S rRNA that are important for the in vitro assembly of the Escherichia coli 30S small ribosomal... was reconstituted from phosphorothioate-substituted ... |
|||
|
Source: Joseph, Simpson - Department of Chemistry and Biochemistry, University of California at San Diego |
|||
|
Collection: Biology and Medicine ; Chemistry |
|||
| 12 | Molecular Ecology (2003) 12, 153167 2003 Blackwell Publishing Ltd | ||
|
Summary: number for the genes COI and 16S rRNA No. Species Locality Site Latitude Longitude Date Collector COI 16S... analysis Sequences for COI were of identical length, and 16S ... |
|||
|
Source: Ribera, Ignacio - Institut de Biologia Evolutiva, Universitat Pompeu Fabra |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 13 | Molecular Phylogenetics and Evolution 34 (2005) 645654 www.elsevier.com/locate/ympev | ||
|
Summary: to investigate the phylogenetic relationship among all the acontine samples. The primer sets, 16S rRNA and COI... the 16S rRNA and the COI sequences from this study have been deposited in GenBank. The Gen- Bank... Accession ... |
|||
|
Source: Crandall, Keith A. - Departments of Integrative Biology & Microbiology and Molecular Biology, Brigham Young University |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 14 | letters to nature NATURE |VOL 413 |13 SEPTEMBER 2001 |www.nature.com 157 | ||
|
Summary: ribosomal (16S rRNA). From these data, six loci have been mostly sequenced in ours and co... Achelia/Ammothella/Tanystylum 18S 28S H3 U2 EF POL COI 16S EUCHELICERATA Limulus Limulus polyphemus 18S 28... S H3 U2 EF POL COI ... |
|||
|
Source: Wheeler, Ward - Division of Invertebrate Zoology, American Museum of Natural History |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 15 | Enlightenment of old ideas from new investigations: more questions regarding the evolution of bacteriogenic light organs in squids | ||
|
Summary: the mitochondrial 12S rRNA, 16S rRNA, and the entire cytochrome c oxidase subunit I locus (COI), and a portion... are referred to as 12S (12S rRNA data set alone), 16S (16S data set ... |
|||
|
Source: Nishiguchi, Michele - Department of Biology, New Mexico State University |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 16 | Enlightenment of old ideas from new investigations: more questions regarding the evolution of bacteriogenic light organs in squids | ||
|
Summary: . These data sets are referred to as 12S (12S rRNA data set alone), 16S (16S data set alone), COI (COI data set... a combined analysis of four loci (mtCOI, mt12S, mt16S ... |
|||
|
Source: Ruby, Edward G. - Department of Medical Microbiology and Immunology, University of Wisconsin at Madison |
|||
|
Collection: Biology and Medicine |
|||
| 17 | APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Sept. 2009, p. 60056007 Vol. 75, No. 18 0099-2240/09/$08.00 0 doi:10.1128/AEM.00689-09 | ||
|
Summary: sequenc- ing of the symbiont 16S rRNA gene from these individuals has revealed a single, unique phylotype... amplification of fragments of the mitochondrial cytochrome c oxidase subunit I gene (COI) and the symbiont 16S... - rial). Unambiguous contigs of 340 ... |
|||
|
Source: Stewart, Frank - School of Biology, Georgia Institute of Technology |
|||
|
Collection: Biology and Medicine |
|||
| 18 | Genetic diversity of Chelonibia caretta, commensal barnacles of the endangered | ||
|
Summary: of ribosomal RNA (16S rRNA) and the cytochrome oxidase subunit I (COI). Haplotypic diversity (h) for 16S (N... ¼ 34) and COI (N ¼ 26) varied from 0.763 to 0.468, respectively. The nucleotide diversity (p) of ... |
|||
|
Source: Franz, Nico M. - Departamento de Biología, Universidad de Puerto Rico, Mayagüez; Schizas, Nikolaos - Department of Marine Sciences, Universidad de Puerto Rico, Mayagüez |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 19 | Estimating the age of the polydnavirus braconid wasp symbiosis | ||
|
Summary: calculations from the mitochondrial 16S rRNA and COI genes and the nuclear 28S rRNA gene, calibrated using... mitochondrial (16S rRNA and cytochrome oxidase I) and one nuclear (28S rRNA), are used ... |
|||
|
Source: Whitfield, James B. - Department of Entomology, University of Illinois at Urbana-Champaign |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 20 | Evolution of Fragmented Mitochondrial Ribosomal RNA Genes in Chlamydomonas | ||
|
Summary: information using the coordinates of the E. coli 16S (AE) and 23S rRNA (FN) are as follows: A, 160; B, 110... of the chloroplast 16S rRNA gene and its surrounding regions in Chlamydomonas rein- hardtii. Nucleic Acids Res 10... coding and tRNA genes. The ... |
|||
|
Source: Sankoff, David - Laboratory for Innovation in Bioinformatics, University of Ottawa |
|||
|
Collection: Biology and Medicine ; Mathematics |
|||
Page: 1 2 3 4 5
Page:
1
2
3
4
5
Page: 1 2 3 4 5
| 21 | Decapod Phylogenetics And Molecular Evolution ALICIA TOON, MAEGAN FINLEY, JEFFREY STAPLES & KEITH A. CRANDALL | ||
|
Summary: , 16S and COI Mitochondrial ribosomal genes 12S and 16S and coding genes such as COI have been... 659990 Mokady et al. 1994 16S rRNA 16s-1472 AGA TAG AAA CCA ACC TGG ... |
|||
|
Source: Crandall, Keith A. - Departments of Integrative Biology & Microbiology and Molecular Biology, Brigham Young University |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 22 | The EMBO Journal vol.13 no.4 pp.898-905, 1994 A 7.1 kb linear DNA molecule of Theileria parva has | ||
|
Summary: similarity to several regions of 16S (SSU) rRNA of E.coli have also been tentatively identified (data... of variable structure (reviewed by Raue et al., 1990). Escherichia coli 23S (LSU) and 16S (SSU) rRNAs serve... (LSU) or small (SSU) ribosomal subunit RNA. Phylo- genetically conserved ... |
|||
|
Source: Fairlamb, Alan - Division of Biological Chemistry and Molecular Microbiology, University of Dundee |
|||
|
Collection: Biology and Medicine |
|||
| 23 | Syst. Biol. 50(6):781816, 2001 Phylogeny of Trichoptera (Caddis ies): Characterization of Signal | ||
|
Summary: subunit nuclear rRNA, and a frag- ment of the mitochondrial COI gene (441 nt) for most taxa. COI... datasets were complete. Identical sets of taxa were used for both rRNA and COI datasets, but for EF-1... for the rRNA, EF-1®, and COI data, and ... |
|||
|
Source: Holzenthal, Ralph W. - Department of Entomology, University of Minnesota |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 24 | Molecular Phylogenetics and Ecological Diversification of the Transisthmian Fish Genus Centropomus | ||
|
Summary: bp of the mitochondrial DNA 16S ribosomal RNA (rRNA) gene. Molecular phylogenetic trees were... data, and phylogenetic hypotheses for Centropomus based on 16S rRNA sequences were better supported... from the analyses of allozymes and mtDNA ... |
|||
|
Source: Bermingham, Eldredge - Smithsonian Tropical Research Institute, Balboa Panama |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 25 | Laing and Schlick 27 FIGURE LEGENDS | ||
|
Summary: 23S rRNA 2AW4_267 and 23S rRNA 2J01_1832 of family , and 16S rRNA 2AVY_942 of family c... , H2H3 cH HS22HS1H III-IIIa-IIIb-IIIc 2AVY _141 16S rRNA H1H4 , H2H3 cH HS3HS7HS4HS1 5' H7-8-9-10 2J00... _141 ... |
|||
|
Source: Schlick, Tamar - Department of Chemistry, New York University |
|||
|
Collection: Chemistry |
|||
| 26 | The Norwegian Academy of Science and Letters Zoologica Scripta, 31, 1, February 2002, pp8391 83 Kjer, K. M., Blahnik, R. J. & Holzenthal, R. W. (2002). Phylogeny of caddisflies (Insecta, | ||
|
Summary: . & Woese, C. R. (1994). Lessons from an evolving rRNA: 16S and 23S rRNA structures from a comparative... variable regions of the small subunit nuclear rRNA (V45, 511 nts) and a fragment of the mitochondrial COI... our previous partitioned ... |
|||
|
Source: Holzenthal, Ralph W. - Department of Entomology, University of Minnesota |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 27 | Biophysical ELSEVIER BiophysicalChemistry50(1994)3-16 | ||
|
Summary: on a sucrose gradi- ents. The fractions of 5s RNA, 16s RNA and 23s RNA were analyzed for bound proteins. Hma... , a specific internal nucleoprotein complexof protein HmaLl and a stretch of H23S rRNA was isolated from... the halophilic ribosome. The fragments of the 23s rRNA protected by the protein from ... |
|||
|
Source: Martin, Jan M.L. - Department of Organic Chemistry, Weizmann Institute of Science |
|||
|
Collection: Chemistry |
|||
| 28 | TaxI: a software tool for DNA barcoding using distance methods | ||
|
Summary: different models of sequence evolution. Sets of ribosomal 16S rRNA sequences, characterized by multiple... ; 16S rRNA; species recognition 1. INTRODUCTION Recent work suggested that a DNA-based identification... ) argued against the mitochondrial 12S and ... |
|||
|
Source: Vences, Miguel - Institute for Biodiversity and Ecosystem Dynamics, Zoological Museum, Universiteit van Amsterdam |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 29 | Molecular Phylogenetics and Evolution 37 (2005) 661673 www.elsevier.com/locate/ympev | ||
|
Summary: Xict with several of the nodes, and COI and 16S rRNA contribute to even a much lesser extent. Mor- phology... for 16S rRNA and COI data partitions (the last one having negative overall partitioned Bremer supports... and 12S ... |
|||
|
Source: Huber, Bernhard A. - Zoologische Forschungsmuseum Alexander Koenig |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 30 | 10.1261/rna.2246710Access the most recent version at doi: 2010 16: 1990-2001 originally published online August 24, 2010RNA | ||
|
Summary: online August 24, 2010RNA Zhili Xu and Gloria M. Culver formation Differential assembly of 16S rRNA... .cshlp.orgDownloaded from #12;Differential assembly of 16S rRNA domains during 30S subunit formation ZHILI XU and GLORIA M... approach, we identified 54 nucleotides ... |
|||
|
Source: Bedwell, David M. - Department of Microbiology, University of Alabama at Birmingham |
|||
|
Collection: Biology and Medicine |
|||
| 31 | Hidden diversity in a hyperdiverse gastropod genus: Discovery of previously unidentified members of a Conus species complex | ||
|
Summary: (16S rRNA and cytochrome oxi- dase subunit I) and one nuclear locus (a four-loop conotoxin gene... RNA as described previously (Duda and Palumbi, 1999). We amplified regions of the mitochondrial 16S and COI genes... with universal ... |
|||
|
Source: Duda Jr., Thomas F. - Department of Ecology and Evolutionary Biology, University of Michigan |
|||
|
Collection: Biology and Medicine |
|||
| 32 | Lateral Symbiont Acquisition in a Maternally Transmitted Chemosynthetic Clam Endosymbiosis | ||
|
Summary: ).Hostmarkersincludedportionsofthemitochondrial cytochrome oxidase c subunit I gene (COI; 729 bp), mito- chondrial 16S rRNA gene (mt16S; 441 bp), and first... symbiont phylotype. Phylogenetic analysis of 16S ... |
|||
|
Source: Stewart, Frank - School of Biology, Georgia Institute of Technology |
|||
|
Collection: Biology and Medicine |
|||
| 33 | 2006 The Authors. Journal compilation 2006 The Norwegian Academy of Science and Letters Zoologica Scripta, 35, 4, July 2006, pp353362 353 Daniels, S. R., Heideman, N. J. L., Hendricks, M. G. J. & Crandall, K. A. (2006). Taxonomic | ||
|
Summary: are reciprocally monophyletic based on two mitochondrial markers [16S rRNA and cytochrome oxidase subunit I (COI... by Daniels et al. (2005) were included for 16S rRNA, 12S rRNA, COI and cyt b (Table 2). ... |
|||
|
Source: Crandall, Keith A. - Departments of Integrative Biology & Microbiology and Molecular Biology, Brigham Young University |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 34 | Thermal Adaptation of the Small Subunit Ribosomal RNA Gene: A Comparative Study | ||
|
Summary: regions of the 16S rRNA genes and the optimal growth temperature, and we show that this correlation cannot... repeated in the other kingdoms of life. Materials and Methods Sequence Data The 16S rRNA sequence data were... . 2002). For prokaryotes, we retrieved 10,566 ... |
|||
|
Source: Xia, Xuhua - Department of Biology, University of Ottawa |
|||
|
Collection: Biology and Medicine |
|||
| 35 | Mapping the Inside of the Ribosome with an RNA | ||
|
Summary: dependent manner and directed cleavage to specific regions of the 16S, 23S, and 5S rRNA chains. The positions... between its two subunits. The small (30S) ribosomal subunit, which contains 16S rRNA and 21 proteins... RNAs. The in- terface surface is believed to be ... |
|||
|
Source: Joseph, Simpson - Department of Chemistry and Biochemistry, University of California at San Diego |
|||
|
Collection: Biology and Medicine ; Chemistry |
|||
| 36 | Phylogeography of the Atlanto-Mediterranean sea cucumber Holothuria (Holothuria) mammata: the | ||
|
Summary: Mediterranean and Aegean Sea (Eastern Mediterranean). We analysed mitochondrial 16S and COI gene sequences from... was high (H = 0.9307 for 16S and 0.9203 for COI), and the haplotypes were closely related (p = 0... .0058 for ... |
|||
|
Source: Alberto, Filipe - Centro de Ciencias do Mar, Universidade do Algarve |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 37 | Molecular Phylogenetics and Evolution 36 (2005) 101111 www.elsevier.com/locate/ympev | ||
|
Summary: Bank. Collection data 12S rRNA 16S rRNA COI Nautiloidea (1 sp.) Nautilidae Nautilus pompilius Voucher at AMNH AY... the evolutionary relationships within Gonatidae, three mitochondrial loci (12S rRNA, 16S ... |
|||
|
Source: McFall-Ngai, Margaret - Department of Medical Microbiology and Immunology, University of Wisconsin at Madison; Nishiguchi, Michele - Department of Biology, New Mexico State University |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 38 | This article was originally published in a journal published by Elsevier, and the attached copy is provided by Elsevier for the | ||
|
Summary: combined nucleotide sequences of mitochondrial 12S and 16S rRNA genes) data sets in order to further... , retention index; 16S rRNA and 12S rRNA, genes encoding for the large and small (12S) subunits of ribosomal... fragments were located between ... |
|||
|
Source: Zardoya, Rafael - Biodiversidad y Biologia Evolutiva, Museo Nacional de Ciencias Naturales |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 39 | Phylogeny and historical biogeography of Agabinae diving beetles (Coleoptera) inferred from mitochondrial DNA sequences | ||
|
Summary: . COI 2nd pos. COI 3rd pos. 16S rRNA Total Equal weight 5.44 Æ 6.63 )1.59 Æ 4.25 0.47 Æ 1.71 3.91 Æ 8... and sequence accession numbers No. Speciesa Sp. group Dist. Country Collector 16S rRNA COI ... |
|||
|
Source: Ribera, Ignacio - Institut de Biologia Evolutiva, Universitat Pompeu Fabra |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 40 | 1985 Elsevier Science Publishers B.V. (Biomedical Division) Achievements and Perspectives of Mitochondrial Research | ||
|
Summary: ). The 610 nt 9S RNA exhibits a minimal secondary structure in which all four domains of the E^. coli 16S rRNA... . The structural genes- COI, con, con, CYB, ND4 (HURF4), NDS (HURFB) and NDl (HURFl)- were identified by two basic... identifed genes except, for COI (and NDl) are transcribed ... |
|||
|
Source: Simpson, Larry - Department of Microbiology, Immunology and Molecular Genetics, University of California at Los Angeles |
|||
|
Collection: Biology and Medicine |
|||
Page: 1 2 3 4 5
Page:
1
2
3
4
5
Page: 1 2 3 4 5
| 41 | DOI 10.1007/s00227-007-0843-5 RESEARCH ARTICLE | ||
|
Summary: , Georgia) using the mitochon- drial 16S rRNA gene (Caudill and Bucklin 2004). If more complete analysis... -speciWc primers for the mitochondrial cytochrome oxi- dase subunit one gene (mtCOI) and real-time quantitative PCR... (qPCR) was developed. The general approach is to determine the ... |
|||
|
Source: Smith, David C. - Graduate School of Oceanography, University of Rhode Island |
|||
|
Collection: Geosciences ; Environmental Sciences and Ecology |
|||
| 42 | JOURNAL OF CRUSTACEAN BIOLOGY, 28(1): 7681, 2008 GENETIC IDENTIFICATION OF THE NORTHEASTERN ATLANTIC SPINY SPIDER | ||
|
Summary: of the 16S rRNA gene with 16Sar and 16Sbr (Palumbi et al., 1991) and 710 bp of the COI gene with LCO1490... the divergence within each taxon was 0% for 16S and 0-0.3% for COI, divergence between taxa was 0.6-2.5% for ... |
|||
|
Source: Posada, David - Departamento de Bioquímica, Genética e Inmunología, Universidad de Vigo |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 43 | The Plant Cell, Vol. 15, 10831094, May 2003, www.plantcell.org 2003 American Society of Plant Biologists The COP9 Signalosome Interacts Physically with SCFCOI1 and | ||
|
Summary: the regulation of ubiquitin-proteasome mediated protein degradation. COI1 encodes an F-box protein, which... -tagged COI1 forms SCFCOI1 and associates directly with CSN in vivo. Like the coi1-1 mutant, CSN reduction... - pendent on COI1 dosage. More importantly, most of the ... |
|||
|
Source: Deng, Xing-Wang - Department of Molecular Biophysics and Biochemistry, Yale University |
|||
|
Collection: Biology and Medicine ; Biotechnology |
|||
| 44 | Molecular Ecology (2001) 10, 721735 2001 Blackwell Science Ltd | ||
|
Summary: and speciation rates by comparing species-level phylogenies based on cytochrome oxidase I (COI) and 16S rRNA... and molecular evolution Sequences for COI were not length variable, and 16S rRNA sequences differed in length... ... |
|||
|
Source: Ribera, Ignacio - Institut de Biologia Evolutiva, Universitat Pompeu Fabra |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 45 | Agabus alexandrae sp. n. from Morocco, with a molecular phylogeny of the Western Mediterranean species of the A. | ||
|
Summary: the mitochondrial genes 16S #12;254 rRNA and Cytochrome Oxydase I (COI). The evolutionary history of the lineage... ,based on a Maximum Likelihoodestimateof divergencetime of approximately2% per MY for the combined16S and COI genes... al. (1993). ... |
|||
|
Source: Ribera, Ignacio - Institut de Biologia Evolutiva, Universitat Pompeu Fabra |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 46 | Molecular Phylogenetics and Evolution 36 (2005) 233248 www.elsevier.com/locate/ympev | ||
|
Summary: of the pro- tein coding genes, and between the 12S rRNA, Cyt b, and COI genes as a whole (De... , Cyt b, and COI). For the second analysis we created Wve par- titions by further partitioning the 12S rRNA... .03.015 A phylogenetic analysis of woodpeckers and their allies using 12S, Cyt b, and ... |
|||
|
Source: Moore, William S. - Department of Biological Sciences, Wayne State University |
|||
|
Collection: Biology and Medicine |
|||
| 47 | JOURNAL OF CLINICAL MICROBIOLOGY, Aug. 2004, p. 37113730 Vol. 42, No. 8 0095-1137/04/$08.00 0 DOI: 10.1128/JCM.42.8.37113730.2004 | ||
|
Summary: Reserved. Use of 16S rRNA, 23S rRNA, and gyrB Gene Sequence Analysis To Determine Phylogenetic... analyzed 183 16S rRNA and 74 23S rRNA sequences for all species in the B. cereus group. We also analyzed 30... gyrB sequences ... |
|||
|
Source: Kelly, John J. - Department of Biology, Loyola University Chicago |
|||
|
Collection: Environmental Sciences and Ecology ; Environmental Management and Restoration Technologies |
|||
| 48 | Proc. Natl. Acad. Sci. USA Vol. 96, pp. 366370, January 1999 | ||
|
Summary: radical probing of 30S ribosomal subunits by using Fe(II) tethered to an interruption in the 16S rRNA... and central domains (residues 1920) of 16S rRNA and the other corresponding to its 3 domain (residues 922... . Association of these two halves of ... |
|||
|
Source: Joseph, Simpson - Department of Chemistry and Biochemistry, University of California at San Diego |
|||
|
Collection: Biology and Medicine ; Chemistry |
|||
| 49 | Genome Update: rRNAs in sequenced microbial | ||
|
Summary: . cereus sensu lato group, and comparison of 16S rRNA gene sequences alone cannot distinguish between... in the genome report (Dietrich et al., 2004). Method of the month comparative sequence analysis of 16S rRNA... in Fig. 1. The comparison of ... |
|||
|
Source: Ussery, David W. - Center for Biological Sequence Analysis, Institute of Biotechnology, Danmarks Tekniske Universitet |
|||
|
Collection: Biotechnology |
|||
| 50 | APPLIED AND ENVIRONMENTAL MICROBIOLOGY, 0099-2240/98/$04.00 0 | ||
|
Summary: :364374. 11. Haygood, M. G., and D. L. Distel. 1993. Polymerase chain reaction and 16s rRNA gene sequences... between the 18S and 25S rRNA genes (1,425 to 1,450 bp in length, including ITS region 1, the 5.8S gene... , and ITS region 2) or their cytochrome oxidase subunit I (COI) sequence ... |
|||
|
Source: Nishiguchi, Michele - Department of Biology, New Mexico State University; Ruby, Edward G. - Department of Medical Microbiology and Immunology, University of Wisconsin at Madison |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 51 | Molecular Ecology (2002) 11, 14271437 2002 Blackwell Science Ltd | ||
|
Summary: these two species with: (i) sequence data from two mitochondrial genes (16S rRNA and COI); (ii) data... for species of Alpheus (A) and Automate gardineri based on 16S rRNA mitochondrial gene (most common haplotypes... Phylogenetic tree based on ... |
|||
|
Source: Neigel, Joseph E. - Biology Department, University of Louisiana at Lafayette; Schubart, Christoph - Institut für Zoologie, Universität Regensburg |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 52 | Molecular & Biochemical Parasitology 148 (2006) 6978 Isolation and characterization of mitochondrial ribosomes and | ||
|
Summary: mitochondrial 16S and 12S rRNAs and are much smaller 0166-6851/$ see front matter © 2006 Elsevier B.V. All... Parasitology 148 (2006) 6978 than the eubacterial 23S and 16S rRNAs [16,17]. Secondary structure analyses... mitochondrial ribonucleoprotein (RNP) complexes using the 9S small subunit (SSU) ... |
|||
|
Source: Simpson, Larry - Department of Microbiology, Immunology and Molecular Genetics, University of California at Los Angeles |
|||
|
Collection: Biology and Medicine |
|||
| 53 | Nature Macmillan Publishers Ltd 1998 letters to nature | ||
|
Summary: ), d ¼ 0:031 (16S rRNA, 0.020; COI, 0.041). For the sulcatum group, this was S. crassipes versus S... . sulcatum and S. aequatoriale; d ¼ 0:042 (16S rRNA, 0.021; COI, 0.062). These trans-isthmian species... Myr (0.65% for ... |
|||
|
Source: Hedges, S. Blair - Department of Biology, Pennsylvania State University; Schubart, Christoph - Institut für Zoologie, Universität Regensburg |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 54 | Nature Macmillan Publishers Ltd 1997 Chaperoning | ||
|
Summary: to sequence 1,759 nucleotides of the small-subunit ribosomal RNA gene (18S rRNA) and 708 base pairs... of the protein-coding mitochondrial cyto- chrome c oxidase subunit I gene (COI) from five specimens of X. bocki... collected on the west coast of Sweden. We sequenced the corresponding COI fragment from the flat- worm |
|||
|
Source: Tatar, Marc - Department of Ecology and Evolutionary Biology, Brown University |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 55 | Protist, Vol. 157, 31--43, January 2006 http://www.elsevier.de/protis | ||
|
Summary: . In parallel, the studies of 16S rRNA gene diversity abundantly showed the shortcomings of this approach... affinities of Diplonema within the Euglenozoa as inferred from the SSU rRNA gene and partial COI protein... of enzymatically amplified eu- karyotic ... |
|||
|
Source: Meyers, Steven D. - Ocean Modeling and Prediction Laboratory, University of South Florida |
|||
|
Collection: Geosciences |
|||
| 56 | How stable is the "Polyphyly of Lice" hypothesis (Insecta: Psocodea)?: A comparison of phylogenetic signal in multiple genes | ||
|
Summary: five genes: nuclear 18S rDNA, Histone 3, and wingless and mitochondrial 16S rDNA and COI. Combined... and mitochondrial 16S rDNA and COI. These include both ribosomal and protein coding genes from each genome. We... , mitochondrial protein coding ... |
|||
|
Source: Yoshizawa, Kazunori - Division of Earth and Planetary Sciences, Hokkaido University |
|||
|
Collection: Geosciences |
|||
| 57 | Cryptic species within the Tetratrichomonas gallinarum species complex revealed by molecular polymorphism$ | ||
|
Summary: for the analyses: RAPD and sequencing of 16S rRNA, 5.8S rRNA, ITS1 and ITS2 genes, both producing consistent... the T. gallinarum-like trichomonads. To this end, we performed a detailed analysis of 5.8S rRNA, 16S rRNA... ITS1 ... |
|||
|
Source: Flegr, Jaroslav - Department of Philosophy and History of Science, Charles University in Prague |
|||
|
Collection: Biology and Medicine |
|||
| 58 | MARINE ECOLOGY PROGRESS SERIES Mar Ecol Prog Ser | ||
|
Summary: of ribosomal RNA (16S rRNA) genes yielded distinct and highly supported clades for each of the FLE, FLK, and TX... results and the molecular population structure derived from the mitochondrial genes COI and 16S. MATERIALS... ) for fixed tissue according the ... |
|||
|
Source: Schizas, Nikolaos - Department of Marine Sciences, Universidad de Puerto Rico, Mayagüez |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 59 | APPLIED AND ENVIRONMENTAL MICROBIOLOGY, May 2003, p. 26842691 Vol. 69, No. 5 0099-2240/03/$08.00 0 DOI: 10.1128/AEM.69.5.26842691.2003 | ||
|
Summary: artificial chromosome (BAC) clones were screened for 16S rRNA genes. The sequences obtained from BAC clones... were compared with a collection generated by direct PCR amplification and cloning of 16S rRNA genes... , a method that uses sequence heterogeneity within the ... |
|||
|
Source: Goodman, Robert M. - Department of Ecology, Evolution and Natural Resources, Rutgers University; Handelsman, Jo - Department of Molecular, Cellular and Developmental Biology, Yale University |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 60 | Molecular Ecology (2005) 14, 10151024 doi: 10.1111/j.1365-294X.2005.02470.x 2005 Blackwell Publishing Ltd | ||
|
Summary: [12s rRNA (379 bp), 16s rRNA (465 bp) and COI (736 bp)], from 14 sites (one individual per site... , respectively, 55 °C, 45 °C, and 55 °C for 12s rRNA, 16s rRNA, and COI. The method ... |
|||
|
Source: Blatrix, Rumsais - Centre dEcologie Fonctionnelle et Evolutive; McKey, Doyle - Centre dEcologie Fonctionnelle et Evolutive |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
Page: 1 2 3 4 5
Page:
1
2
3
4
5
Page: 1 2 3 4 5
| 61 | Hydrobiologia 449: 4146, 2001. J.P.M. Paula, A.A.V. Flores & C.H.J.M. Fransen (eds), Advances in Decapod Crustacean Research. | ||
|
Summary: phylogeny of the crab genus Brachynotus (Brachyura: Varunidae) based on the 16S rRNA gene Christoph D... , systematics, 16S rRNA, Crustacea, Decapoda, Brachynotus Abstract The crab genus Brachynotus de Haan, 1833... and geology of the Mediterranean Sea. A molecular ... |
|||
|
Source: Schubart, Christoph - Institut für Zoologie, Universität Regensburg |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 62 | MOLECULAR CONFIRMATION OF SPECIES STATUS FOR THE RARE CEPHALASPIDEAN MELANOCHLAMYS LORRAINAE | ||
|
Summary: , the mitochondrial cytochrome c oxidase subunit I (COI) and large ribosomal subunit (16S) rRNA loci, and the nuclear... reciprocally monophyletic, with net genetic distances of 16.5% for COI, 2.4% for 16S and 0.9% for 28S, all... ). Approximately ... |
|||
|
Source: Krug, Patrick J. - Department of Biological Sciences, California State University, Los Angeles |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 63 | Proc. Nati. Acad. Sci. USA Vol. 86, pp. 2267-2271, April 1989 | ||
|
Summary: . coli 16S rRNA (29). This latter modification is not present in yeast (30), hamster (31), or Tetrahymena... (LSU) rRNA sequences. In the nuclear subtree, plants branch offlate, at a position reflecting a massive... rate of sequence divergence of non-plant mitochondrial rRNA sequences. In ... |
|||
|
Source: Sankoff, David - Laboratory for Innovation in Bioinformatics, University of Ottawa |
|||
|
Collection: Biology and Medicine ; Mathematics |
|||
| 64 | This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research | ||
|
Summary: ). Regions of COI, 16S rRNA, tRNA Leu, Ala, Ser and Leu and 28S rRNA genes were amplified (see primers... to determine with certainty due to their structural simplicity. We sequenced fragments of COI, 16S, t... ... |
|||
|
Source: Complutense de Madrid, Universidad - Departamento de Zoología y Antropología Física, Grupo de Zoología del Suelo |
|||
|
Collection: Biology and Medicine |
|||
| 65 | Phylogenetic Affinity of Mitochondria of Euglena gracilis and Kinetoplastids Using Cytochrome Oxidase I and hsp60 | ||
|
Summary: Abstract. The mitochondrial DNA-encoded cyto- chrome oxidase subunit I (COI) gene and the nuclear DNA... -encoded hsp60 gene from the euglenoid protozoan Euglena gracilis were cloned and sequenced. The COI sequence... of the cor- responding tRNA species. COI cDNAs from E. gracilis possess short 5 and 3 untranslated |
|||
|
Source: Simpson, Larry - Department of Microbiology, Immunology and Molecular Genetics, University of California at Los Angeles |
|||
|
Collection: Biology and Medicine |
|||
| 66 | Microbial Evolution and Systematics | ||
|
Summary: and secondary structure of 16S ribosomal RNA (rRNA). This is the 16S rRNA from Escherichia coli (Bacteria); 16S... in primary structure (sequence). The counterpart to 16S ... |
|||
|
Source: Meserve, Peter L. - Department of Biological Sciences, Northern Illinois University |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 67 | Exceptional cryptic diversity and multiple origins of parthenogenesis in a freshwater ostracod | ||
|
Summary: . A molecular phylogeny of E. virens based on the mitochondrial COI and 16S fragments is presented... other phy- logenetically, using partial mitochondrial cytochrome oxidase I (COI) and 16S ribosomal DNA... was amplified from the mitochondrial ... |
|||
|
Source: Laboratoire de Génétique et Evolution des Maladies Infectieuses (GEMI), UMR CNRS-IRD 2724 UR 165 |
|||
|
Collection: Biology and Medicine |
|||
| 68 | Tensor Decomposition Reveals Concurrent Evolutionary Convergences and Divergences and Correlations with | ||
|
Summary: this hypothesis in comparative analyses of 16S and 23S rRNA sequence alignments by using a tensor decomposition, i... . Today, the small subunit ribosomal RNA (16S rRNA) is the gene with the largest number of determined... computationally test this hypothesis in ... |
|||
|
Source: Weiss, Jeffrey A. - Department of Bioengineering, University of Utah |
|||
|
Collection: Engineering |
|||
| 69 | Syst. Biol. 53(3):506514, 2004 Copyright c Society of Systematic Biologists | ||
|
Summary: : 16S and 23S rRNA structures from a comparative perspective. Microbiol. Rev. 58:1026. Hickson, R. E... :502507. Whitfield, J. B. and S. A. Cameron. 1998. Hierarchical analysis of varia- tion in the mitochondrial 16S rRNA... relationships generated from analysis of ... |
|||
|
Source: Danforth, Bryan Nicholas - Department of Entomology, Cornell University |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 70 | Complete mitochondrial DNA sequence of the Australian freshwater crayfish, Cherax destructor (Crustacea: Decapoda: Parastacidae) | ||
|
Summary: RNAThr 6659 6722 64 8 ND6 6745 7224 480 AAT TAA 22 tRNAPro 7302 7367 66 77 16S (7368 8669) 1302 0 CR 8670 9646... for the gene inversions. In addition, the arrangement of rRNA genes is incompatible with current mitochondrial... genes (ATP6 and 8, CO13, Cyt b, ND16 and 4L), two rRNA genes (lrRNA and ... |
|||
|
Source: Burridge, Chris - School of Zoology, University of Tasmania |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 71 | BioMed Central Page 1 of 11 | ||
|
Summary: amplified and sequenced one nuclear (28S rRNA) and two mitochondrial (cytb, COI) genes. Results: Whereas... species were well segregated in topologies obtained for COI and 28S rRNA, an unexpected pattern... coast clustered in two separated clades, identically to the pattern obtained for ... |
|||
|
Source: Blatrix, Rumsais - Centre dEcologie Fonctionnelle et Evolutive; Lehmann, Laurent - Département d'écologie et évolution, Universite de Lausanne |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 72 | JOURNAL OF BACTERIOLOGY, May 2004, p. 26292635 Vol. 186, No. 9 0021-9193/04/$08.00 0 DOI: 10.1128/JB.186.9.26292635.2004 | ||
|
Summary: . Divergence and Redundancy of 16S rRNA Sequences in Genomes with Multiple rrn Operons Silvia G. Acinas, Luisa... divergence, and redundancy of 16S rRNA sequences were evaluated. Bacterial genomes display up to 15 operons... to at least one other ... |
|||
|
Source: Entekhabi, Dara - Kavli Institute for Astrophysics and Space Research & Department of Civil and Environmental Engineering, Massachusetts Institute of Technology (MIT) |
|||
|
Collection: Engineering ; Geosciences |
|||
| 73 | Systematic Entomology (2011), 36, 446452 The Neotropical social wasp Mischocyttarus `alfkenii' | ||
|
Summary: mitochondrial genes (16S and cytochrome c oxidase subunit I, COI) in excentric- and centric-form M. `alfkenii... ). Fragments of two mitochondrial genes, 16S ribosomal RNA (16S) and COI, were PCR amplified and sequenced... , ... |
|||
|
Source: Cameron, Sydney A. - Department of Entomology, University of Illinois at Urbana-Champaign |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 74 | CEFE-CNRS, 1919 route de Mende, 34293 Montpellier cedex 5, France; 2 LEAE, Institut de Zoologie, Universite de Neucha^tel, 11 | ||
|
Summary: -2183 and modified TL2-N-3014 (TCCATTGCACTAATCTGCCATATTA) for COI; 28ee & 28 mm for 28s rRNA. To confirm... results obtained by COI, we sequenced another mitochondrial gene, 12S rRNA (primers 12Sai and 12Sbi... , and the sequences of 758 (COI), 384 (12s rRNA) and ... |
|||
|
Source: Blatrix, Rumsais - Centre dEcologie Fonctionnelle et Evolutive; McKey, Doyle - Centre dEcologie Fonctionnelle et Evolutive |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 75 | Insect Molecular Biology (2001) 10(5), 475485 2001 Blackwell Science Ltd 475 | ||
|
Summary: Sequences for nearly complete 18S rRNA and partial 16S rRNA genes were determined for sixteen species... of the mitochondrial 16S rRNA gene from sixteen species of Calyptratae, in an attempt to resolve the lineage... inference within Calyptratae. ... |
|||
|
Source: urovec, Michal - Department of Physiology, University of South Bohemia |
|||
|
Collection: Biology and Medicine |
|||
| 76 | Molecular Phylogenetics and Evolution 36 (2005) 4257 www.elsevier.com/locate/ympev | ||
|
Summary: , cytochrome oxidase I (COI) and 16S ribosomal RNA. Approximately half of the species examined formed well... GenBank Accession No. Top D COI Bottom D 16S Locality A. aleenae Chamberlin and Ivie aleenae1 AY770786... Wed to species. Species COI ... |
|||
|
Source: Small, Randall - Department of Ecology and Evolutionary Biology, University of Tennessee |
|||
|
Collection: Environmental Management and Restoration Technologies |
|||
| 77 | C. D. Schubart J. E. Neigel D. L. Felder Molecular phylogeny of mud crabs (Brachyura: Panopeidae) | ||
|
Summary: of the mitochondrial large subunit rRNA (16S; 529 basepairs) and cytochrome oxidase I (COI; 640 basepairs) genes... . In the present study, we used mitochondrial, large-subunit rRNA (16S) and cyto- chrome oxidase I (COI) ... |
|||
|
Source: Neigel, Joseph E. - Biology Department, University of Louisiana at Lafayette; Schubart, Christoph - Institut für Zoologie, Universität Regensburg |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 78 | RESEARCH ARTICLE S. Reuschel C. D. Schubart | ||
|
Summary: ) and manually aligned with BioEdit (Hall 1999). The two mitochondrial genes 16S rRNA and COI were combined... and sequencing of the 16S rRNA and the mitochondrial COI genes Name Primer sequence 5¢-3¢ References COIf CCT ... |
|||
|
Source: Schubart, Christoph - Institut für Zoologie, Universität Regensburg |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 79 | PRIMARY RESEARCH PAPER Phylogeography and the genetic structure of the land-locked | ||
|
Summary: Phylogeography Á Glaciation Á 16S rRNA Á COI Á Introduction Introduction The geographical distribution... of the large subunit ribosomal RNA (16S rRNA) gene and the cytochrome oxidase subunit I (COI) gene, to reveal... ). ... |
|||
|
Source: Dever, Jennifer A. - Biology Department, University of San Francisco |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 80 | APPLIED AND ENVIRONMENTAL MICROBIOLOGY, July 2004, p. 40884095 Vol. 70, No. 7 0099-2240/04/$08.00 0 DOI: 10.1128/AEM.70.7.40884095.2004 | ||
|
Summary: on the populations involved in the detoxification process, a comprehensive 16S rRNA gene-based bacterial community... -supporting electron acceptors. The combined molecular approach allowed a compar- ison between different 16S rRNA gene... in a bio- reactor ... |
|||
|
Source: Löffler, Frank E. - School of Civil and Environmental Engineering, Georgia Institute of Technology |
|||
|
Collection: Environmental Management and Restoration Technologies |
|||
Page: 1 2 3 4 5
Page:
1
2
3
4
5
Page: 1 2 3 4 5
| 81 | Complete Mitochondrial DNA Sequences of the Decapod Crustaceans Pseudocarcinus gigas (Menippidae) and | ||
|
Summary: . Proc Natl Acad Sci U S A 84, 71837187 31. Murphy NP, Austin CM (2002) A preliminary study of the 16S rRNA... Tamura and Aotsuka (1988). Partial sequences for the Cyt b and COI mito- chondrial genes of Pse. gigas... sequences were initially generated for the Ir- RNA and COI genes using ... |
|||
|
Source: Burridge, Chris - School of Zoology, University of Tasmania |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 82 | Molecular Microbiology (2001) 40(3), 509519 MicroReview | ||
|
Summary: ). The positions of the ribose-methylated nucleotides in the 16S rRNA are currently being determined. In contrast... in 16S or 23S rRNA are indicated. Positions of nucleotide substitution in the aligned sequences... box plus five base pair methylation guide rule. Two ... |
|||
|
Source: Lowe, Todd M. - Department of Biomolecular Engineering, University of California at Santa Cruz |
|||
|
Collection: Biology and Medicine ; Biotechnology |
|||
| 83 | Deeply divergent mitochondrial lineages reveal patterns of local endemism in chironomids of the Australian | ||
|
Summary: fluctuations on patterns of endemism. In this study, mitochondrial COI and 16S data were analysed for E... , a 523-bp fragment of the 16S rRNA gene was also amplified from a subset of samples to provide greater... ). The 16S ... |
|||
|
Source: Cranston, Peter S. - Department of Entomology, University of California, Davis; Gullan, Penny J. - Department of Entomology, University of California, Davis |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 84 | Molecular Phylogenetics and Evolution 40 (2006) 227235 www.elsevier.com/locate/ympev | ||
|
Summary: six gene loci that included four mitochondrial genes (two ribosomal loci, 16S rRNA and 12S rRNA, two... study (Daniels et al., 2002), which were downloaded from GenBank (12S rRNA, 16S rRNA, and #12;S... ) with the following ... |
|||
|
Source: Crandall, Keith A. - Departments of Integrative Biology & Microbiology and Molecular Biology, Brigham Young University |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 85 | Population size and molecular evolution on islands Megan Woolfit1,2,* and Lindell Bromham2 | ||
|
Summary: subunit I (COI), cytochrome oxidase subunit II (COII), 12S small subunit ribosomal RNA (12S), 16S small... Macaronesia COI 2.0660 0.1467 0.0306 Mandarina Bonin 16S 0.6424 -- -- Megalagrion Hawaii COII, EF1a 0.2580 0... .036 0.0327 Meladema Macaronesia ... |
|||
|
Source: Australian National University, Centre for Macroevolution and Macroecology |
|||
|
Collection: Environmental Sciences and Ecology ; Biology and Medicine |
|||
| 86 | Phylogenetic analysis of hostsymbiont specificity and codivergence in bioluminescent symbioses | ||
|
Summary: of the taxonomically broad sampling of fishes, based on sequences of the 16S rRNA and COI genes, resulted in a single... specimen used for phylogenetic analysis. Genes analyzed were mitochondrial 16S rRNA and COI genes... for ... |
|||
|
Source: Dunlap, Paul - Department of Ecology and Evolutionary Biology, University of Michigan; Ruby, Edward G. - Department of Medical Microbiology and Immunology, University of Wisconsin at Madison |
|||
|
Collection: Biology and Medicine |
|||
| 87 | SYSTEMATICS Survey and Identification of Termites (Isoptera: Rhinotermitidae) | ||
|
Summary: -bp region of the mitochondrial DNA (mtDNA) 16S rRNA gene was ampliÞed and sequenced from all Þve... lacking of diagnostic morphological characters. KEY WORDS termite, survey, 16S rRNA, polymerase chain... .g., 12S and 16S), ... |
|||
|
Source: Buczkowski, Grzegorz - Department of Entomology, Purdue University; Wang, Changlu - Department of Entomology, Rutgers University |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 88 | Mar Biol (2009) 156:10391048 DOI 10.1007/s00227-009-1148-7 | ||
|
Summary: , and southern Spain. To do so, we analysed two mito- chondrial fragments of the COI and 16S genes in 217... . Data analysis For the most part, the COI and 16S datasets were treated independently, but for some... for COI (Ketmaier et al. 2003) and ... |
|||
|
Source: Posada, David - Departamento de Bioquímica, Genética e Inmunología, Universidad de Vigo |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 89 | Complete mitochondrial genome sequences of three Crocodylus species and their comparison within the Order Crocodylia | ||
|
Summary: /1604 bp/1607 bp 16S rRNA gene in C. moreletii, C. johnstoni and C. palustris, respectively... .4% and 47.8%, respectively. The 16S rRNA lies in between tRNALeu and tRNAVal and the nucleotide pattern... of 16S ... |
|||
|
Source: Batzer, Mark A. - Department of Biological Sciences, Louisiana State University; Ray, David - Department of Biochemistry and Molecular Biology, Mississippi State University |
|||
|
Collection: Biology and Medicine ; Biotechnology ; Environmental Sciences and Ecology |
|||
| 90 | Laying the foundations for a new classification of Agaonidae (Hymenoptera: Chalcidoidea), a multilocus phylogenetic approach | ||
|
Summary: - struction of the Agaonidae phylogeny: 16S mtDNA (Whitfield et al., 2002; Chen et al., 2004; Niehuis and Wa... compared the evolutionary dynamics of the six gene-sequence data sets (Cytb, COI, Wg, 18S rRNA, 28S rRNA D2... each codon position (Cytb, COI, Wg) or stems, ... |
|||
|
Source: Blatrix, Rumsais - Centre dEcologie Fonctionnelle et Evolutive; Lebreton, Jean-Dominique - Centre dEcologie Fonctionnelle et Evolutive |
|||
|
Collection: Biology and Medicine ; Environmental Sciences and Ecology |
|||
| 91 | PRIMED: Community-of-Interest-Based DDoS Mitigation Patrick Verkaik, Oliver Spatscheck | ||
|
Summary: 178, Aug. 2004. [16] S. Savage, D. Wetherall, A. Karlin, and T. Anderson. Network support for IP traceback... communities of interest (COIs) to capture the collective past behavior of remote network entities and uses... them to predict fu- ture behavior. Specifically, ISPs construct a network-wide bad COI ... |
|||
|
Source: van der Merwe, Kobus - Networking Research Department, AT&T Labs-Research |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 92 | PRIMED: Community-of-Interest-Based DDoS Mitigation Patrick Verkaik, Oliver Spatscheck | ||
|
Summary: . ACM SIGCOMM, pages 167178, Aug. 2004. [16] S. Savage, D. Wetherall, A. Karlin, and T. Anderson... )interest in receiving traffic from particular network entities. Our solution em- ploys communities of interest (COIs... . Specifically, ISPs construct a network-wide bad COI that contains network entities who ... |
|||
|
Source: Snoeren, Alex - Department of Computer Science and Engineering, University of California at San Diego |
|||
|
Collection: Computer Technologies and Information Sciences |
|||
| 93 | Phylogeny of Henicopidae (Chilopoda: Lithobiomorpha): a combined analysis of morphology | ||
|
Summary: 2198 (for the COI fragment), 16Sar and 16Sb (for the 16S rRNA fragment) and 12Sai and 12Sbi (for the 12... ). The 16S rRNA fragment was ampli®ed and sequenced using primers 16Sar (5¢±CGC CTG TTT ATC AAA AAC AT± 3... ) was excluded from the ... |
|||
|
Source: Wheeler, Ward - Division of Invertebrate Zoology, American Museum of Natural History |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 94 | Crystal Structure of the Ribosome at 5.5 Resolution | ||
|
Summary: and transfer RNAs (tRNAs) at 5.5 angstrom resolution. All of the 16S, 23S, and 5S ribosomal RNA (rRNA) chains... (30S) sub- units, containing 16S rRNA and about 20 proteins, and large (50S) subunits, which con- tain... head (H), body (B), platform (P), and neck (N) ... |
|||
|
Source: Economou, Tassos - Institute of Molecular Biology and Biotechnology, Foundation of Research and Technology, Hellas |
|||
|
Collection: Biology and Medicine |
|||
| 95 | Biogeography and phylogeny of the New Zealand cicada genera (Hemiptera | ||
|
Summary: 314151 through AF314162 (12S); AF426274 through AF426287 (16S); AF426438 through AF426448 (COI); AF313500... ) combined ribosomal 12S and 16S nucleo- tide sequences (12S + 16S data set, 893 bp), (2) combined COI... S + ... |
|||
|
Source: Simon, Chris - Department of Ecology and Evolutionary Biology, University of Connecticut |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 96 | Molecular Methods in Microbial Ecology Contact Info: Julie Huber and Nancy Akerman | ||
|
Summary: membrane with pH 8, low-salt buffer #12;Choosing a Depth Horizon · 16S rRNA Bacteria · 16S rRNA Archaea... · rRNA is transcribed from rDNA genes 70S Ribosome 50S subunit 30S subunit 21 different proteins ... |
|||
|
Source: Vallino, Joseph J. - Ecosystems Center, Marine Biological Laboratory, Woods Hole |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 97 | The name of the father: conflict between Louis and Alexander Agassiz and the Embiotoca surfperch | ||
|
Summary: , P ¼ 0Á74). Aligned portions of mtDNA cyt b (687 bp), 16S rRNA (469 bp), COI (764 bp), ATPases 6... (16S rRNA; Cassano, 2000), thus preventing a proper assessment of the issue. Therefore, the goal... of three FIG. 2. Phylogenetic tree based on ... |
|||
|
Source: Bernardi, Giacomo - Institute of Marine Science & Department of Ecology and Evolutionary Biology, University of California at Santa Cruz |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 98 | Search for Evolution-Related-Oligonucleotides and Conservative Words in rRNA Sequences | ||
|
Summary: a pair of 16S or 18S rRNA sequences is defined in terms of the difference in the two sets of frequencies... than 7 bases in 16S rRNA sequences from an enlarged set of 98 organisms in Bacteria and Archaea... strong constraint. We shall use ... |
|||
|
Source: Lee, H.C. Paul - Graduate Institute of Biophysics & Department of Physics, National Central University |
|||
|
Collection: Biology and Medicine ; Physics |
|||
| 99 | Molecular Ecology (2003) 12, 12071215 2003 Blackwell Publishing Ltd | ||
|
Summary: hosts based on comparative sequence analysis of 16s rRNA genes. Applied and Environmental Microbiology... , 63, 9198. Lane DJ (1991) 16s/23s rRNA sequencing. In: Nucleic Acid Tech- niques in Bacterial... mitochondrial cytochrome oxidase c subunit I ... |
|||
|
Source: Hellberg, Michael E. - Department of Biological Sciences, Louisiana State University |
|||
|
Collection: Environmental Sciences and Ecology |
|||
| 100 | Phylogenetic evidence for an ancient rapid radiation of Caribbean sponge-dwelling snapping shrimps (Synalpheus) | ||
|
Summary: of partial mtCOI sequences (strict consensus of 3 MP trees); (B) weighted-parsimony analysis of partial 16S rRNA... as sister taxon-pairs by COI. 3.2.2. 16S rRNA Weighted parsimony analysis of ... |
|||
|
Source: Duffy, J. Emmett - Virginia Institute of Marine Science, College of William and Mary |
|||
|
Collection: Environmental Sciences and Ecology |
|||
Page: 1 2 3 4 5
